Sample records for del primer programa

  1. Infórmese sobre el programa de WIFIA

    EPA Pesticide Factsheets

    La Ley de finanzas e innovación de la infraestructura del agua de 2014 estableció el programa de WIFIA, un programa federal crediticio administrado por la EPA para proyectos elegibles de infraestructura de agua y aguas sanitarias.

  2. Obtenga más información sobre la etiqueta Safer Choice

    EPA Pesticide Factsheets

    Entérese más acerca del programa EPA Diseño para el medio ambiente, incluyendo información sobre su historia, proyectos anteriores y otros programas de la EPA que están relacionados con este programa.

  3. Vigilando la Calidad del Agua de los Grandes Rios de la Nacion: El Programa NASQAN del Rio Grande (Rio Bravo del Norte)

    USGS Publications Warehouse

    Lurry, Dee L.; Reutter, David C.; Wells, Frank C.; Rivera, M.C.; Munoz, A.

    1998-01-01

    La Oficina del Estudio Geologico de los Estados Unidos (U.S. Geological Survey, 0 USGS) ha monitoreado la calidad del agua de la cuenca del Rio Grande (Rio Bravo del Norte) desde 1995 como parte de la rediseiiada Red Nacional para Contabilizar la Calidad del Agua de los Rios (National Stream Quality Accounting Network, o NASOAN) (Hooper and others, 1997). EI programa NASOAN fue diseiiado para caracterizar las concentraciones y el transporte de sedimento y constituyentes quimicos seleccionados, encontrados en los grandes rios de los Estados Unidos - incluyendo el Misisipi, el Colorado y el Columbia, ademas del Rio Grande. En estas cuatro cuencas, el USGS opera actualmente (1998) una red de 40 puntos de muestreo pertenecientes a NASOAN, con un enfasis en cuantificar el flujo en masa (la cantidad de material que pasa por la estacion, expresado en toneladas por dial para cada constituyente. Aplicacando un enfoque consistente, basado en la cuantificacion de flujos en la cuenca del Rio Grande, el programa NASOAN esta generando la informacion necesaria para identificar fuentes regionales de diversos contaminantes, incluyendo sustancias qui micas agricolas y trazas elementos en la cuenca. EI efecto de las grandes reservas en el Rio Grande se puede observar segun los flujos de constituyentes discurren a 10 largo del rio. EI analisis de los flujos de constituyentes a escala de la cuenca proveera los medios para evaluar la influencia de la actividad humana sobre las condiciones de calidad del agua del Rio Grande.

  4. Manual del McVCO 1999

    USGS Publications Warehouse

    McChesney, P.J.

    1999-01-01

    El McVCO es un generador de frecuencias basado en un microcontrolador que reemplaza al oscilador controlado por voltaje (VCO) utilizado en telemetría analógica de datos sísmicas. Acepta señales de baja potencia desde un sismómetro y produce una señal subportadora modulada en frecuencia adecuada para enlaces telefónicos o vía radio a un lugar remoto de recolección de datos. La frecuencia de la subportadora y la ganancia pueden ser seleccionadas mediante un interruptor. Tiene la opción de poder operar con dos canales para la observación con ganancia alta y baja. El McVCO fue diseñado con el propósito de mejorar la telemetría analógica de las señales dentro de la Pacific Northwest Seismograph Network (PNSN) (Red Sismográfica del Noroeste del Pacífico). Su desarrollo recibió el respaldo del Programa de Geofísica de la Universidad de Washington y del "Volcano Hazards and Earthquake Hazards programs of the United States Geological Survey (USGS) (Programa de Investigaciones de Riesgos Volcánicos y Programa de Investigaciones de Riesgos Sísmicos de los EEUU). Cientos de instrumentos se han construido e instalado. Además de utilizarlo el PNSN, el McVCO es usado por el Observatorio Vulcanológico de Alaska para monitorear los volcanes aleutianos y por el USGS Volcano Disaster Assistance Program (Programa de Ayuda en las Catástrofes Volcánicas del USGS) para responder a crisis volcánicas en otros países. Este manual cubre el funcionamiento del McVCO, es una referencia técnica para aquellos que necesitan saber con más detalle cómo funciona el McVCO, y cubre una serie de temas que requieren un trato explícito o que derivan del despliegue del instrumento.

  5. Iniciativas escolares y deportivas lideradas desde la Fédération Internationale de Football Association (FIFA): revisión sistemática.

    PubMed

    Correa, Jorge E; Meneses-Echávez, José F; Barengo, Noël C; Tovar, Gustavo; Ruiz-Castellanos, Erika; Lobelo, Felipe; Ramírez-Vélez, Robinson

    2015-09-01

    Introducción: Los programas iniciados por la Fédération Internationale de Football Association (FIFA) consisten en la difusión de mensajes relacionados con el cuidado de la salud y como estrategia de prevención de lesiones deportivas entre los niños y jóvenes. El objetivo de esta revisión sistemática fue resumir los resultados de la implementación de los programas "FIFA 11 para la salud" y "FIFA 11+". Métodos: Se realizó una búsqueda sistemática en las bases de datos electrónicos de MEDLINE, EMBASE y Scopus, identificando los estudios que evaluaran la implementación de los programas "FIFA 11 para la salud" y "FIFA 11+", durante los últimos 10 años (1 enero 2003 a 1 diciembre 2013). Resultados: Incluimos 17 estudios. Dos estudios evaluaron la implementación del programa "FIFA 11 para la salud" y encontraron un aumento significativo en el conocimiento de los mensajes de promoción de la salud; 15 estudios evaluaron los efectos del programa "FIFA 11+", reportando una reducción en el riesgo de lesiones deportivas y mejorías en el rendimiento deportivo. Discusión: Los programas "FIFA 11 para la salud" y "FIFA 11+" han demostrado resultados positivos para la salud, en el ámbito escolar y deportivo. Conclusiones: Dichos programas del FIFA representan una oportunidad para crear hábitos protectores y fomentar modos de vida saludables en niños y jóvenes.

  6. Analisis del contenido curricular de los Documentos Normativos del Programa de Ciencias en el area de biologia para la escuela superior del sistema de educacion publica de Puerto Rico: 1993-2012

    NASA Astrophysics Data System (ADS)

    Davila Montanez, Melissa

    Esta investigacion de naturaleza cualitativa se ocupo de realizar un analisis de contenido documental de los Documentos Normativos del Programa de Ciencias en el area de biologia de la escuela superior del sistema de educacion publica de Puerto Rico del periodo 1993-2012. Los documentos analizados fueron: Guia Curricular, 1995; Marco Curricular, 2003; Estandares de Excelencia, 1996, 2000 y Estandares de Contenido y Expectativas de Grado, 2007. Se indago si hubo cambios en significados en los Componentes Estructurales: Naturaleza de la ciencia, Paradigmas para la ensenanza de la ciencia, Funcion del curriculo formal, Mision de la ensenanza de la ciencia; Contenidos, destrezas y competencias, Estrategias de ensenanza y Evaluacion/Assessment del aprendizaje. El analisis sugiere que no hubo cambios sustanciales en los significados de los Componentes Estructurales. Los documentos estudiados muestran mayormente caracteristicas similares, aunque los documentos mas recientes eran mas descriptivos, explicativos y especificos.

  7. Resumen del programa de WIFIA

    EPA Pesticide Factsheets

    Hojas informativas sobre el programa de WIFIA que acelera la inversión en la infraestructura de agua de nuestro país proporcionando préstamos a largo plazo y de bajo costo para proyectos considerables a nivel tanto regional como nacional.

  8. Energia Renovable para Centros de Salud Rurales (Renewable Energy for Rural Health Clinics) (in Spanish)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jimenez, T.; Olson, K.

    Esta es la primera de una serie de guias de aplicaciones que el Programa de Energia de Villas de NREL esta comisionando para acoplar sistemas comerciales renovables con aplicaciones rurales, incluyendo agua, escuelas rurales y micro empresas. La guia esta complementada por las actividades de desarrollo del Programa de Energia de Villas de NREL, proyectos pilotos internacionales y programas de visitas profesionales.

  9. REFORZANDO LAS CAPACIDADES EN INVESTIGACIÓN EN INFORMÁTICA PARA LA SALUD GLOBAL EN LA REGIÓN ANDINA A TRAVÉS DE LA COLABORACIÓN INTERNACIONAL

    PubMed Central

    Curioso, Walter H.; García, Patricia J.; Castillo, Greta M.; Blas, Magaly M.; Perez-Brumer, Amaya; Zimic, Mirko

    2011-01-01

    RESUMEN Para mejorar la salud global y bienestar de una población se requiere de recursos humanos capacitados, no solo en el campo de la medicina y salud, sino también en el campo de la informática. Desafortunadamente, los programas de entrenamiento e investigación en informática biomédica en países en desarrollo son escasos y poco documentados. El objetivo del presente trabajo es reportar los resultados del primer Taller Internacional de Expertos en Informática para la región andina que se llevó a cabo en marzo de 2010 en Lima y que incluye la descripción de nueve casos de estudio procedentes de instituciones de América Latina. En el taller participaron 23 expertos latinoamericanos, quienes discutieron la necesidad de entrenamiento e investigación multidisciplinaria en informática biomédica en áreas prioritarias para América Latina. Además, se estableció la Red QUIPU debido a la necesidad de ampliar y consolidar una red de investigación y entrenamiento a nivel regional y global. PMID:21152740

  10. Calidad del aire interior en las escuelas

    EPA Pesticide Factsheets

    EPA ha desarrollado el Programa de Herramientas de Calidad del Aire Interior para las Escuelas para reducir la exposición a los contaminantes ambientales en las mismas a través de la adopción voluntaria de las prácticas para manejar la calidad del aire int

  11. Sistemas de transporte inteligentes en cruces fronterizos internacionales : un estudio abarcador : facilitando el comercio y mejorando la seguridad en el transporte

    DOT National Transportation Integrated Search

    2001-04-01

    El Programa de Permisosen Fronteras Internacionales (IBC por sus siglas en ingls) fue iniciado bajo la previsin del Acta de Eficiencia de Transporte Terrestre Intermodal (ISTEA por sus siglas en ingls) en 1991. El programa fue concebido origina...

  12. PubMed

    Serrano-Guzmán, María; Valenza-Peña, Carmen M; Serrano-Guzmán, Carmen; Aguilar-Ferrándiz, Encarnación; Olmedo-Alguacil, Milagrosa; Villaverde-Gutiérrez, Carmen

    2016-11-29

    Objetivo: este estudio tuvo como objetivo probar la eficacia de un programa de danzaterapia en la composición corporal y calidad de vida en mujeres mayores de 65 años, que no realizan ejercicio físico de forma habitual. Métodos: cincuenta y dos mujeres sedentarias (edad media de 69,27 ± 3,85 años) fueron asignadas al azar para realizar un programa de danzaterapia (n = 27) o formar parte del grupo control (n = 25). El grupo de danza, participó durante ocho semanas en un programa de danza, tres sesiones semanales de 50 minutos cada una, basado en danza popular española (sevillanas) y ballet. Ambos grupos reciben información sobre la importancia de la alimentación y del ejercicio físico al comienzo y mitad del estudio. La circunferencia de la cintura, la presión arterial, el índice de masa corporal y la calidad de vida se evaluaron al inicio y después del tratamiento en ambos grupos. El análisis estadístico se realizó con un 2 × 2 ANOVA.Resultados: las mujeres del grupo de danza mostraron reducción significativa de la circunferencia de la cintura (p = 0,001) en comparación con las del grupo control. Los cambios en el IMC y la calidad de vida, aunque mejoraron en el grupo de danza, no alcanzaron significación estadística. Conclusión: la danzaterapia española es una forma de ejercicio físico eficaz para reducir la grasa visceral y prevenir comorbilidades en mujeres mayores, contribuyendo a cambiar estilos de vida poco saludables.

  13. Diseño de un programa basado en la promoción del desarrollo positivo en la infancia para la prevención temprana de la violencia en Colombia.

    PubMed

    Hernández Holguín, Dora M; Páez Zapata, Esteban; Múnera Restrepo, Laura M; Duque Ramírez, Luis F

    2017-03-01

    Aunque algunos informes identifiquen a Colombia como ejemplo de un país que ha logrado revertir los niveles crecientes de violencia, estos siguen siendo altos. Por este motivo se han convocado acciones de promoción de la convivencia y prevención de la violencia, a las cuales responde el programa que presentamos en este artículo. Este programa está basado en la perspectiva contextual-evolutiva del modelo ecológico y en la educación para la salud, tendiente al cuidado de sí en los padres o cuidadores, y al ejercicio de una crianza, centrada en los derechos de los niños, el desarrollo infantil y la promoción de la salud mental, con el fin de promover el desarrollo saludable y prevenir comportamientos agresivos en los niños; éste es presentado como una alternativa de orientación psicosocial para el fortalecimiento de estrategias y programas dirigidos a la primera infancia.

  14. Measurement and evaluation of national family planning programs.

    PubMed

    Mauldin, W P

    1967-03-01

    RESUMEN: En los últimos quince años diez paises han inaugurado programas nacionales de planeamiento familiar: India, Pakistán, Corea del Sur, Taiwan, Turquía, Malasia, Ceilán, Túez, la República Arabe Unida, y Marruecos. Otros paises, incluyendo Tailandia, Hong Kong, Singapur, Kenya, Barbados, Trinidad y los Estados Unidos, apoyan y/o estimulan actividades de planeamiento familiar. En la mayor parte de los casos la razón fundamental del programa ha sido que si la tasa de crecimiento poblacional disminuyera, aumentaría la tasa de crecimiento económico.Las metas de largo alcance, expresadas típicamente en términos de reducir las tasa.de de natalidad o de crecimiento, tienen su ejemplo en el propósito de Pakistán de reducir su tasa de crecimiento a 26 para 1970; el de Corea de reducir su tasa de natalidad a 20 para 1971; y el de India de reducir su tasa de natalidad a 25 para 1973.Los objectivos intermedios, que cubren diversos aspectos del pro grama, incluyen metas específicas para un determinado mes a año, considerando personal, la adquisición de anticonceptivos, y el número de usarios por método. Las metas específicas anuales de aceptantes de dispositivos intrauterinos (IUD), para Taiwán, Corea, Túnez, Pakistán e India, son comunes, tanto por la naturaleza del artefacto, como por la facilidad de medición de los que continúan utilizándolos. El programa de evaluación en Taiwán, que trata de medir por diversos medios los efectos inmediatos, mediatos y de largo plazo del programa de planeamiento familiar sirve de modelo. El propósito de la evaiuación de un programa de planeamiento familiar es contribuir a la efectividad y eficiencia del programa, midiendo y analizando su progreso. Las áreas a medir pueden ser clasificadas como- (1) conocimiento acerca de; (2) actitudes hacia; (3) práctica de control de natalidad; y (4) nivel de fecundidad.Un buen sistema de evaluación debería incluir: A. Un buen conjunto de estadísticas de servicio presentadas en formularios estandarizados, en las siguienies formas: 1. Informes nensuales por áreas administrativas, sobre los actuales servicios de planeamiento familiar proporcionados en la actualidad, de carácter permanente o de larga duración (al presente, esterilización y IUD de acuerdo a las siguientes características del receptor: residencia, edad, paridad (número de hijos vivos por sexo), y donde se enteró del programa, si es posible "clase";(probablemente educación de la madre, pero posiblemente ocupación del esposo, ingreso, o equivalente); prácticas anticonceptivas anteriores; intervalo; y deseo de tener más hijos. En un programa grande estos datos pueden obtenerse en base a una muestra. 2. Informes mensuales sobre la distribución de suministros anticonceptivos (condones, píldoras, sustancias efervescentes, etc.), los primeros suministros deben ir acompañados de un registro de las características del recipiente, como anteriormente; los suministros subsecuentes se regietrarán sólo en volumen bruto. Esto también se aplicará al ritmo, donde éste método se enseñe a un número considerable de mujeres. 3. Informes regulares sobre las actividades de planeamiento familiar de médicos privados, como una estimación del efecto catalítico del programa del gobierno sobre ci sector privado. 4. Datos generates mensuales, ppr áreas admirtistrativas importantes, sabre: visitas domiciliarias, reuniones, cuñas radiates y televisadas, avisos en los periódicos y personal que trabaja. 5. Para propósitos de seguimiento una entrevi eta de campo cada 6 a 12 meses a cada N mujer de las listas para (1) y (2) arriba, en un total de 300 o 400, para conocer las tasas de continuación y las razones de abandono (ej: desea otro hijo, insatisfecha can ci método, otras). Las mue.stras podrían ser de 300 cada una, con una supuesta experiencia de 6, 12, 18 y 24 meses. B. Un buen conjunto de datos sobre costa (datos sobre cotos actulaes atribuíbles directamente al programa de planeamiento familiar) fraccionados par áreas principales y cinco a seis categorías de costos importantes tales coma: adminietración, personal de campo, publicidad, suministros, etc. C. Un buen conjunto de dates globales sobre la distribución de los suministros comerciales que puedan llegar tan cerca como sea posible del último consumidor, to cual significa probablemente obtener información de los mayoristas. D. Una encuesta de conocimientos, actitudes y prácticas (KAP) para una evaluación general cada dos años. Las preguntas básicas (además de las antes mencionadas y estatus marital y étnico cuando sea pertinente) son: actitud hacia e interés por la anticoncepción, número de niños por sexo, deseo de tener más hijos, prácticas anticonceptivas, experiencia sobre abortos, tal vez historia de embarazo (especialmente si esta producirá una tasa de fecundidad válida), aprobación del programa gubernamental (para uso politico), y si está actualmente embarazada (la única y mejor pregunta cuya respuesta habla del efecto sobre la tasa de natalidad). Administrativamente, la responsabilidad por la evalucion debe estar cerca al director, se debe tomar provisiones para obtener informes regulares (meneulaes) y especiales dirigidos a preguntar sobre política. El corolario es que el jefe de evaluación debe tener la confianza del director y debe estar al día en cuanto a las decisiones sabre la politics a seguir. Su trabajo consiste en extractar los aspectos principales que funcionan bien y los no operantes. En cuanto a costos, la evaluación debe hacerse sobre no más del 10 par ciento del costa del programa en paises pequeños (de menos de 30 milliones) y sabre no más del 5 per ciento en paises más grandes.Para medir en que forma el programa satisface el criterio final-la magnitud en que cambia la fecundidad-se debe realizar un trabajo más elaborado en el centro (Universidades, Consejos de población, etc.) para desarrollar una forma (a formas) segura de traducir las estadísticas de servicio en práticas y tal vez aún datos sobre suministro comercial en datos sabre tasas de natalidad. Esto incluye, par ejemplo, los esfuerzos para consolidar observaciones coma "cinco años-mujer de usa de IUD, a 400 condones equivalen a la prevención de un nacimiento," y esfuerzos como los de Pakistán de calcular tasas coma "años de protección de una pareja contra el embarazo."In the belief that a decrease in the rate of population growth will increase economic development, more than ten countries have inaugurated family planning programs in the past fifteen years. To provide a model for measuring the immediate, intermediate, and long-term effects of any such program, the authors use the Taiwan evaluation.The model suggests that a good system of evaluation should include monthly statistics on (1) participants, who are grouped by characteristics; (2) the distribution of supplies, reported at first by the characteristics of recipients, but after by gross volume only; (3) family planning activities of private physicians to measure the catalytic effect on the private sector; (4) new contacts and amount of advertising in mass media; (5) costs broken down by areas and by cost categories; and (6) distribution of commercial supplies. In addition, the program should conduct 300-400 interviews every 6-12 months to learn the rates of continuation and the rates and reasons for discontinuation. Finally, a KAP survey should be conducted every two years.The administration of the evaluation should be close to the director for policy decisions and for the ultimate work of evaluation-the finding of new ways to measure the main goal of change in fertility by the translation of statistics on Services provided and commercial supplies into birth rate data.

  15. Efecto del Programa de Entrenamiento “Manejo del Dolor” en la Documentación de Enfermería en el Expediente Electrónico

    PubMed Central

    Monsiváis, María Guadalupe Moreno; Guzmán, Ma. Guadalupe Interial; Flores, Paz Francisco Sauceda; Arreola, Leticia Vázquez

    2012-01-01

    Resumen En el presente trabajo se muestra la importancia de entrenar al personal de enfermería para mejorar la documentación en el expediente electrónico. Se eligió el manejo del dolor por ser un área prioritaria; una alta proporción de pacientes en período post operatorio cursa con dolor, por lo tanto, la documentación debe ser útil para la toma de decisiones clínicas. Se implementó un programa de entrenamiento denominado “Manejo del Dolor” dirigido al personal de enfermería. Se utilizó la tecnología de la información como herramienta para fortalecer el conocimiento con base en la revisión sistemática de la literatura; el personal de enfermería participante seleccionó la mejor evidencia; posteriormente se trabajó en la transferencia de este conocimiento a la práctica a través del diseño de un protocolo para el manejo del dolor. Se concluye que el conocimiento del manejo del dolor es fundamental para que enfermería documente con mayor precisión sus intervenciones. PMID:24199106

  16. Breast Cancer Epidemiology in Puerto Rico

    DTIC Science & Technology

    2013-06-30

    Universidad de Puerto Rico Recinto de Ciencias Medicas Escuela Graduada de Salud Publica Apartado postal 365067, San Juan, Puerto Rico 00936-5067... Ciencias Medicas. Este proyecto recibe fondos del Programa de Investigacion de Cancer de Mama, bajo el mecanismo de Donativo para Adiestramiento en...minimo. Una enfermera adiestrada del Consorcio de Investigacion Clinica y Traslacional del Recinto de Ciencias Medicas (PRCTRC) tomara estas muestras

  17. Home Delivery Medicament Program: access, inactivity and cardiovascular risk.

    PubMed

    Araújo, Roque da Silva; Arcuri, Edna Apparecida Moura; Lopes, Victor Cauê

    2016-10-10

    to verify causes of inactivity in the Home Delivery Medicament Program, as referred by users from a Primary Health Care Service in São Paulo, comparing them to the causes registered in the program and analyzing them in the theoretical model Concept of Access to Health. cross-sectional study, interviewing 111 inactive users; and documentary study in the program records. half of the users did not know the condition of inactivity. Discrepancies were found between the user's and the program's information, observing different levels of agreement: Absence of physician and administrative staff member 0%; Transfer to other service 25%; Death 50%; Option to quit 50%; Address change 57% and Change in therapeutic schedule 80%. The users' feeling of accepting the program was observed. In the health access concept, inactivity can be explained in the information dimension, in the degree of asymmetry between the patient's and the health professional's knowledge, identified through the indicators: education, knowledge and information sources. due to the low education level, the user does not assimilate the information on the steps of the program flowchart, does not return for the assessment that guarantees its continuity. Consequently, (s)he stops receiving the medication and spends a long time without treatment, increasing the cardiovascular risk of hypertensive (92% of the sample), diabetic (44%) and dyslipidemic patients (31%). verificar causas de inatividade no Programa Remédio em Casa, referidas por usuários de Unidade Básica de Saúde de São Paulo, comparando-as às registradas pelo programa e analisando-as no modelo teórico Conceito de Acesso à Saúde. estudo transversal entrevistando 111 usuários inativos; e documental, nos registros do programa. metade dos usuários desconhecia a condição de inatividade. Constatadas discrepâncias nas informações usuário versus programa, observando-se diferentes níveis de concordância: Falta de médico e funcionário administrativo 0%; Transferência para outra unidade 25%; Óbito 50%; Opção desistir 50%; Mudança de endereço 57% e Mudança de esquema terapêutico 80%. Observados sentimentos de aceitação do programa pelos usuários. No conceito de acesso à saúde, a inatividade pode ser explicada na dimensão Informação, no grau de assimetria entre o conhecimento do paciente e do profissional de saúde, identificada pelos indicadores: escolaridade, conhecimento e fontes de informação. devido ao baixo nível de escolaridade, o usuário não assimila as informações sobre as etapas do fluxograma do programa, não retorna para a avaliação que garante sua continuidade. Consequentemente, para de receber medicamentos e permanece longo tempo sem tratamento, o que aumenta o risco cardiovascular dos hipertensos (92% da amostra), diabéticos (44%) e dislipidêmicos (31%). verificar causas de inactividad en el Programa Medicamento en Casa, referidas por usuarios de Unidad Básica de Salud de São Paulo, comparándolas a las registradas por el programa y analizándolas en el modelo teórico Concepto de Acceso a la Salud. estudio trasversal entrevistando 111 usuarios inactivos; y documental, en los registros del programa. la mitad de los usuario desconocía la condición de inactividad. Constatadas discrepancias en las informaciones usuario versus programa, observándose diferentes niveles de concordancia: Falta de médico y funcionario administrativo 0%; Trasferencia para otra unidad 25%; Óbito 50%; Opción desistir 50%; Cambio de dirección 57% y Cambio de esquema terapéutico 80%. Observados sentimientos de aceptación del programa por los usuarios. En el concepto de acceso a la salud, la inactividad puede ser explicada en la dimensión Información, en el grado de asimetría entre el conocimiento del paciente y del profesional de salud, identificada por los indicadores: escolaridad, conocimiento y fuentes de información. debido al bajo nivel de escolaridad, el usuario no asimila las informaciones sobre las etapas del diagrama de flujo del programa, no regresa para la evaluación que garantiza su continuidad. Consecuentemente, deja de recibir medicamentos y sigue largo tiempo sin tratamiento, lo que aumenta el riesgo cardiovascular de los hipertensivos (92% de la muestra), diabéticos (44%) y dislipidémicos (31%).

  18. Teorí­as de primer y segundo orden sobre el potencial de ciertas figuras de equilibrio de cuerpos celestes

    NASA Astrophysics Data System (ADS)

    Gumbau, Manuel Forner

    2010-11-01

    Uno de los problemas que aborda la Mecánica Celeste es la determinación de las figuras de equilibrio de los cuerpos celestes. Para investigar su solución mediante métodos directos, se precisa evaluar el potencial generado por su autogravitación, el generado por su fuerza centrí­fuga y el generado por la fuerza de atracción entre los cuerpos. Los métodos clásicos de Finlay y Kopal que afrontan estos problemas, para determinar el potencial autogravitatorio en las configuraciones de equilibrio, emplean desarrollos en serie de los potenciales interior y exterior del potencial autogravitatorio. Estos métodos incurren en el error de suponer la convergencia en capas donde resulta cuestionable dicha convergencia para estos desarrollos en serie. En este trabajo se han elaborado unos algoritmos que contemplan toda la casuí&stica y que permiten una manipulación efic iente del producto de polinomios de Legendre, del producto de funciones asociada s de Legendre y del producto de armónicos esféricos como combinacióon lineal de ellos mismos, respectivamente. Se han obtenido, para primer y segundo orden en las amplitudes, los desarrollos correctos para los potencial es interior y exterior del potencial autogravitatorio para configuraciones de equilibrio aisladas, y , en primer orden de amplitudes, los mismos potenciales para los sistemas binarios próximos. Se ha elaborado un método analítico, en primer orden respecto de las amplitudes, para la determinación del potencial de marea en sistemas binarios próximos en el cual se manifiesta la forma de la componente secundaria del sistema

  19. Manual de control de calidad del Inventario Forestal Nacional (IFN) [Quality control manual of the National Forest Inventory (NFI)

    Treesearch

    P. Barbosa; F. Herrera; S. Goeking; V. Nieto; M. Pena; S. Ortiz

    2014-01-01

    El Inventario Forestal Nacional de Colombia (IFN) incluye un programa de Aseguramiento de Calidad (AC) para garantizar la confiabilidad de todos los datos recogidos y generados en la etapa de muestreo. El objetivo de este programa; es proporcionar un marco que asegure que la información compilada acerca de los bosques es completa, exacta, imparcial y de calidad...

  20. [Not Available].

    PubMed

    Vizuet Vega, Norma Isela; Shamah Levy, Teresa; Gaona Pineda, Elsa Berenice; Cuevas Nasu, Lucía; Méndez Gómez-Humarán, Ignacio

    2016-07-19

    Introducción: la anemia es un factor de riesgo en la población infantil con consecuencias graves para su crecimiento y desarrollo. Los programas de ayuda alimentaria pueden contribuir a su prevención y control. Objetivo: estudiar la adherencia al consumo de suplementos y su relación con la prevalencia de anemia en niños menores de tres años de edad en San Luis Potosí, México beneficiarios del programa PROSPERA.Métodos: se realizó un análisis comparativo en niños de 12 a 36 meses que consumen diferentes suplementos alimenticios: 414 pertenecientes al grupo de intervención y 334 al de comparación. Se midió la hemoglobina (Hb) por Hemocue clasificando como anémicos a quienes tuvieron valores <110 g/l. Se aplicaron pruebas de t de Student y X2. Se estimaron efectos de intervención mediante el método de diferencias en diferencias y un puntaje de adherencia al consumo de suplementos.Resultados: al final del estudio la prevalencia de anemia disminuyó 11.2 pp en el grupo de intervención y 8.7 pp en el de comparación; la interacción del puntaje de adherencia por suplemento y etapa de observación mostró que la adherencia al consumo de Bebida láctea + Vitaniño reduce el riesgo de presentar anemia (p = 0,14). El consumo de Nutrisano + Vitaniño se asoció con menor riesgo (0,2), ambos con respecto al consumo de Nutrisano.Conclusiones: el programa PROSPERA tuvo efectos importantes en la disminución de las prevalencias de anemia. Se recomienda llevar a cabo acciones para mejorar la adherencia al consumo de suplementos alimenticios, a fIn de mejorar la efectividad de los programas.

  1. Primer registro para Peru del genero Nielsonia Young, 1977 (Hemiptera: Cicadellidae: Cicadellinae: Cicadellini)

    USDA-ARS?s Scientific Manuscript database

    En este articulo se reporta por primera vez para el Peru una especies del genero Nielsonia Young, 1977, de material procedente del Departamento de Tumbes. El genero ha sido reportada anteriormente de Ecuador, como unico registro para Sudamerica, y America Central. El unico especimen hembra encontra...

  2. Efectos combinados de la ampliación de la atención primaria de salud y de las transferencias condicionadas de dinero en efectivo sobre la mortalidad infantil en Brasil, 1998–2010*

    PubMed Central

    Guanais, Frederico C.

    2015-01-01

    Objetivos. Examiné los efectos combinados del acceso a la atención primaria mediante el Programa de Salud Familiar (PSF) y las transferencias condicionadas de dinero en efectivo del Programa Bolsa Familia (PBF) sobre la mortalidad infantil posneonatal (MIPN) en Brasil. Métodos. Empleé un análisis ecológico longitudinal usando datos en panel de 4 583 municipios brasileños de 1998 al 2010, con 54 253 observaciones en total. Estimé modelos de regresión de efectos fijos por mínimos cuadrados ordinarios, con la tasa de MIPN como la variable dependiente y el PSF, el PBF y sus interacciones como las principales variables independientes de interés. Resultados. La asociación de una mayor cobertura del PSF con una menor tasa de MIPN se volvió más fuerte conforme aumentaba la cobertura del PBF. En los promedios de todas las demás variables, cuando la cobertura de PBF era 25%, la MIPN predicha fue 5,24 (intervalo de confianza [IC] de 95% = 4,95, 5,53) para una cobertura del PSF de 0%, y de 3,54 (IC de 95% = 2,77, 4,31) para una cobertura del PSF de 100%. Cuando la cobertura del PBF era de 60%, la MIPN predicha fue 4,65 (IC de 95% = 4,36, 4,94) para una cobertura del PSF de 0%, y de 1,38 (IC de 95% = 0,88, 1,89) para una cobertura del PSF de 100%. Conclusiones. El efecto del PSF depende de la ampliación del PBF. Para las poblaciones empobrecidas y subatendidas, la combinación de intervenciones tanto del lado de la oferta como del lado de la demanda podría ser necesaria para mejorar los resultados en salud.

  3. Relative Militarization and Its Impact on Public Policy Budgetary Shifts in Argentina, 1963-1982

    DTIC Science & Technology

    1988-07-01

    and Z.T. de Quinteros (1981), "El programa de es- tabilizaci6n economica y las politicas de salud y bienestar social 1976- 1980." Cuadernos Medico...Canitrot, A. (1980), "La disciplina como objetivo de la politica ec6nomica. Un ensayo sobre el programa econ6mico del gobierno Argentino desde 1976...Politicas Estatales en America Latina: Hacia una estrategia de investigaci6n." Buenos Aires: Documento CEDES/G. E. CLACSO/N .4. ’ Oszlak, 0. (1977

  4. Estilo de Liderazgo de Maestros y Maestras de Salud Escolar del Nivel Secundario en la Implantacion del Programa de Educacion en Salud Escolar en Puerto Rico

    ERIC Educational Resources Information Center

    Rosario Arroyo, Luis Antonio

    2012-01-01

    Health education school programs have a planned activity structure that focus on developing awareness on the need of keeping an adequate integral health, through the teaching and learning processes within an appropriate methodological context that promotes students full development. It is expected that school health teachers are effective leaders;…

  5. La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

    NASA Astrophysics Data System (ADS)

    Arroyo Betancourt, Luz I.

    Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las participantes basado en lo que estas manifestaron en su practica didactica. Dos maestras coinciden en una vision constructivista social de la construccion del conocimiento, del aprendizaje y de los metodos didacticos. La otra manifesto una vision constructivista piagetiana en el aprendizaje, los metodos didacticos y en la construccion del conocimiento. Se espera que este trabajo, ademas de promover los estudios de caso sobre el enfoque constructivista de ensenanza en el contexto puertorriqueno, sirva para que los maestros, que estan transformando su enfoque educativo de uno tradicional a uno constructivista, tengan una vision mas clara de la implantacion de este enfoque. Se espera ademas que sirva para que el Departamento de Educacion y sus programas de adiestramiento y readiestramiento en servicio, asi como las universidades y sus programas de preparacion de maestros, tomen en cuenta los resultados y recomendaciones de este estudio al revisar sus programas.

