Screening and Crystallization Plates for Manual and High-throughput Protein Crystal Growth
NASA Technical Reports Server (NTRS)
Thorne, Robert E. (Inventor); Berejnov, Viatcheslav (Inventor); Kalinin, Yevgeniy (Inventor)
2010-01-01
In one embodiment, a crystallization and screening plate comprises a plurality of cells open at a top and a bottom, a frame that defines the cells in the plate, and at least two films. The first film seals a top of the plate and the second film seals a bottom of the plate. At least one of the films is patterned to strongly pin the contact lines of drops dispensed onto it, fixing their position and shape. The present invention also includes methods and other devices for manual and high-throughput protein crystal growth.
Method For Screening Microcrystallizations For Crystal Formation
Santarsiero, Bernard D. , Stevens, Raymond C. , Schultz, Peter G. , Jaklevic, Joseph M. , Yegian, Derek T. , Cornell, Earl W. , Nordmeyer, Robert A.
2003-10-07
A method is provided for performing array microcrystallizations to determine suitable crystallization conditions for a molecule, the method comprising: forming an array of microcrystallizations, each microcrystallization comprising a drop comprising a mother liquor solution whose composition varies within the array and a molecule to be crystallized, the drop having a volume of less than 1 microliter; storing the array of microcrystallizations under conditions suitable for molecule crystals to form in the drops in the array; and detecting molecule crystal formation in the drops by taking images of the drops.
NASA Astrophysics Data System (ADS)
Parry, Ellis; Kim, Dong-Jin; Castrejón-Pita, Alfonso A.; Elston, Steve J.; Morris, Stephen M.
2018-06-01
This paper investigates the drop-on-demand inkjet printing of a nematic liquid crystal (LC) onto a variety of substrates. Achieving both a well-defined droplet boundary and uniformity of the LC director in printed droplets can be challenging when traditional alignment surfaces are employed. Despite the increasing popularity of inkjet printing LCs, the mechanisms that are involved during the deposition process such as drop impact, wetting and spreading have received very little attention, in the way of experiments, as viable routes for promoting alignment of the resultant LC droplets. In this work, radial alignment of the director and uniformity of the droplet boundary are achieved in combination via the use of a partially-wet polymer substrate, which makes use of the forces and flow generated during droplet impact and subsequent wetting process. Our findings could have important consequences for future LC inkjet applications, including the development of smart inks, printable sensors and lasers.
Supercrystallization of KCl from solution irradiated by soft X-rays
NASA Astrophysics Data System (ADS)
Janavičius, A. J.; Rinkūnas, R.; Purlys, R.
2016-10-01
The X-rays influence on KCl crystallization in a saturated water solution has been investigated for the aim of comparing it with previously considered NaCl crystallization. The rate of crystallization has been measured in the drying drop in the solution activated by the irradiation. We have measured the influence of the irradiation time of the solution on the rates of KCl crystallization as well as the beginning of the crystallization processes on drying drops. For a longer irradiation time of the solution early crystallization in the drops occurs. A saturated water solution of KCl was irradiated with the diffractometer DRON-3M (Russian device) and this had a great influence on the two-step processes of crystallization. The ionization of the solution by soft X-rays can produce ions, metastable radicals in water, excited crystals' seeds and vacancies in growing crystals by Auger's effect. The X-rays generate a very fast crystallization in the drying drop.
Controlling Vapor Pressure In Hanging-Drop Crystallization
NASA Technical Reports Server (NTRS)
Carter, Daniel C.; Smith, Robbie
1988-01-01
Rate of evaporation adjusted to produce larger crystals. Device helps to control vapor pressure of water and other solvents in vicinity of hanging drop of solution containing dissolved enzyme protein. Well of porous frit (sintered glass) holds solution in proximity to drop of solution containing protein or enzyme. Vapor from solution in frit controls evaporation of solvent from drop to control precipitation of protein or enzyme. With device, rate of nucleation limited to decrease number and increase size (and perhaps quality) of crystals - large crystals of higher quality needed for x-ray diffraction studies of macromolecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jackson, Michael R.; Selby, Thomas L.
2012-10-30
A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.
Imaging transport phenomena during lysozyme protein crystal growth by the hanging drop technique
NASA Astrophysics Data System (ADS)
Sethia Gupta, Anamika; Gupta, Rajive; Panigrahi, P. K.; Muralidhar, K.
2013-06-01
The present study reports the transport process that occurs during the growth of lysozyme protein crystals by the hanging drop technique. A rainbow schlieren technique has been employed for imaging changes in salt concentration. A one dimensional color filter is used to record the deflection of the light beam. An optical microscope and an X-ray crystallography unit are used to characterize the size, tetragonal shape and Bravais lattice constants of the grown crystals. A parametric study on the effect of drop composition, drop size, reservoir height and number of drops on the crystal size and quality is reported. Changes in refractive index are not large enough to create a meaningful schlieren image in the air gap between the drop and the reservoir. However, condensation of fresh water over the reservoir solution creates large changes in the concentration of NaCl, giving rise to clear color patterns in the schlieren images. These have been analyzed to obtain salt concentration profiles near the free surface of the reservoir solution as a function of time. The diffusion of fresh water into the reservoir solution at the early stages of crystal growth followed by the mass flux of salt from the bulk solution towards the free surface has been recorded. The overall crystal growth process can be classified into two regimes, as demarcated by the changes in slope of salt concentration within the reservoir. The salt concentration in the reservoir equilibrates at long times when the crystallization process is complete. Thus, transport processes in the reservoir emerge as the route to monitor protein crystal growth in the hanging drop configuration. Results show that crystal growth rate is faster for a higher lysozyme concentration, smaller drops, and larger reservoir heights.
NASA Astrophysics Data System (ADS)
Venkatesh, A.; Piragash Kumar, R. M.; Moorthy, V. H. S.
2018-05-01
We report the first observation of extraordinary transmission of deep-UV light (λ = 289nm) through 20nm aluminum film coated two-dimensional photonic crystals. The two-dimensional photonic crystals are made of self-assembled hexagonally arranged monolayer of 200 nm polystyrene spheres fabricated using drop casting method. The high quality photonic crystal exhibits a well-defined photonic band gap of 4.59 eV (λ = 270nm) and the aluminum coated two-dimensional photonic crystal displays extraordinary transmission in the deep-UV region at λ = 289 nm. The fabricated aluminum nanostructure produces a sensitivity of 42nm/RIU and 57nm/RIU when the refractive index of the surrounding medium is changed from 1 (= air) to 1.36 (= ethanol) and 1.49 (=toluene), respectively. Therefore, the aluminum film coated two-dimensional photonic crystals could be utilized to fabricate cost-effective and ultrasensitive chemical sensors.
Hanging drop crystal growth apparatus
NASA Technical Reports Server (NTRS)
Naumann, Robert J. (Inventor); Witherow, William K. (Inventor); Carter, Daniel C. (Inventor); Bugg, Charles E. (Inventor); Suddath, Fred L. (Inventor)
1990-01-01
This invention relates generally to control systems for controlling crystal growth, and more particularly to such a system which uses a beam of light refracted by the fluid in which crystals are growing to detect concentration of solutes in the liquid. In a hanging drop apparatus, a laser beam is directed onto drop which refracts the laser light into primary and secondary bows, respectively, which in turn fall upon linear diode detector arrays. As concentration of solutes in drop increases due to solvent removal, these bows move farther apart on the arrays, with the relative separation being detected by arrays and used by a computer to adjust solvent vapor transport from the drop. A forward scattering detector is used to detect crystal nucleation in drop, and a humidity detector is used, in one embodiment, to detect relative humidity in the enclosure wherein drop is suspended. The novelty of this invention lies in utilizing angular variance of light refracted from drop to infer, by a computer algorithm, concentration of solutes therein. Additional novelty is believed to lie in using a forward scattering detector to detect nucleating crystallites in drop.
Liquid drop stability for protein crystal growth in microgravity
NASA Technical Reports Server (NTRS)
Owen, Robert B.; Broom, Beth H.; Snyder, Robert S.; Daniel, Ron
1987-01-01
It is possible to grow protein crystals for biomedical research in microgravity by deploying a protein-rich solution from a syringe, forming a drop in which crystallization can occur with the proper degree of supersaturation. Drop stability is critical to the success of this research, due to the large drop sizes which can be achieved in space. In order to determine the type of syringe tips most suitable to support these large drops, tests were performed during brief periods of weightlessness onboard the NASA KC-135 low-gravity simulation aircraft. The drops were analyzed using three simple models in which the samples were approximated by modified pendulum and spring systems. It was concluded that the higher frequency systems were the most stable, indicating that of the syringes utilized, a disk-shaped configuration provided the most stable environment of low-gravity protein crystal growth.
Drop deployment system for crystal growth apparatus
NASA Technical Reports Server (NTRS)
Rhodes, Percy H. (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)
1992-01-01
This invention relates to a crystal growth apparatus (10) generally used for growing protein crystals wherein a vapor diffusion method is used for growing the crystals. In this apparatus, a precipitating solution and a solution containing dissolved crystalline material are stored in separate vials (12, 14), each having a resilient diaphragm (28) across one end and an opening (24) with a puncturable septum (26) thereacross at an opposite end. The vials are placed in receptacles (30) having a manifold (41) with a manifold diaphragm (42) in contact with the vial diaphragm at one end of the receptacle and a hollow needle (36) for puncturing the septum at the other end of the manifold. The needles of each vial communicate with a ball mixer (40) that mixes the precipitate and protein solutions and directs the mixed solution to a drop support (64) disposed in a crystal growth chamber (16), the drop support being a tube with an inner bevelled surface (66) that provides more support for the drop (68) than the tubes of the prior art. A sealable storage region (70) intermediate the drop support and mixer provides storage of the drop (68) and the grown crystals.
NASA Astrophysics Data System (ADS)
McBride, Samantha; Dash, Susmita; Khan, Sami; Varanasi, Kripa
2017-11-01
Solute-laden sessile drops evaporating on a substrate will often force crystallization of the solute at the triple phase contact line between the drop, substrate, and air in an effect similar to the ``coffee-ring'' deposition of particles from a particle-laden drop. We report new observations of ring-shaped desiccation patterns of gypsum crystals on hydrophobic oxide substrates; ceria, erbia, and silica. These surfaces have similar contact angles ( 105 degrees), and evaporation of sessile drops proceeds at the same rate and without contact angle hysteresis on all three substrates. However, despite the apparent similarity, the patterns of crystal deposits exhibit large differences across the substrates. The supersaturation and elapsed time at the onset of crystallization also varied across substrates, despite overall evaporation rates being identical. The differences in patterns can be explained in light of the position and morphology of the crystals just prior to completion of evaporation when the sessile drop has transitioned to a thin film spread over the deposit area. Break-up of this film occurs very differently on the different surfaces, and is simultaneously influenced by existing crystals while also influencing final crystalline patterns. This work was supported by the NSF GRFP.
McFarquhar, Greg
2011-07-25
Best estimate of cloud microphysical parameters derived using data collected by the cloud microphysical probes installed on the National Research Council (NRC) of Canada Convair-580 during ISDAC. These files contain phase, liquid and ice crystal size distributions (Nw(D) and Ni(D) respectively), liquid water content (LWC), ice water content (IWC), extinction of liquid drops (bw), extinction of ice crystals (bi), effective radius of water drops (rew) and of ice crystals (rei) and median mass diameter of liquid drops (Dmml) and of ice crystals (Dmmi) at 30 second resolution.
Drop deployment system for crystal growth apparatus
NASA Technical Reports Server (NTRS)
Rhodes, Percy (Inventor); Snyder, Robert S. (Inventor); Pusey, Marc L. (Inventor)
1990-01-01
A crystal growth apparatus is presented. It utilizes a vapor diffusion method for growing protein crystals, and particularly such an apparatus wherein a ball mixer is used to mix the fluids that form a drop within which crystals are grown. Particular novelty of this invention lies in utilizing a ball mixer to completely mix the precipitate and protein solutions prior to forming the drop. Additional novelty lies in details of construction of the vials, the fluid deployment system, and the fluid storage system of the preferred embodiment.
Convection effects in protein crystal growth
NASA Technical Reports Server (NTRS)
Roberts, Glyn O.
1988-01-01
Protein crystals for X-ray diffraction study are usually grown resting on the bottom of a hanging drop of a saturated protein solution, with slow evaporation to the air in a small enclosed cell. The evaporation rate is controlled by hanging the drop above a reservoir of water, with its saturation vapor pressure decreased by a low concentration of a passive solute. The drop has a lower solute concentration, and its volume shrinks by evaporation until the molecular concentrations match. Protein crystals can also be grown from a seed crystal suspended or supported in the interior of a supersaturated solution. The main analysis of this report concerns this case because it is less complicated than hanging-drop growth. Convection effects have been suggested as the reason for the apparent cessation of growth at a certain rather small crystal size. It seeems that as the crystal grows, the number of dislocations increases to a point where further growth is hindered. Growth in the microgravity environment of an orbiting space vehicle has been proposed as a method for obtaining larger crystals. Experimental observations of convection effects during the growth of protein crystals have been reported.
The role of mass transport in protein crystallization.
García-Ruiz, Juan Manuel; Otálora, Fermín; García-Caballero, Alfonso
2016-02-01
Mass transport takes place within the mesoscopic to macroscopic scale range and plays a key role in crystal growth that may affect the result of the crystallization experiment. The influence of mass transport is different depending on the crystallization technique employed, essentially because each technique reaches supersaturation in its own unique way. In the case of batch experiments, there are some complex phenomena that take place at the interface between solutions upon mixing. These transport instabilities may drastically affect the reproducibility of crystallization experiments, and different outcomes may be obtained depending on whether or not the drop is homogenized. In diffusion experiments with aqueous solutions, evaporation leads to fascinating transport phenomena. When a drop starts to evaporate, there is an increase in concentration near the interface between the drop and the air until a nucleation event eventually takes place. Upon growth, the weight of the floating crystal overcomes the surface tension and the crystal falls to the bottom of the drop. The very growth of the crystal then triggers convective flow and inhomogeneities in supersaturation values in the drop owing to buoyancy of the lighter concentration-depleted solution surrounding the crystal. Finally, the counter-diffusion technique works if, and only if, diffusive mass transport is assured. The technique relies on the propagation of a supersaturation wave that moves across the elongated protein chamber and is the result of the coupling of reaction (crystallization) and diffusion. The goal of this review is to convince protein crystal growers that in spite of the small volume of the typical protein crystallization setup, transport plays a key role in the crystal quality, size and phase in both screening and optimization experiments.
A novel photonic crystal ring resonator configuration for add/drop filtering
NASA Astrophysics Data System (ADS)
Zhang, Juan; Liu, Hao; Ding, Yipeng; Wang, Yang
2018-07-01
A novel compact photonic crystal ring resonator (PCRR) configuration is proposed to realize high-efficiency waveguided add-drop filtering. Its wavelength selection and dropping-direction exchange functions are demonstrated numerically. The working mechanism of this nested dual-loop resonant cavity structure is analyzed in detail.
NASA Astrophysics Data System (ADS)
Fontana, Pietro; Pettit, Donald; Cristoforetti, Samantha
2015-10-01
Crystallization from aqueous sodium chloride solutions as thin liquid sheets, 0.2-0.7 mm thick, with two free surfaces supported by a wire frame, thick liquid layers, 4-6 mm thick, with two free surfaces supported by metal frame, and hemispherical sessile drops, 20-32 mm diameter, supported by a flat polycarbonate surface or an initially flat gelatin film, were carried out under microgravity on the International Space Station (ISS). Different crystal morphologies resulted based on the fluid geometry: tabular hoppers, hopper cubes, circular [111]-oriented crystals, and dendrites. The addition of polyethylene glycol (PEG-3350) inhibited the hopper growth resulting in flat-faced surfaces. In sessile drops, 1-4 mm tabular hopper crystals formed on the free surface and moved to the fixed contact line at the support (polycarbonate or gelatin) self-assembling into a shell. Ring formation created by sessile drop evaporation to dryness was observed but with crystals 100 times larger than particles in terrestrially formed coffee rings. No hopper pyramids formed. By choosing solution geometries offered by microgravity, we found it was possible to selectively grow crystals of preferred morphologies.
Saridakis, Emmanuel; Chayen, Naomi E.
2003-01-01
A systematic approach for improving protein crystals by growing them in the metastable zone using the vapor diffusion technique is described. This is a simple technique for optimization of crystallization conditions. Screening around known conditions is performed to establish a working phase diagram for the crystallization of the protein. Dilutions of the crystallization drops across the supersolubility curve into the metastable zone are then carried out as follows: the coverslips holding the hanging drops are transferred, after being incubated for some time at conditions normally giving many small crystals, over reservoirs at concentrations which normally yield clear drops. Fewer, much larger crystals are obtained when the incubation times are optimized, compared with conventional crystallization at similar conditions. This systematic approach has led to the structure determination of the light-harvesting protein C-phycocyanin to the highest-ever resolution of 1.45 Å. PMID:12547801
Hiraki, Masahiko; Kato, Ryuichi; Nagai, Minoru; Satoh, Tadashi; Hirano, Satoshi; Ihara, Kentaro; Kudo, Norio; Nagae, Masamichi; Kobayashi, Masanori; Inoue, Michio; Uejima, Tamami; Oda, Shunichiro; Chavas, Leonard M G; Akutsu, Masato; Yamada, Yusuke; Kawasaki, Masato; Matsugaki, Naohiro; Igarashi, Noriyuki; Suzuki, Mamoru; Wakatsuki, Soichi
2006-09-01
Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS.
Model for determining vapor equilibrium rates in the hanging drop method for protein crystal growth
NASA Technical Reports Server (NTRS)
Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.
1987-01-01
An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented. Results are applied to 18 drop and well arrangements commonly encountered in the laboratory. The chemical nature of the salt, drop size and shape, drop concentration, well size, well concentration, and temperature are taken into account. The rate of evaporation increases with temperature, drop size, and the salt concentration difference between the drop and the well. The evaporation in this model possesses no unique half-life. Once the salt in the drop achieves 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.
[Stability of physical state on compound hawthorn dropping pills].
Zhang, Wei; Chen, Hong-Yan; Jiang, Jian-Lan
2008-11-01
To evaluate the stability of physical state with accelerate test and dropping in process before and after on compound hawthorn dropping pills. Scanning electron microscope, TG-DTA, FT-IR and XRD were used. The active components presented amorphous, tiny crystal and molecular state in dropping pills, and it had no obvious reaction between PEG 4000 and active components. With time prolonging, a little of active components changed from amorphous state to tiny crystal or molecular state. Solid dispersion improved the stability and dissolution of compound hawthorn dropping pills.
Evaporation kinetics in the hanging drop method of protein crystal growth
NASA Technical Reports Server (NTRS)
Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.
1987-01-01
An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented; these results are applied to 18 different drop and well arrangements commonly encountered in the laboratory, taking into account the chemical nature of the salt, the drop size and shape, the drop concentration, the well size, the well concentration, and the temperature. It is found that the rate of evaporation increases with temperature, drop size, and with the salt concentration difference between the drop and the well. The evaporation possesses no unique half-life. Once the salt in the drop achieves about 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.
Large charged drop levitation against gravity
NASA Technical Reports Server (NTRS)
Rhim, Won-Kyu; Chung, Sang Kun; Hyson, Michael T.; Trinh, Eugene H.; Elleman, Daniel D.
1987-01-01
A hybrid electrostatic-acoustic levitator that can levitate and manipulate a large liquid drop in one gravity is presented. To the authors' knowledge, this is the first time such large drops (up to 4 mm in diameter in the case of water) have been levitated against 1-gravity. This makes possible, for the first time, many new experiments both in space and in ground-based laboratories, such as 1)supercooling and superheating, 2) containerless crystal growth from various salt solutions or melts, 3) drop dynamics of oscillating or rotating liquid drops, 4) drop evaporation and Rayleigh bursting, and 5) containerless material processing in space. The digital control system, liquid drop launch process, principles of electrode design, and design of a multipurpose room temperature levitation chamber are described. Preliminary results that demonstrate drop oscillation and rotation, and crystal growth from supersaturated salt solutions are presented.
Hanging colloidal drop: A new photonic crystal synthesis route
NASA Astrophysics Data System (ADS)
Sandu, Ion; Dumitru, Marius; Fleaca, Claudiu Teodor; Dumitrache, Florian
2018-05-01
High-quality photonic crystals (hundreds of micrometres in thickness) were grown by the free evaporation of a colloidal drop consisting of silica and polystyrene nanospheres with dimensions of 300 nm, 500 nm, and 1000 nm. The essence of experimental findings is that the drop has to hang on a pillar. This leads to the inhibition of the droplet spreading, the minimisation of the convective force, and the zeroing of the static frictional force between nanospheres and the liquid/air interface, where the first layer is formed. The theoretical essence is the continuous adjustment of nanospheres positions during the growth of photonic crystal, a key condition of the self-assembling phenomenon.
Containerless protein crystal growth method
NASA Technical Reports Server (NTRS)
Rhim, Won-Kyu; Chung, Sang K.
1991-01-01
A method of growing protein crystals from levitated drops is introduced and unique features of containerless approach in 1-g and micro-G laboratories are discussed. Electrostatic multidrop levitation system which is capable of simultaneous four drop levitation is described. A method of controlling protein saturation level in a programmed way is introduced and discussed. Finally, some of the unique features of containerless approach of protein crystal growth in space are discussed and summarized.
Crystallization of highly supersaturated solutions - An experimental study
NASA Technical Reports Server (NTRS)
Queen, Brian; Hallett, John
1990-01-01
The crystallization of ammonium sulfate solutions under very high supersaturation is investigated. The results imply that high saturation ratios can exist at least to 30 +/- 5 and possibly higher in smaller drops. Under certain atmospheric conditions highly supersaturated drops can persist at even lower temperatures and humidities.
Validation of a rapid conductimetric test for the measurement of wine tartaric stability.
Bosso, Antonella; Motta, Silvia; Petrozziello, Maurizio; Guaita, Massimo; Asproudi, Andriani; Panero, Loretta
2016-12-01
This work was aimed at optimizing a rapid and reproducible conductivity test for the evaluation of wine tartaric stability, in order to improve the practices for the prevention of tartaric precipitations during bottle aging. The test consists in measuring the drop of conductivity in wines kept under stirring for a fixed time, at low temperature, after the addition of micronized potassium bitartrate crystals (KHT). An experimental design was planned to study three factors affecting the test: temperature, duration and dose of added potassium bitartrate. A standard protocol was defined to produce a micronized potassium bitartrate starting from available commercial products, since the dimensions of the crystals can affect the final conductivity values. After the choice of the best conditions the method was validated. Two different stability thresholds were defined for white wines and for red/rosé wines by comparing the results of the mini-contact test with those of the cold test. Copyright © 2016 Elsevier Ltd. All rights reserved.
Shinya, Akihiko; Mitsugi, Satoshi; Kuramochi, Eiichi; Notomi, Masaya
2005-05-30
We have devised an ultra-small multi-channel drop filter based on a two-port resonant tunneling system in a two-dimensional photonic crystal with a triangular air-hole lattice. This filter does not require careful consideration of the interference process to achieve a high dropping efficiency. First we develop three-port systems based on a two-port resonant tunneling filter. Next we devise a multi-port channel drop filter by cascading these three-port systems. In this paper, we demonstrate a ten-channel drop filter with an 18 mum device size by 2D-FDTD calculation, and a three-port resonant tunneling filter with 65+/- 20 % dropping efficiency by experiment.
Channel add-drop filter based on dual photonic crystal cavities in push-pull mode.
Poulton, Christopher V; Zeng, Xiaoge; Wade, Mark T; Popović, Miloš A
2015-09-15
We demonstrate an add-drop filter based on a dual photonic crystal nanobeam cavity system that emulates the operation of a traveling wave resonator, and, thus, provides separation of the through and drop port transmission from the input port. The device is on a 3×3 mm chip fabricated in an advanced microelectronics silicon-on-insulator complementary metal-oxide semiconductor (SOI CMOS) process (IBM 45 nm SOI) without any foundry process modifications. The filter shows 1 dB of insertion loss in the drop port with a 3 dB bandwidth of 64 GHz, and 16 dB extinction in the through port. To the best of our knowledge, this is the first implementation of a port-separating, add-drop filter based on standing wave cavities coupled to conventional waveguides, and demonstrates a performance that suggests potential for photonic crystal devices within optical immersion lithography-based advanced CMOS electronics-photonics integration.
Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut
2014-04-01
The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-D-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. © 2014 The Protein Society.
Buschmann, Sabine; Richers, Sebastian; Ermler, Ulrich; Michel, Hartmut
2014-01-01
The cbb3 cytochrome c oxidases are distant members of the superfamily of heme copper oxidases. These terminal oxidases couple O2 reduction with proton transport across the plasma membrane and, as a part of the respiratory chain, contribute to the generation of an electrochemical proton gradient. Compared with other structurally characterized members of the heme copper oxidases, the recently determined cbb3 oxidase structure at 3.2 Å resolution revealed significant differences in the electron supply system, the proton conducting pathways and the coupling of O2 reduction to proton translocation. In this paper, we present a detailed report on the key steps for structure determination. Improvement of the protein quality was achieved by optimization of the number of lipids attached to the protein as well as the separation of two cbb3 oxidase isoenzymes. The exchange of n-dodecyl-β-d-maltoside for a precisely defined mixture of two α-maltosides and decanoylsucrose as well as the choice of the crystallization method had a most profound impact on crystal quality. This report highlights problems frequently encountered in membrane protein crystallization and offers meaningful approaches to improve crystal quality. PMID:24488923
Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A
2016-02-01
A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.
Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan
2004-10-01
The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.
Device For Controlling Crystallization Of Protein
NASA Technical Reports Server (NTRS)
Noever, David A.
1993-01-01
Variable sandwich spacer enables optimization of evaporative driving force that governs crystallization of protein from solution. Mechanically more rigid than hanging-drop and sitting-drop devices. Large oscillations and dislodgment of drop of solution in response to vibrations suppressed by glass plates. Other advantages include: suitable for automated delivery, stable handling, and programmable evaporation of protein solution; controlled configuration enables simple and accurate determination of volume of solution without disrupting crystallization; pH and concentration of precipitant controlled dynamically because pH and concentration coupled to rate of evaporation, controllable via adjustment of gap between plates; and enables variation of ratio between surface area and volume of protein solution. Alternative version, plates oriented vertically instead of horizontally.
Ge, Xiaochen; Shi, Yaocheng; He, Sailing
2014-12-15
The design, fabrication, and characterization of a compact photonic crystal nanobeam drop filter based on the tunneling effect of the degenerate modes are presented. The degeneracy was achieved by tuning the coupling distance between the nanobeam and input/output waveguides. The tunneling effect of degenerate resonances with different symmetries has been verified experimentally. Channel drop filters with an extinction ratio larger than 10 dB and a quality factor of ∼5000 have been experimentally demonstrated.
Hanging drop crystal growth apparatus and method
NASA Technical Reports Server (NTRS)
Carter, Daniel C. (Inventor); Smith, Robbie E. (Inventor)
1989-01-01
An apparatus (10) is constructed having a cylindrical enclosure (16) within which a disc-shaped wicking element (18) is positioned. A well or recess (22) is cut into an upper side (24) of this wicking element, and a glass cover plate or slip (28) having a protein drop disposed thereon is sealably positioned on the wicking element (18), with drop (12) being positioned over well or recess (22). A flow of control fluid is generated by a programmable gradient former (16), with this control fluid having a vapor pressure that is selectively variable. This flow of control fluid is coupled to the wicking element (18) where control fluid vapor diffusing from walls (26) of the recess (22) is exposed to the drop (12), forming a vapor pressure gradient between the drop (12) and the control fluid vapor. Initially, this gradient is adjusted to draw solvent from the drop (12) at a relatively high rate, and as the critical supersaturation point is approached (the point at which crystal nucleation occurs), the gradient is reduced to more slowly draw solvent from the drop (12). This allows discrete protein molecules more time to orient themselves into an ordered crystalline lattice, producing protein crystals which, when processed by X-ray crystallography, possess a high degree of resolution.
NASA Technical Reports Server (NTRS)
Todd, Paul; Sportiello, Michael G.; Gregory, Derek; Cassanto, John M.; Alvarado, Ulises A.; Ostroff, Robert; Korszun, Z. R.
1993-01-01
Two methods of protein crystallization, osmotic dewatering and liquid-liquid diffusion, like the vapor diffusion (hanging-drop and sessile-drop) methods allow a gradual approach to supersaturation conditions. The crystallization of hen egg-white lysozyme, an extensively characterized protein crystal, in the presence of sodium chloride was used as an experimental model with which to compare these two methods in low gravity and in the laboratory. Comparisons of crystal growth rates by the two methods under the two conditions have, to date, indicated that the rate of crystal growth by osmotic dewatering is nearly the same in low gravity and on the ground, while much faster crystal growth rates can be achieved by the liquid-liquid diffusion method in low gravity.
Analysis of models for two solution crystal growth problems
NASA Technical Reports Server (NTRS)
Fehribach, Joseph D.; Rosenberger, Franz
1989-01-01
Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.
Formation of curved micrometer-sized single crystals.
Koifman Khristosov, Maria; Kabalah-Amitai, Lee; Burghammer, Manfred; Katsman, Alex; Pokroy, Boaz
2014-05-27
Crystals in nature often demonstrate curved morphologies rather than classical faceted surfaces. Inspired by biogenic curved single crystals, we demonstrate that gold single crystals exhibiting curved surfaces can be grown with no need of any fabrication steps. These single crystals grow from the confined volume of a droplet of a eutectic composition melt that forms via the dewetting of nanometric thin films. We can control their curvature by controlling the environment in which the process is carried out, including several parameters, such as the contact angle and the curvature of the drops, by changing the surface tension of the liquid drop during crystal growth. Here we present an energetic model that explains this phenomenon and predicts why and under what conditions crystals will be forced to grow with the curvature of the microdroplet even though the energetic state of a curved single crystal is very high.
LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.
A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less
NASA Astrophysics Data System (ADS)
Golovanova, O. A.; Chikanova, E. S.; Fedoseev, V. B.
2018-05-01
The processes occurring in aqueous salt solutions have been investigated based on thermodynamic and experimental modeling. The self-organization in a drying drop of dehydrated liquids is analyzed using the fractal theory, due to which the quantitative characteristics of the crystallization processes in a small volume are obtained.
Air-Flow Navigated Crystal Growth for TIPS Pentacene-Based Organic Thin-Film Transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Zhengran; Chen, Jihua; Sun, Zhenzhong
2012-01-01
6,13-bis(triisopropylsilylethynyl)pentacene (TIPS pentacene) is a promising active channel material of organic thin-film transistors (OTFTs) due to its solubility, stability, and high mobility. However, the growth of TIPS pentacene crystals is intrinsically anisotropic and thus leads to significant variation in the performance of OTFTs. In this paper, air flow is utilized to effectively reduce the TIPS pentacene crystal anisotropy and enhance performance consistency in OTFTs, and the resulted films are examined with optical microscopy, grazing-incidence X-ray diffraction, and thin-film transistor measurements. Under air-flow navigation (AFN), TIPS pentacene drop-cast from toluene solution has been observed to form thin films with improved crystalmore » orientation and increased areal coverage on substrates, which subsequently lead to a four-fold increase of average hole mobility and one order of magnitude enhancement in performance consistency defined by the ratio of average mobility to the standard deviation of the field-effect mobilities.« less
Efg Crystal Growth Apparatus And Method
Mackintosh, Brian H.; Ouellette, Marc
2003-05-13
An improved mechanical arrangement controls the introduction of silicon particles into an EFG (Edge-defined Film-fed Growth) crucible/die unit for melt replenishment during a crystal growth run. A feeder unit injects silicon particles upwardly through a center hub of the crucible/die unit and the mechanical arrangement intercepts the injected particles and directs them so that they drop into the melt in a selected region of the crucible and at velocity which reduces splashing, whereby to reduce the likelihood of interruption of the growth process due to formation of a solid mass of silicon on the center hub and adjoining components. The invention also comprises use of a Faraday ring to alter the ratio of the electrical currents flowing through primary and secondary induction heating coils that heat the crucible die unit and the mechanical arrangement.
Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki
2007-09-01
Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less
Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth
2014-01-01
An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176
Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin, Lei; Zhu, De-Yu; Yang, Na
2005-04-01
The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, Minglian; Li, Zhenguo; Zheng, Wei
The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.
NASA Astrophysics Data System (ADS)
Zhou, Kai; Liu, Yong; Si, Liming; Lv, Xin
2013-08-01
An integrated 0.5 THz electromagnetic crystals(EMXT) channel-drop filter based on PBG structure is presented in this paper. A channel-drop filter is a device in which a narrow bandwidth is redirected to another "drop" waveguide while other frequencies are unaffected. It's capable of extracting a certain frequency from a continuous spectrum in the bus channel and passing it to the test channel. It has potential applications in photonic integrated circuits, radio astronomy, THz spectroscopy, THz communication and remote sensing radar receiver. PBG structures(or photonic crystals) are periodic structures which possess band gaps, where the electromagnetic wave of certain ranges of frequencies cannot pass through and is reflected. The proposed channel-drop filter consists of input waveguide,output waveguide and PBG structure. The proposed filter is simulated using the finite element method and can be fabricated by micro-electromechanical systems (MEMS) technology,due to its low cost, high performance and high processing precision.The filter operation principle and fabrication process are discussed.The simulation results show its ability to filter the frequency of 496GHz with a linewidth of approximately 4GHz and transmission of 27.2 dB above background.The loss at resonant frequency is less than 1dB considering the thickness and roughness of gold layer required by the MEMS process.The channel drop efficiency is 84%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago
2006-02-01
D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less
Optical Add-Drop Filters Based on Photonic Crystal Ring Resonators
2007-02-19
34 Appl. Phys. Lett. 81,2499-2501 (2002). 17. V. Dinesh Kumar , T. Srinivas, A. Selvarajan, "Investigation of ring resonators in photonic crystal...No.4 / opncs EXPRESS 1824 Kumar et al. [17], where a large single quasi-rectangular ring was introduced as the frequency selective dropping elements...were introduced by Kumar et al. as well, in order to suppress the counter propagating modes which can cause spurious dips in the transmission spectrum
Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude
2010-12-01
This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.
Containerless protein crystal growth technology: Electrostatic multidrop positioner
NASA Technical Reports Server (NTRS)
Rhim, Won-Kyu
1990-01-01
A brief discussion of containerless protein crystal growth in space and a diagram of the electrostatic multidrop positioner are presented. A picture of lysome crystals growing in a drop and a graph of levitation voltage versus time (minutes) are also presented.
NASA Technical Reports Server (NTRS)
Casay, G. A.; Wilson, W. W.
1992-01-01
One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.
A Fiber Optic Probe for Monitoring Protein Aggregation, Nucleation, and Crystallization
NASA Technical Reports Server (NTRS)
Ansari, Rafat R.; Suh, Kwang I.; Arabshahi, Alireza; Wilson, William W.; Bray, Terry L.; DeLucas, Lawrence J.
1996-01-01
Protein crystals are experimentally grown in hanging drops in microgravity experiments on-board the Space Shuttle orbiter. The technique of dynamic light scattering (DLS) can be used to monitor crystal growth process in hanging droplets (approx. 30 (L)) in microgravity experiments, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. In this paper we demonstrate that such experiments are now feasible. We apply a newly developed fiber optic probe to various earth and space (micro- gravity) bound protein crystallization system configurations to test its capability. These include conventional batch (cuvette or capillary) systems, hanging drop method in a six-pack hanging drop vapor diffusion apparatus (HDVDA), a modified HDVDA for temperature- induced nucleation and aggregation studies, and a newly envisioned dynamically controlled vapor diffusion system (DCVDS) configuration. Our compact system exploits the principles of DLS and offers a fast (within a few seconds) means of quantitatively and non-invasively monitoring the various growth stages of protein crystallization. In addition to DLS capability, the probe can also be used for performing single-angle static light scattering measurements. It utilizes extremely low levels of laser power (approx. few (W)) without a need of having any optical alignment and vibration isolation. The compact probe is also equipped with a miniaturized microscope for visualization of macroscopic protein crystals. This new optical diagnostic system opens up enormous opportunity for exploring new ways to grow good quality crystals suitable for x-ray crystallographic analysis and may help develop a concrete scientific basis for understanding the process of crystallization.
1×3 optical drop splitter in a rod-type silicon photonic crystal
NASA Astrophysics Data System (ADS)
Zhuang, Dongxia; Chen, Xiyao; Li, Junjun; Lin, Guimin; Qiang, Zexuan; Qiu, Yishen; Li, Hui
2011-12-01
We report an 1×3 optical drop splitter (ODS) based on a self-collimation ring resonator (SCRR) in a rod-type silicon photonic crystal. The proposed 1×3 ODS consists of four beam splitters which are formed by changing the radius of one row of silicon rods. When the self-collimated light with resonance frequency is launched into the ODS, the light beam can be split into three parts come out from three drop ports while no light coming out from the through port. The splitting ratio of the three drop beams can be controlled by tuning the radii of the beam splitters. The FDTD method is employed to calculate the transmission of the 1×3 ODS. For the drop wavelength of 1550 nm, the free spectral range is 28.7 nm, which almost covers the whole optical communication C-band window. This 1×3 ODS may have applications in photonic integrated circuits.
Aerosol partitioning in natural mixed-phase clouds
NASA Astrophysics Data System (ADS)
Henning, S.; Bojinski, S.; Diehl, K.; Ghan, S.; Nyeki, S.; Weingartner, E.; Wurzler, S.; Baltensperger, U.
2004-03-01
In situ aerosol and cloud drop microphysical measurements at a high-alpine site are used to investigate aerosol partitioning between cloud and interstitial phases in natural, mid-latitude, mixed-phase clouds. Measurements indicate a decrease in the activated aerosol fraction (FN) for particle diameters dP > 100 nm with cloud temperature from FN ~ 0.54 in summer liquid-phase clouds to FN ~ 0.08 in winter mixed-phase clouds. The latter may be attributed to the Bergeron-Findeisen mechanism whereby ice crystals grow at the expense of liquid water drops, releasing formerly activated aerosols back into the interstitial phase. This provides a means to distinguish the indirect effects of aerosols on drops and ice crystals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun
2008-08-01
Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki
2006-09-01
The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko
2007-10-01
Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com; Dusad, Lalit Kumar; Rajasthan Technical University, Kota, Rajasthan
In this paper, the design & performance of two dimensional (2-D) photonic crystal structure based channel drop filter is investigated using quad shaped photonic crystal ring resonator. In this paper, Photonic Crystal (PhC) based on square lattice periodic arrays of Gallium Indium Phosphide (GaInP) rods in air structure have been investigated using Finite Difference Time Domain (FDTD) method and photonic band gap is being calculated using Plane Wave Expansion (PWE) method. The PhC designs have been optimized for telecommunication wavelength λ= 1571 nm by varying the rods lattice constant. The number of rods in Z and X directions is 21 andmore » 20, with lattice constant 0.540 nm it illustrates that the arrangement of Gallium Indium Phosphide (GaInP) rods in the structure which gives the overall size of the device around 11.4 µm × 10.8 µm. The designed filter gives good dropping efficiency using 3.298, refractive index. The designed structure is useful for CWDM systems. This device may serve as a key component in photonic integrated circuits. The device is ultra compact with the overall size around 123 µm{sup 2}.« less
Interaction Between Graphene-Coated SiC Single Crystal and Liquid Copper
NASA Astrophysics Data System (ADS)
Homa, M.; Sobczak, N.; Sobczak, J. J.; Kudyba, A.; Bruzda, G.; Nowak, R.; Pietrzak, K.; Chmielewski, M.; Strupiński, W.
2018-04-01
The wettability of graphene-coated SiC single crystal (CGn/SiCsc) by liquid Cu (99.99%) was investigated by a sessile drop method in vacuum conditions at temperature of 1100 °C. The graphene layer was produced via a chemical vapor deposition routine using 4H-SiC single crystal cut out from 6″ wafer. A dispensed drop technique combined with a non-contact heating of a couple of materials was applied. The Cu drop was squeezed from a graphite capillary and deposited on the substrate directly in a vacuum chamber. The first Cu drop did not wet the CGn/SiCsc substrate and showed a lack of adhesion to the substrate: the falling Cu drop only touched the substrate forming a contact angle of θ 0 = 121° and then immediately rolled like a ball along the substrate surface. After settling near the edge of the substrate in about 0.15 s, the Cu drop formed an asymmetric shape with the right and left contact angles of different values (θ R = 86° and θ L = 70°, respectively), while in the next 30 min, θ R and θ L achieved the same final value of 52°. The second Cu drop was put down on the displacement path of the first drop, and immediately after the deposition, it also did not wet the substrate (θ = 123°). This drop kept symmetry and the primary position, but its wetting behavior was unusual: both θ R and θ L decreased in 17 min to the value of 23° and next, they increased to a final value of 65°. Visual observations revealed a presence of 2.5-mm-thick interfacial phase layer reactively formed under the second drop. Scanning electron microscopy (SEM) investigations revealed the presence of carbon-enriched precipitates on the top surface of the first Cu drop. These precipitates were identified by the Raman spectroscopy as double-layer graphene. The Raman spectrum taken from the substrate far from the drop revealed the presence of graphene, while that obtained from the first drop displacement path exhibited a decreased intensity of 2D peak. The results of SEM investigations and Raman spectroscopy studies suggest that the presence of graphene layer on the SiC substrate suppresses but does not completely prevent chemical interaction between liquid Cu drop and SiC. Both chemical degradation (etching) and mechanical degradation of the graphene layer during drop rolling due to high adhesion of the Cu drop to the SiC substrate are responsible for mass transfer through the 2nd drop/substrate interface that in turn results in significant changes of structure and chemistry of the drop and the interface.
Interaction Between Graphene-Coated SiC Single Crystal and Liquid Copper
NASA Astrophysics Data System (ADS)
Homa, M.; Sobczak, N.; Sobczak, J. J.; Kudyba, A.; Bruzda, G.; Nowak, R.; Pietrzak, K.; Chmielewski, M.; Strupiński, W.
