Sample records for del primer cuestionario

  1. Evaluación de la utilidad diagnóstica de la versión española del cuestionario al informador «AD8»☆

    PubMed Central

    Pardo, C. Carnero; de la Vega Cotarelo, R.; Alcalde, S. López; Aparicio, C. Martos; Carrillo, R. Vílchez; Gavilán, E. Mora; Galvin, J.E.


    Introducción El AD8 es un cuestionario al informador breve que puede ser autoaplicado y facilita la identificación de deterioro cognitivo (DC); nuestro objetivo es evaluar la utilidad diagnóstica (UD) de una versión española. Material y métodos Estudio transversal en una muestra clínica de díadas paciente/ informador, 330 sujetos con sospecha de DC o demencia (DEM) y 71 controles. Se ha evaluado la consistencia interna (α de Cronbach) y la validez (correlaciones parciales con estadio GDS, Fototest e índice funcional [IF]). La UD se ha evaluado para no DC vs DC (GDS 3–4) por medio del área bajo la curva ROC (aROC) y se ha considerado mejor punto de corte aquel que hacía máximo el índice de Youden. Resultados En la muestra, 105 no tenían DC, 99 tenían DC sin DEM y 203 DEM. La consistencia interna es alta (α 0,90, IC del 95%, 0,89–0,92), al igual que las correlaciones con GDS (r = 0,72, p < 0,001), Fototest (r = −0,61, p < 0,001) e IF (r = 0,59, p < 0,001). El aROC del AD8 es 0,90 (IC del 95%, 0,86–0,93), sin diferencia significativa con la del Fototest (aROC 0,93, IC del 95%, 0,89–0,96); el mejor punto de corte es 3/4 con sensibilidad de 0,93 (IC del 95%, 0,88–0,96), especificidad de 0,81 (IC del 95%, 0,72–0,88) y el 88,8% de las clasificaciones correctas. El uso conjunto de AD8 y Fototest mejora de forma significativa la UD de ambos (aROC 0,96, IC del 95%, 0,93–0,98, p < 0,05). Conclusiones La versión española del AD8 conserva las cualidades psicométricas y la UD de la versión original; su uso combinado con el Fototest mejora de forma significativa la UD de ambos. PMID:22652137

  2. Cuestionarios | Smokefree Español

    Los cuestionarios de Smokefree son una manera divertida de obtener información importante sobre temas relacionados con dejar de fumar, como los síntomas de abstinencia, el estrés y el humo de segunda mano. Responda un cuestionario y mejore su método para dejar de fumar.

  3. Phonics Primer

    ERIC Educational Resources Information Center

    Elam, Sandra


    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  4. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    NASA Astrophysics Data System (ADS)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los


    SciTech Connect

    Munn, R. J.; Stewart, J. M.; Norden, A. P.; Pagoaga, M. Katherine


    The language RATMAC is a direct descendant of one of the most successful structured FORTRAN languages, rational FORTRAN, RATFOR. RATMAC has all of the characteristics of RATFOR, but is augmented by a powerful recursive macro processor which is extremely useful in generating transportable FORTRAN programs. A macro is a collection of programming steps which are associated with a keyword. This keyword uniquely identifies the macro, and whenever it appears in a RATMAC program it is replaced by the collection of steps. This primer covers the language's control and decision structures, macros, file inclusion, symbolic constants, and error messages.

  6. Salinas primer.

    SciTech Connect

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar


    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  7. Polyacid macromolecule primers


    Sugama, Toshifumi.


    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  8. Polyacid macromolecule primers


    Sugama, Toshifumi


    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  9. Education Vouchers. A Primer.

    ERIC Educational Resources Information Center

    Richter, Philip C.; Hollender, Mary Jo

    This document is intended to serve both as a primer and as an annotated bibliography about educational vouchers. As a primer, it introduces the reader to the concept of vouchers and to the variety of issues--including political, economic, legal, and educational issues--associated with vouchers. As an annotated bibliography, it provides a summary…

  10. Quick spacecraft charging primer

    SciTech Connect

    Larsen, Brian Arthur


    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  11. Designing Polymerase Chain Reaction Primers Using Primer3Plus.


    Hung, Jui-Hung; Weng, Zhiping


    Designing oligonucleotide primers is a crucial step for successful molecular biology experiments that require the use of the polymerase chain reaction (PCR). PCR involves cycles of three steps: denaturation, annealing, and extension. During denaturation, double-stranded DNA (dsDNA) molecules (templates) are separated into single strands. During annealing, a pair of primers is annealed to the complementary regions of the single-stranded molecules. In the extension step, DNA polymerase extends the primers to produce DNA molecules that correspond to the region bracketed by the primers (the amplicons). All of these steps are temperature sensitive, and the common choice of temperatures is 94°C, 60°C, and 70°C, respectively. Poorly designed primers may lead to no amplification product or additional undesired amplified fragments. The goals of primer design include good primer specificity, high annealing efficiency, appropriate melting temperature, proper GC content, and the prevention of primer hairpins or primer dimers. PMID:27574202

  12. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricte...

  13. China Energy Primer

    SciTech Connect

    Ni, Chun Chun


    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  14. Primer on Social Economics.

    ERIC Educational Resources Information Center

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  15. Nulcear materials production: Primer

    SciTech Connect

    Not Available


    The US Department of Energy's (DOE's) Office of Nuclear Materials Production (NMP) is responsible for managing the production and recovery of nuclear materials for national defense. NMP oversees the production of radioactive materials for government, commercial, industrial, and medical applications. This Primer is a general introduction to NMP's major activities.

  16. An SAT® Validity Primer

    ERIC Educational Resources Information Center

    Shaw, Emily J.


    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  17. Crystalline Silica Primer

    USGS Publications Warehouse

    Staff- Branch of Industrial Minerals


    substance and will present a nontechnical overview of the techniques used to measure crystalline silica. Because this primer is meant to be a starting point for anyone interested in learning more about crystalline silica, a list of selected readings and other resources is included. The detailed glossary, which defines many terms that are beyond the scope of this publication, is designed to help the reader move from this presentation to a more technical one, the inevitable next step.

  18. Primer on molecular genetics

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  19. Coal Bed Methane Primer

    SciTech Connect

    Dan Arthur; Bruce Langhus; Jon Seekins


    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  20. A Quantum Groups Primer

    NASA Astrophysics Data System (ADS)

    Majid, Shahn


    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  1. Laser Doppler velocimetry primer

    NASA Technical Reports Server (NTRS)

    Bachalo, William D.


    Advanced research in experimental fluid dynamics required a familiarity with sophisticated measurement techniques. In some cases, the development and application of new techniques is required for difficult measurements. Optical methods and in particular, the laser Doppler velocimeter (LDV) are now recognized as the most reliable means for performing measurements in complex turbulent flows. And such, the experimental fluid dynamicist should be familiar with the principles of operation of the method and the details associated with its application. Thus, the goals of this primer are to efficiently transmit the basic concepts of the LDV method to potential users and to provide references that describe the specific areas in greater detail.

  2. Multiplexed Primer Prediction for PCR


    MPP predicts sets of multiplex-compatible primers for Polymerase Chain Reaction (PCR), finding a near minimal set of primers such that at least one amplicon will be generated from every target sequence in the input file. The code finds highly conserved oligos that are suitable as primers, according to user-specified desired primer characteristics such as length, melting temperature, and amplicon length. The primers are predicted not to form unwanted dimer or hairpin structures. The target sequencesmore » used as input can be diverse, since no multiple sequence alighment is required. The code is scalable, taking up to tens of thousands of sequences as input, and works, for example, to find a "universal primer set" for all viral genomes provided as a single input file. The code generates a periodic check-point file, thus in the event of premature execution termination, the application can be restarted from the last check-point file.« less

  3. Limited-life cartridge primers


    Makowiecki, D.M.; Rosen, R.S.


    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  4. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  5. Limited-life cartridge primers


    Makowiecki, Daniel M.; Rosen, Robert S.


    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  6. A Brief Taxometrics Primer

    PubMed Central

    Beauchaine, Theodore P.


    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  7. STR primer concordance study.


    Budowle, B; Masibay, A; Anderson, S J; Barna, C; Biega, L; Brenneke, S; Brown, B L; Cramer, J; DeGroot, G A; Douglas, D; Duceman, B; Eastman, A; Giles, R; Hamill, J; Haase, D J; Janssen, D W; Kupferschmid, T D; Lawton, T; Lemire, C; Llewellyn, B; Moretti, T; Neves, J; Palaski, C; Schueler, S; Sgueglia, J; Sprecher, C; Tomsey, C; Yet, D


    Over 1500 population database samples comprising African Americans, Caucasians, Hispanics, Native Americans, Chamorros and Filipinos were typed using the PowerPlex 16 and the Profiler Plus/COfiler kits. Except for the D8S1179 locus in Chamorros and Filipinos from Guam, there were eight examples in which a typing difference due to allele dropout was observed. At the D8S1179 locus in the population samples from Guam, there were 13 examples of allele dropout observed when using the Profiler Plus kit. The data support that the primers used in the PowerPlex 16, Profiler Plus, and COfiler kits are reliable for typing reference samples that are for use in CODIS. In addition, allele frequency databases have been established for the STR loci Penta D and Penta E. Both loci are highly polymorphic. PMID:11741760

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  9. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives... the primer except where the blasthole contains sufficient depth of water to protect the primer...

  10. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert


    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  11. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie


    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  12. A Hearing Aid Primer 1

    ERIC Educational Resources Information Center

    Yetter, Carol J.


    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  13. Postsecondary Data Connections: A Primer

    ERIC Educational Resources Information Center

    Data Quality Campaign, 2011


    There is an increasing focus at the state and federal levels on linking data across the P-20/Workforce spectrum to help inform policies and practices. This primer is intended to provide policymakers with: (1) An overview of the status of states vis-a-vis the linking of postsecondary data to K-12 and workforce data; (2) A subset of questions…

  14. A Primer on Multilevel Modeling

    ERIC Educational Resources Information Center

    Hayes, Andrew F.


    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  15. Freshwater Wetlands: A Citizen's Primer.

    ERIC Educational Resources Information Center

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  16. Primer vector theory and applications

    NASA Technical Reports Server (NTRS)

    Jezewski, D. J.


    A method developed to compute two-body, optimal, N-impulse trajectories was presented. The necessary conditions established define the gradient structure of the primer vector and its derivative for any set of boundary conditions and any number of impulses. Inequality constraints, a conjugate gradient iterator technique, and the use of a penalty function were also discussed.

  17. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  18. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR


    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  19. 30 CFR 75.1317 - Primer cartridges.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer cartridges. 75.1317 Section 75.1317... MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Explosives and Blasting § 75.1317 Primer cartridges. (a) Primer cartridges shall be primed and loaded only by a qualified person or a person working in...

  20. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2011 CFR


    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Primer protection. 57.6304 Section 57.6304... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives or blasting agents that are 4 inches (100 millimeters)...

  1. Using Primers to Motivate Your Students

    ERIC Educational Resources Information Center

    Graff, Dan


    Primers are used to motivate and uplift your class. They come in many different styles and can be used in a variety of ways. Making primers relevant to students helps them to learn and makes them feel appreciated and knowledgeable when they participate. Using primers in the classroom to make students feel valued brings much success.

  2. Primer residues deposited by handguns.


    Cooper, R; Guileyardo, J M; Stone, I C; Hall, V; Fletcher, L


    There is much anecdotal information being disseminated, even offered in expert witness testimony, concerning the deposit of primer residues on the hands of persons in front of the muzzle of handguns. We present data for 9 mm and 380 Auto pistols and for a 38 caliber revolver depicting the procedure for obtaining wipings taken from targets representing the hands of a gunshot victim. These wipings from pork tissue were then analyzed for the primer residue metals antimony, barium, and lead. The data show that the two primary metals, antimony and barium, are deposited on the targets out to 4 feet for the pistols and out to three feet for the 38-caliber revolver. Testing will continue in actual cases with the gun and ammunition involved in the shooting. PMID:7879775

  3. Water based adhesive primers on aluminum substrates

    SciTech Connect

    Wightman, J.P.; Mori, S.


    The number of aluminum alloy bonding applications has been increasing recently in the automobile industry. Primer coating of aluminum substrates is one of the main processes used to promote bond performance. Solvent based organic primers have been used for a long time but environmental regulations now require the substitution of volatile organic compounds (VOC) by alternate materials such as water based adhesive primers. However, the bond strengths obtained with many water based primers are generally lower than for solvent based ones. Water based primers which have some reactive functional groups have been proposed recently but such primers require special treatment. This paper describes a study conducted to optimize bond strength using a water based adhesive as a primer in the adhesive bonding of anodized aluminum.

  4. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.


    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong


    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  5. In silico PCR primer designing and validation.


    Kumar, Anil; Chordia, Nikita


    Polymerase chain reaction (PCR) is an enzymatic reaction whose efficiency and sensitivity largely depend on the efficiency of the primers that are used for the amplification of a concerned gene/DNA fragment. Selective amplification of nucleic acid molecules initially present in minute quantities provides a powerful tool for analyzing nucleic acids. In silico method helps in designing primers. There are various programs available for PCR primer design. Here we described designing of primers using web-based tools like "Primer3" and "Web Primer". For designing the primer, DNA template sequence is required that can be taken from any of the available sequence databases, e.g., RefSeq database. The in silico validation can be carried out using BLAST tool and Gene Runner software, which check their efficiency and specificity. Thereafter, the primers designed in silico can be validated in the wet lab. After that, these validated primers can be synthesized for use in the amplification of concerned gene/DNA fragment. PMID:25697657

  6. Nucleic acid amplification using modular branched primers


    Ulanovsky, Levy; Raja, Mugasimangalam C.


    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  7. URPD: a specific product primer design tool

    PubMed Central


    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at PMID:22713312

  8. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.


    O'Halloran, Damien M


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  9. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.


    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  10. Linear elastic fracture mechanics primer

    NASA Astrophysics Data System (ADS)

    Wilson, Christopher D.


    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  11. Linear elastic fracture mechanics primer

    NASA Technical Reports Server (NTRS)

    Wilson, Christopher D.


    This primer is intended to remove the blackbox perception of fracture mechanics computer software by structural engineers. The fundamental concepts of linear elastic fracture mechanics are presented with emphasis on the practical application of fracture mechanics to real problems. Numerous rules of thumb are provided. Recommended texts for additional reading, and a discussion of the significance of fracture mechanics in structural design are given. Griffith's criterion for crack extension, Irwin's elastic stress field near the crack tip, and the influence of small-scale plasticity are discussed. Common stress intensities factor solutions and methods for determining them are included. Fracture toughness and subcritical crack growth are discussed. The application of fracture mechanics to damage tolerance and fracture control is discussed. Several example problems and a practice set of problems are given.

  12. A primer on gadolinium chemistry

    PubMed Central

    Sherry, A. Dean; Caravan, Peter; Lenkinski, Robert E.


    Gadolinium is widely known by all practitioners of MRI but few appreciate the basic solution chemistry of this trivalent lanthanide ion. Given the recent linkage between gadolinium contrast agents and nephrogenic systemic fibrosis, some basic chemistry of this ion must be more widely understood. This short primer on gadolinium chemistry is intended to provide the reader the background principles necessary to understand the basics of chelation chemistry, water hydration numbers, and the differences between thermodynamic stability and kinetic stability or inertness. We illustrate the fundamental importance of kinetic dissociation rates in determining gadolinium toxicity in vivo by presenting new data for a novel europium DOTA-tetraamide complex that is relatively unstable thermodynamically yet extraordinarily inert kinetically and also quite non-toxic. This, plus other literature evidence forms the basis of the fundamental axiom that it is the kinetic stability of a gadolinium complex, not its thermodynamic stability, that determines its in vivo toxicity. PMID:19938036

  13. A Practical Primer on Geostatistics

    USGS Publications Warehouse

    Olea, Ricardo A.


    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  14. Primer on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Luna, Tom


    This section of the Idaho Primer on Special Education in Charter Schools is divided into two parts: (1) a discussion of the legal status of charter schools and their linkage to other local education agencies (LEAs), and (2) a synopsis of federal laws that are most relevant to special education in charter schools. The Primer on Special Education in…

  15. Electrostatic Discharge testing of propellants and primers

    SciTech Connect

    Berry, R.B.


    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  16. SBE primer : multiplexing minisequencing-based genotyping

    SciTech Connect

    Kaderali, L.; Deshpande, A.; Uribe-Romeo, F. J.; Schliep, A.; Torney, D. C.


    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  17. Climate change primer for respirologists.


    Takaro, Tim K; Henderson, Sarah B


    Climate change is already affecting the cardiorespiratory health of populations around the world, and these impacts are expected to increase. The present overview serves as a primer for respirologists who are concerned about how these profound environmental changes may affect their patients. The authors consider recent peer-reviewed literature with a focus on climate interactions with air pollution. They do not discuss in detail cardiorespiratory health effects for which the potential link to climate change is poorly understood. For example, pneumonia and influenza, which affect >500 million people per year, are not addressed, although clear seasonal variation suggests climate-related effects. Additionally, large global health impacts in low-resource countries, including migration precipitated by environmental change, are omitted. The major cardiorespiratory health impacts addressed are due to heat, air pollution and wildfires, shifts in allergens and infectious diseases along with respiratory impacts from flooding. Personal and societal choices about carbon use and fossil energy infrastructure should be informed by their impacts on health, and respirologists can play an important role in this discussion. PMID:25664458

  18. MRI Biosensors: A Short Primer

    PubMed Central

    Louie, Angelique


    Interest in Magnetic Resonance Imaging (MRI) contrast agents for molecular imaging of biological function experienced a surge of excitement approximately 20 years ago with the development of the first activatable contrast agents that could act as biosensors and turn “on” in response to a specific biological activity. This brief tutorial, based on a short course lecture from the 2011 ISMRM meeting, provides an overview of underlying principles governing the design of biosensing contrast agents. We describe mechanisms by which a magnetic resonance imaging (MRI) contrast agent can be made into a sensor for both T1 and T2 types contrast agents. Examples of biological activities that can interact with a contrast agent are discussed using specific examples from the recent literature to illustrate the primary mechanisms of action that have been utilized to achieve activation. MRI sensors for pH, ion binding, enzyme cleavage, and oxidation-reduction are presented. This article is not meant to be an exhaustive review, but an illustrative primer to explain how activation can be achieved for an MRI contrast agent. Chemical exchange saturation transfer (CEST) is not covered as these agents were covered in a separate lecture. PMID:23996662

  19. Primer on spontaneous heating and pyrophoricity

    SciTech Connect

    Not Available


    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  20. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    Two artifacts introduced in using differential display technology are (1) random priming from dT present from affinity purification of PolyA+ RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. We have developed a method eliminating both problems. By separately using 5`-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns, we can detect only those products incorporating the (T){sub 12}XY primer on the 3` ends and the arbitrary primer on 5` ends. Those bands that are generated randomly in the PCR are readily detectable and can be ignored.

  1. Multiplexing Short Primers for Viral Family PCR

    SciTech Connect

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W


    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  2. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.


    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  3. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III


    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  4. Use of labeled primers for differential display

    SciTech Connect

    Paunesku, T.; Woloschak, G.E.


    The differential display of eukaryotic cDNAs using PCR allows for determination of mRNA species differentially expressed when comparing two similar cell populations. This procedure uses a (T){sub 12}XY oligonucleotide as the 3 ft primer and an arbitrary 8-10-mer as the 5 ft primer. Labeling occurs by inclusion of {alpha}[{sup 33}P]-dATP in the PCR reaction. Two artifacts caused by this approach are (1) random printing from dT present from affinity purification of PolyA+RNA and (2) hybridization of the arbitrary primer to template target sequences on both cDNA strands. In this work, we have developed an approach for both eliminating smearing and identifying nonspecific bands on sequencing gels. By separately using 5 ft-end-labeled (T){sub 12}XY and arbitrary primers to label bands and comparing two differential display patterns rather than including labeled nucleotides in the PCR reaction itself, we can detect only those products incorporating the M{sub 12}XY primer on the 3 ft ends and the arbitrary primer on 5 ft ends. Those bands that are generated randomly in the PCR reaction are readily detectable and can be ignored. If on the other hand, one is interested only in a diagnostic banding pattern for differential display, benefit can be derived from the simplicity of the pattern obtained when labeled (T){sub 12}XY is used.

  5. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design.


    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads Tvillinggaard; Genee, Hans Jasper; Holm, Dorte Koefoed; Carlsen, Simon; Hansen, Bjarne Gram; Patil, Kiran Raosaheb; Mortensen, Uffe Hasbro; Wernersson, Rasmus


    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (T(m)), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly flexible cassette options. PHUSER is publicly available at PMID:21622660

  6. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    SciTech Connect

    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-M finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.

  7. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes


    Yoon, Hyejin; Leitner, Thomas


    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  8. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.


    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  9. Primers on Special Education and Charter Schools: Compilation of Full Primer Set

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.; Giovannetti, Elizabeth A.; Lange, Cheryl M.; Rhim, Lauren Morando; Warren, Sandra Hopfengardner


    This set of primers for charter school authorizers; charter school operators and state-level administrators has been developed to provide background information and resources for the "builders" of charter schools and policymakers to facilitate the successful inclusion of students with disabilities in charter schools. The primers open with a…

  10. Exquisite allele discrimination by toehold hairpin primers

    PubMed Central

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.


    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  11. Primerize: automated primer assembly for transcribing non-coding RNA domains.


    Tian, Siqi; Yesselman, Joseph D; Cordero, Pablo; Das, Rhiju


    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: PMID:25999345

  12. Primerize: automated primer assembly for transcribing non-coding RNA domains

    PubMed Central

    Tian, Siqi; Yesselman, Joseph D.; Cordero, Pablo; Das, Rhiju


    Customized RNA synthesis is in demand for biological and biotechnological research. While chemical synthesis and gel or chromatographic purification of RNA is costly and difficult for sequences longer than tens of nucleotides, a pipeline of primer assembly of DNA templates, in vitro transcription by T7 RNA polymerase and kit-based purification provides a cost-effective and fast alternative for preparing RNA molecules. Nevertheless, designing template primers that optimize cost and avoid mispriming during polymerase chain reaction currently requires expert inspection, downloading specialized software or both. Online servers are currently not available or maintained for the task. We report here a server named Primerize that makes available an efficient algorithm for primer design developed and experimentally tested in our laboratory for RNA domains with lengths up to 300 nucleotides. Free access: PMID:25999345

  13. Climate Change, Health, and Communication: A Primer.


    Chadwick, Amy E


    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  14. A Primer for Objective Structured Teaching Exercises

    PubMed Central

    Schaivone, Kathryn A.


    The objective structured teaching exercise (OSTE) is a high-fidelity training method for advancing the teaching and interpersonal communication skills of faculty members and preceptors. This paper is a primer for implementation of OSTEs as part of a comprehensive faculty development program. This primer addresses teaching and precepting skills that can be most effectively enhanced and assessed by the OSTE method. Development of case scenarios, recruitment and training of standardized students, OSTE session implementation processes, and OSTE evaluation methods are discussed. The experience of the authors as well as recommendations from a review of the literature and discussions with educators with OSTE experience are included. PMID:24954944

  15. Primer: Office of Science and Technology

    SciTech Connect

    Not Available


    The OST primer is to inform new OST employees, other EPA offices, and outside agencies of the mission of the OST program as well as the functions of the OST divisions. It also provides information to OST employees on office policy and procedures.

  16. A Primer on Simulation and Gaming.

    ERIC Educational Resources Information Center

    Barton, Richard F.

    In a primer intended for the administrative professions, for the behavioral sciences, and for education, simulation and its various aspects are defined, illustrated, and explained. Man-model simulation, man-computer simulation, all-computer simulation, and analysis are discussed as techniques for studying object systems (parts of the "real…

  17. Chemically modified primers for improved multiplex PCR

    PubMed Central

    Shum, Jonathan; Paul, Natasha


    Multiplexed PCR, the amplification of multiple targets in a single reaction, presents a new set of challenges that further complicate more traditional PCR set-ups. These complications include a greater probability for non-specific amplicon formation and for imbalanced amplification of different targets, each of which can compromise quantification and detection of multiple targets. Despite these difficulties, multiplex PCR is frequently used in such applications as pathogen detection, RNA quantification, mutation analysis and now, next generation DNA sequencing. Herein, we investigate the utility of primers with one or two thermolabile 4-oxo-1-pentyl phosphotriester modifications in improving multiplex PCR performance. Initial endpoint and real-time analyses reveal a decrease in off-target amplification and subsequent increase in amplicon yield. Furthermore, the use of modified primers in multiplex set-ups revealed a greater limit of detection and more uniform amplification of each target as compared to unmodified primers. Overall, the thermolabile modified primers present a novel and exciting avenue in improving multiplex PCR performance. PMID:19258004

  18. Internet Primer: Workshop Design and Objectives.

    ERIC Educational Resources Information Center

    Laverty, Corinne Y. C.


    Outlines the design, objectives, and evaluation of an introductory Internet workshop offered with library instruction classes in an electronic classroom at Queens University (Kingston, Ontario, Canada). Presents teaching tips and frequently-asked questions. The Internet primer handouts are appended. (AEF)

  19. Microsatellite primers for red drum (Sciaenops ocellatus)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...

  20. School Safety & Youth Violence: A Legal Primer.

    ERIC Educational Resources Information Center

    Bailey, Kirk A.; Ross, Catherine J.

    This legal primer on violence in schools addresses the responsibility of school officials to respond to undisciplined youths whose behavior threatens the welfare and safety of other children in attendance. It is broken down into sections that provide a brief overview of the key rules and guidelines for school officials and teachers in each topic…

  1. Forest Interpreter's Primer on Fire Management.

    ERIC Educational Resources Information Center

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  2. Microsatellite primer resource for Populus developed from

    SciTech Connect

    Yin, Tongming; Yang, Xiaohan; Gunter, Lee E; Tuskan, Gerald A; Wullschleger, Stan D; Huang, Prof. Minren; Li, Shuxian; Zhang, Xinye


    In this study, 148 428 simple sequence repeat (SSR) primer pairs were designed from the unambiguously mapped sequence scaffolds of the Nisqually-1 genome. The physical position of the priming sites were identified along each of the 19 Populus chromosomes, and it was specified whether the priming sequences belong to intronic, intergenic, exonic or UTR regions. A subset of 150 SSR loci were amplified and a high amplification success rate (72%) was obtained in P. tremuloides, which belongs to a divergent subgenus of Populus relative to Nisqually-1. PCR reactions showed that the amplification success rate of exonic primer pairs was much higher than that of the intronic/intergenic primer pairs. Applying ANOVA and regression analyses to the flanking sequences of microsatellites, the repeat lengths, the GC contents of the repeats, the repeat motif numbers, the repeat motif length and the base composition of the repeat motif, it was determined that only the base composition of the repeat motif and the repeat motif length significantly affect the microsatellite variability in P. tremuloides samples. The SSR primer resource developed in this study provides a database for selecting highly transferable SSR markers with known physical position in the Populus genome and provides a comprehensive genetic tool to extend the genome sequence of Nisqually-1 to genetic studies in different Populus species.

  3. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur


    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers

  4. Loop-mediated amplification accelerated by stem primers.


    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence


    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  5. Rust transformation/rust compatible primers

    NASA Technical Reports Server (NTRS)

    Emeric, Dario A.; Miller, Christopher E.


    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  6. Caries inhibition by fluoride-releasing primers.


    Kerber, L J; Donly, K J


    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  7. New primers for adhesive bonding of aluminum alloys

    NASA Technical Reports Server (NTRS)

    Burrell, B. W.; Port, W. S.


    Synthetic polypeptide adhesive primers are effective, with high temperature epoxy resins, at temperatures from 100 deg to 300 deg C. Lap-shear failure loads and lap-shear strength of both primers are discussed.

  8. Instrumented drop ball tester for percussion primers

    SciTech Connect

    Woods, C.M.; Robinson, M.A.; Merten, C.W.; Robbins, V.E. ); Begeal, D.R. )


    The drop ball tester has historically been used for determining the threshold characteristics of percussion primers. Typically, the data obtained from such a tester show a wide variation with significantly large standard deviations. This requires that the acceptance specifications for primers be fairly lax. To determine how much of the data scatter was due to the tester alone, a drop ball tester was instrumented with a force monitoring gage, velocity capabilities, deflection gages, and a pressure time output measuring system. This paper deals with the basic fundamental physics involved with the tester and presents results of improvements to the tester geometry. Threshold test results are presented, correlating all of the variables measured. 8 refs., 10 figs.

  9. A primer for criticality calculations with DANTSYS

    SciTech Connect

    Busch, R.D.


    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  10. Universal COI primers for DNA barcoding amphibians.


    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping


    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. PMID:22145866

  11. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.


    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei


    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. PMID:25319067

  12. MPprimer: a program for reliable multiplex PCR primer design

    PubMed Central


    Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs) for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy), which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays. PMID:20298595

  13. Hydrology of Central Florida Lakes - A Primer

    USGS Publications Warehouse

    Schiffer, Donna M.


    INTRODUCTION Lakes are among the most valued natural resources of central Florida. The landscape of central Florida is riddled with lakeswhen viewed from the air, it almost seems there is more water than land. Florida has more naturally formed lakes than other southeastern States, where many lakes are created by building dams across streams. The abundance of lakes on the Florida peninsula is a result of the geology and geologic history of the State. An estimated 7,800 lakes in Florida are greater than 1 acre in surface area. Of these, 35 percent are located in just four counties (fig. 1): Lake, Orange, Osceola, and Polk (Hughes, 1974b). Lakes add to the aesthetic and commercial value of the area and are used by many residents and visitors for fishing, boating, swimming, and other types of outdoor recreation. Lakes also are used for other purposes such as irrigation, flood control, water supply, and navigation. Residents and visitors commonly ask questions such as Whyare there so many lakes here?, Why is my lake drying up (or flooding)?, or Is my lake spring-fed? These questions indicate that the basic hydrology of lakes and the interaction of lakes with ground water and surface water are not well understood by the general population. Because of the importance of lakes to residents of central Florida and the many questions and misconceptions about lakes, this primer was prepared by the U.S. Geological Survey (USGS) in cooperation with the St. Johns River Water Management District and the South Florida Water Management District. The USGS has been collecting hydrologic data in central Florida since the 1920s, obtaining valuable information that has been used to better understand the hydrology of the water resources of central Florida, including lakes. In addition to data collection, as of 1994, the USGS had published 66 reports and maps on central Florida lakes (Garcia and Hoy, 1995). The main purpose of this primer is to describe the hydrology of lakes in central

  14. Hubble Space Telescope Primer for Cycle 21

    NASA Astrophysics Data System (ADS)

    Gonzaga, S.; et al.


    The Hubble Space Telescope Primer for Cycle 21 is a companion document to the HST Call for Proposals1. It provides an overview of the Hubble Space Telescope (HST), with basic information about telescope operations, instrument capabilities, and technical aspects of the proposal preparation process. A thorough understanding of the material in this document is essential for the preparation of a competitive proposal. This document is available as an online HTML document and a PDF file. The HTML version, optimized for online browsing, contains many links to additional information. The PDF version is optimized for printing, but online PDF readers have search capabilities for quick retrieval of specific information.

  15. Genome-Wide Association Studies: A Primer

    PubMed Central

    Corvin, Aiden; Craddock, Nick; Sullivan, Patrick F.


    There have been nearly 400genome-wide association studies published since 2005. The GWAS approach has been exceptionally successful in identifying common genetic variants that predispose to a variety of complex human diseases and biochemical and anthropometric traits. Although this approach is relatively new, there are many excellent reviews of different aspects of the GWAS method. Here, we provide a primer, an annotated overview of the GWAS method with particular reference to psychiatric genetics. We dissect the GWAS methodology into its components and provide a brief description with citations and links to reviews that cover the topic in detail. PMID:19895722

  16. Primer on electric-utility deregulation

    SciTech Connect

    Not Available


    This primer on deregulation of the electric utility industry presents material on various subjects that are important for assessing the merits and weaknesses of alternative proposals and for generally understanding the meaning and implications of deregulation. It reviews: (a) the structure of the utility industry, its operation and its technology, with an emphasis placed on economies of scale and the benefits/problems of increased competition; (b) economic regulation, its criticisms and its prospects for improvement; and (c) the host of deregulation proposals and the few analytic studies of deregulation.

  17. Census Tracts (PHC80-2). Census '80 Product Primers: Primer Number 10.

    ERIC Educational Resources Information Center

    Bureau of the Census (DOC), Washington, DC. Data User Services Div.

    This primer is designed to teach about the concept of census tracts. Census tracts are relatively small statistical subdivisons that vary in population from about 2,500 to 8,000 and are designed to include fairly homogeneous populations. They are most often found in cities and counties of metropolitan areas of the nation. In all, there are over…

  18. Fuel primer for float type carburetors

    SciTech Connect

    Scott, W.A.


    A fuel primer for float type carburetors having a fuel bowl, the fuel bowl coupled with a fuel inlet, an outlet vent, and a nozzle, the fuel inlet coupled with a fuel source and the nozzle coupled with an intake path, the primer is described comprising: means coupled with the outlet for introducing a pressurized fluid flow in the fuel bowl and means associated with the fuel bowl and ambient air for automatically enabling ambient air flow to enter into the fuel bowl upon start up and for enabling fuel flow to enter into the intake path from the fuel bowl during pressurization of the fluid while preventing the fuel flow from exiting the air flow means during pressurization of the fluid such that air enters an engine through the means associated with the fuel bowl and the engine begins to run and continues to run during start up enabling an operator to move a choke from a closed to an open position for continuous operation of the engine.

  19. Formaldehyde as hypothetical primer of biohomochirality

    NASA Astrophysics Data System (ADS)

    Goldanskii, Vitalii I.


    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and ``annihilation'' of L and D enantiomers) to the series of interactions of FA ``trimers'' (i.e. C3H6O3 compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means ``achirons'' (a=CHn, n>=2 and C=M, M=C,O) and (p) mean ``prochirons'' (p=HC*OM, M=H,C).

  20. Global Health in Family Medicine Summer Primer

    PubMed Central

    Rouleau, Katherine; Janakiram, Praseedha; Nicolle, Eileen; Godoy-Ruiz, Paula; Pakes, Barry N.


    Abstract Problem addressed Despite the rapid emergence of global health training across North American universities, there remains a gap in educational programs focusing on the unique role of family medicine and primary care in global health. Objective of program The objective of the Global Health in Family Medicine Summer Primer, developed in 2013 by the Department of Family and Community Medicine at the University of Toronto in Ontario, is to strengthen global health competencies among family medicine residents and faculty. Program description The course covers the meaning of global health; global health ethics; the place of family medicine, primary care, and primary health care in the global health context; epidemiology; infectious diseases; the social determinants of health; and care of vulnerable populations locally and globally. The course is delivered in an intensive 5-day format with didactic lectures, group discussions, interactive workshops, and lived-experience panels. Conclusion The Global Health in Family Medicine Summer Primer has proven to be a successful educational initiative and provides valuable lessons learned for other academic science centres in developing global health training programs for family medicine residents and faculty. PMID:26380854

  1. Alanylated lipoteichoic acid primer in Bacillus subtilis

    PubMed Central

    Luo, Yu


    Lipoteichoic acid is a major lipid-anchored polymer in Gram-positive bacteria such as Bacillus subtilis. This polymer typically consists of repeating phosphate-containing units and therefore has a predominant negative charge. The repeating units are attached to a glycolipid anchor which has a diacylglycerol (DAG) moiety attached to a dihexopyranose head group. D-alanylation is known as the major modification of type I and type IV lipoteichoic acids, which partially neutralizes the polymer and plays important roles in bacterial survival and resistance to the host immune system. The biosynthesis pathways of the glycolipid anchor and lipoteichoic acid have been fully characterized. However, the exact mechanism of D-alanyl transfer from the cytosol to cell surface lipoteichoic acid remains unclear. Here I report the use of mass spectrometry in the identification of possible intermediate species in the biosynthesis and D-alanylation of lipoteichoic acid: the glycolipid anchor, nascent lipoteichoic acid primer with one phosphoglycerol unit, as well as mono- and di-alanylated forms of the lipoteichoic acid primer. Monitoring these species as well as the recently reported D-alanyl-phosphatidyl glycerol should aid in shedding light on the mechanism of the D-alanylation pathway of lipoteichoic acid. PMID:27134729

  2. Better primer design for metagenomics applications by increasing taxonomic distinguishability

    PubMed Central


    Current methods of understanding microbiome composition and structure rely on accurately estimating the number of distinct species and their relative abundance. Most of these methods require an efficient PCR whose forward and reverse primers bind well to the same, large number of identifiable species, and produce amplicons that are unique. It is therefore not surprising that currently used universal primers designed many years ago are not as efficient and fail to bind to recently cataloged species. We propose an automated general method of designing PCR primer pairs that abide by primer design rules and uses current sequence database as input. Since the method is automated, primers can be designed for targeted microbial species or updated as species are added or deleted from the database. In silico experiments and laboratory experiments confirm the efficacy of the newly designed primers for metagenomics applications. PMID:24564926

  3. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    PubMed Central

    Luesken, Francisca A.; Zhu, Baoli; van Alen, Theo A.; Butler, Margaret K.; Diaz, Marina Rodriguez; Song, Bongkeun; Op den Camp, Huub J. M.; Jetten, Mike S. M.; Ettwig, Katharina F.