  6. PubMed

    Ávila García, Manuel; Huertas Delgado, Francisco Javier Huertas Delgado; Tercedor Sánchez, Pablo

    2016-11-29

    Introducción: España es el tercer país europeo con mayor prevalencia de obesidad infantil, dando lugar a la aparición de programas de intervención destinados a fomentar hábitos alimentarios saludables y/o de actividad física (AF).Objetivo: el propósito de esta revisión sistemática fue conocer aquellos programas de intervención para la promoción de hábitos alimentarios y de AF desarrollados en escolares españoles de Educación Primaria (EP) y analizar la influencia que han tenido las intervenciones sobre la composición corporal, los hábitos alimentarios y la AF.Método: se revisaron los artículos publicados entre los años 2000 y 2015 en las siguientes bases de datos: Web of Science, Scopus, Dialnet, PubMed, Eric, Sportdiscus y Psycinfo por dos revisores independientes.Resultados: se contabilizaron un total de 813 artículos, de los cuales tras la eliminación de duplicados (192), lectura de títulos y resumen (587) y lectura del texto completo (17), tan solo 7 cumplieron con los criterios de inclusión.Conclusiones: los programas de intervención analizados mostraron cambios positivos en la mejora de la composición corporal en algo menos de la mitad de los estudios analizados; por otro lado, casi todos los programas de intervención analizados tuvieron un efecto positivo sobre conductas respecto a ciertos hábitos alimentarios, como la ingesta de frutas, y sobre el incremento del nivel de AF.

  7. PROGRAMA PARA LA VERIFICACION DE LA TECNOLOGIA AMBIENTAL - CULTIVANDO ASOCIACIONES PARA EL INCREMENTO DE LAS SELECCIONES DE TECNOLOGIAS AMBIENTALES A LOS SECTORES PUBLICO Y PRIVADO EN LOS ESTADOS UNIDOS Y EN EL EXTERIOR (EPA/600/F-97/005A)

    EPA Science Inventory

    La meta del ETV es verificar, a travs de una
    evaluacin de informacin objectiva y de calidad, las caracteristicas del desempeo de tecnologas
    comerciales ambientales. As el ETV proporciona a
    los compradores y los licenciadores potenciales una valoracin imparcial y creble d...

  8. DOE Office of Scientific and Technical Information (OSTI.GOV)

    None

    Por encargo del Secretario Abraham, la Oficina de Eficiencia Energética y Energía Renovable suministra el liderazgo a nivel nacional para impulsar las tecnologías de eficiencia energética y energía renovables, para saltar por encima de las limitaciones del status quo, y para alcanzar beneficios ambientales notables. El Programa de Tecnologías Geotérmicas, parte crítica de nuestro esfuerzo conjunto, está avanzando a grandes zancadas para aumentar la viabilidad y el despliegue de electricidad ...

  9. Our Roots Feed Our Future: 30th Anniversary Conference of the Cornell Migrant Program. Presentations (May 22, 2002) = Nuestras raices nutren nuestro futuro: Conferencia del 30mo aniversario del Programa para Emigrantes de Cornell. Presentaciones (22 mayo 2002).

    ERIC Educational Resources Information Center

    State Univ. of New York, Ithaca. Coll. of Human Ecology at Cornell Univ.

    Presented in English and Spanish, this publication compiles 13 presentations at a conference celebrating the 30th anniversary of the Cornell Migrant Program. The entries examine experiences of migrant workers and children related to immigrating, finding work, enduring discrimination and police harassment, switching schools frequently, suffering…

  10. [Barriers and Facilitators in the Recruitment and Retention of Heterosexual Couples for Preventive Interventions.

    PubMed

    Hernández-Hernández, Alberto L; Perez-Jimenez, David

    2010-01-01

    El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes.

  11. Eight years of bioethics

    PubMed Central

    Moreno-Exebio, Luis

    2012-01-01

    Este trabajo presenta la experiencia que significó el paso por el Programa Internacional de Formación en Ética de la investigación biomédica y psicosocial del Centro Interdisciplinario de Estudios en Bioética de la Universidad de Chile (2003–2004) y algunas reflexiones respecto de la integración de lo aprendido en mi posterior labor en comités de ética y programas académicos de ética de investigación. Asimismo, en la elaboración de regulaciones que permitan una mejor evaluación ética y científica. PMID:23172984

  12. Sistema Planeta-Satélite. Simulación orbital y potenciales gravitatorios

    NASA Astrophysics Data System (ADS)

    Medina, C.; Carrillo, M.

    Se presenta un programa (desarrollado en Quick Basic 4.5) que simula, en tres dimensiones, el movimiento orbital de un satélite (o luna) alrededor de un planeta, al tiempo que calcula y grafica, en un plano, el potencial gravitatorio del sistema en función de la distancia al planeta. Para la simulación orbital, se emplea la matriz de transformación entre el sistema del planeta y el plano orbital. Para el cálculo y graficación del potencial se aplica un desarrollo en serie hasta el segundo orden, que da cuenta del efecto de achatamiento de los polos, en caso de que éste exista. Las longitudes de los ejes del planeta, la masa de éste y del satélite, sus tamaños aparentes, y los parámetros orbitales son introducidos por el usuario.

  13. ¿Qué está haciendo la EPA para proteger a los arrecifes de coral?

    EPA Pesticide Factsheets

    La EPA protege a los arrecifes de coral mediante la implementación de programas de la Ley de Agua Limpia que protegen la calidad del agua en cuencas y zonas costeras de las áreas con arrecifes de coral.

  14. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto indefinido y al gen para la proteina de la DNA polimerasa en otros virus herpes. Se encontraron tres o cuatro grupos de iniciadores especificos para el virus vacunal y para el 100% (7/7) de los a??slamientos de campo, pero no amplificaron el DNA del virus de hepatitis por cuerpos de inclusi??n de grullas. Se analiz?? la especificidad de un primer juego de iniciadores con moldes del genoma de otros virus herpes aviares, incluyendo el ?!guila dorada, ?!guila de cabeza blanca, lechuza de cuernos grandes, lechuza blanca, halc??n peregrino, palomas, aves psit?!cidas y pollos (virus de laringotraqueitis infecciosa), pero no se produjeron los productos finales. Por lo tanto, esta prueba de reacci??n en cadena por la polimerasa es altamente especifica para el DNA del virus. Dos grupos de iniciadores fueron capaces de detectar un fragmento de DNA de la cepa vacunal equivalente a cinco copias del genoma. Adem?!s, se determin?? que la proporci??n de la dosis infecciosa en cultivo celular y copias del genoma del virus vacunal de c??lulas de embri??n de pato infectadas era de 10 a 100 respectivamente, haciendo la prueba de la reacci??n en cadena por la polimerasa 20 veces m?!s sensible que el cultivo celular para detectar el virus. La velocidad, sensibilidad y especificidad de la prueba de la reacci??n en cadena por la polimerasa suministra una herramienta de investigaci??n y de diagn??stico altamente mejorada para el estudio de la epizootiolog?-a del virus.

  15. PubMed

    Valero Gaspar, Teresa; Del Pozo de la Calle, Susana; Ruiz Moreno, Emma; Ávila Torres, Osé Manuel; Varela-Moreiras, Gregorio; Cuadrado Vives, Carmen

    2016-11-29

    Introducción: a finales del siglo xx, no se conocía con precisión si la comida del comedor escolar contribuía adecuadamente a la dieta de la población infantil. Además, este servicio complementario no se contemplaba en el proyecto educativo del centro pese a considerarse fundamental en todas sus dimensiones.Objetivo: describir el origen y desarrollo del programa de comedores escolares de la Comunidad de Madrid (CM) en 15 años desde su implantación.Métodos: se elaboró una normativa a cumplir por las empresas de restauración, y que contemplaba aspectos nutricionales y de composición y variedad de los menús, que se utilizó en los concursos para acceder a la prestación del servicio de comedor escolar, publicados en los años 2001, 2002, 2005, 2009 y 2013. Además se realizaron visitas acreditadas a los centros sin previo aviso para verifi car el cumplimiento de la documentación aportada durante el concurso.Resultados: los criterios más actuales sobre programación y elaboración de menús escolares se recogen en el Pliego de Prescripciones Técnicas del año 2013 (C-504/001-2013). Un 92% de las empresas de restauración superaron los cinco concursos habidos en los 15 años de funcionamiento. Hasta el año 2014, se han realizado 755 visitas, revisándose un total de 574 centros.Conclusiones: el programa de comedores escolares de la CM, desde su implementación pionera en España, ha contribuido a la mejora del servicio complementario de comedor. En estos años se han ido incluyendo nuevos requisitos dietéticos y nutricionales que han logrado menús cada vez más ajustados a las recomendaciones de la población escolar.

  16. Barreras y Facilitadores en el Reclutamiento y la Retención de Parejas Heterosexuales en Intervenciones Preventivas en VIH/SIDA

    PubMed Central

    Hernández-Hernández, Alberto L.; Perez-Jimenez, David

    2012-01-01

    Compendio El Reclutamiento y la Retención (R&R) de participantes es fundamental para el éxito de estudios y para el desarrollo de intervenciones preventivas. El R&R de participantes determina la validez y efectividad de estos programas. En este trabajo examinamos algunos de los factores que facilitan y dificultan el R&R en los proyectos preventivos y ofrecemos algunas alternativas para mejorar los índices de R&R. Realizamos dos estudios, en el primero administramos el Instrumento de Informatión, Motivatión y Conductas-Español (IIMC-E) a un grupo de 26 parejas heterosexuales (52 participantes). En el segundo, entrevistamos a 5 parejas VIH discordantes (10 participantes). Encontramos que el 75% de los/las participantes indicó que su trabajo era una de las principales barreras que dificultan la asistencia a las actividades. Otras barreras son las responsabilidades laborales y familiares. Encontramos que la principal barrera fue el miedo a la revelación del estado serlógico. Los principales facilitadores del R&R son la coordinación adecuada y el seguimiento telefónico ofrecido por parte del personal del proyecto. Concluimos que en el desarrollo e implantación de programas de prevención el investigador/a debe tomar en cuenta la adaptación de aspectos logísticos como la disponibilidad y las necesidades particulares de los/las participantes. PMID:23264700

  17. Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

    PubMed

    Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

    2010-06-01

    Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

  18. Viviremos! On the Road to Healthy Living: A Bilingual Curriculum on AIDS and HIV Prevention for Migrant Students (Grades 6-12) = El Camino Hacia la Salud: Un Programa de Estudio Bilingue sobre la Prevencion del SIDA y del VIH para Estudiantes Migrantes (Grados 6-12).

    ERIC Educational Resources Information Center

    VAMOS (Villarreal Analytical Management and Organizational Services), San Marcos, TX.

    This curriculum provides the basic information everyone needs to avoid HIV infection, but was specifically designed for Latino farmworker students in grades 6-7. The student materials are written in Spanish and English and may be used with older student or young adults, or in English-as-a-second-language courses. An introduction provides…

  19. PROGRAMA PARA LA VERIFICACIN DE LA TECNOLOGIA AMBIENTAL/ENVIRONMENTAL TECHNOLOGY VERIFICATION PROGRAM (ETV) (EPA/600/F-98/015A)

    EPA Science Inventory

    A travs de su historia, la Agencia de Proteccin del Medio Ambiente estadounidense (U.S. Environmental Protection Agency, EPA) ha evaluado distintas tecnologas para determinar su efectividad en el monitoreo, la prevencin, el control, y la limpieza de la contaminacin ambiental. Sin...

  20. EL PROGRAMA CITI: UNA ALTERNATIVA PARA LA CAPACITACIÓN EN ÉTICA DE LA INVESTIGACIÓN EN AMÉRICA LATINA

    PubMed Central

    Litewka, Sergio; Goodman, Kenneth; Braunschweiger, y Paul

    2011-01-01

    El Programa CITI (Collaborative Institutional Training Initiative) es un curso basado en Internet y desarrollado por voluntarios, que brinda material educacional sobre protección de sujetos humanos en investigaciones biomédicas y de conducta, buenas prácticas clínicas, conducta responsable de la investigación y trato humanitario a animales de laboratorio. Es un esfuerzo conjunto del Fred Hutchinson Cancer Research Center y la Universidad de Miami. Con la colaboración de expertos locales, gran parte del contenido se ha adaptado para América Latina, se ha traducido al español y portugués y se han establecido acuerdos de colaboración con instituciones especializadas en bioética en Chile, Brasil, Costa Rica y Perú. Los autores presentan una metodología accesible para la capacitación en ética de la investigación y una justificación de su uso y difusión en América Latina PMID:21687817

  1. Implementación de un modelo de capacitación multimedial para brindar orientación alimentaria a los beneficiarios de un programa de ayuda social en México.

    PubMed

    Amaya-Castellanos, Maritza Alejandra; Morales-Ruan, María Del Carmen; Uribe-Carvajal, Rebeca; Jiménez-Aguilar, Alejandra; Salazar-Coronel, Araceli Apolonia; Martínez-Tapia, Brenda; Shamah-Levy, Teresa

    2018-03-01

    Introducción: Se implementó un modelo de capacitación en orientación alimentaria para la población beneficiaria y el personal operativo del Programa de Abasto Rural (PAR) de Diconsa, el cual es una iniciativa social de ayuda alimentaria que abastece productos básicos y complementarios, además de brindar capacitación en localidades de alta marginación en México. Objetivo: Documentar la utilización de la Metodología de Capacitación Multimedial (MCM) en el desarrollo de un esquema de capacitación sobre orientación alimentaria y su implementación en la población beneficiaria del PAR, a través de la propia estructura operativa del PAR. Metodología: El modelo se fundamenta en la MCM, integrada por cuatro elementos didácticos e indivisibles que conforman el paquete pedagógico multimedial (PPM), compuesto a su vez por tres videos y rotafolios, material impreso, prácticas y las relaciones interpersonales. Los ejes temáticos fueron: alimentación correcta para una vida saludable, alimentación materno-infantil, elecciones saludables y gasto familiar. El modelo fue replicado en cascada en los tres niveles operativos del PAR (responsables de capacitación, supervisores operativos y beneficiarios del PAR), con un componente de multiplicación horizontal, e implementado como piloto en cuatro estados de México. Resultados: Se observó un cambio positivo sobre los conocimientos en alimentación correcta en todos los niveles de capacitación, principalmente en los beneficiarios del PAR. La evaluación del proceso mostró conocimientos previos de los responsables de capacitación en los temas, buen desempeño como facilitadores, y habilidades de presentación y manejo del grupo de los supervisores operativos. A partir de las evaluaciones y del acompañamiento en la prueba piloto, fueron modificados las actividades, las estrategias y los materiales educativos del PPM. Conclusiones: La capacitación multimedial y la educación nutricional promueven procesos de cambio y desarrollo comunitario, posibles a través de la toma de conciencia y la puesta en práctica de acciones que favorecen la salud.

  2. Development of quality control procedures for mass produced and released Bactrocera Philippinensis (Diptera: Tephritidae) for sterile insect technique programs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Resilva, S.; Obra, G.; Zamora, N.

    Quality control procedures for Bactrocera philippinensis Drew and Hancock 1994 (Diptera: Tephritidae) used in sterile insect technique (SIT) programs were established in the mass rearing facility at the Philippine Nuclear Research Institute. Basic studies on pupal irradiation, holding/packaging systems, shipping procedures, longevity, sterility studies, and pupal eye color determination in relation to physiological development at different temperature regimes were investigated. These studies will provide baseline data for the development of quality control protocols for an expansion of B. philippinensis field programs with an SIT component in the future. (author) [Spanish] Los procedimientos de control de calidad para Bactrocera philippinensis Drewmore » y Hancock 1994 (Diptera: Tephritidae) usados en programas de la tecnica de insecto esteril (TIE) fueron establecidos en la facilidad de cria en masa del Instituto Filipino de Investigacion Nuclear. Estudios basicos sobre la irradiacion de las pupas, sistemas de almacenaje/empaque, procedimientos del envio, longevidad, estudios de esterilidad y la determinacion del color de ojo de la pupa en relacion con el desarrollo fisiologico en regimenes diferentes de temperatura fueron investigados. Estos estudios proveeran una linea de informacion basica para el desarrollo de protocolos de control de calidad para una expansion de los programas de campo para B. philippinensis con un componente de TIS en el futuro. (author)« less

  3. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    PubMed

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M; McClean, Phillip E

    2014-01-01

    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate.

  4. Developing market class specific InDel markers from next generation sequence data in Phaseolus vulgaris L.

    PubMed Central

    Moghaddam, Samira Mafi; Song, Qijian; Mamidi, Sujan; Schmutz, Jeremy; Lee, Rian; Cregan, Perry; Osorno, Juan M.; McClean, Phillip E.

    2013-01-01

    Next generation sequence data provides valuable information and tools for genetic and genomic research and offers new insights useful for marker development. This data is useful for the design of accurate and user-friendly molecular tools. Common bean (Phaseolus vulgaris L.) is a diverse crop in which separate domestication events happened in each gene pool followed by race and market class diversification that has resulted in different morphological characteristics in each commercial market class. This has led to essentially independent breeding programs within each market class which in turn has resulted in limited within market class sequence variation. Sequence data from selected genotypes of five bean market classes (pinto, black, navy, and light and dark red kidney) were used to develop InDel-based markers specific to each market class. Design of the InDel markers was conducted through a combination of assembly, alignment and primer design software using 1.6× to 5.1× coverage of Illumina GAII sequence data for each of the selected genotypes. The procedure we developed for primer design is fast, accurate, less error prone, and higher throughput than when they are designed manually. All InDel markers are easy to run and score with no need for PCR optimization. A total of 2687 InDel markers distributed across the genome were developed. To highlight their usefulness, they were employed to construct a phylogenetic tree and a genetic map, showing that InDel markers are reliable, simple, and accurate. PMID:24860578

  5. Impacto del Seguro Popular en el gasto catastrófico y de bolsillo en el México rural y urbano, 2005–2008

    PubMed Central

    Sosa-Rubí, Sandra G; Salinas-Rodríguez, Aarón; Galárraga, Omar

    2016-01-01

    Objetivo Estimar el efecto del Seguro Popular (SP) sobre la incidencia del gasto catastrófico en salud (GCS) y sobre el gasto de bolsillo en salud (GBS) en el mediano plazo. Material y métodos Con base en la Encuesta de Evaluación del Seguro Popular (2005–2008), se analizaron los resultados del efecto del SP en la cohorte rural para dos años de seguimiento (2006 y 2008) y en la cohorte urbana para un año (2008). Resultados A nivel conglomerado no se detectaron efectos del SP. A nivel hogar se encontró que el SP tiene un efecto protector en el GCS y en el GBS en consulta externa y hospitalización en zonas rurales; y efectos significativos en la reducción de GBS en consulta externa en zonas urbanas. Conclusiones El SP se muestra como un programa efectivo para proteger a los hogares contra gastos de bolsillo por motivos de salud en el mediano plazo. PMID:22282205

  6. An Exploration of EFL Teachers' Awareness of the Sources of Pedagogical Knowledge in a Teacher Education Program (Una exploración del nivel de conciencia de docentes de inglés como lengua extranjera respecto a las fuentes del conocimiento pedagógico en un programa de formación de docentes)

    ERIC Educational Resources Information Center

    Macías, Diego Fernando

    2013-01-01

    This project set out to investigate the extent to which the sources of English as a foreign language teachers' pedagogical knowledge are acknowledged and addressed in a teacher education program in a public university in Colombia. It involved the participation of teacher educators and novice teachers as well as the analysis of documents. This…

  7. Memorias del segundo simposio internacional sobre políticas, planificación y economía de los programas de protección contra incendios forestales: una visión global; 2004 Abril 19–22; Córdoba, España

    Treesearch

    Armando González-Cabán

    2008-01-01

    Estas memorias resumen el resultado de un simposio diseñado para discutir los problemas actuales que confrontan las agencias con responsabilidad para la protección contra incendios forestales a nivel federal y estadual en los EE.UU., al igual que agencias en la comunidad internacional. Los temas discutidos en el simposio incluyen economía del fuego, teoría y modelos...

  8. Experiencias y avatares en la instalación local del programa ATLAS

    NASA Astrophysics Data System (ADS)

    Merlo, D. C.; Milone, L. A.

    In this paper we briefly describe the steps required for installation of AT- LAS code by Robert Kurucz. Subsequently, we summarize its implementa- tion and its comparison with our code MAPCOR, finding agreement on the structures of pressure when we look deeper layers, but some discrepancies in outer layers due to its limitations. FULL TEXT IN SPANISH

  9. Binarias en cúmulos abiertos: ?`Qué hay de nuevo?

    NASA Astrophysics Data System (ADS)

    Levato, H.

    Las herramientas modernas para detectar duplicidad han jugado un papel fundamental en el resurgimiento del estudio de la binaridad en cúmulos abiertos. El fracaso de las teorías de bifurcación para explicar la formación de estrellas dobles ha puesto en consideración los encuentros de estrellas en cúmulos para formar binarias. Existen muchas pruebas empíricas que pueden realizarse para verificar las creencias actuales. En esta revisión del tema se hace un breve resumen de la historia del problema y se analiza el conocimiento actual. Se proponen las investigaciones y programas que darían lugar a la comprobación de las predicciones que surgen de considerar que las binarias en cúmulos se forman por encuentros.

  10. Experiencias de Vida de la Mujer Adulta: Estudio de Caso de Lideres en Desarrollo del Programa de Administracion y Supervision Educativa

    ERIC Educational Resources Information Center

    Morales-Roman, Gildrette M.

    2012-01-01

    Since the twentieth century to present, the role of women in society has undergone fundamental changes. Women, today, has assumed many different task and new roles, becoming part of professional workforce and increasing level of education by aspiring a higher education gaining access to leadership positions. The purpose of this qualitative…

  11. Reseña del Programa de Certificación para Técnicos conforme a la Sección 608 de la Ley de Aire Limpio

    EPA Pesticide Factsheets

    Información sobre los requisitos de la EPA referente a la certificación de técnicos que manejen, reparen o desechen electrodomésticos que emiten refrigerantes a la atmósfera conforme a la Sección 608 de la Ley de Aire Limpio.

  12. Introduccion a la hidraulica de aguas subterraneas : un texto programado para auto-ensenanza

    USGS Publications Warehouse

    Bennett, Gordon D.

    1987-01-01

    Este ' texto programado esta diseflado para ayudarle a comprender la teoria de la hidniulica de aguas subterraneas por medio de la auto-enseflanza. La instrucci6n programada es un enfoque a una materia, un metodo de aprender;que no elimina el esfuerzo mental del proceso de aprendizaje. Algunas secciones de este programa necesitan solamente ser leidas; otras tendrian que ser elaboradas con lapiz y papel. Algunas preguntas pueden ser contestadas directamente; otras requieren calculos. A medida que se avanza en el texto, tendra que consultar frecuentemente textos o referencias sobre matematicas, mecanica de fluidos e hidrologia. En cada una de las ocho partes del texto, inicie el programa de instrucci6n leyendo la Secci6n 1. Elija una respuesta a la pregunta al final de la secci6n y dirijase a la nueva secci6n indicada al lado de la respuesta escogida. Si su respuesta fue correcta, pase a la secci6n que contiene materia nueva y otra pregunta, y proceda tal como en la Secci6n 1. Si su respuesta no fue correcta, dirijase a la secci6n que contiene explicaciones adicionales sobre el tema anterior y que le indica volver a la pregunta inicial e intentar de nuevo. En este caso, valdra Ia pena repasar el material de la secci6n anterior. Continue de esta man era en el programa hasta que llegue a Ia secci6n que indica el final de la parte. Observe que aunque las secciones estan en orden numerico en cada una de las ocho partes, por lo general, usted no procedeni en secuencia numerica (Secci6n 1 ala Secci6n 2, etc.) de principia a fin.

  13. Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual.

    PubMed

    Barrios, Liliana Mondragón

    2012-01-01

    El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar.

  14. Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual

    PubMed Central

    Barrios, Liliana Mondragón

    2012-01-01

    El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar. PMID:22754085

  15. Social Representations of Gynecologic Cancer Screening Assessment a Qualitative research on Ecuadorian women.

    PubMed

    Godoy, Yolanda; Godoy, Clara; Reyes, Juan

    2016-06-01

    The purpose of this work was to explore: knowledge, attitudes, and beliefs regarding gynecologic cancer screening on Ecuadorian women users of primary care facilities, to identify the social representations that users of health services make about these programs and their influence on the decision to undergo a screening. An exploratory and qualitative research design was held using focus groups and in-depth interviews for data collection. A narrative content analysis of the results was conducted. Women's knowledge on gynecological cancer screening was confusing. Most frequent misconceptions related to the pap smear were: the belief that it could be useful for detecting pregnancy, ovarian cysts or infections. Most of the participants stated that the pap smear procedure is a traumatic and painful experience. Regarding to mammography women said it was used for sick woman and this procedure by itself may cause cancer. El propósito de esta investigación fue explorar los conocimientos, actitudes y creencias respecto a los programas de detección del cáncer ginecológico entre usuarias de centros de atención primaria de salud para identificar las representaciones sociales que las usuarias de los servicios de salud elaboran acerca de estos programas y de los diferentes procedimientos que comprenden. El diseño de la investigación fue exploratorio y cualitativo, mediante grupos focales y entrevistas a profundidad, con el respectivo análisis narrativo e interpretativo del contenido. Se encontró conocimiento confuso acerca de los programas de tamizaje de cáncer ginecológico y dificultades asociadas a la realización de los procedimientos. Los significados más frecuentes acerca de los programas fueron: el uso de la citología cérvico-vaginal para detectar embarazo, quistes ováricos o infecciones. La mayoría de los participantes asociaba este procedimiento con una experiencia dolorosa y traumática. Respecto al autoexamen de mamas, lo calificaron como un masaje preventivo-terapéutico y a la mamografía como peligrosa porque podría desarrollar cáncer.

  16. [In Process Citation].

    PubMed

    Alarcón Hormazábal, Manuel; Delgado Floody, Pedro; Castillo Mariqueo, Lidia; Thuiller Lepelegy, Nicole; Bórquez Becerra, Pablo; Sepúlveda Mancilla, Carlos; Rebolledo Quezada, Sara

    2016-03-25

    Introducción: existe una alta prevalencia de sedentarismo, sobrepeso y obesidad en jóvenes universitarios. Objetivo: el propósito del estudio fue determinar los efectos de un programa de entrenamiento intervalado de alta intensidad (HIIT) sobre el perfil antropométrico, glicemia basal y VO 2 máx (consumo máximo de oxígeno) de jóvenes sedentarios con malnutrición por exceso. Material y métodos: 6 mujeres y 2 hombres (2 obesos y 6 con sobrepeso) se sometieron a un programa de entrenamiento de alta intensidad de 8 semanas de duración (3 sesiones/semana). Se evaluó en ayuno y posterior a 72 horas de la última intervención; peso, índice de masa corporal (IMC), contorno de cintura (CC), perímetro de cadera y glicemia de basal. El VO 2 máx fue evaluado en condiciones normales previo a la primera sesión. Resultados: las variables de estudio no presentaron cambios significativos (p > 0,05), pero reportaron disminuciones porcentuales. El peso disminuyó un 0,18%, el IMC un 0,27%, el CC 2,67%, el perímetro de cadera un 1,15%, y el VO 2 máx un 0,48%. La glicemia basal presentó la mayor disminución, pasó de 95,13 ± 23,91 a 89,88 ± 12,45 mg/dl (5,52%), estabilizando y mejorando sus niveles en cada uno de los participantes. Conclusiones: el programa de entrenamiento intervalado de alta intensidad fue factible de realizar sin resultados adversos para la salud de los participantes, la glicemia basal mostró la mayor variación, estabilizando sus valores en los participantes, lo que es un indicador positivo dentro del programa. Es necesario seguir investigando sobre esta metodología HIIT y aumentar los tiempos de estudio para ver los cambios que se pueden producir en distintos parámetros metabólicos, antropométricos y físicos en población con malnutrición por exceso.

  17. Descripción de la zona de alta difusión en un modelo bidimensional para hojas de corriente

    NASA Astrophysics Data System (ADS)

    Montero, M. F.; Paola, C. A.; Platzeck, A. M.

    Los modelos bidimensionales para describir hojas de corriente de alta simetría no suministran una descripción detallada de las regiones donde la difusión es considerablemente importante. Tal es el caso de los modelos desarrollados en la década del '60 por Sweet, Parker, Petschek y Sonnerup. En esta comunicación presentamos una solución de las ecuaciones MHD en el entorno del origen, construyendo series bidimensionales para todas las magnitudes físicas involucradas. Valiéndonos de la alta simetría y de las características del problema, logramos reducir el número de coeficientes a calcular. Utilizamos un programa autoconsistente para extender el cálculo a regiones vecinas con difusión moderada o despreciable.

  18. Digitalización de diapositivas del Sol en H α

    NASA Astrophysics Data System (ADS)

    Missio, H.; Montenegro, C.; Montenegro, R.

    El objetivo de este trabajo ha sido el de obtener imágenes digitalizadas de las diapositivas tomadas del Sol en luz de hidrógeno de la línea correspondiente a Hα, y de esta manera llegar a convertir las mismas a un archivo digital para poder ser tratadas luego por computadora y poder contabilizar con exactitud, mediante un programa adecuado para tal fin, las zonas activas del Sol en la imagen digitalizada. En principio, para llegar a esto se pensó en la utilización de medios accesibles, y como detector se utilizó un fototransistor ubicado dentro de un soporte rectangular sobre dos ejes de desplazamiento X e Y. Se han obtenido con este procedimiento imágenes de buena calidad, construídas a partir de tres datos digitalizados en cada barrido que aportan la posición X e Y y la intensidad del pixel en ese punto indicada en 255 tonos de grises.

  19. Head Start Program Performance Standards on Services for Children with Disabilities (45-CFR 1308) [and] Normas de Ejecucion del Programa Head Start Sobre Servicios para Ninos con Discapacidades (45-CFR 1308).

    ERIC Educational Resources Information Center

    Administration for Children, Youth, and Families (DHHS), Washington, DC. Head Start Bureau.

    This document consolidates, clarifies, and updates federal regulations on Head Start services for children with disabilities. The regulations are designed to complement the Head Start Program Performance Standards governing services to all enrolled children. Specifically, these regulations require Head Start programs to: (1) design comprehensive…

  20. Escaparate. Programa de lectura y ensenanza del lenguaje, Unidad C. Guia Para El Maestro (Show Window. Reading and Language Learning Program, Unit C. Teacher's Guide).

    ERIC Educational Resources Information Center

    Dissemination and Assessment Center for Bilingual Education, Austin, TX.

    Instructions for use of "Escaparate," the third of eight Spanish reading and language instruction units developed by Edgewood School District's Bilingual Program, San Antonio, Texas, are given in this teacher guide. Originally intended for grades four through six, the program may be used from fourth grade to secondary school in Spanish reading and…

  1. Educación sobre sexualidad y prevención del VIH: un diagnóstico para América Latina y el Caribe

    PubMed Central

    DeMaria, Lisa M.; Galárraga, Omar; Campero, Lourdes; Walker, Dilys M.

    2016-01-01

    RESUMEN Objetivo Mostrar, a través de un diagnóstico en América Latina y el Caribe, el panorama legislativo y curricular sobre sexualidad y prevención contra el virus de inmunodeficiencia humana (VIH) en el ámbito escolar, contrastándolo con los comportamientos sexuales reportados en encuestas demográficas y de salud. Métodos En mayo de 2008 se realizó, con el apoyo del Fondo de Población de las Naciones Unidas (UNFPA), una encuesta a informantes clave en 34 países de la Región. El cuestionario autoaplicado solicitó información sustantiva de agentes de las diferentes partes interesadas, como ministerios de educación y de salud, sobre los programas de prevención contra el VIH/Sida que se están aplicando en las escuelas. Resultados Respondieron a la encuesta 27 países que representan 95,5% de la población objetivo (6 a 18 años de edad). La mayoría de los países informó tener al menos un libro de texto o un capítulo específico para enseñar los temas de educación sobre sexualidad y prevención del VIH. En la escuela secundaria se cubren la mayor parte de los temas pertinentes relevantes para la educación sobre sexualidad, pero no todos. Por ejemplo, el problema de la discriminación por orientación o preferencia sexual no se incluye en los programas escolares. Conclusiones El material educativo sobre sexualidad debe ser revisado y actualizado periódicamente de modo que refleje los avances en los temas y en la forma de tratar los contenidos. En cada país el currículo debe abordar el tema del respeto a la diversidad sobre orientación, preferencia e identidad sexuales, y en particular el manejo apropiado de la educación para prevenir infecciones de transmisión sexual (ITS) en hombres que tienen sexo con hombres. Los esfuerzos de evaluación de la efectividad de los programas deben contemplar desenlaces tales como marcadores biológicos (incidencia y prevalencia de ITS y embarazo) y no únicamente indicadores de conocimiento y comportamiento sexual auto-reportado. PMID:20107702

  2. Acceptability of an Embodied Conversational Agent-based Computer Application for Hispanic Women

    PubMed Central

    Wells, Kristen J.; Vázquez-Otero, Coralia; Bredice, Marissa; Meade, Cathy D.; Chaet, Alexis; Rivera, Maria I.; Arroyo, Gloria; Proctor, Sara K.; Barnes, Laura E.

    2015-01-01

    There are few Spanish language interactive, technology-driven health education programs. Objectives of this feasibility study were to: 1) learn more about computer and technology usage among Hispanic women living in a rural community; and 2) evaluate acceptability of the concept of using an embodied conversational agent (ECA) computer application among this population. A survey about computer usage history and interest in computers was administered to a convenience sample of 26 women. A sample video prototype of a hospital discharge ECA was administered followed by questions to gauge opinion about the ECA. Data indicate women exhibited both a high level of computer experience and enthusiasm for the ECA. Feedback from community is essential to ensure equity in state of the art dissemination of health information. Hay algunos programas interactivos en español que usan la tecnología para educar sobre la salud. Los objetivos de este estudio fueron: 1) aprender más sobre el uso de computadoras y tecnología entre mujeres Hispanas que viven en comunidades rurales y 2) evaluar la aceptabilidad del concepto de usar un programa de computadora utilizando un agente de conversación encarnado (ECA) en esta población. Se administro una encuesta sobre el historial de uso y del interés de aprender sobre computadoras fue a 26 mujeres por muestreo de conveniencia. Un ejemplo del prototipo ECA en forma de video de un alta hospitalaria fue administrado y fue seguido por preguntas sobre la opinión que tenían del ECA. Los datos indican que las mujeres mostraron un alto nivel de experiencia con las computadoras y un alto nivel de entusiasmo sobre el ECA. La retroalimentación de la comunidad es esencial para asegurar equidad en la diseminación de información sobre la salud con tecnología de punta. PMID:26671558

  3. Tesoros de mi raza: Programa de lecture y ensenanza del lenguaje (Treasures of My Culture: Reading and Teaching Program for Language Instruction).

    ERIC Educational Resources Information Center

    Santos, Richard G.; And Others

    This teacher's guide, reader and workbook are part of a series of bilingual instructional materials designed for the fourth, fifth, and sixth grades. The present materials are specifically for fourth graders. The goal of the series is to teach Spanish by means of stories that present historical and cultural facts and aspects of the daily life of a…

  4. Radio Nutricion: A Program for Nutrition Education with the Hispanic Community. Service Provider's Guide = Radio Nutricion: Un Programa de Educacion para la Nutricion para la Comunidad Hispana. Guia del Proveeidor de Servicios.