2018-05-01
The wettability of graphene-coated SiC single crystal (CGn/SiCsc) by liquid Cu (99.99%) was investigated by a sessile drop method in vacuum conditions at temperature of 1100 °C. The graphene layer was produced via a chemical vapor deposition routine using 4H-SiC single crystal cut out from 6″ wafer. A dispensed drop technique combined with a non-contact heating of a couple of materials was applied. The Cu drop was squeezed from a graphite capillary and deposited on the substrate directly in a vacuum chamber. The first Cu drop did not wet the CGn/SiCsc substrate and showed a lack of adhesion to the substrate: the falling Cu drop only touched the substrate forming a contact angle of θ 0 = 121° and then immediately rolled like a ball along the substrate surface. After settling near the edge of the substrate in about 0.15 s, the Cu drop formed an asymmetric shape with the right and left contact angles of different values ( θ R = 86° and θ L = 70°, respectively), while in the next 30 min, θ R and θ L achieved the same final value of 52°. The second Cu drop was put down on the displacement path of the first drop, and immediately after the deposition, it also did not wet the substrate ( θ = 123°). This drop kept symmetry and the primary position, but its wetting behavior was unusual: both θ R and θ L decreased in 17 min to the value of 23° and next, they increased to a final value of 65°. Visual observations revealed a presence of 2.5-mm-thick interfacial phase layer reactively formed under the second drop. Scanning electron microscopy (SEM) investigations revealed the presence of carbon-enriched precipitates on the top surface of the first Cu drop. These precipitates were identified by the Raman spectroscopy as double-layer graphene. The Raman spectrum taken from the substrate far from the drop revealed the presence of graphene, while that obtained from the first drop displacement path exhibited a decreased intensity of 2D peak. The results of SEM investigations and Raman spectroscopy studies suggest that the presence of graphene layer on the SiC substrate suppresses but does not completely prevent chemical interaction between liquid Cu drop and SiC. Both chemical degradation (etching) and mechanical degradation of the graphene layer during drop rolling due to high adhesion of the Cu drop to the SiC substrate are responsible for mass transfer through the 2nd drop/substrate interface that in turn results in significant changes of structure and chemistry of the drop and the interface.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com; Dusad, Lalit Kumar
In this paper channel drop filter (CDF) is designed using dual curved photonic crystal ring resonator (PCRR). The photonic band gap (PBG) is calculated by plane wave expansion (PWE) method and the photonic crystal (PhC) based on two dimensional (2D) square lattice periodic arrays of silicon (Si) rods in air structure have been investigated using finite difference time domain (FDTD) method. The number of rods in Z and X directions is 21 and 20 respectively with lattice constant 0.540 nm and rod radius r = 0.1 µm. The channel drop filter has been optimized for telecommunication wavelengths λ = 1.591 µm with refractivemore » indices 3.533. In the designed structure further analysis is also done by changing whole rods refractive index and it has been observed that this filter may be used for filtering several other channels also. The designed structure is useful for CWDM systems. This device may serve as a key component in photonic integrated circuits. The device is ultra compact with the overall size around 123 µm{sup 2}.« less
Federal Register 2010, 2011, 2012, 2013, 2014
2010-08-16
... Ice Crystal Icing Conditions AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of... airplanes most affected by these icing conditions, mixed phase and ice crystal conditions for all transport category airplanes, and supercooled large drop, mixed phase, and ice crystal icing conditions for all...
Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S
2014-12-01
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.
Fluorescent Approaches to High Throughput Crystallography
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Forsythe, Elizabeth
2005-01-01
X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, 51%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear hits. Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.
Fluorescent Approaches to High Throughput Crystallography
NASA Technical Reports Server (NTRS)
Minamitani, Elizabeth Forsythe; Pusey, Marc L.
2004-01-01
X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of a macromolecules purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals will show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "bits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.
Fluorescent Approaches to High Throughput Crystallography
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Forsythe, Elizabeth
2004-01-01
X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically can not reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "hits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki
2006-02-01
PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less
Fluorescent Approaches to High Throughput Crystallography
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Forsythe, Elizabeth; Achari, Aniruddha
2006-01-01
We have shown that by covalently modifying a subpopulation, less than or equal to 1%, of a macromolecule with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification, and the presence of the probe at low concentrations does not affect the X-ray data quality or the crystallization behavior. The presence of the trace fluorescent label gives a number of advantages when used with high throughput crystallizations. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination crystals show up as bright objects against a dark background. Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Brightly fluorescent crystals are readily found against less bright precipitated phases, which under white light illumination may obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries as the protein or protein structures is all that shows up. Fluorescence intensity is a faster search parameter, whether visually or by automated methods, than looking for crystalline features. We are now testing the use of high fluorescence intensity regions, in the absence of clear crystalline features or "hits", as a means for determining potential lead conditions. A working hypothesis is that kinetics leading to non-structured phases may overwhelm and trap more slowly formed ordered assemblies, which subsequently show up as regions of brighter fluorescence intensity. Preliminary experiments with test proteins have resulted in the extraction of a number of crystallization conditions from screening outcomes based solely on the presence of bright fluorescent regions. Subsequent experiments will test this approach using a wider range of proteins. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons.
A simple apparatus for controlling nucleation and size in protein crystal growth
NASA Technical Reports Server (NTRS)
Gernert, Kim M.; Smith, Robert; Carter, Daniel C.
1988-01-01
A simple device is described for controlling vapor equilibrium in macromolecular crystallization as applied to the protein crystal growth technique commonly referred to as the 'hanging drop' method. Crystal growth experiments with hen egg white lysozyme have demonstrated control of the nucleation rate. Nucleation rate and final crystal size have been found to be highly dependent upon the rate at which critical supersaturation is approached. Slower approaches show a marked decrease in the nucleation rate and an increase in crystal size.
NASA Astrophysics Data System (ADS)
Cho, Joung-min; Mori, Takehiko
2016-06-01
Transistors based on single-crystal films of 2-decyl-7-phenyl-[1]benzothieno[3,2-b][1]benzothiophene (Ph-BTBT-10) fabricated using the blade-coating method are investigated by the four-probe method down to low temperatures. The four-probe mobility is as large as 18 cm2/V s at room temperature, and increases to 45 cm2/V s at 80 K. At 60 K the two-probe mobility drops abruptly by about 50%, but the mobility drop is mostly attributed to the increase of the source resistance. The carrier transport in the present single-crystal film is regarded as essentially bandlike down to 30 K.
NASA Technical Reports Server (NTRS)
Turnbull, D.
1984-01-01
The formation by melt quenching of such metastable structures as glassy or microcrystalline solids and highly supersaturated solutions is made possible by the extreme resistance of most melts to homophase crystal nucleation at deep undercooling. This nucleation resistance contrasts sharply with the very low kinetic resistance to the movement of crystal-melt interfaces, once formed, in metals and other fluid systems at even minute undercooling. The methods of nucleation study which have proven especially effective in bypassing nucleation by heterophase impurities thereby exposing the high resistance of melts to homophase nucleation may be summarized as follows: observation of the crystallization behavior of dispersed small droplets; drop tube experiments in which liquid drops solidify, under containerless conditions, during their fall in the tube; and observation of the crystallization of bulk specimens immersed in fluxes chosen to dissolve or otherwise deactivate (e.g., by wetting) heterophase nucleants. This method has proven to be remarkably effective in deactivating such nucleants in certain pure metals.
Crystallization screening test for the whole-cell project on Thermus thermophilus HB8
Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki
2008-01-01
It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056
Kinetic limit of heterogeneous melting in metals.
Ivanov, Dmitriy S; Zhigilei, Leonid V
2007-05-11
The velocity and nanoscale shape of the melting front are investigated in a model that combines the molecular dynamics method with a continuum description of the electron heat conduction and electron-phonon coupling. The velocity of the melting front is strongly affected by the local drop of the lattice temperature, defined by the kinetic balance between the transfer of thermal energy to the latent heat of melting, the electron heat conduction from the overheated solid, and the electron-phonon coupling. The maximum velocity of the melting front is found to be below 3% of the room temperature speed of sound in the crystal, suggesting a limited contribution of heterogeneous melting under conditions of fast heating.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui
2007-06-01
The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less
NASA Technical Reports Server (NTRS)
Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.
1992-01-01
Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.
Method for controlling protein crystallization
NASA Technical Reports Server (NTRS)
Noever, David A. (Inventor)
1993-01-01
A method and apparatus for controlling the crystallization of protein by solvent evaporation including placing a drop of protein solution between and in contact with a pair of parallel plates and driving one of the plates toward and away from the other plate in a controlled manner to adjust the spacing between the plates is presented. The drop of solution forms a liquid cylinder having a height dependent upon the plate spacing thereby effecting the surface area available for solvent evaporation. When the spacing is close, evaporation is slow. Evaporation is increased by increasing the spacing between the plates until the breaking point of the liquid cylinder. One plate is mounted upon a fixed post while the other plate is carried by a receptacle movable relative to the post and driven by a belt driven screw drive. The temperature and humidity of the drop of protein solution are controlled by sealing the drop within the receptacle and mounting a heater and dessicant within the receptacle.
Driving Organic Molecule Crystalliztion with Surface Reconstructions
NASA Astrophysics Data System (ADS)
Bickel, Jessica; Trovato, Gianfranco
This work examines how surface reconstructions can drive crystallization of organic molecules via self-assembly. Organic electronic molecules have low conductivities compared to inorganic materials, but crystallizing these polymers increases their conductivity. This project uses surface reconstructions with periodically repeating topographies to drive the crystallization process. The samples are grown by placing a drop of a dilute PEDOT solution on the clean Si(001)-(2x1) or Si(111)-(7x7) surface reconstruction and heating the surface up to both evaporate the solvent and promote diffusion of the polymer to the thermodynamically defined lowest energy position. The resulting samples are characterized by scanning tunneling microscopy (STM) with respect to their crystallinity and electronic properties. Of particular interest is whether there is a preferential location for the PEDOT molecule to adsorb and whether there are any conformational changes upon adsorption that modify the HOMO-LUMO gap. This work is being done in a new pan-style RHK-STM enclosed in a glovebox at Cleveland State University. The glovebox has O2 and H2O levels of less than 1ppm. This allows for sample preparation and imaging in a controlled environment that is free from contamination.
Protein crystals as scanned probes for recognition atomic force microscopy.
Wickremasinghe, Nissanka S; Hafner, Jason H
2005-12-01
Lysozyme crystal growth has been localized at the tip of a conventional silicon nitride cantilever through seeded nucleation. After cross-linking with glutaraldehyde, lysozyme protein crystal tips image gold nanoparticles and grating standards with a resolution comparable to that of conventional tips. Force spectra between the lysozyme crystal tips and surfaces covered with antilysozyme reveal an adhesion force that drops significantly upon blocking with free lysozyme, thus confirming that lysozyme crystal tips can detect molecular recognition interactions.
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.
2014-01-01
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231
Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...
2014-11-28
A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
Rosenthal, Ann K; Fahey, Mark; Gohr, Claudia; Burner, Todd; Konon, Irina; Daft, Laureen; Mattson, Eric; Hirschmugl, Carol; Ryan, Lawrence M; Simkin, Peter
2008-10-01
Basic calcium phosphate (BCP) crystals are common components of osteoarthritis (OA) synovial fluid. Progress in understanding the role of these bioactive particles in clinical OA has been hampered by difficulties in their identification. Tetracyclines stain calcium phosphate mineral in bone. The aim of this study was to investigate whether tetracycline staining might be an additional or alternative method for identifying BCP crystals in synovial fluid. A drop of oxytetracycline was mixed with a drop of fluid containing synthetic or native BCP, calcium pyrophosphate dihydrate (CPPD), or monosodium urate (MSU) crystals and placed on a microscope slide. Stained and unstained crystals were examined by light microscopy, with and without a portable broad-spectrum ultraviolet (UV) pen light. A small set of characterized synovial fluid samples were compared by staining with alizarin red S and oxytetracycline. Synthetic BCP crystals in synovial fluid were quantified fluorimetrically using oxytetracycline. After oxytetracycline staining, synthetic and native BCP crystals appeared as fluorescent amorphous aggregates under UV light. Oxytetracycline did not stain CPPD or MSU crystals or other particulates. Oxytetracycline staining had fewer false-positive test results than did alizarin red S staining and could provide estimates of the quantities of synthetic BCP crystals in synovial fluid. With further validation, oxytetracycline staining may prove to be a useful adjunct or alternative to currently available methods for identifying BCP crystals in synovial fluid.
Fluorescent Approaches to High Throughput Crystallography
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Forsythe, Elizabeth; Achari, Amiruddha
2005-01-01
X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1 %, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "hits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. Preliminary experiments show that the presence of the fluorescent probe does not affect the nucleation process or the quality of the X-ray data obtained.
Fluorescent Applications to Crystallization
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Forsythe, Elizabeth; Achari, Aniruddha
2006-01-01
By covalently modifying a subpopulation, less than or equal to 1%, of a macromolecule with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification, and tests with model proteins have shown that labeling u to 5 percent of the protein molecules does not affect the X-ray data quality obtained . The presence of the trace fluorescent label gives a number of advantages. Since the label is covalently attached to the protein molecules, it "tracks" the protein s response to the crystallization conditions. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination crystals show up as bright objects against a darker background. Non-protein structures, such as salt crystals, do not show up under fluorescent illumination. Crystals have the highest protein concentration and are readily observed against less bright precipitated phases, which under white light illumination may obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries as the protein or protein structures is all that shows up. Fluorescence intensity is a faster search parameter, whether visually or by automated methods, than looking for crystalline features. Preliminary tests, using model proteins, indicates that we can use high fluorescence intensity regions, in the absence of clear crystalline features or "hits", as a means for determining potential lead conditions. A working hypothesis is that more rapid amorphous precipitation kinetics may overwhelm and trap more slowly formed ordered assemblies, which subsequently show up as regions of brighter fluorescence intensity. Experiments are now being carried out to test this approach using a wider range, of proteins. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons.
Sizing of colloidal particle and protein molecules in a hanging fluid drop
NASA Technical Reports Server (NTRS)
Ansari, Rafat R.; Suh, Kwang I.
1995-01-01
We report non-invasive particle size measurements of polystyrene latex colloidal particles and bovine serum albumin (BSA) protein molecules suspended in tiny hanging fluid drops of 30 micro-Liter volume using a newly designed fiber optic probe. The probe is based upon the principles of the technique of dynamic light scattering (DLS). The motivation for this work comes from growing protein crystals in outer space. Protein crystals have been grown previously in hanging drops in microgravity experiments on-board the space shuttle orbiter. However, obtaining quantitative information on nucleation and growth of the protein crystals in real time has always been a desired goal, but hitherto not achieved. Several protein researchers have shown interest in using DLS to monitor crystal growth process in a droplet, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. We demonstrate that such an experiment is now possible. Our system offers fast (5 seconds) determination of particle size, utilize safe levels of very low laser power (less than or equal to 0.2 mW), a small scattering volume (approximately 2 x 10(exp -5) cu mm) and high spatial coherence (Beta) values. This is a major step forward when compared to currently available DLS systems.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi
2005-03-01
A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.
On the metal-insulator-transition in vanadium dioxide
NASA Astrophysics Data System (ADS)
Jovaini, Azita; Fujita, Shigeji; Godoy, Salvador; Suzuki, Akira
2012-02-01
Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity σ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop.
NASA Technical Reports Server (NTRS)
Nisbet, John S.
1988-01-01
General equations for the Reynolds number of a variety of types of ice crystals and water drops are given in terms of the Davies, Bond, and Knudsen numbers. The equations are in terms of the basic physical parameters of the system and are valid for calculating velocities in gravitational and electric fields over a very wide range of sizes and atmospheric conditions. The equations are asymptotically matched at the bottom and top of the size spectrum, useful when checking large computer codes. A numerical system for specifying the dimensional properties of ice crystals is introduced. Within the limits imposed by such variables as particle density, which have large deviations, the accuracy of velocities appears to be within 10 percent over the entire range of sizes of interest.
NASA Astrophysics Data System (ADS)
Herlach, Dieter M.; Kobold, Raphael; Klein, Stefan
2018-03-01
Glass formation of a liquid undercooled below its melting temperature requires the complete avoidance of crystal nucleation and subsequent crystal growth. Even though they are not part of the glass formation process, a detailed knowledge of both processes involved in crystallization is mandatory to determine the glass-forming ability of metals and metallic alloys. In the present work, methods of containerless processing of drops by electrostatic and electromagnetic levitation are applied to undercool metallic melts prior to solidification. Heterogeneous nucleation on crucible walls is completely avoided giving access to large undercoolings. A freely suspended drop offers the additional benefit of showing the rapid crystallization process of an undercooled melt in situ by proper diagnostic means. As a reference, crystal nucleation and dendrite growth in the undercooled melt of pure Zr are experimentally investigated. Equivalently, binary Zr-Cu, Zr-Ni and Zr-Pd and ternary Zr-Ni-Cu alloys are studied, whose glass-forming abilities differ. The experimental results are analyzed within classical nucleation theory and models of dendrite growth. The findings give detailed knowledge about the nucleation-undercooling statistics and the growth kinetics over a large range of undercooling.
Crystallization and X-ray analysis of the salmon-egg lectin SEL24K
DOE Office of Scientific and Technical Information (OSTI.GOV)
Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu
2007-05-01
The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji
Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less
Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.
2008-02-01
The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less
Nano Liquid Crystal Droplet Impact on Solid Surfaces
NASA Astrophysics Data System (ADS)
Zhang, Rui; de Pablo, Juan; dePablo Team
2015-03-01
Liquid droplet impaction on solid surfaces is an important problem with a wide range of applications in everyday life. Liquid crystals (LCs) are anisotropic liquids whose internal structure gives rise to rich optical and morphological phenomena. In this work we study the liquid crystal droplet impaction on solid surfaces by molecular dynamics simulations. We employ a widely used Gay-Berne model to describe the elongated liquid crystal molecules and their interactions. Our work shows that, in contrast to isotropic liquids, drop deformation is symmetric unless an instability kicks in, in which case a nano scale liquid crystal droplet exhibits distinct anisotropic spreading modes that do not occur in simple liquids. The drop prefers spreading along the low viscosity direction, but inertia can in some cases overcome that bias. The effects of the director field of the droplet, preferred anchoring direction and the anchoring strength of the wall are investigated. Large scale (0.1 micron) simulations are performed to connect our nano scale results to the experiments. Our studies indicate that LCs could provide an interesting alternative for development of next-generation printing inks.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Molina, Rafael; González, Ana; Moscoso, Miriam
2007-09-01
The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Rose, M. Franklin (Technical Monitor)
2000-01-01
Three different types of ribosome crystals were grown by the vapor diffusion technique in hanging drops as described in (1,2). The ribosome is a large asymmetric RNA-protein complex (2.3 million Da), which is protein syntheses machinery of the cell. In this poster we would like to discuss the features of ribosome crystallization. Ribosomes were purified from the thermophilic bacteria Thermus thermophilus by centrifugation (3). Three types of crystals (needle, flat tetragonal and tetragonal-like pyramid) can be grown from the same solution; furthermore, in the same drop using 10-15% 2-methyl-2,4- pentanediol as a precipitant. The crystals appeared in 5-48 hours. The crystals were stable and can co-exist in solution over long period of time. The kinetics of appearance of different crystal forms was different: first the needle crystals were grown, then the tetragonal, and finally the tetragonal pyramids. Later studies of the process of ribosome crystal growth depending on supersaturation showed that low supersaturation results in the appearance of tetragonal plates or tetragonal-like pyramids. An electron microscopy study, together with computer modeling, has shown that crystals of different forms have a high probability of having the same unit cell parameters. According to these experiments the following conclusion can be dranvn: the level of supersaturation of the macromolecule in a crystallizing solution is one of the major factors for forming three-dimensional crystals convenient for X-rays diffraction analysis. From the same macromolecule solution, crystals of different forms can be grown at approximately the same conditions by varying the concentration of macromolecule in the solution. Ion-macromolecule and water-macromolecule interactions, apparently, play the main role in the formation of the unit cell of the crystals.
Gentle, fast and effective crystal soaking by acoustic dispensing
Ng, Jia Tsing; Talon, Romain; Nekrosiute, Karolina; Krojer, Tobias; Douangamath, Alice; Brandao-Neto, Jose; Pearce, Nicholas M.; von Delft, Frank
2017-01-01
The steady expansion in the capacity of modern beamlines for high-throughput data collection, enabled by increasing X-ray brightness, capacity of robotics and detector speeds, has pushed the bottleneck upstream towards sample preparation. Even in ligand-binding studies using crystal soaking, the experiment best able to exploit beamline capacity, a primary limitation is the need for gentle and nontrivial soaking regimens such as stepwise concentration increases, even for robust and well characterized crystals. Here, the use of acoustic droplet ejection for the soaking of protein crystals with small molecules is described, and it is shown that it is both gentle on crystals and allows very high throughput, with 1000 unique soaks easily performed in under 10 min. In addition to having very low compound consumption (tens of nanolitres per sample), the positional precision of acoustic droplet ejection enables the targeted placement of the compound/solvent away from crystals and towards drop edges, allowing gradual diffusion of solvent across the drop. This ensures both an improvement in the reproducibility of X-ray diffraction and increased solvent tolerance of the crystals, thus enabling higher effective compound-soaking concentrations. The technique is detailed here with examples from the protein target JMJD2D, a histone lysine demethylase with roles in cancer and the focus of active structure-based drug-design efforts. PMID:28291760
Gicquel, Yannig; Schubert, Robin; Kapis, Svetlana; Bourenkov, Gleb; Schneider, Thomas; Perbandt, Markus; Betzel, Christian; Chapman, Henry N; Heymann, Michael
2018-04-24
This protocol describes fabricating microfluidic devices with low X-ray background optimized for goniometer based fixed target serial crystallography. The devices are patterned from epoxy glue using soft lithography and are suitable for in situ X-ray diffraction experiments at room temperature. The sample wells are lidded on both sides with polymeric polyimide foil windows that allow diffraction data collection with low X-ray background. This fabrication method is undemanding and inexpensive. After the sourcing of a SU-8 master wafer, all fabrication can be completed outside of a cleanroom in a typical research lab environment. The chip design and fabrication protocol utilize capillary valving to microfluidically split an aqueous reaction into defined nanoliter sized droplets. This loading mechanism avoids the sample loss from channel dead-volume and can easily be performed manually without using pumps or other equipment for fluid actuation. We describe how isolated nanoliter sized drops of protein solution can be monitored in situ by dynamic light scattering to control protein crystal nucleation and growth. After suitable crystals are grown, complete X-ray diffraction datasets can be collected using goniometer based in situ fixed target serial X-ray crystallography at room temperature. The protocol provides custom scripts to process diffraction datasets using a suite of software tools to solve and refine the protein crystal structure. This approach avoids the artefacts possibly induced during cryo-preservation or manual crystal handling in conventional crystallography experiments. We present and compare three protein structures that were solved using small crystals with dimensions of approximately 10-20 µm grown in chip. By crystallizing and diffracting in situ, handling and hence mechanical disturbances of fragile crystals is minimized. The protocol details how to fabricate a custom X-ray transparent microfluidic chip suitable for in situ serial crystallography. As almost every crystal can be used for diffraction data collection, these microfluidic chips are a very efficient crystal delivery method.
Dynamics and universal scaling law in geometrically-controlled sessile drop evaporation
Sáenz, P. J.; Wray, A. W.; Che, Z.; Matar, O. K.; Valluri, P.; Kim, J.; Sefiane, K.
2017-01-01
The evaporation of a liquid drop on a solid substrate is a remarkably common phenomenon. Yet, the complexity of the underlying mechanisms has constrained previous studies to spherically symmetric configurations. Here we investigate well-defined, non-spherical evaporating drops of pure liquids and binary mixtures. We deduce a universal scaling law for the evaporation rate valid for any shape and demonstrate that more curved regions lead to preferential localized depositions in particle-laden drops. Furthermore, geometry induces well-defined flow structures within the drop that change according to the driving mechanism. In the case of binary mixtures, geometry dictates the spatial segregation of the more volatile component as it is depleted. Our results suggest that the drop geometry can be exploited to prescribe the particle deposition and evaporative dynamics of pure drops and the mixing characteristics of multicomponent drops, which may be of interest to a wide range of industrial and scientific applications. PMID:28294114
Dynamics and universal scaling law in geometrically-controlled sessile drop evaporation.
Sáenz, P J; Wray, A W; Che, Z; Matar, O K; Valluri, P; Kim, J; Sefiane, K
2017-03-15
The evaporation of a liquid drop on a solid substrate is a remarkably common phenomenon. Yet, the complexity of the underlying mechanisms has constrained previous studies to spherically symmetric configurations. Here we investigate well-defined, non-spherical evaporating drops of pure liquids and binary mixtures. We deduce a universal scaling law for the evaporation rate valid for any shape and demonstrate that more curved regions lead to preferential localized depositions in particle-laden drops. Furthermore, geometry induces well-defined flow structures within the drop that change according to the driving mechanism. In the case of binary mixtures, geometry dictates the spatial segregation of the more volatile component as it is depleted. Our results suggest that the drop geometry can be exploited to prescribe the particle deposition and evaporative dynamics of pure drops and the mixing characteristics of multicomponent drops, which may be of interest to a wide range of industrial and scientific applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
2006-09-01
A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less
Soliton-like defects in nematic liquid crystal thin layers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chuvyrov, A. N.; Krekhov, A. P.; Lebedev, Yu. A., E-mail: lebedev@anrb.ru
The nonsingular soliton-like defects in plane nematic liquid crystal (NLC) layers and spherical NLC drops are experimentally detected and studied when the interaction of NLC molecules with a bounding surface is varied. The dynamics and the annihilation of nonsingular defects of opposite signs on a plane surface are investigated. Periodic transformations of the soliton-like defects in NLC drops in an electric field are detected. The theory of elasticity is used to show that the surface energy taken into account in the total free energy of NLC in the case of weak anchoring leads to the possibility of nonsingular solutions ofmore » a director equilibrium equation. The calculated pictures of director distribution in a plane NLC layer and in a spherical NLC drop characterized by weak surface anchoring agree well with the results of polarized light optical observations.« less
Control of solvent evaporation in hen egg white lysozyme crystallization
NASA Technical Reports Server (NTRS)
Wilson, L. J.; Suddath, F. L.
1992-01-01
An investigation of the role of solvent evaporation in tetragonal lysozyme crystallization was preformed with a device that employs N2(g) to control the evaporation of solvent from a micro-volume crystallization hanging drop. The number of crystals was found to vary with the rate at which the final supersaturation level was achieved. It was found that the more rapid the approach to supersaturation the larger the number of crystals. Accordingly, the crystals reached a smaller terminal size. Elongation of the (110) face parallel to the four-fold axis was observed with the slower evaporation rates.
Preliminary investigations of protein crystal growth using the Space Shuttle
NASA Technical Reports Server (NTRS)
Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.
1986-01-01
Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.
Protein crystal growth in space
NASA Technical Reports Server (NTRS)
Bugg, C. E.; Clifford, D. W.
1987-01-01
The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.
Drop evaporation in a single-axis acoustic levitator
NASA Technical Reports Server (NTRS)
Lierke, E. G.; Croonquist, A. P.
1990-01-01
A 20 kHz single-axis acoustic positioner is used to levitate aqueous-solution drops (volumes less than or approximately equal to 100 micro-liters). Drop evaporation rates are measured under ambient, isothermal conditions for different relative humidities. Acoustic convection around the levitated sample enhances the mass loss over that due to natural convection and diffusion. A theoretical treatment of the mass flow is developed in analogy to previous studies of the heat transfer from a sphere in an acoustic field. Predictions of the enhanced mass loss, in the form of Nusselt (Sherwood) numbers, are compared with observed rages of drop shrinking. The work is part of an ESA crystal growth from levitated solution drops.
Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.
Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G
1987-11-01
Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.
Luft, Joseph R.; Wolfley, Jennifer R.; Snell, Edward H.
2011-01-01
Observations of crystallization experiments are classified as specific outcomes and integrated through a phase diagram to visualize solubility and thereby direct subsequent experiments. Specific examples are taken from our high-throughput crystallization laboratory which provided a broad scope of data from 20 million crystallization experiments on 12,500 different biological macromolecules. The methods and rationale are broadly and generally applicable in any crystallization laboratory. Through a combination of incomplete factorial sampling of crystallization cocktails, standard outcome classifications, visualization of outcomes as they relate chemically and application of a simple phase diagram approach we demonstrate how to logically design subsequent crystallization experiments. PMID:21643490
Factors affecting the morphology of isocitrate lyase crystals
NASA Technical Reports Server (NTRS)
Demattei, Robert C.; Feigelson, Robert S.; Weber, Patricia C.
1992-01-01
Isocitrate lyase crystals have been grown by the hanging drop vapor equilibration method in both 1-g and microgravity and by vapor equilibrium in small capillaries. The crystal morphologies obtained have ranged from dendritic to 'octagonal' prisms. Theoretical evaporation models have been applied to these growth regimes. The results of these analyses along with other experimental results, indicate the factors which must be controlled to produce good growth morphologies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China
2012-06-22
Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less
Containerless crystallization of silicon
NASA Astrophysics Data System (ADS)
Kuribayashi, K.; Aoyama, T.
2002-04-01
Crystallization from undercooled melt of silicon was carried out by means of electro-magnetic levitation method under controlled undercooling. The measured growth rate vs. undercooling was categorized into three regions, I, II and III, respectively, from the point of the interface morphology. Thin plate crystals whose interface consisted of both faceted (1 1 1) plane and wavy edge plane like saw-tooth were observed in the region I where the undercooling is less than 100 K. The growth rate of the wavy edge plane was well described by the dendrite growth model. The morphology of growing crystals was abruptly changed to faceted dendrite in the region II, though there was no abrupt change in the growth rate. Seeding at temperatures in the region I changes the drop to a mono-crystalline sphere, if the growth rate along the normal direction of the thin plate crystal is controlled by step-wise growth on the faceted plane. Actually, the sample of 5 mm in diameter seeded at undercooling of 26 K was a quasi-single crystal with large grain, except for a small area where twinning and cracking are observed. The result suggests that the single crystal could be grown, if a smaller sample, 1 or 2 mm in diameter, that is difficult to be levitated by electro-magnetic force were processed with other methods such as free fall in a drop tube.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing
2005-09-01
Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less
NASA Astrophysics Data System (ADS)
Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.
2014-09-01
The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.
Protein crystal growth results from shuttle flight 51-F
NASA Technical Reports Server (NTRS)
Bugg, C. E.
1985-01-01
The protein crystal growth (PCG) experiments run on 51-F were analyzed. It was found that: (1) sample stability is increased over that observed during the experiments on flight 51-D; (2) the dialysis experiments produced lysozyme crystals that were significantly larger than those obtained in our identical ground-based studies; (3) temperature fluctuations apparently caused problems during the crystallization experiments on 51-F; (4) it is indicated that teflon tape stabilizes droplets on the syringe tips; (5) samples survived during the reentry and landing in glass tips that were not stoppered with plungers; (6) from the ground-based studies, it was expected that equilibration should be complete within 2 to 4 days for all of these vapor-diffusion experiments, thus it appears that the vapor diffusion rates are somewhat slower under microgravity conditions; (7) drop tethering was highly successful, all four of the tethered drops were stable, even though they contained MPD solutions; (8) the PCG experiments on 51-F were done to assess the hardware and experimental procedures that are developed for future flights, when temperature control will be available. Lysozyme crystals obtained by microdialysis are considerably larger than those obtained on the ground, using the identical apparatus and procedures.
Protein crystal growth in low gravity
NASA Technical Reports Server (NTRS)
Feigelson, Robert S.
1993-01-01
This Final Technical Report for NASA Grant NAG8-774 covers the period from April 27, 1989 through December 31, 1992. It covers five main topics: fluid flow studies, the influence of growth conditions on the morphology of isocitrate lyase crystals, control of nucleation, the growth of lysozyme by the temperature gradient method and graphoepitaxy of protein crystals. The section on fluid flow discusses the limits of detectability in the Schlieren imaging of fluid flows around protein crystals. The isocitrate lyase study compares crystals grown terrestrially under a variety of conditions with those grown in space. The controlling factor governing the morphology of the crystals is the supersaturation. The lack of flow in the interface between the drop and the atmosphere in microgravity causes protein precipitation in the boundary layer and a lowering of the supersaturation in the drop. This lowered supersaturation leads to improved crystal morphology. Preliminary experiments with lysozyme indicated that localized temperature gradients could be used to nucleate crystals in a controlled manner. An apparatus (thermonucleator) was designed to study the controlled nucleation of protein crystals. This apparatus has been used to nucleate crystals of materials with both normal (ice-water, Rochelle salt and lysozyme) and retrograde (horse serum albumin and alpha chymotrypsinogen A) solubility. These studies have lead to the design of an new apparatus that small and more compatible with use in microgravity. Lysozyme crystals were grown by transporting nutrient from a source (lysozyme powder) to the crystal in a temperature gradient. The influence of path length and cross section on the growth rate was demonstrated. This technique can be combined with the thermonucleator to control both nucleation and growth. Graphoepitaxy utilizes a patterned substrate to orient growing crystals. In this study, silicon substrates with 10 micron grooves were used to grow crystals of catalase, lysozyme and canavalin. In all cases, the crystals grew oriented to the substrate. The supersaturation needed for nucleation and growth was lower on the patterned substrates. In some cases, isolated, large crystals were grown.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zipper, Lauren E.; Binghamton University, 4400 Vestal Parkway East, Vestal, NY 13902; Aristide, Xavier
This article describes the use of evaporation control lids that are fitted to crystallization plates to improve the reproducibility of trials using as little as 5 nl. The plate lids contain apertures which are large enough for the transfer of protein containing droplets, but small enough to greatly reduce the rate of evaporation during the time needed to prepare the plate. A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fittingmore » the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less
NASA Astrophysics Data System (ADS)
Berseth, V.; Indenbom, M. V.; van der Beek, C. J.; D'Anna, G.; Benoit, W.
1997-08-01
Using a multiterminal contact configuration, we investigate the local variations of the resistivity drop near the vortex lattice first order phase transition in a very homogeneous Bi2Sr2CaCu2O8+δ (BSCCO) single crystal.
Single-drop optimization of protein crystallization.
Meyer, Arne; Dierks, Karsten; Hilterhaus, Dierk; Klupsch, Thomas; Mühlig, Peter; Kleesiek, Jens; Schöpflin, Robert; Einspahr, Howard; Hilgenfeld, Rolf; Betzel, Christian
2012-08-01
A completely new crystal-growth device has been developed that permits charting a course across the phase diagram to produce crystalline samples optimized for diffraction experiments. The utility of the device is demonstrated for the production of crystals for the traditional X-ray diffraction data-collection experiment, of microcrystals optimal for data-collection experiments at a modern microbeam insertion-device synchrotron beamline and of nanocrystals required for data collection on an X-ray laser beamline.
NASA Technical Reports Server (NTRS)
Fowlis, William W.; Delucas, Lawrence J.; Twigg, Pamela J.; Howard, Sandra B.; Meehan, Edward J.
1988-01-01
The principles of the hanging-drop method of crystal growth are discussed, and the rate of water evaporation in a water droplet (containing protein, buffer, and a precipitating agent) suspended above a well containing a double concentration of precipitating agent is investigated theoretically. It is shown that, on earth, the rate of evaporation may be determined from diffusion theory and the colligative properties of solutions. The parameters affecting the rate of evaporation include the temperature, the vapor pressure of water, the ionization constant of the salt, the volume of the drop, the contact angle between the droplet and the coverslip, the number of moles of salt in the droplet, the number of moles of water and salt in the well, the molar volumes of water and salt, the distance from the droplet to the well, and the coefficient of diffusion of water vapor through air. To test the theoretical equations, hanging-drop experiments were conducted using various reagent concentrations in 25-microliter droplets and measuring the evaporation times at 4 C and 25 C. The results showed good agreement with the theory.
Içten, Elçin; Giridhar, Arun; Nagy, Zoltan K; Reklaitis, Gintaras V
2016-04-01
The features of a drop-on-demand-based system developed for the manufacture of melt-based pharmaceuticals have been previously reported. In this paper, a supervisory control system, which is designed to ensure reproducible production of high quality of melt-based solid oral dosages, is presented. This control system enables the production of individual dosage forms with the desired critical quality attributes: amount of active ingredient and drug morphology by monitoring and controlling critical process parameters, such as drop size and product and process temperatures. The effects of these process parameters on the final product quality are investigated, and the properties of the produced dosage forms characterized using various techniques, such as Raman spectroscopy, optical microscopy, and dissolution testing. A crystallization temperature control strategy, including controlled temperature cycles, is presented to tailor the crystallization behavior of drug deposits and to achieve consistent drug morphology. This control strategy can be used to achieve the desired bioavailability of the drug by mitigating variations in the dissolution profiles. The supervisor control strategy enables the application of the drop-on-demand system to the production of individualized dosage required for personalized drug regimens.
From screen to structure with a harvestable microfluidic device.
Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A
2011-08-01
Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.
Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J
2013-12-01
Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.
Automation of Vapor-Diffusion Growth of Protein Crystals
NASA Technical Reports Server (NTRS)
Hamrick, David T.; Bray, Terry L.
2005-01-01
Some improvements have been made in a system of laboratory equipment developed previously for studying the crystallization of proteins from solution by use of dynamically controlled flows of dry gas. The improvements involve mainly (1) automation of dispensing of liquids for starting experiments, (2) automatic control of drying of protein solutions during the experiments, and (3) provision for automated acquisition of video images for monitoring experiments in progress and for post-experiment analysis. The automation of dispensing of liquids was effected by adding an automated liquid-handling robot that can aspirate source solutions and dispense them in either a hanging-drop or a sitting-drop configuration, whichever is specified, in each of 48 experiment chambers. A video camera of approximately the size and shape of a lipstick dispenser was added to a mobile stage that is part of the robot, in order to enable automated acquisition of images in each experiment chamber. The experiment chambers were redesigned to enable the use of sitting drops, enable backlighting of each specimen, and facilitate automation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com
2014-10-15
In this paper, we have proposed a new design of tunable two dimensional (2D) photonic crystal (PhC) channel drop filter (CDF) using ring resonators. The increasing interest in photonic integrated circuits (PIC's) and the increasing use of all-optical fiber networks as backbones for global communication systems have been based in large part on the extremely wide optical transmission bandwidth provided by dielectric materials. Based on the analysis we present novel photonic crystal channel drop filters. Simulations demonstrate that these filters exhibit ideal transfer characteristics. Channel dropping filters (CDF's) that access one channel of a wavelength division multiplexed (WDM) signal whilemore » leaving other channels undisturbed are essential components of PIC's and optical communication systems. In this paper we have investigated such parameters which have an effect on resonant wavelength in this Channel Drop Filter, such as dielectric constant of inner, coupling, adjacent and whole rods of the structure. The dimensions of these structures are taken as 20a×19a and the area of the proposed structure is about 125.6μm{sup 2}; therefore this structure can be used in the future photonic integrated circuits. While using this design the dropping efficiency at the resonance of single ring are 100%. The spectrum of the power transmission is obtained with finite difference time domain (FDTD) method. FDTD method is the most famous method for PhC analysis. In this paper the dielectric rods have a dielectric constant of 10.65, so the refractive index is 3.26 and radius r=0.213a is located in air, where a is a lattice constant. In this we have used five scatter rods for obtaining more coupling efficiency; radius of scatter rods is set to 0.215a. The proposed structure is simulated with OptiFDTD.v.8.0 software, the different dielectric constant of rods equal to ε{sub r}−0.4, ε{sub r} and ε{sub r}+0.4 at wavelength of 1570 nm.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reis, Nuno M.; Chirgadze, Dimitri Y.; Blundell, Tom L.
The nucleation of lysozyme in microbatch experiments was linked to the formation of protein–precipitant interfaces. The use of oscillatory shear allowed decreasing the nucleation rate and extending the growth period for lysozyme crystals, presumably through the control of the number of interfaces and removal of impurities or defects. This paper is concerned with the effect of protein–precipitant interfaces and externally applied shear on the nucleation and growth kinetics of hen egg-white lysozyme crystals. The early stages of microbatch crystallization of lysozyme were explored using both optical and confocal fluorescence microscopy imaging. Initially, an antisolvent (precipitant) was added to a proteinmore » drop and the optical development of the protein–precipitant interface was followed with time. In the presence of the water-soluble polymer poly(ethylene glycol) (PEG) a sharp interface was observed to form immediately within the drop, giving an initial clear separation between the lighter protein solution and the heavier precipitant. This interface subsequently became unstable and quickly developed within a few seconds into several unstable ‘fingers’ that represented regions of high concentration-gradient interfaces. Confocal microscopy demonstrated that the subsequent nucleation of protein crystals occurred preferentially in the region of these interfaces. Additional experiments using an optical shearing system demonstrated that oscillatory shear significantly decreased nucleation rates whilst extending the growth period of the lysozyme crystals. The experimental observations relating to both nucleation and growth have relevance in developing efficient and reliable protocols for general crystallization procedures and the controlled crystallization of single large high-quality protein crystals for use in X-ray crystallography.« less
Metal Insulator transition in Vanadium Dioxide
NASA Astrophysics Data System (ADS)
Jovaini, Azita; Fujita, Shigeji; Suzuki, Akira; Godoy, Salvador
2012-02-01
MAR12-2011-000262 Abstract Submitted for the MAR12 Meeting of The American Physical Society Sorting Category: 03.9 (T) On the metal-insulator-transition in vanadium dioxide AZITA JOVAINI, SHIGEJI FUJITA, University at Buffalo, SALVADOR GODOY, UNAM, AKIRA SUZUKI, Tokyo University of Science --- Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity _/ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop. Prefer Oral Session X Prefer .
Compact Apparatus Grows Protein Crystals
NASA Technical Reports Server (NTRS)
Bugg, Charles E.; Delucas, Lawrence J.; Suddath, Fred L.; Snyder, Robert S.; Herren, Blair J.; Carter, Daniel C.; Yost, Vaughn H.
1989-01-01
Laboratory apparatus provides delicately balanced combination of materials and chemical conditions for growth of protein crystals. Apparatus and technique for growth based on hanging-drop method for crystallization of macromolecules. Includes pair of syringes with ganged plungers. One syringe contains protein solution; other contains precipitating-agent solution. Syringes intrude into cavity lined with porous reservoir material saturated with 1 mL or more of similar precipitating-agent solution. Prior to activation, ends of syringes plugged to prevent transport of water vapor among three solutions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hou, Jing; Li, Ming; Chen, Jiashu
Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.
Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim
2004-10-01
Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.
Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi
2006-01-01
The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559
Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina
2012-05-08
Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Feifei; Gao, Feng; Li, Honglin
The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tao, Keyu; Shenzhen Key Laboratory of Micro-Nano Photonic Information Technology, Shenzhen 518067; College of Electronic Science and Technology, Shenzhen University, Shenzhen 518067
We present a versatile add-drop integrated photonic filter (ADF) consisting of nonreciprocal waveguides in which the propagation of light is restricted in one predetermined direction. With the bus and add/drop waveguides symmetrically coupled through a cavity, the four-port device allows each individual port to add and/or drop a signal of the same frequency. The scheme is general and we demonstrate the nonreciprocal ADF with magneto-optical photonic crystals. The filter is immune to waveguide defects, allowing straightforward implementation of multi-channel ADFs by cascading the four-port designs. The results should find applications in wavelength-division multiplexing and related integrated photonic techniques.