    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment. PMID:21460105

  4. Partially overlapping primer-based PCR for genome walking.


    Li, Haixing; Ding, Dongqin; Cao, Yusheng; Yu, Bo; Guo, Liang; Liu, Xiaohua


    Current genome walking methods are cumbersome to perform and can result in non-specific products. Here, we demonstrate the use of partially overlapping primer-based PCR (POP-PCR), a direct genome walking technique for the isolation of unknown flanking regions. This method exploits the partially overlapping characteristic at the 3' ends of a set of POP primers (walking primers), which guarantees that the POP primer only anneals to the POP site of the preceding PCR product at relatively low temperatures. POP primer adaptation priming at the genomic DNA/POP site occurs only once due to one low-/reduced-stringency cycle in each nested PCR, resulting in the synthesis of a pool of single-stranded DNA molecules. Of this pool, the target single-stranded DNA is replicated to the double-stranded form bound by the specific primer and the POP primer in the subsequent high-stringency cycle due to the presence of the specific primer-binding site. The non-target single stranded DNA does not become double stranded due to the absence of a binding site for any of the primers. Therefore, the POP-PCR enriches target DNA while suppressing non-target products. We successfully used POP-PCR to retrieve flanking regions bordering the gadA locus in Lactobacillus brevis NCL912, malQ in Pichia pastoris GS115, the human aldolase A gene, and hyg in rice. PMID:25811779

  5. Great Lakes rivermouths: a primer for managers

    USGS Publications Warehouse

    Pebbles, Victoria; Larson, James; Seelbach, Paul


    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  6. The Dating Violence Questionnaire: Validation of the Cuestionario de Violencia de Novios Using a College Sample From the United States.


    López-Cepero, Javier; Fabelo, Humberto Eduardo; Rodríguez-Franco, Luis; Rodríguez-Díaz, F Javier


    This study provides psychometric information for the Dating Violence Questionnaire (DVQ), an instrument developed to assess intimate partner victimization among adolescents and youths. This instrument, an English version of Cuestionario de Violencia de Novios, assesses both frequency and discomfort associated with 8 types of abuse (detachment, humiliation, sexual, coercion, physical, gender-based, emotional punishment, and instrumental). Participant included 859 U.S. students enrolled in undergraduate psychology courses in a mid-Atlantic university (M = 19 years; SD = 1.5 years). One-third of the participants were males, and two-thirds were females. Regarding racial identity, around 55% of participants identified themselves as White, 22% as African American, 12% as Asian, whereas 11% selected other identities. Around 9% of participants identified themselves as Hispanic. Confirmatory factor analysis shows that the DVQ achieved adequate goodness-of-fit indexes for the original eight-factor model (X(2)/df <5; root mean square error of approximation [RMSEA] <.080), as well as higher parsimony when compared to simpler alternative models. The 8 scales demonstrated acceptable internal consistency indexes (α >.700), surpassing those found in the original Spanish validation. Descriptive analysis suggests higher victimization experience on subtle aggressions (detachment, coercion, and emotional punishment), with overt abuses (physical, instrumental) obtaining the smallest means; these findings were similar across gender, race identity, and ethnicity. Results of this validation study encourage the inclusion of DVQ in both research and applied contexts. PMID:27076450

  7. Primer on tritium safe handling practices

    SciTech Connect

    Not Available


    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  8. HST archive primer, version 4.1

    NASA Technical Reports Server (NTRS)

    Fruchter, A. (Editor); Baum, S. (Editor)


    This version of the HST Archive Primer provides the basic information a user needs to know to access the HST archive via StarView the new user interface to the archive. Using StarView, users can search for observations interest, find calibration reference files, and retrieve data from the archive. Both the terminal version of StarView and the X-windows version feature a name resolver which simplifies searches of the HST archive based on target name. In addition, the X-windows version of StarView allows preview of all public HST data; compressed versions of public images are displayed via SAOIMAGE, while spectra are plotted using the public plotting package, XMGR. Finally, the version of StarView described here features screens designed for observers preparing Cycle 5 HST proposals.

  9. Automotive body primers: Their application in vehicle identification.


    Deaken, D


    An approach to vehicle identification based on the varied primer color combinations used by the automobile manufacturers is outlined. A description is given of the primer color combinations found on a number of domestic and foreign cars. The expediency of this system of vehicle identification by successive elimation is discussed. PMID:1123598

  10. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    NASA Astrophysics Data System (ADS)


    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  11. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.


    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  12. Primer on electricity futures and other derivatives

    SciTech Connect

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.


    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  13. Plastid primers for angiosperm phylogenetics and phylogeography1

    PubMed Central

    Prince, Linda M.


    Premise of the study: PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Methods: Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Results: Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Discussion: Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. “Universal” primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications. PMID:26082876

  14. PD5: A General Purpose Library for Primer Design Software

    PubMed Central

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda


    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. Results The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C++ with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. Conclusions The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: PMID:24278254

  15. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    SciTech Connect

    Gardner, S. N.


    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  16. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets


    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether theremore » are also TaqMan/Luminex probe matches within predicted amplicons.« less

  17. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.


    Pauthenier, Cyrille; Faulon, Jean-Loup


    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. PMID:24829457


    EPA Science Inventory

    This primer is designed for brownfields stakeholders concerned about vapor intrusion, including property owners, real estate developers, and contractors performing environmental site investigations. It provides an overview of the vapor intrusion issue and how it can impact the ap...

  19. A Primer of Easy Pieces: Teaching through Typical Narrative.

    ERIC Educational Resources Information Center

    Waldman, Peter


    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  20. A Pollen Primer | NIH MedlinePlus the Magazine


    ... please turn Javascript on. Feature: Managing Allergies A Pollen Primer Past Issues / Summer 2011 Table of Contents ... National Institute of Environmental Health Sciences (NIEHS) . Plant Pollen Ragweed and other weeds, such as curly dock, ...


    EPA Science Inventory

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  2. Development and characterization of microsatellite primers in Pogostemon cablin (Lamiaceae).


    Sandes, S S; Pinheiro, J B; Zucchi, M I; Monteiro, M; Arrigoni-Blank, M F; Blank, A F


    Microsatellite primers were developed and optimized for patchouli (Pogostemon cablin) to characterize the patchouli Active Germplasm Bank of Universidade Federal de Sergipe. Creation of a genomic library for patchouli enabled the design of 12 microsatellite primers. Six of these microsatellites were polymorphic, revealing two well-defined groups of individuals that possess exclusive alleles. The data allowed us to characterize the patchouli active Germplasm Bank, identify its genetic diversity, and provide new information for researching this species. PMID:24065640

  3. Universal primers that amplify RNA from all three flavivirus subgroups

    PubMed Central

    Maher-Sturgess, Sheryl L; Forrester, Naomi L; Wayper, Paul J; Gould, Ernest A; Hall, Roy A; Barnard, Ross T; Gibbs, Mark J


    Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5) coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers. PMID:18218114

  4. Teorí­as de primer y segundo orden sobre el potencial de ciertas figuras de equilibrio de cuerpos celestes

    NASA Astrophysics Data System (ADS)

    Gumbau, Manuel Forner


    Uno de los problemas que aborda la Mecánica Celeste es la determinación de las figuras de equilibrio de los cuerpos celestes. Para investigar su solución mediante métodos directos, se precisa evaluar el potencial generado por su autogravitación, el generado por su fuerza centrí­fuga y el generado por la fuerza de atracción entre los cuerpos. Los métodos clásicos de Finlay y Kopal que afrontan estos problemas, para determinar el potencial autogravitatorio en las configuraciones de equilibrio, emplean desarrollos en serie de los potenciales interior y exterior del potencial autogravitatorio. Estos métodos incurren en el error de suponer la convergencia en capas donde resulta cuestionable dicha convergencia para estos desarrollos en serie. En este trabajo se han elaborado unos algoritmos que contemplan toda la casuí&stica y que permiten una manipulación efic iente del producto de polinomios de Legendre, del producto de funciones asociada s de Legendre y del producto de armónicos esféricos como combinacióon lineal de ellos mismos, respectivamente. Se han obtenido, para primer y segundo orden en las amplitudes, los desarrollos correctos para los potencial es interior y exterior del potencial autogravitatorio para configuraciones de equilibrio aisladas, y , en primer orden de amplitudes, los mismos potenciales para los sistemas binarios próximos. Se ha elaborado un método analítico, en primer orden respecto de las amplitudes, para la determinación del potencial de marea en sistemas binarios próximos en el cual se manifiesta la forma de la componente secundaria del sistema

  5. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    SciTech Connect

    Rearden, Bradley T; Mueller, Don; Bowman, Stephen M; Busch, Robert D.; Emerson, Scott


    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  6. Amplification of human papillomavirus DNA sequences by using conserved primers.

    PubMed Central

    Gregoire, L; Arella, M; Campione-Piccardo, J; Lancaster, W D


    The polymerase chain reaction has potential for use in the detection of small amounts of human papillomavirus (HPV) viral nucleic acids present in clinical specimens. However, new HPV types for which no probes exist would remain undetected by using type-specific primers for the polymerase chain reaction before hybridization. Primers corresponding to highly conserved HPV sequences may be useful for detecting low amounts of known HPV DNA as well as new HPV types. Here we analyze a pair of primers derived from conserved sequences within the E1 open reading frame for HPV sequence amplification by using the polymerase chain reaction. The longest perfect homology among HPV sequences is a 12-mer within the first exon of E1M. A region of conserved amino acids coded by the E1 open reading frame allowed the detection of another highly conserved region about 850 base pairs downstream. Two 21-mers derived from these conserved regions were used to amplify sequences from all HPV DNAs used as templates. The amplified DNA was shown to be specific for HPV sequences within the E1 open reading frame. DNA from HPVs whose sequences were not available were amplified by using these two primers. HPV DNA sequences in clinical specimens could also be amplified with the primers. Images PMID:2556429

  7. PCR Primers for Metazoan Mitochondrial 12S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Kweskin, Matthew; Knowlton, Nancy


    Background Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. Methodology/Principal Findings A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. Conclusions/Significance Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans. PMID:22536450

  8. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David


    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  9. ConservedPrimers 2.0: A high-throughput pipeline for comparative genome referenced intron-flanking PCR primer design and its application in wheat SNP discovery

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In some genomic applications it is necessary to design large numbers of PCR primers in exons flanking one or several introns on the basis of orthologous gene sequences in related species. The primer pairs designed by this target gene approach are called "intron-flanking primers" or because they ar...

  10. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    SciTech Connect

    Bowman, Stephen M


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  11. Intrageneric primer design: Bringing bioinformatics tools to the class.


    Lima, André O S; Garcês, Sérgio P S


    Bioinformatics is one of the fastest growing scientific areas over the last decade. It focuses on the use of informatics tools for the organization and analysis of biological data. An example of their importance is the availability nowadays of dozens of software programs for genomic and proteomic studies. Thus, there is a growing field (private and academic) with a need for bachelor of science students with bioinformatics skills. In consideration of this need, described here is a problem-based class in which students are asked to design a set of intrageneric primers for PCR. The exercise is divided into five classes of 1 h each, in which students use freeware bioinformatics tools and data bases available through the Internet. Besides designing the set of primers, the students will consequently learn the significance and use of the major bioinformatics procedures, such as searching a data base, conducting and analyzing sequence multialignment, comparing sequences with a data base, and selecting primers. PMID:21638710

  12. New cyt b gene universal primer set for forensic analysis.


    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M


    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  13. A High Temperature Hermetic Primer and a Variable Spring Tester

    SciTech Connect

    Begeal, D.R.


    Percussion primers are used at Sandia to ignite energetic components such as pyrotechnic actuators and thermal batteries. This report describes a High Temperature Hermetic Primer (HTHP) that was developed to replace a previous G16 Percussion Primer Subassembly (Gl6PPS). The ignition mix in these primers is the same as in the discontinued Remington 44G16 (KC1O{sub 3}, SbS{sub 3}, and Ca{sub 2}Si). The HTHP has nearly the same sensitivity as the 44G16 and a significantly lower sensitivity than the G16PPS. In parallel with the HTHP development, we also designed a Variable Spring Tester (VST) to determine percussion primer ignition sensitivity with firing pins that have the same mass as those used in field applications. The tester is capable of accelerating firing pins over a velocity range of 100 to 600 inches per second for pins weighing up to 6 grams. The desired impulse can be preselected with an accuracy of better than {plus_minus}1%. The actual impulse is measured on every shot. The VST was characterized using the WW42Cl primer, as well as with the G16PPS and the HTHP. Compared to data from conventional ball drop testers, we found that ignition sensitivities were lower and there was less scatter in the sensitivity data. Our experiments indicate that ignition sensitivity is not strictly energy dependent, but also depends on the rate of deposition, or firing pin velocity in this case. Development results for the HTHP and Variable Spring Tester are discussed and design details are shown.

  14. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    Lucas, D.S.


    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  15. Environmental testing of a unique polyurethane primer/topcoat

    SciTech Connect

    Novak, H.L.; Klotz, J.M.


    High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently requires high volatile organic compound (VOC) chromated primers and epoxy topcoats. Epoxy paint tends to be brittle and has low Ultraviolet (UV) exposure resistance. A unique non-leaded/non-chromated polyurethane single coat (primer/topcoat) tradenamed BOOSTERCOAT(c) has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance. In addition, coating formulation has been optimized for electrostatic spray capability and extended potlife. This report will discuss the environmental testing of BOOSTERCOAT(c) using neutral salt spray (ASTM B-117), beach exposure, Electrochemical Impedance Spectroscopy (EIS) and Prohesion apparatus.

  16. Changes in Rous Sarcoma Virus RNA Secondary Structure near the Primer Binding Site upon tRNATrp Primer Annealing

    PubMed Central

    Morris, Shannon; Leis, Jonathan


    Predicted secondary-structure elements encompassing the primer binding site in the 5′ untranslated region of Rous sarcoma virus (RSV) RNA play an integral role in multiple viral replications steps including reverse transcription, DNA integration, and RNA packaging (A. Aiyar, D. Cobrinik, Z. Ge, H. J. Kung, and J. Leis, J. Virol. 66:2464–2472, 1992; D. Cobrinik, A. Aiyar, Z. Ge, M. Katzman, H. Huang, and J. Leis, J. Virol. 65:3864–3872, 1991; J. T. Miller, Z. Ge, S. Morris, K. Das, and J. Leis, J. Virol. 71:7648–7656, 1997). These elements include the U5-Leader stem, U5-IR stem-loop, and U5-TΨC interaction region. Limited digestion of the 5′ untranslated region of wild-type and mutant RSV RNAs with structure- and/or sequence-specific RNases detects the presence of the U5-Leader stem and the U5-IR stem-loop. When a tRNATrp primer is annealed to wild-type RNAs in vitro, limited nuclease mapping indicates that the U5-IR stem becomes partially unwound. This is not observed when mutant RNAs with altered U5-IR stem-loop structures are substituted for wild-type RNAs. The U5-Leader stem also becomes destabilized when the tRNA primer is annealed to either wild-type or mutant RNA fragments. Nuclease mapping studies of tRNATrp, as well as the viral RNA, indicate that the U5-TΨC helix does form in vitro upon primer annealing. Collectively, these data suggest that the various structural elements near the RSV primer binding site undergo significant changes during the process of primer annealing. PMID:10400722

  17. Blood Donation and Transfusion: A Primer for Health Educators.

    ERIC Educational Resources Information Center

    Felts, W. Michael; Glascoff, Mary A.


    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  18. A Primer on Fresh Water: The Environmental Citizenship Series.

    ERIC Educational Resources Information Center

    Environment Canada, Ottawa (Ontario).

    Water is the lifeblood of the environment as no organisms can survive without it. This reference booklet is designed to help people make environmentally responsible decisions. The primer is targeted at the general public (grade 8 to post-secondary) to be used by educators, communities and organizations as well as individuals, as part of a learning…

  19. Adolescence, School Transitions, and Prevention: A Research-Based Primer.

    ERIC Educational Resources Information Center

    Berliner, BethAnn

    Preventionists have long recognized that the transition from elementary to secondary school represents a period of uncertainty and profound change in young adolescents' lives. This paper offers a research-based primer for teachers and other preventionists. It builds upon the prevention literature that focuses on protective factors as well as the…

  20. Depth profiles and free volume in aircraft primer films

    NASA Astrophysics Data System (ADS)

    Van Horn, J. D.; Chen, H.; Jean, Y. C.; Zhang, W.; Jaworowski, M. R.


    Positron annihilation lifetime spectroscopy (PALS) and associated techniques provide non-destructive methods to study the free volume inside polymeric materials, and to study material characteristics over a depth profile. Cast free films of organic- or aqueous-based, non-chromated aerospace primers, when cured for about one week, had very different water vapour transport (through-plane) behaviour. In addition, both types of primer films showed strong anisotropic behaviour in in-plane versus through-plane water vapour transport rates. We report the differences between the organic- and aqueous-based aircraft primer films samples and their surface depth profiles. In bulk PALS measurements, an aged, organic-based film exhibited typical lifetimes and intensities for a particulate-containing polymer film on both faces. In contrast, aqueous-based films exhibited face oriented-dependent differences. In all aqueous- based samples, the I3 value of the back of the sample was smaller. The primer film samples were also evaluated with mono-energetic positron beam techniques to generate depth profile information. The heterogeneity in the samples was verified by Doppler broadening of energy spectroscopy (DBES). A model for the differences in the faces of the films, and their layered structure is discussed.

  1. Criticality calculations with MCNP{sup TM}: A primer

    SciTech Connect

    Mendius, P.W.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  2. Sequence-specific DNA primer effects on telomerase polymerization activity.

    PubMed Central

    Lee, M S; Blackburn, E H


    The ribonucleoprotein enzyme telomerase synthesizes one strand of telomeric DNA by copying a template sequence within the RNA moiety of the enzyme. Kinetic studies of this polymerization reaction were used to analyze the mechanism and properties of the telomerase from Tetrahymena thermophila. This enzyme synthesizes TTGGGG repeats, the telomeric DNA sequence of this species, by elongating a DNA primer whose 3' end base pairs with the template-forming domain of the RNA. The enzyme was found to act nonprocessively with short (10- to 12-nucleotide) primers but to become processive as TTGGGG repeats were added. Variation of the 5' sequences of short primers with a common 3' end identified sequence-specific effects which are distinct from those involving base pairing of the 3' end of the primer with the RNA template and which can markedly induce enzyme activity by increasing the catalytic rate of the telomerase polymerization reaction. These results identify an additional mechanistic basis for telomere and DNA end recognition by telomerase in vivo. Images PMID:8413255

  3. Deeper Learning: A Primer for State Legislators. ECS Education Trends

    ERIC Educational Resources Information Center

    Aragon, Stephanie


    A growing number of schools across the country are working hard to provide a "deeper" learning experience for their students, and state legislators are being asked to create policies that support wide-scale implementation of 21st century learning practices. This primer is created for state policymakers seeking to modify instruction and…

  4. A Primer on Economics for Financial Aid Professionals.

    ERIC Educational Resources Information Center

    Baum, Sandy

    This primer is intended to provide college financial aid professionals with a background in fundamental areas of economics. Its goal is to provide a stronger understanding of the key principles that shape need analysis systems. Part 1 presents basic economic concepts and discusses their application to college enrollment and student aid. These…

  5. Children on Medication: A Primer for School Personnel.

    ERIC Educational Resources Information Center

    Gadow, Kenneth D.

    Intended as a primer for school personnel, the book discusses children whose various disorders require them to be on medication, and describes the behavioral effects of these drugs along with their major side effects. Fundamental concepts in pharmacotherapy are reviewed, including dosage adjustment and side effects, and a brief introduction to the…

  6. Method to amplify variable sequences without imposing primer sequences


    Bradbury, Andrew M.; Zeytun, Ahmet


    The present invention provides methods of amplifying target sequences without including regions flanking the target sequence in the amplified product or imposing amplification primer sequences on the amplified product. Also provided are methods of preparing a library from such amplified target sequences.

  7. Zip Pak for Pre-Primer Reading Level (Teacher's Manual).

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children with reading deficiencies. Its goals are to: (1) increase and widen the child's ability to be selective in choosing his information and selecting information pertinent to a purpose; and (2) improve the child's ability to make decisions,…

  8. Zip Pak for Pre-Primer Reading Level.

    ERIC Educational Resources Information Center

    Scott, Norval C., Comp.

    The Zip Pak for the pre-primer reading level was developed for use with migrant Mexican American children who have reading deficiencies. The area of failure with these children has not been with the visual discrimination involved in decoding, but with the interpretation of the material to be decoded. Therefore, the 5 lessons in this student…

  9. Improved primer for bonding polyurethane adhesives to metals

    NASA Technical Reports Server (NTRS)

    Constanza, L. J.


    Primer ensures effective bonding integrity of polyurethane adhesives on metal surfaces at temperatures ranging from minus 423 degrees to plus 120 degrees F. It provides greater metal surface protection and bond strengths over this temperature range than could be attained with other adhesive systems.

  10. Philosophical Foundations: A Primer for Adult Continuing Education.

    ERIC Educational Resources Information Center

    Rampp, Lary C., Ed.; Guffey, J. Stephen, Ed.

    This document, which is intended as a primer for adult continuing education, contains 11 chapters examining the philosophical foundations of adult and continuing education. The chapter titles and authors are as follows: "Progressivism and Adult Continuing Education" (Michael Day); "Progressivism: An Anthology" (Andrea Reeve); "Progressivism;…

  11. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    ERIC Educational Resources Information Center

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  13. An economical method of indirect labeling of microsatellite primers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In order to reduce the cost of labeling and detection of microsatellite markers for QTL research, an economical method of indirect labeling reported for catfish was modified to work with honey bees. The forward primer of each pair is modified by adding a 19-base sequence at the 5’ end. This same 1...

  14. Factor Scores, Structure and Communality Coefficients: A Primer

    ERIC Educational Resources Information Center

    Odum, Mary


    (Purpose) The purpose of this paper is to present an easy-to-understand primer on three important concepts of factor analysis: Factor scores, structure coefficients, and communality coefficients. Given that statistical analyses are a part of a global general linear model (GLM), and utilize weights as an integral part of analyses (Thompson, 2006;…

  15. Specific primers for the detection of freshwater alphaproteobacterial magnetotactic cocci.


    Lin, Wei; Pan, Yongxin


    Freshwater magnetotactic cocci within Alphaproteobacteria are of ecological interest due to their ubiquitous distribution in aquatic environments as well as their potential roles in iron cycling and the bulk magnetism of sediment. To effectively investigate the diversity and distribution of these cocci, specific primers (FMTCf and FMTCr) were developed. Their specificity, applicability, and effectiveness were then evaluated theoretically and empirically. PMID:20112228

  16. The development, characterization and testing of magnesium-rich primers

    NASA Astrophysics Data System (ADS)

    Battocchi, Dante

    Aluminum alloys are widely used in aircraft industry for their strength and light weight. Those alloys that are hardened by precipitation, especially the Copper-rich of the 2000 series, are prone to corrosion and are protected against it using chromate containing coatings. The primary component of these coating systems is Chromium 6+ (CrVI) that has been found to be very toxic in the environment and carcinogenic, toxic and mutagenic in humans. The Mg-rich primer development is the result of a successful multi-year project funded by the US Air-force with its objective the replacement of coatings based on CrVI with a class of coatings less toxic and with comparable protective performances. The Mg rich primer fulfilled the USAF requirements and it is currently undergoing commercial and military qualifications testing. The use of Mg as one of the active pigments in coatings allows the primer to protect the underlying Al sacrificially, not considered possible for this substrate until now. Mg is anodic to most of the other structural metals and when particulate Mg became available commercially, the concept of the primer was first developed by analogy to Zn-rich coatings for steel. When Mg and Al are in contact and immersed in a corrosive environment, magnesium corrodes preferentially and protects the aluminum.

  17. A Primer on Individualized Education Programs for Handicapped Children.

    ERIC Educational Resources Information Center

    Torres, Scottie, Ed.

    Intended to be a practical guide for administrators, teachers, and parents on how to meet the individualized education program (IEP) requirements of Public Law 94-142, the primer provides 10 author contributed chapters to aid the reader in developing, implementing, and monitoring an IEP for every handicapped child. Chapters have the following…

  18. Criticality calculations with MCNP{trademark}: A primer

    SciTech Connect

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.


    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  19. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.


    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  20. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis.

    PubMed Central

    Ju, J; Ruan, C; Fuller, C W; Glazer, A N; Mathies, R A


    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5' end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525, 555, 580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. Images Fig. 4 Fig. 5 PMID:7753809

  1. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  2. Multiplex primer-extension assay for identification of Yersinia species.


    Dalmasso, Alessandra; Civera, Tiziana; Filipello, Virginia; Bottero, Maria Teresa


    A multiplex primer-extension reaction (PER) assay, was specifically designed for the identification of ten Yersinia species. The assay, directed towards the tufA (elongation factor Tu) gene, was tested on a total of 42 samples representing Yersinia species and non-Yersinia species. The primers used in the preliminary PCR, designed in highly conserved regions upstream and downstream of the diagnosis sites, successfully amplified a 587 bp fragment. The diagnosis sites were simultaneously interrogated using a multiplex PER and the results were confirmed by fragment sequencing. The proposed test provides an appropriate tool to monitor the presence of Yersinia spp. in food samples and to evaluate the potential hazard for consumers. PMID:24985982

  3. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  4. Recombination of polynucleotide sequences using random or defined primers


    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.


    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  5. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.


    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  6. Template-directed primer extension catalyzed by the Tetrahymena ribozyme.

    PubMed Central

    Bartel, D P; Doudna, J A; Usman, N; Szostak, J W


    The Tetrahymena ribozyme has been shown to catalyze an RNA polymerase-like reaction in which an RNA primer is extended by the sequential addition of pN nucleotides derived from GpN dinucleotides, where N = A, C, or U. Here, we show that this reaction is influenced by the presence of a template; bases that can form Watson-Crick base pairs with a template add as much as 25-fold more efficiently than mismatched bases. A mutant enzyme with an altered guanosine binding site can catalyze template-directed primer extension with all four bases when supplied with dinucleotides of the form 2-aminopurine-pN. Images PMID:2038341

  7. [Screening of peafowl microsatellite primers and analysis of genetic diversity].


    Bao, Wen-Bin; Chen, Guo-Hong; Shu, Jing-Ting; Xu, Qi; Li, Hui-Fang


    The applicability of chicken microsatellite primers to peafowl population was analyzed in the present paper, and the results showed 14 of 29 pairs of microsatellite primers from chicken could amplify peafowl DNA and produce specific allele patterns. A mean of 1.71 alleles was found for each locus. Seven pairs were highly polymorphic, and MCW0080 and MCW0098 were ideal markers for peafowl. Genetic diversity analysis within and between the green peafowl and the blue peafowl populations demonstrated that the expected heterozygosity of two peafowl populations were 0.2482 and 0.2744, respectively. The inbreeding index (FST), Reynolds' genetic distance and gene flow between the two populations were 0.078, 0.0603 and 3.896 respectively. These results indicate that the heterozygosity and the genetic diversity of these two peafowl populations were very low, and suggest a tendency towards intermixing. PMID:17035182

  8. Primer on Molecular Genetics; DOE Human Genome Program

    DOE R&D Accomplishments Database


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  9. Primer on molecular genetics. DOE Human Genome Program

    SciTech Connect

    Not Available


    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  10. Small Commercial Building Re-tuning: A Primer

    SciTech Connect

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas


    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  11. Sensory reception of the primer pheromone ethyl oleate

    NASA Astrophysics Data System (ADS)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang


    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  12. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    SciTech Connect

    D. S. Lucas


    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at

  13. The PCR-SSP Manager computer program: a tool for maintaining sequence alignments and automatically updating the specificities of PCR-SSP primers and primer mixes.


    Bunce, M; Barnardo, M C; Welsh, K I


    An emerging problem of molecular typing methods such as PCR amplification using sequence-specific primers (PCR-SSP) is that they frequently require updating as new alleles are constantly being described which potentially affect the specificity of every PCR-SSP reaction. PCR-SSP uses pairs of primers to detect cis-linked polymorphisms and thus each new allele described must be compared to each individual primer pair. Furthermore, sequence homology between the various loci for class I and class II means that, for example, new HLA-A sequences have to be compared with HLA-B and HLA-C primer mixes to rule out cross-locus amplification. We have developed a computer program known as SSP Manager which is capable of aligning HLA class I and class II sequences obtained from Internet-accessible databases such as GenBank. The program then updates all individual primer specificities held in its database before updating the specificities of all primer mixes. Sets of primer mixes can then be combined from the primer mix directory to create PCR-SSP typing trays which are subsequently analysed by the program. A report is generated which stipulates whether all known sequences are amplified and the reason for apparent failure to test for individual alleles, e.g. a lack of relevant sequence information. SSP Manager has the flexibility to cope with unusual sequences (deletions and insertions), primers with internal mismatches and primers with a deliberate mismatch. The program also has many tools for developing new primer mixes, such as the facility to search for novel reactions using Boolean operators. The organisation and operational use of the SSP Manager program is described and its uses are illustrated with an updated allele list for our previously described Phototyping PCR-SSP class I and class II typing set. The SSP Manager is available on request from the authors. PMID:9756405

  14. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.


    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  15. Rapid identification of Zygosaccharomyces with genus-specific primers.


    Hulin, Michelle; Wheals, Alan


    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. PMID:24382328

  16. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    PubMed Central


    Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of Bdelloidea and Eutardigrada in

  17. Design and in vitro evaluation of new rpoB-DGGE primers for ruminants.


    Perumbakkam, Sudeep; Craig, A Morrie


    Two new primer sets based on the rpoB gene were designed and evaluated with bovine and ovine rumen samples. The newly developed rpoB-DGGE primer set was used along with the 16S rRNA gene-V3, and another (old) rpoB-DGGE-based primer set from a previous study to in vitro compare the bovine and ovine rumen ecosystems. The results indicate a significant (P<0.001) difference in the microbial population between the two ruminants irrespective of the primers used in the analysis. Qualitative comparison of the data provides evidence for the presence of similar phyla profiles between the 16S rRNA gene and the newly developed rpoB primers. A comparison between the two rpoB-based primer sets (old and new) showed that the old rpoB-based primers failed to amplify phylum Bacteroidetes (a common phylum in the rumen) in both bovine and ovine rumen samples. The old and new rpoB-DGGE-based primers amplified a large number of clones belonging to phylum Proteobacteria, providing a useful insight into the microbial structure of the rumen. ChaoI, ACE, Simpson, and Shannon-Weaver index analysis estimated the bovine rumen to be more diverse than the ovine rumen for all three primer sets. These results provide a new insight into the community structure among ruminants using the newly developed primers in this study. PMID:21223335

  18. Fluorescence energy transfer dye-labeled primers for DNA sequencing and analysis

    SciTech Connect

    Ju, J.; Glazer, A.N.; Mathies, R.A.; Ruan, C.; Fuller, C.W.


    Fluorescent dye-labeled DNA primers have been developed that exploit fluorescence energy transfer (ET) to optimize the absorption and emission properties of the label. These primers carry a fluorescein derivative at the 5{prime} end as a common donor and other fluorescein and rhodamine derivatives attached to a modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine residue within the primer sequence as acceptors. Adjustment of the donor-acceptor spacing through the placement of the modified thymidine in the primer sequence allowed generation of four primers, all having strong absorption at a common excitation wavelength (488 nm) and fluorescence emission maxima of 525,555,580, and 605 nm. The ET efficiency of these primers ranges from 65% to 97%, and they exhibit similar electrophoretic mobilities by gel electrophoresis. With argon-ion laser excitation, the fluorescence of the ET primers and of the DNA sequencing fragments generated with ET primers is 2- to 6-fold greater than that of the corresponding primers or fragments labeled with single dyes. The higher fluorescence intensity of the ET primers allows DNA sequencing with one-fourth of the DNA template typically required when using T7 DNA polymerase. With single-stranded M13mp18 DNA as the template, a typical sequencing reaction with ET primers on a commercial sequencer provided DNA sequences with 99.8% accuracy in the first 500 bases. ET primers should be generally useful in the development of other multiplex DNA sequencing and analysis methods. 29 refs., 5 figs.

  19. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    SciTech Connect

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.


    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  20. A primer on liquid hydrocarbon storage in salt formations

    SciTech Connect

    Halfast, T.G.


    Storage caverns leached in both domal and bedded salt formations have been an economical, safe and environmentally sound method of storing large quantities of liquid hydrocarbons since the late 1940`s and today these formations are utilized throughout the world to store many different liquid hydrocarbons. This paper addresses some of the many factors that should be considered in the design and operation of a liquid hydrocarbon storage well. For anyone interested in a more thorough primer the author recommends obtaining copies of either API-RP-1114, Titled ``Leached Underground Storage Design`` or API-RP-1115, Titled ``Operation of Solution Mined Storage.``

  1. The Primer for Sports Medicine Professionals on Imaging

    PubMed Central

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda


    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  2. Steel Primer Chamber Assemblies for Dual Initiated Pyrovalves

    NASA Technical Reports Server (NTRS)

    Guemsey, Carl S.; Mizukami, Masashi; Zenz, Zac; Pender, Adam A.


    A solution was developed to mitigate the potential risk of ignition failures and burn-through in aluminum primer chamber assemblies on pyrovalves. This was accomplished by changing the assembly material from aluminum to steel, and reconfiguration of flame channels to provide more direct paths from initiators to boosters. With the geometric configuration of the channels changed, energy is more efficiently transferred from the initiators to the boosters. With the alloy change to steel, the initiator flame channels do not erode upon firing, eliminating the possibility of burn-through. Flight qualification tests have been successfully passed.

  3. The primer for sports medicine professionals on imaging: the shoulder.


    Farshad-Amacker, Nadja A; Jain Palrecha, Sapna; Farshad, Mazda


    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathologic conditions of the rotator cuff tendons and muscles, the long head of the biceps tendon, shoulder impingement, labral and glenohumeral ligament pathology, MR findings in shoulder instability, adhesive capsulitis, and osteoarthritis. PMID:24381700

  4. A NASTRAN primer for the analysis of rotating flexible blades

    NASA Technical Reports Server (NTRS)

    Lawrence, Charles; Aiello, Robert A.; Ernst, Michael A.; Mcgee, Oliver G.


    This primer provides documentation for using MSC NASTRAN in analyzing rotating flexible blades. The analysis of these blades includes geometrically nonlinear (large displacement) analysis under centrifugal loading, and frequency and mode shape (normal modes) determination. The geometrically nonlinear analysis using NASTRAN Solution sequence 64 is discussed along with the determination of frequencies and mode shapes using Solution Sequence 63. A sample problem with the complete NASTRAN input data is included. Items unique to rotating blade analyses, such as setting angle and centrifugal softening effects are emphasized.

  5. New Primers for Discovering Fungal Diversity Using Nuclear Large Ribosomal DNA

    PubMed Central

    Gloor, Gregory B.; Lindo, Zoë


    Metabarcoding has become an important tool in the discovery of biodiversity, including fungi, which are the second most speciose group of eukaryotes, with diverse and important ecological roles in terrestrial ecosystems. We have designed and tested new PCR primers that target the D1 variable region of nuclear large subunit (LSU) ribosomal DNA; one set that targets the phylum Ascomycota and another that recovers all other fungal phyla. The primers yield amplicons compatible with the Illumina MiSeq platform, which is cost-effective and has a lower error rate than other high throughput sequencing platforms. The new primer set LSU200A-F/LSU476A-R (Ascomycota) yielded 95–98% of reads of target taxa from environmental samples, and primers LSU200-F/LSU481-R (all other fungi) yielded 72–80% of target reads. Both primer sets have fairly low rates of data loss, and together they cover a wide variety of fungal taxa. We compared our results with these primers by amplifying and sequencing a subset of samples using the previously described ITS3_KYO2/ITS4_KYO3 primers, which amplify the internal transcribed spacer 2 (ITS2) of Ascomycota and Basidiomycota. With approximately equivalent read depth, our LSU primers recovered a greater number and phylogenetic diversity of sequences than the ITS2 primers. For instance, ITS3_KYO2/ITS4_KYO3 primers failed to pick up any members of Eurotiales, Mytilinidiales, Pezizales, Saccharomycetales, or Venturiales within Ascomycota, or members of Exobasidiomycetes, Microbotryomycetes, Pucciniomycetes, or Tremellomycetes within Basidiomycota, which were retrieved in good numbers from the same samples by our LSU primers. Among the OTUs recovered using the LSU primers were 127 genera and 28 species that were not obtained using the ITS2 primers, although the ITS2 primers recovered 10 unique genera and 16 species that were not obtained using either of the LSU primers These features identify the new primer sets developed in this study as useful

  6. FullSSR: Microsatellite Finder and Primer Designer

    PubMed Central

    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  7. Primer for evaluating ecological risk at petroleum release sites.