    ERIC Educational Resources Information Center

    Association of Farmworker Opportunity Program, Arlington, VA.

    The set of materials was designed to provide nutrition instruction to Spanish-speaking farm workers using radio broadcasts. It includes audiocassette tapes of four novellas (mini-dramas) on nutrition-related topics (diabetes, heart disease and high blood pressure, pregnancy, smart shopping), talk shows on the same topics, a public service…

  5. USSR Report, International Affairs.

    DTIC Science & Technology

    1987-01-08

    Programa de Reordenamiento Nacional," Propuesta del Gobierno al Pueblo de Guatemala, Guatemala, 6 March 1985, p 6. 8. Ibid., p. 1. 9. EL DIA, 11...April 1986. 10. PR0CESO, No 471, 1986, pp 44-45. 11. Mensaje de la Unidad Revolucionaria Nacional Guatemalteca (URNG) en su cuarto aniversario al...recent times, was emphasized by inclusion of the question of safety in air transport within the agenda for the session. The Soviet delegation proposed

  6. La Exploracion Del Contexto Social y Sus Efectos en el Programa de Espanol en Mexico Rural. (Exploring the Social Context Affecting a Pre-School Spanish Program in Rural Mexico).

    ERIC Educational Resources Information Center

    Finegold, Lynda

    A major stumbling block for the implementation of Mexico's Global Development Plan has been the country's large rural population of Indians. One government strategy to integrate this sector into the mainstream of society has been to teach Spanish, the official language, as a second language, while at the same time fostering ethnic pride. The…

  7. Comportamiento del Helio en estrellas químicamente peculiares

    NASA Astrophysics Data System (ADS)

    Malaroda, S. M.; López García, Z.; Leone, F.; Catalano, F.

    Las estrellas químicamente peculiares (CP) se caracterizan por tener deficiencias y sobreabundancias de algunos elementos químicos de hasta 106 veces la abundancia solar. Además presentan variaciones en las líneas espectrales. Se piensa que ello se debe a que los campos magnéticos presentes en este tipo de estrellas son principalmente dipolares, con un eje de simetría diferente del eje de rotación. La distribución de los elementos sobreabundantes y deficientes no es homogénea sobre la superficie estelar y las variaciones observadas serían una consecuencia directa de la rotación estelar. Entre los elementos con abundancia anómala se encuentra el Helio, cuyas líneas tienen intensidades que no son consistentes con una abundancia normal, que no puede ser determinada del modo usual, o sea, considerando una atmósfera con composición solar. Con el fin de determinar la abundancia de este elemento, se inició un estudio de estrellas anómalas de Helio, Hew y He strong. Además se determinarán las abundancias de otros elementos anómalos como ser el Si, Cr, Mg, Mn y Fe. Las mismas se determinan del modo tradicional, o sea: a) medida de los anchos equivalentes de las líneas de los distintos elementos analizados; b) adopción de la temperatura efectiva, gravedad y abundancia del Helio; c) cálculo del modelo de atmósfera d) comparación con las observaciones y reinicio de un proceso iterativo hasta lograr un acuerdo entre todos los parámetros analizados. Las observaciones se llevaron a cabo en el Complejo Astronómico El Leoncito. Se observaron setenta y ocho estrellas anómalas de Helio. En este momento se está procediendo a calcular las abundancias correspondientes a los distintos elementos químicos. Para ello se hace uso de los modelos de Kurucz, ATLAS9. Los cálculos NLTE de las líneas de Helio se llevan a cabo con el programa MULTI y se compararán con los realizados con el programa WIDTH9 de Kurucz (LTE), con el objeto de resaltar la importancia de los efectos NLTE.

  8. Mirror Coronograph for Argentina (MICA). Primera Luz

    NASA Astrophysics Data System (ADS)

    Stenborg, G.; Epple, A.; Schwenn, R.; Francile, C.; Rovira, M.

    En Julio de 1997 se terminó con la primera parte de la instalación del ``Coronógrafo de Espejo para la Argentina'' en la estación de altura Carlos U. Cesco (El Leoncito), gracias al esfuerzo de la gente del Max Planck Institut für Aeronomie (Alemania), del OAFA y del IAFE. Dicho coronógrafo forma parte de un programa de ciencia bilateral entre Alemania y Argentina. El propósito del mismo, en conjunción con otros telescopios solares y terrestres, es contribuir a un mejor entendimiento de cuestiones fundamentales de la física solar. Para ello, ya está observando la corona de emisión en el verde (Fe XIV), rojo (Fe X) y Hα entre 1.05 y 2 radios solares aproximadamente. El diseño del instrumento, el cual fuera ya presentado en esta misma reunión en La Plata en 1996, es esencialmente similar al del telescopio LASCO-C1 a bordo del Solar Heliospheric Observatory (SOHO). La adquisición de datos se realiza con un CCD de 1280x1024 pixels, codificando en 12 bits, pudiendo ser el mismo operado en forma remota. En esta reunión presentaremos algunas de las observaciones realizadas durante la puesta a punto del instrumento en el período julio-setiembre de 1997. Asimismo expondremos cómo y por qué sus resultados complementarán a los de su par en el espacio.

  9. Primer prueba de desafio controlado en tilapia del Nilo Para Resistencia a Streptococcus iniae

    USDA-ARS?s Scientific Manuscript database

    Intensification of tilapia production has resulted in disease outbreaks that negatively affect commercial fish farmers. One bacterial pathogen that commonly causes losses in tilapia production is Streptococcus iniae. Control and prevention of S. iniae can be difficult and requires an integrated fish...

  10. Autoguía para el telescopio 2,15 mts de CASLEO

    NASA Astrophysics Data System (ADS)

    Aballay, J. A.; Casagrande, A. R.; Pereyra, P. F.; Marún, A. H.

    Se está desarrollando un sistema de autoguía para el telescopio de 2,15 mts. El mismo se realizará aprovechando el Offset Guider. Al ocular móvil de éste se vinculará alguna cámara digital (ST4-ST7-CH250) para lograr la visión del objeto. El funcionamiento del equipo será el siguiente: primero, dadas las coordenadas del objeto a observar, se tomarán las coordenadas del telescopio para que, a través de una base de datos, se determine un campo de objetos que sirvan para la cámara de visión, luego, la PC obtendrá el offset entre la estrella de observación y la estrella seleccionada como guía, este valor será trasladado a los motores que posicionarán en forma automática el ocular. Una vez que la estrella es visualizada en la cámara (monitor de PC ) se correrá el programa que guiará el telescopio automáticamente.

  11. Raza de Tesoros. Programa de Lectura y Ensenanza del Lenguaje, Unidad B. Guia para el Maestro (Race of Treasures. Reading and Language Learning Program, Unit B. Teacher's Guide).

    ERIC Educational Resources Information Center

    Dissemination and Assessment Center for Bilingual Education, Austin, TX.

    This is the teacher's guide accompanying a reader and a workbook that are part of an ungraded language arts and reading program that can be used in classes from upper elementary through high school. The program is designed around reading selections which present aspects of history, culture, and present-day experiences of special relevance to the…

  12. Valores, Creencias Y Objectivos: Base del programa de la Escuela Experimental P.K. Yonge. (Values, Beliefs and Objectives: The Basis of Experimental Schools P.K. Yonge's Program.)

    ERIC Educational Resources Information Center

    Florida Univ., Gainesville. Coll. of Education.

    The values, beliefs, and objectives that form the core of the program at the Experimental School P.K. Yonge in the University of Florida are presented in this paper which is written in Spanish. This experimental school serves approximately 900 students from grades one through twelve. The function of the school is to conduct research to solve…

  13. The U.S.-Colombia Free Trade Agreement: Economic and Political Implications

    DTIC Science & Technology

    2008-05-01

    a Colombia, Anuncia el Presidente de Colombia en Entrevista a Caracol Radio,” May 3, 2007. 48 Colombia’s Observatorio del Programa Presidencial de ...Presidente de Colombia en Entrevista a Caracol Radio,” May 3, 2007. 51 Embassy of Colombia, pp. 11-12. that under President Uribe’s leadership, Colombia has...American Free Trade Agreement (NAFTA), the U.S.- Chile Free Trade Agreement, the Dominican Republic-Central America Free Trade Agreement (CAFTA-DR

  14. [Not Available].

    PubMed

    Fernández Castillo, Rafael; Cañadas de la Fuente, Gustavo R; Cañadas de la Fuente, Guillermo A; De la Fuente Solana, Emilia Inmaculada; Esteban de la Rosa, Rafael José; Bravo Soto, Juan

    2016-07-19

    Introducción: la obesidad y el sobrepeso presentan efectos adversos sobre la salud, lo que contribuye a la aparición de enfermedades metabólicas y cardiovasculares que ponen en peligro la integridad del injerto.Objetivo: investigar la influencia del IMC pretrasplante renal sobre el funcionamiento del injerto renal al año de trasplante mediante el estudio de cuatro métodos distintos de medir la filtración glomerular.Material y métodos: en este trabajo se ha seguido a 1.336 pacientes de ambos sexos trasplantados renales; se les realizaron mediciones pretrasplante y postrasplante de parámetros bioquímicos, mediciones antropométricas y función renal mediante medidas de filtrado glomerular.Resultados: a mayor índice de masa corporal pretrasplante se produce una disminución del filtrado glomerular medido por cuatro métodos distintos, así como mayor porcentaje de rechazos.Conclusiones: un IMC elevado pretrasplante contribuye a la disfunción del injerto, a una disminución del filtrado glomerular y a complicaciones del injerto en el primer año postrasplante.

  15. Estudio teórico de moléculas de interés en Astrofísica: compuestos binarios policarbonados

    NASA Astrophysics Data System (ADS)

    Largo-Cabrerizo, A.

    Se han detectado en el espacio distintos compuestos binarios policarbonados (que se pueden formular como CnX), algunos de ellos con elementos de la primera fila del sistema periódico, pero también existen otros que contienen elementos de la segunda fila, como azufre o silicio. La información experimental sobre estos últimos compuestos es escasa, por lo que los estudios teóricos son especialmente valiosos en este campo. En esta comunicación presentaremos los avances mas recientes que sobre el tema ha realizado nuestro grupo. Incidiremos particularmente en dos aspectos. En primer lugar resumiremos los estudios en los que hemos intentado proporcionar información estructural sobre carburos metálicos formados por sodio, magnesio, aluminio o calcio, que pueda ser de ayuda a la hora de caracterizar estas moléculas en laboratorio como paso previo a su eventual detección en el espacio. Un aspecto importante dentro de este primer apartado es el análisis de las propiedades moleculares en función del tamaño del sistema (cuantificado en el numero de átomos de carbono) con el objeto de intentar sistematizar su estudio. En segundo lugar comentaremos brevemente algunos de los estudios realizados sobre posibles reacciones que pueden ser vías de síntesis de este tipo de compuestos en el medio interestelar.

  16. The Contribution of the Spanish Guardia Civil to the Peace and Stability Operations Within the Human Security Framework

    DTIC Science & Technology

    2010-03-08

    1999.- U.N. Civilian Police component in Kosovo (UNMIK.) 2000.- Oficina del Programa de Irak (no es especificamente una misi6n de paz) 2000.- Special...community security, and political security. Nevertheless, it is worth pointing out that the establishment and the inclusion of an agenda based on the human...model the pattern set in France by the Gendarmerie and in Catalonia by the existing Mossos de Escuadra. The Dulce of Ahumada personally shaped this new

  17. The Proposed U.S.-Colombia Free Trade Agreement: Economic and Political Implications

    DTIC Science & Technology

    2010-04-16

    2008. 50 Ibid, p. 2. 51 Colombia’s Observatorio del Programa Presidencial de DDHH y DIH, Vicepresidencia de la República, April 2008. 52 See CRS...President Alvaro Uribe, “Se Hara Todo el Esfuerzo Para Que No Se Le Niegue el TLC a Colombia, Anuncia el Presidente de Colombia en Entrevista a Caracol...focus of U.S. trade policy as demonstrated by the passage of the North American Free Trade Agreement (NAFTA), the U.S.- Chile Free Trade Agreement, the

  18. Abundancias químicas de las estrellas CP del grupo HgMn μ Leporis y 53 Tauri. II. Boro, Berilio, Carbono, Magnesio, Aluminio y Silicio

    NASA Astrophysics Data System (ADS)

    López García, Z.; Malaroda, S. M.; Faraggiana, R.

    Se determinan las abundancias químicas de los elementos más livianos presentes en dos estrellas CP del grupo HgMn, μ Lep y 53 Tau, utilizando espectros IUE de alta resolución y técnicas de cálculo de espectros sintéticos. Para el cálculo de las líneas se utiliza la lista mas completa de datos atómicos disponible y el programa SYNTHE. Para el cálculo de la abundancia de un elemento se comparan, para cada imagen, los perfiles observados del mayor número de líneas presentes con los perfiles calculados obtenidos por variación de las abundancias iniciales, reteniendo la abundancia para la cual el acuerdo entre las líneas observadas y calculadas es considerado visualmente el mejor. Los resultados obtenidos son comparados con los estimados por la teoría de la difusión.

  19. Bioética y justicia ambiental en la salud de los pobladores andinos de Perú

    PubMed Central

    Alcantara Zapata, Diana E.; Mazzei Pimental, Marinella

    2018-01-01

    Este artículo intenta plasmar el panorama bioético-ambiental de la salud del poblador que habita en la sierra peruana, remarcando la inequidad en el acceso a los servicios de salud que existe en esta región y reflexionando sobre las posibles causas contextuales, históricas y actuales que han originado diferencias entre el poblador andino del incanato y el poblador andino actual, el cambio de cosmovisón sobre el ambiente y los recursos, el deterioro del enfoque de justicia, solidaridad, bienestar y respeto hacia el ser humano y la naturaleza. Además, se describe la salud desde el escenario histórico de esta región, donde la salud pública tiene y tendrá como desafío la aplicación de programas que respondan a las necesidades específicas de esta población, con un enfoque dirigido hacia lo ambiental. PMID:29708219

  20. Cómo aumentar la actividad física de los niños durante el período del recreo en las escuelas

    PubMed Central

    Ludwig, David

    2014-01-01

    Objetivos. Analizamos si la participación de las escuelas en el Programa de Mejoramiento del Recreo (PMR) en la primavera del año 2011 estuvo asociada a tasas más altas de actividad física intensa en los niños. Métodos. En el PMR, un coordinador dirige a los niños para que practiquen juegos adecuados para la edad a fin de aumentar su nivel de actividad física. Durante el recreo en 25 escuelas primarias públicas de la ciudad de Nueva York (15 participantes en el PMR, 10 no participantes en el PMR) los investigadores observaron algunas áreas predeterminadas (n = 1 339 observaciones) y registraron el número de niños que estaban sedentarios, caminando o muy activos. Resultados. Tras el análisis estadístico con múltiples variables se encontró que la participación en el PMR era una variable predictiva significativa (P = 0,027) de la tasa de actividad física intensa (porcentaje de niños muy activos en las áreas de observación) cuyas medias de los mínimos cuadrados fueron de 41% en las escuelas participantes en el PMR y de 27% en escuelas no participantes en el PMR. En las escuelas participantes en el PMR se siguió registrando una tasa significativamente superior incluso cuando el coordinador de juegos no estaba en el área de observación, lo que sugiere un cambio en la cultura del recreo en las escuelas que participan en este programa. Conclusiones. La tasa de actividad física intensa en las escuelas participantes en el PMR fue 14 puntos porcentuales (o 52%) superior a la tasa registrada en las escuelas no participantes en el PMR. Esta intervención de bajo costo podría ser un agregado valioso a las herramientas para combatir la obesidad infantil y podría valer la pena reproducirla en otros sitios. PMID:24899455

  1. El Planetario Móvil de la Municipalidad de la ciudad de Córdoba

    NASA Astrophysics Data System (ADS)

    Suárez, F. E.; Campos, M.; Goldes, G. V.; Carranza, G. J.; Romero, R.; Juri, H. O.

    Se describen las características y operatoria del nuevo Planetario Móvil. Se trata de un equipamiento de propiedad de la Municipalidad de la Ciudad de Córdoba que es operado por personal y en el predio de la Universidad, en virtud de un convenio suscripto entre ambas instituciones. El planetario consta de una cúpula inflable y de un proyector con programas alternativos que incluyen temas de astronomía, geografía, biología y medio ambiente, entre otros. En la actualidad opera en las instalaciones del Pabellón Argentina de la Ciudad Universitaria y recibe delegaciones escolares de todo el territorio provincial. El Planetario Móvil es parte de un proyecto más amplio de divulgación científica en el cual interactúan la Universidad y el Municipio.

  2. Bases para el Curriculum del Primer Ciclo de las Escuelas de Nivel Intermedio (Bases for the First Term Curriculum in Intermediate Schools).

    ERIC Educational Resources Information Center

    Fermin Mignone, Emilio; And Others

    This curriculum guide for intermediate schools in Argentina begins with a discussion of the historical development of such schools and of their place in the overall educational scheme. The section on the curriculum provides detailed information on objectives, content, and activities; philosophical, political, sociological, methodological, and…

  3. Nutriendo la Promesa: Materiales Para la Aplicacion de las Normas de Ejecucion del Programa Head Start. Guia Para la Utilizacion de los Materiales [y] Transparencias (Nurturing the Promise: Set of Training Materials on the Head Start Program Performance Standards. User's Guide [and] Set of Transparencies).

    ERIC Educational Resources Information Center

    Educational Services, Inc., Washington, DC.

    Since 1975, the Head Start Program Performance Standards have defined the services that local programs are required to provide to enrolled children and families. With revisions effective in 1998, the Program Performance Standards translate the Head Start vision into quality practices implemented at the local level. This document is comprised of a…

  4. Gibraltar Experiment: A Plan for Dynamic and Kinematic Investigations of Strait Mixing, Exchange and Turbulence.

    DTIC Science & Technology

    1986-08-01

    Iuz y clorofila; conl posible opcibn a determinar metales pesados en sedimentos, en el Estrecho de Gibral- tar y zonas adyacentes. Todo ello muy...Estrecho. El trabajo de campo acabara& en Abril y se podra’ disponer de un informe pr-eli- minar par-a despue’s del Verano. Este programa ha sido...pademas realizar una primera campar~a en Junio de 1985 la usari’amas coma campa de pruebas . Aparte de esta campah’a pensamos realizar otra en Octubre a

  5. Artesanias Mexico - Americanas. Programa Piloto de Entrenamiento Para El Asociado Bilingue y Bicultural En El Desarrollo del Nino: Guia XIII [Arts and Crafts of Mexico and the Americas. Pilot Program for the Training of Bilingual and Bicultural Teachers for the Cognitive Development of the Child: Guide XIII].

    ERIC Educational Resources Information Center

    de Celis, Margarita

    This Child Development Associate (CDA) training module, the thirteenth in a series of 16, provides creative experiences with arts and crafts for young children. Designed for preschool teachers and paraprofessional trainees, the Spanish text offers a variety of craft activities. A list of materials necessary, step-by-step directions and…

  6. Juegos - Cuentos - Cantos - Y - Rimas. Programa Piloto de Entrenamiento Para El Asociado Bilinque y Bicultural En El Desarrollo del Nino: Guia XII [Games - Stories - Songs -And - Rhymes. Pilot Program for the Training of Bilingual and Bicultural Teachers for the Cognitive Development of the Child: Guide XII].

    ERIC Educational Resources Information Center

    de Celis, Margarita

    This Child Development Associate (CDA) training module, the twelfth in a series of 16, is designed for preschool teachers and paraprofessional trainees and contains (in four separate sections) games, stories, songs and rhymes in Spanish that can be used in a bilingual, multicultural classroom setting. The module, written in Spanish, offers…

  7. Bionomics of the Primary Malaria Vector, Anopheles pseudopunctipennis, in the Tapachula Foothill Area of Southern Mexico

    DTIC Science & Technology

    1992-02-04

    GoozaJez 00. 1978. Programa de Emdicacion del Paludismo en Mexico y Nuevos Enfoques de su Estraltgia. Sal. Pub. Mex. XX(5):6I3-642. 51. Comision...Gutierrez, J, Neghme, A. 1949. Diez Anos de Lucha Antimalarica en Chile . Rev. Paras;IO!. Ch;le X(1): 5·24. 206. Nee J, Neghme, A. 1940...21): IOS-lI3. 211 . Paez R 1930. Indices Eptdemiologicos de Ia Malaria en el DeparwnenlO de Arica ( Chile ). Rev. InsL Bacterial., Chile 1:4148. 212

  8. Aceptabilidad del diagnóstico rápido casero para HIV entre hombres gay y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires

    PubMed Central

    Balán, Iván C.; Carballo-Diéguez, Alex; Marone, Rubén O.; Pando, María A.; Barreda, Victoria; Ávila, María M.

    2011-01-01

    Resumen El uso del diagnóstico rápido para HIV en Argentina, así como otros países de Latinoamérica, ha sido limitado hasta el momento. Este trabajo reporta los resultados provenientes de un estudio cualitativo realizado entre hombres gays y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires, Argentina. El objetivo principal del mismo fue conocer las ventajas y desventajas que los hombres G&HSH perciben en relación al diagnóstico rápido casero para HIV. Se realizaron ocho grupos focales con 73 participantes en los cuales se discutió acerca de las ventajas y desventajas del uso de los diagnósticos rápidos. Las respuestas fueron codificadas utilizando un programa para análisis de datos cualitativos (NVivo) y analizadas temáticamente. Los participantes describieron numerosas ventajas sobre el uso del diagnóstico rápido casero, aunque algunos reportaron importantes preocupaciones dentro de las cuales se destaca la posibilidad de impulsos suicidas si alguien recibe un resultado positivo estando solo. En términos generales se observó una gran aceptabilidad para el uso del diagnóstico rápido si el mismo es realizado por personal de salud en lugares acondicionados para este fin. PMID:25284951

  9. Aceptabilidad del diagnóstico rápido casero para HIV entre hombres gay y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires.

    PubMed

    Balán, Iván C; Carballo-Diéguez, Alex; Marone, Rubén O; Pando, María A; Barreda, Victoria; Avila, María M

    2011-03-01

    El uso del diagnóstico rápido para HIV en Argentina, así como otros países de Latinoamérica, ha sido limitado hasta el momento. Este trabajo reporta los resultados provenientes de un estudio cualitativo realizado entre hombres gays y otros hombres que tienen sexo con hombres (G&HSH) de la Ciudad de Buenos Aires, Argentina. El objetivo principal del mismo fue conocer las ventajas y desventajas que los hombres G&HSH perciben en relación al diagnóstico rápido casero para HIV. Se realizaron ocho grupos focales con 73 participantes en los cuales se discutió acerca de las ventajas y desventajas del uso de los diagnósticos rápidos. Las respuestas fueron codificadas utilizando un programa para análisis de datos cualitativos (NVivo) y analizadas temáticamente. Los participantes describieron numerosas ventajas sobre el uso del diagnóstico rápido casero, aunque algunos reportaron importantes preocupaciones dentro de las cuales se destaca la posibilidad de impulsos suicidas si alguien recibe un resultado positivo estando solo. En términos generales se observó una gran aceptabilidad para el uso del diagnóstico rápido si el mismo es realizado por personal de salud en lugares acondicionados para este fin.

  10. Elastoplasticidad anisotropa de metales en grandes deformaciones

    NASA Astrophysics Data System (ADS)

    Caminero Torija, Miguel Angel

    El objetivo de este trabajo es el desarrollo de modelos y algoritmos numericos que simulen el comportamiento del material bajo estas condiciones en el contexto de programas de elementos finitos, dando como resultado predicciones mas precisas de los procesos de conformado y deformacion plastica en general. Para lograr este objetivo se han desarrollado diversas tareas destinadas a mejorar las predicciones en tres aspectos fundamentales. El primer aspecto consiste en la mejora de la descripcion del endurecimiento cinematico anisotropo en pequenas deformaciones, lo cual se ha realizado a traves de modelos y algoritmos implicitos de superficies multiples. Ha sido estudiada la consistencia de este tipo de modelos tanto si estan basados en una regla implicita similar a la de Mroz o en la regla de Prager. Ademas se han simulado los ensayos de Lamba y Sidebottom, obteniendo, en contra de la creencia general, muy buenas predicciones con la regla de Prager. Dichos modelos podrian ser extendidos de forma relativamente facil para considerar grandes deformaciones a traves de procedimientos en deformaciones logaritmicas, similares a los desarrollados en esta tesis y detallados a continuacion. El segundo aspecto consiste en la descripcion de la anisotropia elastoplastica inicial. Esto se ha conseguido mediante el desarrollo de modelos y algoritmos para plasticidad anisotropa en grandes deformaciones, bien ignorando la posible anisotropia elastica, bien considerandola simultaneamente con la anisotropia plastica. Para ello ha sido necesario desarrollar primero un nuevo algoritmo de elastoplasticidad anisotropa en pequenas deformaciones consistentemente linealizado y sin despreciar ningun termino, de tal forma que se conserve la convergencia cuadratica de los metodos de Newton. Este algoritmo en pequenas deformaciones ha servido para realizar la correccion plastica de dos algoritmos en grandes deformaciones. El primero de estos algoritmos es una variacion del clasico algoritmo de Eterovic y Bathe para incluir la posibilidad de plasticidad anisotropa con endurecimiento mixto. Este primer algoritmo esta restringido a casos de isotropia elastica. La isotropia elastica es una hipotesis bastante habitual en plasticidad anisotropa y tiene la ventaja de que permite el uso de formulaciones mixtas u/p. El segundo algoritmo, mas complejo y general, incluye la posibilidad de elasticidad anisotropa, plasticidad anisotropa y endurecimiento mixto. Este algoritmo supone una contribucion importante ya que esta basado en hipotesis comunmente aceptadas y utilizadas en elastoplasticidad isotropa: descomposicion multiplicativa del gradiente de deformaciones en parte elastica y parte plastica, descripcion hiperelastica sencilla en funcion de deformaciones logaritmicas e integracion exponencial que conserva el volumen. Ademas, la estructura final del algoritmo es modular y relativamente sencilla, consistiendo en un pre- y un postprocesador geometrico y una correccion plastica realizada en pequenas deformaciones. El algoritmo esta consistentemente linealizado para conservar la convergencia cuadratica asintotica de los metodos de Newton y la forma final que toma dicha linealizacion es similar al caso de isotropia elastoplastica implementado; consiste en el modulo tangente algoritmico de pequenas deformaciones sobre el que se aplica una transformacion para convertirlo en el de grandes deformaciones. Todos estos modelos han sido implementados en un codigo propio de elementos finitos denominado DULCINEA, el cual tiene formulaciones lagrangianas totales y actualizadas para grandes deformaciones. Una de las tareas necesarias para poder realizar las simulaciones, ha sido el estudio e implementacion de diferentes elementos que no sufran el bloqueo volumetrico severo que se observa en formulaciones estandar basadas en desplazamientos. Este bloqueo se debe a la condicion de quasi-incompresibilidad que imponen los modelos de plasticidad desviadores y consiste en una respuesta exageradamente rigida de la solucion obtenida por el metodo de los elementos finitos estandar. Entre los elementos implementados cabe destacar el basado en la formulacion mixta u/p, que contiene una interpolacion adicional de grados de libertad de presion. Estos grados de libertad adicionales habitualmente son internos al elemento en mecanica de solidos. En este trabajo se ha desarrollado e implementado en DULCINEA una familia de elementos tridimensionales mixtos en grandes deformaciones que incluye el caso particular BMIX 27/27/4, basado en la formulacion u/p, constituido por 27 nudos, con 27 puntos de integracion estandar y 4 grados de libertad de presiones, y que pasa la condicion Inf-Sup o de Babuska-Brezzi. Sin embargo, se ha observado que la formulacion u/p presenta ciertas limitaciones bajo las hipotesis conjuntas de anisotropia elastica y anisotropia plastica. (Abstract shortened by UMI.)

  11. Estudio epidemiológico de sucesos traumáticos, trastorno de estrés post-traumático y otros trastornos psiquiátricos en una muestra representativa de Chile

    PubMed Central

    Pérez Benítez, Carlos I.; Vicente, Benjamin; Zlotnick, Caron; Kohn, Robert; Johnson, Jennifer; Valdivia, Sandra; Rioseco, Pedro

    2010-01-01

    RESUMEN Durante la década de 1990 en los Estados Unidos (EU), el conocimiento sobre el trastorno de estrés post-traumático (TEPT) evolucionó de estudios específicos en un principio, sobre veteranos de guerra y sobre víctimas de desastres, a estudios epidemiológicos más tarde, sin embargo, la epidemiología del TEPT en países en desarrollo ha sido un área poco estudiada hasta ahora. Los expertos en el área de trauma han propuesto que los sucesos traumáticos que ocurren en la niñez son más perjudiciales para la salud mental que aquellos que ocurren más tarde en la vida. Este trabajo revisa los resultados de un estudio epidemiológico llevado a cabo en Chile. Específicamente, se revisan los resultados sobre las tasas de prevalencia del TEPT, traumas asociados más frecuentemente con él, así como la comorbilidad de este trastorno con otros trastornos psiquiátricos a lo largo de la vida. Igualmente se analizaron las diferencias del TEPT en cada sexo, así como la exposición a traumas en una muestra representativa de chilenos. Además se comparó la prevalencia de trastornos psiquiátricos en personas que sufrieron su primer trauma durante la niñez, durante la edad adulta, o que no reportaron traumas durante su vida. En estos estudios epidemiológicos se usaron módulos del TEPT y trastorno de personalidad antisocial (TPA) de la entrevista diagnóstica siguiendo los criterios del DSM-III-R (DIS–III-R). Para evaluar el resto de los trastornos psiquiátricos se usó la Entrevista Diagnóstica Internacional Compuesta (CIDI). Estos instrumentos fueron administrados en tres ciudades chilenas a 2390 personas mayores de 15 años. Para estimar los errores estándares (EE) debido al diseño de la muestra y a la necesidad de ajuste se usó el método Taylor de linearización seriada. También se usó un análisis de regresión logística para examinar la relación entre el TEPT, los factores demográficos de riesgo y el tipo de trauma. Además se utilizó la regresión logística multivariada para evaluar si la relación entre el TEPT y el sexo pudiera ser explicada por medio de otros factores de riesgo, así como para calcular las tasas y la oportunidad relativa (razón de productos cruzados) de trastornos psiquiátricos a lo largo de la vida. El primer análisis arrojó que la prevalencia de TEPT a lo largo de la vida fue de 4.4% (2.5% para hombres y 6.2% para mujeres). De los hechos traumáticos reportados, la violación sexual tuvo una correlación más alta con el TEPT que los demás hechos traumáticos. Las mujeres tuvieron más probabilidades de experimentar TEPT que los hombres, después de controlar la variable asalto violento. El segundo análisis evidenció que los que habían sufrido traumas a lo largo de la vida tuvieron mayor probabilidad de tener un trastorno psiquiátrico en comparación con aquellos que no reportaron traumas. También se encontró que los que sufrieron su primer trauma durante la infancia tuvieron más probabilidad de desarrollar trastornos de pánico a lo largo de la vida que aquellos que sufrieron su primer trauma en la edad adulta, independientemente del número de traumas que sufrieron y de las diferencias demográficas. Aunque Chile tiene un contexto histórico-cultural y una economía diferente a otros países en los que se ha estudiado anteriormente la epidemiología del TEPT, el presente estudio reflejó tendencias similares a las reportadas en estudios previos. Los hallazgos expuestos enfatizan la importancia de investigar la prevalencia del TEPT, los patrones de comorbilidad del TEPT y las diferencias de sexo en la prevalencia del TEPT en diferentes países. También estos resultados sugieren que los sucesos traumáticos en la infancia (y no en la adultez) pueden estar relacionados con la ocurrencia de trastornos psiquiátricos específicos. PMID:21113425

  12. PubMed

    Litewka, Sergio; Goodman, Kenneth; Braunschweiger, Y Paul

    2008-01-01

    El Programa CITI (Collaborative Institutional Training Initiative) es un curso basado en Internet y desarrollado por voluntarios, que brinda material educacional sobre protección de sujetos humanos en investigaciones biomédicas y de conducta, buenas prácticas clínicas, conducta responsable de la investigación y trato humanitario a animales de laboratorio. Es un esfuerzo conjunto del Fred Hutchinson Cancer Research Center y la Universidad de Miami.Con la colaboración de expertos locales, gran parte del contenido se ha adaptado para América Latina, se ha traducido al español y portugués y se han establecido acuerdos de colaboración con instituciones especializadas en bioética en Chile, Brasil, Costa Rica y Perú. Los autores presentan una metodología accesible para la capacitación en ética de la investigación y una justificación de su uso y difusión en América Latina.

  13. Area Handbook Series: El Salvador: A Country Study

    DTIC Science & Technology

    1990-01-01

    military attache, Carlos Ibiiez de Campo, who later became president of Chile , personally led a legendary charge of the Salvadoran cavalry in one of...Instituto Salvadorefio de Administraci6n Municipal. Primer Seminario de Coordinacidn Interinstitucional del Saneamiento Ambiental en El Salvador...Latina y Ei Caribe. La Participa- cidn Comunal en el Proceso de Construcciones Educativas. San Salvador: 1975. __ . Ministerio de Planificaci6n y

  14. [Not Available].

    PubMed

    Sendrós Madroño, José M

    2016-06-03

    La atención nutricional en el paciente oncohematológico debe formar parte del tratamiento global del paciente. Las alteraciones debidas a la localización de la neoplasia y los efectos secundarios del tratamiento oncoespecífico muchas veces dificultan o impiden la alimentación oral. Esto puede dar lugar a una desnutrición y es de gran importancia su detección, valoración e intervención temprana. El primer paso en la intervención nutricional es el consejo dietético. Este artículo muestra qué aspectos deben tenerse en cuenta para poder elaborar un consejo dietético y la importancia de que este sea individualizado. Se describen como ejemplo cuatro situaciones especiales, donde es necesario trasladar las recomendaciones nutricionales a un plan dietético. También se incide en el uso de los probióticos en pacientes inmunocomprometidos.