Structural and Biochemical Studies of the Ovarian Tumor Domain
2007-05-01
solution containing Bis-Tris pH 5.5-6.5, 16-20% PEG 3350 , and 100-200 mM of a magnesium cation. These crystals belong to spacegroup P64 with unit...drop method using a reservoir solution containing Bis-Tris pH 5.5-6.5, 16-20% PEG 3350 , and 50-200 mM ammonium acetate . Orthorhombic crystals
Purification and crystallization of Kokobera virus helicase
DOE Office of Scientific and Technical Information (OSTI.GOV)
De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno
2007-03-01
Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less
Dislocation Mobility and Anomalous Shear Modulus Effect in ^4He Crystals
NASA Astrophysics Data System (ADS)
Malmi-Kakkada, Abdul N.; Valls, Oriol T.; Dasgupta, Chandan
2017-02-01
We calculate the dislocation glide mobility in solid ^4He within a model that assumes the existence of a superfluid field associated with dislocation lines. Prompted by the results of this mobility calculation, we study within this model the role that such a superfluid field may play in the motion of the dislocation line when a stress is applied to the crystal. To do this, we relate the damping of dislocation motion, calculated in the presence of the assumed superfluid field, to the shear modulus of the crystal. As the temperature increases, we find that a sharp drop in the shear modulus will occur at the temperature where the superfluid field disappears. We compare the drop in shear modulus of the crystal arising from the temperature dependence of the damping contribution due to the superfluid field, to the experimental observation of the same phenomena in solid ^4He and find quantitative agreement. Our results indicate that such a superfluid field plays an important role in dislocation pinning in a clean solid ^4He at low temperatures and in this regime may provide an alternative source for the unusual elastic phenomena observed in solid ^4He.
NASA Astrophysics Data System (ADS)
LeFevre, Scott W.; Bao, Zhenan; Ryu, Chang Y.; Siegel, Richard W.; Yang, Hoichang
2007-09-01
It has been shown that high charge mobility in solution-processible organic semiconductor-based field effect transistors is due in part to a highly parallel π-π stacking plane orientation of the semiconductors with respect to gate-dielectric. Fast solvent evaporation methods, generally, exacerbate kinetically random crystal orientations in the films deposited, specifically, from good solvents. We have investigated solubility-driven thin film structures of thiophene derivative polymers via spin- and drop-casting with volatile solvents of a low boiling point. Among volatile solvents examined, marginal solvents, which have temperature-dependent solubility for the semiconductors (e.g. methylene chloride for regioregular poly(3-alkylthiophene)s), can be used to direct the favorable crystal orientation regardless of solvent drying time, when the temperature of gate-dielectrics is held to relatively cooler than the warm solution. Grazing-incidence X-ray diffraction and atomic force microscopy strongly support that significant control of crystal orientation and mesoscale morphology using a "cold" substrate holds true for both drop and spin casting. The effects of physiochemical post-modificaiton on film crystal structures and morphologies of poly(9,9-dioctylfluorene-co-bithiophene) have also been investigated.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp
2007-07-01
The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less
Classification of Arctic, Mid-Latitude and Tropical Clouds in the Mixed-Phase Temperature Regime
NASA Astrophysics Data System (ADS)
Costa, Anja; Afchine, Armin; Luebke, Anna; Meyer, Jessica; Dorsey, James R.; Gallagher, Martin W.; Ehrlich, André; Wendisch, Manfred; Krämer, Martina
2016-04-01
The degree of glaciation and the sizes and habits of ice particles formed in mixed-phase clouds remain not fully understood. However, these properties define the mixed clouds' radiative impact on the Earth's climate and thus a correct representation of this cloud type in global climate models is of importance for an improved certainty of climate predictions. This study focuses on the occurrence and characteristics of two types of clouds in the mixed-phase temperature regime (238-275K): coexistence clouds (Coex), in which both liquid drops and ice crystals exist, and fully glaciated clouds that develop in the Wegener-Bergeron-Findeisen regime (WBF clouds). We present an extensive dataset obtained by the Cloud and Aerosol Particle Spectrometer NIXE-CAPS, covering Arctic, mid-latitude and tropical regions. In total, we spent 45.2 hours within clouds in the mixed-phase temperature regime during five field campaigns (Arctic: VERDI, 2012 and RACEPAC, 2014 - Northern Canada; mid-latitude: COALESC, 2011 - UK and ML-Cirrus, 2014 - central Europe; tropics: ACRIDICON, 2014 - Brazil). We show that WBF and Coex clouds can be identified via cloud particle size distributions. The classified datasets are used to analyse temperature dependences of both cloud types as well as range and frequencies of cloud particle concentrations and sizes. One result is that Coex clouds containing supercooled liquid drops are found down to temperatures of -40 deg C only in tropical mixed clouds, while in the Arctic and mid-latitudes no liquid drops are observed below about -20 deg C. In addition, we show that the cloud particles' aspherical fractions - derived from polarization signatures of particles with diameters between 20 and 50 micrometers - differ significantly between WBF and Coex clouds. In Coex clouds, the aspherical fraction of cloud particles is generally very low, but increases with decreasing temperature. In WBF clouds, where all cloud particles are ice, about 20-40% of the cloud particles are nevertheless classified as spherical for all temperatures, possibly indicating columnar ice crystals (see Järvinen et al, submitted to JAS 2016).
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-02-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.
Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho
2008-01-01
6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina
Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less
High density protein crystal growth
NASA Technical Reports Server (NTRS)
Rouleau, Robyn (Inventor); Hedden, Douglas Keith (Inventor); Delucas, Lawrence (Inventor)
2004-01-01
A protein crystal growth assembly including a crystal growth cell and further including a cell body having a top side and a bottom side and a first aperture defined therethrough, the cell body having opposing first and second sides and a second aperture defined therethrough. A cell barrel is disposed within the cell body, the cell barrel defining a cavity alignable with the first aperture of the cell body, the cell barrel being rotatable within the second aperture. A reservoir is coupled to the bottom side of the cell body and a cap having a top side is disposed on the top side of the cell body. The protein crystal growth assembly may be employed in methods including vapor diffusion crystallization, liquid to liquid crystallization, batch crystallization, and temperature induction batch mode crystallization.
Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA
2012-01-31
An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.
Crystallization of human estrogenic 17β-hydroxysteroid dehydrogenase under microgravity
NASA Astrophysics Data System (ADS)
Zhu, Dao-Wei; Zhou, Ming; Mao, Ying; Labrie, Fernand; Lin, Sheng-Xiang
1995-11-01
Human 17β-hydroxysteroid dehydrogenase has been crystallized on the ground in the complex form with NADP + and a complete data set of the crystal was primarily collected at 2.9 Å [D.-W. Zhu, X. Lee, R. Breton, D. Ghosh, W. Pangborn, W.L. Duax and S.-X. Lin, J. Mol. Biol. 234 (1993) 242]. To eliminate multiseeding, formation of multicrystals and to obtain higher quality crystals, we carried out the crystallization aboard the Russian MIR space station and crystals were recovered in January, 1994. Crystals of the enzyme were formed in 9 of the total 12 sitting drops in the space mission, in the presence of NADP + or estradiol. This is a first attempt of crystallization of a membrane-associated protein under microgravity in the presence of a detergent. The space experiments showed better results in nucleation number, crystal size and morphology than the ground ones, obtaining crystals diffracting to resolutions between 2.5-2.7 Å. The too early ground mixing has limited a more important improvement of the crystallization.
Time lapse microscopy of temperature control during self-assembly of 3D DNA crystals
NASA Astrophysics Data System (ADS)
Conn, Fiona W.; Jong, Michael Alexander; Tan, Andre; Tseng, Robert; Park, Eunice; Ohayon, Yoel P.; Sha, Ruojie; Mao, Chengde; Seeman, Nadrian C.
2017-10-01
DNA nanostructures are created by exploiting the high fidelity base-pairing interactions of double-stranded branched DNA molecules. These structures present a convenient medium for the self-assembly of macroscopic 3D crystals. In some self-assemblies in this system, crystals can be formed by lowering the temperature, and they can be dissolved by raising it. The ability to monitor the formation and melting of these crystals yields information that can be used to monitor crystal formation and growth. Here, we describe the development of an inexpensive tool that enables direct observation of the crystal growth process as a function of both time and temperature. Using the hanging-drop crystallization of the well-characterized 2-turn DNA tensegrity triangle motif for our model system, its response to temperature has been characterized visually.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao
Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.
2010-09-02
Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.
Protein crystal growth in a microgravity environment
NASA Technical Reports Server (NTRS)
Bugg, Charles E.
1988-01-01
Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.
Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N
1993-12-20
gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.
NASA Astrophysics Data System (ADS)
Harrington, J. Y.
2017-12-01
Parameterizing the growth of ice particles in numerical models is at an interesting cross-roads. Most parameterizations developed in the past, including some that I have developed, parse model ice into numerous categories based primarily on the growth mode of the particle. Models routinely possess smaller ice, snow crystals, aggregates, graupel, and hail. The snow and ice categories in some models are further split into subcategories to account for the various shapes of ice. There has been a relatively recent shift towards a new class of microphysical models that predict the properties of ice particles instead of using multiple categories and subcategories. Particle property models predict the physical characteristics of ice, such as aspect ratio, maximum dimension, effective density, rime density, effective area, and so forth. These models are attractive in the sense that particle characteristics evolve naturally in time and space without the need for numerous (and somewhat artificial) transitions among pre-defined classes. However, particle property models often require fundamental parameters that are typically derived from laboratory measurements. For instance, the evolution of particle shape during vapor depositional growth requires knowledge of the growth efficiencies for the various axis of the crystals, which in turn depends on surface parameters that can only be determined in the laboratory. The evolution of particle shapes and density during riming, aggregation, and melting require data on the redistribution of mass across a crystals axis as that crystal collects water drops, ice crystals, or melts. Predicting the evolution of particle properties based on laboratory-determined parameters has a substantial influence on the evolution of some cloud systems. Radiatively-driven cirrus clouds show a broader range of competition between heterogeneous nucleation and homogeneous freezing when ice crystal properties are predicted. Even strongly convective squall lines show a substantial influence to predicted particle properties: The more natural evolution of ice crystals during riming produces graupel-like particles with size and fall-speeds required for the formation of a classic transition zone and extended stratiform precipitation region.
Crystallization and crystallographic studies of kallistatin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com
2015-08-25
The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim
2005-06-01
Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.
Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru
2006-01-01
A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260
Jeffries, C D
1975-09-19
In Ge and Si, and also in Ge-Si alloys (74), there is extensive evidence for the stable binding of electrons and holes into a cold plasma of constant density, which undergoes a phase separation. Liquid metallic drops 1 to 300 microm in size are formed, with lifetimes ranging from 0.1 to 600 microsec. For Ge a surprising amount is known: the phase diagram, the surface energy, the work function, the decay kinetics. Much less is known for Si. There is good agreement between theoretical and experimental values of the liquid density, the critical density, the critical temperature, and the binding energy. The stability of the liquid phase is strikingly dependent on band structure. The multivalley structure and mass anisotropy of Si, Ge, and Ge-Si, together with their indirect band gap, are no doubt responsible for the observed stability in these crystals. In the similar semiconductor gallium phosphide, drops have not yet been observed, most likely because the high impurity content traps the excitons. In gallium arsenide the existence of drops is controversial (75). Undoubtedly drops will be found to exist in other semiconductors, perhaps at even higher temperatures. This is an exciting field for the experimentalist; new phenomena are being rapidly discovered, usually before they are predicted. For the theorist, the electron-hole drop is of high intrinsic interest. It represents the first example of a quantum liquid of constant density in a periodic crystal lattice. A number of challenging experimental and theoretical problems remain.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue
2005-12-01
Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less
On charging of snow particles in blizzard
NASA Technical Reports Server (NTRS)
Shio, Hisashi
1991-01-01
The causes of the charge polarity on the blizzard, which consisted of fractured snow crystals and ice particles, were investigated. As a result, the charging phenomena showed that the characteristics of the blizzard are as follows: (1) In the case of the blizzard with snowfall, the fractured snow particles drifting near the surface of snow field (lower area: height 0.3 m) had positive charge, while those drifting at higher area (height 2 m) from the surface of snow field had negative charge. However, during the series of blizzards two kinds of particles positively and negatively charged were collected in equal amounts in a Faraday Cage. It may be considered that snow crystals with electrically neutral properties were separated into two kinds of snow flakes (charged positively and negatively) by destruction of the snow crystals. (2) In the case of the blizzard which consisted of irregularly formed ice drops (generated by peeling off the hardened snow field), the charge polarity of these ice drops salting over the snow field was particularly controlled by the crystallographic characteristics of the surface of the snow field hardened by the powerful wind pressure.
Design of dual ring wavelength filters for WDM applications
NASA Astrophysics Data System (ADS)
Sathyadevaki, R.; Shanmuga sundar, D.; Sivanantha Raja, A.
2016-12-01
Wavelength division multiplexing plays a prime role in an optical communication due to its advantages such as easy network expansion, longer span lengths etc. In this work, photonic crystal based filters with the dual rings are proposed which act as band pass filters (BPF) and channel drop filter (CDF) that has found a massive applications in C and L-bands used for wavelength selection and noise filtering at erbium doped fiber amplifiers and dense wavelength division multiplexing operation. These filters are formulated on the square lattice with crystal rods of silicon material of refractive index 3.4 which are perforated on an air of refractive index 1. Dual ring double filters (band pass filter and channel drop filter) on single layout possess passing and dropping band of wavelengths in two distinct arrangements with entire band quality factors of 92.09523 & 505.263 and 124.85019 & 456.8633 for the pass and drop filters of initial setup and amended setup respectively. These filters have the high-quality factor with broad and narrow bandwidths of 16.8 nm & 3.04 nm and 12.85 nm & 3.3927 nm. Transmission spectra and band gap of the desired filters is analyzed using Optiwave software suite. Two dual ring filters incorporated on a single layout comprises the size of 15×11 μm which can also be used in the integrated photonic chips for the ultra-compact unification of devices.
Crystallization kinetics in Si-1 at%Sn during rapid solidification in undercooled melt
NASA Astrophysics Data System (ADS)
Kuribayashi, K.; Ozawa, S.; Nagayama, K.; Inatomi, Y.
2017-06-01
In order to elucidate the cause of the morphological transition of crystals growing in an undercooled melt of semiconducting materials, we carried out the containerless solidification of undoped Si and Si-1 at%Sn using a CO2 laser-equipped electromagnetic levitator (EML). The crystallization of these materials was successfully achieved under controlled undercooling. The relation between the shape of growing crystals and the degree of undercooling in Si-1 at%Sn was similar to that in undoped Si; that is, plate-like needle crystals were observed at low undercooling, whereas at medium and high undercooling the shape of growing crystals changed to massive dendrites. The grain-size of as-solidified samples of Si-1 at%Sn was remarkably small compared with that of undoped Si. The surface morphologies of samples solidified by dropping the melt onto a chill plate of mirror-polished silicon consisted of typical twin-related <110> dendrites. On the other hand, samples that were dropped from the undercooled state consisted of twin-free <100> dendrites. The nucleation rate of two-dimensional nuclei calculated on the basis of two mechanisms, which are the twin-plane re-entrant edge mechanism and the twin-free mechanism, suggested that the morphological transition to twin-free <100> dendrites from twin-related <110> dendrites occurs when the degree of undercooling becomes larger than the critical value. These results indicate that the cause of the morphological transition of Si growing in the undercooled melt is not the roughening transition of the crystal-melt interface but the transition of the nucleation kinetics to the twin-free mechanism from the twin-related mechanism.
Code of Federal Regulations, 2014 CFR
2014-04-01
... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... section. Beginning with the top sieve, lift and drop each sieve by its open edge three times. Each time...
Code of Federal Regulations, 2013 CFR
2013-04-01
... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... section. Beginning with the top sieve, lift and drop each sieve by its open edge three times. Each time...
A Bulk Microphysics Parameterization with Multiple Ice Precipitation Categories.
NASA Astrophysics Data System (ADS)
Straka, Jerry M.; Mansell, Edward R.
2005-04-01
A single-moment bulk microphysics scheme with multiple ice precipitation categories is described. It has 2 liquid hydrometeor categories (cloud droplets and rain) and 10 ice categories that are characterized by habit, size, and density—two ice crystal habits (column and plate), rimed cloud ice, snow (ice crystal aggregates), three categories of graupel with different densities and intercepts, frozen drops, small hail, and large hail. The concept of riming history is implemented for conversions among the graupel and frozen drops categories. The multiple precipitation ice categories allow a range of particle densities and fall velocities for simulating a variety of convective storms with minimal parameter tuning. The scheme is applied to two cases—an idealized continental multicell storm that demonstrates the ice precipitation process, and a small Florida maritime storm in which the warm rain process is important.
Corneal crystalline deposits associated with topically applied gatifloxacin.
Elia, Maxwell; Khodadadeh, Sarah; Chow, Jessica
2014-06-01
To report a case of corneal crystalline deposits from the use of gatifloxacin 0.5% topical antibiotic after combined cataract extraction and trabeculotomy ab interno surgery. A 59-year-old woman presented after combined cataract extraction and trabeculotomy ab interno with crystalline deposits in the anterior corneal stroma. Clinical examination and slit-lamp photography were performed. The slit-lamp examination showed inferior white crystal deposition in the anterior stroma with overlying punctate epithelial erosions 4 weeks postoperatively. The eye was asymptomatic, but the deposition was cosmetically noticeable to the patient. Serial slit-lamp photography demonstrated resolution of the crystalline deposits 30 days after the discontinuation of eye drops. The authors present a rare case of stromal crystallization from topical gatifloxacin treatment. Complete resolution of corneal deposits was seen 30 days after the discontinuation of the drops without sequelae.
NASA Astrophysics Data System (ADS)
Gauthier, Robert C.; Mnaymneh, Khaled
2005-09-01
The key feature that gives photonic crystals (PhCs) their ability to form photonic band gaps (PBGs) analogous to electronic band gaps of semiconductors is their translation symmetries. In recent years, however, it has been found that structures that possess only rotational symmetries can also have PBGs. In addition, these structures, known as Photonic Quasicrystals (PhQs), have other interesting qualities that set them apart of their translational cousins. One interesting feature is how defect states can be created in PhQs. If the rotational symmetry is disturbed, defect states analogous to defects states that are created in PhCs can be obtained. Simulation results of these defect states and other propagation properties of planar 12-fold photonic quasicrystal patterns, and its physical implementations in Silicon-On-Insulator (SOI) are presented. The main mechanisms required to make any optical multiplexing system is propagation; stop bands and add/drop ports. With the rotationally symmetry of the PhQ causing the stop bands, line defects facilitating propagation and now these specially design defect states acting as add/drop ports, a physical implementation of an OADM can be presented. Theoretical, practical and manufacturing benefits of PhQs are discussed. Simulated transmission plots are shown for various fill factors, dielectric contrast and propagation direction. It is shown that low index waveguides can be produced using the quasi-crystal photonic crystal pattern. Fabrication steps and results are shown.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kwon, Soo-Young; Kang, Beom Sik; Kim, Ghyung-Hwa
2007-11-01
PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. p-Hydroxybenzoate hydroxylase (PHBH) is an FAD-dependent monooxygenase that catalyzes the hydroxylation of p-hydroxybenzoate (pOHB) to 3,4-dihydroxybenzoate in an NADPH-dependent reaction and plays an important role in the biodegradation of aromatic compounds. PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collectedmore » to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystal belongs to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 94.72, c = 359.68 Å, γ = 120°. The asymmetric unit contains two molecules, corresponding to a packing density of 2.65 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie
2005-01-01
The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp
2007-07-01
To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less
Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N
2009-03-01
Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei
Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less
Code of Federal Regulations, 2011 CFR
2011-04-01
... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... and drop each sieve by its open edge three times. Each time, the open edge of the sieve is lifted the...
Code of Federal Regulations, 2012 CFR
2012-04-01
... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... and drop each sieve by its open edge three times. Each time, the open edge of the sieve is lifted the...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita
2008-04-01
Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)
Crystallization kinetics of GeTe phase-change thin films grown by pulsed laser deposition
NASA Astrophysics Data System (ADS)
Sun, Xinxing; Thelander, Erik; Gerlach, Jürgen W.; Decker, Ulrich; Rauschenbach, Bernd
2015-07-01
Pulsed laser deposition was employed to the growth of GeTe thin films on Silicon substrates. X-ray diffraction measurements reveal that the critical crystallization temperature lies between 220 and 240 °C. Differential scanning calorimetry was used to investigate the crystallization kinetics of the as-deposited films, determining the activation energy to be 3.14 eV. Optical reflectivity and in situ resistance measurements exhibited a high reflectivity contrast of ~21% and 3-4 orders of magnitude drop in resistivity of the films upon crystallization. The results show that pulsed laser deposited GeTe films can be a promising candidate for phase-change applications.
Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki
2005-01-01
To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi
2006-04-01
Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Chunmao; Yu, You; Yang, Maojun, E-mail: maojunyang@tsinghua.edu.cn
2015-10-23
Fhb is a surface virulence protein from Streptococcus suis, which could aid bacterial evasion of host innate immune defense by recruiting complement regulator factor H to inactivate C3b deposited on bacterial surface in blood. Here we successfully expressed and purified the N terminal domain of Fhb (N-Fhb) and obtained crystals of the N-Fhb by sitting-drop vapor diffusion method with a resolution of 1.50 Å. The crystals belong to space group C2 with unit cell parameters a = 127.1 Å, b = 77.3 Å, c = 131.6 Å, α = 90°, β = 115.9°, γ = 90°. The structure of N-Fhb was determined by SAD method and the core structure of N-Fhb is a β sandwich. Wemore » speculated that binding of Fhb to human factor H may be mainly mediated by surface amino acids with negative charges. - Highlights: • We expressed N-Fhb as the soluble protein in Escherichia coli. • Crystals of N-Fhb were grown by sitting drop vapor diffusion method. • Crystals of N-Fhb could diffracted to 1.5 Å. • The core structure of N-Fhb was a β sandwich. • A part of the surface of N-Fhb was rich with negative charges.« less
Three dimensional modeling of cirrus during the 1991 FIRE IFO 2: Detailed process study
NASA Technical Reports Server (NTRS)
Jensen, Eric J.; Toon, Owen B.; Westphal, Douglas L.
1993-01-01
A three-dimensional model of cirrus cloud formation and evolution, including microphysical, dynamical, and radiative processes, was used to simulate cirrus observed in the FIRE Phase 2 Cirrus field program (13 Nov. - 7 Dec. 1991). Sulfate aerosols, solution drops, ice crystals, and water vapor are all treated as interactive elements in the model. Ice crystal size distributions are fully resolved based on calculations of homogeneous freezing of solution drops, growth by water vapor deposition, evaporation, aggregation, and vertical transport. Visible and infrared radiative fluxes, and radiative heating rates are calculated using the two-stream algorithm described by Toon et al. Wind velocities, diffusion coefficients, and temperatures were taken from the MAPS analyses and the MM4 mesoscale model simulations. Within the model, moisture is transported and converted to liquid or vapor by the microphysical processes. The simulated cloud bulk and microphysical properties are shown in detail for the Nov. 26 and Dec. 5 case studies. Comparisons with lidar, radar, and in situ data are used to determine how well the simulations reproduced the observed cirrus. The roles played by various processes in the model are described in detail. The potential modes of nucleation are evaluated, and the importance of small-scale variations in temperature and humidity are discussed. The importance of competing ice crystal growth mechanisms (water vapor deposition and aggregation) are evaluated based on model simulations. Finally, the importance of ice crystal shape for crystal growth and vertical transport of ice are discussed.
X-ray Crystal Truncation Rod Studies of Surface Oxidation and Reduction on Pt(111)
Liu, Yihua; Barbour, Andi; Komanicky, Vladimir; ...
2016-02-26
Here, we present X-ray crystal truncation rods measurements of Pt(111) surface under electrochemical conditions. Analyses of crystal truncation rods reveal that surface oxide formation buckles the top surface layer of platinum to two different heights at the potential (0.95 V vs RHE) below the so-called place-exchange potential. While the anti-Bragg intensity, sensitive to the top surface layer, drops in response to the anodic charge transfers, its responses to the cathodic charge transfers are significantly delayed. Implications to the surface oxidation and reduction behaviors are discussed.
Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.
2010-11-12
Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.
Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J
2008-06-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.
New theoretical results for the Lehmann effect in cholesteric liquid crystals
NASA Technical Reports Server (NTRS)
Brand, Helmut R.; Pleiner, Harald
1988-01-01
The Lehmann effect arising in a cholesteric liquid crystal drop when a temperature gradient is applied parallel to its helical axis is investigated theoretically using a local approach. A pseudoscalar quantity is introduced to allow for cross couplings which are absent in nematic liquid crystals, and the statics and dissipative dynamics are analyzed in detail. It is shown that the Lehmann effect is purely dynamic for the case of an external electric field and purely static for an external density gradient, but includes both dynamic and static coupling contributions for the cases of external temperature or concentration gradients.
NASA Astrophysics Data System (ADS)
Derby, Brian
2010-08-01
Inkjet printing is viewed as a versatile manufacturing tool for applications in materials fabrication in addition to its traditional role in graphics output and marking. The unifying feature in all these applications is the dispensing and precise positioning of very small volumes of fluid (1-100 picoliters) on a substrate before transformation to a solid. The application of inkjet printing to the fabrication of structures for structural or functional materials applications requires an understanding as to how the physical processes that operate during inkjet printing interact with the properties of the fluid precursors used. Here we review the current state of understanding of the mechanisms of drop formation and how this defines the fluid properties that are required for a given liquid to be printable. The interactions between individual drops and the substrate as well as between adjacent drops are important in defining the resolution and accuracy of printed objects. Pattern resolution is limited by the extent to which a liquid drop spreads on a substrate and how spreading changes with the overlap of adjacent drops to form continuous features. There are clearly defined upper and lower bounds to the width of a printed continuous line, which can be defined in terms of materials and process variables. Finer-resolution features can be achieved through appropriate patterning and structuring of the substrate prior to printing, which is essential if polymeric semiconducting devices are to be fabricated. Low advancing and receding contact angles promote printed line stability but are also more prone to solute segregation or “coffee staining” on drying.
Wetting and Spreading of Molten Volcanic Ash in Jet Engines.
Song, Wenjia; Lavallée, Yan; Wadsworth, Fabian B; Hess, Kai-Uwe; Dingwell, Donald B
2017-04-20
A major hazard to jet engines posed by volcanic ash is linked to the wetting and spreading of molten ash droplets on engine component surfaces. Here, using the sessile drop method, we study the evolution of the wettability and spreading of volcanic ash. We employ rapid temperature changes up to 1040-1450 °C, to replicate the heating conditions experienced by volcanic ash entering an operating jet engine. In this scenario, samples densify as particles coalesce under surface tension until they form a large system-sized droplet (containing remnant gas bubbles and crystals), which subsequently spreads on the surface. The data exhibit a transition from a heterogeneous to a homogeneous wetting regime above 1315 °C as crystals in the drops are dissolved in the melt. We infer that both viscosity and microstructural evolution are key controls on the attainment of equilibrium in the wetting of molten volcanic ash droplets.
Spherical crystals of Pb 1 - xSn xTe grown in microgravity
NASA Astrophysics Data System (ADS)
Kinoshita, Kyoichi; Yamada, Tomoaki
1996-07-01
Pb 1- xSn xTe spherical crystals were unintentionally obtained along with a cylindrical Pb 1 - xSn xTe crystal grown during the {SL-J}/{FMPT} mission on board the space shuttle "Endeavor". About 25 spherical crystals ranged from 0.5 to 11 mm in diameter. Melt leaked from the melt reservoir into the spring that plays the role of pushing the melt toward a seed crystal and eliminating free surface areas of the melt. Because of the surface tension of the melt, spherical melt drops formed in the hollow of the spring, then solidified into spherical crystals during the cooling process. Some of the crystals had lower dislocation densities, in the order of 10 4 cm -2, two orders smaller than those of terrestrially grown crystals from a melt. The experiment showed a way of stably positioning a large volume of liquid in microgravity without touching the crucible wall and a way of reducing crystalline defects by such growth.
Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya
2010-01-01
A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161
Formulation and Solid State Characterization of Nicotinamide-based Co-crystals of Fenofibrate
Shewale, Sheetal; Shete, A. S.; Doijad, R. C.; Kadam, S. S.; Patil, V. A.; Yadav, A. V.
2015-01-01
The present investigation deals with formulation of nicotinamide-based co-crystals of fenofibrate by different methods and solid-state characterization of the prepared co-crystals. Fenofibrate and nicotinamide as a coformer in 1:1 molar ratio were used to formulate molecular complexes by kneading, solution crystallization, antisolvent addition and solvent drop grinding methods. The prepared molecular complexes were characterized by powder X-ray diffractometry, differential scanning calorimetry, Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and in vitro dissolution study. Considerable improvement in the dissolution rate of fenofibrate from optimized co-crystal formulation was due to an increased solubility that is attributed to the super saturation from the fine co-crystals is faster because of large specific surface area of small particles and prevention of phase transformation to pure fenofibrate. In vitro dissolution study showed that the formation of co-crystals improves the dissolution rate of fenofibrate. Nicotinamide forms the co-crystals with fenofibrate, theoretically and practically. PMID:26180279
Human serum albumin crystals and method of preparation
NASA Technical Reports Server (NTRS)
Carter, Daniel C. (Inventor)
1989-01-01
Human serum albumin (HSA) crystals are provided in the form of tetragonal plates having the space groups P42(sub 1)2, the crystals being grown to sizes in excess of 0.5 mm in two dimensions and a thickness of 0.1 mm. Growth of the crystals is carried out by a hanging drop method wherein a precipitant solution containing polyethylene glycol (PEG) and a phosphate buffer is mixed with an HSA solution, and a droplet of mixed solution is suspended over a well of precipitant solution. Crystals grow to the desired size in 3 to 7 days. Concentration of reagents, pH and other parameters are controlled within prescribed limits. The resulting crystals exhibit a size and quality such as to allow performance of x ray diffraction studies and enable the conduct of drug binding studies as well as genetic engineering studies.
NASA Astrophysics Data System (ADS)
Mikol, Vincent; Giegé, Richard
1989-09-01
A quick and miniature method has been devised for determining protein solubility and used to investigate the equilibrium solubility of concanavalin A from the Jack Bean with its crystals as a function of ammonium sulfate concentration, temperature and pH. The crystals were characterized by X-ray diffraction and their morphologies related to the corresponding solubilities. The protein solution concentration was estimated out of small crystallizing drops using a rapid and sensitive microassay. Measurements of protein quantity were carried out in 96-well microplates in an automatic spectrophotometer. The resulting phase diagram has permitted to analyse the solubility of concanavalin A, to estimate supersaturation and to devise readily new ways of crystal growth of this lectin, namely by pH and temperature variations. Moreover, the approach is proved to be a valuable tool to design crystallization experiments of new molecules and to improve and control protein crystal growth.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika
A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less
High-efficency stable 213-nm generation for LASIK application
NASA Astrophysics Data System (ADS)
Wang, Zhenglin; Alameh, Kamal; Zheng, Rong
2005-01-01
213nm Solid-state laser technology provides an alternative method to replace toxic excimer laser in LASIK system. In this paper, we report a compact fifth harmonic generation system to generate high pulse energy 213nm laser from Q-switched Nd:YAG laser for LASIK application based on three stages harmonic generation procedures. A novel crystal housing was specifically designed to hold the three crystals with each crystal has independent, precise angular adjustment structure and automatic tuning control. The crystal temperature is well maintained at ~130°C to improve harmonic generation stability and crystal operation lifetime. An output pulse energy 35mJ is obtained at 213nm, corresponding to total conversion efficiency ~10% from 1064nm pump laser. In system verification tests, the 213nm output power drops less than 5% after 5 millions pulse shots and no significant damage appears in the crystals.
Kim, Jaekyun; Kang, Jingu; Cho, Sangho; Yoo, Byungwook; Kim, Yong-Hoon; Park, Sung Kyu
2014-11-01
High-performance microrod single crystal organic transistors based on a p-type 2,7-dioctyl[1]benzothieno[3,2-b][1]benzothiophene (C8-BTBT) semiconductor are fabricated and the effects of grain boundaries on the carrier transport have been investigated. The spin-coating of C8-BTBT and subsequent solvent vapor annealing process enabled the formation of organic single crystals with high aspect ratio in the range of 10 - 20. It was found that the organic field-effect transistors (OFETs) based on these single crystals yield a field-effect mobility and an on/off current ratio of 8.04 cm2/Vs and > 10(5), respectively. However, single crystal OFETs with a kink, in which two single crystals are fused together, exhibited a noticeable drop of field-effect mobility, and we claim that this phenomenon results from the carrier scattering at the grain boundary.
Crystallization of Chicken Egg White Lysozyme from Assorted Sulfate Salts
NASA Technical Reports Server (NTRS)
Forsythe, Elizabeth L.; Snell, Edward H.; Malone, Christine C.; Pusey, Marc L.
1998-01-01
Chicken egg white lysozyme has been found to crystallize from ammonium, sodium, potassium, rubidium, magnesium, and manganese sulfates at acidic and basic pH, with protein concentrations from 60 to 190 mg/ml. Four different crystal morphologies have been obtained, depending upon the temperature, protein concentration, and precipitating salt employed, Crystals grown at 15 C were generally tetragonal, with space group P43212. Crystallization at 20 C typically resulted in the formation of orthorhombic crystals, space group P21212 1. The tetragonal much less than orthorhombic morphology transition appeared to be a function of both the temperature and protein concentration, occurring between 15 and 20 C and between 100 and 125 mg/ml protein concentration. Crystallization from 0.8 -1.2M magnesium sulfate at pH 7.6 - 8.0 gave a hexagonal (trigonal) crystal form, space group P3121, which diffracted to 2.8 A. Ammonium sulfate was also found to result in a monoclinic form, space group C2. Small twinned monoclinic crystals of approx. 0.2 mm on edge were grown by dialysis followed by seeded sitting drop crystallization.
Lapkouski, Mikalai; Hofbauerova, Katerina; Sovova, Zofie; Ettrichova, Olga; González-Pérez, Sergio; Dulebo, Alexander; Kaftan, David; Kuta Smatanova, Ivana; Revuelta, Jose L.; Arellano, Juan B.; Carey, Jannette; Ettrich, Rüdiger
2012-01-01
Raman microscopy permits structural analysis of protein crystals in situ in hanging drops, allowing for comparison with Raman measurements in solution. Nevertheless, the two methods sometimes reveal subtle differences in structure that are often ascribed to the water layer surrounding the protein. The novel method of drop-coating deposition Raman spectropscopy (DCDR) exploits an intermediate phase that, although nominally “dry,” has been shown to preserve protein structural features present in solution. The potential of this new approach to bridge the structural gap between proteins in solution and in crystals is explored here with extrinsic protein PsbP of photosystem II from Spinacia oleracea. In the high-resolution (1.98 Å) x-ray crystal structure of PsbP reported here, several segments of the protein chain are present but unresolved. Analysis of the three kinds of Raman spectra of PsbP suggests that most of the subtle differences can indeed be attributed to the water envelope, which is shown here to have a similar Raman intensity in glassy and crystal states. Using molecular dynamics simulations cross-validated by Raman solution data, two unresolved segments of the PsbP crystal structure were modeled as loops, and the amino terminus was inferred to contain an additional beta segment. The complete PsbP structure was compared with that of the PsbP-like protein CyanoP, which plays a more peripheral role in photosystem II function. The comparison suggests possible interaction surfaces of PsbP with higher-plant photosystem II. This work provides the first complete structural picture of this key protein, and it represents the first systematic comparison of Raman data from solution, glassy, and crystalline states of a protein. PMID:23071614
2008-08-04
can also be initiated mechanically to produce variable lenses [9-11]. Recent work shows lens properties of a controlled liquid drop shape, with no... liquid crystal spherical lens ," Appl. Phys. Lett. 84, 4789-4791 (2004). 3. H. W. Ren, D. W. Fox, B. Wu, and S. T. Wu, " Liquid crystal lens with large...and S. S. Lee, "Focal tunable liquid lens integrated with an electromagnetic actuator," Appl. Phys. Lett. 90, 121129 (2007). 10. H. W. Ren, D. Fox
Liquid crystal droplet formation and anchoring dynamics in a microfluidic device
NASA Astrophysics Data System (ADS)
Steinhaus, Ben; Shen, Amy; Feng, James; Link, Darren
2004-11-01
Liquid crystal drops dispersed in a continuous phase of silicon oil are generated with a narrow distribution in droplet size in microfluidic devices both above and below the nematic to isotropic transition temperature. For these two cases, we observe not only the different LC droplet generation and coalescence dynamics, but also distinct droplet morphology. Our experiments show that the nematic liquid crystalline order is important for the LC droplet formation and anchoring dynamics.
Dumetz, André C.; Snellinger-O'Brien, Ann M.; Kaler, Eric W.; Lenhoff, Abraham M.
2007-01-01
The second osmotic virial coefficients of seven proteins—ovalbumin, ribonuclease A, bovine serum albumin, α-lactalbumin, myoglobin, cytochrome c, and catalase—were measured in salt solutions. Comparison of the interaction trends in terms of the dimensionless second virial coefficient b2 shows that, at low salt concentrations, protein–protein interactions can be either attractive or repulsive, possibly due to the anisotropy of the protein charge distribution. At high salt concentrations, the behavior depends on the salt: In sodium chloride, protein interactions generally show little salt dependence up to very high salt concentrations, whereas in ammonium sulfate, proteins show a sharp drop in b2 with increasing salt concentration beyond a particular threshold. The experimental phase behavior of the proteins corroborates these observations in that precipitation always follows the drop in b2. When the proteins crystallize, they do so at slightly lower salt concentrations than seen for precipitation. The b2 measurements were extended to other salts for ovalbumin and catalase. The trends follow the Hofmeister series, and the effect of the salt can be interpreted as a water-mediated effect between the protein and salt molecules. The b2 trends quantify protein–protein interactions and provide some understanding of the corresponding phase behavior. The results explain both why ammonium sulfate is among the best crystallization agents, as well as some of the difficulties that can be encountered in protein crystallization. PMID:17766383
DOE Office of Scientific and Technical Information (OSTI.GOV)
Obiero, Josiah; Bonderoff, Sara A.; Goertzen, Meghan M.
2006-08-01
Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with amore » His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3{sub 2}21, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress.« less
Stability relationship for water droplet crystallization with the NASA Lewis icing spray
NASA Technical Reports Server (NTRS)
Marek, C. John; Bartlett, C. Scott
1987-01-01
In order to produce small droplets for icing cloud simulation, high pressure air atomizing nozzles are used. For certain icing testing applications, median drop sizes as small as 5 mm are needed, which require air atomizing pressures greater than 3000 kPa. Isentropic expansion of the ambient temperature atomizing air to atmospheric pressure can result in air stream temperatures of -160 C which results in ice crystals forming in the cloud. To avoid such low temperatures, it is necessary to heat the air and water to high initial temperatures. An icing spray research program was conducted to map the temperatures below which ice crystals form. A soot slide technique was used to determine the presence of crystals in the spray.
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-02-01
D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.
NASA Technical Reports Server (NTRS)
Singh, N. B.; Duval, W. M.
1991-01-01
Physical vapor transport processes were studied for the purpose of identifying the magnitude of convective effects on the crystal growth process. The effects of convection on crystal quality were were studied by varying the aspect ratio and those thermal conditions which ultimately affect thermal convection during physical vapor transport. An important outcome of the present study was the observation that the convection growth rate increased up to a certain value and then dropped to a constant value for high aspect ratios. This indicated that a very complex transport had occurred which could not be explained by linear stability theory. Better quality crystals grown at a low Rayleigh number confirmed that improved properties are possible in convectionless environments.
Enhanced Performance Consistency in Nanoparticle/TIPS Pentacene-Based Organic Thin Film Transistors
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Zhengran; Xiao, Kai; Durant, William Mark
2011-01-01
In this study, inorganic silica nanoparticles are used to manipulate the morphology of 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS pentacene) thin films and the performance of solution-processed organic thin-film transistors (OTFTs). This approach is taken to control crystal anisotropy, which is the origin of poor consistency in TIPS pentacene based OTFT devices. Thin film active layers are produced by drop-casting mixtures of SiO{sub 2} nanoparticles and TIPS pentacene. The resultant drop-cast films yield improved morphological uniformity at {approx}10% SiO{sub 2} loading, which also leads to a 3-fold increase in average mobility and nearly 4 times reduction in the ratio of measured mobility standard deviationmore » ({mu}{sub Stdev}) to average mobility ({mu}{sub Avg}). Grazing-incidence X-ray diffraction, scanning and transmission electron microscopy as well as polarized optical microscopy are used to investigate the nanoparticle-mediated TIPS pentacene crystallization. The experimental results suggest that the SiO{sub 2} nanoparticles mostly aggregate at TIPS pentacene grain boundaries, and 10% nanoparticle concentration effectively reduces the undesirable crystal misorientation without considerably compromising TIPS pentacene crystallinity.« less
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-08-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke
2007-01-01
Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368
Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.
Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B
1994-05-13
Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin
2013-04-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Xi; Blue Sky Technology Corporation, Beijing 100083; Ma, Hongwen, E-mail: mahw@cugb.edu.cn
Highlights: • We use the anti-drop precipitation method for synthesis of magnesium hydroxide. • Boron mud which is solid waste from a borax factory is used as the magnesium source. • The magnesium hydroxide nanoflowers are prepared in a short time. • The as-prepared magnesium hydroxide can be used as an effective flame retardant. - Abstract: Using boron mud as the starting material, the flower-like magnesium hydroxide (MH) has been successfully prepared via anti-drop precipitation method. The effect of NH{sub 3}·H{sub 2}O concentration, aging time, and surfactant on the morphology of MH was investigated. The optimum precipitation conditions are droppingmore » MgSO{sub 4} solution in 5% NH{sub 3}·H{sub 2}O solution, with 3% polyethylene glycol as surfactant, aging for 30 min. XRD, SEM, FI-IR, and TG/DTA have been employed to characterize the as-prepared samples. XRD reveals that MH with high purity has the brucite structure. SEM images show that the flower-like MH exists in the form of mono-disperse well uniform spherical aggregation with diameter of 3–5 μm. TG/DTA shows a total percentage of weight loss 33.6% with a well-defined endothermic peak near 381.3 °C corresponding to the decomposition of MH. Furthermore, it reports that the extremely fast primary nucleation is of significance for crystal growth of MH.« less
NASA Astrophysics Data System (ADS)
Taw, Matthew R.