    Claff, R


    Increasingly, risk-based approaches are being used to guide decision making at sites such as service stations and petroleum product terminals, where petroleum products have been inadvertently released to the soil. For example, the API Decision Support System software, DSS, evaluates site human health risk along six different routes of exposure. The American Society for Testing and Materials' Risk-Based Corrective Action (RBCA) standard, ASTM 1739, establishes a tiered framework for evaluating petroleum release sites on the basis of human health risk. Though much of the risk assessment focus has been on human health risk, regulatory agencies recognize that protection of human health may not fully protect the environment; and EPA has developed guidance on identifying ecological resources to be protected through risk-based decision making. Not every service station or petroleum product terminal site warrants a detailed ecological risk assessment. In some cases, a simple preliminary assessment will provide sufficient information for decision making. Accordingly, the American Petroleum Institute (API) is developing a primer for site managers, to assist them in conducting this preliminary assessment, and in deciding whether more detailed ecological risk assessments are warranted. The primer assists the site manager in identifying relevant ecological receptors and habitats, in identifying chemicals and exposure pathways of concern, in developing a conceptual model of the site to guide subsequent actions, and in identifying conditions that may warrant immediate response. PMID:10189585

  8. FullSSR: Microsatellite Finder and Primer Designer.


    Metz, Sebastián; Cabrera, Juan Manuel; Rueda, Eva; Giri, Federico; Amavet, Patricia


    Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR) loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user. PMID:27366148

  9. Development of a unique polyurethane primer/topcoat

    NASA Technical Reports Server (NTRS)

    Novak, Howard L.; Klotz, James M.


    USBI Company, a Division of Pratt & Whitney Government Engines and Space Propulsion, is involved in corrosion and environmental research and development activities both at their headquarters in Huntsville, Alabama and their Florida Operations at Kennedy Space Center, Florida. The programs involve the development of environmentally compatible materials that improve the corrosion protection of expensive Solid Rocket Boosters (SRB) that are part of the Space Shuttle systems developed and managed by Marshall Space Flight Center in Huntsville, Alabama. Coatings For Industry, a paint manufacturer in Souderton, PA helped formulate and produce the first lot of BOOSTERCOAT paint. High strength aluminum aerospace flight hardware exposed to harsh seacoast environments and seawater immersion presently uses high volatile organic compound (VOC) chromated and lead bearing primers and epoxy topcoats for corrosion protection. Epoxy paint tends to be brittle and has relatively low ultraviolet (UV) exposure resistance. A unique, environmentally compatible, non-leaded/non-chromated, low VOC polyurethane single coat (primer/topcoat) trade named BOOSTERCOAT has been developed for excellent corrosion protection, flexibility, adhesion, chemical and solvent resistance properties. This report will discuss the development of BOOSTERCOAT and the potential opportunities for commercial use in the energy, transportation, chemical, maritime, structural fields.

  10. Universal multiplexable matK primers for DNA barcoding of angiosperms1

    PubMed Central

    Heckenhauer, Jacqueline; Barfuss, Michael H. J.; Samuel, Rosabelle


    Premise of the study: PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity. Methods and Results: We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success. Conclusions: These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification. PMID:27347449

  11. A sputtered zirconia primer for improved thermal shock resistance of plasma-sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.


    It is shown that the application of sputtered Y2O3-stabilized ZrO2 (YSZ) primer in plasma-sprayed YSZ ceramic-coated turbine blades results in an improvement, by a factor of 5-6, in the thermal shock life of specimens with a sprayed, porous, Ni-Cr-Al-Y intermediate layer. Species with and without the primer were found to be able to survive 1000 cycles when the intermediate layer was used, but reduced laminar cracking was observed in the specimen with the primer. It is suggested that the sputtered YZS primer-induced properties are due to (1) more effective wetting and adherence of the plasma-sprayed YZS particles to the primer, and (2) the primer's retardation of impinging, molten plasma sprayed particles solidification rates, which result in a less detrimental residual stress distribution.

  12. Selection of functional tRNA primers and primer binding site sequences from a retroviral combinatorial library: identification of new functional tRNA primers in murine leukemia virus replication

    PubMed Central

    Lund, Anders H.; Duch, Mogens; Pedersen, Finn Skou


    Retroviral reverse transcription is initiated from a cellular tRNA molecule and all known exogenous isolates of murine leukemia virus utilise a tRNAPro molecule. While several studies suggest flexibility in murine leukemia virus primer utilisation, studies on human immunodeficiency virus and avian retroviruses have revealed evidence of molecular adaptation towards the specific tRNA isoacceptor used as replication primer. In this study, murine leukemia virus tRNA utilisation is investigated by in vivo screening of a retroviral vector combinatorial library with randomised primer binding sites. While most of the selected primer binding sites are complementary to the 3′-end of tRNAPro, we also retrieved PBS sequences matching four other tRNA molecules and demonstrate that Akv murine leukemia virus vectors may efficiently replicate using tRNAArg(CCU), tRNAPhe(GAA) and a hitherto unknown human tRNASer(CGA). PMID:10637332

  13. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.


    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  14. Investigation of a hydrophilic primer for orthodontic bonding: an in vitro study.


    Littlewood, S J; Mitchell, L; Greenwood, D C; Bubb, N L; Wood, D J


    A common reason for bond failure is moisture contamination. This study investigates the in vitro bond strength of brackets bonded using a new hydrophilic primer, designed to be insensitive to moisture, and compares it with a conventional primer. Using a standardized technique, the in vitro bond strength of brackets bonded with the hydrophilic primer was compared to identical brackets bonded with a conventional primer. Although designed to be moisture insensitive, the directions for use stipulate drying the teeth before bonding. Therefore, for the purposes of comparison with a conventional primer the experiment was conducted under dry conditions. The results were analysed using the Weibull distribution modelling. The median bond strength with the hydrophilic primer (6.43 MPa, 95 per cent C.I. 7.69-9.50) was significantly lower (P = 0.0001) than the conventional primer (8.71 MPa, 95 per cent C.I. 5.89-7.59). The Weibull distribution modelling showed that brackets bonded with the hydrophilic primer were 3.96 times more at risk of failure (95 per cent C.I.: 2.39-6.56; P <0.0001). The bond strength at which 5 per cent of the brackets failed was also lower for the hydrophilic primer. The bond strengths obtained with the hydrophilic primer were significantly lower than with the conventional primer. Although the median bond strength values were promising, the laboratory results for this particular hydrophilic primer were disappointing when using the Weibull analysis, where the whole distribution of bond strength is taken into account. PMID:10867075

  15. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.


    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  16. ecoPrimers: inference of new DNA barcode markers from whole genome sequence analysis

    PubMed Central

    Riaz, Tiayyba; Shehzad, Wasim; Viari, Alain; Pompanon, François; Taberlet, Pierre; Coissac, Eric


    Using non-conventional markers, DNA metabarcoding allows biodiversity assessment from complex substrates. In this article, we present ecoPrimers, a software for identifying new barcode markers and their associated PCR primers. ecoPrimers scans whole genomes to find such markers without a priori knowledge. ecoPrimers optimizes two quality indices measuring taxonomical range and discrimination to select the most efficient markers from a set of reference sequences, according to specific experimental constraints such as marker length or specifically targeted taxa. The key step of the algorithm is the identification of conserved regions among reference sequences for anchoring primers. We propose an efficient algorithm based on data mining, that allows the analysis of huge sets of sequences. We evaluate the efficiency of ecoPrimers by running it on three different sequence sets: mitochondrial, chloroplast and bacterial genomes. Identified barcode markers correspond either to barcode regions already in use for plants or animals, or to new potential barcodes. Results from empirical experiments carried out on a promising new barcode for analyzing vertebrate diversity fully agree with expectations based on bioinformatics analysis. These tests demonstrate the efficiency of ecoPrimers for inferring new barcodes fitting with diverse experimental contexts. ecoPrimers is available as an open source project at: PMID:21930509

  17. Specific Oligonucleotide Primers for Identification of Cladophialophora carrionii, a Causative Agent of Chromoblastomycosis

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nishimura, Kazuko


    Cladophialophora carrionii is one of the relatively common causative agents of chromoblastomycosis. We have developed the specific oligonucleotide primer set based on the internal transcribed spacer regions of ribosomal DNA for the rapid identification of this pathogen. PCR with this primer set amplified a 362-bp amplicon from C. carrionii strains. From other relevant dematiaceous species, including medically important dematiaceous fungi, such as Fonsecaea pedrosoi, Phialophora verrucosa, and Exophiala dermatitidis, and eight species of medically important yeasts, such as Candida albicans and Cryptococcus neoformans var. neoformans, the primer set did not produce any amplicon. PCR with this primer set may be a useful tool for the identification of C. carrionii. PMID:14715791

  18. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  19. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.


    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  20. Express Primer Tool for high-throughput gene cloning and expression


    A tool to assist in the design of primers for DNA amplification. The Express Primer web-based tool generates primer sequences specifically for the generation of expression clones for both lab scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for simultaneous amplification of multiple target genes.more » The Express Primer Tool enables the user to specify various experimental parameters (e.g. optimal Tm, Tm range, maximum Tm difference) for single or multiple candidate sequence(s) in FASTA format input as a flat text (ASCII) file. The application generates condidate primers, selects optimal primer pairs, and writes the forward and reverse primers pairs to an Excel file that is suitable for electronic submission to a synthesis facility. The program parameters emphasize high-throughput but allow for target atrition at various stages of the project.« less

  1. Informe del NCI y los CDC sobre el tabaco sin humo

    El primer informe sobre el consumo mundial del tabaco sin humo y sus consecuencias en la salud pública reveló que más de 300 millones de personas en al menos 70 países usan estos productos dañinos.

  2. Replication of avian leukosis viruses with mutations at the primer binding site: use of alternative tRNAs as primers.

    PubMed Central

    Whitcomb, J M; Ortiz-Conde, B A; Hughes, S H


    We have tested whether avian leukosis viruses (ALVs) can use tRNAs other than tRNATrp to initiate reverse transcription. The primer binding site (PBS) of a wild-type ALV provirus, which is complementary to the 3' end of tRNA(Trp), was replaced with sequences homologous to the 3' ends of six different chicken tRNAs (tRN(APro), tRNA(Lys), tRNA(Met), tRNA(Ile), tRNA(Phe), and tRNA(Ser)). Transfection of these proviruses into chicken embryo fibroblasts resulted in the production of infectious viruses, all of which apparently used the tRNA specified by the mutated PBS to replicate. However, growth of these viruses resulted in reversion to the wild-type (tRNA(Trp)) PBS. Some of the viruses revert quite quickly, while others are more stable. The relative stability of a given PBS correlated with the concentration of the corresponding tRNA in the virion. We determined the percentage of viral RNA that had a tRNA bound to the PBS and found that the occupancy rate is lower in the mutants than in the wild-type virus. We conclude that many different tRNAs can be used as primers to initiate reverse transcription in ALV. However, ALVs that use tRNA(Trp) have a growth advantage over ALVs that use other tRNAs. PMID:7545245

  3. Development of a ceramic primer with higher bond durability for resin cement.


    Li, Rui


    To increase the bond durability of resin to the CAD/CAM ceramic surface, two types of two-bottle type ceramic primers, consisting of Primer A1 or A2 and Primer B, were designed. Primer A1 was prepared by dissolving 25, 50, or 100 mg of gamma-methacryloxypropyltrimethoxysilane in 1 mL of ethanol. Primer A2 was prepared by dissolving 50 mg of mixed silanes, consisting of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane, in 1 mL of ethanol. Mole fractions of 1,2-bis(trimethoxysilyl)ethane to gamma-methacryloxypropyltrimethoxysilane were 0, 10, 20, 30, 40 and 50 mol%. Primer B was prepared after dissolving 0.01, 0.05 or 0.1 mol L(-1) hydrochloric acid in ethanol by 50 vol%. Ceramic surface was silanated with a mixture of Primers A1 and B or Primers A2 and B for 1 min, and then air-dried. Commercial GC ceramic primer and Porcelain Liner M were utilized. Thereafter, dual-curing type resin cement was bonded to silanated ceramic surface through visible-light irradiation. Shear bond strength of resin to the ceramic surface was measured, before and after thermo-cycling. Addition of 0.01 or 0.05 mol L(-1) hydrochloric acid to the gamma-methacryloxypropyltrimethoxysilane allowed for significant increases in the bond strength. However, thermo-cycling resulted in significant decreases of approximately 5 MPa in the bond strength. Conversely, when the mixed silane, where 30 mol% of 1,2-bis(trimethoxysilyl)ethane dissolved in gamma-methacryloxypropyltrimethoxysilane, was utilized with 0.05 mol L(-1) hydrochloric acid, the reduction in the bond strength decreased to approximately 2 MPa. The designed ceramic primers exhibited higher ceramic bond durability than commercial ceramic primers. PMID:20136699

  4. Cyanine dyes with high absorption cross section as donor chromophores in energy transfer primers

    SciTech Connect

    Hung, Su-Chung; Ju, Jingyue; Mathies, R.A.; Glazer, A.N.


    Energy transfer (ET) fluorescent primers are significantly superior to single dye-labeled primers for DNA sequencing and multiplex genetic analyses. We describe here ET primers in which a donor chromophore with a large absorption cross section but a low fluorescence quantum yield is exploited to increase the Stokes-shifted fluorescence emission of acceptor dyes. The new ET primers have 3-({var_epsilon}-carboxy-pentyl)-3{prime}-ethyl-5,5{prime}-dimethyloxacarbocyanine (CYA; {var_epsilon}{sub M}{sup 488 nm} 142,000 M{sup -1} cm{sup -1}) at the 5{prime}-end as a common energy donor, and fluorescein or rhodamine derivatives (FAM, R6G, TAMRA, and ROX), attached to a modified thymidine 10 bases away within the primer sequence, as acceptors. With 488-nm excitation, the fluorescence emission intensity of these four ET primers is 1.4- to 24-fold stronger than that of the corresponding primers labeled only with the single acceptor dye. When compared with the corresponding ET primers with a fluorescein derivative (FAM; {var_epsilon}{sub M}{sup 488 nm} 60,000 M{sup -1} cm{sup -1}) as donor, the fluorescence emissions of primers with CYA as donor and FAM, R6G, TAMRA, and ROX as acceptors are respectively 0.8-, 1.0-, 1.7-, and 1.7-fold as intense. The low fluorescence quantum yield of the CYA donor resulted in distinct fluorescence signals for the DNA-sequencing fragments with much lower crosstalk between the four detection channels than that seen with ET primers based on a FAM donor. With single-stranded M13mp18 DNA as the template, the CYA ET primers provided DNA sequences on a four-color capillary sequencer with 100% accuracy in the first 500 bases. 15 refs., 7 figs., 1 tab.

  5. Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

    PubMed Central

    Marcon, Helena Sanches; Coscrato, Virgínia Elias; Selivon, Denise; Perondini, André Luiz Paranhos; Marino, Celso Luis


    Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity. PMID:24031693

  6. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    NASA Astrophysics Data System (ADS)


    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  7. 'Not just little adults' - a pediatric trauma primer.


    Overly, Frank L; Wills, Hale; Valente, Jonathan H


    This article describes pediatric trauma care and specifically how a pediatric trauma center, like Hasbro Children's Hospital, provides specialized care to this patient population. The authors review unique aspects of pediatric trauma patients broken down into anatomy and physiology, including Airway and Respiratory, Cardiovascular Response to Hemorrhage, Spine Injuries, Traumatic Brain Injuries, Thoracic Injuries and Blunt Abdominal Trauma. They review certain current recommendations for evaluation and management of these pediatric patients. The authors also briefly review the topic of Child Abuse/Non-accidental Trauma in pediatric patients. Although Pediatric Trauma is a very broad topic, the goal of this article is to act as a primer and describe certain characteristics and management recommendations unique to the pediatric trauma patient. PMID:24400309

  8. Primer Part 1-The building blocks of epilepsy genetics.


    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C


    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. PMID:27226047

  9. A Primer to Single-Particle Cryo-Electron Microscopy

    PubMed Central

    Cheng, Yifan; Grigorieff, Nikolaus; Penczek, Pawel A.; Walz, Thomas


    Summary Cryo-electron microscopy (cryo-EM) of single-particle specimens is used to determine the structure of proteins and macromolecular complexes without the need for crystals. Recent advances in detector technology and software algorithms now allow images of unprecedented quality to be recorded and structures to be determined at near-atomic resolution. However, compared with X-ray crystallography, cryo-EM is a young technique with distinct challenges. This primer explains the different steps and considerations involved in structure determination by single-particle cryo-EM to provide an overview for scientists wishing to understand more about this technique and the interpretation of data obtained with it, as well as a starting guide for new practitioners. PMID:25910204

  10. ParaDiS-FEM dislocation dynamics simulation code primer

    SciTech Connect

    Tang, M; Hommes, G; Aubry, S; Arsenlis, A


    The ParaDiS code is developed to study bulk systems with periodic boundary conditions. When we try to perform discrete dislocation dynamics simulations for finite systems such as thin films or cylinders, the ParaDiS code must be extended. First, dislocations need to be contained inside the finite simulation box; Second, dislocations inside the finite box experience image stresses due to the free surfaces. We have developed in-house FEM subroutines to couple with the ParaDiS code to deal with free surface related issues in the dislocation dynamics simulations. This primer explains how the coupled code was developed, the main changes from the ParaDiS code, and the functions of the new FEM subroutines.

  11. [The pharmacology of humour -- a primer to quantum humourdynamics].


    Györfi, András


    A good word put in for someone during a medical consultation can alleviate the stress generated by the contact with the clinic. The superlative of "good word" in these situations could be a humorous phrase of the physician during the consultation, which can cause a cognitive shift in the patient's perception of her/his situation. This change of perspective will diminish the anxiety generated by the disease, can rebuild optimism and establish a good doctor-patient relationship, based on hope and collaboration. This paper analyzes the elements of humour and the neurological mechanisms involved in the emergence of mirth. The dosage of this genuine alternative medication is discussed based on a primer to quantum humor dynamics, observing the similarity between the behaviour of quantum mechanic's elementary particles with the quanta of humour called hilarion. Finally, laughter's psychological and physiological benefits are discussed, obtained through changes in circulation, respiration, muscular tonus and endorphin release. PMID:25087216

  12. Evaluation of non toxic alkyd primers by electrochemical impedance spectroscopy

    SciTech Connect

    Hernandez, L.S.; Garcia, G. |; Lopez, C.


    The purpose of this work was to compare the protective capacity of several alkyd primers pigmented with 12.1 volume percent either of calcium phosphate or micronized zinc phosphate as anticorrosive pigments. A paint containing zinc chromate was used as reference. The performance of these paints on steel was assessed through Electrochemical Impedance Spectroscopy (EIS) using a 3% NaCl solution. After 576 hr immersion, the paint with calcium phosphate and specially that with micronized zinc phosphate, showed a better behavior than paint with zinc chromate. Paint rating, using impedance parameters (ionic resistance and capacitance of the paint film, and breakpoint frequency), was in agreement with the visible paint deterioration and corrosion, In addition, there was a good correlation between these parameter and the open circuit corrosion potential of the metallic substrate.

  13. Prader-Willi syndrome: A primer for clinicians

    PubMed Central


    The advent of sensitive genetic testing modalities for the diagnosis of Prader-Willi syndrome has helped to define not only the phenotypic features of the syndrome associated with the various genotypes but also to anticipate clinical and psychological problems that occur at each stage during the life span. With advances in hormone replacement therapy, particularly growth hormone children born in circumstances where therapy is available are expected to have an improved quality of life as compared to those born prior to growth hormone. This manuscript was prepared as a primer for clinicians-to serve as a resource for those of you who care for children and adults with Prader-Willi syndrome on a daily basis in your practices. Appropriate and anticipatory interventions can make a difference. PMID:22008714

  14. MCNP{sup TM} criticality primer and training experiences

    SciTech Connect

    Briesmeister, J.; Forster, R.A.; Busch, R.


    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k{sub eff}). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k{sub eff} calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP.

  15. Comparison of Shear Bond Strength of New Self-etching Primer with Conventional Self-etching Primers: An In-vitro Study

    PubMed Central

    Sorake, Abhinay; Rai, Rohan; Hegde, Gautham; Suneja, Ridhima; Kumar, Naveena; Skaria, Jibin


    Background: In the past few years, there has been a major research drive to increase bond strength between dental materials and dental hard tissue and to reduce the associated demineralization around fixed orthodontic appliances. Thus, a recent approach is to incorporate an antibacterial agent into the primer to reduce the demineralization and enhance bond strength. The objective of this study was: (1) To evaluate the shear bond strength of orthodontic preadjusted edgewise appliance brackets bonded to extracted premolar teeth with antimicrobial self-etch primer (Reliance self-etching primer, Clearfil Protect Bond) and self-etching primer without antimicrobial agent (Clearfil SE bond). (2) To compare the mean shear bond strength values of the tested materials to conventional self-etching primer Transbond Plus. Materials and Methods: A total of 125 extracted human premolar teeth were randomly divided into five groups of 25 teeth each. Each sample was embedded in an acrylic block of polymethyl meth acrylate resin till coronal portion. Instron testing machine model LR LOYD 50 K was used for testing the shear bond strength of individual samples. Results: The results of the study showed that all five groups had adequate clinically acceptable bond strength. In intergroup comparison, there was statistically significant difference in bond strength of Reliance self-etching primer, Promt L pop, Clearfil Protect Bond, clearfil SE bond and Transbond Plus. Conclusion: Reliance self-etching primer showed highest bond strength, followed by Clearfil Protect Bond, clearfil SE bond, and Transbond Plus. Clearfil Protect Bond primer containing methacryloxy dodecyl pyridium bromide have been demonstrated to kill Streptococcus mutans within a short time of contact and also exhibits an inhibitory effect on the growth of bacteria on its surface. PMID:26229365

  16. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  17. Demystifying Special Education in Virtual Charter Schools. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Rhim, Lauren Morando; Kowal, Julie


    This special report is a supplement to a series of special education primers created to inform state officials, authorizers and charter school operators about special education in the charter sector. The primer series also provides tools to help these stakeholders build charter school capacity to provide special education and related services. In…

  18. GSP: A web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  19. A Comprehensive Evaluation of PCR Primers to Amplify the nifH Gene of Nitrogenase

    PubMed Central

    Gaby, John Christian; Buckley, Daniel H.


    The nifH gene is the most widely sequenced marker gene used to identify nitrogen-fixing Bacteria and Archaea. Numerous PCR primers have been designed to amplify nifH, but a comprehensive evaluation of nifH PCR primers has not been performed. We performed an in silico analysis of the specificity and coverage of 51 universal and 35 group-specific nifH primers by using an aligned database of 23,847 nifH sequences. We found that there are 15 universal nifH primers that target 90% or more of nitrogen fixers, but that there are also 23 nifH primers that target less than 50% of nifH sequences. The nifH primers we evaluated vary in their phylogenetic bias and their ability to recover sequences from commonly sampled environments. In addition, many of these primers will amplify genes that do not mediate nitrogen fixation, and thus it would be advisable for researchers to screen their sequencing results for the presence of non-target genes before analysis. Universal primers that performed well in silico were tested empirically with soil samples and with genomic DNA from a phylogenetically diverse set of nitrogen-fixing strains. This analysis will be of great utility to those engaged in molecular analysis of nifH genes from isolates and environmental samples. PMID:22848735

  20. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners.


    Summerfield, Marc R; Feemster, Agnes Ann


    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail's ability to meet language standards, enhance the writer's image, and successfully transmit information. PMID:26715801

  1. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.


    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  2. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  3. Degenerative primer design and gene sequencing validation for select turkey genes.


    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald


    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  4. 3-Nitropyrrole and 5-nitroindole as universal bases in primers for DNA sequencing and PCR.

    PubMed Central

    Loakes, D; Brown, D M; Linde, S; Hill, F


    3-Nitropyrrole and 5-nitroindole have been assessed as universal bases in primers for dideoxy DNA sequencing and in the polymerase chain reaction (PCR). In contrast to a previous report, we have found that the introduction of more than one 3-nitropyrrole residue at dispersed positions into primers significantly reduced their efficiency in PCR and sequencing reactions. Primers containing 5-nitroindole at multiple dispersed positions were similarly affected; for both bases only a small number of substitutions were tolerated. In PCR experiments neither base, when incorporated into primers in codon third positions, was as effective as hypoxanthine, which was incorporated in six codon third positions in a 20mer oligomer. However, primers containing up to four consecutive 5-nitroindole substitutions performed well in both PCR and sequencing reactions. Consecutive 3-nitropyrrole substitutions were tolerated, but less well in comparable reactions. Images PMID:7630712

  5. Characterization of the 18S rRNA Gene for Designing Universal Eukaryote Specific Primers

    PubMed Central

    Hadziavdic, Kenan; Lekang, Katrine; Lanzen, Anders; Jonassen, Inge; Thompson, Eric M.; Troedsson, Christofer


    High throughput sequencing technology has great promise for biodiversity studies. However, an underlying assumption is that the primers used in these studies are universal for the prokaryotic or eukaryotic groups of interest. Full primer universality is difficult or impossible to achieve and studies using different primer sets make biodiversity comparisons problematic. The aim of this study was to design and optimize universal eukaryotic primers that could be used as a standard in future biodiversity studies. Using the alignment of all eukaryotic sequences from the publicly available SILVA database, we generated a full characterization of variable versus conserved regions in the 18S rRNA gene. All variable regions within this gene were analyzed and our results suggested that the V2, V4 and V9 regions were best suited for biodiversity assessments. Previously published universal eukaryotic primers as well as a number of self-designed primers were mapped to the alignment. Primer selection will depend on sequencing technology used, and this study focused on the 454 pyrosequencing GS FLX Titanium platform. The results generated a primer pair yielding theoretical matches to 80% of the eukaryotic and 0% of the prokaryotic sequences in the SILVA database. An empirical test of marine sediments using the AmpliconNoise pipeline for analysis of the high throughput sequencing data yielded amplification of sequences for 71% of all eukaryotic phyla with no isolation of prokaryotic sequences. To our knowledge this is the first characterization of the complete 18S rRNA gene using all eukaryotes present in the SILVA database, providing a robust test for universal eukaryotic primers. Since both in silico and empirical tests using high throughput sequencing retained high inclusion of eukaryotic phyla and exclusion of prokaryotes, we conclude that these primers are well suited for assessing eukaryote diversity, and can be used as a standard in biodiversity studies. PMID:24516555

  6. Improved PCR primers to amplify 16S rRNA genes from NC10 bacteria.


    He, Zhanfei; Wang, Jiaqi; Hu, Jiajie; Zhang, Hao; Cai, Chaoyang; Shen, Jiaxian; Xu, Xinhua; Zheng, Ping; Hu, Baolan


    Anaerobic oxidation of methane (AOM) coupled to nitrite reduction (AOM-NIR) is ecologically significant for mitigating the methane-induced greenhouse effect. The microbes responsible for this reaction, NC10 bacteria, have been widely detected in diverse ecosystems. However, some defects were discovered in the commonly used NC10-specific primers, 202F and qP1F. In the present work, the primers were redesigned and improved to overcome the defects found in the previous primers. A new nested PCR method was developed using the improved primers to amplify 16S ribosomal RNA (rRNA) genes from NC10 bacteria. In the new nested PCR method, the qP1mF/1492R and 1051F/qP2R primer sets were used in the first and second rounds, respectively. The PCR products were sequenced, and more operational taxonomic units (OTUs) of the NC10 phylum were obtained using the new primers compared to the previous primers. The sensitivity of the new nested PCR was tested by the serial dilution method, and the limit of detection was approximately 10(3) copies g(-1) dry sed. for the environmental samples compared to approximately 10(5) copies g(-1) dry sed. by the previous method. Finally, the improved primer, qP1mF, was used in quantitative PCR (qPCR) to determine the abundance of NC10 bacteria, and the results agreed well with the activity of AOM-NIR measured by isotope tracer experiments. The improved primers are able to amplify NC10 16S rRNA genes more efficiently than the previous primers and useful to explore the microbial community of the NC10 phylum in different systems. PMID:27020287

  7. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    SciTech Connect

    Busch, R.D.


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a.

  8. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.


    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  9. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Technical Reports Server (NTRS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, B.


    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high quality data for many areas of investigation. Unconditioned simple aperture time-series photometry are however affected by systematic structure. Examples of these systematics are differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 10(exp 5) stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have occurred to remove or reduce systematic artifacts. This paper provides a conceptual primer for users of the Kepler data archive to understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  10. Demystifying Kepler Data: A Primer for Systematic Artifact Mitigation

    NASA Astrophysics Data System (ADS)

    Kinemuchi, K.; Barclay, T.; Fanelli, M.; Pepper, J.; Still, M.; Howell, Steve B.


    The Kepler spacecraft has collected data of high photometric precision and cadence almost continuously since operations began on 2009 May 2. Primarily designed to detect planetary transits and asteroseismological signals from solar-like stars, Kepler has provided high-quality data for many areas of investigation. Unconditioned simple aperture time-series photometry is, however, affected by systematic structure. Examples of these systematics include differential velocity aberration, thermal gradients across the spacecraft, and pointing variations. While exhibiting some impact on Kepler's primary science, these systematics can critically handicap potentially ground-breaking scientific gains in other astrophysical areas, especially over long timescales greater than 10 days. As the data archive grows to provide light curves for 105 stars of many years in length, Kepler will only fulfill its broad potential for stellar astrophysics if these systematics are understood and mitigated. Post-launch developments in the Kepler archive, data reduction pipeline and open source data analysis software have helped to remove or reduce systematic artifacts. This paper provides a conceptual primer to help users of the Kepler data archive understand and recognize systematic artifacts within light curves and some methods for their removal. Specific examples of artifact mitigation are provided using data available within the archive. Through the methods defined here, the Kepler community will find a road map to maximizing the quality and employment of the Kepler legacy archive.

  11. A Transparent Window into Biology: A Primer on Caenorhabditis elegans

    PubMed Central

    Corsi, Ann K.; Wightman, Bruce; Chalfie, Martin


    A little over 50 years ago, Sydney Brenner had the foresight to develop the nematode (round worm) Caenorhabditis elegans as a genetic model for understanding questions of developmental biology and neurobiology. Over time, research on C. elegans has expanded to explore a wealth of diverse areas in modern biology including studies of the basic functions and interactions of eukaryotic cells, host–parasite interactions, and evolution. C. elegans has also become an important organism in which to study processes that go awry in human diseases. This primer introduces the organism and the many features that make it an outstanding experimental system, including its small size, rapid life cycle, transparency, and well-annotated genome. We survey the basic anatomical features, common technical approaches, and important discoveries in C. elegans research. Key to studying C. elegans has been the ability to address biological problems genetically, using both forward and reverse genetics, both at the level of the entire organism and at the level of the single, identified cell. These possibilities make C. elegans useful not only in research laboratories, but also in the classroom where it can be used to excite students who actually can see what is happening inside live cells and tissues. PMID:26088431

  12. A primer to frequent itemset mining for bioinformatics.


    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart; Laukens, Kris


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences. PMID:24162173

  13. The corrosion mechanisms for primer coated 2219-T87 aluminum

    NASA Technical Reports Server (NTRS)

    Danford, Merlin D.; Knockemus, Ward W.


    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  14. Primer Extension Reactions for the PCR- based α- complementation Assay

    PubMed Central

    Achuthan, Vasudevan; DeStefano, Jeffrey J.


    The PCR- based- α- complementation assay is an effective technique to measure the fidelity of polymerases, especially RNA-dependent RNA polymerases (RDRP) and Reverse Transcriptases (RT). It has been successfully employed to determine the fidelity of the poliovirus polymerase 3D-pol (DeStefano, 2010) as well as the human immunodeficiency virus Reverse Transcriptase (HIV RT) (Achuthan et al., 2014). A major advantage of the assay is that since the PCR step is involved, even the low yield of products obtained after two rounds of low yield of RNA synthesis (for RDRP) or reverse transcription (for RT) can be measured using the assay. The assay also mimics the reverse transcription process, since both RNA- and DNA- directed RT synthesis steps are performed. We recently used this assay to show that the HIV RT, at physiologically relevant magnesium concentration, has accuracy in the same range as other reverse transcriptases (Achuthan et al., 2014). Here, we describe in detail how to prepare the inserts using the primer extension reactions. The prepared inserts are then processed further in the PCR- based- α- complementation assay.

  15. A primer to frequent itemset mining for bioinformatics

    PubMed Central

    Naulaerts, Stefan; Meysman, Pieter; Bittremieux, Wout; Vu, Trung Nghia; Vanden Berghe, Wim; Goethals, Bart


    Over the past two decades, pattern mining techniques have become an integral part of many bioinformatics solutions. Frequent itemset mining is a popular group of pattern mining techniques designed to identify elements that frequently co-occur. An archetypical example is the identification of products that often end up together in the same shopping basket in supermarket transactions. A number of algorithms have been developed to address variations of this computationally non-trivial problem. Frequent itemset mining techniques are able to efficiently capture the characteristics of (complex) data and succinctly summarize it. Owing to these and other interesting properties, these techniques have proven their value in biological data analysis. Nevertheless, information about the bioinformatics applications of these techniques remains scattered. In this primer, we introduce frequent itemset mining and their derived association rules for life scientists. We give an overview of various algorithms, and illustrate how they can be used in several real-life bioinformatics application domains. We end with a discussion of the future potential and open challenges for frequent itemset mining in the life sciences. PMID:24162173

  16. A primer for billing in interventional pain management.


    Yong, R Jason; Nelson, Ehren R; Urman, Richard D; Kaye, Alan David


    The surge of interest in pain from many types of physicians over the past few decades has resulted in a specialty with unique challenges. In response to the growth in pain medicine, pain fellowships have emerged to appropriately diagnose and to treat a wide variety of pain conditions. Despite improvements and standardization among pain fellowships, education in the basics of billing and coding is typically limited. Though courses on proper billing practices exist within the specialty of pain medicine, many new practitioners are challenged by clinical responsibilities with limited training with regards to billing and coding of pain services. Inaccurate billing and coding can result in financial issues and legal ramifications. ICD-10, which is expected later this year, will present additional challenges to effective billing and coding. In summary, there are frequent changes to the rules and regulations governing pain management that can significantly impact practice management. Strong consideration should be made by stakeholders in any pain practitioner to attend regular educational meetings and take steps necessary for continued compliance, efficiency, quality, and profitability. A basic primer on concepts related to billing and code terminology, therefore, is presented for clinicians. PMID:26062319

  17. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G

    PubMed Central

    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng


    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome. PMID:25788548

  18. Guidelines for the tetra-primer ARMS-PCR technique development.


    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa


    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  19. Indexed PCR Primers Induce Template-Specific Bias in Large-Scale DNA Sequencing Studies

    PubMed Central

    O’Donnell, James L.; Kelly, Ryan P.; Lowell, Natalie C.; Port, Jesse A.


    Massively parallel sequencing is rapidly emerging as an efficient way to quantify biodiversity at all levels, from genetic variation and expression to ecological community assemblage. However, the number of reads produced per sequencing run far exceeds the number required per sample for many applications, compelling researchers to sequence multiple samples per run in order to maximize efficiency. For studies that include a PCR step, this can be accomplished using primers that include an index sequence allowing sample origin to be determined after sequencing. The use of indexed primers assumes they behave no differently than standard primers; however, we found that indexed primers cause substantial template sequence-specific bias, resulting in radically different profiles of the same environmental sample. Likely the outcome of differential amplification efficiency due to primer-template mismatch, two indexed primer sets spuriously change the inferred sequence abundance from the same DNA extraction by up to 77.1%. We demonstrate that a double PCR approach alleviates these effects in applications where indexed primers are necessary. PMID:26950069

  20. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    PubMed Central

    Coloma, Javier; Johnson, Robert E.; Prakash, Louise; Prakash, Satya; Aggarwal, Aneel K.


    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually engages with a DNA:DNA helix during primer synthesis. We present here the first crystal structure of human Polα polymerase subunit in complex with a DNA:DNA helix. Unexpectedly, we find that portion of the DNA:DNA helix in contact with the polymerase is not in a B-form but in a hybrid A-B form. Almost all of the contacts observed previously with an RNA primer are preserved with a DNA primer – with the same set of polymerase residues tracking the sugar-phosphate backbone of the DNA or RNA primer. Thus, rather than loss of specific contacts, the free energy cost of distorting DNA from B- to hybrid A-B form may augur the termination of primer synthesis in eukaryotes. PMID:27032819

  1. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes


    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.


    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus.more » Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  2. Universal primers for the amplification and sequence analysis of actin-1 from diverse mosquito species.


    Staley, Molly; Dorman, Karin S; Bartholomay, Lyric C; Fernández-Salas, Ildefonso; Farfan-Ale, Jose A; Loroño-Pino, Maria A; Garcia-Rejon, Julian E; Ibarra-Juarez, Luis; Blitvich, Bradley J


    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5'-ATGGTCGGYATGGGNCAGAAGGACTC-3') and Act-8R (5'-GATTCCATACCCAGGAAGGADGG-3'), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  3. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.