  15. Alternative Fuels Data Center: Recursos en español

    Science.gov Websites

    colaboración entre el gobierno y la industria patrocinada por el Programa de Tecnologías de Vehículos del enchufables Recursos en la web Use estas recursos para obtener información sobre: Economía de combustible y huella de carbono de su vehículo Cómo aumentar la economía de combustible Importancia de la economía

  16. Learning qualitative aspects of the ethics of biomedical and psychosocial research program of the Interdisciplinary Center for Studies on Bioethics, University of Chile1

    PubMed Central

    Rodríguez, Eduardo

    2012-01-01

    El presente trabajo reflexiona sobre la experiencia de 10 años en procesos de aprendizaje grupal y adquisición de competencias, de los participantes en el Programa de Ética de la Investigación Biomédica y Psicosocial del Centro Interdisciplinario de Estudios en Bioética de la Universidad de Chile, Fogarty Grant R25TW6056. Considera el papel de la bioética en la formación en su carácter transdisciplinario. PMID:22833694

  17. Registros del Cuco Hormiguero (Neomorphus geoffroyi) en la Reserva de Biosfera de Bosawas, Nicaragua

    Treesearch

    H.M. Herrera-Rosales; M. Tórrez; W.J. Arendt

    2014-01-01

    El cuco hormiguero, Neomorphus geoffroyi, se registró en la Reserva de Biósfera de Bosawás y representa el primer gráfico de la especie para el Norte y para el país. Esta especie es rara y es sensible a la deforestación, se observó en compañía de bandadas mixtas, con su comportamiento...

  18. Quality control method to measure predator evasion in wild and mass-reared Mediterranean fruit flies (Diptera: Tephritidae)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hendrichs, M.; Wornoayporn, V.; Hendrichs, J.

    Sterile male insects, mass-reared and released as part of sterile insect technique (SIT) programs, must survive long enough in the field to mature sexually and compete effectively with wild males for wild females. An often reported problem in Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) SIT programs is that numbers of released sterile males decrease rapidly in the field for various reasons, including losses to different types of predators. This is a serious issue in view that most operational programs release sterile flies at an age when they are still immature. Previous field and field-cage tests have confirmed that fliesmore » of laboratory strains are less able to evade predators than wild flies. Such tests involve, however, considerable manipulation and observation of predators and are therefore not suitable for routine measurements of predator evasion. Here we describe a simple quality control method with aspirators to measure agility in medflies and show that this parameter is related to the capacity of flies to evade predators. Although further standardization of the test is necessary to allow more accurate inter-strain comparisons, results confirm the relevance of measuring predator evasion in mass-reared medfly strains. Besides being a measure of this sterile male quality parameter, the described method could be used for the systematic selection of strains with a higher capacity for predator evasion. (author) [Spanish] Insectos machos esteriles criados en forma masiva para ser liberados en programas que utilizan la tecnica del insecto esteril (TIE), tienen que tener la capacidad de sobrevivir en el campo el tiempo necesario para poder madurar sexualmente y competir efectivamente con los machos silvestres por hembras silvestres. Un problema frecuentemente reportado por dichos programas de la mosca del Mediterraneo, Ceratitis capitata (Wiedemann), es que el numero de machos esteriles de laboratorio liberados en el campo, decrecen rapidamente por varias razones, incluyendo perdidas debidas a diferentes tipos de depredadores. Estudios anteriores conducidos en el campo, y en jaulas de campo, han confirmado que las cepas de machos de laboratorio tienen menos capacidad de evadir depredadores que los machos silvestres. Estos estudios involucran, sin embargo, una considerable cantidad de manipulacion y observacion de depredadores, por lo que no son adecuados para ser usados como medidas rutinarias en los programas de cria masiva. Aqui describimos un metodo sencillo de control de calidad usando aspiradores para medir agilidad en la mosca del Mediterraneo y mostramos que este parametro esta relacionado a la capacidad de la moscas a evadir a depredadores. Aunque aun es necesario refinar la estandarizacion de este metodo para permitir la comparacion entre cepas, los resultados confirman la importancia de tener un metodo rutinario para medir la capacidad de evasion de depredadores en cepas de cria de laboratorio de la mosca del Mediterraneo. Ademas de medir este parametro de control de calidad de los machos esteriles, el metodo descrito podria tambien ser usado para la seleccion sistematica de cepas con una mayor capacidad de evasion de depredadores. (author)« less

  19. [Not Available].

    PubMed

    Díaz, Toni; Ficapal-Cusí, Pilar; Aguilar-Martínez, Alicia

    2016-07-19

    Introducción: a pesar de la relevancia nutricional del desayuno para el desarrollo y su asociación a un mejor aprendizaje y rendimiento escolar, numerosos estudios ponen en evidencia que en muchos casos se omite o se hace mal.Objetivo: determinar la calidad del desayuno de estudiantes de entre 10 y 16 años con intención de determinar en qué momento sería conveniente realizar programas educativos sobre la importancia de esta comida y cómo mejorar su calidad.Método: estudio observacional, descriptivo y transversal a partir de un cuestionario con preguntas cerradas acerca de los hábitos de alimentación en el desayuno en estudiantes de educación primaria y secundaria.Resultados y conclusión: solo el 18,5% de los estudiantes realiza un desayuno de buena calidad y su mala calidad va aumentando progresivamente con los cursos y se asocia al hecho de desayunar solo. En ambos niveles educativos los alimentos más consumidos en casa pertenecen al grupo de los lácteos y los cereales, mientras que en el centro escolar, el bocadillo resulta el desayuno más habitual; no obstante se observan diferencias entre primaria y secundaria en cuanto al consumo de fruta y bebidas azucaradas, entre otros.Conclusión: sería interesante valorar la instauración de programas de desayuno escolar incluyendo en ellos no solo a estudiantes de primaria, sino también, y especialmente, a adolescentes pues son estos quienes omiten esta comida en mayor proporción. Las intervenciones deberían orientarse a corregir las desviaciones más habituales observadas en cada uno de los niveles educativos.

  20. Los plaguicidas y la contaminacion del medio ambiente Venezolano

    USGS Publications Warehouse

    Stickel, L.F.; Stickel, W.H.

    1972-01-01

    RESUMEN DE RECOMENDACIONES Recomendaciones para el Programa de Investigacion: 1. Establecer un sistema de muestreo biologico para detectar los niveles tendencias de los productos quimicos toxicos en un peque?o numero de si tios representativos. 2. Mantener continua vigilancia de la contaminacion ambiental, mediante la seleccion acertadamente dirigida de las zonas afectadas y de las fuentes de contaminacion. 3. Realizar estudios acerca de las poblaciones de animales silvestres, y del exito de los procesos reproductivos de las especies o grupos clayes de animales que se consideran mas gravemente afectados. 4. Preparar recomendaciones para una accion gubernamental de proteccion al hombre, a la fauna silvestre y al medio ambiente. Recomendaciones para la Accion Administrativa: 1. Establecer limites a la tolerancia de los residuos de plaguicidas en los alimentos. Constituye una medida clave para disminuir la contaminacion ambiental. 2. Establecer normas de calidad del agua para las corrientes, represas, la gos y otros cuerpos. Es la segunda medida clave para reducir la contaminacion del ambiente 3. Exigir un tratamiento adecuado de los efluentes industriales, especialmente antes de que se construyan las nuevas plantas. 4. Exigir a los agricultores que en el uso de plaguicidas sigan los consejos tecnicos autorizados y negar a los vendedores el derecho a recomendar productos por su cuenta. 5. Tomar medidas para recoger y eliminar los recipientes y sobrantes de los plaguicidas.

  1. Multiplex pyrosequencing of InDel markers for forensic DNA analysis.

    PubMed

    Bus, Magdalena M; Karas, Ognjen; Allen, Marie

    2016-12-01

    The capillary electrophoresis (CE) technology is commonly used for fragment length separation of markers in forensic DNA analysis. In this study, pyrosequencing technology was used as an alternative and rapid tool for the analysis of biallelic InDel (insertion/deletion) markers for individual identification. The DNA typing is based on a subset of the InDel markers that are included in the Investigator ® DIPplex Kit, which are sequenced in a multiplex pyrosequencing analysis. To facilitate the analysis of degraded DNA, the polymerase chain reaction (PCR) fragments were kept short in the primer design. Samples from individuals of Swedish origin were genotyped using the pyrosequencing strategy and analysis of the Investigator ® DIPplex markers with CE. A comparison between the pyrosequencing and CE data revealed concordant results demonstrating a robust and correct genotyping by pyrosequencing. Using optimal marker combination and a directed dispensation strategy, five markers could be multiplexed and analyzed simultaneously. In this proof-of-principle study, we demonstrate that multiplex InDel pyrosequencing analysis is possible. However, further studies on degraded samples, lower DNA quantities, and mixtures will be required to fully optimize InDel analysis by pyrosequencing for forensic applications. Overall, although CE analysis is implemented in most forensic laboratories, multiplex InDel pyrosequencing offers a cost-effective alternative for some applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Trastornos mentales y consumo de drogas en la población víctima del conflicto armado en tres ciudades de Colombia.

    PubMed

    Castaño, Guillermo; Sierra, Gloria; Sánchez, Daniela; Torres, Yolanda; Salas, Carolina; Buitrago, Carolina

    2018-05-01

    Introducción. La violencia en sus diferentes modalidades incrementa el riesgo de trastornos mentales y de consumo de drogas.Objetivos. Estimar la prevalencia de los trastornos mentales, del uso y abuso de drogas, así como los factores asociados en víctimas de desplazamiento forzado en tres ciudades colombianas.Materiales y métodos. Se hizo un estudio de prevalencia en una muestra de 1.026 personas entre los 13 y los 65 años de edad, a quienes se entrevistó utilizando el instrumento Composite International Diagnostic Interview y el Alcohol Use Disorders Identification Test de la Organización Mundial de la Salud, así como un cuestionario sobre el consumo de drogas modificado a partir de la encuesta del Sistema Interamericano de Datos Uniformes sobre Drogas de la Comisión Interamericana para el Control del Abuso de Drogas de la Organización de Estados Americanos, y otro sobre aspectos relacionados con el desplazamiento forzado. El análisis se hizo mediante el programa estadístico SPSS™, versión 21.Resultados. La prevalencia de vida de los trastornos mentales fue la siguiente: fobia específica, 17,7 %; depresión mayor, 16,4 %; estrés postraumático, 9,9 %; trastorno oposicionista desafiante, 8,9 %; ansiedad por separación, 7,2 %; trastornos de conducta, 5,8 %, y déficit de atención, 5,6 %. La prevalencia de vida del consumo de alcohol fue de 68,7 %; de tabaco, 31,3 %, de marihuana, 11,2 %, de cocaína, 3,5 %, de basuco, 2,0 %, de inhalables, 2,3 %, y de medicamentos ansiolíticos sin receta, 2,5 %, en tanto que 0,7 % de los entrevistados se había inyectado drogas. El presentar cualquiera de los trastornos mentales se asoció con el sexo femenino (odds ratio, OR=1,61; IC95% 1,21-2,14), así como el haber sido sometido a más de un desplazamiento forzado (OR=1,47; IC95 1,05-2,05). El consumo de cualquiera de las drogas se asoció con ser hombre (OR=5,38; IC95% 2,35-12,34).Conclusiones. La alta prevalencia de trastornos mentales y de consumo de drogas en la población estudiada, comparada con la población general, constituye un problema de salud pública que justifica el diseño de planes y la implementación de programas orientados a la recuperación de su bienestar y salud mental.

  3. Clinical relevance of CHEK2 and NBN mutations in the macedonian population.

    PubMed

    Kostovska, I Maleva; Jakimovska, M; Kubelka-Sabit, K; Karadjozov, M; Arsovski, A; Stojanovska, L; Plaseska-Karanfilska, D

    2015-06-01

    Clinical importance of the most common CHEK2 (IVS2+1 G>A, 1100delC, I157T and del5395) and NBN (R215W and 657del5) gene mutations for breast cancer development in Macedonian breast cancer patients is unknown. We performed a case-control study including 300 Macedonian breast cancer patients and 283 Macedonian healthy controls. Genotyping was done using a fast and highly accurate single-nucleotide primer extension method for the detection of five mutations in a single reaction. The detection of the del5395 was performed using an allele-specific duplex polymerase chain reaction (PCR) assay. We have found that mutations were more frequent in breast cancer patients (n = 13, 4.3%) than in controls (n = 5, 1.8%), although without statistical significance. Twelve patients were heterozygous for one of the analyzed mutations, while one patient had two mutations (NBN R215W and CHEK2 I157T). The most frequent variant was I157T, found in 10 patients and four controls (p = 0.176) and was found to be associated with familial breast cancer (p = 0.041). CHEK2 1100delC and NBN 657del5 were each found in one patient and not in the control group. CHEK2 IVS2+1G>A and del5395 were not found in our cohort. Frequencies of the studied mutations are low and they are not likely to represent alleles of clinical importance in the Macedonian population.

  4. El círculo meridiano automático de San Fernando - San Juan. Sus primeros pasos en el hemisferio sur

    NASA Astrophysics Data System (ADS)

    Mallamaci, C. C.; Muiños, J. L.; Gallego, M.; Pérez, J. A.; Marmolejo, L.; Navarro, J. L.; Sedeño, J.; Vallejos, M.; Belizón, F.

    Se informa sobre el estado actual del Círculo Meridiano Automático de San Fernando-San Juan. El instrumento (Grubb-Parson, de 178mm de abertura y 2665 mm de distancia focal) es gemelo del que se encuentra en las Islas Canarias, y fue instalado durante los meses de julio y agosto de 1996 en la estación astronómica ``Dr. C.U.Cesco" (El Leoncito, Barreal), a unos 200 km de distancia de la ciudad de San Juan, merced a un Convenio de Cooperación Científica, firmado en 1994 entre el ROA (España) y el OAFA (Argentina). En la actualidad se está llevando a cabo un programa de prueba cuyos resultados preliminares muestran que el telescopio está en buenas condiciones para observar estrellas de hasta magnitud aproximada 14.5, con buenos errores de observación (<0.12" en ascensión recta y declinación).

  5. Dinámica y crecimiento de los granos de polvo en la nebulosa protoplanetaria

    NASA Astrophysics Data System (ADS)

    de La Fuente Marcos, Carlos

    2001-06-01

    En el escenario estándar de la formación planetaria, los planetesimales (cuerpos de tamaño kilométrico) crecen a partir de granos de polvo, similares a los interestelares, embebidos en un disco gaseoso denominado nebulosa protoplanetaria. Durante esta etapa, los movimientos del gas pueden tener gran influencia en la dinámica y el crecimiento de los granos de polvo, dado que el flujo kepleriano del gas frena el movimiento de los mismos haciendo que caigan hacia el Sol, y la turbulencia inhibe la inestabilidad gravitacional de la capa de polvo. Aunque se acepta que los planetesimales fueron los elementos constituyentes de los planetas, todavía se desconoce cómo se produjo la formación de los mismos. Por esta razón, en los estudios más recientes, existe un renovado interés por comprender mejor la evolución de la capa de polvo inmersa en el disco gaseoso de la Nebulosa. El gas que fluye en el disco puede engendrar estructuras carentes de simetría axial, como por ejemplo ondas espirales y vórtices, a partir de gran variedad de mecanismos de excitación e inestabilidad. En 1995, Barge y Sommeria pusieron de manifiesto que la existencia de vórtices gaseosos persistentes en la nebulosa solar tendría importantes consecuencias sobre la formación de los planetesimales y el posterior crecimiento de los planetas gigantes. La investigación desarrollada en esta Tesis analiza la relación entre el polvo y el gas debida al acoplamiento por fricción dinámica entre ambos; en concreto, se estudia el efecto del flujo medio del gas sobre la dinámica de las partículas de polvo. El primer objetivo es investigar en profundidad los procesos de captura y crecimiento de los granos de polvo dentro de un vórtice y su posible relevancia en cuanto a la formación de los planetesimales. El segundo objetivo es la exploración de los efectos de ondas espirales propagándose en el disco gaseoso sobre la dinámica y el crecimiento de las partículas. La presencia de líneas de corriente no circulares perturba significativamente el movimiento de las partículas alrededor del Sol e incrementa su vida media en la Nebulosa. El flujo medio del gas se modela de forma simple, analizándose la dinámica y el crecimiento de las partículas mediante simulaciones numéricas. Al incrementarse la vida media y la densidad superficial de las partículas sólidas, los mecanismos de confinamiento derivados de la presencia de vórtices y ondas espirales actuan sobre el material sólido de la Nebulosa (mediante agregación colisional o inestabilidades gravitacionales) de manera mucho más eficiente que la previamente considerada. Esto ofrece nuevas posibilidades para la formación de planetesimales y núcleos de planetas gigantes, y puede explicar la formación rápida de planetas extrasolares gigantes. Además, esta Tesis analiza la respuesta de las partículas, en un disco protoplanetario con un radio de 100 UA en torno a una estrella de tipo solar, al campo gravitatorio derivado de la presencia de dos estrellas compañeras ligadas en una órbita relativamente elongada (300-1600 UA). Para llevar a cabo este análisis, se han realizado una serie de simulaciones numéricas de configuraciones jerárquicas coplanares utilizando un programa FORTRAN que integra directamente las ecuaciones del movimiento con el objeto de modelar la presencia de las fuerzas gravitacionales y viscosas. El disco protoplanetario masivo se encuentra en torno a una de las componentes de la binaria. La evolución temporal del subdisco de polvo depende directamente de la naturaleza (directa o retrógrada) de la revolución relativa de la compañera estelar, y de la temperatura y la masa del disco circunestelar.

  6. Foco Nasmyth para el telescopio 2,15mts. de CASLEO

    NASA Astrophysics Data System (ADS)

    Casagrande, A. R.

    En principio, este proyecto intenta lograr el mayor aprovechamiento posible del instrumental que se dispone, buscando la manera de optimizar y hacer más eficiente el servicio que brinda el CASLEO a la comunidad astronómica. El mismo consiste en utilizar dispositivos ya existentes en el telescopio, y darle una utilidad. Tal es el caso del camino óptico destinado al foco Coude. Si tenemos en cuenta que disponemos de un tercer espejo Coude, con todos sus mecanismos automatizados, (actualmente sin uso), una distancia apropiada del plano focal, el espacio y el lugar físico necesario para instalar un periférico, es posible la habilitación de un foco Nasmyth en el telescopio 2,15mts. El hecho de contar con este nuevo foco, redundará en importantes beneficios. En primer lugar, posibilitará la observación, casi simultánea, con dos instrumentos. Otro aspecto a tener en cuenta, es que disminuirá el frecuente cambio del instrumental periférico, motivo este que degrada su ideal puesta a punto. Por último, también de interés, es de destacar su escaso costo de ejecución.

  7. Impact of payments for environmental services and protected areas on local livelihoods and forest conservation in northern Cambodia

    PubMed Central

    Clements, Tom; Milner-Gulland, E J

    2015-01-01

    The potential impacts of payments for environmental services (PES) and protected areas (PAs) on environmental outcomes and local livelihoods in developing countries are contentious and have been widely debated. The available evidence is sparse, with few rigorous evaluations of the environmental and social impacts of PAs and particularly of PES. We measured the impacts on forests and human well-being of three different PES programs instituted within two PAs in northern Cambodia, using a panel of intervention villages and matched controls. Both PES and PAs delivered additional environmental outcomes relative to the counterfactual: reducing deforestation rates significantly relative to controls. PAs increased security of access to land and forest resources for local households, benefiting forest resource users but restricting households’ ability to expand and diversify their agriculture. The impacts of PES on household well-being were related to the magnitude of the payments provided. The two higher paying market-linked PES programs had significant positive impacts, whereas a lower paying program that targeted biodiversity protection had no detectable effect on livelihoods, despite its positive environmental outcomes. Households that signed up for the higher paying PES programs, however, typically needed more capital assets; hence, they were less poor and more food secure than other villagers. Therefore, whereas the impacts of PAs on household well-being were limited overall and varied between livelihood strategies, the PES programs had significant positive impacts on livelihoods for those that could afford to participate. Our results are consistent with theories that PES, when designed appropriately, can be a powerful new tool for delivering conservation goals whilst benefiting local people. El Impacto de los Pagos por Servicios Ambientales y Áreas Protegidas sobre la Subsistencia Local y la Conservación del Bosque en el Norte de Camboya Resumen Los impactos potenciales de los pagos por servicios ambientales (PSA) y áreas protegidas (APs) sobre los resultados ambientales y las subsistencias locales en los países en desarrollo son polémicos y se han debatido ampliamente. La evidencia disponible es escasa; ha habido pocas evaluaciones rigurosas de los impactos ambientales y sociales de las APs y particularmente los PSA. Medimos el impacto sobre los bosques y el bienestar humano en tres diferentes programas de PSA que se llevan a cabo dentro de dos APs en el norte de Camboya usando un panel de aldeas de intervención y controles emparejados. Tanto los PSA como las APs brindaron resultados ambientales adicionales en relación a los contrafácticos, esto quiere decir que redujeron las tasas de deforestación significativamente en relación a los controles. Las áreas protegidas incrementaron el acceso seguro a los recursos del suelo y el bosque para las viviendas locales, beneficiando a los usuarios de los recursos del bosque pero restringiendo la habilidad de las viviendas para expandirse y diversificar su agricultura. Los impactos de los pagos por servicios ambientales sobre el bienestar de las viviendas estuvieron relacionados con la magnitud de los pagos proporcionados. Los dos programas de PSA de mayor paga y con conexión al mercado tuvieron impactos positivos significativos, mientras que un programa de menor paga con el objetivo de proteger a la biodiversidad no tuvo un efecto detectable sobre las viviendas, a pesar de sus resultados ambientales positivos. Las viviendas que se inscribieron a los programas de PSA con mayor paga, sin embargo, necesitaban típicamente más bienes capitales, por lo que eran menos pobres y tenían mayor seguridad alimentaria que otros aldeanos. Por esto, mientras los impactos de las APs sobre el bienestar de las viviendas fueron limitados en general y variaron dependiendo de las estrategias de subsistencia, los programas de PSA tuvieron impactos positivos significativos sobre las viviendas para aquellos que podían costear participar. Nuestros resultados son congruentes con las teorías de que los PSA, cuando se designan apropiadamente, pueden ser una herramienta poderosa y novedosa para obtener objetivos de conservación mientras se beneficia a la gente local. PMID:25492724

  8. Obstáculos a la adherencia y retención en los sistemas de salud público y privado según pacientes y personal de salud

    PubMed Central

    Arístegui, Inés; Dorigo, Analía; Bofill, Lina; Bordatto, Alejandra; Lucas, Mar; Cabanillas, Graciela Fernández; Sued, Omar; Cahn, Pedro; Cassetti, Isabel; Weiss, Stephen; Jones., Deborah

    2016-01-01

    Resumen Introducción el Programa Nacional de Sida garantiza el acceso universal a los antirretrovirales, aun así las personas que reciben medicamentos a través del sistema público no logran obtener una carga viral indetectable en la misma proporción que los pacientes del sistema privado. Este estudio cualitativo tiene como objeto identificar los factores asociados a la adherencia y retención en la cascada de atención de VIH de los sistemas de salud público y privado de Buenos Aires, según las percepciones de pacientes y del personal de salud. Métodos se registraron datos cualitativos de 12 entrevistas semi-estructuradas a informantes clave y 4 grupos focales de pacientes y personal de salud tanto del sistema público como privado. Se codificaron y analizaron temas predeterminados sobre adherencia, utilizando el software QRS Nvivo9® de análisis de datos cualitativos. Resultados pacientes y personal de salud de ambos sistemas coinciden en la importancia del estigma asociado al VIH, la relación médicopaciente, la comunicación entre ambos y la división de responsabilidades en relación al tratamiento como aspectos fundamentales para la adherencia y retención en la cascada de atención. Se observan diferencias entre los sistemas en la forma en que algunos de estos aspectos actúan. Las barreras estructurales se presentan como principales obstáculos del sistema público. Discusión se resalta la necesidad de intervenciones focalizadas en la díada médico-paciente que considere las particularidades de cada sistema de atención para facilitar el compromiso del paciente en la adherencia. PMID:26878024

  9. [Not Available].

    PubMed

    Pacheco-Herrera, Javier Darío; Ramírez-Vélez, Robinson; Correa-Bautista, Jorge Enrique

    2016-06-30

    Objetivo: el presente estudio tuvo por objetivos: a) determinar los valores de referencia de la condición muscular mediante el índice general de fuerza (IGF); y b) estudiar si el IGF está asociado con indicadores de adiposidad en niños y adolescentes escolares de Bogotá, Colombia.Métodos: del total de 7.268 niños y adolescentes (9-17,9 años) evaluados en el estudio FUPRECOL, 4.139 (57%) fueron mujeres. Se evaluó el IGF como marcador del desempeño muscular a partir de la tipificación de las pruebas de fuerza prensil (FP) y salto de longitud (SL). El IGF se recodificó en cuartiles (Q), siendo el Q4 la posición con mejor valor del IGF. El índice de masa corporal (IMC), la circunferencia de cintura (CC), el índice cintura/talla (ICT) y el porcentaje de grasa corporal (% GC) por bioimpedancia eléctrica se midieron como marcadores de adiposidad.Resultados: la edad media de los evaluados fue 12,8 ± 2,3 años. Se aprecia una tendencia hacia un incremento del nivel de condición física muscular en los varones conforme aumenta la edad, y hacia la estabilidad o un ligero aumento en el caso de las mujeres. El IGF se relacionóinversamente con el ICT y % GC en los varones (r = -0,280, r = -0,327, p < 0,01), respectivamente. Los escolares ubicados en el Q4 del IGF presentaron menores valores en marcadores de adiposidad IMC, CC, ICT y % GC, p < 0,01, que su contraparte del Q1.Conclusión: se presentan valores de referencia del IGF a partir de la estandarización de los resultados obtenidos en la FP y SL. La evaluación de la fuerza muscular en edades tempranas permitirá implementar programas de prevención de riesgo cardiovascular y metabólico futuro.

  10. Estudio participativo para el desarrolllo de un instrumento de observación de violencia escolar

    PubMed Central

    Medina Santiago, Nilda G.; Rivera, Tania Cruz; Rodríguez, Maryanes Trenche; Báez Ávila, Loggina S.

    2018-01-01

    La violencia en las escuelas es reconocida como un problema de salud pública a nivel mundial que impacta negativamente el proceso de enseñanza-aprendizaje. Sin embargo, en Puerto Rico las estadísticas oficiales y los medios de comunicación generalmente se enfocan en hechos aislados de violencia extrema donde se utilizan armas o se destruye propiedad y no recogen formas de violencia más comunes que suelen ocurrir a diario en las escuelas. En este estudio se utilizó el Instrumento de Observación de Violencia Escolar (INOVE), preparado con el insumo de las comunidades escolares participantes del Proyecto VIAS (Violence and Asthma Health Disparity Network) de la Universidad del Este (UNE), para recopilar información acerca de las características de la violencia en dos escuelas puertorriqueñas. Entre los hallazgos del estudio se destacan diferencias por sexo en cuanto a categorías de violencia observadas y la observación de agresividad en juegos e interacciones entre estudiantes. Los datos recopilados han servido de base para la toma de decisiones en cuanto a la prevención de la violencia en las escuelas participantes y tienen implicaciones para el desarrollo de estrategias y programas de prevención. PMID:29643972

  11. Primer reporte del híbrido intergenérico Vermivora chrysoptera x Vermivora pinus (“Brewsters Warbler”) en Nicaragua

    Treesearch

    W.J. Arendt; M.A. Tórrez

    2008-01-01

    This article is in Spanish. During an inventory to assess avian biodiversity among the critical watersheds that flow into the Pacific from Nicaragua, we captured a hybrid Vermivora chrysoptera (“Golden-winged Warbler”) with V. pinus (“Blue-winged Warbler”) known as Brewster’s Warbler (V. leucobronchialis). The capture ocurred on November 30, 2007 in dry forest (...

  12. Precisión de las velocidades radiales obtenidas con el REOSC

    NASA Astrophysics Data System (ADS)

    González, J. F.; Lapasset, E.

    Complementando una línea de trabajo iniciada con anterioridad discutimos la estabilidad del espectrógrafo REOSC de CASLEO en DC para la medición de velocidades radiales en base al análisis de observaciones realizadas en enero y abril de 1997. En esas oportunidades obtuvimos 26 espectros de estrellas patrones y 27 espectros de 3 estrellas usadas como estrellas de referencia en nuestro programa de cúmulos abiertos. Además tomamos 26 espectros de crepúsculo con el telescopio en posiciones cubriendo el rango H=-4,+4 y δ =-90,+30. Mediante correlaciones cruzadas derivamos la velocidad de 19 órdenes en cada uno de estos espectros. En base a un análisis estadístico de los datos obtenidos discutimos la contribución de los distintos factores que afectan a la dispersión de lectura observada. En particular, la flexión del instrumento no introduciría errores significativos cuando se observa con masas de aire menores que 2.0. La dispersión de los valores de velocidad medidos para espectros de alta relación S/N de una misma estrella resultó del orden de 0.5 km/s. La comparación con los valores de velocidad publicados por distintos autores para las estrellas patrones no permite distinguir ninguna diferencia sistemática apreciable de las velocidades de CASLEO, siendo la media cuadrática de los residuos del orden de 1.0 km/s.

  13. Capacitación-acción participativa: una experiencia de 24 años en las comunidades rurales de Oaxaca, México.

    PubMed

    Ysunza, Alberto M; Diez-Urdanivia, Silvia; Pérez-Gil, Sara E

    2017-12-01

    Resumen: En este artículo presentamos el proyecto de capacitación llevado a cabo en comunidades de la sierra y costa de Oaxaca, México, desde 1991, por el Centro de Capacitación Integral para Promotores Comunitarios (CECIPROC). La decisión de hacer este trabajo en Oaxaca responde a que ese estado ocupa uno de los primeros lugares de marginación y de desnutrición en menores de 5 años. El objetivo es describir un modelo de capacitación y compartir parte de las experiencias derivadas, tanto del modelo como del trabajo realizado en las distintas áreas (nutrición y alimentación, salud comunitaria, ecología y etnobotánica, y educación y organización), por promotores mujeres y hombres en sus comunidades. La experiencia obtenida en 24 años muestra la factibilidad técnica y social del proyecto en el ámbito de la salud, el reconocimiento social del proyecto del CECIPROC como un organismo civil que ha aportado alternativas como solución a la problemática de salud, el hacer suyo el proyecto por algunos promotores y los diferentes obstáculos a los que se ha enfrentado. Enfatizamos el hecho de que la situación socioeconómica y política prevaleciente en el estado de Oaxaca es una limitante para el buen desarrollo de los programas colectivos de salud, e insistimos en la necesidad de compartir nuestras experiencias para que puedan ser utilizadas en la planificación y ejecución de otros proyectos.

  14. Role of ACE and AGT gene polymorphisms in genetic susceptibility to diabetes mellitus type 2 in a Brazilian sample.

    PubMed

    Wollinger, L M; Dal Bosco, S M; Rempe, C; Almeida, S E M; Berlese, D B; Castoldi, R P; Arndt, M E; Contini, V; Genro, J P

    2015-12-29

    The aim of the current study was to investigate the association between the InDel polymorphism in the angiotensin I-converting enzyme gene (ACE) and the rs699 polymorphism in the angiotensinogen gene (AGT) and diabetes mellitus type 2 (DM2) in a sample population from Southern Brazil. A case-control study was conducted with 228 patients with DM2 and 183 controls without DM2. The ACE InDel polymorphism was genotyped by polymerase chain reaction (PCR) with specific primers, followed by electrophoresis on 1.5% agarose gel. The AGT rs699 polymorphism was genotyped using a real-time PCR assay. No significant association between the ACE InDel polymorphism and DM2 was detected (P = 0.97). However, regarding the AGT rs699 polymorphism, DM2 patients had a significantly higher frequency of the AG genotype and lower frequency of the GG genotype when compared to the controls (P = 0.03). Our results suggest that there is an association between the AGT rs699 polymorphism and DM2 in a Brazilian sample.

  15. Accidentes laborales asociados al desánimo de médicos SERUMS para laborar en el primer nivel de atención de Lima, Perú

    PubMed Central

    Mejia, Christian R.; Valladares-Garrido, Mario J.; Romero, Brian M.; Valladares-Garrido, Danai; Linares-Reyes, Edgardo

    2018-01-01

    Introducción la retención laboral es un tema de suma importancia, porque se requiere de profesionales en el primer nivel de atención (PNA). El objetivo fue determinar si los accidentes laborales se asociaron al desánimo de los médicos para trabajar en el PNA de Lima, Perú. Métodos estudio transversal analítico de datos secundarios de una base de datos generada de una encuesta a médicos que realizaron su Servicio Rural y Urbano-Marginal en Salud (SERUMS). Se incluyó solo a los médicos que manifestaron al inicio del SERUMS que podían trabajar en el PNA de Lima. Se definió como cambio de intención de trabajo en el PNA a los que finalizando el SERUMS refirieron que ya no deseaban laborar en Lima. Esto se asoció según si tuvieron un accidente laboral y se ajustó por otras variables. Resultados de los 124 médicos el 63% fueron hombres (78). La mediana de edad fue de 26 años (rango intercuartílico: 25-27 años). Después de su SERUMS, el 12% (15) manifestó que cambió su interés y que deseaba trabajar en la capital. En el análisis multivariado, haber tenido un accidente laboral disminuyó la frecuencia del cambio de intención de trabajo en el PNA (RPa: 0.28, IC 95%: 0.14-0.54, p < 0,001), ajustado por ocho variables. Conclusiones en un estudio previo los accidentes laborales disminuyeron la frecuencia de trabajar en provincias, pero nuestro estudio dice lo contrario, posiblemente por la percepción de que un trabajo en la capital del país permite estar más cerca de los servicios para ser atendido en caso de cualquier emergencia. PMID:29190859

  16. PubMed

    Gómez, Luis Alberto; Montoya, Gladis; Rivera, Hernán Mauricio; Hernández, Juan Carlos

    2017-04-01

    Introducción. El virus del Zika (ZIKV) es un flavivirus con envoltura, transmitido a los seres humanos principalmente por el vector Aedes aegypti. La infección por ZIKV se ha asociado con un gran neurotropismo y con efectos neuropáticos, como el síndrome de Guillain-Barré en el adulto y la microcefalia fetal y posnatal, así como con un síndrome de infección congénita similar al producido por el virus de la rubéola (RV).Objetivo. Comparar las estructuras moleculares de la proteína de envoltura E del virus del Zika (E-ZIKV) y de la E1 del virus de la rubéola (E1-RV), y plantear posibles implicaciones en el neurotropismo y en las alteraciones del sistema nervioso asociadas con el ZIKV.Materiales y métodos. La secuencia de aminoácidos de la proteína E-ZIKV (PDB: 5iZ7) se alineó con la de la glucopreteína E1 del virus de la rubéola (PDB: 4ADG). Los elementos de la estructura secundaria se determinaron usando los programas Vector NTI Advance®, DSSP y POSA, así como herramientas de gestión de datos (AlignX®). Uno de los criterios principales de comparación y alineación fue la asignación de residuos estructuralmente equivalentes, con más de 70 % de identidad.Resultados. La organización estructural de la proteína E-ZIKV (PDB: 5iZ7) fue similar a la de E1-RV (PDB: 4ADG) (70 a 80 % de identidad), y se observó una correspondencia con la estructura definida para las glucoproteínas de fusión de membrana de clase II de los virus con envoltura. E-ZIKV y E1-RV exhibieron elementos estructurales de fusión muy conservados en la región distal del dominio II, asociados con la unión a los receptores celulares de entrada del virus de la rubéola (glucoproteína de mielina del oligodendrocito, Myelin Oligodendrocyte Glycoprotein, MOG), y con los receptores celulares Axl del ZIKV y de otros flavivirus.Conclusión. La comparación de las proteínas E-ZIKV y E1-RV es un paso necesario hacia la definición de otros factores moleculares determinantes del neurotropismo y la patogenia del ZIKV, el cual puede contribuir a generar estrategias de diagnóstico, prevención y tratamiento de las complicaciones neurológicas inducidas por el ZIKV.