The hardness and reduced modulus of aspirin, RDX, HMX, TATB, FOX-7, ADAAF, and TNT/CL-20 were experimentally measured with nanoindentation. These values are reported for the first time using as-received micron sized crystals of energetic materials with no additional mechanical processing. The results for TATB, ADAAF, and TNT/CL-20 are the first of their kind, while comparisons to previous nanoindentation studies on large, carefully grown single crystals of the other energetic materials show that mechanical properties of the larger crystals are comparable to crystals in the condition they are practically used. Measurements on aspirin demonstrate the variation that can occur between nanoindentation indents based on the orientation of a Berkovich tip relative to the surface of the sample. The Hertzian elastic contact model was used to analyze the materials initial yield, or pop-in, behavior. The length, energy, indentation load, and shear stress at initial yielding were used to characterize each material. For the energetic materials the length and energy of the yield excursions were compared to the drop weight sensitivity. This comparison revealed a general trend that more impact sensitive materials have longer, more severe pop-in excursions. Hot spot initiation mechanisms involving crystal defects such as void collapses and dislocation pile-up followed by avalanche are supported by these trends. While this only takes one aspect of impact sensitivity into consideration, if this trend is observed in a larger range of energetics these methods could possibly be used to great advantage in the early stages of new explosives synthesis to obtain an estimation of drop weight sensitivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi
2016-11-30
A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi
2016-11-30
A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less
Pechkova, E; Vasile, F; Spera, R; Fiordoro, S; Nicolini, C
2005-11-01
Protein nanocrystallography, a new technology for crystal growth based on protein nanotemplates, has recently been shown to produce diffracting, stable and radiation-resistant lysozyme crystals. This article, by computing these lysozyme crystals' atomic structures, obtained by the diffraction patterns of microfocused synchrotron radiation, provides a possible mechanism for this increased stability, namely a significant decrease in water content accompanied by a minor but significant alpha-helix increase. These data are shown to be compatible with the circular dichroism and two-dimensional Fourier transform spectra of high-resolution H NMR of proteins dissolved from the same nanotemplate-based crystal versus those from a classical crystal. Finally, evidence for protein direct transfer from the nanotemplate to the drop and the participation of the template proteins in crystal nucleation and growth is provided by high-resolution NMR spectrometry and mass spectrometry. Furthermore, the lysozyme nanotemplate appears stable up to 523 K, as confirmed by a thermal denaturation study using spectropolarimetry. The overall data suggest that heat-proof lysozyme presence in the crystal provides a possible explanation of the crystal's resistance to synchrotron radiation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajaj,M.; Moriyama, H.
2007-01-01
The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-03-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.
Two approaches to the rapid screening of crystallization conditions
NASA Technical Reports Server (NTRS)
Mcpherson, Alexander
1992-01-01
A screening procedure is described for estimating conditions under which crystallization will proceed, thus providing a starting point for more careful experiments. The initial procedure uses the experimental setup of McPherson (1982) which supports 24 individual hanging drop experiments for screening variables such as the precipitant type, the pH, the temperature, and the effects of certain additives and which uses about 1 mg of protein. A second approach is proposed (which is rather hypothetical at this stage and needs a larger sample), based on the isoelectric focusing of protein samples on concentration gradients of common precipitating agents. Using this approach, crystals of concanavalin B and canavalin were obtained.
Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.
2008-01-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065
ERIC Educational Resources Information Center
Ramette, R. W.
2007-01-01
The exocharmic reactions that can be observed microscopically are discussed. The students can discover the optimal concentration of an acidic lead nitrate solution, so that a crystal of potassium iodide, nudged to the edge of a drop, results in glinting golden hexagons of lead iodide.
Chemical analysis of acoustically levitated drops by Raman spectroscopy.
Tuckermann, Rudolf; Puskar, Ljiljana; Zavabeti, Mahta; Sekine, Ryo; McNaughton, Don
2009-07-01
An experimental apparatus combining Raman spectroscopy with acoustic levitation, Raman acoustic levitation spectroscopy (RALS), is investigated in the field of physical and chemical analytics. Whereas acoustic levitation enables the contactless handling of microsized samples, Raman spectroscopy offers the advantage of a noninvasive method without complex sample preparation. After carrying out some systematic tests to probe the sensitivity of the technique to drop size, shape, and position, RALS has been successfully applied in monitoring sample dilution and preconcentration, evaporation, crystallization, an acid-base reaction, and analytes in a surface-enhanced Raman spectroscopy colloidal suspension.
Device and method for screening crystallization conditions in solution crystal growth
NASA Technical Reports Server (NTRS)
Carter, Daniel C. (Inventor)
1995-01-01
A device and method for detecting optimum protein crystallization conditions and for growing protein crystals in either 1g or microgravity environments comprising a housing, defining at least one pair of chambers for containing crystallization solutions is presented. The housing further defines an orifice therein for providing fluid communication between the chambers. The orifice is adapted to receive a tube which contains a gelling substance for limiting the rate of diffusive mixing of the crystallization solutions. The solutions are diffusively mixed over a period of time defined by the quantity of gelling substance sufficient to achieve equilibration and to substantially reduce density driven convection disturbances therein. The device further includes endcaps to seal the first and second chambers. One of the endcaps includes a dialysis chamber which contains protein solution in which protein crystals are grown. Once the endcaps are in place, the protein solution is exposed to the crystallization solutions wherein the solubility of the protein solution is reduced at a rate responsive to the rate of diffusive mixing of the crystallization solutions. This allows for a controlled approach to supersaturation and allows for screening of crystal growth conditions at preselected intervals.
Device and Method for Screening Crystallization Conditions in Solution Crystal Growth
NASA Technical Reports Server (NTRS)
Carter, Daniel C. (Inventor)
1997-01-01
A device and method for detecting optimum protein crystallization conditions and for growing protein crystals in either 1 g or microgravity environments comprising a housing defining at least one pair of chambers for containing crystallization solutions. The housing further defines an orifice therein for providing fluid communication between the chambers. The orifice is adapted to receive a tube which contains a gelling substance for limiting the rate of diffusive mixing of the crystallization solutions. The solutions are diffusively mixed over a period of time defined by the quantity of gelling substance sufficient to achieve equilibration and to substantially reduce density driven convection disturbances therein. The device further includes endcaps to seal the first and second chambers. One of the endcaps includes a dialysis chamber which contains protein solution in which protein crystals are grown. Once the endcaps are in place. the protein solution is exposed to the crystallization solutions wherein the solubility of the protein solution is reduced at a rate responsive to the rate of diffusive mixing of the crystallization solutions. This allows for a controlled approach to supersaturation and allows for screening of crystal growth conditions at preselected intervals.
Lee, Jae Bong; Dos Santos, Salomé; Antonini, Carlo
2016-08-16
Understanding the interaction between liquids and deformable solid surfaces is a fascinating fundamental problem, in which interaction and coupling of capillary and viscoelastic effects, due to solid substrate deformation, give rise to complex wetting mechanisms. Here we investigated as a model case the behavior of water drops on two smooth bitumen substrates with different rheological properties, defined as hard and soft (with complex shear moduli in the order of 10(7) and 10(5) Pa, respectively, at 1 Hz), focusing both on wetting and on dewetting behavior. By means of classical quasi-static contact angle measurements and drop impact tests, we show that the water drop behavior can significantly change from the quasi-static to the dynamic regime on soft viscoelastic surfaces, with the transition being defined by the substrate rheological properties. As a result, we also show that on the hard substrate, where the elastic response is dominant under all investigated conditions, classical quasi-static contact angle measurements provide consistent results that can be used to predict the drop dynamic wetting behavior, such as drop deposition or rebound after impact, as typically observed for nondeformable substrates. Differently, on soft surfaces, the formation of wetting ridges did not allow to define uniquely the substrate intrinsic advancing and receding contact angles. In addition, despite showing a high adhesion to the soft surface in quasi-static measurements, the drop was surprisingly able to rebound and escape from the surface after impact, as it is typically observed for hydrophobic surfaces. These results highlight that measurements of wetting properties for viscoelastic substrates need to be critically used and that wetting behavior of a liquid on viscoelastic surfaces is a function of the characteristic time scales.
When a water drop freezes before it solidifies
NASA Astrophysics Data System (ADS)
Kavehpour, Pirouz; Davis, Stephen; Tavakoli, Faryar
2012-11-01
When a drop of liquid is placed on a substrate which temperature is below the melting point of the liquid, one would expect the drop to solidify instantaneously. However, many liquids, such as water, must be subcooled to solidify below its melting temperature due to homogeneous nucleation's high activation energy. Most of the drop solidification research, particularly for water, phase change is assumed to occur at equilibrium freezing temperature; however, this is not the case. We found that after a certain degree of supercooling, a kinetic based nucleation begins and latent heat of fusion is suddenly liberated, causing an increase in liquid temperature. At the end of this stage, approximately 20% of the drop is crystallized. This phenomenon is known among metallurgists as recalescence. This is followed by a slow solidification process at the melting point. As a water droplet spreads on a cold substrate, its contact line stops just prior to freezing inception from the liquid-solid interface. In this study, we assert that recalescence prior to solidification may be the cause of water's sudden immobility, which results in a fixed contact angle and droplet diameter. In our experiments, the nucleation front initiates from the trijunction point and propagates to the drop volume.
Tunable all-optical photonic crystal channel drop filter for DWDM systems
NASA Astrophysics Data System (ADS)
Habibiyan, H.; Ghafoori-Fard, H.; Rostami, A.
2009-06-01
In this paper we propose a tunable channel drop filter in a two-dimensional photonic crystal, based on coupled-cavity waveguides with alternating small and large defects and an electromagnetically induced transparency phenomenon. By utilizing this phenomenon a narrower linewidth is obtained and also the frequency of the dropped signal becomes tunable. Simulation results show that the proposed filter is suitable for dense wavelength-division multiplexing (DWDM) systems with 0.8 nm channel spacing. Using this novel component, two ultrasmall eight-channel double-sided and single-sided demultiplexers are introduced. The properties of these devices are investigated using the finite-difference time-domain method. For the single-sided device, transmission loss is 1.5 ± 0.5 dB, the cross-talk level between adjacent channels is better than -18 dB and the average 3 dB optical passband is 0.36 nm. Using planar silicon-on-insulator technology, the physical area for the single-sided component is 700 µm2 and for the double-sided component is 575 µm2. To the best of our knowledge, these are the smallest all-optical demultiplexers with this spectral resolution reported to date. Malfunction of the proposed device due to fabrication errors is modeled and its tunable characteristic is demonstrated.
Characterization of the Protein Crystal Growth Apparatus for Microgravity Aboard the Space Station
NASA Technical Reports Server (NTRS)
Kundrot, Craig E.; Roeber, D.; Achari, A.; Stinson, Thomas N. (Technical Monitor)
2002-01-01
We have conducted experiments to determine the equilibration rates of some major precipitants used in protein crystallography aboard the International Space Station (ISS). The solutions were placed in the Protein Crystallization Apparatus for Microgravity (PCAM) which mimic Cryschem sitting drop trays. The trays were placed in cylinders. These cylinders were placed inside a Single locker Thermal Enclosure System (STES), and were activated for different durations during the flight. Bumpers pressed against elastomers seal drops in a deactivated state during pre-flight and prior to transfer to the ISS. Activation occurs while in flight on the ISS by releasing the bumpers allowing the drops to be exposed to the reservoir. PCAM was flown to the ISS on STS 100, Flight 6A, on April 19, 2001. Six series of equilibration experiments were tested for each precipitant with a small amount of Green Fluorescent Protein (GFP). Cylinder 10 was never activated, 7 was activated for 40 days, 8 was activated for 20 days, 9 was activated for 10 days, 11 was activated for 4 days and 12 was activated for 2 days. Upon the return to Earth by STS 104 on July 24,2001 the samples were transferred to Marshall Space Flight Center. The samples were then brought to the lab and the volumes of each sample were measured.
Peascoe-Meisner, Roberta A [Knoxville, TN; Keiser, James R [Oak Ridge, TN; Hemric, James G [Knoxville, TN; Hubbard, Camden R [Oak Ridge, TN; Gorog, J Peter [Kent, WA; Gupta, Amul [Jamestown, NY
2008-10-21
A method includes containing a high-temperature alkali salt containing environment using a refractory containment liner containing MgAl.sub.2O.sub.4 spinel. A method, includes forming a refractory brick containing MgAl.sub.2O.sub.4 spinel having an exterior chill zone defined by substantially columnar crystallization and an interior zone defined by substantially equiaxed crystallization; and removing at least a portion of the exterior chill zone from the refractory brick containing MgAl.sub.2O.sub.4 spinel by scalping the refractory brick containing MgAl.sub.2O.sub.4 spinel to define at least one outer surface having an area of substantially equiaxed crystallization. A product of manufacture includes a refractory brick containing MgAl.sub.2O.sub.4 spinel including an interior zone defined by substantially equiaxed crystallization; and at least one outer surface having an area of substantially equiaxed crystallization.
Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi
2009-01-01
2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007
Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki
2007-01-01
BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa
The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.
Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro
2007-01-01
d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-psicose has not been reported with epimerases other than P. cichorii D-TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456
NASA Technical Reports Server (NTRS)
Kelton, K. F.; Croat, T. K.; Gangopadhyay, A.; Holland-Moritz, D.; Hyers, Robert W.; Rathz, Thomas J.; Robinson, Michael B.; Rogers, Jan R.
2001-01-01
Undercooling experiments and thermal physical property measurements of metallic alloys on the International Space Station (ISS) are planned. This recently-funded research focuses on fundamental issues of the formation and structure of highly-ordered non-crystallographic phases (quasicrystals) and related crystal phases (crystal approximants), and the connections between the atomic structures of these phases and those of liquids and glasses. It extends studies made previously by us of the composition dependence of crystal nucleation processes in silicate and metallic glasses, to the case of nucleation from the liquid phase. Motivating results from rf-levitation and drop-tube measurements of the undercooling of Ti/Zr-based liquids that form quasicrystals and crystal approximants are discussed. Preliminary measurements by electrostatic levitation (ESL) are presented.
Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase
Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo
2006-01-01
Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269
Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu
2004-01-01
We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-01-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737
Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru
2009-11-01
Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya
2007-11-01
A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less
In Situ μGISAXS: II. Thaumatin Crystal Growth Kinetic
Gebhardt, Ronald; Pechkova, Eugenia; Riekel, Christian; Nicolini, Claudio
2010-01-01
The formation of thaumatin crystals by Langmuir-Blodgett (LB) film nanotemplates was studied by the hanging-drop technique in a flow-through cell by synchrotron radiation micrograzing-incidence small-angle x-ray scattering. The kinetics of crystallization was measured directly on the interface of the LB film crystallization nanotemplate. The evolution of the micrograzing-incidence small-angle x-ray scattering patterns suggests that the increase in intensity in the Yoneda region is due to protein incorporation into the LB film. The intensity variation suggests several steps, which were modeled by system dynamics based on first-order differential equations. The kinetic data can be described by two processes that take place on the LB film, a first, fast, process, attributed to the crystal growth and its detachment from the LB film, and a second, slower process, attributed to an unordered association and conversion of protein on the LB film. PMID:20713011
Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S
2014-11-01
Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.
Crystallization of the Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae
Casutt, Marco S.; Wendelspiess, Severin; Steuber, Julia; Fritz, Günter
2010-01-01
The Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from the human pathogen Vibrio cholerae couples the exergonic oxidation of NADH by membrane-bound quinone to Na+ translocation across the membrane. Na+-NQR consists of six different subunits (NqrA–NqrF) and contains a [2Fe–2S] cluster, a noncovalently bound FAD, a noncovalently bound riboflavin, two covalently bound FMNs and potentially Q8 as cofactors. Initial crystallization of the entire Na+-NQR complex was achieved by the sitting-drop method using a nanolitre dispenser. Optimization of the crystallization conditions yielded flat yellow-coloured crystals with dimensions of up to 200 × 80 × 20 µm. The crystals diffracted to 4.0 Å resolution and belonged to space group P21, with unit-cell parameters a = 94, b = 146, c = 105 Å, α = γ = 90, β = 111°. PMID:21139223
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi
2006-12-01
UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less
Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin
2013-01-01
Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol
2006-10-01
CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less
Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.
Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L
2007-05-01
The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.
NASA Technical Reports Server (NTRS)
Achari, Aniruddha; Roeber, Dana F.; Barnes, Cindy L.; Kundrot, Craig E.; Stinson, Thomas N. (Technical Monitor)
2002-01-01
Protein Crystallization Apparatus in Microgravity (PCAM) trays have been used in Shuttle missions to crystallize proteins in a microgravity environment. The crystallization experiments are 'sitting drops' similar to that in Cryschem trays, but the reservoir solution is soaked in a wick. From early 2001, crystallization experiments are conducted on the International Space Station using mission durations of months rather than two weeks on previous shuttle missions. Experiments were set up in April 2001 on Flight 6A to characterize the time crystallization experiments will take to reach equilibrium in a microgravity environment using salts, polyethylene glycols and an organic solvent as precipitants. The experiments were set up to gather data for a series of days of activation with different droplet volumes and precipitants. The experimental set up on ISS and results of this study will be presented. These results will help future users of PCAM to choose precipitants to optimize crystallization conditions for their target macromolecules for a particular mission with known mission duration. Changes in crystal morphology and size between the ground and space grown crystals of a protein and a protein -DNA complex flown on the same mission will also be presented.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chaikuad, Apirat, E-mail: apirat.chaikuad@sgc.ox.ac.uk; Knapp, Stefan; Johann Wolfgang Goethe-University, Building N240 Room 3.03, Max-von-Laue-Strasse 9, 60438 Frankfurt am Main
An alternative strategy for PEG sampling is suggested through the use of four newly defined PEG smears to enhance chemical space in reduced screens with a benefit towards protein crystallization. The quest for an optimal limited set of effective crystallization conditions remains a challenge in macromolecular crystallography, an issue that is complicated by the large number of chemicals which have been deemed to be suitable for promoting crystal growth. The lack of rational approaches towards the selection of successful chemical space and representative combinations has led to significant overlapping conditions, which are currently present in a multitude of commercially availablemore » crystallization screens. Here, an alternative approach to the sampling of widely used PEG precipitants is suggested through the use of PEG smears, which are mixtures of different PEGs with a requirement of either neutral or cooperatively positive effects of each component on crystal growth. Four newly defined smears were classified by molecular-weight groups and enabled the preservation of specific properties related to different polymer sizes. These smears not only allowed a wide coverage of properties of these polymers, but also reduced PEG variables, enabling greater sampling of other parameters such as buffers and additives. The efficiency of the smear-based screens was evaluated on more than 220 diverse recombinant human proteins, which overall revealed a good initial crystallization success rate of nearly 50%. In addition, in several cases successful crystallizations were only obtained using PEG smears, while various commercial screens failed to yield crystals. The defined smears therefore offer an alternative approach towards PEG sampling, which will benefit the design of crystallization screens sampling a wide chemical space of this key precipitant.« less
Performance improvement for solution-processed high-mobility ZnO thin-film transistors
NASA Astrophysics Data System (ADS)
Sha Li, Chen; Li, Yu Ning; Wu, Yi Liang; Ong, Beng S.; Loutfy, Rafik O.
2008-06-01
The fabrication technology of stable, non-toxic, transparent, high performance zinc oxide (ZnO) thin-film semiconductors via the solution process was investigated. Two methods, which were, respectively, annealing a spin-coated precursor solution and annealing a drop-coated precursor solution, were compared. The prepared ZnO thin-film semiconductor transistors have well-controlled, preferential crystal orientation and exhibit superior field-effect performance characteristics. But the ZnO thin-film transistor (TFT) fabricated by annealing a drop-coated precursor solution has a distinctly elevated linear mobility, which further approaches the saturated mobility, compared with that fabricated by annealing a spin-coated precursor solution. The performance of the solution-processed ZnO TFT was further improved when substituting the spin-coating process by the drop-coating process.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jagadeesan, G.; Malathy, P.; Gunasekaran, K.
2014-10-25
The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika
2007-08-01
The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less
NASA Astrophysics Data System (ADS)
Ellmer, K.; Seeger, S.; Mientus, R.
2006-08-01
By rapid thermal crystallization of an amorphous WS3+x film, deposited by reactive magnetron sputtering at temperatures below 150 °C, layer-type semiconducting tungsten disulfide films (WS2) were grown. The rapid crystallization was monitored in real-time by in situ energy-dispersive X-ray diffraction. The films crystallize very fast (>40 nm/s), provided that a thin nickel film acts as nucleation seeds. Experiments on different substrates and the onset of the crystallization only at a temperature between 600 and 700 °C points to the decisive role of seeds for the textured growth of WS2, most probably liquid NiSx drops. The rapidly crystallized WS2 films exhibit a pronounced (001) texture with the van der Waals planes oriented parallel to the surface, leading to photoactive layers with a high hole mobility of about 80 cm2/Vs making such films suitable as absorbers for thin film solar cells.
Mikosch, Annabel; Kuehne, Alexander J C
2016-03-22
The spontaneous self-assembly of polymer colloids into ordered arrangements provides a facile strategy for the creation of photonic crystals. However, these structures often suffer from defects and insufficient cohesion, which result in flaking and delamination from the substrate. A coassembly process has been developed for convective assembly, resulting in large-area encapsulated colloidal crystals. However, to generate patterns or discrete deposits in designated places, convective assembly is not suitable. Here we experimentally develop conditions for direct-writing of coassembling monodisperse dye-doped polystyrene particles with a sol-gel precursor to form solid encapsulated photonic crystals. In a simple procedure the colloids are formulated in a sol-gel precursor solution, drop-cast on a flat substrate, and dried. We here establish the optimal parameters to form reproducible highly ordered photonic crystals with good optical performance. The obtained photonic crystals interact with light in the visible spectrum with a narrow optical stop-gap.
Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim
2006-01-01
Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jens, Jason; Raghunathan, Kannan; Vago, Frank
2010-01-12
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, H. L.; Shah, S. A. A.; Hao, Y. L.
It is well-known that the body centered cubic (bcc) crystal in titanium alloys reaches its stability limit as the electron-to-atom (e/a) ratio of the alloy drops down to ~4.24. This critical value, however, is much higher than that of a multifunctional bcc type alloy (e/a = 4.15). Here we demonstrate that a nano-scale concentration modulation created by spinodal decomposition is what stabilizes the bcc crystal of the alloy. Aided by such a nano-scale concentration heterogeneity, unexpected properties from its chemically homogeneous counterpart are obtained. This provides a new strategy to design functional titanium alloys by tuning the spinodal decomposition.
Koizumi, H; Uda, S; Fujiwara, K; Nozawa, J
2011-07-05
The effect of an external ac electric field on the nucleation rate of hen egg white lysozyme crystals increased with an increase in the concentration of the precipitant used, which enabled the design of an electric double layer (EDL) formed at the inner surface of the drop in the oil. This is attributed to the thickness of the EDL controlled by the ionic strength of the precipitant used. Control of the EDL formed at the interface between the two phases is important to establishing this novel technique for the crystallization of proteins under the application of an external ac electric field. © 2011 American Chemical Society
Polarized quantum dot emission in electrohydrodynamic jet printed photonic crystals
DOE Office of Scientific and Technical Information (OSTI.GOV)
See, Gloria G.; Xu, Lu; Nuzzo, Ralph G.
2015-08-03
Tailored optical output, such as color purity and efficient optical intensity, are critical considerations for displays, particularly in mobile applications. To this end, we demonstrate a replica molded photonic crystal structure with embedded quantum dots. Electrohydrodynamic jet printing is used to control the position of the quantum dots within the device structure. This results in significantly less waste of the quantum dot material than application through drop-casting or spin coating. In addition, the targeted placement of the quantum dots minimizes any emission outside of the resonant enhancement field, which enables an 8× output enhancement and highly polarized emission from themore » photonic crystal structure.« less
Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.
2005-01-01
This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108
laboratory studies on the uptake of organic compounds by ice crystals
NASA Astrophysics Data System (ADS)
Fries, E.; Jaeschke, W.
2003-04-01
Anthropogenic aerosols produced from biomass burning are known to increase the number of cloud condensation nuclei in the atmosphere at most latitudes. This reduces cloud droplet size, which prevents raindrop formation at shallower levels in the atmosphere. Vertical convection processes force particles and water vapor to rise up to the upper troposphere. At lower temperatures, ice crystals are formed via heterogeneous freezing of supercooled droplets containing particles known as ice nuclei (IN) and/or via condensation of supercooled water onto IN directly from the vapor, followed by freezing. Ice crystals grow by vapor deposition, by collision of supercooled drops with ice particles and by collision of ice crystals. The grown ice crystals melt on their way down and turn into rain. Most of the precipitation falling to the surface at midlatitudes originates as ice. The adsorption of organic gases emitted from fossil fuel combustion like BTEX may alter particle growth and sublimation rates in the atmosphere. This may also change precipitation rates, which impact the climate world-wide. Considering importance of ice in atmospheric science, laboratory studies are carried out to quantify organic vapor adsorption onto ice. At temperatures between 0 and -40^oC, organic gases at ppb gas levels are allowed to adsorb to the surface of ice crystals with surface properties similar to atmospheric ice. For the experiments, a vertical ice chamber (stainless-steel) with 10 different screen inserts (stainless-steel) was constructed. The chamber is 39 cm in length and 10,5 cm in diameter. The size of the stainless-steel mesh of the screens was chosen by the size of the ice crystals and is 0.14 cm. The ice chamber is located inside a 2x2 m walk-in cold chamber. Prior to the addition of the organic gases, the precleaned carrier gas of synthetic air is humidified to ice saturation in the walk-in cold chamber by passing the carrier stream through a 10 m long and 5 cm in diameter aluminum pipe. Resulting super cooled droplets are removed by stainless-steel-wool. The carrier gas is mixed outside the ice chamber in various proportions with a defined gas mixture of 60 different organic compounds. This mixture is allowed to flow through the ice chamber at defined pressures and temperatures. The concentrations of the compounds in the gas phase are determined at the inlet and the outlet of the ice chamber by a mobile GC (AirmoVoc1020). Additionally, the amount of adsorbed compounds is determined by a very sensitive method based on solid-phase-micro-extraction (SPME) followed by GC/FID. The resulting sorption coefficients for different gas concentrations are plotted vs the reciprocal of the absolute temperature for all substances. First results dealing with the adsorption properties of the investigated organic compounds.
Seemann, Ralf; Brinkmann, Martin; Pfohl, Thomas; Herminghaus, Stephan
2012-01-01
Droplet based microfluidics is a rapidly growing interdisciplinary field of research combining soft matter physics, biochemistry and microsystems engineering. Its applications range from fast analytical systems or the synthesis of advanced materials to protein crystallization and biological assays for living cells. Precise control of droplet volumes and reliable manipulation of individual droplets such as coalescence, mixing of their contents, and sorting in combination with fast analysis tools allow us to perform chemical reactions inside the droplets under defined conditions. In this paper, we will review available drop generation and manipulation techniques. The main focus of this review is not to be comprehensive and explain all techniques in great detail but to identify and shed light on similarities and underlying physical principles. Since geometry and wetting properties of the microfluidic channels are crucial factors for droplet generation, we also briefly describe typical device fabrication methods in droplet based microfluidics. Examples of applications and reaction schemes which rely on the discussed manipulation techniques are also presented, such as the fabrication of special materials and biophysical experiments.
NASA Astrophysics Data System (ADS)
Saha, Biswadeep
Rare-earth-free Fe-Ga magnetostrictive alloys exhibit an excellent combination of large low-field magnetostriction, strength, ductility, wide operating temperature range, and low cost. Various observations in these and other alpha-Fe-based magnetostrictive alloys suggest that lattice strain modulations that are influenced by solute elements, near neighbor atomic environments around Fe atoms, coherent and incoherent precipitates, and structural defects such as dislocations likely play an important role in their magnetostrictive behavior. In the first part, the effect of dislocations on the magnetostriction of Fe-Ga single crystals was examined. The [001]- and [126]-oriented Fe-20 at.% Ga single crystal samples were deformed in a controlled way to introduce dislocation arrays with two different array geometries. Magnetostriction values showed a much lower decrease after deformation for the case of a [001]-oriented crystal, where eight different slip systems were operative and consequently eight different sets of dislocation arrays are expected. A drastic drop in magnetostriction measured along the sample axis is observed in the sample subjected to a small strain by deformation of a [126]-oriented crystal during which slip occurred on only one slip system. The nature of strain modulation introduced in this case was spatially asymmetric. The [126] deformation was accompanied by an acoustic emission during the formation of slip band. Transmission electron microscopy was carried out to examine the nature of dislocation distribution. The results show that the nature of strain modulation introduced by the dislocation arrays has a strong influence on the magnetostrictive behavior of magnetostrictive alloys. In the second part of this research, the effect of Mo addition to Fe was examined in detail. Addition of Mo to Fe increased the magnetostriction (3/2)lambda100 Fe very rapidly to 137 ppm at 10 at.% Mo, the highest value observed in these alloys. Further Mo additions decreased the magnetostriction. Magnetization data show a drastic drop in magnetization to 63 emu/gm for Fe-20 at.% Mo from 176 emu/gm for Fe-10 at.% Mo suggesting the formation large amounts of nonmagnetic second phase and reduction in total Fe content of the alloy. The drop in magnetostriction at higher Mo contents is associated with the formation of a second phase.
Sagittal focusing Laue monochromator
Zhong,; Zhong, Hanson [Stony Brook, NY; Jonathan, Hastings [Wading River, NY; Jerome, Kao [Stanford, CA; Chi-Chang, Lenhard [Setauket, NY; Anthony, Siddons [Medford, NY; David Peter, Zhong [Cutchogue, NY; Hui, [Coram, NY
2009-03-24
An x-ray focusing device generally includes a slide pivotable about a pivot point defined at a forward end thereof, a rail unit fixed with respect to the pivotable slide, a forward crystal for focusing x-rays disposed at the forward end of the pivotable slide and a rearward crystal for focusing x-rays movably coupled to the pivotable slide and the fixed rail unit at a distance rearward from the forward crystal. The forward and rearward crystals define reciprocal angles of incidence with respect to the pivot point, wherein pivoting of the slide about the pivot point changes the incidence angles of the forward and rearward crystals while simultaneously changing the distance between the forward and rearward crystals.
Theoretical and experimental morphologies of 4-aminobenzophenone (ABP) crystals
NASA Astrophysics Data System (ADS)
Wang, Qingwu; Sheen, D. B.; Shepherd, E. E. A.; Sherwood, J. N.; Simpson, G. S.; Hammond, R. B.
1997-11-01
The lattice energy (Elatt), slice energies (Eslice) and attachment energies (Eatt) of the different habit faces of ABP crystals have been calculated using the computer program HABIT. On the basis of the attachment energies of different crystal faces, the morphology was defined as {1 0 0}, {0 0 1}, {1 1 0}, {11bar0} and {1 01bar}. To confirm this theoretical prediction, we have grown ABP films and ABP crystals from the vapour phase. In both cases, the morphologically most important face was defined as {1 0 0} face using X-ray diffraction techniques. The remaining faces of the vapour-grown crystals were defined using a projection method, while the crystallites in the films were morphologically analysed by means of atomic force microscopy (AFM). The experimental morphologies are basically in agreement with the computation. Deviations from the equilibrium morphology can be ascribed to departure from equilibrium conditions during growth. For completeness, the results are compared with those for crystals grown from solutions for which deviations in morphology from the theoretical predictions can be ascribed to interaction between the crystal faces and solvent molecules.
Protein Crystal Movements and Fluid Flows During Microgravity Growth
NASA Technical Reports Server (NTRS)
Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;
1998-01-01
The growth of protein crystals suitable for x-ray crystal structure analysis is an important topic. The quality (perfection) of protein crystals is now being evaluated by mosaicity analysis (rocking curves) and x-ray topographic images as well as the diffraction resolution limit and overall data quality. In yet another study, use of hanging drop vapour diffusion geometry on the IML-2 shuttle mission showed, again via CCD video monitoring, growing apocrustacyanin C(sub 1) protein crystal executing near cyclic movement, reminiscent of Marangoni convection flow of fluid, the crystals serving as "markers" of the fluid flow. A review is given here of existing results and experience over several microgravity missions. Some comment is given on gel protein crystal growth in attempts to 'mimic' the benefits of microgravity on Earth. Finally, the recent new results from our experiments on the shuttle mission LMS are described. These results include CCD video as well as interferometry during the mission, followed, on return to Earth, by reciprocal space mapping at the NSLS, Brookhaven, and full X-ray data collection on LMS and Earth control lysozyme crystals. Diffraction data recorded from LMS and ground control apocrustacyanin C(sub 1) crystals are also described.
Electrowetting on semiconductors
NASA Astrophysics Data System (ADS)
Palma, Cesar; Deegan, Robert
2015-01-01
Applying a voltage difference between a conductor and a sessile droplet sitting on a thin dielectric film separating it from the conductor will cause the drop to spread. When the conductor is a good metal, the change of the drop's contact angle due to the voltage is given by the Young-Lippmann (YL) equation. Here, we report experiments with lightly doped, single crystal silicon as the conductive electrode. We derive a modified YL equation that includes effects due to the semiconductor and contact line pinning. We show that light induces a non-reversible wetting transition, and that our model agrees well with our experimental results.
Delta L: An Apparatus for Measuring Macromolecular Crystal Growth Rates in Microgravity
NASA Technical Reports Server (NTRS)
Judge, Russell A.; Whitaker, Ann F. (Technical Monitor)
2001-01-01
In order to determine how macromolecule crystal quality improvement in microgravity is related to crystal growth characteristics, is was necessary to develop new hardware that could measure the crystal growth rates of a population of crystals growing under the same solution conditions. As crystal growth rate is defined as the change or delta in a defined dimension or length (L) of a crystal over time, the hardware was named Delta L. Delta L consists of fluids, optics, and data acquisition, sub-assemblies. Temperature control is provided for the crystal growth chamber. Delta L will be used in connection with the Glovebox Integrated Microgravity Isolation Technology (g-LIMIT) inside the Microgravity Science Glovebox (MSG), onboard the International Space Station (ISS). Delta L prototype hardware has been assembled. This paper will describe an overview of the design of Delta L and present preliminary crystal growth rate data.
Investigating a Drop-on-Demand Microdispenser for Standardized Sample Preparation
2012-09-01
Demand Microdispenser for Standardized Sample Preparation Ellen L. Holthoff, Mikella E. Farrell, and Paul M. Pellegrino Sensors and Electron Devices...instrument. The use of a gravimetric method, such as a quartz crystal microbalance4 ( QCM ) or a sensitive microbalance as discussed in this report, is
76 FR 16417 - Product Cancellation Order for Certain Pesticide Registrations
Federal Register 2010, 2011, 2012, 2013, 2014
2011-03-23
...) Regulatory Public Docket in Rm. S- 4400, One Potomac Yard (South Bldg.), 2777 S. Crystal Dr., Arlington, VA... Shot Phenothrin Wasp & Hornet Tetramethrin Spray. 013283-00013 Rainbow Wasp & Ant Bioallethrin Spray... Neopynamim Tetramethrin Technical. 073510-00008 Marketquest One Permethrin Drop Flea & Tick Control-2. 082498...
Invited review liquid crystal models of biological materials and silk spinning.
Rey, Alejandro D; Herrera-Valencia, Edtson E
2012-06-01
A review of thermodynamic, materials science, and rheological liquid crystal models is presented and applied to a wide range of biological liquid crystals, including helicoidal plywoods, biopolymer solutions, and in vivo liquid crystals. The distinguishing characteristics of liquid crystals (self-assembly, packing, defects, functionalities, processability) are discussed in relation to biological materials and the strong correspondence between different synthetic and biological materials is established. Biological polymer processing based on liquid crystalline precursors includes viscoelastic flow to form and shape fibers. Viscoelastic models for nematic and chiral nematics are reviewed and discussed in terms of key parameters that facilitate understanding and quantitative information from optical textures and rheometers. It is shown that viscoelastic modeling the silk spinning process using liquid crystal theories sheds light on textural transitions in the duct of spiders and silk worms as well as on tactoidal drops and interfacial structures. The range and consistency of the predictions demonstrates that the use of mesoscopic liquid crystal models is another tool to develop the science and biomimetic applications of mesogenic biological soft matter. Copyright © 2011 Wiley Periodicals, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying
2008-04-01
A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid
2006-12-01
The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less
Motion of Deformable Drops Through Porous Media
NASA Astrophysics Data System (ADS)
Zinchenko, Alexander Z.; Davis, Robert H.
2017-01-01
This review describes recent progress in the fundamental understanding of deformable drop motion through porous media with well-defined microstructures, through rigorous first-principles hydrodynamical simulations and experiments. Tight squeezing conditions, when the drops are much larger than the pore throats, are particularly challenging numerically, as the drops nearly coat the porous material skeleton with small surface clearance, requiring very high surface resolution in the algorithms. Small-scale prototype problems for flow-induced drop motion through round capillaries and three-dimensional (3D) constrictions between solid particles, and for gravity-induced squeezing through round orifices and 3D constrictions, show how forcing above critical conditions is needed to overcome trapping. Scaling laws for the squeezing time are suggested. Large-scale multidrop/multiparticle simulations for emulsion flow through a random granular material with multiple drop breakup show that the drop phase generally moves faster than the carrier fluid; both phase velocities equilibrate much faster to the statistical steady state than does the drop-size distribution.
Chinese Manned Space Utility Project
NASA Astrophysics Data System (ADS)
Gu, Y.
Since 1992 China has been carrying out a conspicuous manned space mission A utility project has been defined and created during the same period The Utility Project of the Chinese Manned Space Mission involves wide science areas such as earth observation life science micro-gravity fluid physics and material science astronomy space environment etc In the earth observation area it is focused on the changes of global environments and relevant exploration technologies A Middle Revolution Image Spectrometer and a Multi-model Micro-wave Remote Sensor have been developed The detectors for cirrostratus distribution solar constant earth emission budget earth-atmosphere ultra-violet spectrum and flux have been manufactured and tested All of above equipment was engaged in orbital experiments on-board the Shenzhou series spacecrafts Space life science biotechnologies and micro-gravity science were much concerned with the project A series of experiments has been made both in ground laboratories and spacecraft capsules The environmental effect in different biological bodies in space protein crystallization electrical cell-fusion animal cells cultural research on separation by using free-low electrophoresis a liquid drop Marangoni migration experiment under micro-gravity as well as a set of crystal growth and metal processing was successfully operated in space The Gamma-ray burst and high-energy emission from solar flares have been explored A set of particle detectors and a mass spectrometer measured
On the Fringe Field of Wide Angle LC Optical Phased Array
NASA Technical Reports Server (NTRS)
Wang, Xighua; Wang, Bin; Bos, Philip J.; Anderson, James E.; Pouch, John; Miranda, Felix; McManamon, Paul F.
2004-01-01
For free space laser communication, light weighted large deployable optics is a critical component for the transmitter. However, such an optical element will introduce large aberrations due to the fact that the surface figure of the large optics is susceptable to deformation in the space environment. We propose to use a high-resolution liquid crystal spatial light modulator to correct for wavefront aberrations introduced by the primary optical element, and to achieve very fine beam steering and shaping at the same time. A 2-D optical phased array (OPA) antenna based on a Liquid Crystal on Silicon (LCOS) spatial light modulator is described. This device offers a combination of low cost, high resolution, high accuracy, high diffraction efficiency at video speed. To quantitatively understand the influence factor of the different design parameters, a computer simulation of the device is given by the 2-D director simulation and the Finite Difference Time domain (FDTD) simulation. For the 1-D OPA, we define the maximum steering angle to have a grating period of 8 pixel/reset scheme; as for larger steering angles than this criterion, the diffraction efficiency drops dramatically. In this case, the diffraction efficiency of 0.86 and the Strehl ratio of 0.9 are obtained in the simulation. The performance of the device in achieving high resolution wavefront correction and beam steering is also characterized experimentally.
Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S
2003-10-01
Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.
Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui
2013-01-01
(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567
Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J
2014-06-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.
Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.
2014-01-01
LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099
Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui
2013-10-01
(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.
Barclay, Paul; Srinivasan, Kartik; Painter, Oskar
2005-02-07
A technique is demonstrated which efficiently transfers light between a tapered standard single-mode optical fiber and a high-Q, ultra-small mode volume, silicon photonic crystal resonant cavity. Cavity mode quality factors of 4.7x10(4) are measured, and a total fiber-to-cavity coupling efficiency of 44% is demonstrated. Using this efficient cavity input and output channel, the steady-state nonlinear absorption and dispersion of the photonic crystal cavity is studied. Optical bistability is observed for fiber input powers as low as 250 microW, corresponding to a dropped power of 100 microW and 3 fJ of stored cavity energy. A high-density effective free-carrier lifetime for these silicon photonic crystal resonators of ~ 0.5 ns is also estimated from power dependent loss and dispersion measurements.