    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W


    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups. PMID:18631176

  4. Shop primer as part of the corrosion protective coating for submerged steel structures

    SciTech Connect

    Bjordal, M.; Steinsmo, U.


    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough if the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.

  5. Noncontinuously binding loop-out primers for avoiding problematic DNA sequences in PCR and sanger sequencing.


    Sumner, Kelli; Swensen, Jeffrey J; Procter, Melinda; Jama, Mohamed; Wooderchak-Donahue, Whitney; Lewis, Tracey; Fong, Michael; Hubley, Lindsey; Schwarz, Monica; Ha, Youna; Paul, Eleri; Brulotte, Benjamin; Lyon, Elaine; Bayrak-Toydemir, Pinar; Mao, Rong; Pont-Kingdon, Genevieve; Best, D Hunter


    We present a method in which noncontinuously binding (loop-out) primers are used to exclude regions of DNA that typically interfere with PCR amplification and/or analysis by Sanger sequencing. Several scenarios were tested using this design principle, including M13-tagged PCR primers, non-M13-tagged PCR primers, and sequencing primers. With this technique, a single oligonucleotide is designed in two segments that flank, but do not include, a short region of problematic DNA sequence. During PCR amplification or sequencing, the problematic region is looped-out from the primer binding site, where it does not interfere with the reaction. Using this method, we successfully excluded regions of up to 46 nucleotides. Loop-out primers were longer than traditional primers (27 to 40 nucleotides) and had higher melting temperatures. This method allows the use of a standardized PCR protocol throughout an assay, keeps the number of PCRs to a minimum, reduces the chance for laboratory error, and, above all, does not interrupt the clinical laboratory workflow. PMID:25017792

  6. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    PubMed Central

    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti


    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  7. Optimization of primer design for the detection of variable genomic lesions in cancer.


    Bashir, Ali; Liu, Yu-Tsueng; Raphael, Benjamin J; Carson, Dennis; Bafna, Vineet


    Primer approximation multiplex PCR (PAMP) is a new experimental protocol for efficiently assaying structural variation in genomes. PAMP is particularly suited to cancer genomes where the precise breakpoints of alterations such as deletions or translocations vary between patients. The design of PCR primer sets for PAMP is challenging because a large number of primer pairs are required to detect alterations in the hundreds of kilobases range that can occur in cancer. These sets of primers must achieve high coverage of the region of interest, while avoiding primer dimers and satisfying the physico-chemical constraints of good PCR primers. We describe a natural formulation of these constraints as a combinatorial optimization problem. We show that the PAMP primer design problem is NP-hard, and design algorithms based on simulated annealing and integer programming, that provide good solutions to this problem in practice. The algorithms are applied to a test region around the known CDKN2A deletion, which show excellent results even in a 1:49 mixture of mutated:wild-type cells. We use these test results to help set design parameters for larger problems. We can achieve near-optimal designs for regions close to 1 Mb. PMID:17766270

  8. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens.


    Aremu, Bukola Rhoda; Babalola, Olubukola Oluranti


    Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI). These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi) and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation. PMID:26437427

  9. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    PubMed Central

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; Peña, José; Hysom, David A.; Borucki, Monica K.


    Background. Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results. A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Each group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions. This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family. PMID:25157264

  10. Universal Primers for Detection and Sequencing of Hepatitis B Virus Genomes across Genotypes A to G.


    Chook, Jack Bee; Teo, Woon Li; Ngeow, Yun Fong; Tee, Kok Keng; Ng, Kee Peng; Mohamed, Rosmawati


    Hepatitis B virus (HBV) has been divided into 10 genotypes, A to J, based on an 8% nucleotide sequence divergence between genotypes. The conventional practice of using a single set of primers to amplify a near-complete HBV genome is hampered by its low analytical sensitivity. The current practice of using overlapping conserved primer sets to amplify a complete HBV genome in a clinical sample is limited by the lack of pan-primers to detect all HBV genotypes. In this study, we designed six highly conserved, overlapping primer sets to cover the complete HBV genome. We based our design on the sequences of 5,154 HBV genomes of genotypes A to I downloaded from the GenBank nucleotide database. These primer sets were tested on 126 plasma samples from Malaysia, containing genotypes A to D and with viral loads ranging from 20 to >79,780,000 IU/ml. The overall success rates for PCR amplification and sequencing were >96% and >94%, respectively. Similarly, there was 100% amplification and sequencing success when the primer sets were tested on an HBV reference panel of genotypes A to G. Thus, we have established primer sets that gave a high analytical sensitivity for PCR-based detection of HBV and a high rate of sequencing success for HBV genomes in most of the viral genotypes, if not all, without prior known sequence data for the particular genotype/genome. PMID:25788548

  11. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.


    Cheng, Yu-Huei


    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method. PMID:25429503

  12. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.


    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  13. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy


    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets

  14. Express primer tool for high-throughput gene cloning and expression.

    SciTech Connect

    Yoon, J. R.; Laible, P. D.; Gu, M.; Scott, H. N.; Collart, F. R.; Biosciences Division


    High-throughput approaches for gene cloning and expression require the development of new nonstandard tools for molecular biologists and biochemists. We introduce a Web-based tool to design primers specifically for the generation of expression clones for both laboratory-scale and high-throughput projects. The application is designed not only to allow the user complete flexibility to specify primer design parameters but also to minimize the amount of manual intervention needed to generate a large number of primers for the simultaneous amplification of multiple target genes.

  15. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    SciTech Connect

    Warwick, William M.


    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  16. A primer on incentive regulation for electric utilities

    SciTech Connect

    Hill, L.J.


    In contemplating a regulatory approach, the challenge for regulators is to develop a model that provides incentives for utilities to engage in socially desirable behavior. In this primer, we provide guidance on this process by discussing (1) various models of economic regulation, (2) problems implementing these models, and (3) the types of incentives that various models of regulation provide electric utilities. We address five regulatory models in depth. They include cost-of-service regulation in which prudently incurred costs are reflected dollar-for-dollar in rates and four performance-based models: (1) price-cap regulation, in which ceilings are placed on the average price that a utility can charge its customers; (2) revenue-cap regulation, in which a ceiling is placed on revenues; (3) rate-of-return bandwidth regulation, in which a utility`s rates are adjusted if earnings fall outside a {open_quotes}band{close_quotes} around equity returns; and (4) targeted incentives, in which a utility is given incentives to improve specific components of its operations. The primary difference between cost-of-service and performance-based approaches is the latter sever the tie between costs and prices. A sixth, {open_quotes}mixed approach{close_quotes} combines two or more of the five basic ones. In the recent past, a common mixed approach has been to combine targeted incentives with cost-of-service regulation. A common example is utilities that are subject to cost-of-service regulation are given added incentives to increase the efficiency of troubled electric-generating units.

  17. A primer on trace metal-sediment chemistry

    USGS Publications Warehouse

    Horowitz, Arthur J.


    In most aquatic systems, concentrations of trace metals in suspended sediment and the top few centimeters of bottom sediment are far greater than concentrations of trace metals dissolved in the water column. Consequently, the distribution, transport, and availability of these constituents can not be intelligently evaluated, nor can their environmental impact be determined or predicted solely through the sampling and analysis of dissolved phases. This Primer is designed to acquaint the reader with the basic principles that govern the concentration and distribution of trace metals associated with bottom and suspended sediments. The sampling and analysis of suspended and bottom sediments are very important for monitoring studies, not only because trace metal concentrations associated with them are orders of magnitude higher than in the dissolved phase, but also because of several other factors. Riverine transport of trace metals is dominated by sediment. In addition, bottom sediments serve as a source for suspended sediment and can provide a historical record of chemical conditions. This record will help establish area baseline metal levels against which existing conditions can be compared. Many physical and chemical factors affect a sediment's capacity to collect and concentrate trace metals. The physical factors include grain size, surface area, surface charge, cation exchange capacity, composition, and so forth. Increases in metal concentrations are strongly correlated with decreasing grain size and increasing surface area, surface charge, cation exchange capacity, and increasing concentrations of iron and manganese oxides, organic matter, and clay minerals. Chemical factors are equally important, especially for differentiating between samples having similar bulk chemistries and for inferring or predicting environmental availability. Chemical factors entail phase associations (with such sedimentary components as interstitial water, sulfides, carbonates, and organic

  18. Pharmacological Chaperoning: A Primer on Mechanism and Pharmacology

    PubMed Central

    Ryder, Katelyn G.


    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs is considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  19. Binary electrokinetic separation of target DNA from background DNA primers.

    SciTech Connect

    James, Conrad D.; Derzon, Mark Steven


    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  20. Magnetic Helicity and Large Scale Magnetic Fields: A Primer

    NASA Astrophysics Data System (ADS)

    Blackman, Eric G.


    Magnetic fields of laboratory, planetary, stellar, and galactic plasmas commonly exhibit significant order on large temporal or spatial scales compared to the otherwise random motions within the hosting system. Such ordered fields can be measured in the case of planets, stars, and galaxies, or inferred indirectly by the action of their dynamical influence, such as jets. Whether large scale fields are amplified in situ or a remnant from previous stages of an object's history is often debated for objects without a definitive magnetic activity cycle. Magnetic helicity, a measure of twist and linkage of magnetic field lines, is a unifying tool for understanding large scale field evolution for both mechanisms of origin. Its importance stems from its two basic properties: (1) magnetic helicity is typically better conserved than magnetic energy; and (2) the magnetic energy associated with a fixed amount of magnetic helicity is minimized when the system relaxes this helical structure to the largest scale available. Here I discuss how magnetic helicity has come to help us understand the saturation of and sustenance of large scale dynamos, the need for either local or global helicity fluxes to avoid dynamo quenching, and the associated observational consequences. I also discuss how magnetic helicity acts as a hindrance to turbulent diffusion of large scale fields, and thus a helper for fossil remnant large scale field origin models in some contexts. I briefly discuss the connection between large scale fields and accretion disk theory as well. The goal here is to provide a conceptual primer to help the reader efficiently penetrate the literature.

  1. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  2. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.


    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola


    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666


    EPA Science Inventory

    Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...

  4. Abridged adapter primers increase the target scope of Hi-Plex.


    Nguyen-Dumont, Tú; Hammet, Fleur; Mahmoodi, Maryam; Pope, Bernard J; Giles, Graham G; Hopper, John L; Southey, Melissa C; Park, Daniel J


    Previously, we reported Hi-Plex, an amplicon-based method for targeted massively parallel sequencing capable of generating 60 amplicons simultaneously. In further experiments, however, we found our approach did not scale to higher amplicon numbers. Here, we report a modification to the original Hi-Plex protocol that includes the use of abridged adapter oligonucleotides as universal primers (bridge primers) in the initial PCR mixture. Full-length adapter primers (indexing primers) are included only during latter stages of thermal cycling with concomitant application of elevated annealing temperatures. Using this approach, we demonstrate the application of Hi-Plex across a broad range of amplicon numbers (16-plex, 62-plex, 250-plex, and 1003-plex) while preserving the low amount (25 ng) of input DNA required. PMID:25605578

  5. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    SciTech Connect

    Matamala, G.; Droguett, G. ); Smeltzer, W. . Inst. for Materials Research)


    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showed the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.

  6. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.


    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H


    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  7. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji


    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  8. A Telecommunications Primer for College Presidents. Part I. The Technologies Defined. Educational Technology Profile 25.

    ERIC Educational Resources Information Center

    Smith, Ralph Lee


    Intended for use by presidents, planners, and administrators to acquaint them with developments in electronic communications, this primer describes cable television, common carrier, videotape recorders and videodiscs, satellites, microwave, circuit integration, digital transmission, data packet switching, and fiber optics. (LBH)

  9. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.


    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  10. Streamlining DNA Barcoding Protocols: Automated DNA Extraction and a New cox1 Primer in Arachnid Systematics

    PubMed Central

    Vidergar, Nina; Toplak, Nataša; Kuntner, Matjaž


    Background DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences—mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1)—are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1) improving an automated DNA extraction protocol, (2) testing the performance of commonly used primer combinations, and (3) developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. Methodology We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor—an automated high throughput DNA extraction system—and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. Results The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198) that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93%) matched that of C1-J-2183. Conclusions The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding. PMID:25415202

  11. Composing Effective and Efficient E-mails: A Primer for Pharmacy Practitioners

    PubMed Central

    Feemster, Agnes Ann


    This primer describes the purpose and importance of e-mail as a key communication medium in the workplace. It emphasizes clarity as a primary modality to enhance efficiency and effectiveness. Finally, the primer reviews elements of grammar, punctuation, and style that contribute to each e-mail’s ability to meet language standards, enhance the writer’s image, and successfully transmit information. PMID:26715801

  12. Comparison of shear bond strength of orthodontic brackets using various zirconia primers

    PubMed Central

    Lee, Ji-Yeon; Kim, Jin-Seok


    Objective The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. Methods We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm2. The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). Results The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Conclusions Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses. PMID:26258062

  13. Adhesive bonding and the use of corrosion resistant primers. [for metal surface preparation

    NASA Technical Reports Server (NTRS)

    Hockridge, R. R.; Thibault, H. G.


    The use of an anti-corrosive primer has been shown to be essential to assure survival of a bonded structure in a hostile environment, particularly if a stress is to be applied to the adhesively bonded joint during the environmental exposure. For example, the Lockheed L-1011 TriStar assembly, after exhaustive evaluation tests specifies use of chromate filled inhibitive polysulfide sealants, and use of corrosion inhibiting adhesive primers prior to structural bonding with film adhesive.

  14. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    PubMed Central

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam


    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconia with sandblasting, etching, and porcelain primer (GP); and glazed zirconia with sandblasting, etching, zirconia primer, and porcelain primer (GZP). A stainless steel metal bracket was bonded to each target surface with resin cement, and all specimens underwent thermal cycling. The shear bond strength of the specimens was measured by a universal testing machine. A scanning electron microscope, three-dimensional optical surface-profiler, and stereoscopic microscope were used to image the zirconia surfaces. The data were analyzed with one-way analyses of variance and the Fisher exact test. Results Group GZ showed significantly lower shear bond strength than did the other groups. No statistically significant differences were found among groups NZ, GP, and GZP. All specimens in group GZ showed adhesive failure between the zirconia and resin cement. In groups NZ and GP, bonding failed at the interface between the resin cement and bracket base or showed complex adhesive and cohesive failure. Conclusions Porcelain primer is the more appropriate choice for bonding a metal bracket to the surface of a full-contour glazed zirconia crown with resin cement. PMID:26629476

  15. Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.


    Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong


    The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. PMID:24875331

  16. Rapid Identification of the Genus Fonsecaea by PCR with Specific Oligonucleotide Primers

    PubMed Central

    Abliz, Paride; Fukushima, Kazutaka; Takizawa, Kayoko; Nieda, Norikazu; Miyaji, Makoto; Nishimura, Kazuko


    An oligonucleotide primer set based on internal transcribed spacer regions of ribosomal DNA for PCR which gives the amplicon for only the DNA from Fonsecaea species was designed. This set yielded an amplicon with 333 bp for all strains of Fonsecaea pedrosoi and Fonsecaea compacta examined but no amplicons for related dematiaceous fungi and pathogenic yeasts. PCR using this primer set was considered to be a useful method for the rapid identification of the genus Fonsecaea. PMID:12574304

  17. Primer and platform effects on 16S rRNA tag sequencing

    SciTech Connect

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.

  18. Family-Specific Degenerate Primer Design: A Tool to Design Consensus Degenerated Oligonucleotides

    PubMed Central

    Goñi, Sandra Elizabeth; Lozano, Mario Enrique


    Designing degenerate PCR primers for templates of unknown nucleotide sequence may be a very difficult task. In this paper, we present a new method to design degenerate primers, implemented in family-specific degenerate primer design (FAS-DPD) computer software, for which the starting point is a multiple alignment of related amino acids or nucleotide sequences. To assess their efficiency, four different genome collections were used, covering a wide range of genomic lengths: Arenavirus (10 × 104 nucleotides), Baculovirus (0.9 × 105 to 1.8 × 105 bp), Lactobacillus sp. (1 × 106 to 2 × 106 bp), and Pseudomonas sp. (4 × 106 to 7 × 106 bp). In each case, FAS-DPD designed primers were tested computationally to measure specificity. Designed primers for Arenavirus and Baculovirus were tested experimentally. The method presented here is useful for designing degenerate primers on collections of related protein sequences, allowing detection of new family members. PMID:23533783

  19. Primer and platform effects on 16S rRNA tag sequencing

    PubMed Central

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as well as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. Beta diversity metrics are surprisingly robust to both primer and sequencing platform biases. PMID:26300854

  20. Effect of metal primers and tarnish treatment on bonding between dental alloys and veneer resin

    PubMed Central

    Choo, Seung-Sik; Huh, Yoon-Hyuk; Cho, Lee-Ra


    PURPOSE The aim of this study was to evaluate the effect of metal primers on the bonding of dental alloys and veneer resin. Polyvinylpyrrolidone solution's tarnish effect on bonding strength was also investigated. MATERIALS AND METHODS Disk-shape metal specimens (diameter 8 mm, thickness 1.5 mm) were made from 3 kinds of alloy (Co-Cr, Ti and Au-Ag-Pd alloy) and divided into 4 groups per each alloy. Half specimens (n=12 per group) in tarnished group were immersed into polyvinylpyrrolidone solution for 24 hours. In Co-Cr and Ti-alloy, Alloy Primer (MDP + VBATDT) and MAC-Bond II (MAC-10) were applied, while Alloy Primer and V-Primer (VBATDT) were applied to Au-Ag-Pd alloys. After surface treatment, veneering composite resin were applied and shear bond strength test were conducted. RESULTS Alloy Primer showed higher shear bond strength than MAC-Bond II in Co-Cr alloys and Au-Ag-Pd alloy (P<.05). However, in Ti alloy, there was no significant difference between Alloy Primer and MAC-Bond II. Tarnished Co-Cr and Au-Ag-Pd alloy surfaces presented significantly decreased shear bond strength. CONCLUSION Combined use of MDP and VBATDT were effective in bonding of the resin to Co-Cr and Au-Ag-Pd alloy. Tarnish using polyvinylpyrrolidone solution negatively affected on the bonding of veneer resin to Co-Cr and Au-Ag-Pd alloys. PMID:26576256

  1. PRIMEGENSw3: a web-based tool for high-throughput primer and probe design.


    Kushwaha, Garima; Srivastava, Gyan Prakash; Xu, Dong


    Highly specific and efficient primer and probe design has been a major hurdle in many high-throughput techniques. Successful implementation of any PCR or probe hybridization technique depends on the quality of primers and probes used in terms of their specificity and cross-hybridization. Here we describe PRIMEGENSw3, a set of web-based utilities for high-throughput primer and probe design. These utilities allow users to select genomic regions and to design primer/probe for selected regions in an interactive, user-friendly, and automatic fashion. The system runs the PRIMEGENS algorithm in the back-end on the high-performance server with the stored genomic database or user-provided custom database for cross-hybridization check. Cross-hybridization is checked not only using BLAST but also by checking mismatch positions and energy calculation of potential hybridization hits. The results can be visualized online and also can be downloaded. The average success rate of primer design using PRIMEGENSw3 is ~90 %. The web server also supports primer design for methylated sequences, which is used in epigenetic studies. Stand-alone version of the software is also available for download at the website. PMID:25697661

  2. Enzymatic assay for deoxyribonucleoside triphosphates using synthetic oligonucleotides as template primers

    SciTech Connect

    Sherman, P.A.; Fyfe, J.A. )


    The enzymatic assay for deoxyribonucleoside triphosphates has been improved by using synthetic oligonucleotides of a carefully defined sequence as template primers for DNA polymerase. High backgrounds, which limit the sensitivity of the assay when calf thymus DNA or alternating copolymers are used as template primers, were eliminated with these oligonucleotide template primers. Sensitivity was further increased by designing the template primer to incorporate multiple labeled deoxyribonucleotides per limiting unlabeled deoxyribonucleotide. Each of several DNA polymerases exhibited unique reaction characteristics with the oligonucleotide template primers, which was attributed to the differing exonuclease activities associated with these various enzymes. Assay optimization therefore included matching the polymerase with the template primer to obtain the lowest background reaction and highest sensitivity. This modified assay is particularly well suited for keeping cell sample size to a minimum in experimental protocols which generate large numbers of data points or require careful timing of sampling. With this technique, we measured the levels of all four deoxyribonucleoside triphosphates in extracts from as few as 2 x 10(4) cultured cells.

  3. Primer and platform effects on 16S rRNA tag sequencing


    Tremblay, Julien; Singh, Kanwar; Fern, Alison; Kirton, Edward S.; He, Shaomei; Woyke, Tanja; Lee, Janey; Chen, Feng; Dangl, Jeffery L.; Tringe, Susannah G.


    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  4. PrimerSNP: a web tool for whole-genome selection of allele-specific and common primers of phylogenetically-related bacterial genomic sequences

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The increasing number of genomic sequences of bacteria makes it possible to select unique SNPs of a particular strain/species at the whole genome level and thus design specific primers based on the SNPs. The high similarity of genomic sequences among phylogenetically-related bacteria requires the id...

  5. Primer-Dependent and Primer-Independent Initiation of Double Stranded RNA Synthesis by Purified Arabidopsis RNA-Dependent RNA Polymerases RDR2 and RDR6

    PubMed Central

    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  6. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified Arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6.


    Devert, Anthony; Fabre, Nicolas; Floris, Maïna; Canard, Bruno; Robaglia, Christophe; Crété, Patrice


    Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer-independent and primer-dependent RNA polymerase activities with different efficiencies. We further show that RDR2 and RDR6 can initiate dsRNA synthesis either by elongation of 21- to 24- nucleotides RNAs hybridized to complementary RNA template or by elongation of self-primed RNA template. These findings provide new insights into our understanding of the molecular mechanisms of RNA silencing in plants. PMID:25793874

  7. A Primer on Population Health Management and Its Perioperative Application.


    Boudreaux, Arthur M; Vetter, Thomas R


    The movement toward value-based payment models, driven by governmental policies, federal statutes, and market forces, is propelling the importance of effectively managing the health of populations to the forefront in the United States and other developed countries. However, for many anesthesiologists, population health management is a new or even foreign concept. A primer on population health management and its potential perioperative application is thus presented here. Although it certainly continues to evolve, population health management can be broadly defined as the specific policies, programs, and interventions directed at optimizing population health. The Population Health Alliance has created a particularly cogent conceptual framework and interconnected and very useful population health process model, which together identify the key components of population health and its management. Population health management provides a useful rationale for patients, providers, payers, and policymakers to move collectively away from the traditional system of individual, siloed providers to a more integrated, coordinated, team-based approach, thus creating a holistic view of the patient population. The goal of population health management is to keep the targeted patient population as healthy as possible, thus minimizing the need for costly interventions such as emergency department visits, acute hospitalizations, laboratory testing and imaging, and diagnostic and therapeutic procedures. Population health management strategies are increasingly more important to leaders of health care systems as the health of populations for which they care, especially in a strong cost risk-sharing environment, must be optimized. Most population health management efforts rely on a patient-centric team approach, coordination of care, effective communication, robust outcomes data analysis, and continuous quality improvement. Anesthesiologists have an opportunity to help lead these efforts in

  8. Influence of acid-etching and ceramic primers on the repair of a glass ceramic.


    Queiroz, J R C; Souza, Rodrigo O A; Nogueira Junior, L; Ozcan, M; Bottino, M A


    The objective of this study was to evaluate the influence of different primers on the microtensile bond strength (μTBS) between a feldspathic ceramic and two composites. Forty blocks (6.0 x 6.0 x 5.0 mm³) were prepared from Vita Mark II . After polishing, they were randomly divided into 10 groups according to the surface treatment: Group 1, hydrofluoric acid 10% (HF) + silane; Group 2, CoJet + silane; Group 3, HF + Metal/Zirconia Primer; Group 4, HF + Clearfil Primer; Group 5, HF + Alloy Primer; Group 6, HF + V-Primer; Group 7, Metal/Zirconia Primer; Group 8, Clearfil Primer; Group 9, Alloy Primer; Group 10, V-Primer. After each surface treatment, an adhesive was applied and one of two composite resins was incrementally built up. The sticks obtained from each block (bonded area: 1.0 mm² ± 0.2 mm) were stored in distilled water at 37 degrees C for 30 days and submitted to thermocycling (7,000 cycles; 5 degrees C/55 degrees C ± 1 degree C). The μTBS test was carried out using a universal testing machine (1.0 mm/min). Data were analyzed using ANOVA and a Tukey test (a = 0.05). The surface treatments significantly affected the results (P < 0.05); no difference was observed between the composites (P > 0.05). The bond strength means (MPa) were as follows: Group 1a = 29.6; Group 1b = 33.7; Group 2a = 28.9; Group 2b = 27.1; Group 3a = 13.8; Group 3b = 14.9; Group 4a = 18.6; Group 4b = 19.4; Group 5a = 15.3; Group 5b = 16.5; Group 6a = 11; Group 6b = 18; Groups 7a to 10b = 0. While the use of primers alone was not sufficient for adequate bond strengths to feldspathic ceramic, HF etching followed by any silane delivered higher bond strength. PMID:22414522

  9. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.


    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela


    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics. PMID:25229098

  10. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo


    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  11. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.


    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong


    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  12. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.


    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J


    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  13. Functional genes to assess nitrogen cycling and aromatic hydrocarbon degradation: primers and processing matter

    PubMed Central

    Penton, C. Ryan; Johnson, Timothy A.; Quensen, John F.; Iwai, Shoko; Cole, James R.; Tiedje, James M.


    Targeting sequencing to genes involved in key environmental processes, i.e., ecofunctional genes, provides an opportunity to sample nature's gene guilds to greater depth and help link community structure to process-level outcomes. Vastly different approaches have been implemented for sequence processing and, ultimately, for taxonomic placement of these gene reads. The overall quality of next generation sequence analysis of functional genes is dependent on multiple steps and assumptions of unknown diversity. To illustrate current issues surrounding amplicon read processing we provide examples for three ecofunctional gene groups. A combination of in silico, environmental and cultured strain sequences was used to test new primers targeting the dioxin and dibenzofuran degrading genes dxnA1, dbfA1, and carAa. The majority of obtained environmental sequences were classified into novel sequence clusters, illustrating the discovery value of the approach. For the nitrite reductase step in denitrification, the well-known nirK primers exhibited deficiencies in reference database coverage, illustrating the need to refine primer-binding sites and/or to design multiple primers, while nirS primers exhibited bias against five phyla. Amino acid-based OTU clustering of these two N-cycle genes from soil samples yielded only 114 unique nirK and 45 unique nirS genus-level groupings, likely a reflection of constricted primer coverage. Finally, supervised and non-supervised OTU analysis methods were compared using the nifH gene of nitrogen fixation, with generally similar outcomes, but the clustering (non-supervised) method yielded higher diversity estimates and stronger site-based differences. High throughput amplicon sequencing can provide inexpensive and rapid access to nature's related sequences by circumventing the culturing barrier, but each unique gene requires individual considerations in terms of primer design and sequence processing and classification. PMID:24062736

  14. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen


    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  15. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.


    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  16. Circulating primers enhance platelet function and induce resistance to antiplatelet therapy

    PubMed Central

    Blair, T A; Moore, S F; Hers, I


    Background Aspirin and P2Y12 antagonists are antiplatelet compounds that are used clinically in patients with thrombosis. However, some patients are ‘resistant’ to antiplatelet therapy, which increases their risk of developing acute coronary syndromes. These patients often present with an underlying condition that is associated with altered levels of circulating platelet primers and platelet hyperactivity. Platelet primers cannot stimulate platelet activation, but, in combination with physiologic stimuli, significantly enhance platelet function. Objectives To explore the role of platelet primers in resistance to antiplatelet therapy, and to evaluate whether phosphoinositide 3-kinase (PI3K) contributes to this process. Methods and Results We used platelet aggregation, thromboxane A2 production and ex vivo thrombus formation as functional readouts of platelet activity. Platelets were treated with the potent P2Y12 inhibitor AR-C66096, aspirin, or a combination of both, in the presence or absence of the platelet primers insulin-like growth factor-1 (IGF-1) and thrombopoietin (TPO), or the Gz-coupled receptor ligand epinephrine. We found that platelet primers largely overcame the inhibitory effects of antiplatelet compounds on platelet functional responses. IGF-1-mediated and TPO-mediated, but not epinephrine-mediated, enhancements in the presence of antiplatelet drugs were blocked by the PI3K inhibitors wortmannin and LY294002. Conclusions These results demonstrate that platelet primers can contribute to antiplatelet resistance. Furthermore, our data demonstrate that there are PI3K-dependent and PI3K-independent mechanisms driving primer-mediated resistance to antiplatelet therapy. PMID:26039631

  17. Evaluating Primers for Profiling Anaerobic Ammonia Oxidizing Bacteria within Freshwater Environments

    PubMed Central

    Sonthiphand, Puntipar; Neufeld, Josh D.


    Anaerobic ammonia oxidizing (anammox) bacteria play an important role in transforming ammonium to nitrogen gas and contribute to fixed nitrogen losses in freshwater environments. Understanding the diversity and abundance of anammox bacteria requires reliable molecular tools, and these are not yet well established for these important Planctomycetes. To help validate PCR primers for the detection of anammox bacteria within freshwater ecosystems, we analyzed representative positive controls and selected samples from Grand River and groundwater sites, both from Ontario, Canada. The objectives of this study were to identify a suitable anammox denaturing gradient gel electrophoresis (DGGE) fingerprint method by using GC-clamp modifications to existing primers, and to verify the specificity of anammox-specific primers used for DGGE, cloning and qPCR methods. Six primer combinations were tested from four published primer sets (i.e. A438f/A684r, Amx368f/Amx820r, An7f/An1388r, and Pla46/1392r) for both direct and nested PCR amplifications. All PCR products were run subsequently on DGGE gels to compare the resulting patterns. Two anammox-specific primer combinations were also used to generate clone libraries and quantify anammox bacterial 16S rRNA genes with qPCR. The primer set A438f/A684r was highly specific to anammox bacteria, provided reliable DGGE fingerprints and generated a high proportion of anammox-related clones. A second primer set (Amx368f/Amx820r) was anammox specific, based on clone library analysis, but PCR products from different candidate species of anammox bacteria resolved poorly using DGGE analysis. Both DGGE and cloning results revealed that Ca. Brocadia and an uncharacterized anammox bacterial cluster represented the majority of anammox bacteria found in Grand River sediment and groundwater samples, respectively. Together, our results demonstrate that although Amx368f/Amx820r was useful for anammox-specific qPCR and clone library analysis, A438f/A684r


    PubMed Central

    Tabchoury, Cínthia Pereira Machado; Sousa, Maria Clara K.; Arthur, Rodrigo Alex; Mattos-Graner, Renata Oliveira; Cury, Altair Antoninha Del Bel; Cury, Jaime Aparecido


    Streptococcus mutans has been considered one of the main etiological agents of dental caries and the genotypic diversity rather than its salivary counts may be considered as a virulence factor of this bacterium. For genotyping with polymerase chain reaction (PCR) with arbitrary primers, several primers have been used in order to improve complexity and specificity of amplicon patterns. Thus, the aim of this study was to evaluate the degree of agreement of genotypic identification among AP-PCR reactions performed with 5 distinct arbitrary primers of S. mutans isolated from saliva. Stimulated saliva was collected from 11 adult volunteers for isolation of S. mutans, and a total of 88 isolates were genotyped with arbitrary primers OPA 02, 03, 05, 13 and 18. Fourteen distinct genotypes were identified in the saliva samples. Most volunteers (9 out of 11) presented only one genotype. The results of the present study suggest that primers OPA 02, 03, 05 and 13 were suitable for genotypic identification of S. mutans isolates of saliva from adult volunteers. PMID:19082399

  19. Development of SCAR Primers for PCR Assay to Detect Diplodia seriata

    PubMed Central

    Martín, M. T.; Cuesta, M. J.; Martín, L.


    The aim of this study was to develop primer pairs for Diplodia seriata identification, one of the most common fungal species associated with grapevine decline in Castilla y León (Spain). Genetic variability of selected isolates of D. seriata was estimated. A molecular marker was generated from a random amplified polymorphic DNA (RAPD) fragment. PCR products of around 1200 bp were obtained with OPE20 primer. The PCR products were cloned and sequenced. The sequences were compared and a fragment of 1207 bp was used to design primer pairs. Two primer pairs were selected (DS3.8 S3-DS3.8 R6 and DS3.8 S3-DS3.8 R4) that amplified a single DNA product of 634 bp and 233 bp, respectively, with D. seriata isolates. No amplification was obtained for any of the 57 isolates of other species. The designed SCAR primer pairs allowed a rapid detection of D. seriata, and were able to detect 0.1 pg of the target DNA. Detection was specific and sensitive for D. seriata. The established protocols detected these fungi in naturally infected grapevines after DNA purification. Diplodia seriata was detectable without DNA purification and isolation in 62.5% to 75% of reactions. The detection of this pathogen in wood samples has great potential for use in pathogen-free certification schemes. PMID:27437468

  20. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    PubMed Central

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna


    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  1. Real-time PCR (qPCR) primer design using free online software.


    Thornton, Brenda; Basu, Chhandak


    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  2. Enhanced primers for amplification of DNA barcodes from a broad range of marine metazoans

    PubMed Central


    Background Building reference libraries of DNA barcodes is relatively straightforward when specifically designed primers are available to amplify the COI-5P region from a relatively narrow taxonomic group (e.g. single class or single order). DNA barcoding marine communities have been comparatively harder to accomplish due to the broad taxonomic diversity and lack of consistently efficient primers. Although some of the so-called “universal” primers have been relatively successful, they still fail to amplify COI-5P of many marine animal groups, while displaying random success even among species within each group. Here we propose a new pair of primers designed to enhance amplification of the COI-5P region in a wide range of marine organisms. Results Amplification tests conducted on a wide range of marine animal taxa, rendered possible the first–time sequencing of DNA barcodes from eight separated phyla (Annelida, Arthropoda, Chordata, Cnidaria, Echinodermata, Mollusca, Nemertea and Platyhelminthes), comprising a total of 14 classes, 28 orders, 57 families, 68 genus and 76 species. Conclusions These primers demonstrated to be highly cost-effective, which is of key importance for DNA barcoding procedures, such as for building comprehensive DNA barcode libraries of marine communities, where the processing of a large numbers of specimens from a wide variety of marine taxa is compulsory. PMID:24020880

  3. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    PubMed Central

    Phillips, Allison R.


    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals. PMID:18316812

  4. The use of a fluoropolymer containing primer to enhance adhesion of rotolined fluoropolymer coatings

    SciTech Connect

    Lech, L.M.


    Fluoropolymers such as PFA and ETFE are often used in rotolining applications. A common source of failure for rotolined coatings is delamination from the metal substrate. Extensive thermal cycling of the coated part, permeation of the contained liquid to the substrate, or a combination of both thermal cycling and permeation causes this. Rotolined coatings are typically applied directly to the metal part. It has been found that applying an aqueous fluoropolymer based primer to the metal substrate prior to applying the rotolined resin increases the time before delamination is observed. The primer is applied by conventional spray techniques and can either be force dried at low temperature or air-dried under ambient conditions. The primer consists primarily of a fluoropolymer such as ETFE or PFA and a bonding agent such as polyamide-imide, polyphenylene sulfide, or polyether sulfone. After the primer is applied to the metal part, the fluoropolymer in the primer melt blends with the fluoropolymer rotolining resin during the rotolining process. The bonding agent enhances the adhesion of the entire coating system to the metal part. This extends the lifetime of the rotolined coatings.

  5. Effect of single mismatches at 3′–end of primers on polymerase chain reaction

    PubMed Central

    Simsek, M; Adnan, H


    Objective and Method To investigate the effect of three different mismatches (G/T, G/A or G/G) at the 3′–end of a primer to amplify a 268 bp (base pair) region of the human β–globin gene using different annealing temperatures (45 to 65°C). Results The primer with the G/T mismatch was as efficient as the normal primer (G/C match) in the amplification of a 268 bp product at all temperatures tested. However, the primers having G/A or G/G mismatches at the 3′-end did not produce any specific polymerase chain reaction (PCR) fragment at all the annealing temperatures used, except a barely detectable 268 bp product for the G/G mismatch at 45 and 50°C. Conclusion We conclude that our PCR system was refractory to amplification when one of the primers contained a G/A or G/G mismatch at the 3′–end with template DNA. PMID:24019700

  6. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.


    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  7. Analysis of primer residue from lead free ammunition by X-ray microfluorescence.