  17. Inclusion of Visually Impaired in the School Programme Scheduled Visit of the Museu de Astronomia e Ciências Afins (MAST). (Breton Title: Inclusão de Deficientes Visuais no Programa de Visita Escolar Programada do Museu de Astronomia e Ciências Afins (MAST).) Inclusión de Discapacitados Visuales en el Programa Escolar Programado del Museo de Astronomía y Ciencias Afines (MAST)

    NASA Astrophysics Data System (ADS)

    de Oliveira Gonçalves, Carla; da Conceição Barbosa-Lima, Maria

    2013-07-01

    Inclusive Education in Brazil, contemplated in the 1988 Constitution and in the Law of Guidelines and Bases of National Education (9.394/96) highlights the importance and urgency of promoting inclusive education as a formative element of nationality. Inclusive Education refers to all people who are struggling in school. Inclusion should be in all educational institutions (formal and informal). Our goal in the graduation final task was to report the experience of mediation to visually impaired students of the Instituto Benjamin Constant (IBC) at the Museu de Astronomia e Ciências Afins (MAST), and also suggest some modifications and present new proposals for the School Visit Program (VEP) through a specially constructed apparatus, where the sky can be sensed near the latitude of Rio de Janeiro. A educação inclusiva no Brasil, contemplada na Constituição de 1988 e a Lei de Diretrizes e Bases da Educação Nacional (9.394/96), destaca a importância e urgência de se promover a inclusão escolar como elemento formador da nacionalidade. A educação inclusiva diz respeito a todas as pessoas que enfrentam dificuldades na escola. A inclusão deve estar em todas as instituições educacionais (formais e não formais). Nosso objetivo, no trabalho de final de curso de licenciatura, foi apresentar o relato de experiência de mediação aos alunos deficientes visuais do Instituto Benjamin Constant (IBC) no Museu de Astronomia e Ciências Afins (MAST), as modificações e novas propostas para o Programa de Visita Escolar Programada (VEP) através de um aparelho especialmente construído onde se pode perceber o céu na latitude próxima a do Rio de Janeiro. La educación inclusiva en el Brasil, contemplada en la Constitución de 1988 y en la Ley de Directrices y Bases de la Educación Nacional (9.394/96), destaca la importancia y la urgencia de promover la inclusión escolar como elemento formador de la nacionalidad. La educación inclusiva se refiere a todas las personas que enfrentan dificultades en la escuela. La inclusión debe estar en todas las instituciones educacionales (formales o no). Nuestro objetivo en el trabajo de final de curso de licenciatura, fue el de presentar un relato de la experiencia de mediación a los alumnos con deficiencias visuales del Instituto Benjamin Constant (IBC) en el Museo de Astronomía y Ciencias Afines (MAST) y las modificaciones y nuevas propuestas para el Programa de Visita Escolar Programada (VEP) a través de un aparato especialmente construido con el cual se puede percibir el cielo en una latitud próxima a la de Rio de Janeiro.

  18. Astronomía para ciegos y amblíopes. Proyecto de construcción de un planetario especial en la ciudad de Mar del Plata

    NASA Astrophysics Data System (ADS)

    Musso, S.

    ?`Qué es la Astronomía para Ciegos?. El trabajo es una adaptación en base a la escala de magnitudes de Hipparco que cambia el concepto de luz por una adaptación sonora, donde las estrellas de magnitud 6 se escuchan en 10 dB, más o menos lo que consideramos el umbral de la audición humana. Quienes no escuchan muy bien no pueden escuchar las magnitudes 6, de la misma manera que muchos de nosotros, que no poseemos una visión perfecta, no podemos observar esas mismas estrellas en el cielo (más allá de la polución). A los astros de magnitud 5 vamos a relacionarlos a un sonido en 20 dB. Y así sucesivamente. También los colores estarán representados en una convención de graves a agudos y lo mismo algunas características del cielo. Por ejemplo, la Vía Láctea se mostrará como un ``ruido", como bien nos lo hicieron ver nuestros futuros destinatarios. En Mar del Plata nos encontramos ya trabajando en un proyecto que tiene como objetivo final la construcción del Primer Planetario Acústico del Mundo, una herramienta para la enseñanza de la astronomía, un espacio para la lucha contra la discriminación del discapacitado y una posibilidad de ``ver el cielo de un modo diferente".

  19. Analysis of density and epitopes of D antigen on the surface of erythrocytes from DEL phenotypic individuals carrying the RHD1227A allele.

    PubMed

    Gu, Juan; Sun, An-Yuan; Wang, Xue-Dong; Shao, Chao-Peng; Li, Zheng; Huang, Li-Hua; Pan, Zhao-Lin; Wang, Qing-Ping; Sun, Guang-Ming

    2014-04-01

    The characteristics of the D antigen are important as they influence the immunogenicity of D variant cells. Several studies on antigenic sites have been reported in normal D positive, weak D and partial D cases, including a comprehensive analysis of DEL types in Caucasians. The aim of this study was to assess D antigen density and epitopes on the erythrocyte surface of Asian type DEL phenotypic individuals carrying the RHD1227A allele in the Chinese population. A total of 154 DEL phenotypic individuals carrying the RHD1227A allele were identified through adsorption and elution tests and polymerase chain reaction analysis with sequence-specific primers in the Chinese population. D antigen density on the erythrocyte surface of these individuals was detected using a flow cytometric method. An erythrocyte sample with known D antigen density was used as a standard. Blood samples from D-negative and D-positive individuals were used as controls. In addition, D antigen epitopes on the erythrocyte surface of DEL individuals carrying the RHD1227A allele were investigated with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. The means of the median fluorescence intensity of D antigen on the erythrocyte membrane surface of D-negative, D-positive and DEL individuals were 2.14±0.25, 193.61±11.43 and 2.45±0.82, respectively. The DEL samples were estimated to have approximately 22 D antigens per cell. The samples from all 154 DEL individuals reacted positively with 18 monoclonal anti-D antibodies specific for different D antigen epitopes. In this study, D antigen density on the erythrocyte surface of DEL individuals carrying the RHD1227A allele was extremely low, there being only very few antigenic molecules per cell, but the D antigen epitopes were grossly complete.

  20. Modos de produccion cientifica: Culturas y metodologias de investigacion en la Universidad de Cadiz

    NASA Astrophysics Data System (ADS)

    Gonzalez Ramos, Ana M.

    2004-12-01

    Este trabajo de investigacion supone un modelo teorico de caracter aplicado, que proporciona la oportunidad de evaluar la produccion cientifica de los investigadores. Se encuadra dentro de la tradiccion de la estadistica aplicada y la sociologia del conocimiento. Atiende especialmente a dos conjuntos de temas de interes, por una parte, las caracteristicas principales que determinan el nivel y tipo de produccion academica producida por las unidades de investigacion y por los propios investigadores; por otra, la utilizacion que se hace de los metodos y tecnicas de investigacion puesto que de ello tambien depende el modo de produccion cientifica. Los puntos novedosos de esta tesis son: la medicion cuantitativa del objeto de estudio, la suma de los productos y las condiciones externas a la produccion del conocimiento mas otros elementos internos como las caracteristicas de los investigadores y la metodologia utilizada para desarrollar sus trabajos; y, finalmente, el uso de las nuevas tecnologias. El aprovechamiento de los recursos estadisticos y las fuentes de informacion secundarias se complementan con el diseno propio de una encuesta donde se implementa las caracteristicas descritas en un capitulo anterior sobre los metodos cientificos mas idoneos descritos en los principales manuales y articulos cientificos desde distintas disciplinas de conocimiento. Dicha encuesta ha sido desarrollada como un programa propio y en base a los mas innovadores usos de la tecnologia en la metodologia de encuestas.

  1. Effective Universal Coverage of Diabetes Mellitus Type 2 in Chile.

    PubMed

    Guerrero-Núñez, Sara; Valenzuela-Suazo, Sandra; Cid-Henríquez, Patricia

    2017-04-06

    determine the prevalence of Effective Universal Coverage of Diabetes Mellitus Type 2 in Chile and its relation with the variables: Health Care Coverage of Diabetes Mellitus Type 2; Average of diabetics with metabolic control in 2011-2013; Mortality Rate for Diabetes Mellitus; and Percentage of nurses participating in the Cardiovascular Health Program. cross-sectional descriptive study with ecological components that uses documentary sources of the Ministry of Health. It was established that there is correlation between the Universal Effective Coverage of Diabetes Mellitus Type 2 and the independent variables; it was applied the Pearson Coefficient, being significant at the 0.05 level. in Chile Universal Health Care Coverage of Diabetes Mellitus Type 2 (HbA1c<7% estimated population) is less than 20%; this is related with Mortality Rate for Diabetes Mellitus and Percentage of nurses participating in the Cardiovascular Health Program, being significant at the 0.01 level. effective prevalence of Universal Health Coverage of Diabetes Mellitus Type 2 is low, even though some regions stand out in this research and in the metabolic control of patients who participate in health control program; its relation with percentage of nurses participating in the Cardiovascular Health Program represents a challenge and an opportunity for the health system. determinar a prevalência de Cobertura Universal Efetiva da Diabetes Mellitus tipo 2 em Chile e sua relação com as variáveis; Cobertura da Diabetes Mellitus tipo 2, Média de diabéticos com controle metabólico em 2011-2013, Taxa de Mortalidade por Diabetes Mellitus e Percentagem de participação de enfermeiras no Programa de Saúde Cardiovascular. estudo descritivo transversal com componentes ecológicos, utilizando fontes documentais do Ministério da Saúde. Foi estabelecida correlação entre Cobertura Universal Efetiva da Diabetes Mellitus tipo 2 e as variáveis independentes, aplicando o Coeficiente de Pearson, sendo significante ao 0,05. no Chile a Cobertura Universal Efetiva da Diabetes Mellitus tipo 2 (HbA1c<7% em população estimada) é menor que 20%. Esta se relaciona com uma Taxa de Mortalidade por Diabetes Mellitus e Percentagem de participação de enfermeiras no Programa de Saúde Cardiovascular, que ademais é significativa ao 0,01. a prevalência de Cobertura Universal Efetiva da Diabetes Mellitus tipo 2 é baixa, mesmo quando algumas regiões se destacam nas pesquisas e no controle metabólico de pacientes assistentes ao controle. Sua relação com a Percentagem de participação de enfermeiras no Programa de Saúde Cardiovascular se constitui em um desafio e oportunidade em saúde. determinar la prevalencia de la Cobertura Universal Efectiva de la diabetes mellitus tipo 2 en Chile y su relación con las variables: Cobertura de Diabetes Mellitus tipo 2, Promedio de diabéticos con control metabólico en 2011-2013, Tasa de Mortalidad por Diabetes Mellitus y Porcentaje de participación de enfermeros en el Programa de Salud Cardiovascular. estudio descriptivo transversal con componentes ecológicos, utilizando fuentes documentales del Ministerio de Salud. Se estableció que existe correlación entre la Cobertura Universal Efectiva de la Diabetes Mellitus tipo 2 y las variables independientes, aplicando el Coeficiente de Pearson, siendo significativa al nivel 0,05. en Chile la Cobertura Universal Efectiva de Diabetes Mellitus tipo 2 (HbA1c<7% en población estimada) es menor que 20%; esta se relaciona con la Tasa de Mortalidad por Diabetes Mellitus y con el Porcentaje de participación de enfermeras en el Programa de Salud Cardiovascular, que es significativa al nivel 0,01. la prevalencia de Cobertura Universal Efectiva de la Diabetes Mellitus tipo 2 es baja; sin embargo algunas regiones se destacan en la cobertura y en el control metabólico de pacientes que participan del control de salud. La relación de la cobertura con el porcentaje de participación de enfermeras en el Programa de Salud Cardiovascular es un desafío y una oportunidad en salud.

  2. [Injecting without getting infected: injectors' strategies to prevent HIV and HCV.

    PubMed

    Mateu-Gelabert, P; Friedman, S; Sandoval, M

    2007-10-01

    OBJETIVO: Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. MATERIAL Y M#ENTITYSTARTX000E9;TODOS: Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. RESULTADOS: La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c) seguir sin infectarse por el VIH (sólo un doble negativo tuvo un amplio conocimiento sobre la hepatitis C). Estas intencionalidades no son mutuamente excluyentes. La presencia de varias refuerza la puesta en práctica a diario de comportamientos que pueden ayudar al que se inyecta a mantenerse libre de infecciones durante años. Algunas prácticas que hemos identificado se implementan en grupo y se comunican de UDI a UDI, de esta manera se extienden entre algunas redes sociales de UDI. CONCLUSIONES: Los UDI que permanecen sin infectarse planean e implementan estrategias de prevención en circunstancias donde otros UDI aplican prácticas de riesgo. El mantenimiento de la no infección no es, por lo tanto, un resultado del azar, sino más bien el resultado del esfuerzo (agencia) de los UDI. Investigar y extender estas estrategias y tácticas a través de programas de prevención podría contribuir a la prevención del VIH y el VHC.

  3. Pincharse sin infectarse: estrategias para prevenir la infección por el VIH y el VHC entre usuarios de drogas inyectables

    PubMed Central

    MATEU-GELABERT, P.; FRIEDMAN, S.; SANDOVAL, M.

    2011-01-01

    Resumen Objetivo Desde principios de los noventa, en la ciudad de Nueva York se han implementado con éxito programas para reducir la incidencia del virus de la inmunodeficiencia humana (VIH) y, en menor medida, del virus de la hepatitis C (VHC). A pesar de ello, aproximadamente el 70% de los usuario de drogas inyectables (UDI) están infectados por el VHC. Queremos investigar cómo el 30% restante se las ha arreglado para no infectarse. El Staying safe (nombre original del estudio) explora los comportamientos y mecanismos que ayudan a evitar la infección por el VHC y el VIH a largo plazo. Material y métodos Hemos utilizado el concepto de «desviación positiva» aplicado en otros campos de salud pública. Estudiamos las estrategias, prácticas y tácticas de prevención de aquellos UDI que, viviendo en contextos de alta prevalencia, se mantienen sin infectar por VIH y el VHC, a pesar de haberse inyectado heroína durante años. Los resultados preliminares presentados en este artículo incluyen el análisis de las entrevistas realizadas a 25 UDI (17 doble negativos, 3 doble positivos y 5 con infección por el VHC y sin infección por el VIH). Se usaron entrevistas semiestructuradas que exploraban con detalle la historia de vida de los sujetos, incluyendo su consumo de drogas, redes sociales, contacto con instituciones, relaciones sexuales y estrategias de protección y vigilancia. Resultados La intencionalidad es importante para no infectarse, especialmente durante períodos de involución (períodos donde hay un deterioro económico y/o social que llevan al que se inyecta a situaciones de mayor riesgo). Presentamos tres dimensiones independientes de intencionalidad que conllevan comportamientos que pueden ayudar a prevenir la infección: a) evitar «el mono» (síntomas de abstención) asegurando el acceso a la droga; b) «llevarlo bien» para no convertirse en un junkie y así evitar la «muerte social» y la falta de acceso a los recursos, y c) seguir sin infectarse por el VIH (sólo un doble negativo tuvo un amplio conocimiento sobre la hepatitis C). Estas intencionalidades no son mutuamente excluyentes. La presencia de varias refuerza la puesta en práctica a diario de comportamientos que pueden ayudar al que se inyecta a mantenerse libre de infecciones durante años. Algunas prácticas que hemos identificado se implementan en grupo y se comunican de UDI a UDI, de esta manera se extienden entre algunas redes sociales de UDI. Conclusiones Los UDI que permanecen sin infectarse planean e implementan estrategias de prevención en circunstancias donde otros UDI aplican prácticas de riesgo. El mantenimiento de la no infección no es, por lo tanto, un resultado del azar, sino más bien el resultado del esfuerzo (agencia) de los UDI. Investigar y extender estas estrategias y tácticas a través de programas de prevención podría contribuir a la prevención del VIH y el VHC. PMID:21915175

  4. PubMed

    López, Ana Cristina; Cecchetto, Eugenio; Aguirre, Ana Noemí; Ontiveros, Marina Celeste; Roitter, Claudia Valentina; Garcia, Adelaida Judith; Bernet, Jorgelina; Aguirre, Jorge Alberto

    2018-03-23

    El objetivo del estudio fue describir características clínicas, sociodemográficas y hábitos en adultos con diabetes mellitus y estudiar su asociación con la calidad de vida relacionada con la salud. Se seleccionó una muestra de 311 pacientes del Programa de Diabetes de una obra social universitaria, de la provincia de Córdoba. Se analizaron los datos a como proporciones y los componentes físico y mental del cuestionario SF-36® . El 57,4% alcanzó un nivel de instrucción terciario o universitario. La hipertensión arterial fue el factor de riesgo cardiovascular más prevalente (86,8%), seguida por dislipemia (50,6%) y obesidad (46,5%). El 24,8% tenía complicación macrovascular y el 29% microvascular. En el componente físico (CF) de calidad de vida las mujeres tuvieron una chance 4,2 veces mayor de reportar un valor inferior en relación a los varones. Entre los 50 y los 70 años se triplicó y los mayores de  70 años tuvieron 4 veces peor una puntuación en el CF respecto a los más jóvenes. Las complicaciones macro y microvasculares y los que reportaron menos de 2 hábitos de vida saludables tuvieron el doble de chances de puntuar por debajo del promedio general en el CF. La asociación entre complicaciones y peor calidad de vida es un motivo más para alcanzar un buen control metabólico, optimizar el manejo de factores de riesgo, evitando o retrasando la aparición de complicaciones.

  5. PubMed

    Contreras, Kateir; Vargas, María José; García, Paola; González, Camilo A; Rodríguez, Patricia; Castañeda-Cardona, Camilo; Otálora-Esteban, Margarita; Rosselli, Diego

    2018-03-15

    Introducción. El citomegalovirus es la causa más frecuente de infección en pacientes con trasplante renal. Existen dos estrategias de similar efectividad para prevenirlo: la profilaxis universal con valganciclovir durante 90 días o el tratamiento anticipado verificando la carga viral semanal y aplicándolo solo si esta es positiva.Objetivo. Determinar cuál de estas dos estrategias sería más costo-efectiva en pacientes de riesgo intermedio en Colombia.Materiales y métodos. Se diseñó un árbol de decisiones bajo la perspectiva del tercer pagador considerando únicamente los costos médicos directos en pesos colombianos (COP) del 2014 durante un periodo de un año en una población de pacientes con riesgo intermedio para citomegalovirus (donante positivo y receptor positivo, o donante negativo y receptor positivo). Las probabilidades de transición se extrajeron de los estudios clínicos y se validaron con expertos mediante el método Delphi.Los costos de los procedimientos se basaron en el manual tarifario ISS 2001, con un incremento del 33 % a partir del índice de precios al consumidor (IPC) en salud de 2014, en tanto que los de los medicamentos se extrajeron de las circulares del Ministerio de Salud y del Sistema de Información de Medicamentos (Sismed).Resultados. La profilaxis universal con valganciclovir resultó ser menos costosa y se asoció con una menor probabilidad de infección. El costo promedio del primer año de tratamiento anticipado sería de COP$ 30'961.290, mientras que el universal sería de COP$ 29'967.834, es decir, un costo 'incremental' de COP$ 993.456.Conclusiones. Para los pacientes de riesgo intermedio con trasplante renal en Colombia, la profilaxis universal es la mejor estrategia por ser menos costosa y reducir el riesgo de infección.

  6. Adaptación al español y validación de criterio de una escala para la tamización de problemas emocionales y del comportamiento en la primera infancia.

    PubMed

    Cano, Luz Helena; Acosta, María Natalia; Pulido, Adriana

    2018-05-01

    Introducción. La detección temprana del riesgo de problemas emocionales y del comportamiento en niños puede contribuir al desarrollo de estrategias que promuevan la salud mental desde la primera infancia. En Colombia no existe una herramienta validada para dicha detección.Objetivos. Seleccionar, adaptar y establecer la validez de criterio de una escala de tamización de problemas emocionales y del comportamiento en niños menores de seis años.Materiales y métodos. A partir de una revisión de la literatura y un consenso de expertos, se seleccionó la herramienta Early Childhood Screening Assessment (ECSA). Posteriormente, se llevó a cabo su adaptación lingüística y se determinó la validez de criterio mediante una curva de características de recibidor-operador (Receiver Operating Characteristic, ROC), y se la comparó con el cuestionario Child Behavior Checklist (CBCL 1,5-5). En el estudio participaron 206 cuidadores de niños entre el año y medio y los seis años de edad de la ciudad de Tunja y el municipio de Sopó.Resultados. La puntuación del ECSA presentó una buena correlación con la puntuación t total del CBCL 1,5-5 (ro de Spearman=0,75; p<0,01). La escala ECSA tuvo una sensibilidad de 86 % y una especificidad de 82 % al establecer un punto de corte de 24 para la población estudiada.Conclusión. En este primer estudio de adaptación y validación de la versión en español de la escala ECSA, se detectaron buenos valores de sensibilidad y especificidad para la tamización de problemas emocionales y del comportamiento en la primera infancia.

  7. The effect of the common c.2299delG mutation in USH2A on RNA splicing.

    PubMed

    Lenassi, Eva; Saihan, Zubin; Bitner-Glindzicz, Maria; Webster, Andrew R

    2014-05-01

    Recessive variants in the USH2A gene are an important cause of both Usher syndrome and nonsyndromic retinitis pigmentosa. A single base-pair deletion in exon 13 (c.2299delG, p.Glu767Serfs*21) is considered the most frequent mutation of USH2A. It is predicted to generate a premature termination codon and is presumed to lead to nonsense mediated decay. However the effect of this variant on RNA has not been formally investigated. It is not uncommon for exonic sequence alterations to cause aberrant splicing and the aim of the present report is to evaluate the effect of c.2299delG on USH2A transcripts. Nasal cells represent the simplest available tissue to study splicing defects in USH2A. Nasal brushing, RNA extraction from nasal epithelial cells and reverse transcription PCR were performed in five Usher syndrome patients who were homozygous for c.2299delG, two unaffected c.2299delG heterozygotes and seven control individuals. Primers to amplify between exons 12 and 15 and exons 10 and 14 were utilised. Significant variability was observed between different RT-PCR experiments. Importantly, in controls, PCR product of the expected size were amplified on all occasions (13/13 experiments); for patients this was true in only 4/14 experiments (Fisher exact test p = 0.0002). Bioinformatics tools predict the c.2299delG change to disrupt an exonic splicing enhancer and to create an exonic splicing silencer within exon 13. Here, we report an effect of the common c.2299delG mutation on splicing of exons 12 and 13 of USH2A. Future studies are expected to provide important insights into the contribution of this effect on the phenotype. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Species identification in forensic samples using the SPInDel approach: A GHEP-ISFG inter-laboratory collaborative exercise.

    PubMed

    Alves, Cíntia; Pereira, Rui; Prieto, Lourdes; Aler, Mercedes; Amaral, Cesar R L; Arévalo, Cristina; Berardi, Gabriela; Di Rocco, Florencia; Caputo, Mariela; Carmona, Cristian Hernandez; Catelli, Laura; Costa, Heloísa Afonso; Coufalova, Pavla; Furfuro, Sandra; García, Óscar; Gaviria, Anibal; Goios, Ana; Gómez, Juan José Builes; Hernández, Alexis; Hernández, Eva Del Carmen Betancor; Miranda, Luís; Parra, David; Pedrosa, Susana; Porto, Maria João Anjos; Rebelo, Maria de Lurdes; Spirito, Matteo; Torres, María Del Carmen Villalobos; Amorim, António; Pereira, Filipe

    2017-05-01

    DNA is a powerful tool available for forensic investigations requiring identification of species. However, it is necessary to develop and validate methods able to produce results in degraded and or low quality DNA samples with the high standards obligatory in forensic research. Here, we describe a voluntary collaborative exercise to test the recently developed Species Identification by Insertions/Deletions (SPInDel) method. The SPInDel kit allows the identification of species by the generation of numeric profiles combining the lengths of six mitochondrial ribosomal RNA (rRNA) gene regions amplified in a single reaction followed by capillary electrophoresis. The exercise was organized during 2014 by a Working Commission of the Spanish and Portuguese-Speaking Working Group of the International Society for Forensic Genetics (GHEP-ISFG), created in 2013. The 24 participating laboratories from 10 countries were asked to identify the species in 11 DNA samples from previous GHEP-ISFG proficiency tests using a SPInDel primer mix and control samples of the 10 target species. A computer software was also provided to the participants to assist the analyses of the results. All samples were correctly identified by 22 of the 24 laboratories, including samples with low amounts of DNA (hair shafts) and mixtures of saliva and blood. Correct species identifications were obtained in 238 of the 241 (98.8%) reported SPInDel profiles. Two laboratories were responsible for the three cases of misclassifications. The SPInDel was efficient in the identification of species in mixtures considering that only a single laboratory failed to detect a mixture in one sample. This result suggests that SPInDel is a valid method for mixture analyses without the need for DNA sequencing, with the advantage of identifying more than one species in a single reaction. The low frequency of wrong (5.0%) and missing (2.1%) alleles did not interfere with the correct species identification, which demonstrated the advantage of using a method based on the analysis of multiple loci. Overall, the SPInDel method was easily implemented by laboratories using different genotyping platforms, the interpretation of results was straightforward and the SPInDel software was used without any problems. The results of this collaborative exercise indicate that the SPInDel method can be applied successfully in forensic casework investigations. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Eclipse parcial de Luna - 23-24 de Marzo de 1997

    NASA Astrophysics Data System (ADS)

    Arquiola, A. P.; Arquiola, F. E.

    Luego de varios años en que las condiciones climáticas no nos permitían registrar el fenómeno, pudimos observar y realizar secuencias fotográficas del eclipse parcial Luna. Siendo de una magnitud de 0.92 (muy cercano a la totalidad) se obtuvo una serie de fotografías muy claras y preferentemente con gran contraste a fin de destacar las tonalidades de las sombras, en especial la penumbra, que desde ya el clima nos favoreció. Los métodos fotográficos fueron, en primer lugar, con telezoom de 210mm a f/4.5 con película color de 1600 ASA; y el ya clásico método a foco primario en el Telescopio Schmidt - Cassegrain de 200mm a f/10. Paralelamente a la observación del eclipse, estábamos al instante comunicados por correo electrónico con otros observadores desde diferentes lugares del mundo intercambiando reportes, y también usuarios en general de la red, de esta forma se hizo muy especial el fenómeno. Instrumentos utilizados : Telescopio Schmidt-Cassegrain 200mm f/10, Cámara fotográfica Minolta con Telezoom 210mm f/4.5, Película 1600 ASA color, Telescopio Refractor 80mm a f/15

  10. Descompresión microvascular en neuralgia del trigémino: Reporte de 36 casos y revisión de la literatura

    PubMed Central

    Campero, Alvaro; Ajler, Pablo; Campero, Abraham Agustín

    2014-01-01

    Objetivo: El propósito del presente trabajo es presentar los resultados de 36 pacientes con diagnóstico de neuralgia del trigémino (NT), en los cuales se realizó una descompresión microvascular (DMV). Material y Método: Desde junio de 2005 a mayo de 2012, 36 pacientes con diagnóstico de NT fueron operados por el primer autor (AC), realizando una DMV. Se evaluó: Edad, sexo, tiempo de sintomatología previo a la cirugía, hallazgos intraoperatorios (a través de los videos quirúrgicos), y resultados postoperatorios. Resultados: De los 36 pacientes operados, 25 fueron mujeres y 11 varones. El promedio de edad fue de 48 años. El seguimiento postoperatorio fue en promedio de 38 meses. De los 36 pacientes, 32 (88%) evolucionaron sin dolor hasta la fecha. De los 4 casos con recurrencia de dolor, en dos pacientes se observó como hallazgo intraoperatorio un conflicto venoso. Conclusión: La DMV como tratamiento de la NT es un procedimiento efectivo y seguro. El hallazgo intraoperatorio de una “compresión” venosa podría indicar una evolución postoperatoria desfavorable. PMID:25379343

  11. Democratic Security and Defense Policy: A Successful Counterinsurgency Model

    DTIC Science & Technology

    2012-06-08

    Nueva Colombia, “ Programa Agrario de los Guerrilleros de las FARC,” Mbolivariano.blogspot.com, http://mbolivariano.blogspot. com/2007/12/ programa ...Conferencias de FARC.” Archivo Chile . http://www. Archivochile. Com/america_latina/doc_paises_al/co/farc/ al_farc0003. Pdf (accessed 24 September 2011... Programa Agrario de los Guerrilleros de las FARC.” Mbolivariano.blogspot.com, http://mbolivariano.blogspot. com/2007/12/ programa -agrario- de -los

  12. Marine hydrogeology: recent accomplishments and future opportunities

    NASA Astrophysics Data System (ADS)

    Fisher, A. T.

    2005-03-01

    Marine hydrogeology is a broad-ranging scientific discipline involving the exploration of fluid-rock interactions below the seafloor. Studies have been conducted at seafloor spreading centers, mid-plate locations, and in plate- and continental-margin environments. Although many seafloor locations are remote, there are aspects of marine systems that make them uniquely suited for hydrologic analysis. Newly developed tools and techniques, and the establishment of several multidisciplinary programs for oceanographic exploration, have helped to push marine hydrogeology forward over the last several decades. Most marine hydrogeologic work has focused on measurement or estimation of hydrogeologic properties within the shallow subsurface, but additional work has emphasized measurements of local and global fluxes, fluid source and sink terms, and quantitative links between hydrogeologic, chemical, tectonic, biological, and geophysical processes. In addition to summarizing selected results from a small number of case studies, this paper includes a description of several new experiments and programs that will provide outstanding opportunities to address fundamental hydrogeologic questions within the seafloor during the next 20-30 years. L'hydrogéologie marine est une large discipline scientifique impliquant l' exploration des interactions entre les fluides et les roches sous les fonds marins. Des études ont été menées dans les différents environnements sous-marins (zone abyssale, plaque océanique, marges continentales). Bien que de nombreux fonds marins soient connus, il existe des aspects des systèmes marins qui les rendent inadaptés à l'analyse hydrologique. De nouveaux outils et techniques, et la mise en oeuvre de nombreux programmes multidisciplinaires d'exploration océanographique, ont aidé à pousser en avant l'hydrogéologie marine ces dix dernières années. La plus part des études hydrogéologiques se sont concentrées jusqu'à présent sur la mesure ou l'estimation des propriétés à la sub-surface des fonds marins, et des travaux complémentaires ont mis en valeur les mesures de flux, local ou global, de termes « sources » et « pertes », et des liens quantitatifs entre l'hydrogéologie, la chimie, la tectonique, la biologie, et les processus géophysiques. Cet article vise à résumer des résultats sélectionnés parmi un petit nombre d'études, et à décrire plusieurs nouvelles expériences et programmes, qui sont autant d'opportunités pour répondre aux questions fondamentales relatives aux fonds marins, posées ces dernières 20-30 années. La hidrogeología marina es una disciplina científica de amplios alcances que involucra la exploración de interacciones fluido-roca por debajo del fondo del mar. Se han llevado a cabo estudios en centros de expansión del fondo del mar, lugares en medio de una placa, y en ambientes de placa y margen continental. Aunque muchos sitios en el fondo del mar son remotos, existen aspectos de estos sistemas marinos que los hacen particularmente adaptables para análisis hidrológico. Nuevas técnicas y herramientas desarrolladas, y el establecimiento de varios programas multidisciplinarios para exploración oceanográfica, han ayudado a impulsar la hidrogeología marina hacia delante durante las ultimas décadas. La mayor parte del trabajo hidrogeológico marino se ha enfocado en la medición o estimación de propiedades hidrogeológicas dentro del subsuelo superficial, pero trabajo adicionalha enfatizado mediciones de flujos globales y locales, términos de fuente y sumidero de fluidos, y vínculos cuantitativos entre procesos hidrogeológicos, químicos, tectónicos, biológicos y geofísicos. Además de resumir resultados seleccionados de un número pequeño de estudios de caso, este artículo incluye una descripción de varios programas y experimentos nuevos que aportarán oportunidades excepcionales para dirigir preguntas hidrogeológicas fundamentales dentro del fondo oceánico durante los siguientes 20-30 años.

  13. Regiones de formación de estrellas masivas en las Nubes de Magallanes

    NASA Astrophysics Data System (ADS)

    Barbá, R.; Maíz Apellániz, J.; Rubio, M.; Walborn, N.

    Las Nubes de Magallanes son un laboratorio formidable para el estudio de regiones de formación estelar. A diferencia de lo que sucede en el plano galáctico, ambas galaxias contienen poco polvo que nos afecte la visión directa de dichas regiones. Por otra parte, la menor metalicidad de las Nubes, nos permiten hacer un estudio comparativo de la formación estelar en ambientes de baja metalicidad. El presente trabajo da una revisión de los progresos notables que hemos alcanzado en el conocimiento del contenido estelar de algunas regiones de formación de estrellas masivas en ambas Nubes, en base a la utilización de imágenes del Telescopio Espacial Hubble, Gemini Sur, y Very Large Telescope, entre otros. En especial, nos concentramos en 30 Doradus y N11 en la Nube Mayor, y en NGC 346 en la Nube Menor. Nuevas imágenes de N11 obtenidas en los últimos meses con la Advanced Camera for Surveys del Hubble (óptico), y con Flamingos en Gemini Sur (infrarrojo), nos han permitido descubrir un nuevo `jet' con origen en una fuente infrarroja sumergida en un pilar polvoriento similar al objeto Herbig-Haro de M20 en nuestra galaxia. Este `jet' (junto a otros tres que hemos descubierto en 30 Doradus), es el cuarto ejemplo confirmado de `jet' asociado a una protoestrella fuera de nuestra galaxia. Además, presentamos el descubrimiento del primer objeto estelar joven masivo de la Nube Menor confirmado espectroscópicamente.