Crystal structure and optical properties of silver nanorings
NASA Astrophysics Data System (ADS)
Zhou, Li; Fu, Xiao-Feng; Yu, Liao; Zhang, Xian; Yu, Xue-Feng; Hao, Zhong-Hua
2009-04-01
We report the polyol synthesis and crystal structure characterization of silver nanorings, which have perfect circular shape, smooth surface, and elliptical wire cross-section. The characterization results show that the silver nanorings have well-defined crystal of singly twinned along the whole ring. The spatial distribution of the scattering of a silver nanoring with slanted incidence reveals the unique focus effect of the nanoring, and the focus scattering varies with the incident wavelength. The silver nanorings with perfect geometry and well-defined crystal have potential applications in nanoscaled photonics, plasmonic devices, and optical manipulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cuttitta, Christina M.; Ericson, Daniel L.; Scalia, Alexander
Acoustic droplet ejection (ADE) is an emerging technology with broad applications in serial crystallography such as growing, improving and manipulating protein crystals. One application of this technology is to gently transfer crystals onto MiTeGen micromeshes with minimal solvent. Once mounted on a micromesh, each crystal can be combined with different chemicals such as crystal-improving additives or a fragment library. Acoustic crystal mounting is fast (2.33 transfers s -1) and all transfers occur in a sealed environment that is in vapor equilibrium with the mother liquor. Here, a system is presented to retain crystals near the ejection point and away frommore » the inaccessible dead volume at the bottom of the well by placing the crystals on a concave agarose pedestal (CAP) with the same chemical composition as the crystal mother liquor. The bowl-shaped CAP is impenetrable to crystals. Consequently, gravity will gently move the crystals into the optimal location for acoustic ejection. It is demonstrated that an agarose pedestal of this type is compatible with most commercially available crystallization conditions and that protein crystals are readily transferred from the agarose pedestal onto micromeshes with no loss in diffraction quality. It is also shown that crystals can be grown directly on CAPs, which avoids the need to transfer the crystals from the hanging drop to a CAP. This technology has been used to combine thermolysin and lysozyme crystals with an assortment of anomalously scattering heavy atoms. The results point towards a fast nanolitre method for crystal mounting and high-throughput screening.« less
An evaluation of adhesive sample holders for advanced crystallographic experiments
Mazzorana, Marco; Sanchez-Weatherby, Juan; Sandy, James; Lobley, Carina M. C.; Sorensen, Thomas
2014-01-01
The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposing it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed. PMID:25195752
Pucci, Carlotta; Cousin, Fabrice; Dole, François; Chapel, Jean-Paul; Schatz, Christophe
2018-02-20
The formulation pathway and/or the mixing method are known to be relevant in many out-of-equilibrium processes. In this work, we studied the effect of the mixing conditions on the physicochemical properties of poly-ε-caprolactone (PCL) particles prepared by solvent displacement. More specifically, water was added in one shot (fast addition) or drop by drop to PCL solution in tetrahydrofuran (THF) to study the impact of the mixing process on particle properties including size, stability, and crystallinity. Two distinct composition maps representing the Ouzo domain characteristic of the presence of metastable nanoparticles have been established for each mixing method. Polymer nanoparticles are formed in the Ouzo domain according to a nucleation and growth (or aggregation) mechanism. The fast addition promotes a larger nucleation rate, thus favoring the formation of small and uniform particles. For the drop-by-drop addition, for which the polymer solubility gradually decreases, the composition trajectories systematically cross an intermediate unstable region between the solubility limit of the polymer and the Ouzo domain. This leads to heterogeneous nucleation as shown by the formation of larger and less stable particles. Particles formed in the Ouzo domain have semi-crystalline properties. The PCL melting point is decreased with the THF fraction trapped in particles in accordance with Flory's theory for melt crystallization. On the other hand, the degree of crystallinity is constant, around 20% regardless of the THF fraction. No difference between fast and slow addition could be detected on the semi-crystalline properties of the particles which emphasize that thermodynamic rather than kinetic factors drive the polymer crystallization in particles. The recovery of bulk PCL crystallinity after the removal of THF from particles tends to confirm this hypothesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko
2007-11-01
The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less
Hackney, James M; Clay, Rachel L; James, Meredith
2016-10-01
We measured ground reaction force and lower extremity shortening in ten healthy, young adults in order to compare five trials of drop jumps to drop landings. Our dependent variable was the percentage of displacement (shortening) between the markers on the ASIS and second metatarsal heads on each LE, relative to the maximum shortening (100% displacement) for that trial at the point of greatest ground reaction force. We defined this as "percent displacement at maximum force" (%dFmax). The sample mean %dFmax was 0.73%±0.14% for the drop jumps, and 0.47%±0.09% for the drop landings. The mean within-subject difference score was 0.26%±0.20%. Two-tailed paired t test comparing %dFmax between the drop jump and drop landing yielded P=0.002. For all participants in this study, the %dFmax was greater in drop jumps than in drop landings. This indicates that in drop jumps, the point of maximum force and of maximum shortening was nearly simultaneous, compared to drop landings, where the point of maximum shortening followed that of maximum force by a greater proportion. This difference in force to displacement behavior is explained by linear spring behavior in drop jumps, and linear damping behavior in drop landings. Copyright © 2016 Elsevier B.V. All rights reserved.
Expression and X-Ray Structural Determination of the Nucleoprotein of Lassa Fever Virus.
Qi, Xiaoxuan; Wang, Wenjian; Dong, Haohao; Liang, Yuying; Dong, Changjiang; Ly, Hinh
2018-01-01
We describe methods to express the nucleoprotein (NP) of Lassa fever virus (LASV) in E. coli, to purify and crystallize it using the sitting-drop vapor diffusion method. The crystals were screened using Rigaku micro-007 X-ray generator and a dataset was collected at a resolution of 2.36 Å. The crystals belong to space group P3, with the unit cell parameters a = b = 176.35 Å, c = 56.40 Å, α = β = 90°, and γ = 120°. Using the X-ray diffraction method, we constructed a three-dimensional structure of the LASV NP that should aid in the development of novel therapeutic strategies against this virus, for which vaccine and effective treatment modalities are currently unavailable.
Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.
2013-01-01
Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835
DOE Office of Scientific and Technical Information (OSTI.GOV)
Raghunathan, Kannan; Vago, Frank S.; Ball, Terry
2010-01-12
EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder
2006-01-01
Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268
Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG
Jens, Jason; Raghunathan, Kannan; Vago, Frank; Arvidson, Dennis
2009-01-01
EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 Å and belonged to space group P21, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 Å. PMID:19478449
dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor
2013-01-01
Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585
DOE Office of Scientific and Technical Information (OSTI.GOV)
Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk
In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin
2006-02-01
Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less
Ferguson, A D; Breed, J; Diederichs, K; Welte, W; Coulton, J W
1998-07-01
FhuA (Mr 78,992, 714 amino acids), siderophore receptor for ferrichrome-iron in the outer membrane of Escherichia coli, was affinity tagged, rapidly purified, and crystallized. To obtain FhuA in quantities sufficient for crystallization, a hexahistidine tag was genetically inserted into the fhuA gene after amino acid 405, which resides in a known surface-exposed loop. Recombinant FhuA405.H6 was overexpressed in an E. coli strain that is devoid of several major porins and using metal-chelate chromatography was purified in large amounts to homogeneity. FhuA crystals were grown using the hanging drop vapor diffusion technique and were suitable for X-ray diffraction analysis. On a rotating anode X-ray source, diffraction was observed to 3.0 A resolution. The crystals belong to space group P6(1) or P6(5) with unit cell dimensions of a=b=174 A, c=88 A (alpha=beta=90 degrees, gamma=120 degrees).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.
2007-09-01
The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu
2008-07-01
The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan
2005-11-01
The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir
The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano
The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less
Micro-valve pump light valve display
Yeechun Lee.
1993-01-19
A flat panel display incorporates a plurality of micro-pump light valves (MLV's) to form pixels for recreating an image. Each MLV consists of a dielectric drop sandwiched between substrates, at least one of which is transparent, a holding electrode for maintaining the drop outside a viewing area, and a switching electrode from accelerating the drop from a location within the holding electrode to a location within the viewing area. The sustrates may further define non-wetting surface areas to create potential energy barriers to assist in controlling movement of the drop. The forces acting on the drop are quadratic in nature to provide a nonlinear response for increased image contrast. A crossed electrode structure can be used to activate the pixels whereby a large flat panel display is formed without active driver components at each pixel.
Micro-valve pump light valve display
Lee, Yee-Chun
1993-01-01
A flat panel display incorporates a plurality of micro-pump light valves (MLV's) to form pixels for recreating an image. Each MLV consists of a dielectric drop sandwiched between substrates, at least one of which is transparent, a holding electrode for maintaining the drop outside a viewing area, and a switching electrode from accelerating the drop from a location within the holding electrode to a location within the viewing area. The sustrates may further define non-wetting surface areas to create potential energy barriers to assist in controlling movement of the drop. The forces acting on the drop are quadratic in nature to provide a nonlinear response for increased image contrast. A crossed electrode structure can be used to activate the pixels whereby a large flat panel display is formed without active driver components at each pixel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.
2007-07-01
P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen
2006-10-01
Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng
2008-01-01
SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan
2006-06-01
Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-01-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733
Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi
2009-11-01
RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.
Bi, Sheng; He, Zhengran; Chen, Jihua; ...
2015-07-24
Drop casting of small-molecule organic semiconductors typically forms crystals with random orientation and poor areal coverage, which leads to significant performance variations of organic thin-film transistors (OTFTs). In this study, we utilize the controlled evaporative self-assembly (CESA) method combined with binary solvent system to control the crystal growth. A small-molecule organic semiconductor,2,5-Di-(2-ethylhexyl)-3,6-bis(5"-n-hexyl-2,2',5',2"]terthiophen-5-yl)-pyrrolo[3,4-c]pyrrole-1,4-dione (SMDPPEH), is used as an example to demonstrate the effectiveness of our approach. By optimizing the double solvent ratios, well-aligned SMDPPEH crystals with significantly improved areal coverage were achieved. As a result, the SMDPPEH based OTFTs exhibit a mobility of 1.6 × 10 -2 cm 2/V s, whichmore » is the highest mobility from SMDPPEH ever reported.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei
2007-07-01
An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168
2008-02-01
The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny
2006-01-01
Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo
2006-05-01
The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less
Chen, Yu Wai; Tajima, Toshitaka; Rees, Martin; Garcia-Maya, Mitla
2009-09-01
Human homologue A of Rad23 (hHR23A) plays dual roles in DNA repair as well as serving as a shuttle vehicle targeting polyubiquitinated proteins for degradation. Its N-terminal ubiquitin-like (UbL) domain interacts with the 19S proteasomal cap and provides the docking mechanism for protein delivery. Pyramidal crystals of the UbL domain of hHR23A were obtained by the hanging-drop vapour-diffusion method with ammonium sulfate as the crystallizing agent. The crystals diffracted to beyond 2 A resolution and belonged to the hexagonal space group P6(5)22, with unit-cell parameters a = b = 78.48, c = 63.57 A. The structure was solved by molecular replacement using the UbL domain of yeast Dsk2 as the search model.
Genetic interaction of the fusiform rust fungus with resistance gene FR1 in loblolly pine
Thomas L. Kubisiak; Henry V. Amerson; C. Dana Nelson
2005-01-01
We propose a method for defining DNA markers linked to Cronartium quercuum f. sp. fusiforme avirulence (Avr) genes. However, before this method can be successfully employed, a spore competition study was needed to determine the genetic composition of single pycnial drops and multiple drops on single galls when using the standard...
Selective crystallization of calcium salts by poly(acrylate)-grafted chitosan.
Neira-Carrillo, Andrónico; Yazdani-Pedram, Mehrdad; Retuert, Jaime; Diaz-Dosque, Mario; Gallois, Sebastien; Arias, José L
2005-06-01
The biopolymer chitosan was chemically modified by grafting polyacrylamide or polyacrylic acid in a homogeneous aqueous phase using potassium persulfate (KPS) as redox initiator system in the presence of N,N-methylene-bis-acrylamide as a crosslinking agent. The influence of the grafted chitosan on calcium salts crystallization in vitro was studied using the sitting-drop method. By using polyacrylamide grafted chitosan as substrate, rosette-like CaSO4 crystals were observed. This was originated by the presence of sulfate coming from the initiator KPS. By comparing crystallization on pure chitosan and on grafted chitosan, a dramatic influence of the grafted polymer on the crystalline habit of both salts was observed. Substrates prepared by combining sulfate with chitosan or sulfate with polyacrylamide did not produce similar CaSO4 morphologies. Moreover, small spheres or donut-shaped CaCO3 crystals on polyacrylic acid grafted chitosan were generated. The particular morphology of CaCO3 crystals depends also on other synthetic parameters such as the molecular weight of the chitosan sample and the KPS concentration.
NASA Astrophysics Data System (ADS)
Rossi, Barbara; Giarola, Marco; Mariotto, Gino; Ambrosi, Emmanuele; Monaco, Hugo L.
2010-05-01
Protein SOUL is a new member of the recently discovered putative heme-binding protein family called SOUL/HEBP and, to date, no structural information exists for this protein. Here, micro-Raman spectroscopy is used to study the vibrational properties of single crystals obtained from recombinant protein SOUL by means of two different optimization routes. This spectroscopic approach offers the valuable advantage of the in-situ collection of experimental data from protein crystals, placed onto a hanging-drop plate, under the same conditions used to grow the crystals. By focusing on the regions of amides I and III bands, some secondary structure characteristic features have been recognized. Moreover, some side-chain marker bands were observed in the Raman spectra of SOUL crystals and the unambiguous assignment of these peaks inferred by comparing the experimental Raman spectra of pure amino acids and their Raman intensities computed using quantum chemical calculations. Our comparative analysis allows to get a deeper understanding of the side-chain environments and of the interactions involving these specific amino acids in the two different SOUL crystals.
Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko
2005-08-01
This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less
Cuttitta, Christina M.; Ericson, Daniel L.; Scalia, Alexander; Roessler, Christian G.; Teplitsky, Ella; Joshi, Karan; Campos, Olven; Agarwal, Rakhi; Allaire, Marc; Orville, Allen M.; Sweet, Robert M.; Soares, Alexei S.
2015-01-01
Acoustic droplet ejection (ADE) is an emerging technology with broad applications in serial crystallography such as growing, improving and manipulating protein crystals. One application of this technology is to gently transfer crystals onto MiTeGen micromeshes with minimal solvent. Once mounted on a micromesh, each crystal can be combined with different chemicals such as crystal-improving additives or a fragment library. Acoustic crystal mounting is fast (2.33 transfers s−1) and all transfers occur in a sealed environment that is in vapor equilibrium with the mother liquor. Here, a system is presented to retain crystals near the ejection point and away from the inaccessible dead volume at the bottom of the well by placing the crystals on a concave agarose pedestal (CAP) with the same chemical composition as the crystal mother liquor. The bowl-shaped CAP is impenetrable to crystals. Consequently, gravity will gently move the crystals into the optimal location for acoustic ejection. It is demonstrated that an agarose pedestal of this type is compatible with most commercially available crystallization conditions and that protein crystals are readily transferred from the agarose pedestal onto micromeshes with no loss in diffraction quality. It is also shown that crystals can be grown directly on CAPs, which avoids the need to transfer the crystals from the hanging drop to a CAP. This technology has been used to combine thermolysin and lysozyme crystals with an assortment of anomalously scattering heavy atoms. The results point towards a fast nanolitre method for crystal mounting and high-throughput screening. PMID:25615864
Cuttitta, Christina M.; Ericson, Daniel L.; Scalia, Alexander; ...
2014-06-01
Acoustic droplet ejection (ADE) is an emerging technology with broad applications in serial crystallography such as growing, improving and manipulating protein crystals. One application of this technology is to gently transfer crystals onto MiTeGen micromeshes with minimal solvent. Once mounted on a micromesh, each crystal can be combined with different chemicals such as crystal-improving additives or a fragment library. Acoustic crystal mounting is fast (2.33 transfers s -1) and all transfers occur in a sealed environment that is in vapor equilibrium with the mother liquor. Here, a system is presented to retain crystals near the ejection point and away frommore » the inaccessible dead volume at the bottom of the well by placing the crystals on a concave agarose pedestal (CAP) with the same chemical composition as the crystal mother liquor. The bowl-shaped CAP is impenetrable to crystals. Consequently, gravity will gently move the crystals into the optimal location for acoustic ejection. It is demonstrated that an agarose pedestal of this type is compatible with most commercially available crystallization conditions and that protein crystals are readily transferred from the agarose pedestal onto micromeshes with no loss in diffraction quality. It is also shown that crystals can be grown directly on CAPs, which avoids the need to transfer the crystals from the hanging drop to a CAP. This technology has been used to combine thermolysin and lysozyme crystals with an assortment of anomalously scattering heavy atoms. The results point towards a fast nanolitre method for crystal mounting and high-throughput screening.« less
Apparatus And Method For Producing Single Crystal Metallic Objects
Huang, Shyh-Chin; Gigliotti, Jr., Michael Francis X.; Rutkowski, Stephen Francis; Petterson, Roger John; Svec, Paul Steven
2006-03-14
A mold is provided for enabling casting of single crystal metallic articles including a part-defining cavity, a sorter passage positioned vertically beneath and in fluid communication with the part-defining cavity, and a seed cavity positioned vertically beneath and in fluid communication with the sorter passage. The sorter passage includes a shape suitable for encouraging a single crystal structure in solidifying molten metal. Additionally, a portion of the mold between the sorter passage and the part-defining cavity includes a notch for facilitating breakage of a cast article proximate the notch during thermal stress build-up, so as to prevent mold breakage or the inclusion of part defects.
NASA Astrophysics Data System (ADS)
Wang, Xiaofei; Deane, Grant B.; Moore, Kathryn A.; Ryder, Olivia S.; Stokes, M. Dale; Beall, Charlotte M.; Collins, Douglas B.; Santander, Mitchell V.; Burrows, Susannah M.; Sultana, Camille M.; Prather, Kimberly A.
2017-07-01
The oceans represent a significant global source of atmospheric aerosols. Sea spray aerosol (SSA) particles comprise sea salts and organic species in varying proportions. In addition to size, the overall composition of SSA particles determines how effectively they can form cloud droplets and ice crystals. Thus, understanding the factors controlling SSA composition is critical to predicting aerosol impacts on clouds and climate. It is often assumed that submicrometer SSAs are mainly formed by film drops produced from bursting bubble-cap films, which become enriched with hydrophobic organic species contained within the sea surface microlayer. In contrast, jet drops formed from the base of bursting bubbles are postulated to mainly produce larger supermicrometer particles from bulk seawater, which comprises largely salts and water-soluble organic species. However, here we demonstrate that jet drops produce up to 43% of total submicrometer SSA number concentrations, and that the fraction of SSA produced by jet drops can be modulated by marine biological activity. We show that the chemical composition, organic volume fraction, and ice nucleating ability of submicrometer particles from jet drops differ from those formed from film drops. Thus, the chemical composition of a substantial fraction of submicrometer particles will not be controlled by the composition of the sea surface microlayer, a major assumption in previous studies. This finding has significant ramifications for understanding the factors controlling the mixing state of submicrometer SSA particles and must be taken into consideration when predicting SSA impacts on clouds and climate.
Crystallization and preliminary X-ray studies of dUTPase from Mason–Pfizer monkey retrovirus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barabás, Orsolya; Németh, Veronika; Vértessy, Beáta G., E-mail: vertessy@enzim.hu
2006-04-01
Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. The nucleocapsid-free dUTPase (48426 Da) was co-crystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. Deoxyuridine 5′-triphosphate nucleotidohydrolase from Mason–Pfizer monkey retrovirus (M-PMV dUTPase) is a betaretroviral member of the dUTPase enzyme family. In the mature M-PMV virion, this enzyme is present as the C-terminal domain of the fusion protein nucleocapsid-dUTPase. The homotrimeric organization characteristic of dUTPases is retained in this bifunctional fusion protein. The fusion protein supposedly plays a role in adequate localization of dUTPase activity in the vicinitymore » of nucleic acids during reverse transcription and integration. Here, the nucleocapsid-free dUTPase (48 426 Da) was cocrystallized with a dUTP substrate analogue using the hanging-drop vapour-diffusion method. The obtained crystals belong to the primitive hexagonal space group P6{sub 3}, with unit-cell parameters a = 60.6, b = 60.6, c = 63.6 Å, α = 90, β = 90, γ = 120°. Native and PtCl{sub 4}-derivative data sets were collected using synchrotron radiation to 1.75 and 2.3 Å, respectively. Phasing was successfully performed by isomorphous replacement combined with anomalous scattering.« less
Universal Behavior of the Initial Stage of Drop Impact
NASA Astrophysics Data System (ADS)
Klaseboer, Evert; Manica, Rogerio; Chan, Derek Y. C.
2014-11-01
During the early stages of the impact of a drop on a solid surface, pressure builds up in the intervening thin lubricating air layer and deforms the drop. The extent of the characteristic deformation is determined by the competition between capillary, gravitational, and inertial forces that has been encapsulated in a simple analytic scaling law. For millimetric drops, variations of the observed deformation with impact velocity V exhibit a maximum defined by the Weber and Eötvös numbers: We =1 +Eo . The deformation scales as V1 /2 at the low-velocity capillary regime and as V-1 /2 at the high-velocity inertia regime, in excellent agreement with a variety of experimental systems.
Leveraging microbial biosynthetic pathways for the generation of ‘drop-in’ biofuels
Zargar, Amin; Bailey, Constance B.; Haushalter, Robert W.; ...
2017-04-17
Advances in retooling microorganisms have enabled bioproduction of ‘drop-in’ biofuels, fuels that are compatible with existing spark-ignition, compression-ignition, and gasturbine engines. As the majority of petroleum consumption in the United States consists of gasoline (47%), diesel fuel and heating oil (21%), and jet fuel (8%), ‘drop-in’ biofuels that replace these petrochemical sources are particularly attractive. In this review, we discuss the application of aldehyde decarbonylases to produce gasoline substitutes from fatty acid products, a recently crystallized reductase that could hydrogenate jet fuel precursors from terpene synthases, and the exquisite control of polyketide synthases to produce biofuels with desired physical propertiesmore » (e.g., lower freezing points). With our increased understanding of biosynthetic logic of metabolic pathways, we discuss the unique advantages of fatty acid, terpene, and polyketide synthases for the production of bio-based gasoline, diesel and jet fuel.« less
Leveraging microbial biosynthetic pathways for the generation of 'drop-in' biofuels.
Zargar, Amin; Bailey, Constance B; Haushalter, Robert W; Eiben, Christopher B; Katz, Leonard; Keasling, Jay D
2017-06-01
Advances in retooling microorganisms have enabled bioproduction of 'drop-in' biofuels, fuels that are compatible with existing spark-ignition, compression-ignition, and gas-turbine engines. As the majority of petroleum consumption in the United States consists of gasoline (47%), diesel fuel and heating oil (21%), and jet fuel (8%), 'drop-in' biofuels that replace these petrochemical sources are particularly attractive. In this review, we discuss the application of aldehyde decarbonylases to produce gasoline substitutes from fatty acid products, a recently crystallized reductase that could hydrogenate jet fuel precursors from terpene synthases, and the exquisite control of polyketide synthases to produce biofuels with desired physical properties (e.g., lower freezing points). With our increased understanding of biosynthetic logic of metabolic pathways, we discuss the unique advantages of fatty acid, terpene, and polyketide synthases for the production of bio-based gasoline, diesel and jet fuel. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nitrogen stars: morphogenesis of a liquid drop
NASA Astrophysics Data System (ADS)
Strier, D. E.; Duarte, A. A.; Ferrari, H.; Mindlin, G. B.
2000-08-01
We report a study of a symmetry-breaking instability which ocurrs during the free evaporation of liquid nitrogen placed on a concave container initially at room temperature. The system evolves spontaneously from a highly disordered boiling state to one characterized by sequence of well-defined spatio-temporal structures. This sequence starts with the formation of a levitating drop. As the evaporation proceeds the drop undergoes an alternation between different star-like-shaped patterns with decreasing number of tips. In addition, each of this patterns oscillates. We frame the observed phenomena within the qualitative theory of bifurcations.
NASA Astrophysics Data System (ADS)
Polukhin, V. A.; Kurbanova, E. D.
2016-02-01
Molecular dynamics simulation is used to study the thermal stability of the interfacial states of metallic Al, Ag, Sn, Pb, and Hg films (i.e., the structural elements of superconductor composites and conducting electrodes) reinforced by 2D graphene and silicene crystals upon heating up to disordering and to analyze the formation of nonautonomous fluid pseudophases in interfaces. The effect of perforation defects in reinforcing 2D-C and 2D-Si planes with passivated edge covalent bonds on the atomic dynamics is investigated. As compared to Al and Ag, the diffusion coefficients in Pd and Hg films increase monotonically with temperature during thermally activated disordering processes, the interatomic distances decrease, the sizes decrease, drops form, and their density profile grows along the normal. The coagulation of Pb and Hg drops is accompanied by a decrease in the contact angle, the reduction of the interface contact with graphene, and the enhancement of its corrugation (waviness).
EFFECTS OF COMPLEXION ON CRYSTALLIZATION COEFFICIENT (in Russian)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Grebenshchikova, V.I.; Bobrova, V.N.
S>Coefficients of Pu(IV) crystallization with K/sub 2/SO/sub 4/ in 0.5 to 2N HNO/sub 3/ soiutions were analyzed. It was found that with HNO/sub 3/ concentration from 0.5 to 1N the magnitude of the coefficient drops from 30 surface proces 2 to 4 surface proces 0.5 (corresponding to K/sub 2/SO/sub 4/ concentration change from 0.8 to 1.2M). After that it remains constant up to 2N HNO/sub 3/ (and 1.8M K/sub 2/SO/sub 4/) concentration. (R.V.J.)
Bateman, J; Proctor, M; Buchnev, O; Podoliak, N; D'Alessandro, G; Kaczmarek, M
2014-07-01
The voltage transfer function is a rapid and visually effective method to determine the electrical response of liquid crystal (LC) systems using optical measurements. This method relies on crosspolarized intensity measurements as a function of the frequency and amplitude of the voltage applied to the device. Coupled with a mathematical model of the device it can be used to determine the device time constants and electrical properties. We validate the method using photorefractive LC cells and determine the main time constants and the voltage dropped across the layers using a simple nonlinear filter model.
Effect of crystal habits on the surface energy and cohesion of crystalline powders.
Shah, Umang V; Olusanmi, Dolapo; Narang, Ajit S; Hussain, Munir A; Gamble, John F; Tobyn, Michael J; Heng, Jerry Y Y
2014-09-10
The role of surface properties, influenced by particle processing, in particle-particle interactions (powder cohesion) is investigated in this study. Wetting behaviour of mefenamic acid was found to be anisotropic by sessile drop contact angle measurements on macroscopic (>1cm) single crystals, with variations in contact angle of water from 56.3° to 92.0°. This is attributed to variations in surface chemical functionality at specific facets, and confirmed using X-ray photoelectron spectroscopy (XPS). Using a finite dilution inverse gas chromatography (FD-IGC) approach, the surface energy heterogeneity of powders was determined. The surface energy profile of different mefenamic acid crystal habits was directly related to the relative exposure of different crystal facets. Cohesion, determined by a uniaxial compression test, was also found to relate to surface energy of the powders. By employing a surface modification (silanisation) approach, the contribution from crystal shape from surface area and surface energy was decoupled. By "normalising" contribution from surface energy and surface area, needle shaped crystals were found to be ∼2.5× more cohesive compared to elongated plates or hexagonal cuboid shapes crystals. Copyright © 2014. Published by Elsevier B.V.
Growth Angle - a Microscopic View
NASA Technical Reports Server (NTRS)
Mazurak, K.; Volz, M. P.; Croll, A.
2017-01-01
The growth angle that is formed between the side of the growing crystal and the melt meniscus is an important parameter in the detached Bridgman crystal growth method, where it determines the extent of the crystal-crucible wall gap, and in the Czochralski and float zone methods, where it influences the size and stability of the crystals. The growth angle is a non-equilibrium parameter, defined for the crystal growth process only. For a melt-crystal interface translating towards the crystal (melting), there is no specific angle defined between the melt and the sidewall of the solid. In this case, the corner at the triple line becomes rounded, and the angle between the sidewall and the incipience of meniscus can take a number of values, depending on the position of the triple line. In this work, a microscopic model is developed in which the fluid interacts with the solid surface through long range van der Waals or Casimir dispersive forces. This growth angle model is applied to Si and Ge and compared with the macroscopic approach of Herring. In the limit of a rounded corner with a large radius of curvature, the wetting of the melt on the crystal is defined by the contact angle. The proposed microscopic approach addresses the interesting issue of the transition from a contact angle to a growth angle as the radius of curvature decreases.
Jacobs, S.D.; Cerqua, K.A.
1987-07-14
The spatial intensity profile of an optical beam of designated wavelengths, such as a laser beam, is shaped (the beam is apodized) by means of cholesteric liquid crystals of opposite chirality disposed successively along the path of the beam. The crystals have curved surfaces, which may be defined by a lens which defines the thickness of the liquid crystal fluid gap in a liquid crystal cell, so as to vary the selective reflection of the designated wavelength across the aperture of the beam. In this way, a soft aperture is provided. By using tandem cell pairs having liquid crystals of opposite chirality, but of different pitch, and with lenses of different curvature, beams of different wavelengths which are projected colinearly along the path may be individually tailored in spatial intensity profile. 11 figs.
Jacobs, Stephen D.; Cerqua, Kathleen A.
1987-01-01
The spatial intensity profile of an optical beam of designated wavelengths, such as a laser beam, is shaped (the beam is apodized) by means of cholesteric liquid crystals of opposite chirality disposed successively along the path of the beam. The crystals have curved surfaces, which may be defined by a lens which defines the thickness of the liquid crystal fluid gap in a liquid crystal cell, so as to vary the selective reflection of the designated wavelength across the aperture of the beam. In this way, a soft aperture is provided. By using tandem cell pairs having liquid crystals of opposite chirality, but of different pitch, and with lenses of different curvature, beams of different wavelengths which are projected colinearly along the path may be individually tailored in spatial intensity profile.
Effect of Eccentricity in Compound Droplets Subject to a Simple Shear Flow
NASA Astrophysics Data System (ADS)
Kim, Sangkyu; Dabiri, Sadegh
2016-11-01
A double emulsion, or a compound droplet, is a system where two liquids are separated by an immiscible third liquid, thereby forming an emulsion inside an emulsion. Compound drops benefit from this separation in applications such food sciences, microfluidics, pharmaceutical engineering, and polymer sciences. While the subjects of double emulsion preparations, deformations, and breakup mechanisms are well-explored, the time-evolution of non-concentric compound drops has received far less analytical or computational scrutiny. In this work, we present computational results using finite volume method with front-tracking approach for initially spherical and non-concentric compound drops in a shear flow. Our findings for low Reynolds number flows show that: 1. The surrounding shear flow to the outer drop induces a rotational velocity field inside it, causing the inner drop to tumble with the flow, 2. the tumbling motion persists in time, and acts to increase the eccentricity of the compound drop, and 3. the hemisection-plane to the outer drop that is aligned with the plane of the simple shear defines an unstable equilibrium for inner drop's center, and the inner drop continuously drifts away from that plane. This work suggests a means of favorably configuring compound drops suitable for breakups, and helps to understand their migration in channel flows.
Youth--How to Produce Drop-Ins Rather Than Drop-Outs. Research Resume Number 38.
ERIC Educational Resources Information Center
Fort, Joel
The subject of youth in America lacks definition and young people are often given stereotyped labels. The reaction of others is frequently to the implied stereotype, rather than to young human beings. The life styles of youth involve questioning the Establishment and its goals, seeking to define the good life and working to create a better…
The First United States Microgravity Laboratory
NASA Technical Reports Server (NTRS)
Powers, C. Blake (Editor); Shea, Charlotte; Mcmahan, Tracy; Accardi, Denise; Mikatarian, Jeff
1991-01-01
The United States Microgravity Laboratory (USML-1) is one part of a science and technology program that will open NASA's next great era of discovery and establish the United States' leadership in space. A key component in the preparation for this new age of exploration, the USML-1 will fly in orbit for extended periods, providing greater opportunities for research in materials science, fluid dynamics, biotechnology, and combustion science. The major components of the USML-1 are the Crystal Growth Furnace, the Surface Tension Driven Convection Experiment (STDCE) Apparatus, and the Drop Physics Module. Other components of USML-1 include Astroculture, Generic Bioprocessing Apparatus, Extended Duration Orbiter Medical Project, Protein Crystal Growth, Space Acceleration Measurement System, Solid Surface Combustion Experiment, Zeolite Crystal Growth and Spacelab Glovebox provided by the European Space Agency.
Tylichová, Martina; Briozzo, Pierre; Kopečný, David; Ferrero, Julien; Moréra, Solange; Joly, Nathalie; Snégaroff, Jacques; Šebela, Marek
2008-01-01
Aminoaldehydes are products of polyamine degradation and are known to be reactive metabolites that are toxic to living cells at high concentrations. These compounds are catabolized by aminoaldehyde dehydrogenases, which are enzymes that contain a nicotinamide adenine dinucleotide coenzyme. Aminoaldehyde dehydrogenase from Pisum sativum was overexpressed in Escherichia coli, purified and crystallized using the hanging-drop method. A complete data set was collected to 2.8 Å resolution at 100 K. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 86.4, b = 216.6, c = 205.4 Å, β = 98.1°. Molecular replacement was performed and led to the identification of six dimers per asymmetric unit. PMID:18259056
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, G.J.; Garen, C.R.; Cherney, M.M.
2009-06-03
The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less
Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Linhard, Verena; Fritzsch, Günter; Zhang, Bin; Michel, Hartmut; Stöckigt, Joachim
2004-09-01
Crystals of vinorine synthase (VS) from medicinal plant Rauvolfia serpentina expressed in Escherichia coli have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. The enzyme is involved in the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure of a member of this enzyme family is known. The crystals belong to the space group P2(1)2(1)2(1) with cell dimensions of a=82.3 A, b=89.6 A and c=136.2 A. Under cryoconditions (120 K), a complete data set up to 2.8 A was collected at a synchrotron source.
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-08-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.
Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4
Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping
2012-01-01
Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128
Process modelling for space station experiments
NASA Technical Reports Server (NTRS)
Rosenberger, Franz; Alexander, J. Iwan D.
1988-01-01
The work performed during the first year 1 Oct. 1987 to 30 Sept. 1988 involved analyses of crystal growth from the melt and from solution. The particular melt growth technique under investigation is directional solidification by the Bridgman-Stockbarger method. Two types of solution growth systems are also being studied. One involves growth from solution in a closed container, the other concerns growth of protein crystals by the hanging drop method. Following discussions with Dr. R. J. Naumann of the Low Gravity Science Division at MSFC it was decided to tackle the analysis of crystal growth from the melt earlier than originally proposed. Rapid progress was made in this area. Work is on schedule and full calculations were underway for some time. Progress was also made in the formulation of the two solution growth models.
Xu, Zhen; Yang, Weili; Shi, Nuo; Gao, Yongxiang; Teng, Maikun; Niu, Liwen
2010-08-01
The histone chaperone SET encoded by the SET gene, which is also known as template-activating factor Iß (TAF-Iß), is a multifunctional molecule that is involved in many biological phenomena such as histone binding, nucleosome assembly, chromatin remodelling, replication, transcription and apoptosis. A truncated SET/TAF-Iß ΔN protein that lacked the first 22 residues of the N-terminus but contained the C-terminal acidic domain and an additional His6 tag at the C-terminus was overexpressed in Escherichia coli and crystallized by the hanging-drop vapour-diffusion method using sodium acetate as precipitant at 283 K. The crystals diffracted to 2.7 A resolution and belonged to space group P4(3)2(1)2.
Umeda, Takashi; Katsuki, Junichi; Usami, Yusuke; Inoue, Kengo; Noguchi, Haruko; Fujimoto, Zui; Ashikawa, Yuji; Yamane, Hisakazu; Nojiri, Hideaki
2008-01-01
Novosphingobium sp. KA1 uses carbazole 1,9a-dioxygenase (CARDO) as the first dioxygenase in its carbazole-degradation pathway. The CARDO of KA1 contains a terminal oxygenase component and two electron-transfer components: ferredoxin and ferredoxin reductase. In contrast to the CARDO systems of other species, the ferredoxin component of KA1 is a putidaredoxin-type protein. This novel ferredoxin was crystallized at 293 K by the hanging-drop vapour-diffusion method using PEG MME 550 as the precipitant under anaerobic conditions. The crystals belong to space group C2221 and diffraction data were collected to a resolution of 1.9 Å (the diffraction limit was 1.6 Å). PMID:18607094
Chaikuad, Apirat; Knapp, Stefan; von Delft, Frank
2015-01-01
The quest for an optimal limited set of effective crystallization conditions remains a challenge in macromolecular crystallography, an issue that is complicated by the large number of chemicals which have been deemed to be suitable for promoting crystal growth. The lack of rational approaches towards the selection of successful chemical space and representative combinations has led to significant overlapping conditions, which are currently present in a multitude of commercially available crystallization screens. Here, an alternative approach to the sampling of widely used PEG precipitants is suggested through the use of PEG smears, which are mixtures of different PEGs with a requirement of either neutral or cooperatively positive effects of each component on crystal growth. Four newly defined smears were classified by molecular-weight groups and enabled the preservation of specific properties related to different polymer sizes. These smears not only allowed a wide coverage of properties of these polymers, but also reduced PEG variables, enabling greater sampling of other parameters such as buffers and additives. The efficiency of the smear-based screens was evaluated on more than 220 diverse recombinant human proteins, which overall revealed a good initial crystallization success rate of nearly 50%. In addition, in several cases successful crystallizations were only obtained using PEG smears, while various commercial screens failed to yield crystals. The defined smears therefore offer an alternative approach towards PEG sampling, which will benefit the design of crystallization screens sampling a wide chemical space of this key precipitant. PMID:26249344
Chaikuad, Apirat; Knapp, Stefan; von Delft, Frank
2015-08-01
The quest for an optimal limited set of effective crystallization conditions remains a challenge in macromolecular crystallography, an issue that is complicated by the large number of chemicals which have been deemed to be suitable for promoting crystal growth. The lack of rational approaches towards the selection of successful chemical space and representative combinations has led to significant overlapping conditions, which are currently present in a multitude of commercially available crystallization screens. Here, an alternative approach to the sampling of widely used PEG precipitants is suggested through the use of PEG smears, which are mixtures of different PEGs with a requirement of either neutral or cooperatively positive effects of each component on crystal growth. Four newly defined smears were classified by molecular-weight groups and enabled the preservation of specific properties related to different polymer sizes. These smears not only allowed a wide coverage of properties of these polymers, but also reduced PEG variables, enabling greater sampling of other parameters such as buffers and additives. The efficiency of the smear-based screens was evaluated on more than 220 diverse recombinant human proteins, which overall revealed a good initial crystallization success rate of nearly 50%. In addition, in several cases successful crystallizations were only obtained using PEG smears, while various commercial screens failed to yield crystals. The defined smears therefore offer an alternative approach towards PEG sampling, which will benefit the design of crystallization screens sampling a wide chemical space of this key precipitant.
Coffee-rings and glasses: Colloids out of equilibrium
NASA Astrophysics Data System (ADS)
Yunker, Peter Joseph
This thesis describes experiments that utilize colloids to explore nonequilibrium phenomena. Specifically, the deposition of particles during evaporation and the glass transition are explored. In the first set of experiments, we found that particle shape has a profound effect on particle deposition. We evaporated drops of colloidal suspensions containing micron-sized particles that range in shape from isotropic spheres to very anisotropic ellipsoids. For sessile drops, i.e., drops sitting on a solid surface, spheres are deposited in a ring-like stain, while ellipsoids are deposited uniformly. We also confined drops between glass plates and allowed them to evaporate. During evaporation, colloidal particles coat the air-water interface, forming colloidal monolayer membranes (CMMs). As particle anisotropy increases, CMM bending rigidity was found to increase. This increase in bending rigidity provides a new mechanism that produces a uniform deposition of ellipsoids and a heterogeneous deposition of spheres. In the second set of experiments, we employed colloidal suspensions to investigate the character of glassy materials. "Anisotropic glasses'' were investigated with ellipsoidal particles confined to two-dimensional chambers at high packing fractions; this system enabled the study of the effects of particle shape on the vibrational properties of colloidal glasses. Low frequency modes in glasses composed of slightly anisotropic particles are found to have predominantly rotational character. Conversely, low frequency modes in glasses of highly anisotropic particles exhibit a mix of rotational and translational character. Aging effects in glasses were explored using suspensions of temperature-sensitive microgel spheres. We devised a method to rapidly quench from liquid to glass states, and then observed the resultant colloidal glasses as they aged. Particle rearrangements in glasses occur collectively, i.e., many particles move in a correlated manner. During aging, we observed that the size of these collective rearrangements increases. Thus, the slowing dynamics of aging appear governed by growing correlated domains of particles required for relaxation. Using the same microgel particles, the transformation of a crystal into a glass due to added disorder was investigated by adding smaller particles into a quasi-two-dimensional colloidal crystal. The crystal-glass transition bears structural signatures similar to those of the crystal-fluid transition, but also exhibits a sharp change in dynamic heterogeneity which ``turns-on'' abruptly as a function of increasing disorder. Finally, we investigated the influence of morphology and size on the vibrational properties of disordered clusters of colloidal particles. Spectral features of cluster vibrational modes are found to depend strongly on the average number of nearest neighbors but only weakly on the number of particles in each glassy cluster. The scaling of the median phonon frequency with nearest neighbor number is reminiscent of athermal simulations of the jamming transition.
Ambaye, Nigus D; Gunzburg, Menachem J; Traore, Daouda A K; Del Borgo, Mark P; Perlmutter, Patrick; Wilce, Matthew C J; Wilce, Jacqueline A
2014-02-01
Human growth factor receptor-bound protein 7 (Grb7) is an adapter protein involved in cell growth, migration and proliferation. It is now recognized that Grb7 is an emerging therapeutic target in specific cancer subtypes. Recently, the discovery of a bicyclic peptide inhibitor that targets the Grb7 SH2 domain, named G7-B1, was reported. In an attempt to probe the foundation of its interaction with Grb7, the crystallization and preliminary data collection of both the apo and G7-B1-bound forms of the Grb7 SH2 domain are reported here. Diffraction-quality crystals were obtained using the hanging-drop vapour-diffusion method. After several rounds of microseeding, crystals of the apo Grb7 SH2 domain were obtained that diffracted to 1.8 Å resolution, while those of the G7-B1-Grb7 SH2 domain complex diffracted to 2.2 Å resolution. The apo Grb7 SH2 domain crystallized in the trigonal space group P63, whereas the G7-B1-Grb7 SH2 domain complex crystallized in the monoclinic space group P21. The experimental aspects of crystallization, crystal optimization and data collection and the preliminary data are reported.