    Charpentier, B; Desrochers, C


    In forensic science, the analysis of gunshot residues was traditionally done by the detection of lead (Pb), antimony (Sb) and barium (Ba) usually found in a primer. However, the recent development of lead-free ammunition represents a new challenge for ballistic specialists. This analysis study gunshot residues from primers and ammunitions in the area surrounding bullet holes, a very important tool to determine the shooting distance. The ammunitions used were 9 mm Luger and .38 spl + p calibers, where lead in the primer was replaced with strontium (Sr) and where the lead bullet was plated with copper (Total Metal Jacket). Gunshot analysis results were obtained using an energy dispersive X-ray microfluorescence spectrometer. The method allows the detection and quantification of strontium residues on the target up to a distance of 45 cm. PMID:10782972

  8. New primers for promising single-copy genes in fungal phylogenetics and systematics.


    Schmitt, I; Crespo, A; Divakar, P K; Fankhauser, J D; Herman-Sackett, E; Kalb, K; Nelsen, M P; Nelson, N A; Rivas-Plata, E; Shimp, A D; Widhelm, T; Lumbsch, H T


    Developing powerful phylogenetic markers is a key concern in fungal phylogenetics. Here we report degenerate primers that amplify the single-copy genes Mcm7 (MS456) and Tsr1 (MS277) across a wide range of Pezizomycotina (Ascomycota). Phylogenetic analyses of 59 taxa belonging to the Eurotiomycetes, Lecanoromycetes, Leotiomycetes, Lichinomycetes and Sordariomycetes, indicate the utility of these loci for fungal phylogenetics at taxonomic levels ranging from genus to class. We also tested the new primers in silico using sequences of Saccharomycotina, Taphrinomycotina and Basidiomycota to predict their potential of amplifying widely across the Fungi. The analyses suggest that the new primers will need no, or only minor sequence modifications to amplify Saccharomycotina, Taphrinomycotina and Basidiomycota. PMID:20198159

  9. Microsatellite primers in the weedy annual herb Anacyclus clavatus (Asteraceae) and four closely related species1

    PubMed Central

    Agudo, Alicia; Picó, F. Xavier; Álvarez, Inés


    • Premise of the study: Nuclear microsatellite primers were developed for the weedy herb Anacyclus clavatus to study the genetic structure of hybrid zones with closely related taxa in the western Mediterranean Basin, where different floral phenotypes are present. • Methods and Results: We obtained two microsatellite libraries using next-generation sequencing and Sanger sequencing of cloned restriction fragments. A total of 13 polymorphic and 11 monomorphic loci were identified in three Iberian populations of A. clavatus. The primers amplified di- and trinucleotide repeats with 1–8 alleles per locus. Most primers also amplified in A. homogamos, A. monanthos, A. radiatus, and A. valentinus. • Conclusions: These results indicate the utility of these markers in A. clavatus for population genetic and hybridization studies as well as their applicability across the genus. PMID:25202498

  10. Searching for Beta-Haemolysin hlb Gene in Staphylococcus pseudintermedius with Species-Specific Primers.


    Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin


    The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification. PMID:27086303

  11. The effect of dentin primer on the shear bond strength between composite resin and enamel.


    Hadavi, F; Hey, J H; Ambrose, E R; Louie, P W; Shinkewski, D J


    The purpose of this study was to determine the effect of accidental dentin primer contact with etched enamel on shear bond strength of composite resin to enamel. Four dentin bonding systems were included in this study: GLUMA Dentin Bond, Scotchbond, and Prisma Universal Bond 2 and 3. Eighty extracted human permanent anterior teeth were used and divided in eight test groups. The vestibular surfaces were ground and acid etched. For each dentin bonding system 10 samples were treated with dentin primer prior to placement of resin. Shear bond testing showed that enamel contact with dentin primer in the above two systems decreased the shear bond strength between composite and enamel by 31 to 44%. PMID:8337183

  12. Novel Primers From Informative Nuclear Loci for Louse Molecular Phylogenetics (Insecta: Phthiraptera).


    Sweet, Andrew D; Allen, Julie M; Johnson, Kevin P


    While parasitic lice (Insecta: Phthiraptera) have historically been an important model taxon for understanding host-parasite coevolution, very few molecular markers have been developed for phylogenetic analysis. The current markers are insufficient to resolve many of the deeper nodes in this group; therefore, sequences from additional genetic loci are necessary. Here, we design primers targeting several nuclear protein coding genes based on a complete genome and transcriptome of Pediculus humanus L. plus transcriptomes and modest coverage genomic data from five genera of avian feather lice. These primers were tested on 32 genera of avian feather lice (Ischnocera), including multiple species within some genera. All of the new primer combinations produced sequences for the majority of the genera and had similar or higher divergences than the most widely used nuclear protein-coding gene in lice, EF-1α. These results indicate that these new loci will be useful in resolving phylogenetic relationships among parasitic lice. PMID:26309297

  13. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.


    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo


    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  14. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    PubMed Central


    Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984

  15. Microsatellite primers for a species of South African everlasting daisy (Helichrysum odoratissimum; Gnaphalieae, Asteraceae)1

    PubMed Central

    Glennon, Kelsey L.; Cron, Glynis V.


    Premise of the study: Microsatellites were developed for the widespread Helichrysum odoratissimum (Asteraceae) to estimate gene flow across diploid populations and to test if gene flow occurs among other closely related lineages within this genus. Methods and Results: Ten primer pairs were developed and tested using populations across South Africa; however, only seven primer pairs were polymorphic for the target species. The seven polymorphic primers amplified di- and trinucleotide repeats with up to 16 alleles per locus among 125 diploid individuals used for analyses. Conclusions: These markers can be used to estimate gene flow among populations of known ploidy level of H. odoratissimum to test evolutionary hypotheses. Furthermore, these markers amplify successfully in other Helichrysum species, including the other three taxonomic Group 4 species, and therefore can be used to inform taxonomic work on these species. PMID:27213125

  16. Primers for low-copy nuclear genes in the Melastomataceae1

    PubMed Central

    Reginato, Marcelo; Michelangeli, Fabián A.


    Premise of the study: Low-copy nuclear gene primers were developed for phylogenetic studies across the Melastomataceae. Methods and Results: Total genomic libraries from eight species in the Melastomataceae along with one transcriptome were used for marker identification and primer design. Eight exon-primed intron-crossing markers were amplified with success in taxa of nine tribes in the Melastomataceae. The new markers were directly sequenced for eight samples of closely related species of Miconia (Chaenanthera clade) in the tribe Miconieae. The DNA sequences for the eight loci ranged from 660 to 818 aligned base pairs. Compared with four commonly used markers in other studies, the loci developed here had a higher number of variable sites than plastid spacers (7–16 vs. 26–45) and comparable variation to the ribosomal spacers (28–39). Conclusions: The novel primer pairs should be useful for a broad range of studies of systematics and evolution in the diverse Melastomataceae. PMID:26819862

  17. Mode of action and application of Scorpion primers to mutation detection

    PubMed Central

    Thelwell, Nicola; Millington, Stephen; Solinas, Antonio; Booth, James; Brown, Tom


    Scorpion primers can be used to detect PCR products in homogeneous solution. Their structure promotes a unimolecular probing mechanism. We compare their performance with that of the same probe sequence forced to act in a bimolecular manner. The data suggest that Scorpions indeed probe by a unimolecular mechanism which is faster and more efficient than the bimolecular mechanism. This mechanism is not dependent on enzymatic cleavage of the probe. A direct comparison between Scorpions, TaqMan and Molecular Beacons on a Roche LightCycler indicates that Scorpions perform better, particularly under fast cycling conditions. Development of a cystic fibrosis mutation detection assay shows that Scorpion primers are selective enough to detect single base mutations and give good sensitivity in all cases. Simultaneous detection of both normal and mutant alleles in a single reaction is possible by combining two Scorpions in a multiplex reaction. Such favourable properties of Scorpion primers should make the technology ideal in numerous applications. PMID:11000267

  18. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    PubMed Central

    Wahlberg, Niklas; Peña, Carlos; Ahola, Milla; Wheat, Christopher W.; Rota, Jadranka


    Abstract We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular systematic studies of Lepidoptera, particularly at the intrafamilial level, and our new set of primers now provides a route to generating phylogenomic datasets using traditional methods. PMID:27408580

  19. Dual Functions, Clamp Opening and Primer-Template Recognition, Define a Key Clamp Loader Subunit

    PubMed Central

    Coman, Maria Magdalena; Jin, Mi; Ceapa, Razvan; Finkelstein, Jeff; O'Donnell, Michael; Chait, Brian T.; Hingorani, Manju M.


    Clamp loader proteins catalyze assembly of circular sliding clamps on DNA to enable processive DNA replication. During the reaction, the clamp loader binds primer-template DNA and positions it in the center of a clamp to form a topological link between the two. Clamp loaders are multi-protein complexes, such as the five protein Escherichia coli, Saccharomyces cerevisiae, and human clamp loaders, and the two protein Pyrococcus furiosus and Methanobacterium thermoautotrophicum clamp loaders, and thus far the site(s) responsible for binding and selecting primer-template DNA as the target for clamp assembly remain unknown. To address this issue, we analyzed the interaction between the E. coli γ complex clamp loader and DNA using UV-induced protein–DNA cross-linking and mass spectrometry. The results show that the δ subunit in the γ complex makes close contact with the primer-template junction. Tryptophan 279 in the δ C-terminal domain lies near the 3′-OH primer end and may play a key role in primer-template recognition. Previous studies have shown that δ also binds and opens the β clamp (hydrophobic residues in the N-terminal domain of δ contact β. The clamp-binding and DNA-binding sites on δ appear positioned for facile entry of primer-template into the center of the clamp and exit of the template strand from the complex. A similar analysis of the S. cerevisiae RFC complex suggests that the dual functionality observed for δ in the γ complex may be true also for clamp loaders from other organisms. PMID:15364574

  20. Design and Implementation of Degenerate Microsatellite Primers for the Mammalian Clade

    PubMed Central

    Buschiazzo, Emmanuel; Beck, Josephine S.; Gemmell, Neil J.


    Microsatellites are popular genetic markers in molecular ecology, genetic mapping and forensics. Unfortunately, despite recent advances, the isolation of de novo polymorphic microsatellite loci often requires expensive and intensive groundwork. Primers developed for a focal species are commonly tested in a related, non-focal species of interest for the amplification of orthologous polymorphic loci; when successful, this approach significantly reduces cost and time of microsatellite development. However, transferability of polymorphic microsatellite loci decreases rapidly with increasing evolutionary distance, and this approach has shown its limits. Whole genome sequences represent an under-exploited resource to develop cross-species primers for microsatellites. Here we describe a three-step method that combines a novel in silico pipeline that we use to (1) identify conserved microsatellite loci from a multiple genome alignments, (2) design degenerate primer pairs, with (3) a simple PCR protocol used to implement these primers across species. Using this approach we developed a set of primers for the mammalian clade. We found 126,306 human microsatellites conserved in mammalian aligned sequences, and isolated 5,596 loci using criteria based on wide conservation. From a random subset of ∼1000 dinucleotide repeats, we designed degenerate primer pairs for 19 loci, of which five produced polymorphic fragments in up to 18 mammalian species, including the distinctly related marsupials and monotremes, groups that diverged from other mammals 120–160 million years ago. Using our method, many more cross-clade microsatellite loci can be harvested from the currently available genomic data, and this ability is set to improve exponentially as further genomes are sequenced. PMID:22216321

  1. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    PubMed Central

    Moon, Gi-Seong; Shin, Weon-Sun


    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  2. Bonding of Resin Cement to Zirconia with High Pressure Primer Coating

    PubMed Central

    Wang, Ying-jie; Jiao, Kai; Liu, Yan; Zhou, Wei; Shen, Li-juan; Fang, Ming; Li, Meng; Zhang, Xiang; Tay, Franklin R.; Chen, Ji-hua


    Objectives To investigate the effect of air-drying pressure during ceramic primer coating on zirconia/resin bonding and the surface characteristics of the primed zirconia. Methods Two ceramic primers (Clearfil Ceramic Primer, CCP, Kuraray Medical Inc. and Z-Prime Plus, ZPP, Bisco Inc.) were applied on the surface of air-abraded zirconia (Katana zirconia, Noritake) and dried at 4 different air pressures (0.1–0.4 MPa). The primed zirconia ceramic specimens were bonded with a resin-based luting agent (SA Luting Cement, Kuraray). Micro-shear bond strengths of the bonded specimens were tested after 3 days of water storage or 5,000× thermocycling (n = 12). Failure modes of the fractured specimens were examined with scanning electron miscopy. The effects of air pressure on the thickness of the primer layers and the surface roughness (Sa) of primed zirconia were evaluated using spectroscopic ellipsometry (n = 6), optical profilometry and environmental scanning electron microscopy (ESEM) (n = 6), respectively. Results Clearfil Ceramic Primer air-dried at 0.3 and 0.4 MPa, yielding significantly higher µSBS than gentle air-drying subgroups (p<0.05). Compared to vigorous drying conditions, Z-Prime Plus air-dried at 0.2 MPa exhibited significantly higher µSBS (p<0.05). Increasing air-drying pressure reduced the film thickness for both primers. Profilometry measurements and ESEM showed rougher surfaces in the high pressure subgroups of CCP and intermediate pressure subgroup of ZPP. Conclusion Air-drying pressure influences resin/zirconia bond strength and durability significantly. Higher air-drying pressure (0.3-0.4 MPa) for CCP and intermediate pressure (0.2 MPa) for ZPP are recommended to produce strong, durable bonds between resin cement and zirconia ceramics. PMID:24992678

  3. DNA fingerprinting using arbitrary primer technology (APT): a tool or a torment.


    Bassam, B J; Bentley, S


    A recent variation of the PCR has allowed DNA fingerprints to be obtained independently of prior sequence information and with unparalleled ease. Several approaches, conveniently grouped under the general term of arbitrary primer technology (APT), include the popular RAPD, DAF, and AP-PCR methods. A great deal of attention has been focussed on these methods and questions have arisen regarding reproducibility, DNA fingerprint resolution, and even the future of the technology itself. Here we discuss these issues and examine some of the unique properties of DNA amplification using a single short arbitrary primer. PMID:7765270

  4. Lead-free precussion primer mixes based on metastable interstitial composite (MIC) technology


    Dixon, George P.; Martin, Joe A.; Thompson, Don


    A lead-free percussion primer composition and a percussion cup containing e composition. The lead-free percussion primer composition is comprised of a mixture of about 45 wt % aluminum powder having an outer coating of aluminum oxide and molybdenum trioxide powder or a mixture of about 50 wt % aluminum powder having an outer coating of aluminum oxide and polytetrafluoroethylene powder. The aluminum powder, molybdenum trioxide powder and polytetrafluoroethylene powder has a particle size of 0.1 .mu.m or less, more preferably a particle size of from about 200-500 angstroms.

  5. The Astrobiology Primer - an Early Career Scientist Education, Outreach and Professional Development Project

    NASA Astrophysics Data System (ADS)

    Wright, K. E.; Domagal-Goldman, S. D.


    We are early-career scientists jointly leading a project to write 'The Astrobiology Primer', a brief but comprehensive introduction to astrobiology, and we are using the process of producing the document as an innovative way of strengthening the international community of early-career astrobiologists. Astrobiology is the study of the origin, evolution, distribution and future of life in our universe. It includes not just study of life on Earth, but also the potential for life to exist beyond Earth, and the development of techniques to search for such life. It therefore incorporates geological and earth sciences, life sciences, chemistry, astronomy and planetary sciences. This requires astrobiologists to integrate these different disciplines in order to address questions such as 'How did Earth and its biosphere originate?', 'How do life and the physical, chemical and geological cycles on Earth interact, and affect each other?' and so 'What does life on Earth tell us about the habitability of environments outside Earth?'. The primer will provide a brief but comprehensive introduction to the field; it will be significantly more comprehensive than a normal review paper but much shorter than a textbook. This project is an initiative run entirely by early-career scientists, for the benefit of other early-career scientists and others. All the writers and editors of the primer are graduate/post-graduate students or post-doctoral fellows, and our primary target group for the primer is other early-career scientists, although we hope and expect that the primer will also be useful far more broadly in education and outreach work. An Astrobiology Primer was first published in 2006(Ref1), written and edited by a small group of early-career astrobiologists to provide an introduction to astrobiology for other early-career scientists new to the field. It has been used not only by the target group for private study, but in formal education and outreach settings at universities and

  6. Development of genus-specific primers for better understanding the diversity and population structure of Sphingomonas in soils.


    Zhou, Lisha; Li, Hui; Zhang, Ying; Han, Siqin; Xu, Hui


    Genus Sphingomonas has received increasing attentions due to its somewhat unique metabolic versatilities in the contaminated environment. However, due to the lack of genus-specific primers, the ecological significance of Sphingomonas in polluted soils has been rarely documented by 16S rDNA finger-printing methods. In this study, three genus-specific primer sets targeted at the 16S rRNA gene of Sphingomonas were developed and their specificities were tested with four contaminated soils from Shenfu petroleum-wastewater irrigation zone by constructing clone libraries, amplified ribosomal DNA restriction analysis (ARDRA) and sequencing the represented ARDRA patterns. Meanwhile, the newly designed primer sets and a previously reported primer set were compared, and the results showed that the newly developed primer set SA/429f-933r could detect a larger spectrum (90%) of Sphingomonas strains with higher specificity. Despite the superiority of primer set SA/429f-933r in specifically detecting Sphingomonas from contaminated soils, we cannot blink the fact that different primer sets preferentially amplified different dominant species. Therefore, two or more primer sets are recommended for evaluating the diversity and population structure of genus Sphingomonas. Additionally, a proportion (9.7%) of the cloned sequences discovered in this study were different from known Sphingomonas sequences, suggesting that new Sphingomonas sequences might present in soils from Shenfu irrigation zone. PMID:23686867

  7. In silico vs in vitro analysis of primer specificity for the detection of Gardnerella vaginalis, Atopobium vaginae and Lactobacillus spp.

    PubMed Central


    Background Bacterial vaginosis (BV) is a common pathology of women in reproductive age that can lead to serious health complications, and is associated with shifts in the normal microflora from predominance of Lactobacillus spp. to a proliferation of other anaerobes such as G. vaginalis and A vaginae, which can be detected by PCR. The optimal PCR pathogen detection assay relies mainly on the specificity and sensitivity of the primers used. Findings Here we demonstrate that in silico analytical testing of primer specificity is not a synonym to in vitro analytical specificity by testing a range of published and newly designed primers with both techniques for the detection of BV-associated microorganisms. Conclusions By testing primer in vitro specificity with a sufficient range of bacterial strains, we were able to design primers with higher specificity and sensitivity. Also by comparing the results obtained for the newly designed primers with other previously published primers, we confirmed that in silico analysis is not sufficient to predict in vitro specificity. As such care must be taken when choosing the primers for a detection assay. PMID:23153093

  8. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.


    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  9. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  10. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs

    PubMed Central

    Fischer, Martin A.; Güllert, Simon; Neulinger, Sven C.; Streit, Wolfgang R.; Schmitz, Ruth A.


    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  11. Evaluation of 16S rRNA Gene Primer Pairs for Monitoring Microbial Community Structures Showed High Reproducibility within and Low Comparability between Datasets Generated with Multiple Archaeal and Bacterial Primer Pairs.


    Fischer, Martin A; Güllert, Simon; Neulinger, Sven C; Streit, Wolfgang R; Schmitz, Ruth A


    The application of next-generation sequencing technology in microbial community analysis increased our knowledge and understanding of the complexity and diversity of a variety of ecosystems. In contrast to Bacteria, the archaeal domain was often not particularly addressed in the analysis of microbial communities. Consequently, established primers specifically amplifying the archaeal 16S ribosomal gene region are scarce compared to the variety of primers targeting bacterial sequences. In this study, we aimed to validate archaeal primers suitable for high throughput next generation sequencing. Three archaeal 16S primer pairs as well as two bacterial and one general microbial 16S primer pairs were comprehensively tested by in-silico evaluation and performing an experimental analysis of a complex microbial community of a biogas reactor. The results obtained clearly demonstrate that comparability of community profiles established using different primer pairs is difficult. 16S rRNA gene data derived from a shotgun metagenome of the same reactor sample added an additional perspective on the community structure. Furthermore, in-silico evaluation of primers, especially those for amplification of archaeal 16S rRNA gene regions, does not necessarily reflect the results obtained in experimental approaches. In the latter, archaeal primer pair ArchV34 showed the highest similarity to the archaeal community structure compared to observed by the metagenomic approach and thus appears to be the appropriate for analyzing archaeal communities in biogas reactors. However, a disadvantage of this primer pair was its low specificity for the archaeal domain in the experimental application leading to high amounts of bacterial sequences within the dataset. Overall our results indicate a rather limited comparability between community structures investigated and determined using different primer pairs as well as between metagenome and 16S rRNA gene amplicon based community structure analysis

  12. MICB Allele Genotyping on Microarrays by Improving the Specificity of Extension Primers

    PubMed Central

    Baek, In-Cheol; Jang, Jung-Pil; Choi, Eun-Jeong; Kim, Tai-Gyu


    Major histocompatibility complex (MHC) class I chain-related gene B (MICB) encodes a ligand for activating NKG2D that expressed in natural killer cells, γδ T cells, and αβ CD8+ T cells, which is associated with autoimmune diseases, cancer, and infectious diseases. Here, we have established a system for genotyping MICB alleles using allele-specific primer extension (ASPE) on microarrays. Thirty-six high quality, allele-specific extension primers were evaluated using strict and reliable cut-off values using mean fluorescence intensity (MFI), whereby an MFI >30,000 represented a positive signal and an MFI <10,000 represented a negative signal. Eight allele-specific extension primers were found to be false positives, five of which were improved by adjusting their length, and three of which were optimized by refractory modification. The MICB alleles (*002:01, *003, *005:02/*010, *005:03, *008, *009N, *018, and *024) present in the quality control panel could be exactly defined by 22 allele-specific extension primers. MICB genotypes that were identified by ASPE on microarrays were in full concordance with those identified by PCR-sequence-based typing. In conclusion, we have developed a method for genotyping MICB alleles using ASPE on microarrays; which can be applicable for large-scale single nucleotide polymorphism typing studies of population and disease associations. PMID:26569110

  13. Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...

  14. A new fungal large subunit ribosomal RNA primer for high-throughput sequencing surveys.


    Mueller, Rebecca C; Gallegos-Graves, La Verne; Kuske, Cheryl R


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300-400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R-LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Together, these findings show that the LR22R-LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods. PMID:26656064

  15. Multiplexing with three-primer PCR for rapid and economical microsatellite validation.


    Vartia, Salla; Collins, Patrick C; Cross, Thomas F; Fitzgerald, Richard D; Gauthier, David T; McGinnity, Philip; Mirimin, Luca; Carlsson, Jens


    The next generation sequencing revolution has enabled rapid discovery of genetic markers, however, development of fully functioning new markers still requires a long and costly process of marker validation. This study reports a rapid and economical approach for the validation and deployment of polymorphic microsatellite markers obtained from a 454 pyrosequencing library of Atlantic cod, Gadus morhua, Linnaeus 1758. Primers were designed from raw reads to amplify specific amplicon size ranges, allowing effective PCR multiplexing. Multiplexing was combined with a three-primer PCR approach using four universal tails to label amplicons with separate fluorochromes. A total of 192 primer pairs were tested, resulting in 73 polymorphic markers. Of these, 55 loci were combined in six multiplex panels each containing between six and eleven markers. Variability of the loci was assessed on G. morhua from the Celtic Sea (n = 46) and the Scotian Shelf (n = 46), two locations that have shown genetic differentiation in previous studies. Multilocus F(ST) between the two samples was estimated at 0.067 (P = 0.001). After three loci potentially under selection were excluded, the global F(ST) was estimated at 0.043 (P = 0.001). Our technique combines three-primer and multiplex PCR techniques, allowing simultaneous screening and validation of relatively large numbers of microsatellite loci. PMID:25041267

  16. Sequence analysis reveals genomic factors affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Search for simple sequence repeat (SSR) motifs and design of flanking primers in expressed sequence tag (EST) sequences can be easily done at a large scale using bioinformatics programs. However, failed amplification and/or detection, along with lack of polymorphism, is often seen among randomly sel...

  17. Blocking primers reduce co-amplification of plant DNA when studying bacterial endophyte communities.


    Arenz, Brett E; Schlatter, Dan C; Bradeen, James M; Kinkel, Linda L


    A blocking primer set based on the technique described by Vestheim and Jarman (2008) was developed to reduce amplification of non-target plant DNA when conducting metagenomic studies on bacterial endophyte communities. Bacterial amplification efficiency was increased 300-fold compared to standard PCR in an Illumina-based study of Sorghastrum nutans leaves. PMID:26159909

  18. A Public Education Primer: Basic (and Sometimes Surprising) Facts about the U.S. Education System

    ERIC Educational Resources Information Center

    Kober, Nancy; Rentner, Diane Stark; Jennings, Jack


    Public education matters, whether one is a student, parent, teacher, volunteer, employer, employee, or taxpayer. Although an individual undoubtedly knows something about public education, he may be unaware of important facts about the U.S. education system or may be surprised to learn how things have changed in recent years. In this primer on…

  19. Theoretical Backgrounds: Internet for Training Teachers and the Development of the HyperCard Internet Primer.

    ERIC Educational Resources Information Center

    Anderson, Daniel K.


    Discusses theoretical backgrounds for training teachers to use the Internet, including: a history of the Internet, education reform, technology and education, teacher training, affective domains, learning styles, and evaluation. Instructional design considerations are described for developing the HyperCard Internet Primer, software introducing…

  20. The Primer for Institutional Research. Resources for Institutional Research, Number Seven.

    ERIC Educational Resources Information Center

    Whiteley, Meredith A., Ed.; And Others

    This book presents 11 papers which consider the central issues, methods, and resources for work in institutional research in higher education. The primer uses the idea of a "cookbook" or "manual" for its conceptualization, organization, and format. The chapter topics focus on what are expected to be the key issues facing institutional researchers…


    ERIC Educational Resources Information Center



  2. Degenerate PCR primers for detecting putative priming glycosyltransferase genes in Bifidobacterium strains.


    Hidalgo-Cantabrana, C; Ordoñez, I; Ruas-Madiedo, P; Margolles, A


    A new PCR-based method to detect putative exopolysaccharide (EPS) producers from the genus Bifidobacterium was developed based on the detection of two priming glycosyltransferase genes: rfbP (undecaprenyl-phosphate sugar phospho-transferase) and cpsD (galactosyl-transferase). An in silico analysis of the genomes of 28 bifidobacterial strains, belonging to 8 different species, allowed us to detect rfbP, cpsD, or both, in the large majority of the genomes. Based on DNA sequence homology studies, 24 degenerated primers were synthesised in order to select the primer pairs with the broadest capacity to detect the presence of these genes. Four primer pairs targeting internal regions of rfbP and cpsD were selected, allowing the detection of at least one of the two genes in 63 out of 99 bifidobacterial strains analysed, whereas control strains from other genera yielded negative results, suggesting that these genes are widely spread in this genus. The use of these primers is recommended to screen for the potential of Bifidobacterium strains to produce EPS. PMID:25653152

  3. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.


    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  4. Review of "A School Privatization Primer for Michigan School Officials, Media and Residents"

    ERIC Educational Resources Information Center

    Belfield, Clive


    Issued by the Mackinac Center for Public Policy, "A School Privatization Primer for Michigan School Officials, Media and Residents" examines the "contracting out" of public school support services--specifically food, transportation, and custodial services. The report describes the prevalence of contracting out and sets forth the practical steps in…

  5. Primers to amplify SNP markers in Epichloë canadensis (Clavicipitaceae)1

    PubMed Central

    Sullivan, Terrence J.; Bultman, Thomas L.; Schoolcraft, Jennifer


    Premise of the study: Primers were designed to produce short amplicons containing single-nucleotide polymorphisms (SNPs) in β-tubulin (tubB) and translation elongation factor 1-α (tefA) in Epichloë canadensis (Clavicipitaceae), an endophytic fungus of Elymus canadensis (Poaceae). Methods and Results: Primers to amplify regions of tubB and tefA containing suspected SNPs were designed and tested on individuals from six populations. Two tubB alleles were identified that differed by a single SNP, and three tefA alleles were identified that differed by a combination of two SNPs. All six populations tested were polymorphic for the tefA marker, and three of the populations were also polymorphic for the tubB marker. These primers are also predicted to amplify these regions in 11 additional epichloid species. Conclusions: Primers for short amplicons within tubB and tefA genes can be used to successfully genotype E. canadensis, making them useful markers for population genetic or landscape genomic studies. PMID:27011893

  6. The Interaction between tRNALys3 and the Primer Activation Signal Deciphered by NMR Spectroscopy

    PubMed Central

    Brachet, Franck; Tisne, Carine


    The initiation of reverse transcription of the human immunodeficiency virus type 1 (HIV-1) requires the opening of the three-dimensional structure of the primer tRNALys3 for its annealing to the viral RNA at the primer binding site (PBS). Despite the fact that the result of this rearrangement is thermodynamically more stable, there is a high-energy barrier that requires the chaperoning activity of the viral nucleocapsid protein. In addition to the nucleotide complementarity to the PBS, several regions of tRNALys3 have been described as interacting with the viral genomic RNA. Among these sequences, a sequence of the viral genome called PAS for “primer activation signal” was proposed to interact with the T-arm of tRNALys3, this interaction stimulating the initiation of reverse transcription. In this report, we investigate the formation of this additional interaction with NMR spectroscopy, using a simple system composed of the primer tRNALys3, the 18 nucleotides of the PBS, the PAS (8 nucleotides) encompassed or not in a hairpin structure, and the nucleocapsid protein. Our NMR study provides molecular evidence of the existence of this interaction and highlights the role of the nucleocapsid protein in promoting this additional RNA-RNA annealing. This study presents the first direct observation at a single base-pair resolution of the PAS/anti-PAS association, which has been proposed to be involved in the chronological regulation of the reverse transcription. PMID:23762248

  7. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys

    SciTech Connect

    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable region of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.

  8. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.


    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan


    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. PMID:21332639

  9. A Public Policy Primer: How to Get off the Sidelines and into the Game

    ERIC Educational Resources Information Center

    Hollister, David C.


    This Primer is intended to help individual citizens and community leaders and organizers (1) better understand the complex nature of decision making in democracy and (2) identify strategies for having a larger voice and impact. This publication is predicated and draws upon the author's 40 years of extensive and hands-on experiences in varied…

  10. The Child, the Text and the Teacher: Reading Primers and Reading Instruction

    ERIC Educational Resources Information Center

    Patterson, Annette Joyce; Cormack, Phillip Anton; Green, William Charles


    From the late sixteenth century, in response to the problem of how best to teach children to read, a variety of texts, such as primers, spellers and readers were produced in England for vernacular instruction. This paper describes how these materials were used by teachers to develop, first, a specific religious understanding according to the…

  11. Sequence alignment status and amplicon size difference affecting EST-SSR primer performance and polymorphism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Little attention has been given to failed, poorly-performing, and non-polymorphic expressed sequence tag (EST) simple sequence repeat (SSR) primers. This is due in part to a lack of interest and value in reporting them but also because of the difficulty in addressing the causes of failure on a prime...

  12. A Policymaker's Primer on Education Research: How to Understand, Evaluate and Use It

    ERIC Educational Resources Information Center

    Lauer, Patricia A.


    The goal of this primer is to help policymakers and other interested individuals answer three big questions: (1) What does the research say? (2) Is the research trustworthy? (3) How can the research be used to guide policy? Answering these questions will help policymakers: (1) make evidenced-based decisions about education policies; (2) gain a…

  13. PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats

    PubMed Central

    Camacho, H.; Tuero, A. D.; Bacardí, D.; Palenzuela, D. O.; Aguilera, A.; Silva, J. A.; Estrada, R.; Gell, O.; Suárez, J.; Ancizar, J.; Brown, E.; Colarte, A. B.; Castro, J.; Novoa, L. I.


    The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies. PMID:27382362

  14. Standards-Based IEPs: An Introduction. Special Report. Primers on Special Education in Charter Schools

    ERIC Educational Resources Information Center

    Ahearn, Eileen M.


    This report has been prepared as an introduction to standards-based individualized education programs (IEPs). It has been prepared especially for those who work in and are responsible for charter schools. It is an addition to the resources available on the Primers on Special Education in Charter Schools website that is designed specifically to…

  15. GSP: a web-based platform for designing genome-specific primers in polyploids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The primary goal of this research was to develop a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome background. GSP uses BLAST to extract homeologous sequences of the subgenomes in the existing databases, performed a multip...

  16. El Primer Congreso Mexicanista de 1911: A Precursor to Contemporary Chicanismo

    ERIC Educational Resources Information Center

    Limon, Jose E.


    The article argues that many of the major themes which define the "supposedly new" ideology of Chicanismo were anticipated by El Primer Congreso Mexicanista, a political conference held in Laredo, Texas on September 14-22, 1911. Five of the discussions presented at the conference are appended. (NQ)

  17. Stress and Burnout: A Primer for Special Education and Special Services Personnel.

    ERIC Educational Resources Information Center

    Shaw, Stan F.; And Others

    The primer is designed to help promote mental, physical, and emotional health in school personnel and to prevent job burnout, with primary focus on interventions that special education and special services personnel, administrators, and teacher trainers can implement to manage stress and prevent burnout. Nine chapters address the following topics:…

  18. Getting Started in Global Education: A Primer for Principals and Teachers.

    ERIC Educational Resources Information Center

    Taylor, Howard E., Ed.

    This primer is intended for teachers and principals to help integrate global education into the school curriculum. The articles offer suggestions and rationale for inclusion of a global approach to the classroom. The table of contents offers: (1) "Introduction" (Ernest L. Boyer); (2) What is Global Education?" (M. Eugene Gilliom); (3) "Position…

  19. Detection and analysis of diverse herpesviral species by consensus primer PCR.

    PubMed Central

    VanDevanter, D R; Warrener, P; Bennett, L; Schultz, E R; Coulter, S; Garber, R L; Rose, T M


    A consensus primer PCR method which amplifies a region of herpesviral DNA-directed DNA polymerase (EC and which uses degenerate primers in a nested format was developed. Primers were designed to target sequences coding for highly conserved amino acid motifs covering a region of approximately 800 bp. The assay was applied to 22 species of herpesviruses (8 human and 14 animal viruses), with PCR products obtained for 21 of 22 viruses. In the process, 14 previously unreported amino acid-coding sequences from herpesviral DNA polymerases were obtained, including regions of human herpesviruses 7 and 8. The 50 to 60 amino acid-coding sequences recovered in the present study were determined to be unique to each viral species studied, with very little sequence variation between strains of a single species when studied. Template dilution studies in the presence of human carrier DNA demonstrated that six human herpesviruses (herpesviruses 1, 2, 3, 4, 5, and 6B) could be detected at levels at or below 100 genome equivalents per 100 ng of carrier DNA. These data suggest that consensus primer PCR targeted to herpesviral DNA polymerase may prove to be useful in the detection and identification of known herpesviruses in clinical samples and the initial characterization of new herpesviral genomes. PMID:8784566

  20. With Heat You Never Have to Ask Directions. An Energy Primer for Minnesota Teachers.

    ERIC Educational Resources Information Center

    Minnesota State Dept. of Natural Resources, St. Paul. Environmental Education Board.

    This four-part primer is designed to: (1) help Minnesota teachers acquire some familiarity with basic energy structure and language; (2) provide a capsule summary of Minnesota's energy picture; and (3) demonstrate that it is relatively easy to participate in energy education. Part 1 discusses: the fossil fuel age; kinds and forms of energy; energy…

  1. Seven Principles of Success: A Primer for Business-Led Coalitions.

    ERIC Educational Resources Information Center

    Theis, Audrey; Creticos, Peter; McMahon, Amanda

    Intended to help business-led coalitions master the seven principles of success in education and workforce development, this primer begins with a discussion of the problems stemming from the structural transition underway in the U.S. economy, an overview of the 21st century workforce system, and the potential role of business-led coalitions in…

  2. Parent Involvement in Early Intervening and Responsiveness to Invention (RTI). A Primer for Parents

    ERIC Educational Resources Information Center

    Mountain Plains Regional Resource Center (MPRRC), 2007


    The focus of this primer is to explain Responsiveness to Intervention (RTI) and Early Intervening Services as they pertain to parents and children who are at risk for academic and behavioral problems, explaining changes to special education law and how parents should be involved in each process. Emphasis on early intervening services allows action…

  3. Lives Intertwined: A Primer on the History and Emergence of Minority Serving Institutions

    ERIC Educational Resources Information Center

    Gasman, Marybeth; Nguyen, Thai-Huy; Conrad, Clifton F.


    In this article, we provide an overview--a primer--of the rise of Minority Serving Institutions (MSIs) as context for understanding the contemporary place of these institutions in our broader system of higher education. We also demonstrate how the emergence and the evolution of MSIs stem from our nation's struggle to provide equal educational…

  4. A Web-Based Adaptive Tutor to Teach PCR Primer Design

    ERIC Educational Resources Information Center

    van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.


    When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…

  5. What Are the Odds of that? A Primer on Understanding Logistic Regression

    ERIC Educational Resources Information Center

    Huang, Francis L.; Moon, Tonya R.