  14. Descripción del coronógrafo a ser instalado en Argentina (MICA)

    NASA Astrophysics Data System (ADS)

    Stenborg, G.; Francile, C.; Schwenn, R.; Epple, A.; Rovira, M.

    El ``Coronógrafo de espejo para Argentina'' es un telescopio solar terrestre a ser colocado en el Observatorio Astronómico Félix Aguilar (El Leoncito), antes de finalizar 1996, como parte de un programa de ciencia bilateral entre Alemania y Argentina. Eclipses fotográficos de alta resolución han revelado que la corona solar es altamente estructurada y variable. De hecho, está contínuamente deformada y moldeada por los movimientos convectivos de los extremos de los arcos magnéticos en la fotosfera, estando, en muchas oportunidades, afectada por explosivas liberaciones de energía. MICA, en conjunción con otros telescopios solares espaciales y terrestres, tratará de contribuir al entendimiento de cuestiones fundamentales de la física solar. Entre ellas: cómo la corona está siendo calentada, dónde y cómo el viento solar es acelerado, qué causa los transitorios coronales, etc. Para ello investigará la distribución de los parámetros del plasma y su evolución con el tiempo, la estructura espacial de la corona en fina y gran escala, procesos que ocurren en los transitorios coronales y factores que los disparan, etc. Para responder a estas cuestiones MICA observará la atmósfera solar por sobre el limbo entre 1.1 y 2 radios solares aproximadamente, usando un nuevo tipo de sistema coronográfico que permite suprimir el brillo del disco solar suficientemente bien, tomando las imágenes con una cámara CCD de 1024x1024 pixels, codificada en 12 bits, pudiendo el mismo ser operado en forma remota. En la presente exposición describiremos las características del instrumento, cómo será controlado y qué esperamos observar basados en las imágenes obtenidas por los telescopios de similares características LASCO C1 a bordo del SOHO y PICO (ubicado en el Observatorio de Pic du Midi, Francia).

  15. Analisis experimental de la propagacion en redes de area corporal para la banda de ultra wideband. experimental characterization of the propagation in ultra wideband body area networks

    NASA Astrophysics Data System (ADS)

    Garcia Serna, Ruben Gregorio

    Diferentes dispositivos capaces de obtener informacion sobre parametros fisiologicos, cinematicos o contextuales del cuerpo pueden interconectarse de manera inalambrica dando lugar a las denominadas Redes de Area Corporal Inalambricas (WBAN, Wireless Body Area Networks). De entre las posibles tecnologias para establecer los enlaces, Ultra Wideband (UWB) esta captando cada vez un mayor interes debido a caracteristicas tales como el bajo nivel de potencia de transmision requerido (bajo nivel de exposicion a campos electromagneticos), el alto ancho de banda disponible y la alta resolucion temporal/espacial. El diseno de sistemas centrados en el cuerpo requiere de modelos de canal que describan de manera precisa la propagacion de senales en este tipo de entornos. Esta tesis se plantea con el objetivo de contribuir al estudio experimental de la propagacion en sistemas centrados en el cuerpo operando en la banda UWB. En primer lugar, se presenta un marco introductorio a las redes WBAN, sus elementos constitutivos, bandas de frecuencia, estandarizacion y modelos de canal. Ademas, se introducen los fundamentos de la tecnologia UWB y sus aplicaciones en este area. Seguidamente, se analiza en terminos de las perdidas de propagacion y la dispersion de retardo la propagacion en el canal off-body entre un transmisor fijo y un dispositivo receptor colocado sobre la superficie del cuerpo de un sujeto. Se considera la influencia de diferentes aspectos, tales como el entorno de medidas, la posicion de colocacion de una antena sobre el cuerpo y la postura adoptada por un sujeto. Finalmente, se analiza el canal de propagacion in-body considerando el movimiento relativo entre dos dispositivos causado por efecto de la respiracion. Las condiciones de propagacion en el interior del cuerpo se emulan por medio de un phantom liquido para UWB y la caracterizacion se plantea tanto en frecuencia, en terminos del modelado de la forma y el ensanchamiento del espectro Doppler, como en tiempo, por medio del estudio de la funcion de autocorrelacion y el tiempo de coherencia del canal.

  16. Establishing the Empirical Relationship Between Non-Science Majoring Undergraduate Learners' Spatial Thinking Skills and Their Conceptual Astronomy Knowledge. (Spanish Title: Estableciendo Una Relación Empírica Entre el Razonamiento Espacial de los Estudiantes de Graduación de Carreras no Científicas y su Conocimento Conceptual de la Astronomía.) Estabelecendo Uma Relação Empírica Entre o RacioCínio Espacial dos Estudantes de Graduação EM Carreiras Não Científicas e Seu Conhecimento Conceitual da Astronomia

    NASA Astrophysics Data System (ADS)

    Heyer, Inge; Slater, Stephanie J.; Slater, Timothy F.

    2013-12-01

    The astronomy education community has tacitly assumed that learning astronomy is a conceptual domain resting upon spatial thinking skills. As a first step to formally identify an empirical relationship, undergraduate students in a non-major introductory astronomy survey class at a mediumsized, Ph.D. granting, mid-western US university were given pre- and post-astronomy conceptual diagnostics and spatial reasoning diagnostics, Instruments used were the "Test Of Astronomy Standards" and "What Do You Know?" Using only fully matched data for analysis, our sample consisted of 86 undergraduate non-science majors. Students' normalized gains for astronomy surveys were low at .26 and .13 respectively. Students' spatial thinking was measured using an instrument designed specifically for this study. Correlations between the astronomy instruments' pre- to post-course gain scores and the spatial assessment instrument show moderate to strong relationships suggesting the relationship between spatial reasoning and astronomy ability can explain about 25% of the variation in student achievement. La comunidad de educación en astronomía ha supuesto de forma tácita que el aprendizaje de la astronomía consiste en un dominio conceptual fundamentado en el razonamiento espacial. Como un primer paso para identificar formalmente una relación empírica entre estas dos cosas, utilizamos como muestra los estudantes de graduación de carreras no científicas de un curso experimental en una universidad norteamericana del medioeste de porte mediano con programa de Doctorado em curso, en el cual estos estudiantes se sometieron a un diagnóstico de razonamiento espacial y conceptos astronómicos antes e después del mismo. Las herramientas utilizadas fueron el Test Of Astronomy Standards (TOAST) y el cuestionario What do you know? Utilizando solo los datos completamente consistentes para este análisis, nuestra muestra consistió en 86 estudantes de graduación. Las mejoras, depués de normalizadas, en el desempeño de los estudiantes en estos dos asuntos foram pequenas, 0.26 e 0.13 respectivamente. El razonamiento espacial de los estudiantes fue medido utilizando un instrumento específico desarrollado para este trabaljo. Las correlaciones entre los resultados de los tests astronómicos y este instrumento específico, antes y después del curso mostraron una relación entre moderada y fuerte, sugiriendo que la relación entre el razonamiento espacial y el conocimiento astronómico puede explicar hasta un 25% de la variación em el desempeño de los estudiantes. A comunidade da educação em astronomia tem suposto de forma implícita que o aprendizado da astronomia consiste em um domínio conceitual fundamentado no raciocínio espacial. Como um primeiro passo para identificar formalmente uma relação empírica entre estas duas coisas, utilizamos como amostra os estudantes de graduação de carreiras não científicas de um curso exploratório em uma universidade norte-americana do meio-oeste de médio porte com programa de Doutorado em andamento, onde estes estudantes foram submetidos a um diagnóstico de raciocino espacial e conceitos astronômicos antes e depois do mesmo. As ferramentas utilizadas foram o Test Of Astronomy Standards (TOAST) e o questionário What do you know? Utilizando somente dados completamente consistentes para esta análise, nossa amostra consistiu de 86 estudantes de graduação. As melhoras, depois de normalizadas, do desempenho dos estudantes nos dois quesitos foram pequenas, 0.26 e 0.13 respectivamente. O raciocínio espacial dos estudantes foi medido utilizando um instrumento específico desenhado para este trabalho. As correlações entre os resultados dos testes astronômicos e este instrumento específico antes e depois do curso mostraram uma relação entre moderada e forte, sugerindo que a relação entre o raciocínio espacial e o conhecimento astronômico pode explicar até um 25% na variação no desempenho dos estudantes.

  17. [Not Available].

    PubMed

    Ballesteros-Pomar, María; Villar-Taibo, Rocío; Calleja-Fernández, Alicia; Pintor-de-la-Maza, Begoña; Álvarez-Del-Campo, Cecilia; Vidal-Casariego, Alfonso; Cano-Rodríguez, Isidoro

    2016-06-03

    Los datos del estudio PREDYCES® nos revelaron que en España la desnutrición relacionada con la enfermedad (DRE) afecta a uno de cada cuatro pacientes hospitalizados. Esta cifra aumenta hasta el 36,8% en los pacientes hematológicos. Se calcula que un 20% de los pacientes oncológicos muere por complicaciones relacionadas con la DRE. Nuestro grupo se planteó en 2011 comenzar la implantación de un cribado nutricional en los servicios con mayor riesgo de DRE. La presente revisión trata de describir todo el proceso que hemos seguido para mejorar la situación nutricional en los pacientes ingresados en el Servicio de Hematología del Complejo Asistencial Universitario de León (CAULE), mayoritariamente con diagnóstico de neoplasias hematológicas. En un primer estudio piloto, detectamos una alta prevalencia de desnutrición, que tendió a aumentar durante la hospitalización. Además, solo el 8,3% los enfermos valorados recibieron algún tipo de soporte nutricional y no se estaban cubriendo sus necesidades ni calóricas ni proteicas, lo que se asociaba a un peor pronóstico. Por este motivo, nos decidimos a implantar de manera sistemática un cribado y una intervención nutricional adecuada, que comenzó en 2011 y que ha recibido el reconocimiento como Buena Práctica del Sistema Nacional de Salud.

  18. INTERVENCIÓN EDUCATIVA EFECTIVA EN VIH PARA MUJERES

    PubMed Central

    Miner, Sarah; Poupin, Lauren; Bernales, Margarita; Ferrer, Lilian; Cianelli, Rosina

    2016-01-01

    RESUMEN En Chile se estima que aproximadamente 38 mil personas viven con el Virus de Inmunodeficiencia Humana [VIH]. En el año 2001, 1.092 mujeres chilenas vivían con VIH, actualmente se cree que hay más de 7.600 mujeres con el virus. Frente a estas cifras surge la necesidad de crear estrategias de prevención dirigidas a mujeres chilenas. Objetivo analizar los estudios ya realizados en la prevención de VIH para determinar qué aspectos se deben incluir en programas exitosos de prevención de VIH en mujeres. Diseño y Método se realizó una revisión de la literatura utilizando la base de datos Proquest, CINAHL, Pubmed y Scielo. Los límites comprendieron: textos completos, de los últimos 10 años, de acceso gratuito y escrito en español o inglés. Se seleccionaron 15 artículos para la revisión. Resultados todos los artículos comprenden la evaluación del efecto de una intervención sobre conocimiento y conductas relacionadas con VIH/SIDA. Catorce muestran resultados significativos en cambios positivos de conducta o conocimientos relacionados con la prevención de VIH. Conclusiones los programas de prevención de VIH en mujeres pueden ser efectivos para lograr cambios de conducta y de conocimiento. Las intervenciones exitosas son aquellas basadas en teorías o modelos de prevención y en cambios de conductas, todas adaptadas a la cultura de la población estudiada. PMID:27667897

  19. [Not Available].

    PubMed

    Villa-González, Emilio; Rodríguez-López, Carlos; Barranco-Ruiz, Yaira; Cabezas-Arévalo, Luis Fabián; Chillón, Palma

    2016-06-30

    Objetivo: analizar la concordancia de dos métodos de medición (Google MapsTM vs. Sistema de Información Geográfica) para la determinación de la distancia desde el domicilio familiar hasta el colegio.Métodos: un total de 542 escolares de entre 8-11 años de edad (media = 9,36 ± 0,6) del sur de España participaron en el estudio, facilitando la dirección de su domicilio familiar. La distancia desde el domicilio familiar al colegio se calculó mediante la utilización de dos programas diferentes:Google MapsTM y Sistema de Información Geográfica (GIS) en ruta y en línea recta. La asociación entre ambos métodos fue analizada utilizando la correlación de Spearman y el grado de acuerdo a través del coeficiente de correlación intraclase (ICC), así como el método Bland Altman.Resultados: la correlación entre ambos métodos de medición propuestos fue muy significativa (r = 0,966, p < 0,001; r = 0,984, p < 0,001; y r = 0,954, p < 0,001, respectivamente), y la concordancia fue excelente (ICC = 0,96, p < 0,001; ICC = 0,92, p < 0,001; ICC = 0,97, p < 0,001).Conclusiones: los métodos de medición estudiados podrían ser utilizados en función de las necesidades de la investigación, al presentar ambos una alta concordancia. Sin embargo, se recomienda la utilización del Sistema de Información Geográfica en ruta si se cuenta con medios yfinanciación, por tratarse de un método constatado en fiabilidad y validez.

  20. Quality management systems for fruit fly (Diptera: Tephritidae) sterile insect technique

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Caceres, C.; Robinson, A.; McInnis, D.

    The papers presented in this issue are focused on developing and validating procedures to improve the overall quality of sterile fruit flies for use in area-wide integrated pest management (AW-IPM) programs with a sterile insect technique (SIT) component. The group was coordinated and partially funded by the Joint FAO/IAEA Programme of Nuclear Techniques in Food and Agriculture, International Atomic Energy Agency, Vienna, Austria, under a five-year Coordinated Research Project (CRP) on 'Quality Assurance in Mass-Reared and Released Fruit Flies for Use in SIT Programmes'. Participants in the CRP from 16 countries came from both basic and applied fields of expertisemore » to ensure that appropriate and relevant procedures were developed. A variety of studies was undertaken to develop protocols to assess strain compatibility and to improve colonization procedures and strain management. Specific studies addressed issues related to insect nutrition, irradiation protocols, field dispersal and survival, field cage behavior assessments, and enhancement of mating competitiveness. The main objective was to increase the efficiency of operational fruit fly programs using sterile insects and to reduce their cost. Many of the protocols developed or improved during the CRP will be incorporated into the international quality control manual for sterile tephritid fruit flies, standardizing key components of the production, sterilization, shipment, handling, and release of sterile insects. (author) [Spanish] Los articulos presentados en este numero se enfocan en el desarrollo y la validacion de procedimientos para mejorar la calidad total de moscas de las frutas esteriles para su uso en programas de manejo integrado de plagas en donde la tecnica del insecto esteril (TIE) es uno de los componentes clave. El grupo fue coordinado y parcialmente financiado por la Division Conjunta de Tecnicas Nucleares para la Alimentacion y la Agricultura de la FAO/OIEA, Viena, Austria, por un periodo de cinco anos bajo el proyecto de Investigacion Coordinada (PIC) sobre 'el Aseguramiento de la Calidad de Moscas de las Frutas Criadas y Liberadas para su Uso en Programas de TIE'. Los participantes en el PIC representan 16 paises con experiencia en campos de investigacion basica y aplicada. Para asegurar que los procedimientos desarrollados fueran apropiados y pertinentes, se realizaron una variedad de estudios para el desarrollo de protocolos para evaluar la compatibilidad y para mejorar los procedimientos de colonizacion y manejo de cepas salvajes. Estudios especificos trataron asuntos relacionados con la nutricion de insectos, los protocolos de irradiacion, la dispersion y supervivencia en el campo, evaluacion del comportamiento en jaulas de campo, y el mejoramiento de la competitividad sexual. Los objetivos fundamentales fueron el aumentar la eficiencia y reducir los costos de los programas operacionales de control de moscas de las frutas donde TIE es utilizada. Muchos de los protocolos desarrollados o mejorados durante el PIC seran incorporados en el Manual Internacional de Control de Calidad para Moscas Estriles de la familia Tephritidae, para estandarizar componentes claves como la produccion, esterilizacion, envio, manejo y liberacion de insectos esteriles. (author)« less

  1. Peligros de deslizamientos [Landslide Hazards

    USGS Publications Warehouse

    ,

    2000-01-01

    Deslizamientos, flujos de escombrera y desastres geológicos similares provenientes de volcanes ocurren alrededor del mundo. Cada año estos desastres causan billones de dólares en pérdidas y un sinnúmero de fatalidades y heridos. El primer paso para reducir los efectos dañinos causados por estos desastres es el conocimiento y educación acerca de ellos. El Servicio Geológico de los Estados Unidos se dedica a educar una gran cantidad de personas a través de información e investigaciones acerca de peligros geológicos. Este documento está publicado en inglés y español y puede ser reproducido de cualquier forma para fomentar su distribución.

  2. Combustión turbulenta de materia nuclear en materia extraña

    NASA Astrophysics Data System (ADS)

    Vucetich, H.

    La simulación numérica de supernovas tipo II muestra que los mecanismos físicos convencionales no son suficientes como para producir la explosión. La detonación de materia nuclear en materia extraña es un mecanismo físico capaz de proveer la energía faltante en las simulaciones. En esta comunicación se muestra que la turbulencia en el corazón compacto de una supernova, después del primer choque, es capaz de transformar una combustión lenta en una detonación. Se concluye que, si la materia extraña existe, todas las ``estrellas de neutrones'' son, en realidad, ``estrellas extrañas''.

  3. Sterile insect technique: A model for dose optimisation for improved sterile insect quality

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Parker, A.; Mehta, K.

    The sterile insect technique (SIT) is an environment-friendly pest control technique with application in the area-wide integrated control of key pests, including the suppression or elimination of introduced populations and the exclusion of new introductions. Reproductive sterility is normally induced by ionizing radiation, a convenient and consistent method that maintains a reasonable degree of competitiveness in the released insects. The cost and effectiveness of a control program integrating the SIT depend on the balance between sterility and competitiveness, but it appears that current operational programs with an SIT component are not achieving an appropriate balance. In this paper we discussmore » optimization of the sterilization process and present a simple model and procedure for determining the optimum dose. (author) [Spanish] La tecnica de insecto esteril (TIE) es una tecnologia de control de plagas favorable para el medio ambiente con una aplicacion de un control integrado de plagas claves para toda la area, incluyendo la supresion o eliminacion de poblaciones introducidas y la exclusion de nuevas introducciones. La esterilidad reproductiva es normalmente inducida por radiacion ionizada, un metodo conveniente y consistente que mantiene un grado razonable para la capacidad de competencia en insectos liberados. El costo y la eficacia de un programa de control que incluye TIE dependen en tener un balance entre la esterilidad y la capacidad para competir, pero parece que los programas operacionales corrientes con TIS como un componente no estan logrando el tener un balance apropiado. En esta publicacion, nosotros discutimos la optimizacion del proceso de esterilizacion y presentamos un modelo y procedimiento sencillos para determinar la dosis optima. (author)« less

  4. Analisis de Alteraciones EN la Imagen Debidas a Descolimacion de un Telescopio

    NASA Astrophysics Data System (ADS)

    Cobos, F. J.; Galan, M. J.

    1987-05-01

    Podemos considerar, en términos generales, que los espejos de un telescopio tienen una calidad óptica intrínseca, entendiendo por ésta la que se ha obtenido como resultado, fundamentalmente, de la destreza del personal del Taller Optico, que considerará terminadas las superficies ópticas cuando éstas satisfagan los requisitos de diseño y las pruebas de evaluación pertinentes. Debemos esperar que, una vez instalados los espejos en el telescopio, no se altere esta calidad de la óptica por un funcionamiento inadecuado de partes mecánicas del mismo. En los últimos años, en la medida que los problemas de infraestructuratura de nuestros Observatorios se han ido resolviendo, se ha hecho más patente la necesidad de llevar a la instrumentación existente al máximo de su potencial y parte esencial de ésta la conforman los mismos te lescopios. Mejorar la calidad óptica de las imágenes obtenidas con ellos ha hecho que sea prioritario el realizar una investigación más sistemática de sus características. Este trabajo ha tenido como objetivo primordial el usar un programa de diseño óptico, en el caso particular del telescopio UNAM212, con el fin de calcular y obtener gráficamente los diagramas de manchas de imagenes en foco y extrafocales, tanto con la óptica perfectamente alineada como descolimándola (mediante pequenos giros y descentramientos de los espejos). De esta manera, se hizo una evaluación de los efectos que estas alteraciones simuladas producirían en las imágenes focales y extra focales para así poder compararlas con las que realmente se han observado. Asimismo, se ha buscado información bibliográfica, en particular sobre los efectos de giros y descentramientos en las imágenes extrafocales, en lo que se ref iere a la falta de concentricidad de los círculos que forman la "dona" y a la distribución de intensidad luminosa en la misma. De ésta, l futuro un proceso que, haciendo uso de los detectores bidimensionales, nos permita Ilevar a cabo una alineación más rigurosa de la óptica del telescopio y evaluar con precisión Si variaciones en el posicionado del misesperamos desarrollar en emo producen efectos de descolimación.

  5. The Brazilian Aerospace Industry: A Cast Study of the Technological Impact of Offset Agreements in a Recipient Industry

    DTIC Science & Technology

    1989-12-01

    Special Export Programs, Comissco de Beneficios Fiscais e Programas Especiais de Exportagdo - BEFIEX. This program allows the rebate of tariff and...development became a specific policy objective. The 1968-69 Development Plan, Programa Estrat6gico de Desenvolvimento (PED), defined an explicit...Comunicagdo de Programa de Aquisigdo - CPA) containing: object, quantity, delivery time, value, nature, and other basic elements of contracting. To comply

  6. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction

    PubMed Central

    2012-01-01

    Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584

  7. When Did the Swahili Become Maritime?

    PubMed Central

    Fleisher, Jeffrey; Lane, Paul; LaViolette, Adria; Horton, Mark; Pollard, Edward; Quintana Morales, Eréndira; Vernet, Thomas; Christie, Annalisa; Wynne-Jones, Stephanie

    2015-01-01

    In this article, we examine an assumption about the historic Swahili of the eastern African coast: that they were a maritime society from their beginnings in the first millennium C.E. Based on historical and archaeological data, we suggest that, despite their proximity to and use of the sea, the level of maritimity of Swahili society increased greatly over time and was only fully realized in the early second millennium C.E. Drawing on recent theorizing from other areas of the world about maritimity as well as research on the Swahili, we discuss three arenas that distinguish first- and second-millennium coastal society in terms of their maritime orientation. These are variability and discontinuity in settlement location and permanence; evidence of increased engagement with the sea through fishing and sailing technology; and specialized architectural developments involving port facilities, mosques, and houses. The implications of this study are that we must move beyond coastal location in determining maritimity; consider how the sea and its products were part of social life; and assess whether the marine environment actively influences and is influenced by broader patterns of sociocultural organization, practice, and belief within Swahili and other societies. [maritime, fishing and sailing, long-distance trade, Swahili, eastern Africa] RESUMEN En este artículo, evaluamos la hipótesis de que los pueblos Swahili de la costa oriental africana fueron una sociedad marítima a partir del primer milenio E.C. Basados en información histórica y arqueológica, proponemos que la asociación de la sociedad Swahili con el mar incrementó considerablemente con el tiempo y se manifestó de una forma significativa particularmente desde principios del segundo milenio E.C. Utilizando teorías recientes sobre maritimidad en otras áreas del mundo, así como investigaciones sobre los Swahili, discutimos tres temas que marcan las diferencias del nivel de orientación marítima de esta sociedad costera entre el primer y segundo milenio. Éstas son la variabilidad y discontinuidad en la localización y permanencia de los asentamientos; evidencia de una conexión mayor con el mar a través de la tecnología de pesca y navegación; y desarrollos arquitectónicos especializados que incluyen instalaciones portuarias, mezquitas, y casas. Las implicaciones de este estudio indican que debemos considerar otros aspectos de una sociedad aparte de su localización costera para determinar su maritimidad. Hay que considerar cómo el mar y sus productos son parte de la vida social y evaluar si existe una influencia recíproca entre el ambiente marítimo y los patrones de organización sociocultural, las prácticas, y las creencias de los Swahili y otras sociedades. [marítimo, pesca y navegación, comercio a larga distancia, Swahili, África Oriental] PMID:25821235

  8. When Did the Swahili Become Maritime?

    PubMed

    Fleisher, Jeffrey; Lane, Paul; LaViolette, Adria; Horton, Mark; Pollard, Edward; Quintana Morales, Eréndira; Vernet, Thomas; Christie, Annalisa; Wynne-Jones, Stephanie

    2015-03-01

    In this article, we examine an assumption about the historic Swahili of the eastern African coast: that they were a maritime society from their beginnings in the first millennium C.E. Based on historical and archaeological data, we suggest that, despite their proximity to and use of the sea, the level of maritimity of Swahili society increased greatly over time and was only fully realized in the early second millennium C.E. Drawing on recent theorizing from other areas of the world about maritimity as well as research on the Swahili, we discuss three arenas that distinguish first- and second-millennium coastal society in terms of their maritime orientation. These are variability and discontinuity in settlement location and permanence; evidence of increased engagement with the sea through fishing and sailing technology; and specialized architectural developments involving port facilities, mosques, and houses. The implications of this study are that we must move beyond coastal location in determining maritimity; consider how the sea and its products were part of social life; and assess whether the marine environment actively influences and is influenced by broader patterns of sociocultural organization, practice, and belief within Swahili and other societies. [ maritime, fishing and sailing, long-distance trade, Swahili, eastern Africa ]. En este artículo, evaluamos la hipótesis de que los pueblos Swahili de la costa oriental africana fueron una sociedad marítima a partir del primer milenio E.C. Basados en información histórica y arqueológica, proponemos que la asociación de la sociedad Swahili con el mar incrementó considerablemente con el tiempo y se manifestó de una forma significativa particularmente desde principios del segundo milenio E.C. Utilizando teorías recientes sobre maritimidad en otras áreas del mundo, así como investigaciones sobre los Swahili, discutimos tres temas que marcan las diferencias del nivel de orientación marítima de esta sociedad costera entre el primer y segundo milenio. Éstas son la variabilidad y discontinuidad en la localización y permanencia de los asentamientos; evidencia de una conexión mayor con el mar a través de la tecnología de pesca y navegación; y desarrollos arquitectónicos especializados que incluyen instalaciones portuarias, mezquitas, y casas. Las implicaciones de este estudio indican que debemos considerar otros aspectos de una sociedad aparte de su localización costera para determinar su maritimidad. Hay que considerar cómo el mar y sus productos son parte de la vida social y evaluar si existe una influencia recíproca entre el ambiente marítimo y los patrones de organización sociocultural, las prácticas, y las creencias de los Swahili y otras sociedades. [ marítimo, pesca y navegación, comercio a larga distancia, Swahili, África Oriental ].

  9. Effect of acclimation to outdoor condition on the sexual performance of mass-produced Medflies (Diptera: Tephritidae)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pereira, R.; Silva, N.; Quintal, C.

    Application of the sterile insect technique (SIT) as part of integrated area-wide programs to control the Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) require that the released males attract wild females and transfer sterile sperm. However, knowledge about male sexual performance after they are released is scarce. We conducted a study to evaluate male sexual performance in field cage tests, according to standard quality control procedures. Mass-reared 5-d-old sterile males from the genetic sexing strain VIENNA 7mix2000 were acclimated for 0, 1, and 3 d to outdoor conditions before competing with wild males for wild females. Although the proportion ofmore » mating (PM) in the test was satisfactory, the resulting relative sterility index (RSI) data showed no significant differences among the treatments. The data indicate that pre-conditioning males to outdoor conditions in Madeira did not confer an advantage in field cage sexual performance. (author) [Spanish] La aplicacion de la tecnica del insecto esteril (TIE) como parte de un programa integrado de amplio efecto para el control de la mosca mediterranea de la fruta Ceratitis capitata (Wiedemann) requiere que los machos liberados atraigan las hembras naturales y transfieran su esperma. Sin embargo, el conocimiento del desempeno sexual de los machos despues de ser liberados es muy escaso. Nosotros realizamos un estudio para evaluar el desempeno sexual de los machos en pruebas usando jaulas del campo, segun los procedimientos estandardizados de calidad. Machos esteriles de 5 dias de edad de la raza que separa los sexos geneticamente VIENNA 7mix2000 criados en masa fueron aclimatados por 0, 1 y 3 dias en condiciones de campo antes de competir con machos naturales para las hembras naturales. Aunque la proporcion del apareamiento en la prueba fue satisfactorio, el indice relativo de esterilidad (IRS) resultante no mostro ninguna diferencia significativa entre los tratamientos. Los datos indicaron que al condicionar los machos anteriormente a las condiciones de campo en Madeira no conferio ventaja alguna en el desempeno sexual en la jaula de campo. (author)« less

  10. PubMed

    De Battista, Juan Carlos; Buonanotte, Carlos Federico; Foa Torres, Gustavo A; Keller, Jeffrey Thomas; Aranega, Cesar I

    2018-04-24

    Antecedentes: Las enfermedades que afectan la órbita representan un desafío quirúrgico, en particular las que comprometen el ápex orbitario. Una vía óptima de acceso quirúrgico proporciona la mejor exposición permitiendo identificar ciertas estructuras anatómicas claves llamadas reparos anatómicos. Objetivo: Describir la anatomía endoscópica de la unidad estructural Fisura Orbitaria Inferior / Músculo de Müller a nivel del ápex orbitario generando así un nuevo reparo anatómico endoscópico. Material y método: Análisis descriptivo óseo de la fisura orbitaria inferior (FOI) en cráneos secos, disección y estudio bajo técnica endoscópica de 6 cabezas fijadas en formol y coloreadas; finalmente se tomaron distancias y ángulos a forámenes relacionados con el ápex orbitario a 10 cráneos secos. El análisis estadístico se realizó con el programa estadístico SPSS 17,0 (SPSS, Inc., Chicago, IL). Resultado: En todas las disecciones endoscópicas se pudo identificar la unidad fisura orbitaria inferior-músculo de Müller y también verificar su íntima relación con el ápex orbitario. Morfométricamente el foramen óptico y el foramen redondo mayor están a una distancia promedio de 65.19mm y 60.16mm respectivamente. Los ángulos promedio del FO fue de 13.32 grados y del FRM de19.31 grados. Hallamos correlación significativa entre CO. y el FRM sólo en el hemicráneo izquierdo, (Tau b de Kendall 0.69, P=0.006). No se encontraron diferencias anatómicas (o morfológicas) significativas entre lados. Conclusión: bajo técnica endoscópica la unidad Fisura Orbitaria Inferior-Músculo de Müller (FOI-MM) es un reparo anatómico constante, útil y seguro que permite el reconocimiento del ápex orbitario y sus áreas contiguas.

  11. Estudio numerico y experimental del proceso de soldeo MIG sobre la aleacion 6063--T5 utilizando el metodo de Taguchi

    NASA Astrophysics Data System (ADS)

    Meseguer Valdenebro, Jose Luis

    Electric arc welding processes represent one of the most used techniques on manufacturing processes of mechanical components in modern industry. The electric arc welding processes have been adapted to current needs, becoming a flexible and versatile way to manufacture. Numerical results in the welding process are validated experimentally. The main numerical methods most commonly used today are three: finite difference method, finite element method and finite volume method. The most widely used numerical method for the modeling of welded joints is the finite element method because it is well adapted to the geometric and boundary conditions in addition to the fact that there is a variety of commercial programs which use the finite element method as a calculation basis. The content of this thesis shows an experimental study of a welded joint conducted by means of the MIG welding process of aluminum alloy 6063-T5. The numerical process is validated experimentally by applying the method of finite element through the calculation program ANSYS. The experimental results in this paper are the cooling curves, the critical cooling time t4/3, the weld bead geometry, the microhardness obtained in the welded joint, and the metal heat affected zone base, process dilution, critical areas intersected between the cooling curves and the curve TTP. The numerical results obtained in this thesis are: the thermal cycle curves, which represent both the heating to maximum temperature and subsequent cooling. The critical cooling time t4/3 and thermal efficiency of the process are calculated and the bead geometry obtained experimentally is represented. The heat affected zone is obtained by differentiating the zones that are found at different temperatures, the critical areas intersected between the cooling curves and the TTP curve. In order to conclude this doctoral thesis, an optimization has been conducted by means of the Taguchi method for welding parameters in order to obtain an improvement on mechanical properties in aluminum metal joint. Los procesos de soldadura por arco electrico representan unas de las tecnicas mas utilizadas en los procesos de fabricacion de componentes mecanicos en la industria moderna. Los procesos de soldeo por arco se han adaptado a las necesidades actuales, haciendose un modo de fabricacion flexible y versatil. Los resultados obtenidos numericamente en el proceso de soldadura son validados experimentalmente. Los principales metodos numericos mas empleados en la actualidad son tres, metodo por diferencias finitas, metodos por elementos finitos y metodo por volumenes finitos. El metodo numerico mas empleado para el modelado de uniones soldadas, es el metodo por elementos finitos, debido a que presenta una buena adaptacion a las condiciones geometricas y de contorno ademas de que existe una diversidad de programas comerciales que utilizan el metodo por elementos finitos como base de calculo. Este trabajo de investigacion presenta un estudio experimental de una union soldada mediante el proceso MIG de la aleacion de aluminio 6063-T5. El metodo numerico se valida experimentalmente aplicando el metodo de los elementos finitos con el programa de calculo ANSYS. Los resultados experimentales obtenidos son: las curvas de enfriamiento, el tiempo critico de enfriamiento t4/3, geometria del cordon, microdurezas obtenidas en la union soldada, zona afectada termicamente y metal base, dilucion del proceso, areas criticas intersecadas entre las curvas de enfriamiento y la curva TTP. Los resultados numericos son: las curvas del ciclo termico, que representan tanto el calentamiento hasta alcanzar la temperatura maxima y un posterior enfriamiento. Se calculan el tiempo critico de enfriamiento t4/3, el rendimiento termico y se representa la geometria del cordon obtenida experimentalmente. La zona afectada termicamente se obtiene diferenciando las zonas que se encuentran a diferentes temperaturas, las areas criticas intersecadas entre las curvas de enfriamiento y la curva TTP. Para finalizar el trabajo de investigacion se ha realizado una optimizacion, con la aplicacion del metodo de Taguchi, de los parametros de soldeo con el objetivo de obtener una mejora sustancial en las propiedades mecanicas de las uniones metalicas de aluminio.