NASA Astrophysics Data System (ADS)
Lazzerini, Giovanni Mattia; Paternò, Giuseppe Maria; Tregnago, Giulia; Treat, Neil; Stingelin, Natalie; Yacoot, Andrew; Cacialli, Franco
2016-02-01
We report high-resolution, traceable atomic force microscopy measurements of high-quality, solvent-free single crystals of [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). These were grown by drop-casting PCBM solutions onto the spectrosil substrates and by removing the residual solvent in a vacuum. A home-built atomic force microscope featuring a plane mirror differential optical interferometer, fiber-fed from a frequency-stabilized laser (emitting at 632.8 nm), was used to measure the crystals' height. The optical interferometer together with the stabilized laser provides traceability (via the laser wavelength) of the vertical measurements made with the atomic force microscope. We find that the crystals can conform to the surface topography, thanks to their height being significantly smaller compared to their lateral dimensions (namely, heights between about 50 nm and 140 nm, for the crystals analysed, vs. several tens of microns lateral dimensions). The vast majority of the crystals are flat, but an isolated, non-flat crystal provides insights into the growth mechanism and allows identification of "molecular terraces" whose height corresponds to one of the lattice constants of the single PCBM crystal (1.4 nm) as measured with X-ray diffraction.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lazzerini, Giovanni Mattia; Yacoot, Andrew; Paternò, Giuseppe Maria
2016-02-01
We report high-resolution, traceable atomic force microscopy measurements of high-quality, solvent-free single crystals of [6,6]-phenyl-C61-butyric acid methyl ester (PCBM). These were grown by drop-casting PCBM solutions onto the spectrosil substrates and by removing the residual solvent in a vacuum. A home-built atomic force microscope featuring a plane mirror differential optical interferometer, fiber-fed from a frequency-stabilized laser (emitting at 632.8 nm), was used to measure the crystals' height. The optical interferometer together with the stabilized laser provides traceability (via the laser wavelength) of the vertical measurements made with the atomic force microscope. We find that the crystals can conform to the surfacemore » topography, thanks to their height being significantly smaller compared to their lateral dimensions (namely, heights between about 50 nm and 140 nm, for the crystals analysed, vs. several tens of microns lateral dimensions). The vast majority of the crystals are flat, but an isolated, non-flat crystal provides insights into the growth mechanism and allows identification of “molecular terraces” whose height corresponds to one of the lattice constants of the single PCBM crystal (1.4 nm) as measured with X-ray diffraction.« less
Aging and the shape of cognitive change before death: terminal decline or terminal drop?
MacDonald, Stuart W S; Hultsch, David F; Dixon, Roger A
2011-05-01
Relative to typical age-related cognitive decrements, the terms "terminal decline" and "terminal drop" refer to the phenomenon of increased cognitive decline in proximity to death. Given that these terms are not necessarily synonymous, we examined the important theoretical distinction between the two alternative trajectories or shapes of changes they imply. We used 12-year (5-wave) data from the Victoria Longitudinal Study to directly test whether pre-death cognitive decrements follow a terminal decline (generally gradual) or a terminal drop (more abrupt) shape. Pre-death trajectories of cognitive decline for n=265 decedents (Mage = 72.67 years, SD = 6.44) were examined separately for 5 key cognitive constructs (verbal speed, working memory, episodic memory, semantic memory, and crystallized ability). Several classes of linear mixed models evaluated whether cognitive decline increased per additional year closer to death. Findings indicated that the shape of pre-death cognitive change was predominantly characterized by decline that is steeper as compared with typical aging-related change, but still best described as slow and steady decline, especially as compared with precipitous drop. The present findings suggest that terminal decline and terminal drop trajectories may not be mutually exclusive but could rather reflect distinct developmental trajectories within the same individual.
Internal Flows in Free Drops (IFFD)
NASA Technical Reports Server (NTRS)
Trinh, E. H.; Sadhal, Satwindar S.; Thomas, D. A.; Crouch, R. K.
1998-01-01
Within the framework of an Earth-based research task investigating the internal flows within freely levitated drops, a low-gravity technology development experiment has been designed and carried out within the NASA Glovebox facility during the STS-83 and STS-94 Shuttle flights (MSL-1 mission). The goal was narrowly defined as the assessment of the capabilities of a resonant single-axis ultrasonic levitator to stably position free drops in the Shuttle environment with a precision required for the detailed measurement of internal flows. The results of this entirely crew-operated investigation indicate that the approach is fundamentally sound, but also that the ultimate stability of the positioning is highly dependent on the residual acceleration characteristic of the Spacecraft, and to a certain extent, on the initial drop deployment of the drop. The principal results are: the measured dependence of the residual drop rotation and equilibrium drop shape on the ultrasonic power level, the experimental evaluation of the typical drop translational stability in a realistic low-gravity environment, and the semi-quantitative evaluation of background internal flows within quasi-isothermal drops. Based on these results, we conclude that the successful design of a full-scale Microgravity experiment is possible, and would allow accurate the measurement of thermocapillary flows within transparent drops. The need has been demonstrated, however, for the capability for accurately deploying the drop, for a quiescent environment, and for precise mechanical adjustments of the levitator.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Agarkar, Vinod B.; Kimani, Serah W.; Cowan, Donald A.
2006-12-01
The amidase from G. pallidus RAPc8, a moderate thermophile, converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned, expressed and purified, and then crystallized using the hanging-drop vapour-diffusion method. The amidase from Geobacillus pallidus RAPc8, a moderate thermophile, is a member of the nitrilase enzyme superfamily. It converts amides to the corresponding acids and ammonia and has application as an industrial catalyst. RAPc8 amidase has been cloned and functionally expressed in Escherichia coli and has been purified by heat treatment and a number of chromatographic steps. The enzyme wasmore » crystallized using the hanging-drop vapour-diffusion method. Crystals produced in the presence of 1.2 M sodium citrate, 400 mM NaCl, 100 mM sodium acetate pH 5.6 were selected for X-ray diffraction studies. A data set having acceptable statistics to 1.96 Å resolution was collected under cryoconditions using an in-house X-ray source. The space group was determined to be primitive cubic P4{sub 2}32, with unit-cell parameter a = 130.49 (±0.05) Å. The structure was solved by molecular replacement using the backbone of the hypothetical protein PH0642 from Pyrococcus horikoshii (PDB code 1j31) with all non-identical side chains substituted with alanine as a probe. There is one subunit per asymmetric unit. The subunits are packed as trimers of dimers with D3 point-group symmetry around the threefold axis in such a way that the dimer interface seen in the homologues is preserved.« less
NASA Technical Reports Server (NTRS)
Woese, C.
1998-01-01
A genetic annealing model for the universal ancestor of all extant life is presented; the name of the model derives from its resemblance to physical annealing. The scenario pictured starts when "genetic temperatures" were very high, cellular entities (progenotes) were very simple, and information processing systems were inaccurate. Initially, both mutation rate and lateral gene transfer levels were elevated. The latter was pandemic and pervasive to the extent that it, not vertical inheritance, defined the evolutionary dynamic. As increasingly complex and precise biological structures and processes evolved, both the mutation rate and the scope and level of lateral gene transfer, i.e., evolutionary temperature, dropped, and the evolutionary dynamic gradually became that characteristic of modern cells. The various subsystems of the cell "crystallized," i.e., became refractory to lateral gene transfer, at different stages of "cooling," with the translation apparatus probably crystallizing first. Organismal lineages, and so organisms as we know them, did not exist at these early stages. The universal phylogenetic tree, therefore, is not an organismal tree at its base but gradually becomes one as its peripheral branchings emerge. The universal ancestor is not a discrete entity. It is, rather, a diverse community of cells that survives and evolves as a biological unit. This communal ancestor has a physical history but not a genealogical one. Over time, this ancestor refined into a smaller number of increasingly complex cell types with the ancestors of the three primary groupings of organisms arising as a result.
An evaluation of adhesive sample holders for advanced crystallographic experiments
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mazzorana, Marco; Sanchez-Weatherby, Juan, E-mail: juan.sanchez-weatherby@diamond.ac.uk; Sandy, James
Commercially available adhesives have been evaluated for crystal mounting when undertaking complex macromolecular crystallography experiments. Here, their use as tools for advanced sample mounting and cryoprotection is assessed and their suitability for room-temperature data-collection and humidity-controlled studies is investigated. The hydration state of macromolecular crystals often affects their overall order and, ultimately, the quality of the X-ray diffraction pattern that they produce. Post-crystallization techniques that alter the solvent content of a crystal may induce rearrangement within the three-dimensional array making up the crystal, possibly resulting in more ordered packing. The hydration state of a crystal can be manipulated by exposingmore » it to a stream of air at controlled relative humidity in which the crystal can equilibrate. This approach provides a way of exploring crystal hydration space to assess the diffraction capabilities of existing crystals. A key requirement of these experiments is to expose the crystal directly to the dehydrating environment by having the minimum amount of residual mother liquor around it. This is usually achieved by placing the crystal on a flat porous support (Kapton mesh) and removing excess liquid by wicking. Here, an alternative approach is considered whereby crystals are harvested using adhesives that capture naked crystals directly from their crystallization drop, reducing the process to a one-step procedure. The impact of using adhesives to ease the harvesting of different types of crystals is presented together with their contribution to background scattering and their usefulness in dehydration experiments. It is concluded that adhesive supports represent a valuable tool for mounting macromolecular crystals to be used in humidity-controlled experiments and to improve signal-to-noise ratios in diffraction experiments, and how they can protect crystals from modifications in the sample environment is discussed.« less
Forced Oscillations of Supported Drops
NASA Technical Reports Server (NTRS)
Wilkes, Edward D.; Basaran, Osman A.
1996-01-01
Oscillations of supported liquid drops are the subject of wide scientific interest, with applications in areas as diverse as liquid-liquid extraction, synthesis of ceramic powders, growing of pure crystals in low gravity, and measurement of dynamic surface tension. In this research, axisymmetric forced oscillations of arbitrary amplitude of viscous liquid drops of fixed volume which are pendant from or sessile on a rod with a fixed or moving contact line and surrounded by an inviscid ambient gas are induced by moving the rod in the vertical direction sinusiodally in time. In this paper, a preliminary report is made on the computational analysis of the oscillations of supported drops that have 'clean' interfaces and whose contact lines remain fixed throughout their motions. The relative importance of forcing to damping can be increased by either increasing the amplitude of rod motion A or Reynolds number Re. It is shown that as the ratio of forcing to damping rises, for drops starting from an initial rest state a sharp increase in deformation can occur when they are forced to oscillate in the vicinity of their resonance frequencies, indicating the incipience of hysteresis. However, it is also shown that the existence of a second stable limit cycle and the occurrence of hysteresis can be observed if the drop is subjected to a so-called frequency sweep, where the forcing frequency is first increased and then decreased over a suitable range. Because the change in drop deformation response is abrupt in the vicinity of the forcing frequencies where hysteresis occurs, it should be possible to exploit the phenomenon to accurately measure the viscosity and surface tension of the drop liquid.
Electrochemistry in an acoustically levitated drop.
Chainani, Edward T; Ngo, Khanh T; Scheeline, Alexander
2013-02-19
Levitated drops show potential as microreactors, especially when radicals are present as reactants or products. Solid/liquid interfaces are absent or minimized, avoiding adsorption and interfacial reaction of conventional microfluidics. We report amperometric detection in an acoustically levitated drop with simultaneous ballistic addition of reactant. A gold microelectrode sensor was fabricated with a lithographic process; active electrode area was defined by a photosensitive polyimide mask. The microdisk gold working electrode of radius 19 μm was characterized using ferrocenemethanol in aqueous buffer. Using cyclic voltammetry, the electrochemically active surface area was estimated by combining a recessed microdisk electrode model with the Randles-Sevcik equation. Computer-controlled ballistic introduction of reactant droplets into the levitated drop was developed. Chronoamperometric measurements of ferrocyanide added ballistically demonstrate electrochemical monitoring using the microfabricated electrode in a levitated drop. Although concentration increases with time due to drop evaporation, the extent of concentration is predictable with a linear evaporation model. Comparison of diffusion-limited currents in pendant and levitated drops show that convection arising from acoustic levitation causes an enhancement of diffusion-limited current on the order of 16%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru
2007-11-01
The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less
Wang, Xiaofei; Deane, Grant B.; Moore, Kathryn A.; Ryder, Olivia S.; Stokes, M. Dale; Beall, Charlotte M.; Santander, Mitchell V.; Burrows, Susannah M.; Sultana, Camille M.; Prather, Kimberly A.
2017-01-01
The oceans represent a significant global source of atmospheric aerosols. Sea spray aerosol (SSA) particles comprise sea salts and organic species in varying proportions. In addition to size, the overall composition of SSA particles determines how effectively they can form cloud droplets and ice crystals. Thus, understanding the factors controlling SSA composition is critical to predicting aerosol impacts on clouds and climate. It is often assumed that submicrometer SSAs are mainly formed by film drops produced from bursting bubble-cap films, which become enriched with hydrophobic organic species contained within the sea surface microlayer. In contrast, jet drops formed from the base of bursting bubbles are postulated to mainly produce larger supermicrometer particles from bulk seawater, which comprises largely salts and water-soluble organic species. However, here we demonstrate that jet drops produce up to 43% of total submicrometer SSA number concentrations, and that the fraction of SSA produced by jet drops can be modulated by marine biological activity. We show that the chemical composition, organic volume fraction, and ice nucleating ability of submicrometer particles from jet drops differ from those formed from film drops. Thus, the chemical composition of a substantial fraction of submicrometer particles will not be controlled by the composition of the sea surface microlayer, a major assumption in previous studies. This finding has significant ramifications for understanding the factors controlling the mixing state of submicrometer SSA particles and must be taken into consideration when predicting SSA impacts on clouds and climate. PMID:28630346
Effect of ice contamination on liquid-nitrogen drops in film boiling
NASA Technical Reports Server (NTRS)
Schoessow, G. J.; Chmielewski, C. E.; Baumeister, K. J.
1977-01-01
Previously reported vaporization time data of liquid nitrogen drops in film boiling on a flat plate are about 30 percent shorter than predicted from standard laminar film boiling theory. This theory, however, had been found to successfully correlate the data for conventional fluids such as water, ethanol, benzene, or carbon tetrachloride. This paper presents experimental evidence that some of the discrepancy for cryogenic fluids results from ice contamination due to condensation. The data indicate a fairly linear decrease in droplet evaporation time with the diameter of the ice crystal residue. After correcting the raw data for ice contamination along with convection, a comparison of theory with experiment shows good agreement.
Effect of ice contamination of liquid-nitrogen drops in film boiling
NASA Technical Reports Server (NTRS)
Schoessow, G. J.; Chmielewski, C. E.; Baumeister, K. J.
1977-01-01
Previously reported vaporization time data of liquid nitrogen drops in film boiling on a flat plate are about 30 percent shorter than predicted from standard laminar film boiling theory. This theory, however, had been found to successfully correlate the data for conventional fluids such as water, ethanol, benzene, or carbon tetrachloride. Experimental evidence that some of the discrepancy for cryogenic fluids results from ice contamination due to condensation is presented. The data indicate a fairly linear decrease in droplet evaporation time with the diameter of the ice crystal residue. After correcting the raw data for ice contamination along with convection, a comparison of theory with experiment shows good agreement.
Metallic dielectric photonic crystals and methods of fabrication
Chou, Jeffrey Brian; Kim, Sang-Gook
2017-12-05
A metallic-dielectric photonic crystal is formed with a periodic structure defining a plurality of resonant cavities to selectively absorb incident radiation. A metal layer is deposited on the inner surfaces of the resonant cavities and a dielectric material fills inside the resonant cavities. This photonic crystal can be used to selectively absorb broadband solar radiation and then reemit absorbed radiation in a wavelength band that matches the absorption band of a photovoltaic cell. The photonic crystal can be fabricated by patterning a sacrificial layer with a plurality of holes, into which is deposited a supporting material. Removing the rest of the sacrificial layer creates a supporting structure, on which a layer of metal is deposited to define resonant cavities. A dielectric material then fills the cavities to form the photonic crystal.
Metallic dielectric photonic crystals and methods of fabrication
Chou, Jeffrey Brian; Kim, Sang-Gook
2016-12-20
A metallic-dielectric photonic crystal is formed with a periodic structure defining a plurality of resonant cavities to selectively absorb incident radiation. A metal layer is deposited on the inner surfaces of the resonant cavities and a dielectric material fills inside the resonant cavities. This photonic crystal can be used to selectively absorb broadband solar radiation and then reemit absorbed radiation in a wavelength band that matches the absorption band of a photovoltaic cell. The photonic crystal can be fabricated by patterning a sacrificial layer with a plurality of holes, into which is deposited a supporting material. Removing the rest of the sacrificial layer creates a supporting structure, on which a layer of metal is deposited to define resonant cavities. A dielectric material then fills the cavities to form the photonic crystal.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika
2008-08-01
Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less
Electrical properties of lightly Ga-doped ZnO nanowires
NASA Astrophysics Data System (ADS)
Alagha, S.; Heedt, S.; Vakulov, D.; Mohammadbeigi, F.; Senthil Kumar, E.; Schäpers, Th; Isheim, D.; Watkins, S. P.; Kavanagh, K. L.
2017-12-01
We investigated the growth, crystal structure, elemental composition and electrical transport characteristics of ZnO nanowires, a promising candidate for optoelectronic applications in the UV-range. Nominally-undoped and Ga-doped ZnO nanowires were grown by metal-organic chemical vapor deposition. Photoluminescence measurements confirmed the incorporation of Ga via donor-bound exciton emission. With atom-probe tomography we estimated an upper limit of the Ga impurity concentration ({10}18 {{cm}}-3). We studied the electrical transport characteristics of these nanowires with a W-nanoprobe technique inside a scanning electron microscope and with lithographically-defined contacts allowing back-gated measurements. An increase in apparent resistivity by two orders of magnitude with decreasing radius was measured with both techniques with a much larger distribution width for the nanoprobe method. A drop in the effective carrier concentration and mobility was found with decreasing radius which can be attributed to carrier depletion and enhanced scattering due to surface states. Little evidence of a change in resistivity was observed with Ga doping, which indicates that the concentration of native or background dopants is higher than the Ga doping concentration.
Rethinking Dropout in Online Higher Education: The Case of the Universitat Oberta De Catalunya
ERIC Educational Resources Information Center
Grau-Valldosera, Josep; Minguillón, Julià
2014-01-01
In recent years, several studies have been carried out into the reasons why students drop out of online higher education, following the rise in the relative weight of this form of education. However, more effort has gone into analyzing the causes of this phenomenon than into trying to characterize students who drop out, that is defining what a…
Schmit, Alexandre; Salkin, Louis; Courbin, Laurent; Panizza, Pascal
2014-07-14
The combination of two drop makers such as flow focusing geometries or ┬ junctions is commonly used in microfluidics to fabricate monodisperse double emulsions and novel fluid-based materials. Here we investigate the physics of the encapsulation of small droplets inside large drops that is at the core of such processes. The number of droplets per drop studied over time for large sequences of consecutive drops reveals that the dynamics of these systems are complex: we find a succession of well-defined elementary patterns and defects. We present a simple model based on a discrete approach that predicts the nature of these patterns and their non-trivial scheme of arrangement in a sequence as a function of the ratio of the two timescales of the problem, the production times of droplets and drops. Experiments validate our model as they concur very well with predictions.
NASA Astrophysics Data System (ADS)
Thangaraja, Amutha; Shinde, Sachin M.; Kalita, Golap; Tanemura, Masaki
2016-02-01
The synthesis of large-area monolayer tungsten disulphide (WS2) single crystal is critical for realistic application in electronic and optical devices. Here, we demonstrate an effective approach to synthesize monolayer WS2 crystals using tungsten hexachloride (WCl6) as a solid precursor in atmospheric chemical vapor deposition process. In this technique, 0.05M solution of WCl6 in ethanol was drop-casted on SiO2/Si substrate to create an even distribution of the precursor, which was reduced and sulfurized at 750 °C in Ar atmosphere. We observed growth of triangular, star-shaped, as well as dendritic WS2 crystals on the substrate. The crystal geometry evolves with the shape and size of the nuclei as observed from the dendritic structures. These results show that controlling the initial nucleation and growth process, large WS2 single crystalline monolayer can be grown using the WCl6 precursor. Our finding shows an easier and effective approach to grow WS2 monolayer using tungsten halide solution-casting, rather than evaporating the precursor for gas phase reaction.
Crystal morphology variation in inkjet-printed organic materials
NASA Astrophysics Data System (ADS)
Ihnen, Andrew C.; Petrock, Anne M.; Chou, Tsengming; Samuels, Phillip J.; Fuchs, Brian E.; Lee, Woo Y.
2011-11-01
The recent commercialization of piezoelectric-based drop-on-demand inkjet printers provides an additive processing platform for producing and micropatterning organic crystal structures. We report an inkjet printing approach where macro- and nano-scale energetic composites composed of cyclotrimethylenetrinitramine (RDX) crystals dispersed in a cellulose acetate butyrate (CAB) matrix are produced by direct phase transformation from organic solvent-based all-liquid inks. The characterization of printed composites illustrates distinct morphological changes dependent on ink deposition parameters. When 10 pL ink droplets rapidly formed a liquid pool, a coffee ring structure containing dendritic RDX crystals was produced. By increasing the substrate temperature, and consequently the evaporation rate of the pooled ink, the coffee ring structure was mitigated and shorter dendrites from up to ∼1 to 0.2 mm with closer arm spacing from ∼15 to 1 μm were produced. When the nucleation and growth of RDX and CAB were confined within the evaporating droplets, a granular structure containing nanoscale RDX crystals was produced. The results suggest that evaporation rate and microfluidic droplet confinement can effectively be used to tailor the morphology of inkjet-printed energetic composites.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji
A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matsuzawa, Jun; Aikawa, Hiroki; Umeda, Takashi
2014-09-25
A crystal was obtained of the complex between reduced terminal oxygenase and oxidized ferredoxin components of carbazole 1,9a-dioxygenase. The crystal belonged to space group P2{sub 1} and diffracted to 2.25 Å resolution. The initial reaction in bacterial carbazole degradation is catalyzed by carbazole 1,9a-dioxygenase, which consists of terminal oxygenase (Oxy), ferredoxin (Fd) and ferredoxin reductase components. The electron-transfer complex between reduced Oxy and oxidized Fd was crystallized at 293 K using the hanging-drop vapour-diffusion method with PEG 3350 as the precipitant under anaerobic conditions. The crystal diffracted to a maximum resolution of 2.25 Å and belonged to space group P2{submore » 1}, with unit-cell parameters a = 97.3, b = 81.6, c = 116.2 Å, α = γ = 90, β = 100.1°. The V{sub M} value is 2.85 Å{sup 3} Da{sup −1}, indicating a solvent content of 56.8%.« less
Moorthy, Ponnuraj Sathya; Neelagandan, Kamariah; Balasubramanian, Moovarkumudalvan; Ponnuswamy, Mondikalipudur Nanjappa Gounder
2009-01-01
Hemoglobin is a vital protein present in almost all higher species. It is a transport protein involved in carrying oxygen from lungs to tissues and carbon dioxide back to lungs by an intrinsically coordinated manner. Even though a good amount of work has been carried out in this direction there exists scarcity of structural insight on low oxygen affinity species. Attempts are being made to unravel the structural insight of this low oxygen affinity species. Goat blood plasma was collected, treated with EDTA to avoid blood clotting and purification was accomplished using DEAE-anion chromatographic column. The goat hemoglobin was crystallized using 50mM of phosphate buffer at pH 6.7 with 1M NaCl and PEG 3350 as precipitant by hanging drop vapor diffusion method. Crystals obtained are screened and suitable crystals are taken for data collection using mar345dtb as image plate detector system. Goat hemoglobin crystal diffracted up to 2.61 A resolution. Goat hemoglobin crystallizes in orthorhombic space group P212(1)2(1) as a whole biological molecule in the asymmetric unit with cell dimensions a=53.568A, b=67.365A, c=154.183A.
Nucleation and growth control in protein crystallization
NASA Technical Reports Server (NTRS)
Rosenberger, Franz; Nyce, Thomas A.; Meehan, Edward J.; Sowers, Jennifer W.; Monaco, Lisa A.
1990-01-01
The five topics summarized in this final report are as follows: (1) a technique for the expedient, semi-automated determination of protein solubilities as a function of temperature and application of this technique to proteins other than lysozyme; (2) a small solution cell with adjustable temperature gradients for the growth of proteins at a predetermined location through temperature programming; (3) a microscopy system with image storage and processing capability for high resolution optical studies of temperature controlled protein growth and etching kinetics; (4) growth experiments with lysozyme in thermosyphon flow ; and (5) a mathematical model for the evolution of evaporation/diffusion induced concentration gradients in the hanging drop protein crystallization technique.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guo, Feng; Jin, Tengchuan; Howard, Andrew
The crystallization of the brazil nut allergen Ber e 2 is reported. Peanut and tree-nut allergies have attracted considerable attention because of their frequency and their lifelong persistence. Brazil-nut (Bertholletia excelsa) allergies have been well documented and the 11S legumin-like seed storage protein Ber e 2 (excelsin) is one of the two known brazil-nut allergens. In this study, Ber e 2 was extracted from brazil-nut kernels and purified to high purity by crystalline precipitation and gel-filtration chromatography. Well diffracting single crystals were obtained using the hanging-drop vapour-diffusion method. A molecular-replacement structural solution has been obtained. Refinement of the structure ismore » currently under way.« less
Cavity Pull Rod: Device to Promote Single Crystal Growth from the Melt
NASA Technical Reports Server (NTRS)
Goldsby, Jon (Inventor)
2017-01-01
A pull rod for use in producing a single crystal from a molten alloy is provided that includes an elongated rod having a first end and a second end, a first cavity defined at the first end and a second cavity defined at the first end and in communication with the first cavity. The first cavity receives the molten alloy and the second cavity vents a gas from the molten alloy to thereby template a single crystal when the pull rod is dipped into and extracted from the molten alloy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bennett, Brad C.; Meilleur, Flora; Myles, Dean A A
2005-01-01
The contribution of H atoms in noncovalent interactions and enzymatic reactions underlies virtually all aspects of biology at the molecular level, yet their 'visualization' is quite difficult. To better understand the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR), a neutron diffraction study is under way to directly determine the accurate positions of H atoms within its active site. Despite exhaustive investigation of the catalytic mechanism of DHFR, controversy persists over the exact pathway associated with proton donation in reduction of the substrate, dihydrofolate. As the initial step in a proof-of-principle experiment which will identify ligand and residue protonation statesmore » as well as precise solvent structures, a neutron diffraction data set has been collected on a 0.3 mm{sup 3} D{sub 2}O-soaked crystal of ecDHFR bound to the anticancer drug methotrexate (MTX) using the LADI instrument at ILL. The completeness in individual resolution shells dropped to below 50% between 3.11 and 3.48 {angstrom} and the I/{sigma}(I) in individual shells dropped to below 2 at around 2.46 {angstrom}. However, reflections with I/{sigma}(I) greater than 2 were observed beyond these limits (as far out as 2.2 {angstrom}). To our knowledge, these crystals possess one of the largest primitive unit cells (P6{sub 1}, a = b = 92, c = 73 {angstrom}) and one of the smallest crystal volumes so far tested successfully with neutrons.« less
Surfactant-Enhanced Benard Convection on an Evaporating Drop
NASA Astrophysics Data System (ADS)
Nguyen, Van X.; Stebe, Kathleen J.
2001-11-01
Surfactant effects on an evaporating drop are studied experimentally. Using a fluorescent probe, the distribution and surface phase of the surfactant is directly imaged throughout the evaporation process. From these experiments, we identify conditions in which surfactants promote surface tension-driven Benard instabilities in aqueous systems. The drops under study contain finely divided particles, which act as tracers in the flow, and form well-defined patterns after the drop evaporates. Two flow fields have been reported in this system. The first occurs because the contact line becomes pinned by solid particles at the contact line region. In order for the contact line to remain fixed, an outward flow toward the ring results, driving further accumulation at the contact ring. A ‘coffee ring’ of particles is left as residue after the drop evaporates[1]. The second flow is Benard convection, driven by surface tension gradients on the drop[2,3]. In our experiments, an insoluble monolayer of pentadecanoic acid is spread at the interface of a pendant drop. The surface tension is recorded, and the drop is deposited on a well-defined solid substrate. Fluorescent images of the surface phase of the surfactant are recorded as the drop evaporates. The surfactant monolayer assumes a variety of surface states as a function of the area per molecule at the interface: surface gaseous, surface liquid expanded, and surface liquid condensed phases[4]. Depending upon the surface state of the surfactant as the drop evaporates, transitions of residue patterns left by the particles occur, from the coffee ring pattern to Benard cells to irregular patterns, suggesting a strong resistance to outward flow are observed. The occurrence of Benard cells on a surfactant-rich interface occurs when the interface is in LE-LC coexistence. Prior research concerning surfactant effects on this instability predict that surfactants are strongly stabilizing[5]. The mechanisms for this change in behavior are discussed. References: [1]R. D. Deegan,, PRE 61,475 (2000). [2]M. Maillard et al., J. Phys. Chem. B 104, 11871 (2000). [3]H. Wang et al. Langmuir 15, 957 (2001). [4]B. G. Moore et al., J. Phys. Chem. 94, 4588 (1990). [5]J. C. Berg & A. Acrivos, Chem. Eng. Sci. 20,737 (1965).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter
2006-08-01
This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less
Vieira, Diana; Figueiredo, Teresa A.; Verma, Anil; Sobral, Rita G.; Ludovice, Ana M.; de Lencastre, Hermínia; Trincao, Jose
2014-01-01
Amidation of peptidoglycan is an essential feature in Staphylococcus aureus that is necessary for resistance to β-lactams and lysozyme. GatD, a 27 kDa type I glutamine amidotransferase-like protein, together with MurT ligase, catalyses the amidation reaction of the glutamic acid residues of the peptidoglycan of S. aureus. The native and the selenomethionine-derivative proteins were crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol, sodium acetate and calcium acetate. The crystals obtained diffracted beyond 1.85 and 2.25 Å, respectively, and belonged to space group P212121. X-ray diffraction data sets were collected at Diamond Light Source (on beamlines I02 and I04) and were used to obtain initial phases. PMID:24817726
Ring-shaped stain patterns driven by solute reactive mesogens in liquid crystal solution
NASA Astrophysics Data System (ADS)
Cha, Tae Woon; Bulliard, Xavier; Choi, Sang Gun; Lee, Hyoung Sub; Kong, Hyang-Shik; Han, Sang Youn
2014-07-01
We report on the formation of ring-shaped stain patterns in a polymer-stabilized patterned vertical alignment mode liquid crystal display (LCD) during the cell filling process. Through the interpretation of the formation mechanism, an effective way to control its development is provided. Systematic trace of the reactive mesogens reveals that the formation of patterns is strongly related to the segregation of solute mesogens in the stain area. These undesirable patterns can be avoided or controlled by reducing the drop volume at each droplet using an inkjet printing technique, meaning that the printing technique could be a useful solution in display technology. For the formation of ring-shaped patterns, the dragging of reactive mesogens during the spreading of the liquid crystal solution plays a key role in the closed LCD cell.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee,Y.; Kumar, S.; Jobichen, C.
2007-01-01
Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Niemi, Merja, E-mail: merja.niemi@joensuu.fi; Jänis, Janne; Jylhä, Sirpa
The high-resolution mass-spectrometric characterization, crystallization and X-ray diffraction studies of a recombinant IgE Fab fragment in complex with bovine β-lactoglobulin are reported. A D1 Fab fragment containing the allergen-binding variable domains of the IgE antibody was characterized by ESI FT–ICR mass spectrometry and crystallized with bovine β-lactoglobulin (BLG) using the hanging-drop vapour-diffusion method at 293 K. X-ray data suitable for structure determination were collected to 2.8 Å resolution using synchrotron radiation. The crystal belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.0, b = 100.6, c = 168.1 Å. The three-dimensional structure ofmore » the D1 Fab fragment–BLG complex will provide the first insight into IgE antibody–allergen interactions at the molecular level.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen
2006-11-01
Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gao, Xiong-Zhuo; National Laboratory of Protein Engineering and Plant Genetic Engineering, College of Life Sciences, Peking University, Beijing 100871; Li, Lan-Fen
The SMU.961 protein from S. mutans was crystallized and preliminary characterization of the crystals, which diffracted to 2.9 Å resolution, shows them to belong to space group C2. The smu.961 gene encodes a putative protein of 183 residues in Streptococcus mutans, a major pathogen in human dental caries. The gene was cloned into expression vector pET28a and expressed in a substantial quantity in Escherichia coli strain BL21 (DE3) with a His tag at its N-terminus. The recombinant protein SMU.961 was purified to homogeneity in a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals suitable for X-ray diffraction weremore » obtained by the hanging-drop vapour-diffusion method and diffracted to 2.9 Å resolution at beamline I911-3, MAX-II-lab, Sweden. The crystal belonged to space group C2, with unit-cell parameters a = 98.62, b = 73.73, c = 184.73 Å, β = 98.82°.« less
Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi
2007-03-01
A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less
Mohamed Abubakkar, M; Saraboji, K; Ponnuswamy, M N
2013-02-01
Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively.
Acoustic Injectors for Drop-On-Demand Serial Femtosecond Crystallography.
Roessler, Christian G; Agarwal, Rakhi; Allaire, Marc; Alonso-Mori, Roberto; Andi, Babak; Bachega, José F R; Bommer, Martin; Brewster, Aaron S; Browne, Michael C; Chatterjee, Ruchira; Cho, Eunsun; Cohen, Aina E; Cowan, Matthew; Datwani, Sammy; Davidson, Victor L; Defever, Jim; Eaton, Brent; Ellson, Richard; Feng, Yiping; Ghislain, Lucien P; Glownia, James M; Han, Guangye; Hattne, Johan; Hellmich, Julia; Héroux, Annie; Ibrahim, Mohamed; Kern, Jan; Kuczewski, Anthony; Lemke, Henrik T; Liu, Pinghua; Majlof, Lars; McClintock, William M; Myers, Stuart; Nelsen, Silke; Olechno, Joe; Orville, Allen M; Sauter, Nicholas K; Soares, Alexei S; Soltis, S Michael; Song, Heng; Stearns, Richard G; Tran, Rosalie; Tsai, Yingssu; Uervirojnangkoorn, Monarin; Wilmot, Carrie M; Yachandra, Vittal; Yano, Junko; Yukl, Erik T; Zhu, Diling; Zouni, Athina
2016-04-05
X-ray free-electron lasers (XFELs) provide very intense X-ray pulses suitable for macromolecular crystallography. Each X-ray pulse typically lasts for tens of femtoseconds and the interval between pulses is many orders of magnitude longer. Here we describe two novel acoustic injection systems that use focused sound waves to eject picoliter to nanoliter crystal-containing droplets out of microplates and into the X-ray pulse from which diffraction data are collected. The on-demand droplet delivery is synchronized to the XFEL pulse scheme, resulting in X-ray pulses intersecting up to 88% of the droplets. We tested several types of samples in a range of crystallization conditions, wherein the overall crystal hit ratio (e.g., fraction of images with observable diffraction patterns) is a function of the microcrystal slurry concentration. We report crystal structures from lysozyme, thermolysin, and stachydrine demethylase (Stc2). Additional samples were screened to demonstrate that these methods can be applied to rare samples. Copyright © 2016 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, George J.; Garen, Craig R.; Cherney, Maia M.
2007-11-01
The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less
Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki
2015-01-01
NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3 Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977
Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wright, Helena; Kiss, András L.; Szeltner, Zoltán
2005-10-01
Acylaminoacyl peptidase from porcine liver has been crystallized. Data were collected to 3.4 Å from native crystals and a search for heavy-atom derivatives is in progress. Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris–HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl{sub 2} and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. Amore » full data set to 3.4 Å resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 Å and four molecules in the asymmetric unit.« less
Spectroscopic and laser cooling results on Yb3+-doped BaY2F8 single crystal
NASA Astrophysics Data System (ADS)
Bigotta, Stefano; Parisi, Daniela; Bonelli, Lucia; Toncelli, Alessandra; Tonelli, Mauro; Di Lieto, Alberto
2006-07-01
Anti-Stokes cooling has been observed in an Yb3+-doped BaY2F8 single crystal. Single crystals have been grown by the Czochralski technique. The absorption spectra and the emission properties have been measured at room temperature and at 10K. The energy positions of the Stark sublevels of the ground and the excited state manifolds have been determined and separated from the vibronic substructure. The intrinsic decay time of the F5/22 level has been measured taking care of avoiding the effect of multiple reabsorption processes. The theoretical and experimental cooling efficiencies of Yb:BaY2F8 are evaluated and compared with respect to those of the most frequently investigated materials for laser cooling. A temperature drop of almost 4K was measured by pumping the crystal with 3W of laser radiation at ˜1025nm in single pass configuration with a cooling efficiency of ˜3%.
Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.
Nanson, Jeffrey David; Forwood, Jade Kenneth
2014-01-01
The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in
2005-08-01
A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less
Casimir meets Poisson: improved quark/gluon discrimination with counting observables
Frye, Christopher; Larkoski, Andrew J.; Thaler, Jesse; ...
2017-09-19
Charged track multiplicity is among the most powerful observables for discriminating quark- from gluon-initiated jets. Despite its utility, it is not infrared and collinear (IRC) safe, so perturbative calculations are limited to studying the energy evolution of multiplicity moments. While IRC-safe observables, like jet mass, are perturbatively calculable, their distributions often exhibit Casimir scaling, such that their quark/gluon discrimination power is limited by the ratio of quark to gluon color factors. In this paper, we introduce new IRC-safe counting observables whose discrimination performance exceeds that of jet mass and approaches that of track multiplicity. The key observation is that trackmore » multiplicity is approximately Poisson distributed, with more suppressed tails than the Sudakov peak structure from jet mass. By using an iterated version of the soft drop jet grooming algorithm, we can define a “soft drop multiplicity” which is Poisson distributed at leading-logarithmic accuracy. In addition, we calculate the next-to-leading-logarithmic corrections to this Poisson structure. If we allow the soft drop groomer to proceed to the end of the jet branching history, we can define a collinear-unsafe (but still infrared-safe) counting observable. Exploiting the universality of the collinear limit, we define generalized fragmentation functions to study the perturbative energy evolution of collinear-unsafe multiplicity.« less
Casimir meets Poisson: improved quark/gluon discrimination with counting observables
DOE Office of Scientific and Technical Information (OSTI.GOV)
Frye, Christopher; Larkoski, Andrew J.; Thaler, Jesse
Charged track multiplicity is among the most powerful observables for discriminating quark- from gluon-initiated jets. Despite its utility, it is not infrared and collinear (IRC) safe, so perturbative calculations are limited to studying the energy evolution of multiplicity moments. While IRC-safe observables, like jet mass, are perturbatively calculable, their distributions often exhibit Casimir scaling, such that their quark/gluon discrimination power is limited by the ratio of quark to gluon color factors. In this paper, we introduce new IRC-safe counting observables whose discrimination performance exceeds that of jet mass and approaches that of track multiplicity. The key observation is that trackmore » multiplicity is approximately Poisson distributed, with more suppressed tails than the Sudakov peak structure from jet mass. By using an iterated version of the soft drop jet grooming algorithm, we can define a “soft drop multiplicity” which is Poisson distributed at leading-logarithmic accuracy. In addition, we calculate the next-to-leading-logarithmic corrections to this Poisson structure. If we allow the soft drop groomer to proceed to the end of the jet branching history, we can define a collinear-unsafe (but still infrared-safe) counting observable. Exploiting the universality of the collinear limit, we define generalized fragmentation functions to study the perturbative energy evolution of collinear-unsafe multiplicity.« less
Invariant patterns in crystal lattices: Implications for protein folding algorithms
DOE Office of Scientific and Technical Information (OSTI.GOV)
HART,WILLIAM E.; ISTRAIL,SORIN
2000-06-01
Crystal lattices are infinite periodic graphs that occur naturally in a variety of geometries and which are of fundamental importance in polymer science. Discrete models of protein folding use crystal lattices to define the space of protein conformations. Because various crystal lattices provide discretizations of the same physical phenomenon, it is reasonable to expect that there will exist invariants across lattices related to fundamental properties of the protein folding process. This paper considers whether performance-guaranteed approximability is such an invariant for HP lattice models. The authors define a master approximation algorithm that has provable performance guarantees provided that a specificmore » sublattice exists within a given lattice. They describe a broad class of crystal lattices that are approximable, which further suggests that approximability is a general property of HP lattice models.« less
Dynamics of initial drop splashing on a dry smooth surface.
Wu, Zhenlong; Cao, Yihua
2017-01-01
We simulate the onset and evolution of the earliest splashing of an infinite cylindrical liquid drop on a smooth dry solid surface. A tiny splash is observed to be emitted out of the rim of the lamella in the early stage of the impact. We find that the onset time of the splash is primarily dependent on the characteristic timescale, which is defined by the impact velocity as well as the drop radius, with no strong dependence on either the liquid viscosity or surface tension. Three regimes are found to be responsible for different splashing patterns. The outermost ejected droplets keep extending radially at a uniform speed proportional to the impact speed. Finally, we discuss the underlying mechanism which is responsible for the occurrence of the initial drop splash in the study.
Crystallization and X-ray diffraction of crystals formed in water-plasticized amorphous lactose.
Jouppila, K; Kansikas, J; Roos, Y H
1998-01-01
Effects of storage time and relative humidity on crystallization and crystal forms produced from amorphous lactose were investigated. Crystallization was observed from time-dependent loss of sorbed water and increasing intensities of peaks in X-ray diffraction patterns. The rate of crystallization increased with increasing storage relative humidity. Lactose crystallized mainly as alpha-lactose monohydrate and anhydrous crystals with alpha- and beta-lactose in a molar ratio of 5:3. The results suggested that the crystal form was defined by the early nucleation process. The crystallization data are important in modeling of crystallization phenomena and prediction of stability of lactose-containing food and pharmaceutical materials.
Summaries of early materials processing in space experiments
NASA Technical Reports Server (NTRS)
Naumann, R. J.; Mason, D.
1979-01-01
Objectives, methods, and results of low-gravity materials processing experiments are summarized, and a bibliography of published results for each experiment is provided. Included are drop tower experiments, the Apollo demonstration experiments, the skylab experiments and demonstration experiments, and the Apollo-Soyuz experiments and demonstrations. The findings of these experiments in the fields of crystal growth, metallurgy, and fluid behavior are summarized.
Thermotropic Liquid Crystals with Nitrocinnamylidene Unit
1988-10-14
added through dropping funnel. Stir for 2 hrs before precipitated from distilled water . The crude yellow product was redissolved in chloroform and dried...rate 1O*C/hr) for overnight. Filter through celite and ceramic filtration funnel before precipitating with distilled water . The crude product was...Table 1. Cinnamylidene-P-octyloxyaniline was synthesized primarily by reacting cinnamaldehyde with p-octyloxyaniline and exhibits no mesomorphic property
Idealized simulation of the Colorado hailstorm case: comparison of bulk and detailed microphysics
NASA Astrophysics Data System (ADS)
Geresdi, I.