    The purpose of this Methodological Brief is to present a brief primer on logistic regression, a commonly used technique when modeling dichotomous outcomes. Using data from the National Education Longitudinal Study of 1988 (NELS:88), logistic regression techniques were used to investigate student-level variables in eighth grade (i.e., enrolled in a…

  6. CCI Primer: Key Facts about Early Care and Education in New York City. 2008

    ERIC Educational Resources Information Center

    Kolben, Nancy; Holcomb, Betty


    This primer provides a comprehensive look at the early care and education services throughout New York City. The analysis, which includes data on access, funding, and services, helps members of the field, advocates and policy makers identify current challenges and opportunities. Data is presented on: (1) Demographics: New York City's Children and…

  7. Automated cycle sequencing with Taquenase: protocols for internal labeling, dye primer and "doublex" simultaneous sequencing.


    Voss, H; Nentwich, U; Duthie, S; Wiemann, S; Benes, V; Zimmermann, J; Ansorge, W


    This paper describes automated cycle sequencing protocols for internal labeling, dye primer and "doublex" simultaneous sequencing using Taquenase, a new genetically modified DNA polymerase with increased thermostability. Sequencing performance both with labeled and unlabeled primer yields uniform unambiguous signals up to the resolution limit of the sequencing gels. Primer walking with internal labeling was successfully performed on Pl-derived artificial chromosome (PAC) constructs with 130-kb inserts. Taquenase, a commercially available modified thermostable sequencing enzyme (delta 280, F667Y Taq DNA polymerase), incorporates a variety of fluorescent dNTPs carrying fluorescein isothiocyanate, TexasRed or Cy5 labels during the cycle-sequencing process with higher efficiency than other thermostable DNA polymerases. Comparison to other modified Taq DNA polymerases suggests that the particular N-terminal deletion of Taquenase rather than the presence of the F667Y mutation is responsible for the efficient incorporation and extension of labeled dNTPs. Taquenase makes feasible highly accurate "doublex" simultaneous cylce sequencing on both strands of template DNA with two internal labels or two dye-labeled primers in combination with the EMBL-2-dye DNA sequencing system, ARAKIS, or with two commercial DNA sequencers. It allows up to 2000 bases at > 99% accuracy to be determined in a single reaction. PMID:9266089

  8. A sputtered zirconia primer for improved thermal shock resistance of plasma sprayed ceramic turbine seals

    NASA Technical Reports Server (NTRS)

    Bill, R. C.; Sovey, J.; Allen, G. P.


    The development of plasma-sprayed yttria stabilized zirconia (YSZ) ceramic turbine blade tip seal components is discussed. The YSZ layers are quite thick (0.040 to 0.090 in.). The service potential of seal components with such thick ceramic layers is cyclic thermal shock limited. The most usual failure mode is ceramic layer delamination at or very near the interface between the plasma sprayed YSZ layer and the NiCrAlY bondcoat. Deposition of a thin RF sputtered YSZ primer to the bondcoat prior to deposition of the thick plasma sprayed YSZ layer was found to reduce laminar cracking in cyclic thermal shock testing. The cyclic thermal shock life of one ceramic seal design was increased by a factor of 5 to 6 when the sputtered YSZ primer was incorporated. A model based on thermal response of plasma sprayed YSZ particles impinging on the bondcoat surface with and without the sputtered YSZ primer provides a basis for understanding the function of the primer.


    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey


  10. The O*Net Jobs Classification System: A Primer for Family Researchers

    ERIC Educational Resources Information Center

    Crouter, Ann C.; Lanza, Stephanie T.; Pirretti, Amy; Goodman, W. Benjamin; Neebe, Eloise


    We introduce family researchers to the Occupational Information Network, or O*Net, an electronic database on the work characteristics of over 950 occupations. The paper here is a practical primer that covers data collection, selecting occupational characteristics, coding occupations, scale creation, and construct validity, with empirical…


    EPA Science Inventory

    In Phase I, Foster-Miller, Inc., will develop the permanent primer replacement topcoat (PPRT), produce coated test panels, and analyze test panels for key performance properties. Topcoat stripping also will be demonstrated. The team includes coating experts and an aircraft ...

  12. Detection of G-Quadruplex DNA Using Primer Extension as a Tool

    PubMed Central

    Kumari, Rupa; Nambiar, Mridula; Shanbagh, Shaika; Raghavan, Sathees C.


    DNA sequence and structure play a key role in imparting fragility to different regions of the genome. Recent studies have shown that non-B DNA structures play a key role in causing genomic instability, apart from their physiological roles at telomeres and promoters. Structures such as G-quadruplexes, cruciforms, and triplexes have been implicated in making DNA susceptible to breakage, resulting in genomic rearrangements. Hence, techniques that aid in the easy identification of such non-B DNA motifs will prove to be very useful in determining factors responsible for genomic instability. In this study, we provide evidence for the use of primer extension as a sensitive and specific tool to detect such altered DNA structures. We have used the G-quadruplex motif, recently characterized at the BCL2 major breakpoint region as a proof of principle to demonstrate the advantages of the technique. Our results show that pause sites corresponding to the non-B DNA are specific, since they are absent when the G-quadruplex motif is mutated and their positions change in tandem with that of the primers. The efficiency of primer extension pause sites varied according to the concentration of monovalant cations tested, which support G-quadruplex formation. Overall, our results demonstrate that primer extension is a strong in vitro tool to detect non-B DNA structures such as G-quadruplex on a plasmid DNA, which can be further adapted to identify non-B DNA structures, even at the genomic level. PMID:25799152

  13. A new fungal large subunit ribosomal RNA primer for high throughput sequencing surveys


    Mueller, Rebecca C.; Gallegos-Graves, La Verne; Kuske, Cheryl R.


    The inclusion of phylogenetic metrics in community ecology has provided insights into important ecological processes, particularly when combined with high-throughput sequencing methods; however, these approaches have not been widely used in studies of fungal communities relative to other microbial groups. Two obstacles have been considered: (1) the internal transcribed spacer (ITS) region has limited utility for constructing phylogenies and (2) most PCR primers that target the large subunit (LSU) ribosomal unit generate amplicons that exceed current limits of high-throughput sequencing platforms. We designed and tested a PCR primer (LR22R) to target approximately 300–400 bp region of the D2 hypervariable regionmore » of the fungal LSU for use with the Illumina MiSeq platform. Both in silico and empirical analyses showed that the LR22R–LR3 pair captured a broad range of fungal taxonomic groups with a small fraction of non-fungal groups. Phylogenetic placement of publically available LSU D2 sequences showed broad agreement with taxonomic classification. Comparisons of the LSU D2 and the ITS2 ribosomal regions from environmental samples and known communities showed similar discriminatory abilities of the two primer sets. Altogether, these findings show that the LR22R–LR3 primer pair has utility for phylogenetic analyses of fungal communities using high-throughput sequencing methods.« less

  14. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.


    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie


    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  15. A method for automatically extracting infectious disease-related primers and probes from the literature

    PubMed Central


    Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1) convert each document into a tree of paper sections, (2) detect the candidate sequences using a set of finite state machine-based recognizers, (3) refine problem sequences using a rule-based expert system, and (4) annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch. PMID:20682041

  16. Primer Evaluation for PCR and its Application for Detection of Carbapenemases in Enterobacteriaceae

    PubMed Central

    Mlynarcik, Patrik; Roderova, Magdalena; Kolar, Milan


    Background: During the last decade, the prevalence of carbapenem-resistant Enterobacteriaceae in human patients has increased. Carbapenemase-producing bacteria are usually multidrug resistant. Therefore, early recognition of carbapenemase producers is critical to prevent their spread. Objectives: The objective of this study was to develop the primers for single and/or multiplex PCR amplification assays for simultaneous identification of class A, class B, and class D carbapenem hydrolyzing β-lactamases in Enterobacteriaceae and then to evaluate their efficiency. Materials and Methods: The reference sequences of all genes encoding carbapenemases were downloaded from GenBank. Primers were designed to amplify the following 11 genes: blaKPC, blaOXA, blaVIM, blaNDM, blaIMP, blaSME, blaIMI, blaGES, blaGIM, blaDIM and blaCMY. PCR conditions were tested to amplify fragments of different sizes. Two multiplex PCR sets were created for the detection of clinically important carbapenemases. The third set of primers was included for detection of all known carbapenemases in Enterobacteriaceae. They were evaluated using six reference strains and nine clinical isolates. Results: Using optimized conditions, all carbapenemase-positive controls yielded predicted amplicon sizes and confirmed the specificity of the primers in single and multiplex PCR. Conclusions: We have reported here a reliable method, composed of single and multiplex PCR assays, for screening all clinically known carbapenemases. Primers tested in silico and in vitro may distinguish carbapenem-resistant Enterobacteriaceae and could assist in combating the spread of carbapenem resistance in Enterobacteriaceae. PMID:27099689

  17. Experimental evaluation of the impact of seating depth variations on observed marks on primers.


    De Smet, Patrick; Hermsen, Rob; van Leuven, Bert; De Kinder, Jan; Hoffmann, Kai


    Although the examination of bullet and primer striae patterns is still a very important task in forensic ballistics, a fundamental explanation or theoretical model for reasoning about the (ir)reproducibility of the observed marks is still non-existing. More specifically, it is still unclear which ammunition production or firing condition parameters may play an important role in the striae and marks formation process. From a practical point of view this situation is unfortunate because a proper knowledge of these parameters and conditions could help underpin and explain certain differences found in actual casework investigations. Additionally, a proper understanding of these issues could allow examiners to select or develop a near-optimal test firing procedure by using more detailed and controlled variations of certain intra- and/or inter-ammunition parameters than the ones that are in use today. In this paper, we discuss the results of an experiment aimed at evaluating the impact of primer seating depth variations on observed primer striae and other marks. First, three sets of cartridge cases with different seating depth intervals were selected. Second, each of these sets were fired consecutively using a selected pistol. Finally, the cartridge cases were examined using both traditional optical microscopes and three-dimensional (3D) profilometer techniques. The results reported in this paper show that in our experiments no important impact of the initial primer seating depth on the observed primer striae patterns could be found, but that the firing pin impression does seem to change if the initial seating depth is larger than a certain threshold. PMID:18632232

  18. Primer release is the rate-limiting event in lagging-strand synthesis mediated by the T7 replisome.


    Hernandez, Alfredo J; Lee, Seung-Joo; Richardson, Charles C


    DNA replication occurs semidiscontinuously due to the antiparallel DNA strands and polarity of enzymatic DNA synthesis. Although the leading strand is synthesized continuously, the lagging strand is synthesized in small segments designated Okazaki fragments. Lagging-strand synthesis is a complex event requiring repeated cycles of RNA primer synthesis, transfer to the lagging-strand polymerase, and extension effected by cooperation between DNA primase and the lagging-strand polymerase. We examined events controlling Okazaki fragment initiation using the bacteriophage T7 replication system. Primer utilization by T7 DNA polymerase is slower than primer formation. Slow primer release from DNA primase allows the polymerase to engage the complex and is followed by a slow primer handoff step. The T7 single-stranded DNA binding protein increases primer formation and extension efficiency but promotes limited rounds of primer extension. We present a model describing Okazaki fragment initiation, the regulation of fragment length, and their implications for coordinated leading- and lagging-strand DNA synthesis. PMID:27162371

  19. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2014 CFR


    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  20. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2013 CFR


    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  1. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2012 CFR


    ...)-defined carcinogen as specified in 29 CFR 1910.1200(d)(4). (b) Emissions from all bake ovens used to cure... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection...

  2. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    PubMed Central

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  3. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    NASA Astrophysics Data System (ADS)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  4. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River.


    Cannon, M V; Hester, J; Shalkhauser, A; Chan, E R; Logue, K; Small, S T; Serre, D


    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity. PMID:26965911

  5. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.


    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang


    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. PMID:26084789

  6. Evaluation of skin irritation and sensitization of two diol solutions used as experimental dentin primers in humans and guinea pigs.


    Kurihara, A; Manabe, A; Katsuno, K; Itoh, K; Hisamitsu, H; Wakumoto, S; Yoshida, T


    The purpose of the present study was to evaluate the safety of ethylene glyco (EG) and 1,6-hexanediol (HD) solutions as experimental dentin primers when subjected to the guinea pig maximization test (GPMT), primary irritation test, cumulative skin irritation test and human patch test. No primary and cumulative skin irritation resulting from the use of 62.5% EG or 45% HD solutions was observed. In the case of GPMT, the animals sensitized with 2-hydroxyethyl methacrylate (2-HEMA) responded to 100% HD. 62.5% EG and 45% HD as dentin primers were safer than 2-HEMA such as a methacrylic primer. PMID:9550022

  7. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.


    Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

  8. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers.


    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan; Ro, Hyeon-Su


    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  9. Human DNA polymerase θ grasps the primer terminus to mediate DNA repair.


    Zahn, Karl E; Averill, April M; Aller, Pierre; Wood, Richard D; Doublié, Sylvie


    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break-inducing agents, including ionizing radiation. Reported here are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contacts to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. These observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining. PMID:25775267

  10. Optimization of primer specific filter metrics for the assessment of mitochondrial DNA sequence data

    PubMed Central



    Filter metrics are used as a quick assessment of sequence trace files in order to sort data into different categories, i.e. High Quality, Review, and Low Quality, without human intervention. The filter metrics consist of two numerical parameters for sequence quality assessment: trace score (TS) and contiguous read length (CRL). Primer specific settings for the TS and CRL were established using a calibration dataset of 2817 traces and validated using a concordance dataset of 5617 traces. Prior to optimization, 57% of the traces required manual review before import into a sequence analysis program, whereas after optimization only 28% of the traces required manual review. After optimization of primer specific filter metrics for mitochondrial DNA sequence data, an overall reduction of review of trace files translates into increased throughput of data analysis and decreased time required for manual review. PMID:21171863

  11. Human DNA polymerase θ grasps the primer terminus to mediate DNA repair

    PubMed Central

    Zahn, Karl E.; Averill, April M.; Aller, Pierre; Wood, Richard D.; Doublié, Sylvie


    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Breast, lung and oral cancers over-express polymerase θ, and reduction of its activity in mammalian cells increases sensitivity to double-strand break inducing agents, including ionizing radiation. Reported here are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ employs a specialized thumb subdomain to establish unique upstream contacts to the primer DNA strand, including an interaction to the 3’-terminal phosphate from one of five distinctive insertion loops. These observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions, or extend poorly annealed DNA termini to mediate end-joining. PMID:25775267

  12. Primers for low-copy nuclear genes in Metrosideros and cross-amplification in Myrtaceae1

    PubMed Central

    Pillon, Yohan; Johansen, Jennifer; Sakishima, Tomoko; Chamala, Srikar; Barbazuk, W. Brad; Stacy, Elizabeth A.


    • Premise of the study: Primers were developed to amplify low-copy nuclear genes in Hawaiian Metrosideros (Myrtaceae). • Methods and Results: Data from a pooled 454 Titanium run of the partial transcriptomes of four Metrosideros taxa were used to identify the loci of interest. Ten exon-primed intron-crossing (EPIC) markers were amplified and sequenced directly with success in Metrosideros, as well as in a representative selection of Myrtaceae, including Syzygium, Psidium, and Melaleuca for most of the markers. The loci amplified ranged between 500 and 1100 bp, and up to 117 polymorphic sites were observed within an individual gene alignment. Two introns contained microsatellites in some of the species. • Conclusions: These novel primer pairs should be useful for phylogenetic analysis and population genetics of a broad range of Myrtaceae, particularly the diverse fleshy-fruited tribes Syzygieae and Myrteae. PMID:25309837

  13. Microsatellite primers for Camissoniopsis cheiranthifolia (Onagraceae) and cross-amplification in related species1

    PubMed Central

    López-Villalobos, Adriana; Samis, Karen E.; Eckert, Christopher G.


    • Premise of the study: We developed 24 nuclear microsatellite primers from an enriched genomic library for the Pacific coastal dune endemic Camissoniopsis cheiranthifolia to study the consequences of mating system differentiation, the genetics of species’ range limits, and hybridization with its closest sister taxon, C. bistorta. • Methods and Results: Twenty-four primer pairs were developed and characterized in four populations of C. cheiranthifolia and one population of C. bistorta. We also tested eight additional taxa for cross-amplification. The average number of alleles per locus per species was 4.3 and 6.0, respectively. The number of loci that amplified and were variable within the eight related taxa ranged from six to 17. • Conclusions: These markers will be useful in studying mating system evolution, the genetic structure of species’ ranges, hybridization, and the provenance of material used for habitat restoration in C. cheiranthifolia, C. bistorta, and related species. PMID:25309839

  14. Universal primer PCR with DGGE for rapid detection of bacterial pathogens.


    Ji, Niannian; Peng, Bo; Wang, Guizhong; Wang, Sanying; Peng, Xuanxian


    A universal primer PCR (UPPCR) combined with denaturing gradient gel electrophoresis (DGGE) was evaluated as a method permitting the rapid detection of pathogens. The results show that this method is efficient at amplifying the conserved regions of bacterial 16S rRNA genes with universal primers and can detect causative bacterial pathogens rapidly. Six species of bacteria from fisheries (Pseudomonas fluorescens, Vibrio anguillarum, Aeromonas hydrophila, Vibrio fluvialis, Providencia rettgeri and Aeromonas sobria) were examined. Our results indicate that the approach we undertook can be adopted not only for axenic bacterial populations but also for mixed communities as well. Furthermore, we were able to achieve the rapid detection of multiple bacteria a single in sample. In addition, UPPCR-DGGE was shown to be better than previously reported UPPCR-single-stranded conformation polymorphism (SSCP)-based methods for the rapid detection of bacterial pathogens. PMID:15134888

  15. The National Cancer Institute's Dietary Assessment Primer: A Resource for Diet Research.


    Thompson, Frances E; Kirkpatrick, Sharon I; Subar, Amy F; Reedy, Jill; Schap, TusaRebecca E; Wilson, Magdalena M; Krebs-Smith, Susan M


    This monograph describes the National Cancer Institute's Dietary Assessment Primer, a web resource developed to help researchers choose the best available dietary assessment approach to achieve their research objective. All self-report instruments have error, but understanding the nature of that error can lead to better assessment, analysis, and interpretation of results. The Primer includes profiles of the major self-report dietary assessment instruments, including guidance on the best uses of each instrument; discussion of validation and measurement error generally and with respect to each instrument; guidance for choosing a dietary assessment approach for different research questions; and additional resources, such as a glossary, references, and overviews of specific/important issues in the field. This monograph also describes some future research needs in the field of dietary assessment. PMID:26422452

  16. Development and characterization of 11 microsatellite primers for the sedge Trichophorum planifolium (Cyperaceae)1

    PubMed Central

    Nowell, Victoria J.; Wang, Song; Smith, Tyler W.


    Premise of the study: Microsatellite loci were developed for Trichophorum planifolium (Cyperaceae), an endangered woodland sedge protected under federal and provincial legislation in Canada, to explore patterns of population genetic diversity and differentiation in the species. Methods and Results: Sixty-three primer pairs were evaluated for amplification consistency and screened for polymorphisms in 96 samples collected from 12 populations of T. planifolium distributed through the range of the species. Of these, 11 loci were shown to be polymorphic, displaying two to six alleles. Mean observed heterozygosity across loci ranged from 0.00 to 0.06 among populations tested. Conclusions: The results suggest that the 11 primer pairs developed in this study will be useful for future studies of broad-scale genetic variation in T. planifolium and in guiding management protocols for the species in Canada. PMID:26421254

  17. Isolation of Fungal Pathogens to an Edible Mushroom, Pleurotus eryngii, and Development of Specific ITS Primers

    PubMed Central

    Kim, Sang-Woo; Kim, Sinil; Lee, Hyun-Jun; Park, Ju-Wan


    Fungal pathogens have caused severe damage to the commercial production of Pleurotus eryngii, the king oyster mushroom, by reducing production yield, causing deterioration of commercial value, and shortening shelf-life. Four strains of pathogenic fungi, including Trichoderma koningiopsis DC3, Phomopsis sp. MP4, Mucor circinelloides MP5, and Cladosporium bruhnei MP6, were isolated from the bottle culture of diseased P. eryngii. A species-specific primer set was designed for each fungus from the ITS1-5.8S rDNA-ITS2 sequences. PCR using the ITS primer set yielded a unique DNA band for each fungus without any cross-reaction, proving the validity of our method in detection of mushroom fungal pathogens. PMID:24493949

  18. Phosphorothioate primers improve the amplification of DNA sequences by DNA polymerases with proofreading activity.

    PubMed Central

    Skerra, A


    Two thermostable DNA polymerases with proofreading activity--Vent DNA polymerase and Pfu DNA polymerase--have attracted recent attention, mainly because of their enhanced fidelities during amplification of DNA sequences by the polymerase chain reaction. A severe disadvantage for their practical application, however, results from the observation that due to their 3' to 5' exonuclease activities these enzymes degrade the oligodeoxynucleotides serving as primers for the DNA synthesis. It is demonstrated that this exonucleolytic attack on the primer molecules can be efficiently prevented by the introduction of single phosphorothioate bonds at their 3' termini. This strategy, which can be easily accomplished using routine DNA synthesis methodology, may open the way to a widespread use of these novel enzymes in the polymerase chain reaction. Images PMID:1641322

  19. Differentiation of five tuna species by a multiplex primer-extension assay.


    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana


    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  20. Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays.


    Wang, Xiaohong; Zheng, Zhi-Ming


    Papillomaviruses are a family of small, non-enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5'- and 3'-rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full-length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT-PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. PMID:26855281

  1. Distinción Empírica Entre Engagement y Trabajolismo en Enfermeras Hospitalarias de Japón: Efecto Sobre la Calidad del Sueño y el Desempeño Laboral

    PubMed Central

    Kubota, Kazumi; Shimazu, Akihito; Kawakami, Norito; Takahashi, Masaya; Nakata, Akinori; Schaufeli, Wilmar B.


    Objetivo El objetivo de este estudio es demostrar la distinción entre engagement y trabajolismo, estudiando su relación con la calidad del sueño y el desempeño laboral. Método Un total de 447 enfermeras de 3 hospitales de Japón fueron entrevistadas mediante un cuestionario autoadministrado que incluía la escala Utrecht (UWES, Utrecht Work Engagement Scale), la Escala de Adicción al Trabajo Holandesa (DUWAS, Dutch Workaholism Scale), preguntas sobre la calidad del sueño (7 ítems) con respecto a (1) dificultad para conciliar el sueño, (2) dificultad para mantener el sueño, (3) despertar temprano por la mañana, (4) dormirse o tomar siestas durante el día, (5) somnolencia diurna excesiva en el trabajo, (6) dificultad para despertarse por la mañana, y (7) despertar cansado en la mañana, y el Cuestionario sobre Salud y Desempeño (CSD) de la Organización Mundial de la Salud. Resultados Los modelos de ecuaciones estructurales demostraron que el engagement se relaciona positivamente con la calidad del sueño y el rendimiento laboral, mientras que el trabajolismo tiene una relación negativa con la calidad del sueño y el desempeño laboral. Conclusión Los resultados indican que el engagement y el trabajolismo son conceptualmente diferentes. El primero tiene una connotación positiva, mientras que el segundo se asocia de manera negativa al bienestar (buena calidad del sueño y buen rendimiento en el trabajo). PMID:26752805

  2. Development of primers to amplify mitochondrial DNA control region of Old World porcupines (subgenus Hystrix).


    Trucchi, E; Gentile, G; Sbordoni, V


    Eight primers were developed for the amplification of mitochondrial DNA control region of Old world porcupines (subgenus Hystrix). Successful amplifications of low-quality DNA extracted from old (12 years old) and recent quills were performed, thus facilitating field sampling. Successful cross-species amplifications were obtained for Hystrix africaeaustralis, H. cristata and H. indica. Length and structure of mitochondrial DNA control region were analysed and its usefulness as genetic marker for interspecific and population investigation was discussed. PMID:21585995

  3. An anti-steroidogenic inhibitory primer pheromone in male sea lamprey (Petromyzon marinus)

    USGS Publications Warehouse

    Chung-Davidson, Yu-Wen; Wang, Huiyong; Bryan, Mara B.; Wu, Hong; Johnson, Nicholas S.; Li, Weiming


    Reproductive functions can be modulated by both stimulatory and inhibitory primer pheromones released by conspecifics. Many stimulatory primer pheromones have been documented, but relatively few inhibitory primer pheromones have been reported in vertebrates. The sea lamprey male sex pheromone system presents an advantageous model to explore the stimulatory and inhibitory primer pheromone functions in vertebrates since several pheromone components have been identified. We hypothesized that a candidate sex pheromone component, 7α, 12α-dihydroxy-5α-cholan-3-one-24-oic acid (3 keto-allocholic acid or 3kACA), exerts priming effects through the hypothalamic-pituitary-gonadal (HPG) axis. To test this hypothesis, we measured the peptide concentrations and gene expressions of lamprey gonadotropin releasing hormones (lGnRH) and the HPG output in immature male sea lamprey exposed to waterborne 3kACA. Exposure to waterborne 3kACA altered neuronal activation markers such as jun and jun N-terminal kinase (JNK), and lGnRH mRNA levels in the brain. Waterborne 3kACA also increased lGnRH-III, but not lGnRH-I or -II, in the forebrain. In the plasma, 3kACA exposure decreased all three lGnRH peptide concentrations after 1 h exposure. After 2 h exposure, 3kACA increased lGnRHI and -III, but decreased lGnRH-II peptide concentrations in the plasma. Plasma lGnRH peptide concentrations showed differential phasic patterns. Group housing condition appeared to increase the averaged plasma lGnRH levels in male sea lamprey compared to isolated males. Interestingly, 15α-hydroxyprogesterone (15α-P) concentrations decreased after prolonged 3kACA exposure (at least 24 h). To our knowledge, this is the only known synthetic vertebrate pheromone component that inhibits steroidogenesis in males.

  4. OrigenArp Primer: How to Perform Isotopic Depletion and Decay Calculations with SCALE/ORIGEN

    SciTech Connect

    Bowman, Stephen M; Gauld, Ian C


    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for nuclear analyses. ORIGEN-ARP is a SCALE isotopic depletion and decay analysis sequence used to perform point-depletion calculations with the well-known ORIGEN-S code using problem-dependent cross sections. Problem-dependent cross-section libraries are generated using the ARP (Automatic Rapid Processing) module using an interpolation algorithm that operates on pre-generated libraries created for a range of fuel properties and operating conditions. Methods are provided in SCALE to generate these libraries using one-, two-, and three-dimensional transport codes. The interpolation of cross sections for uranium-based fuels may be performed for the variables burnup, enrichment, and water density. An option is also available to interpolate cross sections for mixed-oxide (MOX) fuels using the variables burnup, plutonium content, plutonium isotopic vector, and water moderator density. This primer is designed to help a new user understand and use ORIGEN-ARP with the OrigenArp Windows graphical user interface in SCALE. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with nuclear depletion codes in general or with SCALE/ORIGEN-ARP in particular. The primer is based on SCALE 6 but should be applicable to earlier or later versions of SCALE. Information is included to help new users, along with several sample problems that walk the user through the different input forms and menus and illustrate the basic features. References to related documentation are provided. The primer provides a starting point for the nuclear analyst who uses SCALE/ORIGEN-ARP. Complete descriptions are provided in the SCALE documentation. Although the primer is self-contained, it is intended as a companion volume to the SCALE documentation. The SCALE Manual is

  5. Globin mRNAs are primers for the transcription of influenza viral RNA in vitro

    PubMed Central

    Bouloy, Michele; Plotch, Stephen J.; Krug, Robert M.


    Because influenza viral RNA transcription in vitro is greatly enhanced by the addition of a primer dinucleotide, ApG or GpG, we have proposed that viral RNA transcription in vivo requires initiation by primer RNAs synthesized by the host cell, specifically by RNA polymerase II, thereby explaining the α-amanitin sensitivity of viral RNA transcription in vivo. Here, we identify such primer RNAs, initially in reticulocyte extracts, where they are shown to be globin mRNAs. Purified globin mRNAs very effectively stimulated viral RNA transcription in vitro, and the resulting transcripts directed the synthesis of all the nonglycosylated virus-specific proteins in micrococcal nuclease-treated L cell extracts. The viral RNA transcripts synthesized in vitro primed by ApG also directed the synthesis of the nonglycosylated virus-specific proteins, but the globin mRNA-primed transcripts were translated about 3 times more efficiently. The translation of the globin mRNA-primed, but not the ApG-primed, viral RNA transcripts was inhibited by 7-methylguanosine 5′-phosphate in the presence of S-adenosylhomocysteine, suggesting that the globin mRNA-primed transcripts contained a 5′-terminal methylated cap structure. We propose that this cap was transferred from the globin mRNA primer to the newly synthesized viral RNA transcripts, because no detectable de novo synthesis of a methylated cap occurred during globin mRNA-primed viral RNA transcription. Preliminary experiments indicate that other purified eukaryotic mRNAs also stimulate influenza viral RNA transcription in vitro. Images PMID:283399

  6. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    SciTech Connect

    Lestelle, Lawrence C.; Mobrand, Lars E.


    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  7. Plasma polymerized primer for rubber-to-metal bonding: Adhesion measurement and interphase characterization

    SciTech Connect

    Tsai, Y.M.; Boerio, F.J.; Kim, D.K.


    Adhesion of rubber to steel is of considerable practical importance in many areas of technology. However, direct adhesion of natural rubber to most metals is very poor. As a result, metals are frequently plated with brass, to which rubber adheres very strongly, or else the metals are coated with proprietary primers and adhesives in order to obtain adhesion of rubber. Plasma processing has been attracting attention in many areas due to some of its unique features. During the process, the synthesis and deposition of plasma polymers can be accomplished at the same time, making plasma processing a very efficient method for polymer coating. Plasma processing also allows flexible combinations of reactor parameters which would provide a great deal of process control and versatility. Moreover, in plasma processing, there are no solvents involved and there are no solvent-disposal problems. The purpose of this paper is to describe results the authors have obtained in developing plasma polymerized primer films to enhance rubber-to-steel bonding. Preliminary durability test results are reported. Results obtained using a model rubber system to simulate reactions in the rubber/primer {open_quotes}interphase{close_quotes} are also described.

  8. Crystal Structure of Complete Rhinovirus RNA Polymerase Suggests Front Loading of Protein Primer

    PubMed Central

    Appleby, Todd C.; Luecke, Hartmut; Shim, Jae Hoon; Wu, Jim Z.; Cheney, I. Wayne; Zhong, Weidong; Vogeley, Lutz; Hong, Zhi; Yao, Nanhua


    Picornaviruses utilize virally encoded RNA polymerase and a uridylylated protein primer to ensure replication of the entire viral genome. The molecular details of this mechanism are not well understood due to the lack of structural information. We report the crystal structure of human rhinovirus 16 3D RNA-dependent RNA polymerase (HRV16 3Dpol) at a 2.4-Å resolution, representing the first complete polymerase structure from the Picornaviridae family. HRV16 3Dpol shares the canonical features of other known polymerase structures and contains an N-terminal region that tethers the fingers and thumb subdomains, forming a completely encircled active site cavity which is accessible through a small tunnel on the backside of the molecule. The small thumb subdomain contributes to the formation of a large cleft on the front face of the polymerase which also leads to the active site. The cleft appears large enough to accommodate a template:primer duplex during RNA elongation or a protein primer during the uridylylation stage of replication initiation. Based on the structural features of HRV16 3Dpo1 and the catalytic mechanism known for all polymerases, a front-loading model for uridylylation is proposed. PMID:15596823

  9. Edesign: Primer and Enhanced Internal Probe Design Tool for Quantitative PCR Experiments and Genotyping Assays

    PubMed Central

    Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias


    Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at, and the source code is available for download. PMID:26863543

  10. Genetic linkage analysis using pooled DNA and infrared detection of tailed STRP primer patterns

    NASA Astrophysics Data System (ADS)

    Oetting, William S.; Wildenberg, Scott C.; King, Richard A.


    The mapping of a disease locus to a specific chromosomal region is an important step in the eventual isolation and analysis of a disease causing gene. Conventional mapping methods analyze large multiplex families and/or smaller nuclear families to find linkage between the disease and a chromosome marker that maps to a known chromosomal region. This analysis is time consuming and tedious, typically requiring the determination of 30,000 genotypes or more. For appropriate populations, we have instead utilized pooled DNA samples for gene mapping which greatly reduces the amount of time necessary for an initial chromosomal screen. This technique assumes a common founder for the disease locus of interest and searches for a region of a chromosome shared between affected individuals. Our analysis involves the PCR amplification of short tandem repeat polymorphisms (STRP) to detect these shared regions. In order to reduce the cost of genotyping, we have designed unlabeled tailed PCR primers which, when combined with a labeled universal primer, provides for an alternative to synthesizing custom labeled primers. The STRP pattern is visualized with an infrared fluorescence based automated DNA sequencer and the patterns quantitated by densitometric analysis of the allele pattern. Differences in the distribution of alleles between pools of affected and unaffected individuals, including a reduction in the number of alleles in the affected pool, indicate the sharing of a region of a chromosome. We have found this method effective for markers 10 - 15 cM away from the disease locus for a recessive genetic disease.

  11. Surface modification of luminescent lanthanide phosphate nanorods with cationic "Quat-primer" polymers.


    Komban, Rajesh; Beckmann, Ralph; Rode, Sebastian; Ichilmann, Sachar; Kühnle, Angelika; Beginn, Uwe; Haase, Markus


    "Quat-primer" polymers bearing cationic groups were investigated as a surface modifier for Tb-doped cerium phosphate green-emitting fluorescent nanorods (NRs). The NRs were synthesized by a microwave process without using any complex agents or ligands and were characterized with different analytical tools such as X-ray diffraction, transmission electron microscopy, and fluorescence spectroscopy. Poly(ethyleneimine) partially quarternized with glycidyltrimethylammonium chloride was synthesized separately and characterized in detail. (1)H and (13)C NMR spectroscopic studies revealed that the quaternary ammonium group was covalently attached to the polymer. UV-vis spectroscopy was used to examine the stability of the colloidal dispersions of the bare NRs as well as the modified NRs. ζ potential, thermogravimetric analysis, and atomic force microscopy studies were carried out to confirm that the positively charged Quat-primer polymer is adsorbed on the negatively charged surface of the NRs, which results in high dispersion stability. Emission spectra of the modified NRs indicated that there was no interference of the Quat-primer polymer with the fluorescence behavior. PMID:21721577

  12. Tea stains-inspired initiator primer for surface grafting of antifouling and antimicrobial polymer brush coatings.


    Pranantyo, Dicky; Xu, Li Qun; Neoh, Koon-Gee; Kang, En-Tang; Ng, Ying Xian; Teo, Serena Lay-Ming


    Inspired by tea stains, plant polyphenolic tannic acid (TA) was beneficially employed as the primer anchor for functional polymer brushes. The brominated TA (TABr) initiator primer was synthesized by partial modification of TA with alkyl bromide functionalities. TABr with trihydroxyphenyl moieties can readily anchor on a wide range of substrates, including metal, metal oxide, polymer, glass, and silicon. Concomitantly, the alkyl bromide terminals serve as initiation sites for atom transfer radical polymerization (ATRP). Cationic [2-(methacryloyloxy)ethyl]trimethylammonium chloride (META) and zwitterionic 2-methacryloyloxyethyl phosphorylcholine (MPC) and N-(3-sulfopropyl)-N-(methacryloxyethyl)-N,N-dimethylammonium betaine (SBMA) were graft-polymerized from the TABr-anchored stainless steel (SS) surface. The cationic polymer brushes on the modified surfaces are bactericidal, while the zwitterionic coatings exhibit resistance against bacterial adhesion. In addition, microalgal attachment (microfouling) and barnacle cyprid settlement (macrofouling) on the functional polymer-grafted surfaces were significantly reduced, in comparison to the pristine SS surface. Thus, the bifunctional TABr initiator primer provides a unique surface anchor for the preparation of functional polymer brushes for inhibiting both microfouling and macrofouling. PMID:25650890

  13. New primers for sex identification in the Chinese egret and other ardeid species.


    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin


    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species. PMID:21429119

  14. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    PubMed Central

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe


    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  15. Analysis of telomerase activity based on a spired DNA tetrahedron TS primer.


    Li, Yan; Wen, Yanli; Wang, Lele; Liang, Wen; Xu, Li; Ren, Shuzhen; Zou, Ziying; Zuo, Xiaolei; Fan, Chunhai; Huang, Qing; Liu, Gang; Jia, Nengqin


    The development of sensitive telomerase biosensors is hindered by the restricted accessibility of telomere strand (TS) primer and the limited enzyme reaction space, which is mainly confined by the vertical distance. In this work, we designed an electrochemical telomerase biosensor based on a spired DNA tetrahedron TS primer (STTS). By adding a rigid dsDNA spire onto the top of the DNA tetrahedron, we successfully regulated the distance between the TS primer and the surface, and thus greatly facilitated the telomerase elongation on surface. The signal-to-noise ratio was 2 times higher than TSP without the spire structure. The limit of detection was calculated to be lower than 10 HeLa cells, which is at least 2 magnitudes lower than other surface extension-based electrochemical telomerase sensors without amplification. The practicability of STTS sensor was also demonstrated by analysing various other cell lines including cancer cells, stem cells of high telomerase activity and somatic cells of low telomerase activity. PMID:25194236

  16. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).