  12. PrimerDesign-M: A multiple-alignment based multiple-primer design tool for walking across variable genomes

    DOE PAGES

    Yoon, Hyejin; Leitner, Thomas

    2014-12-17

    Analyses of entire viral genomes or mtDNA requires comprehensive design of many primers across their genomes. In addition, simultaneous optimization of several DNA primer design criteria may improve overall experimental efficiency and downstream bioinformatic processing. To achieve these goals, we developed PrimerDesign-M. It includes several options for multiple-primer design, allowing researchers to efficiently design walking primers that cover long DNA targets, such as entire HIV-1 genomes, and that optimizes primers simultaneously informed by genetic diversity in multiple alignments and experimental design constraints given by the user. PrimerDesign-M can also design primers that include DNA barcodes and minimize primer dimerization. PrimerDesign-Mmore » finds optimal primers for highly variable DNA targets and facilitates design flexibility by suggesting alternative designs to adapt to experimental conditions.« less

  13. Mexican-US cooperation on renewable energy programs

    NASA Astrophysics Data System (ADS)

    Waddle, D. B.

    1991-04-01

    I traveled to Mexico on April 1 with Pete Smith and Chris Rovero of Oak Ridge Associated Universities on a mission sponsored by the Agency for International Development (AID) to initiate a technical support project with Mexican government and private institutions. We met with officials of AID; the Programa Nacional de Solidaridad; the Laboratorio de Energia Solar; Instituto Investigaciones de Electricidad; Comision Federal de Electricidad; Compania de Luz y Fuerza del Centro; and several private firms to discuss the terms of support. An AIDE Memoire was drafted outlining the scope of future assistance. I traveled to San Jose, Cost Rica on April 7, 1991. There I met with Carlos Rodriguez, manager of Cooperativa Electrica de San Carlos, and Federico Baltodano, the director of BEL Ingenieria to discuss the San Lorenzo hydroelectric project. Details of an engineering and financial analysis outlining the costs and benefits of adding daily pondage to the project were discussed, as was the project development schedule and other issues. I returned to Oak Ridge on April 9, 1991.

  14. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation

    PubMed Central

    2009-01-01

    Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502

  15. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    PubMed

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  16. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    PubMed Central

    2012-01-01

    Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base. PMID:23126469

  17. PrimerZ: streamlined primer design for promoters, exons and human SNPs.

    PubMed

    Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam

    2007-07-01

    PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.

  18. Staff Movements

    NASA Astrophysics Data System (ADS)

    Huber, M. C. E.

    1986-09-01

    Los astronomos de ESO dedican una considerable parte de su tiempo a la preparacion de solicitudes para tiempo de observacion en La Silla. Sin embargo, debido a la gran demanda par los telescopios, se debe hacer una seleccion, aveces drastica, de los programas de observacion presentados. EI Comite de Programas de Observacion (OPC) tiene como tarea evaluar el merito cientifico de las solicitudes presentadas. Basada en las recomendaciones dei OPC, ESO prepara una Lista de Tiempos de Observacion en la cual distribuye el tiempo disponible en los telescopios a los programas mejor evaluados.

  19. PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome

    PubMed Central

    Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi

    2006-01-01

    PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094

  20. Primer3_masker: integrating masking of template sequence with primer design software.

    PubMed

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  1. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG

    PubMed Central

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations—nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively—in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent. PMID:27413738

  2. Diagnosis of Xeroderma Pigmentosum Groups A and C by Detection of Two Prevalent Mutations in West Algerian Population: A Rapid Genotyping Tool for the Frequent XPC Mutation c.1643_1644delTG.

    PubMed

    Bensenouci, Salima; Louhibi, Lotfi; De Verneuil, Hubert; Mahmoudi, Khadidja; Saidi-Mehtar, Nadhira

    2016-01-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder. Considering that XP patients have a defect of the nucleotide excision repair (NER) pathway which enables them to repair DNA damage caused by UV light, they have an increased risk of developing skin and eyes cancers. In the present study, we investigated the involvement of the prevalent XPA and XPC genes mutations-nonsense mutation (c.682C>T, p.Arg228X) and a two-base-pair (2 bp) deletion (c.1643_1644delTG or p.Val548Ala fsX25), respectively-in 19 index cases from 19 unrelated families in the West of Algeria. For the genetic diagnosis of XPA gene, we proceeded to PCR-RFLP. For the XPC gene, we validated a routine analysis which includes a specific amplification of a short region surrounding the 2 bp deletion using a fluorescent primer and fragment sizing (GeneScan size) on a sequencing gel. Among the 19 index cases, there were 17 homozygous patients for the 2 bp deletion in the XPC gene and 2 homozygous patients carrying the nonsense XPA mutation. Finally, XPC appears to be the major disease-causing gene concerning xeroderma pigmentosum in North Africa. The use of fragment sizing is the simplest method to analyze this 2 bp deletion for the DNA samples coming from countries where the mutation c.1643_1644delTG of XPC gene is prevalent.

  3. Frequency of 8 CFTR gene mutations in cystic fibrosis patients in Minas Gerais, Brazil, diagnosed by neonatal screening.

    PubMed

    Perone, C; Medeiros, G S; del Castillo, D M; de Aguiar, M J B; Januário, J N

    2010-02-01

    The nature and frequency of cystic fibrosis mutations in Brazil is not uniform due to the highly varied ethnic composition of the population. The average frequency of the F508del mutation has been reported to be 48.6%. Other common mutations in Brazil are G542X, R1162X, and N1303K. The aim of this study was to analyze the frequency of 8 mutations (F508del, G542X, R1162X, N1303K, W1282X, G85E, 3120+1G>A, and 711+1G>T) in a sample of 111 newborn patients with cystic fibrosis diagnosed by the Cystic Fibrosis Neonatal Screening Program of Minas Gerais State. The mutations were tested by allele-specific oligonucleotide PCR with specially designed primers. An allele frequency of 48.2% was observed for the F508del mutation, and allele frequencies of 5.41, 4.50, 4.05, and 3.60% were found for the R1162X, G542X, 3120+1G>A, and G85E mutations, respectively. The genotypes obtained were in Hardy-Weinberg equilibrium. These data demonstrate that the 8-mutation panel studied here has extensive coverage (68%) for the cystic fibrosis mutations in Minas Gerais. These data improve our knowledge of cystic fibrosis in Brazil, particularly in this region. In addition, this investigation contributed to the establishment of a sensitive and population-specific mutation panel, which can be helpful for molecular diagnosis of cystic fibrosis.

  4. PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.

    PubMed

    Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt

    2017-01-24

    The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).

  5. Comprension de los conceptos de los enlaces ionico y covalente en estudiantes universitarios del primer curso de quimica general

    NASA Astrophysics Data System (ADS)

    Ballesteros Benavides, Maria Elvira

    Para este trabajo utilizamos el estudio de casos cualitativo que se llevo a cabo en una universidad privada de Puerto Rico. Empleamos como unidad de analisis el concepto de enlace quimico, ionico y covalente. Los participantes fueron los estudiantes de la seccion nocturna del curso de Quimica General I. La investigacion se desarrollo por medio de dos entrevistas de persona a persona, observaciones de las expresiones no verbales y la hoja de identificacion de conceptos. Para la triangulacion tomamos en consideracion las preconcepciones erroneas, las concepciones alternativas y el mapa de conceptos de cada participante. Preparamos un mapa de conceptos para el enlace quimico validado por un comite de expertos. Tambien, elaboramos los mapas de conceptos de los participantes que sirvieron para varios propositos: conocer la estructura conceptual, expresar los logros, hacer comparaciones e identificar la presencia de concepciones alternativas. Entre los hallazgos encontramos que todos los participantes poseen conocimiento previo de los enlaces quimicos ionico y covalente y dentro de ese conocimiento existen preconcepciones erroneas mas numerosas para el enlace ionico. Al principio del semestre el 50% de los participantes demostraron tener "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente. Al finalizar el semestre encontramos en el 40% de los participantes concepciones alternativas tanto para el enlace ionico como para el covalente y el 90% no lograron distinguir un enlace del otro. Nuestras conclusiones fueron que los participantes sin distincion del aprovechamiento academico demostraron tener la tendencia de "carencia fuerte de conceptos" tanto para el enlace ionico como para el covalente, presentaron dificultad al integrar los conceptos de los enlaces quimicos ionico y covalente que se pusieron de manifiesto al dar los ejemplos. Las preconcepciones erroneas contribuyen en el desarrollo de las concepciones alternativas. Ademas, los participantes no lograron diferenciar los dos enlaces quimicos. Esto implica que reflexionemos sobre la necesidad de revisar tanto las competencias cognoscitivas como la forma de ensenar quimica en el salon de clase. Recomendamos indagar y dar importancia al conocimiento previo de los estudiantes, enfatizar la ensenanza de los conceptos y propiciar el aprendizaje con significado.

  6. Deconstructing the Polymerase Chain Reaction: Understanding and Correcting Bias Associated with Primer Degeneracies and Primer-Template Mismatches

    PubMed Central

    Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930

  7. miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA

    PubMed Central

    Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming

    2018-01-01

    MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706

  8. Evidence for a founder effect for the IVS4 +4 A{r_arrow}T mutation in the Fanconi anemia gene FACC in a Jewish population

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verlander, P.C.; Kaporis, A.G.; Qian, L.

    1994-09-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder defined by hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C(FACC) has been cloned. Two common mutations, IVS4 +4 A{r_arrow}T and 322delG, and several rare mutations have recently been reported in affected individuals. We now report the development of amplification refractory mutation system (ARMS) assays for rapid, non-radioactive detection of these known mutations in FACC. Primer pairs specific for variant sequences were designed, with the 3{prime} terminal base of one primer matching the variant base. PCR products are separated by electrophoresis on 2.5% agarose gels; mutationsmore » are indicated by the presence of a band of a specific size. These ARMS assays can be multiplexed to allow screening for all known mutations in two PCR reactions. We have used these assays for detection of FACC mutations in affected individuals in the International Fanconi Anemia Registry (IFAR), and for carrier detection FACC families. IVS4 +4 A{r_arrow}T is the only FACC mutation found in Jewish FA patients and their families, of both Ashkenazi and Sephardic ancestry. This mutation was not found in any affected individual of non-Jewish origin. In addition, DNA samples from 1596 healthy Jewish individuals primarily of Ashkenazi ancestry were supplied to us by Dor Yeshorim. These samples, ascertained for carrier screening for Tay Sachs, cystic fibrosis, and other genetic diseases with a high frequency in the religious Jewish community served by this organization, were tested for both IVS4 +4 A{r_arrow}T and 322delG mutations; seventeen IVS4 +4 A{r_arrow}T are of Sephardic Jewish ancestry. We hypothesize that IVS4 +4 A{r_arrow}T is a very old mutation, predating the divergence of the Ashkenazi and Sephardic populations. Haplotype analysis with microsatellite markers is in progress.« less

  9. NORD's Patient Assistance Programs

    MedlinePlus

    ... 486-8462 *learn more about this program* *aprender más sobre este programa* Chronic Non-Infectious Uveitis | Closed ... 486-8033 *learn more about this program* *aprender más sobre este programa* Cystinuria | Temporarily at Capacity Co- ...

  10. MethPrimer: designing primers for methylation PCRs.

    PubMed

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  11. Presentación del estudio "Links" de hombres que tienes sexo con hombres en Buenos Aires, Argentina.

    PubMed

    Carballo-Diéguez, Alex; Avila, María M; Balán, Iván C; Marone, Rubén; Pando, María A; Barreda, Victoria

    2011-03-01

    Estudios previos en Buenos Aires reportaron altas prevalencias de HIV entre HSH, con valores que oscilan entre 9 y 14% durante casi 10 años de continuo testeo. El objetivo principal de este estudio fue la evaluación de factores relacionados al comportamiento de alto riesgo para transmisión del HIV entre HSH entre los que se incluyen el conocimiento y factores emocionales, socioculturales y ambientales. Por otro lado se realizó la estimación de prevalencia e incidencia de HIV utilizando RDS (Respondent Driven Sampling), así como la presencia de otras infecciones de transmisión sexual. Por último se evaluaron los hábitos de testeo para HIV indagando que factores facilitan o impiden su realización. El estudio constó de dos fases, en primer lugar una fase cualitativa y posteriormente una fase cuantitativa con una duración total de 4 años y medio. Durante la fase cualitativa se realizaron 44 entrevistas individuales en profundidad, 8 grupos focales y 10 observaciones etnográficas (hoteles, baños públicos ("teteras"), cines pornográficos, fiestas privadas, dark rooms y discotecas). Durante la fase cuantitativa del estudio se realizó el reclutamiento de 500 participantes que provinieron de la Ciudad Autónoma de Buenos Aires, así como del Gran Buenos Aires. El reclutamiento se comenzó con 16 participantes llamados semillas. Se realizó el diagnóstico de infección por HIV, hepatitis B y C (HBV y HCV), Treponema pallidum, Virus Papiloma Humano (HPV) y Chlamidias. La colaboración establecida entre los grupos de trabajo enfocados en áreas diversas posibilitó el abordaje conjunto de nuevas estrategias de investigación antes no exploradas en nuestro país. Los resultados más relevantes de esta investigación serán progresivamente publicados en sucesivos números de Actualizaciones en SIDA.

  12. [Not Available].

    PubMed

    Burgos Peláez, Rosa; Cuerda Compes, María Cristina; García-Luna, Pedro P; Martínez Faedo, Ceferino; Mauri Roca, Sílvia; Moreno Villares, José Manuel; Virgili Casas, M Nuria; Wanden-Berghe, Carmina

    2016-07-19

    Introducción:la nutrición parenteral (NP) a largo plazo puede asociarse a complicaciones graves, con un deterioro importante de la calidad de vida de los pacientes con síndrome de intestino corto (SIC). Teduglutida, un análogo del péptido-2 similar al glucagón, pertenece a una nueva familia terapéutica y representa el primer abordaje no sintomático del SIC. Objetivos: revisar los datos preclínicos y clínicos en cuanto a eficacia y seguridad de teduglutida. Resultados: la aprobación de teduglutida se basó en los resultados de un estudio en fase III de 24 semanas, doble ciego, controlado con placebo (STEPS). Pacientes con fallo intestinal por SIC dependientes de NP ≥ 3 veces/semana durante ≥ 12 meses recibieron 0,05 mg/kg de teduglutida (n = 43) o placebo (n = 43) 1 vez/día. En la semana 24 hubo significativamente más respondedores en el grupo de teduglutida que en el de placebo (63 vs.30%; p = 0,002). La reducción absoluta media del volumen de NP frente al valor basal en la semana 24 fue significativamente mayor con teduglutida (4,4 vs.2,3 l/semana; p < 0,001). La necesidad de NP se redujo ≥ 1 día en la semana 24 en el 54% de pacientes tratados con teduglutida vs.23% con placebo. Del total de pacientes que recibieron teduglutida en los ensayos en fase III (n = 134), el 12% consiguió una autonomía completa de la NP. Por lo general, la administración subcutánea de teduglutida se toleró bien. Conclusiones: se ha demostrado que teduglutida recupera la absorción intestinal y reduce significativamente la dependencia de la NP, consiguiendo incluso la independencia en algunos pacientes.

  13. Construction of an interspecific genetic map based on InDel and SSR for mapping the QTLs affecting the initiation of flower primordia in pepper (Capsicum spp.).

    PubMed

    Tan, Shu; Cheng, Jiao-Wen; Zhang, Li; Qin, Cheng; Nong, Ding-Guo; Li, Wei-Peng; Tang, Xin; Wu, Zhi-Ming; Hu, Kai-Lin

    2015-01-01

    Re-sequencing permits the mining of genome-wide variations on a large scale and provides excellent resources for the research community. To accelerate the development and application of molecular markers and identify the QTLs affecting the flowering time-related trait in pepper, a total of 1,038 pairs of InDel and 674 SSR primers from different sources were used for genetic mapping using the F2 population (n = 154) derived from a cross between BA3 (C. annuum) and YNXML (C. frutescens). Of these, a total of 224 simple PCR-based markers, including 129 InDels and 95 SSRs, were validated and integrated into a map, which was designated as the BY map. The BY map consisted of 13 linkage groups (LGs) and spanned a total genetic distance of 1,249.77 cM with an average marker distance of 5.60 cM. Comparative analysis of the genetic and physical map based on the anchored markers showed that the BY map covered nearly the whole pepper genome. Based on the BY map, one major and five minor QTLs affecting the number of leaves on the primary axis (Nle) were detected on chromosomes P2, P7, P10 and P11 in 2012. The major QTL on P2 was confirmed based on another subset of the same F2 population (n = 147) in 2014 with selective genotyping of markers from the BY map. With the accomplishment of pepper whole genome sequencing and annotations (release 2.0), 153 candidate genes were predicted to embed in the Nle2.2 region, of which 12 important flowering related genes were obtained. The InDel/SSR-based interspecific genetic map, QTLs and candidate genes obtained by the present study will be useful for the downstream isolation of flowering time-related gene and other genetic applications for pepper.

  14. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection

    PubMed Central

    O’Halloran, Damien M.

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  15. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    PubMed Central

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  16. Indicators to assess the quality of programs to prevent occupational risk for tuberculosis: are they feasible?

    PubMed

    Santos, Talita Raquel Dos; Padoveze, Maria Clara; Nichiata, Lúcia Yasuko Izumi; Takahashi, Renata Ferreira; Ciosak, Suely Itsuko; Gryschek, Anna Luiza de Fátima Pinho Lins

    2016-06-07

    to analyze the feasibility of quality indicators for evaluation of hospital programs for preventing occupational tuberculosis. a descriptive cross-sectional study. We tested indicators for evaluating occupational tuberculosis prevention programs in six hospitals. The criterion to define feasibility was the time spent to calculate the indicators. time spent to evaluate the indicators ranged from 2h 52min to 15h11min 24sec. The indicator for structure evaluation required less time; the longest time was spent on process indicators, including the observation of healthcare workers' practices in relation to the use of N95 masks. There was an hindrance to test one of the indicators for tuberculosis outcomes in five situations, due to the lack of use of tuberculin skin test in these facilities. The time requires to calculate indicators in regarding to the outcomes for occupational tuberculosis largely depends upon the level of organizational administrative structure for gathering data. indicators to evaluate the structure for occupational tuberculosis prevention are highly feasible. Nevertheless, the feasibility of indicators for process and outcome is limited due to relevant variations in administrative issues at healthcare facilities. analisar a viabilidade de indicadores de qualidade para avaliação de programas hospitalares de prevenção de tuberculose ocupacional. estudo descritivo transversal. Testaram-se indicadores de avaliação de programas de prevenção de tuberculose ocupacional em seis hospitais. O critério para definir a viabilidade foi o tempo necessário para aplicar os indicadores. o tempo necessário para avaliar os indicadores variou de 02'52'' até 15h11'24''. O indicador para a avaliação da estrutura demandou menor tempo; o maior tempo foi utilizado com os indicadores de processo, incluindo a observação das práticas dos trabalhadores de saúde em relação ao uso de máscaras N95. Um dos indicadores de resultados de tuberculose deixou de ser testado em cinco situações devido à falta de uso do teste tuberculínico nessas instituições. O tempo necessário para aplicar indicadores em relação aos resultados de tuberculose ocupacional depende em grande parte do nível da organização da estrutura administrativa para a coleta de dados. os indicadores de avaliação da estrutura de prevenção de tuberculose ocupacional são altamente viáveis. No entanto, a viabilidade de aplicação dos indicadores de processo e de resultado é limitada devido a variações relevantes em questões administrativas nas instituições de saúde. analizar la viabilidad de los indicadores de calidad de la evaluación de los programas hospitalarios para la prevención de la tuberculosis en el trabajo. estudio descriptivo transversal. Se probaron los indicadores dirigidos a evaluar los programas para la prevención de la tuberculosis laboral en seis hospitales. El criterio para definir la viabilidad fue el tiempo para aplicar los indicadores. el tiempo empleado para la evaluación de los los indicadores varió desde 02'52 '' hasta 15h11'24 ''. El indicador para la evaluación de la estructura requiere menos tiempo; se invirtió más tiempo en los indicadores de proceso, lo que incluye la observación de las prácticas de los empleados del cuidado de salud en relación con el uso de máscaras N95. No se pudo probar uno de los indicadores de resultados de tuberculosis en cinco situaciones debido a la falta de uso de la prueba de la tuberculina en estas centros. El tiempo necesario para aplicar los indicadores en relación con los resultados por tuberculosis laboral depende en gran medida del nivel de organización de la estructura administrativa para la recopilación de datos. los indicadores para evaluar la estructura para la prevención de la tuberculosis laboral son altamente factibles. Sin embargo, la viabilidad de aplicación de los indicadores de proceso y el resultado es limitada debido a las variaciones relevantes en cuestiones administrativas en los centros sanitarios.

  17. A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR

    PubMed Central

    Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven

    2016-01-01

    Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800

  18. PrecisePrimer: an easy-to-use web server for designing PCR primers for DNA library cloning and DNA shuffling.

    PubMed

    Pauthenier, Cyrille; Faulon, Jean-Loup

    2014-07-01

    PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Detection and genetic distance of resistant populations of Pseudosuccinea columella (Mollusca: Lymnaeidae) to Fasciola hepatica (Trematoda: Digenea) using RAPD markers.

    PubMed

    Calienes, Aymé Fernandez; Fraga, Jorge; Pointier, Jean-Pierre; Yong, Mary; Sanchez, Jorge; Coustau, Christine; Gutiérrez, Alfredo; Théron, André

    2004-09-01

    Twelve natural populations of Pseudosuccinea columella snails, sampled in the western and central regions of Cuba, were analyzed using the RAPD-PCR technique to screen for resistance to Fasciola hepatica. Ten OPA primers previously shown to produce marker bands for resistance and susceptibility were tested. A new population of P. columella (El Azufre, Pinar del Río) exhibited the amplification patterns of resistant snails, and its resistant status was confirmed after experimental exposure to miracidia. No genetic variability was detected across or within the susceptible isolates. Similarly, the novel resistant isolate displayed an RAPD profile identical to the profile of two other isolates previously identified as resistant to F. hepatica. However, clear differences in RAPD banding patterns and genetic distance were observed between resistant and susceptible isolates.

  20. Design of primers and probes for quantitative real-time PCR methods.

    PubMed

    Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J

    2015-01-01

    Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.

  1. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    PubMed

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  2. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    PubMed

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  3. El Programa Nacional de Estuarios (NEP)

    EPA Pesticide Factsheets

    Información general sobre el Programa Nacional de Estuarios (PNE, por sus siglas en inglés) establecido en el 1987 para restaurar y proteger los estuarios significativos para Estados Unidos, y sus territorios. La Agencia de Protección Ambiental de EE.UU.

  4. Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies

    PubMed Central

    Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.

    2014-01-01

    Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453

  5. Shear bond strength between autopolymerizing acrylic resin and Co-Cr alloy using different primers.

    PubMed

    Sanohkan, Sasiwimol; Urapepon, Somchai; Harnirattisai, Choltacha; Sirisinha, Chakrit; Sunintaboon, Panya

    2012-01-01

    This study aimed to examine the shear bond strength between cobalt chromium alloy and autopolymerizing acrylic resin using experimental primers containing 5, 10, and 15 wt% of 4-methacryloxyethyl trimellitic anhydride or 1, 2, and 3 wt% of 3-methacryloxypropyl-trimethoxysilane comparison to 5 commercial primers (ML primers, Alloy primer, Metal/Zirconia primer, Monobond S, and Monobond plus). Sixty alloy specimens were sandblasted and treated with each primer before bonded with an acrylic resin. The control group was not primed. The shear bond strengths were tested and statistically compared. Specimens treated with commercial primers significantly increased the shear bond strength of acrylic resin to cobalt chromium alloy (p<0.05). The highest shear bond strength was found in the Alloy primer group. Among experimental group, using 10 wt% of 4-methacryloxyethyl trimellitic anhydride -or 2 wt% of 3-methacryloxypropyltrimethoxysilane enhanced highest shear bond strength. The experimental and commercial primers in this study all improved bonding of acrylic resin to cobalt chromium alloy.

  6. Neuraminidase Subtyping of Avian Influenza Viruses with PrimerHunter-Designed Primers and Quadruplicate Primer Pools

    PubMed Central

    Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.

    2013-01-01

    We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367

  7. [Not Available].

    PubMed

    Sellés, Sergio; Fernández-Sáez, José; López-Lluch, Guillermo; Cejuela, Roberto

    2016-02-16

    El proceso de formación de futuros deportistas debe ser un trabajo estructurado y planificado para poder alcanzar el máximo nivel deportivo. Es fundamental en este periodo tener presentes los ritmos de desarrollo y maduración de los jóvenes deportistas para así adecuar las cargas de entrenamientos a sus estados evolutivos. El objetivo del estudio fue determinar y analizar la edad morfológica en nadadores y triatletas adolescentes, estableciendo diferencias entre su edad cronológica, grupos y género. A través del método antropométrico se determinó el estado de maduración biológica en un grupo de 37 deportistas jóvenes tecnificados. Los resultados muestran que la mayoría de la muestra (70,8%) se encuentra en un estado avanzado de desarrollo con respecto a su edad cronológica, siendo más notorio en el caso de los nadadores este estado de madurez avanzado. Tener una edad morfológica más avanzada respecto a su edad cronológica podría favorecer a los deportistas adolescentes a la hora de conseguir mejores marcas y resultados en las competiciones y de esta manera acceder con más facilidad a los programas de tecnificación. El índice de desarrollo corporal modificado (IDCm) se presenta como un método validado, fiable y no invasivo para tener presente el grado de desarrollo y maduración en la selección de talentos deportivos y adecuar las cargas de entrenamiento al estado evolutivo de los deportistas.

  8. Detección automática de NEOs en imágenes CCD utilizando la transformada de Hough

    NASA Astrophysics Data System (ADS)

    Ruétalo, M.; Tancredi, G.

    El interés y la dedicación por los objetos que se acercan a la órbita de la Tierra (NEOs) ha aumentado considerablemente en los últimos años, tanto que se han iniciado varias campañas de búsqueda sistemática para aumentar la población identificada de éstos. El uso de placas fotográficas e identificación visual está siendo sustituído, progresivamente, por el uso de cámaras CCD y paquetes de detección automática de los objetos en las imágenes digitales. Una parte muy importante para la implementación exitosa de un programa automatizado de detección de este tipo es el desarrollo de algoritmos capaces de identificar objetos de baja relación señal-ruido y con requerimientos computacionales no elevados. En el presente trabajo proponemos la utilización de la transformada de Hough (utilizada en algunas áreas de visión artificial) para detectar automáticamente trazas, aproximadamente rectilíneas y de baja relación señal-ruido, en imágenes CCD. Desarrollamos una primera implementación de un algoritmo basado en ésta y lo probamos con una serie de imágenes reales conteniendo trazas con picos de señales de entre ~1 σ y ~3 σ por encima del nivel del ruido de fondo. El algoritmo detecta, sin inconvenientes, la mayoría de los casos y en tiempos razonablemente adecuados.

  9. [Not Available].

    PubMed

    Domínguez, Raúl; Garnacho-Castaño, Manuel Vicente; Maté-Muñoz, José Luis

    2016-06-30

    La fuerza influye directamente en el estado de salud y en la capacidad de fitness, motivo por el que el entrenamiento contra resistencias o resistance training (RT) se incluye dentro de aquellos programas de ejercicio encaminados a mejorar la salud y calidad de vida. Debido a que muchasenfermedades cursan con alteración de la masa y funcionalidad muscular y a que el RT es la principal modalidad de ejercicio encaminada a mejorar la función muscular, el objetivo de la presente revisión bibliográfica ha sido exponer las evidencias actuales sobre las adaptaciones delRT, así como su posible aplicación en patologías como la obesidad, diabetes, dislipemia, hipertensión, cáncer, Parkinson, esclerosis múltiple o fibromialgia. El RT en estas enfermedades puede aumentar los niveles de masa muscular, disminuyendo los niveles de masa grasa, los nivelesde ácidos grasos en sangre y la glucemia, incrementando la sensibilidad a la insulina, y disminuyendo los niveles de citokinas inflamatorias. El RT, además, mejora el gasto cardiaco y la funcionalidad endotelial, regulando la tensión arterial e incrementando el consumo de oxígeno. Las ganancias de fuerza muscular mejoran la funcionalidad y la calidad de vida, especialmente en población con una afectación neuromuscular grave, como pudieran ser los enfermos de esclerosis múltiple, fibromialgia o Parkinson. Por ello, el RT debe ser incorporado como parte del tratamiento en las personas que presentan determinado tipo de patologías.

  10. A participatory approach to integrated aquifer management: The case of Guanajuato State, Mexico

    NASA Astrophysics Data System (ADS)

    Sandoval, Ricardo

    Guanajuato State, located in central Mexico, with less than 2% of the country's area, has almost 17,000 deep water wells, from which nearly 4,000 cubic hectometers (hm3) per year are being extracted, more than 1,000 hm3 over the estimated renewable yield. Since, in Mexico, water is administered under federal jurisdiction by the National Water Commission (CNA, for its Spanish acronym), the state government faces the challenge of ensuring its population's economic development without formal means of intervention. Being thus limited to apply mandatory policies and measures, the state water program has focused on the implementation of a two-sided strategy. First, basic hydrogeological studies and mathematical groundwater hydrodynamic models were developed upon a comprehensive survey of existing wells and a general revision of the state's geological framework. Second, a structure for water user's participation in water management actions was promoted (from the dissemination of information to the implementation of pilot efficient water use projects) with financial, technical and political support from the state. Simultaneously, a coordinated effort towards the completion of the water user's registry was performed with the federal authority along with other supporting measures such as training and monitoring programs. In this paper, a general overview of the project's achievements and challenges is presented. L'État de Guanajuato, situé dans la partie centrale du Mexique, avec moins de 2% de la surface du pays, a près de 17 000 puits profonds, d'où sont extraits près de 4 000 hm3 par an, soit plus de 1 000 hm3 de plus que le débit renouvelable estimé. Comme au Mexique l'eau est administrée dans le cadre d'une juridiction fédérale, le gouvernement de l'État fait tout son possible pour assurer le développement de sa population sans moyens formels d'intervention. Étant ainsi limité à appliquer des politiques et des mesures de recommandations, le programme Eau de l'État s'est appliqué à développer une stratégie sur deux plans. Tout d'abord, des études hydrogéologiques de base et des modèles mathématiques d'écoulement et de transport de nappe ont été réalisés à partir d'un suivi d'ensemble des puits existants et d'une révision générale du contexte géologique de l'État. Ensuite, on a soutenu une structure de participation des usagers de l'eau aux actions de gestion de l'eau, à partir de la dissémination de l'information pour la mise en place de projets pilotes efficaces d'utilisation de l'eau, avec des aides financières, techniques et politiques de l'État. Simultanément, un effort coordonné en vue de l'achèvement de l'enregistrement des usagers de l'eau a été fait avec l'autorité fédérale, en même temps que d'autres mesures de soutien, telles que des programmes de formation et des campagnes de surveillance. Cet article présente une vue d'ensemble des réalisations de projets et des défis. Resumen El Estado de Guanajuato, situado en el centro de México, ocupa menos del 2% de la superficie del país. Tiene casi 17.000 pozos profundos, de los cuales se extrae cerca de 4.000 hm3/a, lo que supone un exceso de 1.000 hm3/a respecto a la recarga anual. Puesto que el agua es administrada a nivel federal en México, el gobierno del Estado afronta el reto de asegurar el desarrollo de la población sin disponer de medios formales de intervención. Dadas las limitaciones para aplicar políticas y medidas reguladoras, el programa del agua en el Estado tiene como objetivo principal la implantación de una doble estrategia. Por un lado, desarrollar estudios hidrogeológicos básicos y modelos matemáticos de flujo y transporte de los acuíferos, basándose en una campaña exhaustiva de pozos existentes y en una revisión del marco geológico del Estado. Por otro lado, promover-con soporte financiero, técnico y político-una estructura de participación de los usuarios en las acciones de gestión, incluyendo desde la difusión de la información hasta la implantación de proyectos piloto para un uso eficiente del agua. Simultáneamente, se ha llevado a cabo un esfuerzo coordinado con la autoridad federal para completar el registro de usuarios del agua, además de promover otras medidas de ayuda, como programas de capacitación y campañas de muestreo. En este artículo, se ofrece una visión general de los logros y retos del proyecto.

  11. La Enseñanza/Aprendizaje del Modelo Sol-Tierra Análisis de la Situación Actual y Propuesta de Mejora Para la Formación de los Futuros Profesores de Primaria

    NASA Astrophysics Data System (ADS)

    Martínez Sebastià, Bernat

    2004-12-01

    This work is an extened summary of the autor's PhD thesis. It deals with the teaching of astronomy (day/night, seasons) in primary school. At first, students teachers' undestanding of astronomical concepts related to Sun-Earth system have been analysed. Taking into account the results of the previous analysis and using a socio-constructivist approach a teaching sequence has been designed. This sequence has been tested with different groups of students teachers showing an improvement in their undestanding of elementary astronomical concepts. El trabajo que presentamos es un resumen extenso de la tesis doctoral del autor. El enfoque utilizado ha sido tratar de ligar la investigación sobre las ideas, razonamientos y obstáculos de los profesores de primaria con la planificación de la enseñanza del modelo Sol-Tierra que permite explicar el ciclo día/noche y las estaciones. En primer lugar, se ha procedido a realizar un análisis crítico de los resultados que se obtienen en el aprendizaje de los contenidos astronómicos en la enseñanza habitual. En segundo lugar se ha diseñado un curriculum potencialmente superador de esta situación desde una orientación que concibe la enseñanza y el aprendizaje como un proceso de construcción de conocimientos en una estructura problematizada. Finalmente, esta secuencia didáctica ha sido experimentada con diferentes grupos de estudiantes de magisterio, mostrando una mejora relevante en la comprensión de los conceptos astronómicos fundamentales.