One of the purposes of the Fourth Cloud Modeling Workshop was to compare different microphysical treatments. In this paper, the results of a widely used bulk treatment and five versions of a detailed microphysical model are presented. Sensitivity analysis was made to investigate the effect of bulk parametrization, ice initiation technique, CCN concentration and collision efficiency of rimed ice crystal-drop collision. The results show that: (i) The mixing ratios of different species of hydrometeors calculated by bulk and one of the detailed models show some similarity. However, the processes of hail/graupel formation are different in the bulk and the detailed models. (ii) Using different ice initiation in the detailed models' different processes became important in the hail and graupel formation. (iii) In the case of higher CCN concentration, the mixing ratio of liquid water, hail and graupel were more sensitive to the value of collision efficiency of rimed ice crystal-drop collision. (iv) The Bergeron-Findeisen process does not work in the updraft core of a convective cloud. The vapor content was always over water saturation; moreover, the supersaturation gradually increased after the appearance of precipitation ice particles.
Su, Junwei; Charmchi, Majid; Sun, Hongwei
2016-01-01
Dropwise condensation (DWC) on hydrophobic surfaces is attracting attention for its great potential in many industrial applications, such as steam power plants, water desalination, and de-icing of aerodynamic surfaces, to list a few. The direct dynamic characterization of liquid/solid interaction can significantly accelerate the progress toward a full understanding of the thermal and mass transport mechanisms during DWC processes. This work reports a novel Quartz Crystal Microbalance (QCM) based method that can quantitatively analyze the interaction between water droplets and micropillar surfaces during different condensation states such as filmwise, Wenzel, and partial Cassie states. A combined nanoimprinting lithography and chemical surface treatment approach was utilized to fabricate the micropillar based superhydrophobic and superhydrophilic surfaces on the QCM substrates. The normalized frequency shift of the QCM device together with the microscopic observation of the corresponding drop motion revealed the droplets growth and their coalescence processes and clearly demonstrated the differences between the three aforementioned condensation states. In addition, the transition between Cassie and Wenzel states was successfully captured by this method. The newly developed QCM system provides a valuable tool for the dynamic characterization of different condensation processes. PMID:27739452
Climate warming may increase aphids' dropping probabilities in response to high temperatures.
Ma, Gang; Ma, Chun-Sen
2012-11-01
Dropping off is considered an anti-predator behavior for aphids since previous studies have shown that it reduces the risk of predation. However, little attention is paid to dropping behavior triggered by other external stresses such as daytime high temperatures which are predicted to become more frequent in the context of climate warming. Here we defined a new parameter, drop-off temperature (DOT), to describe the critical temperature at which an aphid drops off its host plant when the ambient temperature increases gradually and slowly. Detailed studies were conducted to reveal effects of short-term acclimation (temperature, exposure time at high-temperature and starvation) on DOT of an aphid species, Sitobion avenae. Our objectives were to test if the aphids dropped off host plant to avoid high temperatures and how short-term acclimation affected the aphids' dropping behavior in response to heat stress. We suggest that dropping is a behavioral thermoregulation to avoid heat stress, since aphids started to move before they dropped off and the dropped aphids were still able to control their muscles prior to knockdown. The adults starved for 12 h had higher DOT values than those that were unstarved or starved for 6 h, and there was a trade-off between behavioral thermoregulation and energy acquisition. Higher temperatures and longer exposure times at high temperatures significantly lowered the aphids' DOT, suggested that the aphids avoid heat stress by dropping when exposed to high temperatures. Climate warming may therefore increase the aphids' dropping probabilities and consequently affect the aphids' individual development and population growth. Copyright © 2012 Elsevier Ltd. All rights reserved.
Lecithin-linker formulations for self-emulsifying delivery of nutraceuticals.
Chu, Jacquelene; Cheng, Yu-Ling; Rao, A Venketeshwer; Nouraei, Mehdi; Zarate-Muñoz, Silvia; Acosta, Edgar J
2014-08-25
Lecithin-linker microemulsions are formulations produced with soybean lecithin in combination with a highly lipophilic (lipophilic linker) and highly hydrophilic (hydrophilic linkers) surfactant-like additives. In this work, lecithin-linker systems were formulated to produce self-emulsifying delivery systems for β-carotene and β-sitosterol. The concentration of the lipophilic linker, sorbitan monooleate, was adjusted to minimize the formation of liquid crystals. The concentration of hydrophilic linkers, decaglyceryl caprylate/caprate and PEG-6-caprylic/capric glycerides, was gradually increased (scanned) until single phase clear microemulsions were obtained. For these scans, the oil (ethyl caprate) to water ratio was set to 1. The single phase, clear microemulsions were diluted with fed-state simulated intestinal fluid (FeSSIF) and produced stable emulsions, with drop sizes close to 200 nm. Using pseudo-ternary phase diagrams to evaluate the process of dilution of microemulsion preconcentrates (mixtures of oil, lecithin and linkers with little or no water) with FeSSIF, it was determined that self-emulsifying systems are obtained when the early stages of the dilution produce single phase microemulsions. If liquid crystals or multiple phase systems are obtained during those early stages, then the emulsification yields unstable emulsions with large drop sizes. An in vitro permeability study conducted using a Flow-Thru Dialyzer revealed that stable emulsions with drop sizes of 150-300 nm produce large and irreversible permeation of β-carotene to sheep intestine. On the other hand, unstable emulsions produced without the linker combination separated in the dialyzer chamber. Copyright © 2014 Elsevier B.V. All rights reserved.
Control and measurement of the phase behavior of aqueous solutions using microfluidics
Shim, Jung-uk; Cristobal, Galder; Link, Darren R.; Thorsen, Todd; Jia, Yanwei; Piattelli, Katie; Fraden, Seth
2008-01-01
A microfluidic device denoted the Phase Chip has been designed to measure and manipulate the phase diagram of multi-component fluid mixtures. The Phase Chip exploits the permeation of water through poly(dimethylsiloxane) (PDMS) in order to controllably vary the concentration of solutes in aqueous nanoliter volume microdrops stored in wells. The permeation of water in the Phase Chip is modeled using the diffusion equation and good agreement between experiment and theory is obtained. The Phase Chip operates by first creating drops of the water/solute mixture whose composition varies sequentially. Next, drops are transported down channels and guided into storage wells using surface tension forces. Finally, the solute concentration of each stored drop is simultaneously varied and measured. Two applications of the Phase Chip are presented. First, the phase diagram of a polymer/salt mixture is measured on-chip and validated off-chip and second, protein crystallization rates are enhanced through the manipulation of the kinetics of nucleation and growth. PMID:17580868
Viscosity Measurement Using Drop Coalescence in Microgravity
NASA Technical Reports Server (NTRS)
Antar, Basil N.; Ethridge, Edwin C.; Maxwell, Daniel; Curreri, Peter A. (Technical Monitor)
2002-01-01
We present in here validation studies of a new method for application in microgravity environment which measures the viscosity of highly viscous undercooled liquids using drop coalescence. The method has the advantage of avoiding heterogeneous nucleation at container walls caused by crystallization of undercooled liquids during processing. Homogeneous nucleation can also be avoided due to the rapidity of the measurement using this method. The technique relies on measurements from experiments conducted in near zero gravity environment as well as highly accurate analytical formulation for the coalescence process. The viscosity of the liquid is determined by allowing the computed free surface shape relaxation time to be adjusted in response to the measured free surface velocity for two coalescing drops. Results are presented from two sets of validation experiments for the method which were conducted on board aircraft flying parabolic trajectories. In these tests the viscosity of a highly viscous liquid, namely glycerin, was determined at different temperatures using the drop coalescence method described in here. The experiments measured the free surface velocity of two glycerin drops coalescing under the action of surface tension alone in low gravity environment using high speed photography. The liquid viscosity was determined by adjusting the computed free surface velocity values to the measured experimental data. The results of these experiments were found to agree reasonably well with the known viscosity for the test liquid used.
Mechanisms and Control of Self-Emulsification upon Freezing and Melting of Dispersed Alkane Drops.
Valkova, Zhulieta; Cholakova, Diana; Tcholakova, Slavka; Denkov, Nikolai; Smoukov, Stoyan K
2017-10-31
Emulsification requires drop breakage and creation of a large interfacial area between immiscible liquid phases. Usually, high-shear or high-pressure emulsification devices that generate heat and increase the emulsion temperature are used to obtain emulsions with micrometer and submicrometer droplets. Recently, we reported a new, efficient procedure of self-emulsification (Tcholakova et al. Nat. Commun. 2017, 8, 15012), which consists of one to several cycles of freezing and melting of predispersed alkane drops in a coarse oil-in-water emulsion. Within these freeze-thaw cycles of the dispersed drops, the latter burst spontaneously into hundreds and thousands of smaller droplets without using any mechanical agitation. Here, we clarify the main factors and mechanisms, which drive this self-emulsification process, by exploring systematically the effects of the oil and surfactant types, the cooling rate, and the initial drop size. We show that the typical size of the droplets, generated by this method, is controlled by the size of the structural domains formed in the cooling-freezing stage of the procedure. Depending on the leading mechanism, these could be the diameter of the fibers formed upon drop self-shaping or the size of the crystal domains formed at the moment of drop-freezing. Generally, surfactant tails that are 0-2 carbon atoms longer than the oil molecules are most appropriate to observe efficient self-emulsification. The specific requirements for the realization of different mechanisms are clarified and discussed. The relative efficiencies of the three different mechanisms, as a function of the droplet size and cooling procedure, are compared in controlled experiments to provide guidance for understanding and further optimization and scale-up of this self-emulsification process.
Ground based research in microgravity materials processing
NASA Technical Reports Server (NTRS)
Workman, Gary L.; Rathz, Tom
1994-01-01
The core activities performed during this time period have been concerned with tracking the TEMPEST experiments on the shuttle with drops of Zr, Ni, and Nb alloys. In particular a lot of Zr drops are being made to better define the recalescence characteristics of that system so that accurate comparisons of the drop tube results with Tempest can be made. A new liner, with minimal reflectivity characteristics, has been inserted into the drop tube in order to improve the recalescence measurements of the falling drops. The first installation to make the geometric measurements to ensure a proper fit has been made. The stovepipe sections are currently in the shop at MSFC being painted with low reflectivity black paint. Work has also continued on setting up the MEL apparatus obtained from Oak Ridge in the down stairs laboratory at the Drop Tube Facilities. Some ground-based experiments on the same metals as are being processed on TEMPEST are planned for the MEL. The flight schedules for the KC-135 experiments are still to be determined in the near future.
Dielectric evidence for possible type-II multiferroicity in α-RuCl3
NASA Astrophysics Data System (ADS)
Zheng, JiaCheng; Cui, Yi; Li, TianRun; Ran, KeJing; Wen, JinSheng; Yu, WeiQiang
2018-05-01
$\\alpha$-RuCl$_3$ is a Mott insulator with a honeycomb lattice with strong spin-orbit coupling. We report dielectric measurements on $\\alpha$-RuCl$_3$ single crystals under field. At zero field, the dielectric constant, $\\epsilon$, drops rapidly when cooled through the magnetic transition temperature T$_N$. With increasing field, the onset of the drop in $\\epsilon$ tracks the T$_N$. Such behavior is absent with field above a critical value H$_c$ ~ 7.5 T, indicating the onset of a quantum phase transition. Our data suggest that the dielectric constant can be used as a probe of magnetic ordering in $\\alpha$-RuCl$_3$, and $\\alpha$-RuCl$_3$ is a possible type-II multiferroics.
Counit Inclusion in Hydrogenated Polynorbornene Copolymer Crystals
NASA Astrophysics Data System (ADS)
Burns, Adam; Showak, Michael; Stella, Andrew; Register, Richard
2014-03-01
Crystallization in poly(A-co-B) random copolymers, where homopolymer A is crystalline but B is not, is dictated by the degree to which crystals of A can include B units. Typically, B units are strongly excluded from the A crystals, drastically reducing the degree of crystallinity wc and crystal thickness tc even at modest comonomer contents. However, in some cases, B units can be incorporated into the crystals as defects, significantly diminishing the counits' impact on wc and tc. The extent and consequences of counit inclusion have been investigated in hydrogenated polynorbornene (hPN) with alkylnorbornene counits, synthesized by living ring-opening metathesis polymerization followed by hydrogenation. In the case of 5-hexylnorbornene (HxN) counits, a steep decline in wc and tc with counit content is found, indicative of strong exclusion. In contrast, when the counits are 5-methylnorbornene (MeN), extensive inclusion of MeN units into the crystals is observed. hP(N-co-MeN) copolymers maintain appreciable crystallinity above 30 mol% MeN, and the dependence of the melting point Tm on tc tracks that of the hPN homopolymer. Four times as much MeN as HxN (molar basis) is required to produce a comparable drop in wc. Therefore, copolymerization with MeN can be used to tune Tm without drastically reducing wc. Additionally, hPN exhibits a polymorphic transition to a rotationally disordered (RD) crystal at temperature Tcc
A Genetic Screen for Mutants with Supersized Lipid Droplets in Caenorhabditis elegans
Li, Shiwei; Xu, Shibin; Ma, Yanli; Wu, Shuang; Feng, Yu; Cui, Qingpo; Chen, Lifeng; Zhou, Shuang; Kong, Yuanyuan; Zhang, Xiaoyu; Yu, Jialei; Wu, Mengdi; Zhang, Shaobing O.
2016-01-01
To identify genes that regulate the dynamics of lipid droplet (LD) size, we have used the genetically tractable model organism Caenorhabditis elegans, whose wild-type LD population displays a steady state of size with an upper limit of 3 μm in diameter. From a saturated forward genetic screen of 6.7 × 105 mutagenized haploid genomes, we isolated 118 mutants with supersized intestinal LDs often reaching 10 μm. These mutants define nine novel complementation groups, in addition to four known genes (maoc-1, dhs-28, daf-22, and prx-10). The nine groups are named drop (lipid droplet abnormal) and categorized into four classes. Class I mutants drop-5 and drop-9, similar to prx-10, are up-regulated in ACS-22-DGAT-2-dependent LD growth, resistant to LD hydrolysis, and defective in peroxisome import. Class II mutants drop-2, drop-3, drop-6, and drop-7 are up-regulated in LD growth, are resistant to LD hydrolysis, but are not defective in peroxisome import. Class III mutants drop-1 and drop-8 are neither up-regulated in LD growth nor resistant to LD hydrolysis, but seemingly up-regulated in LD fusion. Class IV mutant drop-4 is cloned as sams-1 and, different to the other three classes, is ACS-22-independent and hydrolysis-resistant. These four classes of supersized LD mutants should be valuable for mechanistic studies of LD cellular processes including growth, hydrolysis, and fusion. PMID:27261001
Code of Federal Regulations, 2012 CFR
2012-07-01
... once per applicable certification test cycle as defined in appendix I, paragraph (f), of this part, or... engine is speed is greater than or equal to 50% (as defined in § 1065.610, Eq. 1065.610-3) and engine... emission test conditions. For purposes of this paragraph, the detectable change in pressure drop is defined...
Code of Federal Regulations, 2013 CFR
2013-07-01
... once per applicable certification test cycle as defined in appendix I, paragraph (f), of this part, or... engine is speed is greater than or equal to 50% (as defined in § 1065.610, Eq. 1065.610-3) and engine... emission test conditions. For purposes of this paragraph, the detectable change in pressure drop is defined...
Dynamics of initial drop splashing on a dry smooth surface
Wu, Zhenlong; Cao, Yihua
2017-01-01
We simulate the onset and evolution of the earliest splashing of an infinite cylindrical liquid drop on a smooth dry solid surface. A tiny splash is observed to be emitted out of the rim of the lamella in the early stage of the impact. We find that the onset time of the splash is primarily dependent on the characteristic timescale, which is defined by the impact velocity as well as the drop radius, with no strong dependence on either the liquid viscosity or surface tension. Three regimes are found to be responsible for different splashing patterns. The outermost ejected droplets keep extending radially at a uniform speed proportional to the impact speed. Finally, we discuss the underlying mechanism which is responsible for the occurrence of the initial drop splash in the study. PMID:28493989
LSA Large Area Silicon Sheet Task Continuous Czochralski Process Development
NASA Technical Reports Server (NTRS)
Rea, S. N.
1979-01-01
A commercial Czochralski crystal growing furnace was converted to a continuous growth facility by installation of a small, in-situ premelter with attendant silicon storage and transport mechanisms. Using a vertical, cylindrical graphite heater containing a small fused quartz test tube linear from which the molten silicon flowed out the bottom, approximately 83 cm of nominal 5 cm diamter crystal was grown with continuous melt addition furnished by the test tube premelter. High perfection crystal was not obtained, however, due primarily to particulate contamination of the melt. A major contributor to the particulate problem was severe silicon oxide buildup on the premelter which would ultimately drop into the primary melt. Elimination of this oxide buildup will require extensive study and experimentation and the ultimate success of continuous Czochralski depends on a successful solution to this problem. Economically, the continuous Czochralski meets near-term cost goals for silicon sheet material.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hu, Guan-Jing; Li, Lan-Fen; Li, Dan
2007-09-01
A glucosamine 6-phosphate deaminase homologue from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.4 Å resolution. The SMU.636 protein from Streptococcus mutans is a putative glucosamine 6-phosphate deaminase with 233 residues. The smu.636 gene was PCR-amplified from S. mutans genomic DNA and cloned into the expression vector pET-28a(+). The resultant His-tagged fusion protein was expressed in Escherichia coli and purified to homogeneity in two steps. Crystals of the fusion protein were obtained by the hanging-drop vapour-diffusion method. The crystals diffracted to 2.4 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, withmore » unit-cell parameters a = 53.83, b = 82.13, c = 134.70 Å.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaur, Vineet; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in
The purification, identification, crystallization and preliminary crystallographic studies of an allergy-related protein, Pru du amandin, from P. dulcis nuts are reported. Food allergies appear to be one of the foremost causes of hypersensitivity reactions. Nut allergies account for most food allergies and are often permanent. The 360 kDa hexameric protein Pru du amandin, a known allergen, was purified from almonds (Prunus dulcis) by ammonium sulfate fractionation and ion-exchange chromatography. The protein was identified by a BLAST homology search against the nonredundant sequence database. Pru du amandin belongs to the 11S legumin family of seed storage proteins characterized by the presencemore » of a cupin motif. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 150.7, c = 164.9 Å.« less
Rosenthal, Cindy; Mueller, Uwe; Panjikar, Santosh; Sun, Lianli; Ruppert, Martin; Zhao, Yu; Stöckigt, Joachim
2006-01-01
Perakine reductase (PR) is a novel member of the aldo-keto reductase enzyme superfamily from higher plants. PR from the plant Rauvolfia serpentina is involved in the biosynthesis of monoterpenoid indole alkaloids by performing NADPH-dependent reduction of perakine, yielding raucaffrinoline. However, PR can also reduce cinnamic aldehyde and some of its derivatives. After heterologous expression of a triple mutant of PR in Escherichia coli, crystals of the purified and methylated enzyme were obtained by the hanging-drop vapour-diffusion technique at 293 K with 100 mM sodium citrate pH 5.6 and 27% PEG 4000 as precipitant. Crystals belong to space group C2221 and diffract to 2.0 Å, with unit-cell parameters a = 58.9, b = 93.0, c = 143.4 Å. PMID:17142919
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra
The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less
NASA Astrophysics Data System (ADS)
Sowa, Michał; Ślepokura, Katarzyna; Matczak-Jon, Ewa
2014-01-01
Combination of two Active Pharmaceutical Ingredients, myricetin and piracetam, yields a 1:1 cocrystal characterized by X-ray single-crystal and powder diffraction, Raman spectroscopy, 1H NMR, thermal analysis (DSC and TG-DTA) methods. Constituents of the cocrystalline phase were also investigated in terms of Hirshfeld surfaces. Compounds in their neutral forms cocrystallize in the Pna21 space group of orthorhombic system. Notably, piracetam adopts an uncommon conformation, not encountered in its cocrystals previously described. In the crystal lattice, a three-dimensional hydrogen-bonded network is observed, including formation of a 2D molecular scaffolding motif. A scale-up procedure is readily available with use of solvent-drop grinding method, in which application of a variety of common solvents leads to formation of the cocrystal, as confirmed by XRPD and Raman spectroscopy.
Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel
2014-09-01
TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.
Hu, Wenxin; Wang, Qihai; Bi, Ruchang
2005-12-01
Diadenosine tetraphosphate (Ap4A) hydrolase (EC 3.6.1.41) hydrolyzes Ap4A symmetrically in prokaryotes. It plays a potential role in organisms by regulating the concentration of Ap4A in vivo. To date, no three-dimensional structures of proteins with significant sequence homology to this protein have been determined. The 31.3 kDa Ap4A hydrolase from Shigella flexneri 2a has been cloned, expressed and purified using an Escherichia coli expression system. Crystals of Ap4A hydrolase have been obtained by the hanging-drop technique at 291 K using PEG 550 MME as precipitant. Ap4A hydrolase crystals diffract X-rays to 3.26 A and belong to space group P2(1), with unit-cell parameters a = 118.9, b = 54.6, c = 128.5 A, beta = 95.7 degrees.
Perederina, Anna; Esakova, Olga; Quan, Chao; Khanova, Elena; Krasilnikov, Andrey S
2010-01-01
Eukaryotic ribonucleases P and MRP are closely related RNA-based enzymes which contain a catalytic RNA component and several protein subunits. The roles of the protein subunits in the structure and function of eukaryotic ribonucleases P and MRP are not clear. Crystals of a complex that included a circularly permuted 46-nucleotide-long P3 domain of the RNA component of Saccharomyces cerevisiae ribonuclease MRP and selenomethionine derivatives of the shared ribonuclease P/MRP protein components Pop6 (18.2 kDa) and Pop7 (15.8 kDa) were obtained using the sitting-drop vapour-diffusion method. The crystals belonged to space group P4(2)22 (unit-cell parameters a = b = 127.2, c = 76.8 A, alpha = beta = gamma = 90 degrees ) and diffracted to 3.25 A resolution.
Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru
2009-01-01
(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lundgren, Stina; Andersen, Birgit; Piškur, Jure
2007-10-01
β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less
Crystal growth velocity in deeply undercooled Ni-Si alloys
NASA Astrophysics Data System (ADS)
Lü, Y. J.
2012-02-01
The crystal growth velocity of Ni95Si5 and Ni90Si10 alloys as a function of undercooling is investigated using molecular dynamics simulations. The modified imbedded atom method potential yields the equilibrium liquidus temperatures T L ≈ 1505 and 1387 K for Ni95Si5 and Ni90Si10 alloys, respectively. From the liquidus temperatures down to the deeply undercooled region, the crystal growth velocities of both the alloys rise to the maximum with increasing undercooling and then drop slowly, whereas the athermal growth process presented in elemental Ni is not observed in Ni-Si alloys. Instead, the undercooling dependence of the growth velocity can be well-described by the diffusion-limited model, furthermore, the activation energy associated with the diffusion from melt to interface increases as the concentration increases from 5 to 10 at.% Si, resulting in the remarkable decrease of growth velocity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nelersa, Claudiu M.; Schmier, Brad J.; Malhotra, Arun
2012-05-08
The final step in RNA degradation is the hydrolysis of RNA fragments five nucleotides or less in length (nanoRNA) to mononucleotides. In Escherichia coli this step is carried out by oligoribonuclease (Orn), a DEDD-family exoribonuclease that is conserved throughout eukaryotes. However, many bacteria lack Orn homologs, and an unrelated DHH-family phosphoesterase, NrnA, has recently been identified as one of the enzymes responsible for nanoRNA degradation in Bacillus subtilis. To understand its mechanism of action, B. subtilis NrnA was purified and crystallized at room temperature using the hanging-drop vapor-diffusion method with PEG 4000, PEG 3350 or PEG MME 2000 as precipitant.more » The crystals belonged to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 50.62, b = 121.3, c = 123.4 {angstrom}, {alpha} = 90, {beta} = 91.31, {gamma} = 90{sup o}.« less
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-01-01
The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288
Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi
2010-07-01
The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.
Preparation for microgravity - The role of the Microgravity Material Science Laboratory
NASA Technical Reports Server (NTRS)
Johnston, J. Christopher; Rosenthal, Bruce N.; Meyer, Maryjo B.; Glasgow, Thomas K.
1988-01-01
Experiments at the NASA Lewis Research Center's Microgravity Material Science Laboratory using physical and mathematical models to delineate the effects of gravity on processes of scientific and commercial interest are discussed. Where possible, transparent model systems are used to visually track convection, settling, crystal growth, phase separation, agglomeration, vapor transport, diffusive flow, and polymer reactions. Materials studied include metals, alloys, salts, glasses, ceramics, and polymers. Specific technologies discussed include the General Purpose furnace used in the study of metals and crystal growth, the isothermal dendrite growth apparatus, the electromagnetic levitator/instrumented drop tube, the high temperature directional solidification furnace, the ceramics and polymer laboratories and the center's computing facilities.
Reconditioning perovskite films in vapor environments through repeated cation doping
NASA Astrophysics Data System (ADS)
Boonthum, Chirapa; Pinsuwan, Kusuma; Ponchai, Jitprabhat; Srikhirin, Toemsak; Kanjanaboos, Pongsakorn
2018-06-01
Perovskites have attracted considerable attention for application as high-efficiency photovoltaic devices owing to their low-cost and low-temperature fabrication. A good surface and high crystallinity are necessary for high-performance devices. We examine the negative effects of chemical ambiences on the perovskite crystal formation and morphology. The repeated cation doping (RCD) technique was developed to remedy these issues by gradually dropping methylammonium ions on top of about-to-form perovskite surfaces to cause recrystallization. RCD promotes pinhole-free, compact, and polygonal-like surfaces under various vapor conditions. Furthermore, it enhances the electronic properties and crystallization. The benefits of RCD extend beyond perovskites under vapor ambiences, as it can improve regular and wasted perovskites.
Electrodiagnosis of ulnar neuropathy at the elbow (Une): a Bayesian approach.
Logigian, Eric L; Villanueva, Raissa; Twydell, Paul T; Myers, Bennett; Downs, Marlene; Preston, David C; Kothari, Milind J; Herrmann, David N
2014-03-01
In ulnar neuropathy at the elbow (UNE), we determined how electrodiagnostic cutoffs [across-elbow ulnar motor conduction velocity slowing (AECV-slowing), drop in across-elbow vs. forearm CV (AECV-drop)] depend on pretest probability (PreTP). Fifty clinically defined UNE patients and 50 controls underwent ulnar conduction testing recording abductor digiti minimi (ADM) and first dorsal interosseous (FDI), stimulating wrist, below-elbow, and 6-, 8-, and 10-cm more proximally. For various PreTPs of UNE, the cutoffs required to confirm UNE (defined as posttest probability = 95%) were determined with receiver operator characteristic (ROC) curves and Bayes Theorem. On ROC and Bayesian analyses, the ADM 10-cm montage was optimal. For PreTP = 0.25, the confirmatory cutoffs were >23 m/s (AECV-drop), and <38 m/s (AECV-slowing); for PreTP = 0.75, they were much less conservative: >14 m/s, and <47 m/s, respectively. (1) In UNE, electrodiagnostic cutoffs are critically dependent on PreTP; rigid cutoffs are problematic. (2) AE distances should be standardized and at least 10 cm. Copyright © 2013 Wiley Periodicals, Inc.
Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan
2014-11-01
GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.
Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study
Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta
2015-01-01
The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689
DOE Office of Scientific and Technical Information (OSTI.GOV)
Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel
2006-01-01
The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less
Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen
2008-07-09
The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.
Purification of a Multidrug Resistance Transporter for Crystallization Studies
Alegre, Kamela O.; Law, Christopher J.
2015-01-01
Crystallization of integral membrane proteins is a challenging field and much effort has been invested in optimizing the overexpression and purification steps needed to obtain milligram amounts of pure, stable, monodisperse protein sample for crystallography studies. Our current work involves the structural and functional characterization of the Escherichia coli multidrug resistance transporter MdtM, a member of the major facilitator superfamily (MFS). Here we present a protocol for isolation of MdtM to increase yields of recombinant protein to the milligram quantities necessary for pursuit of structural studies using X-ray crystallography. Purification of MdtM was enhanced by introduction of an elongated His-tag, followed by identification and subsequent removal of chaperonin contamination. For crystallization trials of MdtM, detergent screening using size exclusion chromatography determined that decylmaltoside (DM) was the shortest-chain detergent that maintained the protein in a stable, monodispersed state. Crystallization trials of MdtM performed using the hanging-drop diffusion method with commercially available crystallization screens yielded 3D protein crystals under several different conditions. We contend that the purification protocol described here may be employed for production of high-quality protein of other multidrug efflux members of the MFS, a ubiquitous, physiologically and clinically important class of membrane transporters. PMID:27025617
Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi
2010-05-01
The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.
The luminescence characteristics of CsI(Na) crystal under α and X/γ excitation
NASA Astrophysics Data System (ADS)
Liu, Jinliang; Liu, Fang; Ouyang, Xiaoping; Liu, Bin; Chen, Liang; Ruan, Jinlu; Zhang, Zhongbing; Liu, Jun
2013-01-01
In this paper, we study the effective decay time characteristic of CsI(Na) crystal under 239Pu alpha particle and 137Cs gamma-ray excitation using a single photon counting decay time measurement system. The measurement system employs a silicon optical fiber to couple and transit single photon. The slow decay time component of CsI(Na) crystal is 460-550 ns. We observe a 15 ns fast decay component under alpha particle excitation. In addition, we find that the primary stage of the falling edge in the decay time curve is non-exponential and drops rapidly when CsI(Na) crystal is excited by 239Pu alpha particles. Since the high density of self-trapped-excitons (STEs) is produced in alpha particle excitation process, we propose that the fast falling edge is corresponding to the quenching process of STEs which transit with non-radiation in the case of high excitation density. To prove this proposal, we excited the CsI(Na) crystal with sub-nanosecond intensive pulsed X-ray radiation. Our X-ray impinging results show that the fast falling edge also exists under low energy (average 100 keV) bremsstrahlung X-ray excitation.
NASA Technical Reports Server (NTRS)
Quade, D. A.
1978-01-01
The airplane flutter and maneuver-gust load analysis results obtained during B-52B drop test vehicle configuration (with fins) evaluation are presented. These data are presented as supplementary data to that given in Volume 1 of this document. A brief mathematical description of airspeed notation and gust load factor criteria are provided as a help to the user. References are defined which provide mathematical description of the airplane flutter and load analysis techniques. Air-speed-load factor diagrams are provided for the airplane weight configurations reanalyzed for finned drop test vehicle configuration.
Protein Crystallization Using Room Temperature Ionic Fluids
NASA Technical Reports Server (NTRS)
Pusey, Marc L.; Paley, Mark Steve; Turner, Megan B.; Rogers, Robin D.
2006-01-01
The ionic liquids (ILs) 1-butyl-3-methylimidizolium chloride (C4mim-C1), 1-butyl-3- methylimidizolium diethyleneglycol monomethylethersulfate ([C4mim]DEMGS), and 1-butyl-1 -methylpyrollidinium dihydrogenphosphate ([p1,4]dhp) were tested for their effects on the crystallization of the proteins canavalin, beta-lactoglobulin B, xylanase, and glucose isomerase, using a standard high throughput screen. The crystallization experiments were set up with the ILs added to the protein solutions at 0.2 and 0.4 M final concentrations. Crystallization droplets were set up at three proteixprecipitant ratios (1:1, 2:1, and 4:l), which served to progressively dilute the effects of the screen components while increasing the equilibrium protein and IL concentrations. Crystals were obtained for all four proteins at a number of conditions where they were not obtained from the IL-free control experiment. Over half of the protein-IL combinations tested had more successful outcomes than negative, where the IL-free crystallization was better than the corresponding IL-containing outcome, relative to the control. One of the most common causes of a negative outcome was solubilization of the protein by the IL, resulting in a clear drop. In one instance, we were able to use the IL-induced solubilizing to obtain beta-lactoglobulin B crystals from conditions that gave precipitated protein in the absence of IL. The results suggest that it may be feasible to develop ILs specifically for the task of macromolecule crystallization.
Li, Z Y; Lam, W M; Yang, C; Xu, B; Ni, G X; Abbah, S A; Cheung, K M C; Luk, K D K; Lu, W W
2007-03-01
Recently, strontium (Sr) as ranelate compound has become increasingly popular in the treatment of osteoporosis. However, the lattice structure of bone crystal after Sr incorporation is yet to be extensively reported. In this study, we synthesized strontium-substituted hydroxyapatite (Sr-HA) with different Sr content (0.3%, 1.5% and 15% Sr-HA in mole ratio) to simulate bone crystals incorporated with Sr. The changes in chemical composition and lattice structure of apetite after synthetic incorporation of Sr were evaluated to gain insight into bone crystal changes after incorporation of Sr. X-ray diffraction (XRD) patterns revealed that 0.3% and 1.5% Sr-HA exhibited single phase spectrum, which was similar to that of HA. However, 15% Sr-HA induced the incorporation of HPO4(2-) and more CO3(2-), the crystallinity reduced dramatically. Transmission electron microscopy (TEM) images showed that the crystal length and width of 0.3% and 1.5% Sr-HA increased slightly. Meanwhile, the length and width distribution were broadened and the aspect ratio decreased from 10.68+/-4.00 to 7.28+/-2.80. The crystal size and crystallinity of 15% Sr-HA dropped rapidly, which may suggest that the fundamental crystal structure is changed. The findings from this work indicate that current clinical dosage which usually results in Sr incorporation of below 1.5% may not change chemical composition and lattice structure of bone, while it will broaden the bone crystal size distribution and strengthen the bone.
X-ray transparent Microfluidics for Protein Crystallization and Biomineralization
NASA Astrophysics Data System (ADS)
Opathalage, Achini
Protein crystallization demands the fundamental understanding of nucleation and applying techniques to find the optimal conditions to achieve the kinetic pathway for a large and defect free crystal. Classical nucleation theory predicts that the nucleation occurs at high supersaturation conditions. In this dissertation we sought out to develop techniques to attain optimal supersaturation profile to a large defect free crystal and subject it to in-situ X-ray diffraction using microfluidics. We have developed an emulsion-based serial crystallographic technology in nanolitre-sized droplets of protein solution encapsulated in to nucleate one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different un-oriented crystals. As proof of concept, the structure of Glucose Isomerase was solved to 2.1 A. We have developed a suite of X-ray semi-transparent micrfluidic devices which enables; controlled evaporation as a method of increasing supersaturation and manipulating the phase space of proteins and small molecules. We exploited the inherently high water permeability of the thin X-ray semi-transparent devices as a mean of increasing the supersaturation by controlling the evaporation. We fabricated the X-ray semi-transparent version of the PhaseChip with a thin PDMS membrane by which the storage and the reservoir layers are separated, and studies the phase transition of amorphous CaCO3.
A Validated All-Pressure Fluid Drop Model and Lewis Number Effects for a Binary Mixture
NASA Technical Reports Server (NTRS)
Harstad, K.; Bellan, J.
1999-01-01
The differences between subcritical liquid drop and supercritical fluid drop behavior are discussed. Under subcritical, evaporative high emission rate conditions, a film layer is present in the inner part of the drop surface which contributes to the unique determination of the boundary conditions; it is this film layer which contributes to the solution's convective-diffusive character. In contrast, under supercritical condition as the boundary conditions contain a degree of arbitrariness due to the absence of a surface, and the solution has then a purely diffusive character. Results from simulations of a free fluid drop under no-gravity conditions are compared to microgravity experimental data from suspended, large drop experiments at high, low and intermediary temperatures and in a range of pressures encompassing the sub-and supercritical regime. Despite the difference between the conditions of the simulations and experiments (suspension vs. free floating), the time rate of variation of the drop diameter square is remarkably well predicted in the linear curve regime. The drop diameter is determined in the simulations from the location of the maximum density gradient, and agrees well with the data. It is also shown that the classical calculation of the Lewis number gives qualitatively erroneous results at supercritical conditions, but that an effective Lewis number previously defined gives qualitatively correct estimates of the length scales for heat and mass transfer at all pressures.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rumpf, Tobias; Gerhardt, Stefan; Einsle, Oliver, E-mail: einsle@biochemie.uni-freiburg.de
2015-11-18
In the present study, microseed matrix seeding was successfully applied to obtain a large number of crystals of the human sirtuin isotypes Sirt2 and Sirt3. These crystals appeared predictably in diverse crystallization conditions, diffracted to a higher resolution than reported in the literature and were subsequently used to study the protein–ligand interactions of two indole inhibitors. Sirtuins constitute a family of NAD{sup +}-dependent enzymes that catalyse the cleavage of various acyl groups from the ∊-amino group of lysines. They regulate a series of cellular processes and their misregulation has been implicated in various diseases, making sirtuins attractive drug targets. Tomore » date, only a few sirtuin modulators have been reported that are suitable for cellular research and their development has been hampered by a lack of structural information. In this work, microseed matrix seeding (MMS) was used to obtain crystals of human Sirt3 in its apo form and of human Sirt2 in complex with ADP ribose (ADPR). Crystal formation using MMS was predictable, less error-prone and yielded a higher number of crystals per drop than using conventional crystallization screening methods. The crystals were used to solve the crystal structures of apo Sirt3 and of Sirt2 in complex with ADPR at an improved resolution, as well as the crystal structures of Sirt2 in complex with ADPR and the indoles EX527 and CHIC35. These Sirt2–ADPR–indole complexes unexpectedly contain two indole molecules and provide novel insights into selective Sirt2 inhibition. The MMS approach for Sirt2 and Sirt3 may be used as the basis for structure-based optimization of Sirt2/3 inhibitors in the future.« less
Nanoparticles in liquid crystals, and liquid crystals in nanoparticles
NASA Astrophysics Data System (ADS)
de Pablo, Juan
2015-03-01
Liquid crystals are remarkably sensitive to interfacial interactions. Small perturbations at a liquid crystal interface, for example, can be propagated over relatively long length scales, thereby providing the basis for a wide range of applications that rely on amplification of molecular events into macroscopic observables. Our recent research efforts have focused on the reverse phenomenon; that is, we have sought to manipulate the interfacial assembly of nanoparticles or the organization of surface active molecules by controlling the structure of a liquid crystal. This presentation will consist of a review of the basic principles that are responsible for liquid crystal-mediated interactions, followed by demonstrations of those principles in the context of two types of systems. In the first, a liquid crystal is used to direct the assembly of nanoparticles; through a combination of molecular and continuum models, it is found that minute changes in interfacial energy and particle size lead to liquid-crystal induced attractions that can span multiple orders of magnitude. Theoretical predictions are confirmed by experimental observations, which also suggest that LC-mediated assembly provides an effective means for fabrication of plasmonic devices. In the second type of system, the structure of a liquid crystal is controlled by confinement in submicron droplets. The morphology of the liquid crystal in a drop depends on a delicate balance between bulk and interfacial contributions to the free energy; that balance can be easily perturbed by adsorption of analytes or nanoparticles at the interface, thereby providing the basis for development of hierarchical assembly of responsive, anisotropic materials. Theoretical predictions also indicate that the three-dimensional order of a liquid crystal can be projected onto a two-dimensional interface, and give rise to novel nanostructures that are not found in simple isotropic fluids.
Shaikh, Muhammad Faraz; Salcic, Zoran; Wang, Kevin I-Kai; Hu, Aiguo Patrick
2018-03-10
Electrical stimulators are often prescribed to correct foot drop walking. However, commercial foot drop stimulators trigger inappropriately under certain non-gait scenarios. Past researches addressed this limitation by defining stimulation control based on automaton of a gait cycle executed by foot drop of affected limb/foot only. Since gait is a collaborative activity of both feet, this research highlights the role of normal foot for robust gait detection and stimulation triggering. A novel bipedal gait model is proposed where gait cycle is realized as an automaton based on concurrent gait sub-phases (states) from each foot. The input for state transition is fused information from feet-worn pressure and inertial sensors. Thereafter, a bipedal gait model-based stimulation control algorithm is developed. As a feasibility study, bipedal gait model and stimulation control are evaluated in real-time simulation manner on normal and simulated foot drop gait measurements from 16 able-bodied participants with three speed variations, under inappropriate triggering scenarios and with foot drop rehabilitation exercises. Also, the stimulation control employed in commercial foot drop stimulators and single foot gait-based foot drop stimulators are compared alongside. Gait detection accuracy (98.9%) and precise triggering under all investigations prove bipedal gait model reliability. This infers that gait detection leveraging bipedal periodicity is a promising strategy to rectify prevalent stimulation triggering deficiencies in commercial foot drop stimulators. Graphical abstract Bipedal information-based gait recognition and stimulation triggering.
Adobe InDesign vs. QuarkXPress and PageMaker: The Best of Both Worlds?
ERIC Educational Resources Information Center
Wilson, Bradley
2000-01-01
Evaluates the newly released Adobe InDesign software, finding that while it brings new life into desktop publishing, it is not yet a "must buy" for publications advisers. Compares specific features that are relevant for student publications, including: character, paragraph, drop caps, define styles, page setup, text wrap, defining and using…
Ayub, Qaisar; Ngadi, Asri; Rashid, Sulma; Habib, Hafiz Adnan
2018-01-01
Delay Tolerant Network (DTN) multi-copy routing protocols are privileged to create and transmit multiple copies of each message that causes congestion and some messages are dropped. This process is known as reactive drop because messages were dropped re-actively to overcome buffer overflows. The existing reactive buffer management policies apply a single metric to drop source, relay and destine messages. Hereby, selection to drop a message is dubious because each message as source, relay or destine may have consumed dissimilar magnitude of network resources. Similarly, DTN has included time to live (ttl) parameter which defines lifetime of message. Hence, when ttl expires then message is automatically destroyed from relay nodes. However, time-to-live (ttl) is not applicable on messages reached at their destinations. Moreover, nodes keep replicating messages till ttl expires even-though large number of messages has already been dispersed. In this paper, we have proposed Priority Queue Based Reactive Buffer Management Policy (PQB-R) for DTN under City Based Environments. The PQB-R classifies buffered messages into source, relay and destine queues. Moreover, separate drop metric has been applied on individual queue. The experiment results prove that proposed PQB-R has reduced number of messages transmissions, message drop and increases delivery ratio.