    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S


    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  17. Development of species-specific primers for detection of Streptococcus mutans in mixed bacterial samples

    PubMed Central

    Chen, Zhou; Saxena, Deepak; Caufield, Page W.; Ge, Yao; Wang, Minqi; Li, Yihong


    Streptococcus mutans is the major microbial pathogen associated with dental caries in children. The objectives of this study were to design and evaluate species-specific primers for the identification of S. mutans. Validation of the best primer set, Sm479F/R, was performed using 7 S. mutans reference strains, 48 ATCC non-S. mutans strains, 92 S. mutans clinical isolates, DNA samples of S. mutans-S. sobrinus or S. mutans-S. sanguinis, and mixed bacterial DNA of saliva samples from 33 18-month-old children. All of the S. mutans samples tested positive, and no PCR products were amplified from members of the other streptococci or non-streptococci strains examined. The lowest detection level for PCR was 10−2 nanograms of S. mutans DNA (approximately 4.6 × 103 copies) in the test samples. The results of our study suggest that the Sm479F/R primer pair is highly specific and sensitive for identification of S. mutans in either purified or mixed DNA samples. PMID:17521362

  18. Structure of Hepatitis C Virus Polymerase in Complex with Primer-Template RNA

    SciTech Connect

    Mosley, Ralph T.; Edwards, Thomas E.; Murakami, Eisuke; Lam, Angela M.; Grice, Rena L.; Du, Jinfa; Sofia, Michael J.; Furman, Philip A.; Otto, Michael J.


    The replication of the hepatitis C viral (HCV) genome is accomplished by the NS5B RNA-dependent RNA polymerase (RdRp), for which mechanistic understanding and structure-guided drug design efforts have been hampered by its propensity to crystallize in a closed, polymerization-incompetent state. The removal of an autoinhibitory {beta}-hairpin loop from genotype 2a HCV NS5B increases de novo RNA synthesis by >100-fold, promotes RNA binding, and facilitated the determination of the first crystallographic structures of HCV polymerase in complex with RNA primer-template pairs. These crystal structures demonstrate the structural realignment required for primer-template recognition and elongation, provide new insights into HCV RNA synthesis at the molecular level, and may prove useful in the structure-based design of novel antiviral compounds. Additionally, our approach for obtaining the RNA primer-template-bound structure of HCV polymerase may be generally applicable to solving RNA-bound complexes for other viral RdRps that contain similar regulatory {beta}-hairpin loops, including bovine viral diarrhea virus, dengue virus, and West Nile virus.

  19. A new set of primers for COI amplification from freshwater microcrustaceans.


    Prosser, Sean; Martínez-Arce, Arely; Elías-Gutiérrez, Manuel


    Despite the contribution of DNA barcoding towards understanding the biodiversity and distribution of species, the success of COI amplification has been quite variable when it comes to freshwater zooplankton (Elías-Gutiérrez & Valdez-Moreno 2008; Jeffery et al. 2011). Some genera of microcrustaceans seem to be more difficult to amplify than others. For example, Macrothrix, Scapholeberis, Diaphanosoma and cyclopoids have yielded limited results. Among several possible reasons for the inability to barcode freshwater microcrustaceans is that there does not exist a specific set of primers for COI amplification. To this end, we developed a zooplankton - specific set of primers, which significantly increased average amplification success (20% increase). With these primers, we observed an overall success of over 70% for Sididae and Chydoridae, and more than 80% for Daphniidae, Moinidae, Bosminidae, Macrothricidae, Ilyocryptidae and Diaptomidae. We also demonstrate a simple alteration to a common specimen fixation method that increases the overall recovery of barcodes from freshwater zooplankton. Collectively, we believe our results will greatly aid the recovery of barcodes from these difficult groups. PMID:23795700

  20. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    PubMed Central

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M.; McClean, Phillip E.


    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

  1. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.


    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E


    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

  2. Development of universal primers for detection of potato carlaviruses by RT-PCR.


    Nie, Xianzhou; Bai, Yanju; Molen, Teresa A; Desjardins, David C


    To facilitate efficient and accurate detection of potato-infecting carlaviruses, degenerated universal primers were designed based on conserved amino acid and nucleotide sequences. Two sense primers, Car-F1 and Car-F2, were based on the amino acid sequences "SNNMA" and "GLGVPTE", respectively, in the coat protein. The reverse primer, Car-R, which was located at the border of the nucleic acid binding protein gene and the 3' untranslated region, and dT-B, which was derived from the oligo-dT targeting the poly(A) tail, were selected. Successful application of fragments within the predicted size range of carlaviruses was obtained using Car-F1 paired with either Car-R or dT-B from tested carlaviruses (Potato virus S, M and latent) by RT-PCR. The Car-F2 failed to yield clear-cut fragments within the predicted size range when paired with either Car-R or dT-B in RT-PCR. However, a less degenerated version of the primer, Car-F2b, resulted in amplicons within the predicted size range when paired with either Car-R or dT-B. Sequencing of the tentative carlavirus-fragments resulting from Car-F1/Car-R and Car-F2b/dT-B proved their carlavirus-origin, thus indicating the high specificity of these primers. The sensitivity of Car-F1/Car-R or Car-F2b/Car-R mediated RT-PCR for the detection of carlavirus-infected potato tubers were assessed using composite samples containing one carlavirus-infected-potato-tuber RNA sample with up to 49 virus-free-potato-tuber RNA samples under the optimal annealing temperature. The target carlaviruses were detected readily from all composites, demonstrating a high sensitivity. The method was further evaluated using presumed virus-free or carlavirus-infected potatoes of several cultivars, and reliable results were obtained. PMID:18353450

  3. Tetra Primer ARMS PCR Optimization to Detect Single Nucleotide Polymorphisms of the CYP2E1 Gene.


    Suhda, Saihas; Paramita, Dewi Kartikawati; Fachiroh, Jajah


    Single nucleotide polymorphism (SNP) detection has been used extensively for genetic association studies of diseases including cancer. For mass, yet accurate and more economic SNP detection we have optimized tetra primer amplification refractory mutation system polymerase chain reaction (ARMS PCR) to detect three SNPs in the cytochrome P450 2E1 (CYP2E1) gene locus; i.e. rs3813865, rs2070672 and rs3813867. The optimization system strategies used were (1) designing inner and outer primers; (2) determining of their optimum primer concentration ratios; and (3) determining of the optimum PCR annealing temperature. The tetra primer ARMS PCR result could be directly observed using agarose gel electrophoresis. The method succesfully determined three SNPs in CYP2E1 locus, the results being consistent with validation using DNA sequencing and restriction fragment length polymorphisms (RFLP). PMID:27509930

  4. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).


    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K


    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals. PMID:23950044


    EPA Science Inventory

    Plasma polymerized hexamethyldisiloxane (HMDSO) films (~800 A in thickness) were deposited onto 6111-T4 aluminum substrates in radio frequency and microwave powered reactors and used as primers for structural adhesive bonding. Processing variables such as substrate pre-treatment,...

  6. Single-copy nuclear gene primers for Streptanthus and other Brassicaceae from genomic scans, published data, and ESTs1

    PubMed Central

    Cacho, N. Ivalú; Strauss, Sharon Y.


    • Premise of the study: We report 11 primer sets for nine single-copy nuclear genes in Streptanthus and other Thelypodieae (Brassicaceae) and their utility at tribal-level and species-level phylogenetics in this poorly resolved group. • Methods and Results: We selected regions based on a cross-referenced matrix of previous studies and public Brassica expressed sequence tags. To design primers, we used alignments of low-depth-coverage Illumina sequencing of genomic DNA for two species of Brassica mapped onto Arabidopsis thaliana. We report several primer combinations for five regions that consistently amplified a single band and yielded high-quality sequences for at least 70% of the species assayed, and for four additional regions whose utility might be clade specific. • Conclusions: Our primers will be useful in improving resolution at shallow depths across the Thelypodieae, and likely in other Brassicaceae. PMID:25202560

  7. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    SciTech Connect

    Walters , William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada , Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, Greg; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob


    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of datasets amplified with varied primers requires attention. Here we examine the performance of modified 16S rRNA gene and ITS primers for archaea/bacteria and fungi, respectively, with non-aquatic samples. We moved primer barcodes to the 5’-end, allowing for a range of different 3’ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4-5 of the 16S rRNA gene. We additionally demonstrate that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection of Thaumarchaeota and SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

  8. A Unique Primer with an Inosine Chain at the 5′-Terminus Improves the Reliability of SNP Analysis Using the PCR-Amplified Product Length Polymorphism Method

    PubMed Central

    Shojo, Hideki; Tanaka, Mayumi; Takahashi, Ryohei; Kakuda, Tsuneo; Adachi, Noboru


    Polymerase chain reaction-amplified product length polymorphism (PCR-APLP) is one of the most convenient and reliable methods for single nucleotide polymorphism (SNP) analysis. This method is based on PCR, but uses allele-specific primers containing SNP sites at the 3′-terminus of each primer. To use this method at least two allele-specific primers and one “counter-primer”, which serves as a common forward or reverse primer of the allele-specific primers, are required. The allele-specific primers have SNP sites at the 3′-terminus, and another primer should have a few non-complementary flaps at the 5′-terminus to detect SNPs by determining the difference of amplicon length by PCR and subsequent electrophoresis. A major disadvantage of the addition of a non-complementary flap is the non-specific annealing of the primer with non-complementary flaps. However, a design principle for avoiding this undesired annealing has not been fully established, therefore, it is often difficult to design effective APLP primers. Here, we report allele-specific primers with an inosine chain at the 5′-terminus for PCR-APLP analysis. This unique design improves the competitiveness of allele-specific primers and the reliability of SNP analysis when using the PCR-APLP method. PMID:26381262

  9. Comparative in silico analysis of PCR primers suited for diagnostics and cloning of ammonia monooxygenase genes from ammonia-oxidizing bacteria.


    Junier, Pilar; Kim, Ok-Sun; Molina, Verónica; Limburg, Petra; Junier, Thomas; Imhoff, Johannes F; Witzel, Karl-Paul


    Over recent years, several PCR primers have been described to amplify genes encoding the structural subunits of ammonia monooxygenase (AMO) from ammonia-oxidizing bacteria (AOB). Most of them target amoA, while amoB and amoC have been neglected so far. This study compared the nucleotide sequence of 33 primers that have been used to amplify different regions of the amoCAB operon with alignments of all available sequences in public databases. The advantages and disadvantages of these primers are discussed based on the original description and the spectrum of matching sequences obtained. Additionally, new primers to amplify the almost complete amoCAB operon of AOB belonging to Betaproteobacteria (betaproteobacterial AOB), a primer pair for DGGE analysis of amoA and specific primers for gammaproteobacterial AOB, are also described. The specificity of these new primers was also evaluated using the databases of the sequences created during this study. PMID:18248438

  10. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki


    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  11. String primer

    NASA Astrophysics Data System (ADS)

    Alvarez, Enrique; Meessen, Patrick


    This is the written version of a set of introductory lectures to string theory. The lectures were given at the Universidad Autónoma de Madrid in the semester 1997/98 and at the VI Escuela de Otoño de Física Teórica, held in Santiago de Compostela (10-23 september 1998).

  12. Negotiations Primer.

    ERIC Educational Resources Information Center

    New Jersey Principals and Supervisors Association, Trenton.

    This booklet provides step-by-step advice for New Jersey school administrators on the organization of bargaining units and on negotiation. The section covering organizing reviews briefly the rights of school employee associations to negotiate, the values of collective negotiation, and the specific requirements and procedures involved in…

  13. ROTONET Primer

    NASA Technical Reports Server (NTRS)

    Prichard, Devon S.


    This document provides a brief overview of use of the ROTONET rotorcraft system noise prediction capability within the Aircraft Noise Program (ANOPP). Reviews are given on rotorcraft noise, the state-of-the-art of system noise prediction, and methods for using the various ROTONET prediction modules.

  14. Pollen Primer


    ... air filters (HEPA) or an electrostatic air filter. Tree Pollen Trees produce pollen earliest, as soon as January in ... distributed miles away. Fewer than 100 kinds of trees cause allergies. Some common ones are catalpa, elm, ...

  15. NAEP Primer.

    ERIC Educational Resources Information Center

    Beaton, Albert E.; Gonzalez, Eugenio

    This guide to the National Assessment of Educational Progress (NAEP) is designed to help the secondary data analyst use the NAEP and to introduce some of the sophisticated technology used by the NAEP. The NAEP has been gathering information on American students since 1969. It samples populations that consist of all students in U.S. schools, both…

  16. VGRAF primer

    SciTech Connect

    Padilla, G.C.; Thompson, S.L.


    VGRAF is a powerful FORTRAN program which is designed to produce professional-quality color slides, viewgraphs, posters, and data plots for presentations or reports. The program is easy to use and requires no a priori knowledge of a programming language and little or no previous programming experience. This report describes a subset of the VGRAF commands which will enable the user to make very simple plots. For enhanced plotting, the user is referred to SAND79-2147.

  17. Diskette Primer.

    ERIC Educational Resources Information Center

    Chien, Philip


    This detailed look into proper diskette maintenance presents general precautions on temperature, humidity, lifespan, labeling, storage, and disk drive maintenance. The Apple UniDisk 3.5 disk drive is described, tips on purchasing diskettes are presented, and information on specific data retrieval and backup software and diskettes is included. (MBR)

  18. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.


    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc


    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree. PMID:19778057

  19. An RT-PCR primer pair for the detection of Pospiviroid and its application in surveying ornamental plants for viroids.


    Bostan, Hidayet; Nie, Xianzhou; Singh, Rudra P


    A primer pair for reverse transcription-polymerase chain reaction (RT-PCR), based on the conserved sequences of the members of genus Pospiviroid was designed to yield a fragment of about 200 base pairs (bp). Since pospiviroids infect a large number of plants species and a few members of the genus Pospiviroid have been already detected in some ornamental plants, the primer pair was evaluated for its efficacy using ornamental plants. The method of return-polyacrylamide gel electrophoresis (R-PAGE) was used to determine the general presence of viroids in the test samples. Efficacy of the primer pair for members of genus Pospiviroid was demonstrated by the detection of Potato spindle tuber viroid (PSTVd) and Tomato chlorotic dwarf viroid (TCDVd) in potato, Chrysanthemum stunt viroid and Iresine viroid in Verbena and Vinca species, and Citrus exocortis viroid in Impatiens species. Specificity of the primer pair became evident, where additional viroids were detected by R-PAGE in Coleus and Magilla species, but they were not amplified by the Pospiviroid primer. This primer pair would be of benefit in indexing ornamental plants in quarantine samples or in viroid-free certification schemes, irrespective of their actual identity. PMID:14738987

  20. DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies.


    Hugerth, Luisa W; Wefer, Hugo A; Lundin, Sverker; Jakobsson, Hedvig E; Lindberg, Mathilda; Rodin, Sandra; Engstrand, Lars; Andersson, Anders F


    The taxonomic composition of a microbial community can be deduced by analyzing its rRNA gene content by, e.g., high-throughput DNA sequencing or DNA chips. Such methods typically are based on PCR amplification of rRNA gene sequences using broad-taxonomic-range PCR primers. In these analyses, the use of optimal primers is crucial for achieving an unbiased representation of community composition. Here, we present the computer program DegePrime that, for each position of a multiple sequence alignment, finds a degenerate oligomer of as high coverage as possible and outputs its coverage among taxonomic divisions. We show that our novel heuristic, which we call weighted randomized combination, performs better than previously described algorithms for solving the maximum coverage degenerate primer design problem. We previously used DegePrime to design a broad-taxonomic-range primer pair that targets the bacterial V3-V4 region (341F-805R) (D. P. Herlemann, M. Labrenz, K. Jurgens, S. Bertilsson, J. J. Waniek, and A. F. Andersson, ISME J. 5:1571-1579, 2011,, and here we use the program to significantly increase the coverage of a primer pair (515F-806R) widely used for Illumina-based surveys of bacterial and archaeal diversity. By comparison with shotgun metagenomics, we show that the primers give an accurate representation of microbial diversity in natural samples. PMID:24928874

  1. "Doublex" fluorescent DNA sequencing: two independent sequences obtained simultaneously in one reaction with internal labeling and unlabeled primers.


    Wiemann, S; Stegemann, J; Zimmermann, J; Voss, H; Benes, V; Ansorge, W


    The novel "doublex" DNA sequencing technique that makes it possible to obtain simultaneously two independent sequences from one sequencing reaction with the use of unlabeled primers and internal labeling is described. The different sequencing products are labeled in parallel with fluorescein-15-dATP and Texas red-5-dCTP present in the same tube. The characteristics of T7 DNA polymerase are exploited to ensure that only either of the labeled dNTPs is incorporated into the corresponding sequencing products. Specificity of labeling is ensured by the selection of primers. One of the unlabeled primers is chosen to be followed by an "A," the other by a "C" to be incorporated immediately downstream from the primer binding site. The doublex sequencing technique is applicable to the simultaneous sequencing of either the same DNA template/strand or a mixture of different templates. Combinations of unlabeled and labeled primers in the same sequencing reaction are also possible. The two sequences can be determined in parallel and on-line in the same lanes of a gel with a novel automated DNA sequencer, which was previously described for use with labeled primers. PMID:8714594

  2. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    SciTech Connect

    Jothikumar, N. Hill, Vincent R.


    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  3. POLRMT regulates the switch between replication primer formation and gene expression of mammalian mtDNA

    PubMed Central

    Kühl, Inge; Miranda, Maria; Posse, Viktor; Milenkovic, Dusanka; Mourier, Arnaud; Siira, Stefan J.; Bonekamp, Nina A.; Neumann, Ulla; Filipovska, Aleksandra; Polosa, Paola Loguercio; Gustafsson, Claes M.; Larsson, Nils-Göran


    Mitochondria are vital in providing cellular energy via their oxidative phosphorylation system, which requires the coordinated expression of genes encoded by both the nuclear and mitochondrial genomes (mtDNA). Transcription of the circular mammalian mtDNA depends on a single mitochondrial RNA polymerase (POLRMT). Although the transcription initiation process is well understood, it is debated whether POLRMT also serves as the primase for the initiation of mtDNA replication. In the nucleus, the RNA polymerases needed for gene expression have no such role. Conditional knockout of Polrmt in the heart results in severe mitochondrial dysfunction causing dilated cardiomyopathy in young mice. We further studied the molecular consequences of different expression levels of POLRMT and found that POLRMT is essential for primer synthesis to initiate mtDNA replication in vivo. Furthermore, transcription initiation for primer formation has priority over gene expression. Surprisingly, mitochondrial transcription factor A (TFAM) exists in an mtDNA-free pool in the Polrmt knockout mice. TFAM levels remain unchanged despite strong mtDNA depletion, and TFAM is thus protected from degradation of the AAA+ Lon protease in the absence of POLRMT. Last, we report that mitochondrial transcription elongation factor may compensate for a partial depletion of POLRMT in heterozygous Polrmt knockout mice, indicating a direct regulatory role of this factor in transcription. In conclusion, we present in vivo evidence that POLRMT has a key regulatory role in the replication of mammalian mtDNA and is part of a transcriptional mechanism that provides a switch between primer formation for mtDNA replication and mitochondrial gene expression. PMID:27532055

  4. POLRMT regulates the switch between replication primer formation and gene expression of mammalian mtDNA.


    Kühl, Inge; Miranda, Maria; Posse, Viktor; Milenkovic, Dusanka; Mourier, Arnaud; Siira, Stefan J; Bonekamp, Nina A; Neumann, Ulla; Filipovska, Aleksandra; Polosa, Paola Loguercio; Gustafsson, Claes M; Larsson, Nils-Göran


    Mitochondria are vital in providing cellular energy via their oxidative phosphorylation system, which requires the coordinated expression of genes encoded by both the nuclear and mitochondrial genomes (mtDNA). Transcription of the circular mammalian mtDNA depends on a single mitochondrial RNA polymerase (POLRMT). Although the transcription initiation process is well understood, it is debated whether POLRMT also serves as the primase for the initiation of mtDNA replication. In the nucleus, the RNA polymerases needed for gene expression have no such role. Conditional knockout of Polrmt in the heart results in severe mitochondrial dysfunction causing dilated cardiomyopathy in young mice. We further studied the molecular consequences of different expression levels of POLRMT and found that POLRMT is essential for primer synthesis to initiate mtDNA replication in vivo. Furthermore, transcription initiation for primer formation has priority over gene expression. Surprisingly, mitochondrial transcription factor A (TFAM) exists in an mtDNA-free pool in the Polrmt knockout mice. TFAM levels remain unchanged despite strong mtDNA depletion, and TFAM is thus protected from degradation of the AAA(+) Lon protease in the absence of POLRMT. Last, we report that mitochondrial transcription elongation factor may compensate for a partial depletion of POLRMT in heterozygous Polrmt knockout mice, indicating a direct regulatory role of this factor in transcription. In conclusion, we present in vivo evidence that POLRMT has a key regulatory role in the replication of mammalian mtDNA and is part of a transcriptional mechanism that provides a switch between primer formation for mtDNA replication and mitochondrial gene expression. PMID:27532055

  5. Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases.

    PubMed Central

    Simpson, C L; Giffard, P M; Jacques, N A


    Fractionation of the culture medium showed that Streptococcus salivarius ATCC 25975 secreted a glucosyltransferase (Gtf) that was primer independent. On the basis of this observation, a gene library of S. salivarius chromosomal DNA cloned into lambda L47.1 was screened for a gene(s) coding for such an activity. As a result of this screening process, two new gtf genes, gtfL and gtfM, both of which coded for primer-independent Gtf activities, were isolated. GtfL produced an insoluble glucan that was refractory to digestion by the endo-(1-->6)-alpha-D-glucanase. of Chaetonium gracile, while GtfM produced a soluble glucan that was readily degraded by the glucanase. Comparison of the deduced amino acid sequences of gtfL and gtfM with 10 other available Gtf sequences allowed the relatedness of the conserved catalytic regions to be assessed. This analysis showed that the 12 enzymes did not form clusters based on their primer dependencies or on their product solubilities. Further analysis of the YG repeats in the C-terminal glucan-binding domains of GtfJ, GtfK, GtfL, and GtfM from S. salivarius showed that there was strong homology between a block of contiguous triplet YG repeats present in the four alleles. These blocks of YG repeats were coded for by a region of each gene that appeared to have arisen as a result of a recent duplication event(s). PMID:7822030

  6. Direct Fluorescence Detection of Allele-Specific PCR Products Using Novel Energy-Transfer Labeled Primers.




    Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe. PMID:10089280

  7. Partial molecular cloning of the JHK retrovirus using gammaretrovirus consensus PCR primers

    PubMed Central

    Halligan, Brian D; Sun, Hai-Yuan; Kushnaryov, Vladimir M; Grossberg, Sidney E


    The JHK virus (JHKV) was previously described as a type C retrovirus that has some distinctive ultrastructural features and replicates constitutively in a human B-lymphoblastoid cell line, JHK-3. In order to facilitate the cloning of sequences from JHKV, a series of partially degenerate consensus retroviral PCR primers were created by a data-driven design approach based on an alignment of 14 diverse gammaretroviral genomes. These primers were used in the PCR amplification of purified JHK virion cDNA, and ana lysis of the resulting amplified sequence indicates that the JHKV is in the murine leukemia virus (MLV) family. The JHK sequence is nearly identical to the corresponding region of the Bxv-1 endogenous mouse retrovirus (GenBank accession AC115959) and distinct from XMRV. JHKV gag-specific amplification was demonstrated with nucleic acids from uncultivated, frozen, peripheral blood mononuclear cells (PBMCs) of the index patient, but not in PBMCs from nine healthy blood donors. Unlike earlier reports, in which MLV-like sequences were identified in human source material, which may have been due to murine contamination, budding retrovirions were demonstrated repeatedly by electron microscopy in uncultivated lymphocytes of the index patient that were morphologically identical in their development to the virions in the JHK-3 cells, and immunological evidence was obtained that the index patient produced IgG antibodies that bound to the budding viral particles in patient PBMCs and in the JHK-3 cells. These data indicate that the patient had been infected by JHKV, lending significance to the demonstration of JHKV amplicons in nucleic acids of the patient’s PBMCs. In future studies, the PCR primer sets described herein may expand the detection of an amplifiable subset of viruses related to MLV. PMID:24159361

  8. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.


    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo


    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: PMID:27154272

  9. Design and Validation of Four New Primers for Next-Generation Sequencing To Target the 18S rRNA Genes of Gastrointestinal Ciliate Protozoa

    PubMed Central

    Wright, André-Denis G.


    Four new primers and one published primer were used to PCR amplify hypervariable regions within the protozoal 18S rRNA gene to determine which primer pair provided the best identification and statistical analysis. PCR amplicons of 394 to 498 bases were generated from three primer sets, sequenced using Roche 454 pyrosequencing with Titanium, and analyzed using the BLAST database (NCBI) and MOTHUR version 1.29. The protozoal diversity of rumen contents from moose in Alaska was assessed. In the present study, primer set 1, P-SSU-316F and GIC758R (amplicon of 482 bases), gave the best representation of diversity using BLAST classification, and the set amplified Entodinium simplex and Ostracodinium spp., which were not amplified by the other two primer sets. Primer set 2, GIC1080F and GIC1578R (amplicon of 498 bases), had similar BLAST results and a slightly higher percentage of sequences that were identified with a higher sequence identity. Primer sets 1 and 2 are recommended for use in ruminants. However, primer set 1 may be inadequate to determine protozoal diversity in nonruminants. The amplicons created by primer set 1 were indistinguishable for certain species within the genera Bandia, Blepharocorys, Polycosta, and Tetratoxum and between Hemiprorodon gymnoprosthium and Prorodonopsis coli, none of which are normally found in the rumen. PMID:24973070

  10. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo


    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: PMID:27154272

  11. Effect of addition of chitosan to self-etching primer: antibacterial activity and push-out bond strength to radicular dentin

    PubMed Central

    Elsaka, Shaymaa; Elnaghy, Amr


    The purpose of this study was to evaluate the antibacterial activity of a modified self-etching primer incorporating chitosan and whether this modification affected the bond strength to radicular dentin. A modified self-etching primer was prepared by adding chitosan solutions at 0.03%, 0.06%, 0.12% and 0.25% (W/W) to RealSeal selfe-tching primer. RealSeal primer without chitosan was used as the control. The antibacterial activity of the modified self-etching primer was evaluated using the direct contact test against Enterococcus faecalis. The bonding ability of the RealSeal system to radicular dentin was evaluated using the push-out bond strength test. The modes of failure were examined under a stereomicroscope. Data were analyzed using analysis of variance (ANOVA) and Tukey's test, with a P-value < 0.05 indicating statistical significance. The results showed that the antibacterial properties of the freshly prepared and aged modified self-etching primer incorporating chitosan exhibited potent antibacterial effect against Enterococcus faecalis compared with the unmodified primer. The RealSeal system with the aged modified self-etching primer incorporating chitosan showed no significant differences in the bond strength as compared with the control (P = 0.99). The findings suggest that modified self-etching primer incorporating chitosan is a promising antibacterial primer which does not adversely affect the bond strength of the RealSeal system to radicular dentin. PMID:23554762

  12. Constructing the ecstasy of MDMA from its component mental organs: Proposing the primer/probe method.


    Ray, Thomas S


    The drug MDMA, commonly known as ecstasy, produces a specific and distinct open hearted mental state, which led to the creation of a new pharmacological class, "entactogens". Extensive literature on its mechanisms of action has come to characterize MDMA as a "messy" drug with multiple mechanisms, but the consensus is that the distinctive entactogenic effects arise from the release of neurotransmitters, primarily serotonin. I propose an alternative hypothesis: The entactogenic mental state is due to the simultaneous direct activation of imidazoline-1 (I1) and serotonin-2 (5-HT2) receptors by MDMA. This hypothesis emerges from "mental organ" theory, which embodies many hypotheses, the most relevant of which are: "Mental organs" are populations of neurons that all express their defining metabotropic receptor, and each mental organ plays a distinct role in the mind, a role shaped by evolution as mental organs evolve by duplication and divergence. Mental organs are the mechanism by which evolution sculpts the mind. Mental organs can be in or out of consciousness. In order for a mental organ to enter consciousness, three things must happen: The mental organ must be activated directly at its defining receptor. 5-HT2 must be simultaneously activated. One of the functions of activated 5-HT2 is to load other simultaneously activated mental organs fully into consciousness. In some cases THC must be introduced to remove long-term blocks mediated by the cannabinoid system. I propose the "primer/probe" method to test these hypotheses. A "primer" is a drug that selectively activates 5-HT2 (e.g. DOB or MEM) or serotonin-1 (5-HT1) and 5-HT2 (e.g. DOET or 2C-B-fly). A "probe" is a drug that activates a receptor whose corresponding mental organ we wish to load into consciousness in order to understand its role in the mind. The mental organ is loaded into consciousness when the primer and probe are taken together, but not when taken separately. For example, the blood pressure

  13. Genus-wide microsatellite primers for the goldenrods (Solidago; Asteraceae)1

    PubMed Central

    Beck, James B.; Semple, John C.; Brull, Justin M.; Lance, Stacey L.; Phillips, Mai M.; Hoot, Sara B.; Meyer, Gretchen A.


    • Premise of the study: Microsatellite primers were developed for studies of polyploid evolution, ecological genetics, conservation genetics, and species delimitation in the genus Solidago. • Methods and Results: Illumina sequencing of a shotgun library from S. gigantea identified ca. 1900 putative single-copy loci. Fourteen loci were subsequently shown to be amplifiable, single-copy, and variable in a broad range of Solidago species. • Conclusions: The utility of these markers both across the genus and in herbarium specimens of a wide age range will facilitate numerous inter- and intraspecific studies in the ca. 120 Solidago species. PMID:25202617

  14. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection.


    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L


    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  15. Low-stringency PCR with diagnostically useful primers for identification of Leptospira serovars.

    PubMed Central

    de Caballero, O L; Dias Neto, E; Koury, M C; Romanha, A J; Simpson, A J


    Primers proposed for the diagnosis of the pathogenic spirochete Leptospira spp. (C. Gravekamp, H. V. D. Kemp, M. Franzen, D. Carrington, G.J. Schoone, G.J.J.M. Van Eys, C. O. R. Everard, R.A. Hartskeel, and W.J. Terpstra, J. Gen. Microbiol. 139:1691-1700, 1993) have been found to produce complex serovar-specific patterns under low-stringency PCR conditions. Such patterns obtained by low-stringency PCR, which maintain the specific band as an internal control, offer, an approach to the standardized identification of Leptospira serovars in clinical laboratories. Images PMID:8051272

  16. A Primer on Audience Response Systems: Current Applications and Future Considerations

    PubMed Central

    Robinson, Evan


    Audience response systems (ARSs) are an increasingly popular tool in higher education for promoting interactivity, gathering feedback, preassessing knowledge, and assessing students' understanding of lecture concepts. Instructors in numerous disciplines are realizing the pedagogical value of these systems. Actual research on ARS usage within pharmacy education is sparse. In this paper, the health professions literature on uses of ARSs is reviewed and a primer on the issues, benefits, and potential uses within pharmacy education is presented. Future areas of educational research on ARS instructional strategies are also suggested. PMID:19002277

  17. State Bioenergy Primer: Information and Resources for States on Issues, Opportunities, and Options for Advancing Bioenergy

    SciTech Connect

    Byrnett, D. S.; Mulholland, D.; Zinsmeister, E.; Doris, E.; Milbrandt, A.; Robichaud. R.; Stanley, R.; Vimmerstedt, L.


    One renewable energy option that states frequently consider to meet their clean energy goals is the use of biomass resources to develop bioenergy. Bioenergy includes bioheat, biopower, biofuels, and bioproducts. This document provides an overview of biomass feedstocks, basic information about biomass conversion technologies, and a discussion of benefits and challenges of bioenergy options. The Primer includes a step-wise framework, resources, and tools for determining the availability of feedstocks, assessing potential markets for biomass, and identifying opportunities for action at the state level. Each chapter contains a list of selected resources and tools that states can use to explore topics in further detail.

  18. Gunshot residue particles formed by using ammunitions that have mercury fulminate based primers.


    Zeichner, A; Levin, N; Dvorachek, M


    Ammunition having mercury fulminate-based primers are commonly manufactured by Eastern Bloc countries and used extensively in the Middle East. Gunshot residue (GSR) particles formed by firing these types of ammunition were examined. It was observed that much lower percentage of mercury-containing GSR particles were found in samples taken from a shooter as compared to the percentage of such particles in samples from cartridge cases. This fact must therefore be taken into account when interpreting case results. A plausible explanation for the results described is proposed. PMID:1453170

  19. The Use of a Combination of alkB Primers to Better Characterize the Distribution of Alkane-Degrading Bacteria

    PubMed Central

    Jurelevicius, Diogo; Alvarez, Vanessa Marques; Peixoto, Raquel; Rosado, Alexandre S.; Seldin, Lucy


    The alkane monooxygenase AlkB, which is encoded by the alkB gene, is a key enzyme involved in bacterial alkane degradation. To study the alkB gene within bacterial communities, researchers need to be aware of the variations in alkB nucleotide sequences; a failure to consider the sequence variations results in the low representation of the diversity and richness of alkane-degrading bacteria. To minimize this shortcoming, the use of a combination of three alkB-targeting primers to enhance the detection of the alkB gene in previously isolated alkane-degrading bacteria was proposed. Using this approach, alkB-related PCR products were detected in 79% of the strains tested. Furthermore, the chosen set of primers was used to study alkB richness and diversity in different soils sampled in Carmópolis, Brazil and King George Island, Antarctica. The DNA extracted from the different soils was PCR amplified with each set of alkB-targeting primers, and clone libraries were constructed, sequenced and analyzed. A total of 255 alkB phylotypes were detected. Venn diagram analyses revealed that only low numbers of alkB phylotypes were shared among the different libraries derived from each primer pair. Therefore, the combination of three alkB-targeting primers enhanced the richness of alkB phylotypes detected in the different soils by 45% to 139%, when compared to the use of a single alkB-targeting primer. In addition, a dendrogram analysis and beta diversity comparison of the alkB composition showed that each of the sampling sites studied had a particular set of alkane-degrading bacteria. The use of a combination of alkB primers was an efficient strategy for enhancing the detection of the alkB gene in cultivable bacteria and for better characterizing the distribution of alkane-degrading bacteria in different soil environments. PMID:23825163

  20. Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

    PubMed Central

    Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.


    Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

  1. Effects of antibacterial primers with quaternary ammonium and nano-silver on S. mutans impregnated in human dentin blocks

    PubMed Central

    Cheng, Lei; Zhang, Ke; Weir, Michael D.; Liu, Huaibing; Zhou, Xuedong; Xu, Hockin H. K.


    Objectives Recent studies developed antibacterial bonding agents and composites containing a quaternary ammonium dimethacrylate (QADM) and nanoparticles of silver (NAg). The objectives of this study were to investigate: (1) the effect of antibacterial primers containing QADM and NAg on the inhibition of Streptococcus mutans (S. mutans) impregnated into dentin blocks for the first time, and (2) the effect of QADM or NAg alone or in combination, and the effect of NAg mass fraction, on S. mutans viability in dentin. Methods Scotchbond Multi-Purpose (SBMP) bonding agent was used. QADM and NAg were incorporated into SBMP primer. Six primers were tested: SBMP primer control, control + 10% QADM (mass %), control + 0.05% NAg, control + 10% QADM + 0.05% NAg, control + 0.1% NAg, and control + 10% QADM + 0.1% NAg. S. mutans were impregnated into dentin blocks, then a primer was applied. The viable colony-forming units (CFU) were then measured by harvesting the bacteria in dentin using a sonication method. Results Control + 10% QADM + 0.1% NAg had bacteria inhibition zone 8-fold that of control (p < 0.05). The sonication method successfully harvested bacteria from dentin blocks. Control + 10% QADM + 0.1% NAg inhibited S. mutans in dentin blocks, reducing the viable CFU in dentin by three orders of magnitude, compared to control dentin without primer. Using QADM+NAg was more effective than QADM alone. Higher NAg content increased the potency. Dentin shear bond strength was similar for all groups (p > 0.1). Significance Antibacterial primer with QADM and NAg were shown to inhibit the S. mutans impregnated into dentin blocks for the first time. Bonding agent containing QADM and NAg is promising to eradicate bacteria in tooth cavity and inhibit caries. The QADM and NAg may have applicability to other adhesives, cements, sealants and composites. PMID:23422420

  2. Evaluation of a New Primer In Comparison With Microscopy for the Detection of Giardia lamblia Infection in Stool Samples

    PubMed Central

    BAIRAMI, Amir; REZAEI, Sasan; REZAEIAN, Mostafa


    Background: Among the most important parasitic disease, causing diarrhea, Giardia lamblia is noteworthy. Nowadays detection methods for these parasites include parasitological methods such as microscopic examination. The sensitivity of these methods relies on the expertise and experience of examiners. In contrast, molecular methods such as PCR are less dependent on the expertise of the examiner. Here we developed a PCR for the detection of G. lamblia genome in stool samples in comparison with microscopy, which is the gold standard. Methods: For the evaluation of primers, 22 positive samples and 47 negative samples were used. QIAamp DNA Stool Mini Kit (QIAGEN, Germany) was used for DNA extraction from feces. Primers for PCR were designed using Primer-BLAST which uses Primer 3 to designing specific primers (NCBI/Primer-BLAST). Results: Sensitivity of the PCR was done with 100% (95%CI: 84.56–100) for the detection of G. lamblia DNA isolated from patients stool samples which were positive for G. lamblia cysts and/or trophozoites using microscopy as gold standard. In comparison with microscopy, PCR had showed the specificity of 97.87% (95%CI: 88.71–99.95). Conclusion: We designed new primers for the Giardia, and PCR method for the rapid and accurate identification of Giardia parasites established. With consideration to the routine diagnosis techniques in medical parasitology and their limitations such as time consuming, laborious, less sensitivity etc. This G. lamblia PCR is a sensitive and specific application for the diagnosis of G. lamblia and provides us a reliable method in the routine intestinal parasitic infection laboratory diagnosis. PMID:27095964

  3. The effect of resin cements and primer on retentive force of zirconia copings bonded to zirconia abutments with insufficient retention

    PubMed Central

    Kim, Seung-Mi; Yoon, Ji-Young; Lee, Myung-Hyun


    PURPOSE The purpose of this study was to investigate the effect of resin cements and primer on the retentive force of zirconia copings bonded to zirconia abutments with insufficient retention. MATERIALS AND METHODS Zirconia blocks (Lava, 3M ESPE, St. Paul, MN, USA) were obtained and forty sets of zirconia abutments and copings were fabricated using CAD/CAM technology. They were grouped into 4 categories as follows, depending on the types of resin cements used, and whether the primer is applied or not:Panavia F2.0 (P), Panavia F2.0 using Primer (PRIME Plus, Bisco Inc, Schaumburg, IL, USA) (PZ), Superbond C&B (S), and Superbond C&B using Primer (SZ). For each of the groups, the cementation was conducted. The specimens were kept in sterilized water (37℃) for 24 hours. Retentive forces were tested and measured, and a statistical analysis was carried out. The nature of failure was recorded. RESULTS The means and standard deviations of retentive force in Newton for each group were 265.15 ± 35.04 N (P), 318.21 ± 22.24 N (PZ), 445.13 ± 78.54 N (S) and 508.21 ± 79.48 N (SZ). Superbond C&B groups (S & SZ) showed significantly higher retentive force than Panavia F2.0 groups (P & PZ). In Panavia F2.0 groups, the use of primer was found to contribute to the increase of retentive force. On the other hand, in Superbond C&B groups, the use of primer did not influence the retention forces. Adhesive failure was observed in all groups. CONCLUSION This study suggests that cementation of the zirconia abutments and zirconia copings with Superbond C&B have a higher retentive force than Panavia F2.0. When using Panavia F2.0, the use of primer increases the retentive force. PMID:23755347

  4. Effect of silica coating combined to a MDP-based primer on the resin bond to Y-TZP ceramic.


    May, Liliana Gressler; Passos, Sheila Pestana; Capelli, Diana Barca; Ozcan, Mutlu; Bottino, Marco Antonio; Valandro, Luiz Felipe


    The aim of this study was to evaluate the influence of silica coating and 10-methacryloyloxydecyl dihydrogen phosphate (MDP)-based primer applications upon the bonding durability of a MDP-based resin cement to a yttrium stabilized tetragonal zirconia (Y-TZP) ceramic. Ninety-six Y-TZP tabs were embedded in an acrylic resin (free surface for adhesion: 5 × 5 mm(2)), ground finished and randomly divided into four groups (N = 24) according to the ceramic surface conditioning: (1) cleaning with isopropanol (ALC); (2) ALC + phosphoric acid etching + MDP-based primer application (MDP-primer); (3) silica coating + 3-methacryloyloxypropyl trimethoxysilane (MPS)-based coupling agent application (SiO2 + MPS-Sil); and (4) SiO2 + MDP-primer. The MDP-based resin cement was applied on the treated surface using a cylindrical mold (diameter= 3 mm). Half of the specimens from each surface conditioning were stored in distilled water (37 °C, 24 h) before testing. Another half of the specimens were stored (90 days) and thermo-cycled (12,000 x) during this period (90 d/TC) before testing. A shear bond strength (SBS) test was performed at a crosshead speed of 0.5 mm/min. Two factors composed the experimental design: ceramic conditioning strategy (in four levels) and storage condition (in two levels), totaling eight groups. After 90 d/TC (Tukey; p < 0.05), SiO2 + MDP-primer (24.40 MPa) promoted the highest SBS. The ALC and MDP-primer groups debonded spontaneously during 90 d/TC. Bonding values were higher and more stable in the SiO2 groups. The use of MDP-primer after silica coating increased the bond strength. PMID:20690176

  5. Preguntas y respuestas acerca del Estudio del

    El Estudio del Tamoxifeno y Raloxifeno (STAR, por sus siglas en ingls) es un estudio clnico (un estudio de investigacin conducido con voluntarios) diseado para ver cómo el medicamento raloxifeno (Evista) se compara con el medicamento tamoxifeno (Nolvadex)

  6. Simple Heat Treatment of Zirconia Ceramic Pre-Treated with Silane Primer to Improve Resin Bonding.


    Ha, Jung-Yun; Son, Jun Sik; Kim, Kyo-Han; Kwon, Tae-Yub


    Establishing a strong resin bond to dental zirconia ceramic remains difficult. Previous studies have shown that the conventional application of silane does not work well with zirconia. This paper reports that a silane pre-treatment of dental zirconia ceramic combined with subsequent heat treatment has potential as an adhesive cementation protocol for improving zirconia-resin bonding. Among the various concentrations (0.1 to 16 vol%) of experimental γ-methacryloxypropyltrimethoxysilane (γ-MPTS) primers assessed, the 1% solution was found to be the most effective in terms of the shear bond strength of the resin cement to dental zirconia ceramic. A high shear bond strength (approx. 30 MPa) was obtained when zirconia specimens were pre-treated with this primer and then heat-treated in a furnace for 60 min at 150 degrees C. Heat treatment appeared to remove the hydrophilic constituents from the silane film formed on the zirconia ceramic surface and accelerate the condensation reactions between the silanol groups of the hydrolyzed silane molecules at the zirconia/resin interface, finally making a more desirable surface for bonding with resin. This estimation was supported by Fourier transform infrared spectroscopy of the silanes prepared in this study. PMID:26328408

  7. New primer for specific amplification of the CAG repeat in Huntington disease alleles

    SciTech Connect

    Bond, C.E.; Hodes, M.E.


    Huntington disease is an autosomal dominant neurodegenerative disorder caused by an expansion of a CAG trinucleotide repeat near the 5{prime} end of the gene for Huntington disease (IT15). The CAG repeat is flanked by a variable-length CCG repeat that is included in the amplification product obtained with most currently used primer sets and PCR protocols. Inclusion of this adjacent CCG repeat complicates the accurate assessment of CAG repeat length and interferes with the genotype determination of those individuals carrying alleles in the intermediate range between normal and expanded sized. Due to the GC-rich nature of this region, attempts at designing a protocol for amplification of only the CAG repeat have proved unreliable and difficult to execute. We report here the development of a compatible primer set and PCR protocol that yields consistent amplification of the CAG-repeat region. PCR products can be visualized in ethidium bromide-stained agarose gels for rapid screening or in 6% polyacrylamide gels for determination of exact repeat length. This assay produces bands that can be sized accurately, while eliminating most nonspecific products. Fifty-five specimens examined showed consistency with another well-known method, but one that amplifies the CCG repeats as well. The results we obtained also matched the known carrier status of the donors.

  8. A primer for studying cell cycle dynamics of the human hair follicle.


    Purba, Talveen S; Brunken, Lars; Hawkshaw, Nathan J; Peake, Michael; Hardman, Jonathan; Paus, Ralf


    The cell cycle is of major importance to human hair follicle (HF) biology. Not only is continuously active cell cycling required to facilitate healthy hair growth in anagen VI HFs, but perturbations in the cell cycle are likely to be of significance in HF pathology (i.e. in scarring, non-scarring, chemotherapy-induced and androgenic alopecias). However, cell cycle dynamics of the human hair follicle (HF) are poorly understood in contrast to what is known in mouse. The current Methods Review aims at helping to close this gap by presenting a primer that introduces immunohistological/immunofluorescent techniques to study the cell cycle in the human HF. Moreover, this primer encourages the exploitation of the human HF as a powerful and clinically relevant tool to investigate mammalian cell cycle biology in situ. To achieve this, we describe methods to study markers of general 'proliferation' (nuclei count, Ki-67 expression), apoptosis (terminal deoxynucleotidyl transferase dUTP nick-end labelling, cleaved caspase 3), mitosis (phospho-histone H3, 'pS780'), DNA synthesis (5-ethynyl-2'-deoxyuridine) and cell cycle regulation (cyclins) in the human HF. In addition, we provide specific examples of dual immunolabelling for instructive cell cycle analyses and for investigating the cell cycle behaviour of specific HF keratinocyte subpopulations, such as keratin 15+ stem/progenitor cells. PMID:27094702

  9. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    PubMed Central

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie


    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  10. Adventitious match probability for autosomal profiles when primer binding site mutation is possible.


    Pope, Susan; Evett, Ian; Puch-Solis, Roberto


    This paper considers the situation where two DNA systems with differing primers have been used to produce DNA profiles for loading and searching of a DNA Database. With any profiling system there exists the possibility of a "primer binding site mutation" (PBSM). When such a mutation occurs at one of the loci in a profile, it has the effect that the associated allele is not visible in the profile. In the case where a person has two different alleles at a given locus (heterozygous) the effect of a PBSM would be that the profile would appear to be that of an individual with only one allele at that locus (homozygous). The paper investigates the potential for an adventitious match as a result of a PBSM when, for example, a crime profile and person profile that have originated from two different individuals are found to be the same as a result of a PBSM in one of the profiles. It is demonstrated, both by theory and using simulations, that the effect of PBSMs is to slightly decrease the adventitious match probability from what it would had the same DNA system been used. PMID:27420391

  11. Sequence diversity in haloalkane dehalogenases, as revealed by PCR using family-specific primers.


    Kotik, Michael; Faměrová, Veronika


    Haloalkane dehalogenases (HLDs) are hydrolytic enzymes that cleave carbon-halogen bonds in various halogenated compounds. Interest initially grew in HLDs as biocatalysts for bioremediation and later for biotransformation applications; each specific HLD within the HLD family has its own substrate specificity, enantioselectivity and product inhibition characteristics. We developed degenerate oligonucleotide primers for HLD-encoding genes and used these to PCR-amplify large hld gene fragments using genomic DNA from the microbial community of a chlorinated-solvent-contaminated aquifer as a template. An analysis of small subunit ribosomal RNA genes revealed a high complexity in the eubacterial population, dominated by α-, β- and γ-Proteobacteria, and Acidobacteria. Using HLD-family-specific primers, we also retrieved transcribed hld homologues from the microbial consortium of this contaminated site. The DNA-derived hld sequences were phylogenetically broadly distributed over both HLD subclasses I and II. Most hld sequences of the environmental RNA data set clustered in three groups within both HLD subclasses, indicating that a considerable proportion of the microbial consortium carrying hld genes was actively involved in haloalkane dehalogenation. The small sequence variation in hld genes and transcripts within each HLD cluster inferred the presence of a substantial pool of highly related HLD genes. The sequence variability appeared to be unevenly distributed over the HLD genes, however, with no apparent preference for a particular protein segment or domain. PMID:22155739

  12. Evaluation of inorganic zinc-rich primers using Electrochemical Impedance Spectroscopy (EIS)

    NASA Technical Reports Server (NTRS)

    Calle, Luz M.


    This investigation explores the use of Electrochemical Impedance Spectroscopy (EIS) in combination with beach exposure as a short term method for analyzing the performance of twenty-one zinc-rich primers. The twenty-one zinc-rich primers were: Carboline CZ-11, Ameron Devoe-Marine Catha-Coat 304, Briner V-65, Ameron D-21-9, Sherwin Williams Zinc Clad II, Carboline CZ-D7, Ameron D-4, Dupont Ganicin 347WB, Porter TQ-4374H, Inorganic Coatings IC-531, Subox Galvanox IV, Southern Coatings Chemtec 600, Glidden Glidzinc 5530, Byco SP-101, Tnemec 90E-75, Devoe Catha-Coat 302H, Glidden Glidzinc 5536, Koppers 701, Ameron D-21-5, Coronado 935-152, and Subox Galvanoz V. Data were also collected on galvanized steel for comparison purposes. A library of Bode magnitude plots was generated for each coating including curves for the initial time and after each week of atmospheric exposure as Beach Corrosion Test Site near the Space Shuttle launch pad at the Kennedy Space Center for up to three weeks. An examination of the variation of the Bode magnitude plots with atmospheric exposure revealed no clearly identifiable trend at this point that could distinguish between the good and the poor coatings. The test will be continued by including EIS measurements after six months and one year of atmospheric exposure.

  13. Removal of PCR Error Products and Unincorporated Primers by Metal-Chelate Affinity Chromatography

    PubMed Central

    Kanakaraj, Indhu; Jewell, David L.; Murphy, Jason C.; Fox, George E.; Willson, Richard C.


    Immobilized Metal Affinity Chromatography (IMAC) has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and “histidine tags” genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu2+-iminodiacetic acid (IDA) agarose spin column, 94–99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu2+-IDA agarose) can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs. PMID:21264292

  14. Replacing Uridine with 2-Thiouridine Enhances the Rate and Fidelity of Nonenzymatic RNA Primer Extension

    PubMed Central


    The nonenzymatic replication of RNA oligonucleotides is thought to have played a key role in the origin of life prior to the evolution of ribozyme-catalyzed RNA replication. Although the copying of oligo-C templates by 2-methylimidazole-activated G monomers can be quite efficient, the copying of mixed sequence templates, especially those containing A and U, is particularly slow and error-prone. The greater thermodynamic stability of the 2-thio-U(s2U):A base pair, relative to the canonical U:A base pair, suggests that replacing U with s2U might enhance the rate and fidelity of the nonenzymatic copying of RNA templates. Here we report that this single atom substitution in the activated monomer improves both the kinetics and the fidelity of nonenzymatic primer extension on mixed-sequence RNA templates. In addition, the mean lengths of primer extension products obtained with s2U is greater than those obtained with U, augmenting the potential for nonenzymatic replication of heritable function-rich sequences. We suggest that noncanonical nucleotides such as s2U may have played a role during the infancy of the RNA world by facilitating the nonenzymatic replication of genomic RNA oligonucleotides. PMID:25654265

  15. A Comprehensive Analysis of Primer IDs to Study Heterogeneous HIV-1 Populations.


    Seifert, David; Di Giallonardo, Francesca; Töpfer, Armin; Singer, Jochen; Schmutz, Stefan; Günthard, Huldrych F; Beerenwinkel, Niko; Metzner, Karin J


    Determining the composition of viral populations is becoming increasingly important in the field of medical virology. While recently developed computational tools for viral haplotype analysis allow for correcting sequencing errors, they do not always allow for the removal of errors occurring in the upstream experimental protocol, such as PCR errors. Primer IDs (pIDs) are one method to address this problem by harnessing redundant template resampling for error correction. By using a reference mixture of five HIV-1 strains, we show how pIDs can be useful for estimating key experimental parameters, such as the substitution rate of the PCR process and the reverse transcription (RT) error rate. In addition, we introduce a hidden Markov model for determining the recombination rate of the RT PCR process. We found no strong sequence-specific bias in pID abundances (the same RT efficiencies as compared to commonly used short, specific RT primers) and no effects of pIDs on the estimated distribution of the references viruses. PMID:26711506

  16. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    PubMed Central

    Kirkegaard, Rasmus H.; Nielsen, Per H.


    DNA extraction and primer choice have a large effect on the observed community structure in all microbial amplicon sequencing analyses. Although the biases are well known, no comprehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated through metagenomics and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead beating intensity correlated with cell-wall strength as seen by a large increase in DNA from Gram-positive bacteria (up to 400%). However, significant differences were present at lower phylogenetic levels within the same phylum, suggesting that additional factors are at play. The best primer set based on in silico analysis was found to underestimate a number of important bacterial groups. For 16S rRNA gene analysis in activated sludge we recommend using the FastDNA SPIN Kit for Soil with four times the normal bead beating and V1-3 primers. PMID:26182345

  17. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.


    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra


    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification. PMID:18031344

  18. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.


    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B


    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. PMID:26899925

  19. Effect of silane primers and unfilled resin bonding agents on repair bond strength of a prosthodontic microfilled composite.


    Hisamatsu, N; Atsuta, M; Matsumura, H


    This study examined the effect of silane primers and bonding agents on bonding between layers of a light-activated composite material when repaired in the laboratory process. Disk specimens were prepared with the dentin portion of a composite material (Dentacolor DA-30) and abraded with a silicon carbide rotary cutting instrument. The specimens were conditioned with either one of the two silane primers (Porcelain Liner M and Silicer) or one of the two unfilled resin bonding agents (Dentacolor Opaker liquid and New Metacolor Photo Opaque liquid), or one of four combinations of two primers and two bonding agents. An intact surface with a thin air-inhibited unpolymerized layer, and an unprimed surface with only silicone carbide abrasion were also used for references. After placement of the enamel portion of the same brand of composite material (Dentacolor SA-30) on each surface of the dentin material, the specimens were light-exposed, and stored for 24 h in either dry or wet condition. Shear bond strengths were then determined with a mechanical testing device. The results showed that combined use of a silane primer and a bonding agent generally showed the greatest magnitude of bond strength regardless of material variation. The use of an unfilled resin bonding agent after application of a silane primer (Porcelain Liner M) is recommended to ensure adequate repair bonding between layers of the composite material. PMID:12153453

  20. GenoFrag: software to design primers optimized for whole genome scanning by long-range PCR amplification

    PubMed Central

    Ben Zakour, Nouri; Gautier, Michel; Andonov, Rumen; Lavenier, Dominique; Cochet, Marie-Françoise; Veber, Philippe; Sorokin, Alexei; Le Loir, Yves


    Genome sequence data can be used to analyze genome plasticity by whole genome PCR scanning. Small sized chromosomes can indeed be fully amplified by long-range PCR with a set of primers designed using a reference strain and applied to several other strains. Analysis of the resulting patterns can reveal the genome plasticity. To facilitate such analysis, we have developed GenoFrag, a software package for the design of primers optimized for whole genome scanning by long-range PCR. GenoFrag was developed for the analysis of Staphylococcus aureus genome plasticity by whole genome amplification in ∼10 kb-long fragments. A set of primers was generated from the genome sequence of S.aureus N315, employed here as a reference strain. Two subsets of primers were successfully used to amplify two portions of the N315 chromosome. This experimental validation demonstrates that GenoFrag is a robust and reliable tool for primer design and that whole genome PCR scanning can be envisaged for the analysis of genome diversity in S.aureus, one of the major public health concerns worldwide. PMID:14704339

  1. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    PubMed Central

    Frank, Daniel N


    Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at . PMID:19874596

  2. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.


    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  3. Relaxed Primer Specificity Associated with Reverse Transcriptases Encoded by the pFOXC Retroplasmids of Fusarium oxysporum

    PubMed Central

    Simpson, E. Barry; Ross, Shannon L.; Marchetti, Sarah E.; Kennell, John C.


    The pFOXC mitochondrial retroplasmids are small, autonomously replicating linear DNAs that have a telomere-like repeat of a 5-bp sequence at their termini. The plasmids are possible evolutionary precursors of the ribonucleoprotein complex telomerase, as they encode an active reverse transcriptase (RT) that is involved in plasmid replication. Using an in vitro system to study reverse transcription, we show that the pFOXC RT is capable of copying in vitro-synthesized RNAs by use of cDNA primers or extension of snapped-back RNA templates. The ability of the pFOXC RT to use base-paired primers distinguishes it from the closely related RTs encoded by the Mauriceville and Varkud mitochondrial retroplasmids of Neurospora spp. Reaction products are similar, but not identical, to those obtained with conventional RTs, and differences reflect the ability of the pFOXC RT to initiate cDNA synthesis with loosely associated primers. The pFOXC RT can also copy DNA templates and extend 3′ mismatched DNA oligonucleotide primers. Analysis of pFOXC in vivo replication intermediates suggests that telomeric repeats are added during reverse transcription, and the ability to extend loosely associated primers could play a role in repeat formation by mechanisms similar to those associated with telomerase and certain non-long-terminal-repeat retrotransposons. PMID:15590832

  4. An electrochemical study of corrosion protection by primer-topcoat systems on 4130 steel with ac impedance and dc methods

    NASA Technical Reports Server (NTRS)

    Mendrek, M. J.; Higgins, R. H.; Danford, M. D.


    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac impedance method is applied to six systems of primer coated and primer topcoated 4130 steel. Two primers were used: a zinc-rich epoxy primer and a red lead oxide epoxy primer. The epoxy-polyamine topcoat was used in four of the systems. The EG and G-PARC Model 368 ac impedance measurement system, along with dc measurements with the same system using the polarization resistance method, were used to monitor changing properties of coated 4230 steel disks immersed in 3.5 percent NaCl solutions buffered at pH 5.4 over periods of 40 to 60 days. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for the resistors and capacitors, that can be assigned in the equivalent circuit following a least-squares analysis of the data, describe changes that occur on the corroding metal surface and in the protective coatings. Two equivalent circuits have been determined that predict the correct Bode phase and magnitude of the experimental sample at different immersion times. The dc corrosion current density data are related to equivalent circuit element parameters. Methods for determining corrosion rate with ac impedance parameters are verified by the dc method.

  5. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples

    PubMed Central


    Background Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Results Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. Conclusions A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry. PMID:26681335

  6. An approach to delineate primers for a group of poorly conserved sequences incorporating the common motif region.


    Sahu, Mousumi; Sahu, Jagajjit; Sahoo, Smita; Dehury, Budheswar; Sarma, Kishore; Sarmah, Ranjan; Sen, Priyabrata; Modi, Mahendra Kumar; Barooah, Madhumita


    Glutathione synthetase (gshB) has previously been reported to confer tolerance to acidic soil condition in Rhizobium species. Cloning the gene coding for this enzyme necessitates the designing of proper primer sets which in turn depends on the identification of high quality sequence similarity in multiple global alignments. In this experiment, a group of homologous gene sequences related to gshB gene (accession no: gi-86355669:327589-328536) of Rhizobium etli CFN 42, were extracted from NCBI nucleotide sequence databases using BLASTN and were analyzed for designing degenerate primers. However, the T-coffee multiple global alignment results did not show any block of conserved region for the above sequence set to design the primers. Therefore, we attempted to identify the location of common motif region based on multiple local alignments employing the MEME algorithm supported with MAST and Primer3. The results revealed some common motif regions that enabled us to design the primer sets for related gshB gene sequences. The result will be validated in wet lab. PMID:22419837

  7. Prevalencia y tamizaje del Trastorno por Déficit de Atención con Hiperactividad en Costa Rica

    PubMed Central

    Weiss, Nicholas T.; Schuler, Jovita; Monge, Silvia; McGough, James J.; Chavira, Denise; Bagnarello, Monica; Herrera, Luis Diego; Mathews, Carol A.


    Resumen La investigación tuvo como propósito estimar la prevalencia del Trastorno por Déficit de Atención con Hiperactividad (TDAH) en Costa Rica y determinar si la versión en español del cuestionario Swanson Nolan and Pelham Scale IV (SNAP-IV) es un instrumento de tamizaje útil en una población de niños y niñas escolares costarricenses. El instrumento fue entregado a padres y maestros de 425 niños entre 5 y 13 años de edad (promedio = 8.8). Todos fueron evaluados con el instrumento Swanson, Kotkin, Agler, M-Flynn and Pelham Scale (SKAMP). Su diagnóstico fue confirmado con una entrevista clínica. La sensibilidad y la especificidad del SNAP-IV fueron evaluadas como predictores de criterios de diagnóstico según el DSM-IV. La prevalencia puntual en la muestra del TDAH fue del 5%. El tamizaje más preciso lo hizo el SNAP-IV completado por el maestro en un corte de 20%, con una sensibilidad de 96% y una especificidad de un 82%. La sensibilidad de los instrumentos completados por los padres fue más baja que aquella de los maestros. El SNAP-IV completado por las maestras con un corte aislando el 20% de los mayores puntajes categorizó correctamente a un 87% de los sujetos. PMID:22432094

  8. Yeast Ty1 retrotransposon: the minus-strand primer binding site and a cis-acting domain of the Ty1 RNA are both important for packaging of primer tRNA inside virus-like particles.

    PubMed Central

    Wilhelm, M; Wilhelm, F X; Keith, G; Agoutin, B; Heyman, T


    Reverse transcription of the yeast retrotransposon Ty1 is primed by the cytoplasmic initiator methionine tRNA (tRNA(iMet)). The primer tRNA(iMet) is packaged inside virus-like particles (VLPs) and binds to a 10 nucleotides minus-strand primer binding site, the (-)PBS, complementary to its 3' acceptor stem. We have found that three short sequences of the Ty1 RNA (box 1, box 2.1 and box 2.2) located 3' to the (-)PBS are complementary to other regions of the primer tRNA(iMet) (T psi C and DHU stems and loops). Reconstitution of reverse transcription in vitro with T7 transcribed Ty1 RNA species and tRNA(iMet) purified from yeast cells shows that the boxes do not affect the efficiency of reverse transcription. Thus the role of the boxes on packaging of the primer tRNA(iMet) into the VLPs was investigated by analysing the level of tRNA(iMet) packaged into mutant VLPs. Specific nucleotide changes in the (-)PBS or in the boxes that do not change the protein coding sequence but disrupt the complementarity with the primer tRNA(iMet) within the VLPs. We propose that base pairing between the primer tRNA(iMet) and the Ty1 RNA is of major importance for tRNA(iMet) packaging into the VLPs. Moreover the intactness of the boxes is essential for retrotransposition as shown by the transposition defect of a Ty1 element harboring an intact (-)PBS and mutated boxes. Images PMID:7527135

  9. Il problema del litio.

    NASA Astrophysics Data System (ADS)

    D'Antona, F.


    Contents: 1. Introduzione. 2. La nucleosintesi del Big Bang. 3. Il litio nelle stelle di popolazione II. 4. I modelli stellari standard. 5. Il litio negli ammassi aperti. 6. Meccanismi di distruzione "non standard". 7. I modelli non-standard applicati alla popolazione II. 8. L'evoluzione Galattica del litio. 9. Quali stelle producono litio? 10. Il litio come elemento chiave per dare un nome agli oggetti stellari più minuscoli. 11. Conclusioni.

  10. Espectroscopia del Cometa Halley

    NASA Astrophysics Data System (ADS)

    Naranjo, O.; Fuenmayor, F.; Ferrin, L.; Bulka, P.; Mendoza, C.


    Se reportan observaciones espectroscópicas del cometa Halley. Los espectros fueron tomados usando el espectrógrafo del telescopio reflector de 1 metro del Observatorio Nacional de Venezuela. Se utilizó óptica azul, con una red de difracción de 600 lineas/min, obteniéndose una dispersión de 74.2 A/mm y una resolución de 2.5 A, en el rango espectral de 3500 a 6500 A. Seis placas fueron tomadas con emulsión IIa-O y dos con IIa-D. Los tiempos de exposición fueron entre 10 y 150 minutos. El cometa se encontraba entre 0.70 y 1.04 UA del Sol, y entre 1.28 y 0.73 UA de la Tierra. Las emisiones más prominentes en el espectro, son las del CN, C2, y C3. Otras emisiones detectadas corresponden a CH, NH2 y Na. Los espectros muestran un fuerte continuo, indicando un contenido significativo de polvo. Se detectó mayor intensidad del contínuo, en la dirección anti solar, lo cual es evidencia de la cola de polvo.

  11. easyPAC: A Tool for Fast Prediction, Testing and Reference Mapping of Degenerate PCR Primers from Alignments or Consensus Sequences

    PubMed Central

    Rosenkranz, David


    The PCR-amplification of unknown homologous or paralogous genes generally relies on PCR primers predicted from multi sequence alignments. But increasing sequence divergence can induce the need to use degenerate primers which entails the problem of testing the characteristics, unwanted interactions and potential mispriming of degenerate primers. Here I introduce easyPAC, a new software for the prediction of degenerate primers from multi sequence alignments or single consensus sequences. As a major innovation, easyPAC allows to apply all customary primer test procedures to degenerate primer sequences including fast mapping to reference files. Thus, easyPAC simplifies and expedites the designing of specific degenerate primers enormously. Degenerate primers suggested by easyPAC were used in PCR amplification with subsequent de novo sequencing of TDRD1 exon 11 homologs from several representatives of the haplorrhine primate phylogeny. The results demonstrate the efficient performance of the suggested primers and therefore show that easyPAC can advance upcoming comparative genetic studies.

  12. A Degenerate Primer MOB Typing (DPMT) Method to Classify Gamma-Proteobacterial Plasmids in Clinical and Environmental Settings

    PubMed Central

    de la Cruz, Fernando


    Transmissible plasmids are responsible for the spread of genetic determinants, such as antibiotic resistance or virulence traits, causing a large ecological and epidemiological impact. Transmissible plasmids, either conjugative or mobilizable, have in common the presence of a relaxase gene. Relaxases were previously classified in six protein families according to their phylogeny. Degenerate primers hybridizing to coding sequences of conserved amino acid motifs were designed to amplify related relaxase genes from γ-Proteobacterial plasmids. Specificity and sensitivity of a selected set of 19 primer pairs were first tested using a collection of 33 reference relaxases, representing the diversity of γ-Proteobacterial plasmids. The validated set was then applied to the analysis of two plasmid collections obtained from clinical isolates. The relaxase screening method, which we call “Degenerate Primer MOB Typing” or DPMT, detected not only most known Inc/Rep groups, but also a plethora of plasmids not previously assigned to any Inc group or Rep-type. PMID:22792321

  13. HIV-1 reverse transcriptase specifically interacts with the anticodon domain of its cognate primer tRNA.

    PubMed Central

    Barat, C; Lullien, V; Schatz, O; Keith, G; Nugeyre, M T; Grüninger-Leitch, F; Barré-Sinoussi, F; LeGrice, S F; Darlix, J L


    The virion cores of the replication competent type 1 human immunodeficiency virus (HIV-1), a retrovirus, contain and RNA genome associated with nucleocapsid (NC) and reverse transcriptase (RT p66/p51) molecules. In vitro reconstructions of these complexes with purified components show that NC is required for efficient annealing of the primer tRNALys,3. In the absence of NC, HIV-1 RT is unable to retrotranscribe the viral RNA template from the tRNA primer. We demonstrate that the HIV-1 RT p66/p51 specifically binds to its cognate primer tRNALys,3 even in the presence of a 100-fold molar excess of other tRNAs. Cross-linking analysis of this interaction locates the contact site to a region within the heavily modified anti-codon domain of tRNALys,3. Images PMID:2479543

  14. Microsatellite primers for Parkia biglobosa (Fabaceae: Mimosoideae) reveal that a single plant sires all seeds per pod1

    PubMed Central

    Lassen, Kristin Marie; Kjær, Erik Dahl; Ouédraogo, Moussa; Nielsen, Lene Rostgaard


    • Premise of the study: Microsatellite primers were developed for an indigenous fruit tree, Parkia biglobosa, as a tool to study reproductive biology and population structure. Here we use the primers to determine the number of fathers per pod. • Methods and Results: Microsatellite loci were enriched in a genomic sample and isolated using pyrosequencing. Eleven primer pairs were characterized in two populations of P. biglobosa in Burkina Faso (each with 40 trees). The number of alleles per locus ranged from eight to 15, and one locus had null alleles. We genotyped seeds from 24 open-pollinated pods. The genotypic profiles of seeds per pod suggest that all seeds are outcrossed and that only one pollen donor sires all ovules in a single fruit. • Conclusions: Ten microsatellite markers were highly polymorphic. All seeds per pod of P. biglobosa were full siblings. The markers will be useful for reproductive and population genetic studies. PMID:25202634

  15. Surface characterization of Ti and Ti (6 percent, Al-4 percent, V) metal powders and interaction with primer solutions

    NASA Technical Reports Server (NTRS)

    Siriwardane, R. V.; Wightman, J. P.


    The interaction of Ti and Ti 6-4 powders with water and primer solutions was investigated experimentally by measuring the heats of immersion. Similar comparative studies were made on anatase and rutile TiO2 powders. The surface oxide layers of Ti and Ti 6-4 cracked on heating in vacuum between 300 and 400 C as evidenced by high heats of immersion in both water and primer solutions. Polyimide and polyphenylquinoxaline interacted preferentially, compared with the solvents with both metal powders after outgassing at room temperature. The heats of immersion of Ti 6-4 in water, solvents, and primer solutions increased significantly after pretreatment of the powder by an alkaline etch and a phosphate-fluoride process. The TiO2 powders were not satisfactory models for the surface oxide layer on either Ti or Ti 6-4 powder.

  16. Strain-Specific Identification of Probiotic Lactobacillus rhamnosus with Randomly Amplified Polymorphic DNA-Derived PCR Primers

    PubMed Central

    Tilsala-Timisjärvi, Anu; Alatossava, Tapani


    In the present work, strain-specific PCR primers for Lactobacillus rhamnosus Lc 1/3 are described. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. They were screened for specificity by hybridization with DNA from 11 L. rhamnosus strains. A 613-bp RAPD marker found to be strain-specific was sequenced, and a primer pair specific to L. rhamnosus Lc 1/3 was constructed based on the sequence. The primer pair was tested with 11 Lactobacillus species and 11 L. rhamnosus strains and was found to be strain specific. The nucleotide sequence of the specific RAPD marker was found to contain part of a protein encoding region which showed significant similarity to several transposases for insertion sequence elements of various bacteria, including other lactic acid bacterium species. PMID:9835567

  17. Cloning murine antibody V-genes with non-degenerate primers and conversion to a recombinant antibody format.


    Bialon, Magdalena; Schellenberg, Ludmila; Herzog, Nicolas; Kraus, Stefan; Jörißen, Hannah; Fischer, Rainer; Stein, Christoph; Nähring, Jörg; Barth, Stefan; Püttmann, Christiane


    Monoclonal antibodies are produced in cultured hybridoma cell lines, but these cells tend to be unstable; it is therefore necessary to rescue the corresponding genetic information. Here we describe an improved method for the amplification of antibody variable gene (V-gene) information from murine hybridoma cells using a panel of specific, non-degenerate primers. This primer set allows sequences to be rescued from all murine V-genes, except the lambda light chain genes, which rarely contribute to murine immune diversity. We tested the primers against a range of antibodies and recovered specific amplification products in all cases. The heavy and light chain variable regions were subsequently joined by a two-step cloning strategy or by splice overlap extension PCR. PMID:25545205

  18. Methods for detection and differentiation of existing and new crinivirus species through multiplex and degenerate primer RT-PCR.


    Wintermantel, William M; Hladky, Laura L


    A method was developed for rapid identification and differentiation of both known and novel crinivirus species involving both multiplex and degenerate reverse transcription-polymerase chain reaction (RT-PCR). The multiplex method can discriminate among known criniviruses infecting vegetable and small fruit crops, and rapidly identify viruses associated with disease symptoms, as well as identification of mixed crinivirus infections. Four host groups for multiplex detection of criniviruses were selected based on the types of crops where specific criniviruses would be expected to occur. Each detection group contained three to four crop-specific primers designed to the same region of the gene encoding the highly conserved RNA-dependent RNA polymerase gene (RdRp) of criniviruses for rapid, single-reaction determination of which crinivirus(es) may be infecting a plant. Degenerate reverse primers used for RT and in PCR were designed to amplify all members of each host group, and were coupled with species-specific forward primers resulting in four separate single-reaction cocktails for detection of most criniviruses sequenced to date, whether present in single or mixed virus infections. Additional viruses can be added to multiplex detection by adjustment of primer concentration for balanced detection of target viruses. In order to identify unknown putative criniviruses or those for which sequence information is not yet available, a genus-wide, universal degenerate primer set was developed. These primers also targeted the crinivirus RdRp gene, and amplify a wide range of crinivirus sequences. Both detection systems can be used with most RNA extraction methods, and with RT-PCR reagents common in most laboratories. PMID:20833203

  19. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.


    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk


    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  20. PCR Primers to Study the Diversity of Expressed Fungal Genes Encoding Lignocellulolytic Enzymes in Soils Using High-Throughput Sequencing

    PubMed Central

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia


    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the