Ngadi, Asri; Rashid, Sulma; Habib, Hafiz Adnan
2018-01-01
Delay Tolerant Network (DTN) multi-copy routing protocols are privileged to create and transmit multiple copies of each message that causes congestion and some messages are dropped. This process is known as reactive drop because messages were dropped re-actively to overcome buffer overflows. The existing reactive buffer management policies apply a single metric to drop source, relay and destine messages. Hereby, selection to drop a message is dubious because each message as source, relay or destine may have consumed dissimilar magnitude of network resources. Similarly, DTN has included time to live (ttl) parameter which defines lifetime of message. Hence, when ttl expires then message is automatically destroyed from relay nodes. However, time-to-live (ttl) is not applicable on messages reached at their destinations. Moreover, nodes keep replicating messages till ttl expires even-though large number of messages has already been dispersed. In this paper, we have proposed Priority Queue Based Reactive Buffer Management Policy (PQB-R) for DTN under City Based Environments. The PQB-R classifies buffered messages into source, relay and destine queues. Moreover, separate drop metric has been applied on individual queue. The experiment results prove that proposed PQB-R has reduced number of messages transmissions, message drop and increases delivery ratio. PMID:29438438
Tercjak, A; Garcia, I; Mondragon, I
2008-07-09
Novel well-defined nanostructured thermosetting systems were prepared by modification of a diglicydylether of bisphenol-A epoxy resin (DGEBA) with 10 or 15 wt% amphiphilic poly(styrene-b-ethylene oxide) block copolymer (PSEO) and 30 or 40 wt% low molecular weight liquid crystal 4'-(hexyl)-4-biphenyl-carbonitrile (HBC) using m-xylylenediamine (MXDA) as a curing agent. The competition between well-defined nanostructured materials and the ability for alignment of the liquid crystal phase in the materials obtained has been studied by atomic and electrostatic force microscopy, AFM and EFM, respectively. Based on our knowledge, this is the first time that addition of an adequate amount (10 wt%) of a block copolymer to 40 wt% HBC-(DGEBA/MXDA) leads to a well-organized nanostructured thermosetting system (between a hexagonal and worm-like ordered structure), which is also electro-responsive with high rate contrast. This behavior was confirmed using electrostatic force microscopy (EFM), by means of the response of the HBC liquid crystal phase to the voltage applied to the EFM tip. In contrast, though materials containing 15 wt% PSEO and 30 wt% HBC also form a well-defined nanostructured thermosetting system, they do not show such a high contrast between the uncharged and charged surface.
NASA Astrophysics Data System (ADS)
Planche, C.; Flossmann, A. I.; Wobrock, W.
2009-04-01
A 3D cloud model with detailed microphysics for ice, water and aerosol particles (AP) is used to study the role of AP on the evolution of summertime convective mixed phase clouds and the subsequent precipitation. The model couples the dynamics of the NCAR Clark-Hall cloud scale model (Clark et al., 1996) with the detailed scavenging model (DESCAM) of Flossmann and Pruppacher (1988) and the ice phase module of Leroy et al. (2007). The microphysics follows the evolution of AP, drop, and ice crystal spectra each with 39 bins. Aerosol mass in drops and ice crystals is also predicted by two distribution functions to close the aerosol budget. The simulated cases are compared with radar observations over the northern Vosges mountains and the Rhine valley which were performed on 12 and 13 August 2007 during the COPS field campaign. Using a 3D grid resolution of 250m, our model, called DESCAM-3D, is able to simulate very well the dynamical, cloud and precipitation features observed for the two different cloud systems. The high horizontal grid resolution provides new elements for the understanding of the formation of orographic convection. In addition the fine numerical scale compares well with the high resolved radar observation given by the LaMP X-band radar and Poldirad. The prediction of the liquid and ice hydrometeor spectra allows a detailed calculation of the cloud radar reflectivity. Sensitivity studies realized by the use of different mass-diameter relationships for ice crystals demonstrate the role of the crystal habits on the simulated reflectivities. In order to better understand the role of AP on cloud evolution and precipitation formation several sensitivity studies were performed by modifying not only aerosol number concentration but also their physico-chemical properties. The numerical results show a strong influence of the aerosol number concentration on the precipitation intensity but no effect of the aerosol particle solubility on the rain formation can be found.
NASA Astrophysics Data System (ADS)
Wobrock, Wolfram; Flossmann, Andrea I.; Monier, Marie; Pichon, Jean-Marc; Cortez, Laurent; Fournol, Jean-François; Schwarzenböck, Alfons; Mertes, Stephan; Heintzenberg, Jost; Laj, Paolo; Orsi, Giordano; Ricci, Loretta; Fuzzi, Sandro; Brink, Harry Ten; Jongejan, Piet; Otjes, René
The second field campaign of the Cloud Ice Mountain Experiment (CIME) project took place in February 1998 on the mountain Puy de Dôme in the centre of France. The content of residual aerosol particles, of H 2O 2 and NH 3 in cloud droplets was evaluated by evaporating the drops larger than 5 μm in a Counterflow Virtual Impactor (CVI) and by measuring the residual particle concentration and the released gas content. The same trace species were studied behind a round jet impactor for the complementary interstitial aerosol particles smaller than 5 μm diameter. In a second step of experiments, the ambient supercooled cloud was converted to a mixed phase cloud by seeding the cloud with ice particles by the gas release from pressurised gas bottles. A comparison between the physical and chemical characteristics of liquid drops and ice particles allows a study of the fate of the trace constituents during the presence of ice crystals in the cloud. In the present paper, an overview is given of the CIME 98 experiment and the instrumentation deployed. The meteorological situation during the experiment was analysed with the help of a cloud scale model. The microphysics processes and the behaviour of the scavenged aerosol particles before and during seeding are analysed with the detailed microphysical model ExMix. The simulation results agreed well with the observations and confirmed the assumption that the Bergeron-Findeisen process was dominating during seeding and was influencing the partitioning of aerosol particles between drops and ice crystals. The results of the CIME 98 experiment give an insight on microphysical changes, redistribution of aerosol particles and cloud chemistry during the Bergeron-Findeisen process when acting also in natural clouds.
Aging and the Shape of Cognitive Change Before Death: Terminal Decline Or Terminal Drop?
Hultsch, David F.; Dixon, Roger A.
2011-01-01
Objectives. Relative to typical age-related cognitive decrements, the terms “terminal decline” and “terminal drop” refer to the phenomenon of increased cognitive decline in proximity to death. Given that these terms are not necessarily synonymous, we examined the important theoretical distinction between the two alternative trajectories or shapes of changes they imply. Methods. We used 12-year (5-wave) data from the Victoria Longitudinal Study to directly test whether pre-death cognitive decrements follow a terminal decline (generally gradual) or a terminal drop (more abrupt) shape. Pre-death trajectories of cognitive decline for n = 265 decedents (Mage = 72.67 years, SD = 6.44) were examined separately for 5 key cognitive constructs (verbal speed, working memory, episodic memory, semantic memory, and crystallized ability). Results. Several classes of linear mixed models evaluated whether cognitive decline increased per additional year closer to death. Findings indicated that the shape of pre-death cognitive change was predominantly characterized by decline that is steeper as compared with typical aging-related change, but still best described as slow and steady decline, especially as compared with precipitous drop. Discussion. The present findings suggest that terminal decline and terminal drop trajectories may not be mutually exclusive but could rather reflect distinct developmental trajectories within the same individual. PMID:21300703
Viscosity Measurement using Drop Coalescence in Microgravity
NASA Technical Reports Server (NTRS)
Antar, Basil N.; Ethridge, Edwin; Maxwell, Daniel
1999-01-01
We present in here details of a new method, using drop coalescence, for application in microgravity environment for determining the viscosity of highly viscous undercooled liquids. The method has the advantage of eliminating heterogeneous nucleation at container walls caused by crystallization of undercooled liquids during processing. Also, due to the rapidity of the measurement, homogeneous nucleation would be avoided. The technique relies on both a highly accurate solution to the Navier-Stokes equations as well as on data gathered from experiments conducted in near zero gravity environment. The liquid viscosity is determined by allowing the computed free surface shape relaxation time to be adjusted in response to the measured free surface velocity of two coalescing drops. Results are presented from two validation experiments of the method which were conducted recently on board the NASA KC-135 aircraft. In these tests the viscosity of a highly viscous liquid, such as glycerine at different temperatures, was determined to reasonable accuracy using the liquid coalescence method. The experiments measured the free surface velocity of two glycerine drops coalescing under the action of surface tension alone in low gravity environment using high speed photography. The free surface velocity was then compared with the computed values obtained from different viscosity values. The results of these experiments were found to agree reasonably well with the calculated values.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miyakawa, Takuya; Sawano, Yoriko; Miyazono, Ken-ichi
Purification and crystallization of ginkbilobin-2 and its selenomethionine derivative allowed the collection of complete data to 2.38 Å resolution and multiwavelength anomalous diffraction data sets, respectively. The antifungal protein ginkbilobin-2 (Gnk2) from Ginkgo biloba seeds does not show homology to other pathogenesis-related proteins, but does show homology to the extracellular domain of plant cysteine-rich receptor-like kinases. Native Gnk2 purified from ginkgo nuts and the selenomethionine derivative of recombinant Gnk2 (SeMet-rGnk2) were crystallized by the sitting-drop vapour-diffusion method using different precipitants. X-ray diffraction data were collected from Gnk2 at 2.38 Å resolution and from SeMet-rGnk2 at 2.79 Å resolution using amore » synchrotron-radiation source. The crystals of both proteins belonged to the primitive cubic space group P2{sub 1}3, with unit-cell parameters a = b = c = 143.2 Å.« less
Mohamed Abubakkar, M.; Saraboji, K.; Ponnuswamy, M. N.
2013-01-01
Haemoglobin (Hb) is a respiratory pigment; it is a tetrameric protein that ferries oxygen from the lungs to tissues and transports carbon dioxide on the return journey. The oxygen affinity of haemoglobin is regulated by the concentration of oxygen surrounding it and several efforts have revealed the shapes of Hb in different states and with different functions. However, study of the molecular basis of Hbs from low-oxygen-affinity species is critically needed in order to increase the understanding of the mechanism behind oxygen adaptation. The present study reports the preliminary crystallographic study of low-oxygen-affinity haemoglobin from mongoose, a burrowing mammal. Haemoglobin from mongoose was purified by anion-exchange chromatography, crystallized using the hanging-drop vapour-diffusion method and diffraction data sets were collected from monoclinic (2.3 Å resolution) and orthorhombic (2.9 Å resolution) crystal forms obtained by pH variation. The monoclinic and orthorhombic asymmetric units contained half and a whole biological molecule, respectively. PMID:23385751
DOE Office of Scientific and Technical Information (OSTI.GOV)
El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin
2005-07-01
Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less
Liotard, Brigitte; Sygusch, Jurgen
2004-03-01
Tagatose-1,6-bisphosphate aldolase (EC 4.1.2.40) is situated at the branching of the tagatose-6-phosphate and Embden-Meyerhof-Parnas (glycolysis) metabolic pathways, where it catalyzes the reversible cleavage of tagatose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The recombinant protein from Streptococcus pyogenes was overexpressed in Escherichia coli in its native and selenomethionine-derivative forms and purified using ion-exchange and hydrophobic interaction chromatography. Orthorhombic crystals suitable for structural analysis were obtained by the hanging-drop vapour-diffusion method for both isoforms. The crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.7, b = 108.1, c = 238.7 A for the native form and a = 64.1, b = 108.3, c = 239.8 A for the selenomethionine derivative. The asymmetric unit contains four protomers, corresponding to a crystal volume per protein weight (V(M)) of 2.8 A(3) Da(-1) and a solvent content of 56% by volume.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rong, Hui; Li, Yan; Lou, Xiao-hua
2007-02-01
A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marana, S. R.; Cançado, F. C.; Valério, A. A.
The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less
Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting
2015-04-01
Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.
NASA Astrophysics Data System (ADS)
Jamilan, Saeid; Semouchkin, George; Gandji, Navid P.; Semouchkina, Elena
2018-04-01
The opportunities to use dielectric photonic crystals (PhCs) as the media of cylindrical invisibility cloaks, designed using transformation optics (TO) concepts, are investigated. It is shown that TO-based prescriptions for radial index dispersion, responsible for turning waves around hidden objects, can be dropped if the PhC media support self-collimation of waves in bent crystals. Otherwise, to provide prescribed anisotropy of index dispersion, it is possible to employ PhCs with rectangular lattices. It is found, however, that at acceptable cloak thicknesses, modifications of crystal parameters do not allow for achieving the prescribed level of index anisotropy. This problem is solved by finding the reduced spatial dispersion law for the radial index component, which is characterized by decreased against TO-prescriptions values near the target and increased values in outer layers of the cloak. The cloak utilizing reduced prescriptions for indices is shown to perform almost as efficiently as a TO-based cloak, in terms of both wave front restoration behind the target and reducing the total scattering cross-width of the target.
Life prediction and constitutive models for engine hot section anisotropic materials program
NASA Technical Reports Server (NTRS)
Swanson, G. A.; Linask, I.; Nissley, D. M.; Norris, P. P.; Meyer, T. G.; Walker, K. P.
1986-01-01
This report presents the results of the first year of a program designed to develop life prediction and constitutive models for two coated single crystal alloys used in gas turbine airfoils. The two alloys are PWA 1480 and Alloy 185. The two oxidation resistant coatings are PWA 273, an aluminide coating, and PWA 286, an overlay NiCoCrAlY coating. To obtain constitutive and/or fatigue data, tests were conducted on coated and uncoated PWA 1480 specimens tensilely loaded in the 100 , 110 , 111 , and 123 directions. A literature survey of constitutive models was completed for both single crystal alloys and metallic coating materials; candidate models were selected. One constitutive model under consideration for single crystal alloys applies Walker's micromechanical viscoplastic formulation to all slip systems participating in the single crystal deformation. The constitutive models for the overlay coating correlate the viscoplastic data well. For the aluminide coating, a unique test method is under development. LCF and TMF tests are underway. The two coatings caused a significant drop in fatigue life, and each produced a much different failure mechanism.
Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio
2012-01-01
Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794
Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young
2013-01-01
YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570
Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young
2013-05-01
YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.
NASA Astrophysics Data System (ADS)
Giacomoni, P. P.; Coltorti, M.; Bryce, J. G.; Fahnestock, M. F.; Guitreau, M.
2016-04-01
Coupled textural and in situ geochemical studies of clinopyroxene (cpx) phenocrysts, from both historical and recent eruptions of Mt. Etna volcano, provide a means to investigate the processes occurring in the deepest portion of the feeding system (>10 km depth). Five distinct textures were recognized: (1) normal oscillatory zoning, (2) normal zoning with Fe-rich rim, (3) sieve-textured core, (4) reverse oscillatory zoning, and (5) dusty rim. Electron microprobe analyses indicate an almost constant diopside-augite composition, with a slight enrichment in the enstatite for more recent erupted cpx. Core-to-rim compositional profiles, performed along the cpx, reveal distinct compositional characteristics. Normal oscillatory zoning is often characterized by a sharp increase in FeO (Δ ~ 2 wt%) accompanied by a drop in Al2O3 on the outermost 30 μm. Reverse oscillatory zoning, by contrast, exhibits a drop in FeO, Al2O3 (Δ ~ 2 wt%), and a remarkable crystal rim increase in MgO (up to 5 wt%). Similar compositional changes are evident in dusty-textured rims, which are characterized by dissolution edges and overgrowth containing glass pockets and channels. No significant compositional variations have been observed across crystals with sieve-textured cores. Trace element concentrations show enrichments in Sr, La, Zr, and REE, together with a decreasing La/Yb ratio (from ~7 to ~4) in rims of normally zoned crystals. Cpx with reverse zoning and dusty rims has low Sr, La, Zr, and REE contents toward crystal rims. Thermometers and barometers, based on equilibrium cpx-melt pairs, suggest that cpx cores start nucleating at 720 MPa, with the majority of them forming between 600 and 400 MPa but continuing to crystallize until very shallow depths (<100 MPa). Normal oscillatory-zoned phenocrysts surrounded by rims form at pressures shallower than 400 MPa, while reverse zoning and dusty rims occur between 400 and 500 MPa. Coupled petrologic and thermobarometric studies on both clinopyroxenes and plagioclases, associated with detailed textural and in situ geochemical analyses, are promising tools to reconstruct the entire magma ascent path beneath open-system volcanoes. At Mt. Etna, two distinct processes could account for the observed textures: Fe-rich rims in normal oscillatory-zoned crystals can be related to decompression-induced crystallization, while reverse zoning and dusty rims can be produced by mixing with a more basic magma at 400-500 MPa (i.e., ~10 km). Textural features are not restricted to a particular evolutionary phase of the volcano, which suggest that the deep feeding system has not changed significantly since the first alkaline volcanic phase.
The consequences of crystal relaxation on CO2 partitioning in plagioclase-hosted melt inclusions
NASA Astrophysics Data System (ADS)
Drignon, M. J.; Nielsen, R.; Moore, L.; Bodnar, R. J.; Tepley, F. J., III; Kotash, A.
2017-12-01
Melt inclusions (MI) are samples of magmas representing the early stages of the development of the system, both spatially and compositionally. However, little work has been done to test and understand whether MI in plagioclase faithfully sample and maintain a record of the magmatic history. Here, we examine the effects of post entrapment processes such as sidewall crystallization (PEC) and crystal relaxation that may occur during transport and eruption and, thus alter the composition of MI. To better understand the effects of PEC and crystal relaxation, time-series experiments were conducted on plagioclase-hosted MI from plagioclase ultraphyric basalts to evaluate the extent of crystal relaxation. Run times ranged from 30 min to 4 days. To evaluate the magnitude of the effect, we analyzed the CO2 content in the vapor bubbles using Raman spectroscopy. CO2 in the MI glass was determined by SIMS. The working assumption was that relaxation would lead to a pressure drop within the MI leading to an increase in CO2 in the vapor bubbles as CO2 moved from the melt to the bubble. In addition, a drop in pressure was expected to affect the major element composition of the MI. Our results demonstrated that Na2O, CaO and Al2O3 in the MI decreased, and SiO2 and MgO increased as a function of run time. However, the magnitude of the changes cannot be explained by plagioclase melting alone. In addition, our preliminary data show more CO2 in the vapor bubbles after the 4 day runs than after 30 min runs. Using our SIMS data, and applying the total CO2 reconstruction methodology described in Moore et al. (2015), we estimate that 61% of the total CO2 in the MI is contained within the vapor bubbles after the 4 day runs and 37 % of the CO2 is in the vapor bubbles after 30 min. We hypothesize that after 4 days the CO2 exsolved from the melt into the vapor bubble and is not re-dissolved into the melt due to crystal relaxation and the concomitant pressure decrease in the MI. This suggests that plagioclase-hosted MI hold their volatiles after long runs. The total CO2 reconstruction indicates that the MI were trapped between 3000 and 6000 bars which correspond to 9-18 km. These pressures represent the pressures of last equilibration and suggest that plagioclase megacrysts crystallized in the upper mantle, and are not related to processes within or above the magma lens.
Growth, Characterization and Applications of Beta-Barium Borate and Related Crystals
1993-10-31
Crystal symmetry determines the form of the second order polarization tensor. The second order polarizability tensor is defined by the piezoelectric...cold finger. A temperature oscillation technique1 I was used to limit the number of nuclei formed . These experiments typically yielded thin crystal...statistically sampled to determine the optimal seeding orientation. % was reasoned that the large crystal plates were formed from nucleii which had a favorable
Drop impact on inclined superhydrophobic surfaces
NASA Astrophysics Data System (ADS)
Choi, Wonjae; Leclear, Sani; Leclear, Johnathon; Abhijeet, .; Park, Kyoo-Chul
We report an empirical study and dimensional analysis on the impact patterns of water drops on inclined superhydrophobic surfaces. While the classic Weber number determines the spreading and recoiling dynamics of a water drop on a horizontal / smooth surface, for a superhydrophobic surface, the dynamics depends on two distinct Weber numbers, each calculated using the length scale of the drop or of the pores on the surface. Impact on an inclined superhydrophobic surface is even more complicated, as the velocity that determines the Weber number is not necessarily the absolute speed of the drop but the velocity components normal and tangential to the surface. We define six different Weber numbers, using three different velocities (absolute, normal and tangential velocities) and two different length scales (size of the drop and of the texture). We investigate the impact patterns on inclined superhydrophobic surfaces with three different types of surface texture: (i) posts, (ii) ridges aligned with and (iii) ridges perpendicular to the impact direction. Results suggest that all six Weber numbers matter, but affect different parts of the impact dynamics, ranging from the Cassie-Wenzel transition, maximum spreading, to anisotropic deformation. We acknowledge financial support from the Office of Naval Research (ONR) through Contract 3002453812.
Drag and drop simulation: from pictures to full three-dimensional simulations
NASA Astrophysics Data System (ADS)
Bergmann, Michel; Iollo, Angelo
2014-11-01
We present a suite of methods to achieve ``drag and drop'' simulation, i.e., to fully automatize the process to perform thee-dimensional flow simulations around a bodies defined by actual images of moving objects. The overall approach requires a skeleton graph generation to get level set function from pictures, optimal transportation to get body velocity on the surface and then flow simulation thanks to a cartesian method based on penalization. We illustrate this paradigm simulating the swimming of a mackerel fish.
Anomalous thermal diffusivity in underdoped YBa2Cu3O6+x
Levenson-Falk, Eli M.; Ramshaw, B. J.; Bonn, D. A.; Liang, Ruixing; Hardy, W. N.; Hartnoll, Sean A.; Kapitulnik, Aharon
2017-01-01
The thermal diffusivity in the ab plane of underdoped YBCO crystals is measured by means of a local optical technique in the temperature range of 25–300 K. The phase delay between a point heat source and a set of detection points around it allows for high-resolution measurement of the thermal diffusivity and its in-plane anisotropy. Although the magnitude of the diffusivity may suggest that it originates from phonons, its anisotropy is comparable with reported values of the electrical resistivity anisotropy. Furthermore, the anisotropy drops sharply below the charge order transition, again similar to the electrical resistivity anisotropy. Both of these observations suggest that the thermal diffusivity has pronounced electronic as well as phononic character. At the same time, the small electrical and thermal conductivities at high temperatures imply that neither well-defined electron nor phonon quasiparticles are present in this material. We interpret our results through a strongly interacting incoherent electron–phonon “soup” picture characterized by a diffusion constant D∼vB2τ, where vB is the soup velocity, and scattering of both electrons and phonons saturates a quantum thermal relaxation time τ∼ℏ/kBT. PMID:28484003
Phase-field model with plastic flow for grain growth in nanocrystalline material
NASA Astrophysics Data System (ADS)
Steinbach, Ingo; Song, Xiaoyan; Hartmaier, Alexander
2010-01-01
A phase-field model is presented which considers the accumulation of structural defects in grain boundaries by an isotropic eigenstrain associated with the grain boundaries. It is demonstrated that the elastic energy caused by dilatation of the grain boundary with respect to the bulk crystal contributes largely to the grain boundary energy. The sign of this contribution can be both positive and negative dependent on the local stress state in the grain boundary. Self-diffusion of atoms is taken into account to relax the stress caused by the dilatation of the grain boundary. Application of the model to discontinuous grain growth in pure nanocrystalline cobalt material is presented. Linear grain growth is found in the nanocrystalline state, which is explained by the interpretation of grain boundary motion as a diffusive process defining an upper limit of the grain boundary velocity independent of the grain boundary curvature but dependent on temperature. The transition to regular grain growth at a critical temperature, as observed experimentally, is explained by the drop of theoretical grain boundary velocity due to its mean curvature during coarsening of the nanograin structure below the maximum velocity.
Interaction of human osteoblast-like Saos-2 cells with stainless steel coated by silicalite-1 films.
Jirka, Ivan; Vandrovcová, Marta; Plšek, Jan; Bouša, Milan; Brabec, Libor; Dragounová, Helena; Bačáková, Lucie
2017-07-01
This paper investigates the interaction of human osteoblast-like Saos-2 cells with stainless steel covered by a film of densely inter-grown silicalite-1 crystals with defined outer and inner surfaces. The chemical composition of this film, labeled as SF(RT), was tuned by heat treatment at 300°C and 500°C (labeled as SF(300) and SF(500), respectively) and characterized by X-ray photoelectron spectroscopy (XPS), water drop contact angle (WCA) measurements and scanning electron microscopy (SEM). The number, the spreading area and the activity of alkaline phosphatase of human osteoblast-like Saos-2 cells in cultures on the silicalite-1 film were affected by the chemical composition of its outer surface and by its micro-porous structure. The number and the spreading area of the adhered osteoblast-like cells on day 1 was highest on the surface of SF(RT) relative to their adhesion and spreading on a glass cover slip due to the SF(RT) topology. However, SF(300) markedly supported cell growth during days 3 and 7 after seeding. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455
2005-04-01
ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less
Microscopic reversibility and memory in soft crystals undergoing large deformations
NASA Astrophysics Data System (ADS)
Rosenfeld, Liat; Stan, Claudiu; Tang, Sindy K. Y.
2014-11-01
In this study, we explore the transition from reversible to chaotic behavior in an oscillatory shear flow of water-in-oil emulsions. The emulsion was injected through a microchannel and was forced to rearrange due to a central constriction in the channel. We study the motion of the individual droplets and their neighbors in order to determine their ability to retain their original position after several cycles of oscillations. We have found that the emulsion exhibit behaviors that vary from complete reversibility to complete irreversibility depending on the volume fraction, velocity and strain rate. The reversibility, both in the trajectory and the deformation of every drop, is reproducible even when the drops undergo many rearrangement events over distances of >150 droplet diameters. Moreover, the deformability of the drops and the high volume fraction are crucial conditions for the onset of reversibility. We provide here the first direct visualization and physical analysis of this phenomenon. This work is an important step in describing the flow of concentrated emulsions and suspensions in microchannels and is therefore crucial for understanding the behavior of droplets, bubbles and particles in droplet microfluidic applications.
Numerical approaches to combustion modeling. Progress in Astronautics and Aeronautics. Vol. 135
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oran, E.S.; Boris, J.P.
1991-01-01
Various papers on numerical approaches to combustion modeling are presented. The topics addressed include; ab initio quantum chemistry for combustion; rate coefficient calculations for combustion modeling; numerical modeling of combustion of complex hydrocarbons; combustion kinetics and sensitivity analysis computations; reduction of chemical reaction models; length scales in laminar and turbulent flames; numerical modeling of laminar diffusion flames; laminar flames in premixed gases; spectral simulations of turbulent reacting flows; vortex simulation of reacting shear flow; combustion modeling using PDF methods. Also considered are: supersonic reacting internal flow fields; studies of detonation initiation, propagation, and quenching; numerical modeling of heterogeneous detonations, deflagration-to-detonationmore » transition to reactive granular materials; toward a microscopic theory of detonations in energetic crystals; overview of spray modeling; liquid drop behavior in dense and dilute clusters; spray combustion in idealized configurations: parallel drop streams; comparisons of deterministic and stochastic computations of drop collisions in dense sprays; ignition and flame spread across solid fuels; numerical study of pulse combustor dynamics; mathematical modeling of enclosure fires; nuclear systems.« less
NASA Technical Reports Server (NTRS)
Stormont, R. W.; Morrison, A.
1974-01-01
Single crystal a- and c-axis tubes and ribbons of sodium beta-alumina and sodium magnesium beta-alumina were grown from sodium oxide rich melts. Additional experiments grew ribbon crystals containing sodium magnesium beta, beta double prime, beta triple prime, and beta quadruple prime. A high pressure crystal growth chamber, sodium oxide rich melts, and iridium for all surfaces in contact with the melt were combined with the edge-defined, film-fed growth technique to grow the single crystal beta-alumina tubes and ribbons. The crystals were characterized using metallographic and X-ray diffraction techniques, and wet chemical analysis was used to determine the sodium, magnesium, and aluminum content of the grown crystals.
Preliminary observations of the effect of solutal convection on crystal morphology
NASA Technical Reports Server (NTRS)
Broom, M. Beth H.; Witherow, William K.; Snyder, Robert S.; Carter, Daniel C.
1988-01-01
Studies to examine the effect of solutal convection on crystal morphology using sucrose as a model system were initiated. Aspect ratios, defined as the width of the 100-plane-oriented face over the width of the 001-plane-oriented face, were determined for oriented crystals which were grown with either the 001-oriented or the 100-oriented face perpendicular to the convective flow. The dependence of the crystal morphology on orientation is much greater for crystals grown with one face occluded than for crystals grown suspended in solution. Many factors appear to interact in a complex fashion to influence crystal morphology.
Butterfly wing color: A photonic crystal demonstration
NASA Astrophysics Data System (ADS)
Proietti Zaccaria, Remo
2016-01-01
We have theoretically modeled the optical behavior of a natural occurring photonic crystal, as defined by the geometrical characteristics of the Teinopalpus Imperialis butterfly. In particular, following a genetic algorithm approach, we demonstrate how its wings follow a triclinic crystal geometry with a tetrahedron unit base. By performing both photonic band analysis and transmission/reflection simulations, we are able to explain the characteristic colors emerging by the butterfly wings, thus confirming their crystal form.
Photonic crystal ring resonator based optical filters for photonic integrated circuits
DOE Office of Scientific and Technical Information (OSTI.GOV)
Robinson, S., E-mail: mail2robinson@gmail.com
In this paper, a two Dimensional (2D) Photonic Crystal Ring Resonator (PCRR) based optical Filters namely Add Drop Filter, Bandpass Filter, and Bandstop Filter are designed for Photonic Integrated Circuits (PICs). The normalized output response of the filters is obtained using 2D Finite Difference Time Domain (FDTD) method and the band diagram of periodic and non-periodic structure is attained by Plane Wave Expansion (PWE) method. The size of the device is minimized from a scale of few tens of millimeters to the order of micrometers. The overall size of the filters is around 11.4 μm × 11.4 μm which ismore » highly suitable of photonic integrated circuits.« less
ERIC Educational Resources Information Center
Haavisto, Marja-Leena; Lehto, Juhani E.
2005-01-01
Fluid/spatial intelligence, crystallized intelligence and their relationships to verbal and visuospatial working memory (WM) were studied. A total of 120 Finnish Air Force recruits participated in this study. Fluid/spatial intelligence was assessed using four different tasks, while crystallized intelligence was defined with the help of test scores…
Coarsening of protein clusters on subcellular drops exhibits strong and sudden size selectivity
NASA Astrophysics Data System (ADS)
Brown, Aidan; Rutenberg, Andrew
2015-03-01
Autophagy is an important process for the degradation of cellular components, with receptor proteins targeting substrates to downstream autophagy machinery. An important question is how receptor protein interactions lead to their selective accumulation on autophagy substrates. Receptor proteins have recently been observed in clusters, raising the possibility that clustering could affect autophagy selectivity. We investigate the clustering dynamics of the autophagy receptor protein NBR1. In addition to standard receptor protein domains, NBR1 has a ``J'' domain that anchors it to membranes, and a coiled-coil domain that enhances self-interaction. We model coarsening clusters of NBR1 on the surfaces of a polydisperse collection of drops, representing organelles. Despite the disconnected nature of the drop surfaces, we recover dynamical scaling of cluster sizes. Significantly, we find that at a well-defined time after coarsening begins, clusters evaporate from smaller drops and grow on larger drops. Thus, coarsening-driven size selection will localize protein clusters to larger substrates, leaving smaller substrates without clusters. This provides a possible physical mechanism for autophagy selectivity, and can explain reports of size selection during peroxisome degradation.
Calorimetric determination of thermal parameters for the Li/BrCl in SOCl2 (BCX) chemistry
NASA Technical Reports Server (NTRS)
Darcy, Eric C.; Kalu, Eric E.; White, Ralph E.
1990-01-01
The heat capacity of a Li-BCX DD-cell was found to be dependent on its state of charge by drop calorimetry measurements. The method of drop calorimetry involves measuring the energy (joules) gained or lost from a sample that is transferred from a bath at temperature A to one at temperature B. The thermoneutral potential is defined as the cell potential where the cell electrochemical reactions are neither exothermic nor endothermic. A Hart scientific calorimeter system, Model No. S77XX, designed for heat conduction calorimetry and drop calorimetry was used. Calorimetric analysis yielded a thermoneutral potential of 4.14 volts and a cell heat capacity dependent on the state of charge.
Crystal growth and magnetic properties of equiatomic CeAl
NASA Astrophysics Data System (ADS)
Das, Pranab Kumar; Thamizhavel, A.
2015-03-01
Single crystal of CeAl has been grown by flux method using Ce-Al self-flux. Several needle like single crystals were obtained and the length of the needle corresponds to the [001] crystallographic direction. Powder x-ray diffraction revealed that CeAl crystallizes in orthorhombic CrB-type structure with space group Cmcm (no. 63). The magnetic properties have been investigated by means of magnetic susceptibility, isothermal magnetization, electrical transport, and heat capacity measurements. CeAl is found to order antiferromagnetically with a Neel temperature TN = 10 K. The magnetization data below the ordering temperature reveals two metamagentic transitions for fields less than 20 kOe. From the inverse magnetic susceptibility an effective moment of 2.66 μB/Ce has been estimated, which indicates that Ce is in its trivalent state. Electrical resistivity data clearly shows a sharp drop at 10 K due to the reduction of spin disorder scattering of conduction electrons thus confirming the magnetic ordering. The estimated residual resistivity ratio (RRR) is 33, thus indicating a good quality of the single crystal. The bulk nature of the magnetic ordering is also confirmed by heat capacity data. From the Schottky anomaly of the heat capacity we have estimated the crystal field level splitting energies of the (2J + 1) degenerate ground state as 25 K and 175 K respectively for the fist and second excited states.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew
2008-08-04
The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less
Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E.; Birket, Susan; Picking, William D.; Blocker, Ariel; Picking, Wendy L.; Lea, Susan M.
2006-01-01
IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P212121, with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 Å, and data were collected to 2.9 Å resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 Å resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 Å, β = 107.9°. An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit. PMID:16946465
Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E; Birket, Susan; Picking, William D; Blocker, Ariel; Picking, Wendy L; Lea, Susan M
2006-09-01
IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P2(1)2(1)2(1), with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 A, and data were collected to 2.9 A resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 A resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 A, beta = 107.9 degrees . An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit.
Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G
1999-03-01
ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Inaoka, Daniel Ken; Takashima, Eizo; Osanai, Arihiro
2005-10-01
The Trypanosoma cruzi dihydroorotate dehydrogenase, a key enzyme in pyrimidine de novo biosynthesis and redox homeostasis, was crystallized in complex with its first reaction product, orotate. Dihydroorotate dehydrogenase (DHOD) catalyzes the oxidation of dihydroorotate to orotate, the fourth step and the only redox reaction in the de novo biosynthesis of pyrimidine. DHOD from Trypanosoma cruzi (TcDHOD) has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. Crystals of the TcDHOD–orotate complex were grown at 277 K by the sitting-drop vapour-diffusion technique using polyethylene glycol 3350 as a precipitant. The crystals diffract to better than 1.8 Åmore » resolution using synchrotron radiation (λ = 0.900 Å). X-ray diffraction data were collected at 100 K and processed to 1.9 Å resolution with 98.2% completeness and an overall R{sub merge} of 7.8%. The TcDHOD crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.87, b = 71.89, c = 123.27 Å. The presence of two molecules in the asymmetric unit (2 × 34 kDa) gives a crystal volume per protein weight (V{sub M}) of 2.2 Å{sup 3} Da{sup −1} and a solvent content of 44%.« less
Purification of Restriction Endonuclease EcoRII and its Co-Crystallization
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Chen, L.; Meehan, E.; Pusey, M.; Rose, M. Franklin (Technical Monitor)
2000-01-01
Restriction endonuclease EcoRII (EcoRII) is a homodimeric DNA-binding protein. It belongs to the type II family of restriction-modification enzymes (subclass IIe). EcoRII recognizes the nucleotide sequence 5'-CCWGG (W=A or T) and cleaves the phosphodiester bond preceding the first cytosine. Methylation at C5 of the second cytosine inhibits cleavage. The enzyme has a unique ability to search for the presence of two substrate sites before cleavage. To the best of our knowledge no other subclass IIe restriction endonuclease has been crystallized yet, without or with a DNA-substrate. We have recently grown and characterized the crystals of this enzyme (1) Here we report on the result of co-crystallization experiments of EcoRII with an 11 b.p. oligonucleotide substrate. The dissociation constant (Kd) EcoRII: 11 b.p. was determined earlier (unpublished results). The needle-like crystals of oligonucleotide-EcoRII protein complex were obtained with this substrate by the technique of vapor diffusion hanging drops. The crystals obtained were washed and dissolved in an aliquot of 10 mM Tris-HCl buffer, pH=7.5. Running a portion of this solution on the SDS-get indicated the presence of endonuclease in the solution. A UV-spectrophotometric test of a second portion confirmed the presence of DNA. We are now working on improvement of the DNA-EcoRII protein crystals. Results obtained from these and ongoing efforts will be reported.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang,X.; Hew, C.
2007-01-01
White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less
Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit
2011-03-01
Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.
Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian
2003-05-01
Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.
Assembly, Elasticity, and Structure of Lyotropic Chromonic Liquid Crystals and Disordered Colloids
NASA Astrophysics Data System (ADS)
Davidson, Zoey S.
This dissertation describes experiments which explore the structure and dynamics in two classes of soft materials: lyotropic chromonic liquid crystals and colloidal glasses and super-cooled liquids. The first experiments found that the achiral LCLCs, sunset yellow FCF (SSY) and disodium cromoglycate (DSCG) both exhibit spontaneous mirror symmetry breaking in the nematic phase driven by a giant elastic anisotropy of their twist modulus compared to their splay and bend moduli. Resulting structures of the confined LCLCs display interesting director configurations due to interplay of topologically required defects and twisted director fields. At higher concentrations, the LCLC compounds form columnar phases. We studied the columnar phase confined within spherical drops and discovered and understood configurations of the LC that sometimes led to non-spherical droplet shapes. The second experiments with SSY LCLCs confined in hollow cylinders uncovered director configurations which were driven in large measure by an exotic elastic modulus known as saddle-splay. We measured this saddle-splay modulus in a LCLC for the first time and found it to be more than 50 times greater than the twist elastic modulus. This large relative value of the saddle-splay modulus violates a theoretical result/assumption known as the Ericksen inequality. A third group of experiments on LCLCs explored the drying process of sessile drops containing SSY solutions, including evaporation dynamics, morphology, and deposition patterns. These drops differ from typical, well-studied evaporating colloidal drops primarily due to the LCLC's concentration-dependent isotropic, nematic, and columnar phases. Phase separation occurs during evaporation, creating surface tension gradients and significant density and viscosity variation within the droplet. Thus, the drying multiphase drops exhibit new convective currents, drop morphologies, deposition patterns, as well as a novel ordered crystalline phase. Finally, experiments in colloidal glasses and super-cooled liquids were initiated to probe the relationship between structure and dynamics in their constituent particles. The displacements of individual particles in the colloids can be decomposed into small cage fluctuations and large rearrangements into new cages. We found a correlation between the rate of rearrangement and the local cage structure associated with each particle. Particle trajectories of a two-dimensional binary mixture of soft colloids are captured by video microscopy. We use a machine learning method to calculate particle "softness'', which indicates the likelihood of rearrangement based on many radial structural features for each particle. We measured the residence time between consecutive rearrangements and related probability distribution functions (PDFs). The softness-dependent conditional PDF is well fit by an exponential with decay time decreasing monotonically with increasing softness. Using these data and a simple thermal activation model, we determined activation energies for rearrangements.
Jet dynamics post drop impact on a deep pool
NASA Astrophysics Data System (ADS)
Michon, Guy-Jean; Josserand, Christophe; Séon, Thomas
2017-02-01
We investigate experimentally the jet formed by the collapse of a cavity created by the impact of a drop on a pool of the same aqueous liquid. We show that jets can emerge with very different shapes and velocities, depending on the impact parameters, thus generating droplets with various initial sizes and velocities. After presenting the jet velocity and top drop radius variation as a function of the impact parameters, we discuss the influence of the liquid parameters on the jet velocity. This allows us to define two different regimes: the singular jet and the cavity jet regimes, where the mechanisms leading to the cavity retraction and subsequent jet dynamics are drastically different. In particular, we demonstrate that in the first regime, a singular capillary wave collapse sparks the whole jet dynamics, making the jet's fast, thin, liquid parameters dependent and barely reproducible. On the contrary, in the cavity jet regime, defined for higher impact Froude numbers, the jets are fat and slow. We show that jet velocity is simply proportional to the capillary velocity √{γ /ρlDd }, where γ is the liquid surface tension, ρl the liquid density, and Dd the impacting drop diameter, and it is in particular independent of viscosity, impact velocity, and gravity, even though the cavity is larger than the capillary length. Finally, we demonstrate that capillary wave collapse and cavity retraction are correlated in the singular regime and decorrelated in the cavity jet regime.
Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi
2010-01-01
The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pande, Monu; Dubey, Vikash K.; Jagannadham, Medicherla V., E-mail: vdubey@iitg.ernet.in
2007-02-01
Cryptolepain is a stable glycosylated novel serine protease was crystallized by hanging-drop method. Crystal data was processed up to 2.25 Å with acceptable statistics and structure determination of the enzyme is under way. Cryptolepain is a stable glycosylated novel serine protease purified from the latex of the medicinally important plant Cryptolepis buchanani. The molecular weight of the enzyme is 50.5 kDa, as determined by mass spectrometry. The sequence of the first 15 N-terminal resides of the protease showed little homology with those of other plant serine proteases, suggesting it to be structurally unique. Thus, it is of interest to solvemore » the structure of the enzyme in order to better understand its structure–function relationship. X-ray diffraction data were collected from a crystal of cryptolepain and processed to 2.25 Å with acceptable statistics. The crystals belong to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 81.78, b = 108.15, c = 119.86 Å. The Matthews coefficient was 2.62 Å{sup 3} Da{sup −1} with one molecule in the asymmetric unit. The solvent content was found to be 53%. Structure determination of the enzyme is under way.« less
NASA Astrophysics Data System (ADS)
Park, Jun-Yong; Kim, Gi Hyun; Kim, Jong Bae; Park, Sewoong; Sohn, Il
2016-08-01
The effect of B2O3 on the thermo-physical properties of commercial mold fluxes, including the viscosity, crystallization behavior, and wettability, was investigated. Viscosity was measured using the rotating spindle method, and CCT (continuous cooling transformation) diagrams were obtained to investigate the crystallization behavior at various cooling rates using CLSM (confocal laser scanning microscope). The wettability of the fluxes was determined by measuring the contact angles at 1573 K (1300 °C) using the digital images generated by the sessile drop method and were used to calculate the surface tension, interfacial tension, and work of adhesion for Flux A (existing flux) and B (modified flux). These thermo-physical properties were correlated with the structural analysis obtained using FT-IR (Fourier transform-infrared), Raman and MAS-NMR (magic angle spin-nuclear magnetic resonance) spectroscopy. In addition, DTA (differential thermal analysis) was performed on the samples to measure the liquidus temperatures. Higher B2O3 concentrations resulted in lower liquidus temperatures, consequently decreasing the viscosity, the break temperature, and the crystallization temperature. However, B2O3 addition accelerated crystal growth owing to the higher diffusion kinetics of the cations, which also reduced the size of the liquid/solid co-existing region.