  12. Establishment of Lipolexis oregmae (Hymenoptera: Aphidiidae) in a classical biological control program directed against the brown citrus aphid (Homoptera: Aphididae) in Florida

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Persad, A.B.; Hoy, M.A.; Ru Nguyen

    The parasitoid Lipolexis oregmae Gahan (introduced as L. scutellaris Mackauer) was imported from Guam, evaluated in quarantine, mass reared, and released into citrus groves in Florida in a classical biological control program directed against the brown citrus aphid, Toxoptera citricida Kirkaldy. Releases of 20,200, 12,100, and 1,260 adults of L. oregmae were made throughout Florida during 2000, 2001, and 2002, respectively. To determine if L. oregmae had successfully established, surveys were conducted throughout the state beginning in the summer of 2001 and continuing through the summer of 2003. Parasitism during 2001 and 2002 was evaluated by holding brown citrus aphidsmore » in the laboratory until parasitoid adults emerged. Lipolexis oregmae was found in 10 sites in 7 counties and 4 sites in 3 counties with parasitism rates ranging from 0.7 to 3.3% in 2001 and 2002, respectively. Laboratory tests indicated that high rates of mortality occurred if field-collected parasitized aphids were held in plastic bags, so a molecular assay was used that allowed immature L. oregmae to be detected within aphid hosts immediately after collection. The molecular assay was used in 2003 with the brown citrus aphids and with other aphid species collected from citrus, weeds, and vegetables near former release sites; immatures of L. oregmae were detected in black citrus aphids, cowpea aphids, spirea aphids, and melon aphids, as well as in the brown citrus aphid, in 4 of 8 counties sampled, with parasitism ranging from 2.0 to 12.9%, indicating that L. oregmae is established and widely distributed. Samples taken in Polk County during Oct 2005 indicated that L. oregmae has persisted. The ability of L. oregmae to parasitize other aphid species on citrus, and aphids on other host plants, enhances the ability of L. oregmae to persist when brown citrus aphid populations are low. (author) [Spanish] El parasitoide Lipolexis oregmae Gahan (introducido como L. scutellaris Mackauer) fue importado de Guam, evaluado en cuarentena, criado en masa y liberado en huertos de citricos en un programa de control biologico clasico dirigido contra el afido pardo de citricos, Toxoptera citricida Kirkaldy. Se hicieron liberaciones de 20,200, 12,100, y 1,260 adultos de L. oregmae a traves de la Florida durante los anos de 2000, 2001, y 2002, respectivamente. Para determinar si L. oregmae ha logrado en establecer, se realizaron sondeos a traves del estado empezando en el verano del 2001 y continuando hasta el final del verano del 2003. El parasitismo durante 2001 y 2002 fue evaluado con el mantenimiento de individuos del afido pardo de los citricos en el laboratorio hasta que los adultos emergieron. Lipolexis oregmae fue encontrado en 10 sitios en 7 condados y con tasas de parasitismo en 4 sitios en 3 condados entre 0.7 a 3.3% en el 2001 y 2002, respectivamente. Las pruebas del laboratorio indicaron que las tasas altas de mortalidad fueron posibles si los afidos con parasitos recolectados en el campo fueron mantenidos en bolsas plasticas, entonces un ensayo molecular fue usado con lo que permitio la deteccion de inmaduros de L. oregmae dentro de los hospederos de afidos inmediatamente despues de la recoleccion. El ensayo molecular fue usado en el 2003 con individuos del afido pardo de los citricos y con otras especies de afidos recolectados sobre citricos, malezas y hortalizas cerca de los sitios donde los parasitoides fueron liberados anteriormente; inmaduros de L. oregmae fueron detectados en individuos del afido negro de los citricos, el afido del caupi, el afido spirea y el afido del melon, ademas del afido pardo de los citricos en 4 de los 8 condados muestreados, con la tasa del parasitismo entre 2.0 a12.9%, indicando que L. oregmae estaba estabecido y ampliamente distribuido. Las muestras tomadas en el Condado de Polk durante octobre del 2005 indicaron que L. oregmae ha persistido. La capacidad de L. oregmae para parasitar otras especies de afidos sobre citricos y otros afidos sobre otras plantas hospederas, incrementa la capacidad de L. oregmae para persistir cuando las poblaciones del afido pardo de los citricos estan bajas. (author)« less

  13. Concepciones y concepciones alternativas de estudiantes universitarios/as de biologia y futuros maestros/as de Ciencia de escuela secundaria sobre la teoria de evolucion biologica por seleccion natural

    NASA Astrophysics Data System (ADS)

    Morales Ramos, Egda M.

    La teoria de evolucion biologica (TEB) por seleccion natural es uno de los conceptos unificadores mas importantes del curriculo de Biologia. En Puerto Rico se han hecho pocas investigaciones que abunden sobre las concepciones y concepciones alternativas (CA) que tienen los estudiantes universitarios/as de Biologia y los maestros/as de Ciencia del nivel secundario sobre esta teoria. La politica publica educativa actual establece mediante documentos normativos como los Estandares de contenido y Expectativas de grado del Programa de Ciencias [Puerto Rico Core Standards] la ensenanza de esta teoria. Sin embargo, no se encontraron preguntas sobre la seleccion natural en los ejercicios de practica provistos por el Departamento de Educacion para las pruebas estandarizadas lo cual puede influir para que no se ensene adecuadamente. Las preguntas de investigacion fueron 1. ¿Cuales son las concepciones y concepciones alternativas de estudiantes universitarios/as y de los futuros maestros y maestras de Ciencia sobre la TEB? 2. ¿Cuales conceptos que seleccionan los estudiantes universitarios/as y los futuros maestros y maestras de Ciencia sobre la TEB coinciden con lo aceptado como valido por la comunidad cientifica? y 3. ¿Como comparan las respuestas de la prueba original. v. Entendiendo el cambio biologico que mide concepciones y CA sobre la TEB por seleccion natural, con las de la traducida al idioma espanol? Se utilizo el metodo cuantitativo con un diseno de investigacion transversal por encuesta. La tecnica principal para recopilar los datos fue una prueba con doce items, que formo parte de un instrumento para el cual se recopilaron diversas fuentes de evidencia acerca de su validez. Las muestras estuvieron formadas por 69 estudiantes de Ciencias Naturales y por 16 estudiantes futuros maestros y maestras del nivel secundario de la UPR-RP. Se utilizaron estadisticas descriptivas, analisis de Ji cuadrado y se calcularon los coeficientes alfa de Cronbach y de Spearman. Estos demostraron que la prueba es confiable para medir las concepciones y CA de la TEB por seleccion natural. Aunque los estudiantes escogieron conceptos relacionados con esta teoria, mantienen en sus procesos de razonamiento CA sobre la seleccion natural que no se limitan a la lamarckiana y a la teleologica.

  14. Sex Stereotyping in Mexican Reading Primers.

    ERIC Educational Resources Information Center

    Heathcote, Olivia

    A study was conducted comparing the sex stereotypes present in selected Mexican reading primers published in 1960 with those present in primers published in 1972 to determine whether any significant changes in sex stereotyping were reflected in the 1972 primers. Comparisons were made between four primers published in 1960 for grades one through…

  15. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    PubMed

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  16. Implementation of several mathematical algorithms to breast tissue density classification

    NASA Astrophysics Data System (ADS)

    Quintana, C.; Redondo, M.; Tirao, G.

    2014-02-01

    The accuracy of mammographic abnormality detection methods is strongly dependent on breast tissue characteristics, where a dense breast tissue can hide lesions causing cancer to be detected at later stages. In addition, breast tissue density is widely accepted to be an important risk indicator for the development of breast cancer. This paper presents the implementation and the performance of different mathematical algorithms designed to standardize the categorization of mammographic images, according to the American College of Radiology classifications. These mathematical techniques are based on intrinsic properties calculations and on comparison with an ideal homogeneous image (joint entropy, mutual information, normalized cross correlation and index Q) as categorization parameters. The algorithms evaluation was performed on 100 cases of the mammographic data sets provided by the Ministerio de Salud de la Provincia de Córdoba, Argentina—Programa de Prevención del Cáncer de Mama (Department of Public Health, Córdoba, Argentina, Breast Cancer Prevention Program). The obtained breast classifications were compared with the expert medical diagnostics, showing a good performance. The implemented algorithms revealed a high potentiality to classify breasts into tissue density categories.

  17. La salud en personas con discapacidad intelectual en España: estudio europeo POMONA-II

    PubMed Central

    Martínez-Leal, Rafael; Salvador-Carulla, Luis; Gutiérrez-Colosía, Mencía Ruiz; Nadal, Margarida; Novell-Alsina, Ramón; Martorell, Almudena; González-Gordón, Rodrigo G.; Mérida-Gutiérrez, M. Reyes; Ángel, Silvia; Milagrosa-Tejonero, Luisa; Rodríguez, Alicia; García-Gutiérrez, Juan C.; Pérez-Vicente, Amado; García-Ibáñez, José; Aguilera-Inés, Francisco

    2011-01-01

    Introducción Estudios internacionales demuestran que existe un patrón diferenciado de salud y una disparidad en la atención sanitaria entre personas con discapacidad intelectual (DI) y población general. Objetivo Obtener datos sobre el estado de salud de las personas con DI y compararlos con datos de población general. Pacientes y métodos Se utilizó el conjunto de indicadores de salud P15 en una muestra de 111 sujetos con DI. Los datos de salud encontrados se compararon según el tipo de residencia de los sujetos y se utilizó la Encuesta Nacional de Salud 2006 para comparar estos datos con los de la población general. Resultados La muestra con DI presentó 25 veces más casos de epilepsia y el doble de obesidad. Un 20% presentó dolor bucal, y existió una alta presencia de problemas sensoriales, de movilidad y psicosis. Sin embargo, encontramos una baja presencia de patologías como la diabetes, la hipertensión, la osteoartritis y la osteoporosis. También presentaron una menor participación en programas de prevención y promoción de la salud, un mayor número de ingresos hospitalarios y un uso menor de los servicios de urgencia. Conclusiones El patrón de salud de las personas con DI difiere del de la población general, y éstas realizan un uso distinto de los servicios sanitarios. Es importante el desarrollo de programas de promoción de salud y de formación profesional específicamente diseñados para la atención de personas con DI, así como la implementación de encuestas de salud que incluyan datos sobre esta población. PMID:21948011

  18. Groundwater demand management at local scale in rural areas of India: a strategy to ensure water well sustainability based on aquifer diffusivity and community participation

    NASA Astrophysics Data System (ADS)

    Kulkarni, Himanshu; Vijay Shankar, P. S.; Deolankar, S. B.; Shah, Mihir

    Watershed development programmes provide an opportunity for sustainable management strategies, although currently, they remain largely `supply-side' mechanisms of water resources development. Hydrogeological conditions, community participation and status of groundwater usage are important in evolving strategies on `demand-side' groundwater management. Neemkheda aquifer is a typical low-storage, low-hydraulic conductivity aquifer from a watershed in the dryland regions of Madhya Pradesh State of central India. A shallow unconfined aquifer, it consists of an upper coarse, calcareous sandstone unit underlain by a fine-grained sandstone unit. A `well commune' of seven wells is poised to test the concept of joint groundwater management, wherein wells are mechanisms of tapping a common water source, the Neemkheda aquifer. The strategy for systematic groundwater management in the Neemkheda well commune is based upon the relationship between Transmissivity (T) and Storage coefficient (S), i.e. aquifer diffusivity, and its variation within the aquifer. Wells within a high diffusivity domain tend to dewater more quickly than wells within a low diffusivity domain. A well-use schedule during the dry season, based upon aquifer diffusivity forms the basis of the groundwater management concept. The distribution of local aquifer diffusivities governs the relationship between local and regional aquifer depletion times and forms the basis of the groundwater management exercise being proposed for the Neemkheda aquifer. Los programas de desarrollo de una cuenca hídrica son una oportunidad para el uso de estrategias de gestión sostenible, aunque hoy en día estas siguen siendo principalmente mecanismos para el desarrollo de recursos hídricos con énfasis en la ``oferta''. Las condiciones hidrogeológicas, la participación comunitaria y la condición de utilización del agua subterránea, son importantes en el desarrollo de estrategias para la gestión del agua subterránea, desde el punto de vista de la ``demanda''. El acuífero de Neemkheda es un acuífero típico de almacenamiento bajo y conductividad hidráulica baja, perteneciente a una cuenca hídrica ubicada en las regiones secas del Estado de Madhya Pradesh, en la parte central de India. Un acuífero de tipo libre, somero, formado por una unidad superior de arenisca calcárea de grano grueso, subyacida por una unidad de arenisca de grano fino. Un campo de pozos comunitario compuesto por siete pozos, pone a prueba el concepto de gestión conjunta del agua subterránea, dentro del cual los pozos son mecanismos para usar una fuente de agua común: El acuífero de Neemkheda. La estrategia usada para la gestión sistemática del agua subterránea, en el campo de pozos comunitario de Neemkheda, se basa en la relación existente entre Transmisividad (T) y Coeficiente de Almacenamiento (S), es decir en la Difusividad del Acuífero y en su variación observada dentro del mismo acuífero. Los pozos cuya difusividad esta dentro de un rango alto, tienden a experimentar un descenso en su nivel mas rápidamente que aquellos pozos con una difusividad baja. El concepto de gestión de agua subterránea se basa en un programa especial de operación para cada pozo durante la estación seca, el cual a su vez se basa en la difusividad del acuífero. La distribución de difusividades locales del acuífero rige las relaciones entre las épocas de descensos de nivel en el acuífero a escala regional y local, y además constituyen la base del ejercicio de la gestión del agua subterránea que se esta proponiendo para el acuífero de Neemkheda. Les programmes de développement des bassins versants offrent une occasion de développer des stratégies pour une gestion durable, bien qu' à présent elles restent en grande mesure `le terme source' dans le mécanisme de développement de la ressource en eau. Les conditions hydrogéologiques, la participation de la communauté et l'usage des eaux souterraines sont importants pour le `terme demande' dans les stratégies de gestion des eaux souterraines. L'aquifère de Neemkheda presents des caractéristiques typiques pour un bassin versant dans les régions arides de l'état Madhya Pradesh de l'Inde centrale en ce qui concerne les faible valeurs de la conductivité hydraulique et du coéfficient d'emmagasinement. Il s'agit d'un aquifère phrèatique dont la partie supérieure est constitué par des grès calcaire qui restent sur des grés plus fins. Afin d'essayer le concept de gestion integrée, on a réalisé dans l'aquifère de Neemkheda un captage ayant sept forages qui forment la ressource en eau communale. La stratégie de la gestion systématique du captage est basée sur la relation entre la transmissivité (T), le coéfficient d'emmagasinement (S), donc la diffusivité hydraulique ainsi que sa variation spatiale. Les puits forés dans les zones à grande diffusivité tendent à s'assècher plus vite que ceux creusés dans des zones à faible diffusivité. Le concept de la gestion des eaux souterraines est donc basé sur la distribution spatiale des diffusivités. À partir de ce concept on a développé un programme d'exploitation des forages pendant les saisons sèches. La relation entre les temps d' épuissment locaux et régionaux est determiné par la distribution spatiale de la diffusivitée et forme la base de l'exercice sur la gestion des eaux proposée pour l'aquifère de Neemkheda.

  19. Evidence-based measures to prevent central line-associated bloodstream infections: a systematic review.

    PubMed

    Perin, Daniele Cristina; Erdmann, Alacoque Lorenzini; Higashi, Giovana Dorneles Callegaro; Sasso, Grace Teresinha Marcon Dal

    2016-09-01

    to identify evidence-based care to prevent CLABSI among adult patients hospitalized in ICUs. systematic review conducted in the following databases: PubMed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf and Cochrane Studies addressing care and maintenance of central venous catheters, published from January 2011 to July 2014 were searched. The 34 studies identified were organized in an instrument and assessed by using the classification provided by the Joanna Briggs Institute. the studies presented care bundles including elements such as hand hygiene and maximal barrier precautions; multidimensional programs and strategies such as impregnated catheters and bandages and the involvement of facilities in and commitment of staff to preventing infections. care bundles coupled with education and the commitment of both staff and institutions is a strategy that can contribute to decreased rates of central line-associated bloodstream infections among adult patients hospitalized in intensive care units. identificar evidências de cuidados para prevenção de infecção de corrente sanguínea relacionada a cateter venoso central em pacientes adultos em Unidades de Terapia Intensiva. revisão Sistemática realizada por meio de busca nas bases de dados Pubmed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf e Cochrane. Foram buscadas pesquisas com cuidados com a cateterização e manutenção do cateter venoso central, publicados de janeiro de 2011 a julho de 2014. Os 34 estudos incluídos foram organizados em um instrumento e avaliados por meio da classificação do The Joanna Briggs Institute. os estudos apresentaram bundles de cuidados com elementos como a higiene das mãos e precauções máximas de barreira; programas multidimensionais e estratégias como cateteres e curativos impregnados e o envolvimento da instituição e engajamento da equipe nos esforços para prevenção de infecção. os cuidados no formato de bundles aliados com a educação e engajamento da equipe e da instituição são estratégias que poderão contribuir para a redução das taxas de infecção de corrente sanguínea relacionada a cateter venoso central em pacientes adultos em unidades de terapia intensiva. identificar evidencias de cuidados para prevención de infección de la corriente sanguínea relacionada al catéter venoso central, en pacientes adultos en Unidades de Terapia Intensiva. revisión sistemática realizada por medio de búsqueda en las bases de datos Pubmed, Scopus, Cinahl, Web of Science, Lilacs, Bdenf y Cochrane. Fueron buscadas investigaciones de cuidados con la cateterización y manutención del catéter venoso central, publicados de enero de 2011 a julio de 2014. Los 34 estudios incluidos fueron organizados en un instrumento y evaluados por medio de la clasificación del The Joanna Briggs Institute. los estudios presentaron bundles de cuidados con elementos como: higiene de las manos y precauciones máximas de barrera; programas multidimensionales y estrategias como catéteres y curativos impregnados y, participación de la institución y compromiso del equipo en los esfuerzos para prevención de la infección. los cuidados en el formato de bundles aliados con la educación y compromiso del equipo y de la institución, son estrategias que podrán contribuir para la reducción de las tasas de infección de la corriente sanguínea relacionadas al catéter venoso central, en pacientes adultos en unidades de terapia intensiva.

  20. PRISE2: software for designing sequence-selective PCR primers and probes.

    PubMed

    Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James

    2014-09-25

    PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.

  1. Programa De Educacion Interamericana.

    ERIC Educational Resources Information Center

    Texas A and M Univ., College Station.

    PROGRAMA DE EDUCACION INTERAMERICANA is a project of Texas A&M University in liaison with the Bryan Independent School District. The objectives of the program are to improve the knowledge and understanding of Texas teachers and students about other American cultures. Study teams of educators research and, in midsummer, travel to selected…

  2. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    PubMed

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  3. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR

    PubMed Central

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-01-01

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350

  4. Concepciones Alternativas de "Fotosintesis" en estudiantes Universitarios del curso basico de Biologia y posibles correcciones con el Modelo Educativo MODEF

    NASA Astrophysics Data System (ADS)

    De Jesus Roman, Sandra

    Concepciones Alternativas de Fotosíntesis en estudiantes Universitariosdel curso básico de Biología y posibles correcciones con el Modelo Educativo MODEF El modelo educativo para la enseñanza de Fotosíntesis (MODEF) se implantó para trabajar el problema de las concepciones alternativas (CA) en un curso de Biología General. Se evaluaron los resultados en cuanto al logro del aprendizaje significativo. La pregunta central de la investigación fue: ¿Cómo aporta el modelo educativo en la didáctica y comprensión del tema de fotosíntesis? Se efectuó una investigación acción con una fase cuantitativa y una cualitativa. Para la fase cuantitativa se elaboró una prueba para determinar las concepciones alternativas, se validó y se sometió a los estudiantes que participaron en el estudio antes y después de ofrecer la unidad de metabolismo celular. Los participantes eran estudiantes de primer año de la Universidad de Puerto Rico en Bayamón (UPRB). Se llevó a cabo un análisis de consistencia interna de la prueba mediante el método Alfa de Cronbach. Se analizaron las contestaciones a cada pregunta mediante la prueba de Ji cuadrado de contingencia, se efectuó la prueba de t y el coeficiente r de Pearson. La fase cualitativa incluyó la observación participativa de la investigadora- profesora, las reflexiones de los estudiantes y la información de las entrevistas semi-estructuradas que se realizaron a tres estudiantes del curso. El análisis se llevó a cabo mediante el Modelo de Wolcott. Se trabajaron diez CA de las cuales siete fueron corregidas mediante el Modelo MODEF. Las actividades más importantes para el proceso de aprendizaje incluyeron el trabajo de investigación o búsqueda de información para hacer una presentación digital, la elaboración de tablas, los mapas de conceptos, el uso de visuales o videos y las analogías para explicar conceptos o procesos. En conclusión: se recomienda el uso del Modelo MODEF para la discusión del tema de Fotosíntesis a base de los resultados cuantitativos y cualitativos de esta investigación. El Comité Institucional para la Protección de los Seres Humanos en la Investigación (CIPSHI) autorizó el estudio.

  5. [Clinical and genetic analysis of a patient with Treacher Collins syndrome in TCOF1 gene].

    PubMed

    Li, Hongbo; Zhang, Xu; Li, Zhenyue; Chen, Jing; Lu, Yu; Jia, Jingjie; Yuan, Huijun; Han, Dongyi

    2012-05-01

    To analyze the clinical and genetic features of a patient with Treacher Collins syndrome (TCS), and identify the mutation in TCOF1 gene. The medical history was taken, and general physical examinations and otological examinations were conducted in this patient. Genomic DNA was extracted from this patient and his parents and complete TCOF1 gene coding exons were amplified by specific PCR primers. Direct sequencing was carried out to identify the mutations. The raw data was analyzed with GeneTool software and molecular biological website. We detected a heterozygous c. 1639 delAG mutation in exon 11 of TCOF1, which resulted in a truncated protein lacking normal function. This mutation is a novel mutation and the second case identified in exon 11 of in TCS. TCS patient reported in this study has unique clinical phenotype. TCOF1 gene mutation is the specific risk factor.

  6. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery

    PubMed Central

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David

    2006-01-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092

  7. SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.

    PubMed

    Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David

    2006-07-01

    Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.

  8. A PCR primer bank for quantitative gene expression analysis.

    PubMed

    Wang, Xiaowei; Seed, Brian

    2003-12-15

    Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.

  9. Comparison among amoA Primers Suited for Quantification and Diversity Analyses of Ammonia-Oxidizing Bacteria in Soil

    PubMed Central

    Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito

    2012-01-01

    Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625

  10. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

  11. 40 CFR 63.3092 - How must I control emissions from my electrodeposition primer system if I want to comply with the...

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... electrodeposition primer system if I want to comply with the combined primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? 63.3092 Section 63.3092 Protection of...-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive emission limit? If your...

  12. Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis

    PubMed Central

    Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.

    2005-01-01

    Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538

  13. Astronomy in Science Textbooks: An Analysis of Pnld 2008. (Spanish Title: Astronomía en los Libros de Ciencia: un Análisis del Pnld 2008.) Astronomia Nos Livros Didáticos de Ciências: Uma Análise do Pnld 2008

    NASA Astrophysics Data System (ADS)

    Amaral, Patrícia; Quintanilha Vaz de Oliveira, Carlos Eduardo

    2011-12-01

    The importance of the textbooks in classrooms is revealed when studies are pointing that these pedagogical sources are, most of the times, the only source used by the elementary school teachers when preparing their Science lessons. When we analyzed the Astronomy contents in the textbooks approved by the Brazilian Textbook Program 2008 and which, in theory, are the best available in the Brazilian editorial market, we examined some categories in the 2008 Textbook Guide. This research characterizes the frequency of Astronomical contents appearing in the texts, in the pictures, and in the hands-on activities. Additionally, it describes some misconceptions and presents additional information on the collections. La importancia de los libros de texto en las aulas se pone de manifiesto cuando los estudios indican que este recurso educativo es a menudo la única fuente de consulta utilizada por el profesor de ciencias de la escuela primaria para preparar sus lecciones. Cuando analizamos el contenido presente en los libros de texto de astronomía aprobados por el Programa Nacional de Libros de Texto de 2008 y que, en teoría, son los mejores libros disponibles en el mercado editorial brasileño, buscamos examinar algunas categorías que figuran en los libros de texto de la Guía de Libros Didácticos de 2008. El estudio caracteriza la frecuencia del contenido de Astronomía en el texto, en las figuras, y en las actividades de experimentación. También describe algunos errores conceptuales y presenta un conjunto de información adicional sobre las colecciones. A importância dos livros didáticos nas salas de aula revela-se quando estudos apontam que este recurso pedagógico é, muitas vezes, a única fonte de consulta utilizada pelo professor de Ciências do ensino fundamental para a preparação de suas aulas. Quando analisamos os conteúdos de Astronomia presentes nos livros didáticos aprovados no Programa Nacional do Livro Didático de 2008 e que, teoricamente, são os melhores livros disponíveis no mercado editorial brasileiro, buscamos esquadrinhar algumas categorias constantes no Guia de Livros Didáticos de 2008. A pesquisa caracteriza a freqüência do conteúdo de Astronomia no texto, nas figuras e nas atividades de experimentação. Além disso, descreve alguns erros conceituais e apresenta um conjunto de informações adicionais sobre as coleções.

  14. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    PubMed Central

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  15. Yeast diversity associated to sediments and water from two Colombian artificial lakes

    PubMed Central

    Silva-Bedoya, L.M.; Ramírez-Castrillón, M.; Osorio-Cadavid, E.

    2014-01-01

    In Colombia, knowledge of the yeast and yeast-like fungi community is limited because most studies have focused on species with clinical importance. Sediments and water represent important habitats for the study of yeast diversity, especially for yeast species with industrial, biotechnological, and bioremediation potential. The main purpose of this study was to identify and compare the diversity of yeast species associated with sediment and water samples from two artificial lakes in Universidad del Valle (Cali-Colombia). Yeast samplings were performed from fifteen sediment samples and ten water samples. Grouping of similar isolates was initially based on colony and cell morphology, which was then complemented by micro/mini satellite primed PCR banding pattern analysis by using GTG5 as single primer. A representative isolate for each group established was chosen for D1/D2 domain sequencing and identification. In general, the following yeast species were identified: Candida albicans, Candida diversa, Candida glabrata, Candida pseudolambica, Cryptococcus podzolicus, Cryptococcus rajasthanensis, Cryptococcus laurentii, Williopsis saturnus, Hanseniaspora thailandica, Hanseniaspora uvarum, Rhodotorula mucilaginosa, Saccharomyces cerevisiae, Torulaspora delbrueckii, Torulaspora pretoriensis, Tricosporon jirovecii, Trichosporon laibachii and Yarrowia lypolitica. Two possible new species were also found, belonging to the Issatchenkia sp. and Bullera sp. genera. In conclusion, the lakes at the Universidad del Valle campus have significant differences in yeast diversity and species composition between them. PMID:24948924

  16. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system.

    PubMed

    Shinohara, Ayano; Taira, Yohsuke; Sakihara, Michino; Sawase, Takashi

    2018-01-01

    Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study.

  17. Effects of three silane primers and five adhesive agents on the bond strength of composite material for a computer-aided design and manufacturing system

    PubMed Central

    2018-01-01

    Abstract Objective The objective of this study was to evaluate the effects of combinations of silane primers and adhesive agents on the bond strength of a composite block for a computer-aided design and manufacturing system. Material and Methods Three silane primers [Clearfil Ceramic Primer (CP), Super-Bond PZ Primer (PZ), and GC Ceramic Primer II (GP)] were used in conjunction with five adhesive agents [G-Premio Bond (P-Bond), Repair Adhe Adhesive (R-Adhesive), Super-Bond D-Liner Dual (SB-Dual), Super-Bond C&B (SB-Self), and SB-Dual without tributylborane derivative (SB-Light)]. The surface of a composite block (Gradia Block) was ground with silicon carbide paper. After treatment with a silane primer, a adhesive agent was applied to each testing specimen. The specimens were then bonded with a light-curing resin composite. After 24 h, the shear bond strength values were determined and compared using a post hoc test (α=0.05, n=8/group). We also prepared control specimens without primer (No primer) and/or without adhesive agent (No adhesive). Results PZ/SB-Dual and GP/SB-Dual presented the highest bond strength, followed by GP/P-Bond, CP/SB-Dual, CP/R-Adhesive, No primer/SB-Dual, GP/R-Adhesive, CP/P-Bond, No primer/R-Adhesive, PZ/R-Adhesive, CP/SB-Self, PZ/P-Bond, PZ/SB-Self, and GP/SB-Self in descending order of bond strength. No primer/P-Bond, No primer/SB-Self, and all specimens in the SB-Light and No adhesive groups presented the lowest bond strengths. Conclusion A dual-curing adhesive agent (SB-Dual) containing a tributylborane derivative in combination with a silane primer (GP or PZ) presents a greater bond strength between the composite block and the repairing resin composite than the comparators used in the study. PMID:29742254

  18. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-01-01

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272

  19. MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.

    PubMed

    Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo

    2015-11-16

    Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. A 22-mer primer enhances discriminatory power of AP-PCR fingerprinting technique in characterization of leptospires.

    PubMed

    Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C

    2004-11-01

    To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.

  1. Output testing of small-arms primers

    NASA Technical Reports Server (NTRS)

    Bement, Laurence J.; Doris, Thomas A.; Schimmel, Morry L.

    1991-01-01

    The performance of two standard primers for initiating small-caliber ammunition are compared to that of a primer for initiating aircraft escape-system components. Three testing methods are employed including: (1) firing the primer to measure total energy delivered; (2) monitoring output in terms of gaseous product-mass flow rate and pressure as a function of time; and (3) firing the primer onto ignition material to study gas pressure produced during ignition and burning as a function of time. The results of the test demonstrate differences in the ignitability factors of the standard primers and time peak pressures of less than 100 microseconds. One unexpected result is that two percussion primers (the FA-41 and the M42C1) developed for different applications have the same ignitability. The ignitability test method is shown to yield the most useful data and can be used to specify percussion primers and optimize their performance.

  2. Report of the procedure of voluntary interruption of pregnancy at a university hospital in Uruguay.

    PubMed

    Bentancor, Ana; Hernández, Ana Laura; Godoy, Yamile; Dapueto, Juan J

    2016-07-04

    To describe the constitution and operation of a voluntary interruption of pregnancy team of a university hospital, from the outlook of the mental health team. In this case study, the following aspects were analyzed: 1) historical background; 2) implementation of Law 18,897 of October 22, 2012; and 3) functioning of the program at the Hospital de Clínicas of the Facultad de Medicina (Universidad de la República, Uruguay), taking into account three dimensions: structure, process, and results. Between December 2012 and November 2013, a total of 6,676 voluntary interruptions of pregnancy were reported in Uruguay; out of these, 80 were conducted at the Hospital de Clínicas. The patients' demographic data agreed with those reported at the national level: Of the total patients, 81.0% were aged over 19 years; 6.2% decided to continue with the pregnancy; and only 70.0% attended the subsequent control and received advice on contraception. In its implementation year in Uruguay, we can assess the experience as positive from the point of view of women's health. Our experience as a mental health team at the Hospital de Clínicas, inserted into the multidisciplinary voluntary interruption of pregnancy team, is in the process of assessment and reformulation of practices. Describir la conformación y funcionamiento de un equipo de interrupción voluntaria del embarazo de un hospital universitario, desde la mirada del equipo de salud mental. En este estudio de caso, se analizan los siguientes aspectos: 1) antecedentes históricos; 2) implementación de la Ley 18.897 de 22 de octubre de 2012; y 3) funcionamiento del programa en el Hospital de Clínicas de la Facultad de Medicina (Universidad de la República, Uruguay), teniendo en cuenta tres dimensiones (estructura, proceso y resultados). Entre diciembre de 2012 y noviembre de 2013, se reportaron en Uruguay un total de 6.676 interrupciones voluntarias del embarazo; de ellas, 80 se llevaron a cabo en el Hospital de Clínicas. Los datos sociodemográficos de las pacientes concordaron con los reportados a nivel nacional: 81,0% de las pacientes que consultaron era mayores de 19 años; 6,2% decidieron continuar con el embarazo; solo 70,0% concurrieron al control posterior y recibieron asesoramiento sobre anticoncepción. Al año de su implementación, en Uruguay, podemos evaluar la experiencia como positiva desde el punto de vista de la salud de las mujeres. Nuestra experiencia como equipo de salud mental en el Hospital de Clínicas, inserto dentro del equipo multidisciplinario de interrupción voluntaria del embarazo, se encuentra en pleno proceso de evaluación y reformulación de prácticas.

  3. Development of a sharp interface model that simulates coastal aquifer flow with the coupled use of GIS

    NASA Astrophysics Data System (ADS)

    Gemitzi, Alexandra; Tolikas, Demetrios

    A simulation program, which works seamlessly with GIS and simulates flows in coastal aquifers, is presented in the present paper. The model is based on the Galerkin finite element discretization scheme and it simulates both steady and transient freshwater and saltwater flow, assuming that the two fluids are separated by a sharp interface. The model has been verified in simple cases where analytical solutions exist. The simulation program works as a tool of the GIS program, which is the main database that stores and manages all the necessary data. The combined use of the simulation and the GIS program forms an integrated management tool offering a simpler way of simulating and studying saline intrusion in coastal aquifers. Application of the model to the Yermasogia aquifer illustrates the coupled use of modeling and GIS techniques for the examination of regional coastal aquifer systems. Pour étudier un système aquifère côtier, nous avons développé un modèle aux éléments finis en quasi 3-D qui simule les écoulements d'eau douce et d'eau salée en régime aussi bien permanent que transitoire. Les équations qui les régissent sont discrétisées par un schéma de discrétisation de Garlekin aux éléments finis. Le modèle a été vérifié dans des cas simples où il existe des solutions analytiques. Toutes les données nécessaires sont introduites et gérées grâce à un logiciel de gestion de SIG. Le programme de simulation est utilisé comme un outil du logiciel de SIG, constituant ainsi un outil de gestion intégrée dont le but est de simuler et d'étudier l'intrusion saline dans les aquifères côtiers. L'application du modèle à l'aquifère de Yermasogia illustre l'utilisation couplée de la modélisation et des techniques de SIG pour l'étude des systèmes aquifères côtiers régionaux. Se ha desarrollado un modelo casi tridimensional de elementos finitos para simular el flujo de agua dulce y salada, tanto en régimen estacionario como en transitorio, en sistemas acuíferos costeros, bajo la hipótesis de separación por medio de una interfaz abrupta. Las ecuaciones del modelo han sido discretizadas mediante un esquema de Galerkin de discretización en elementos finitos. El modelo ha sido verificado en casos sencillos para los que existe solución analítica. Todos los datos necesarios se introducen y gestionan con un Sistema de Información Geográfica [SIG] por ordenador. El programa de simulación forma parte del programa de SIG, constituyendo una herramienta integrada de gestión para estudiar la intrusión salina en acuíferos costeros. La aplicación del modelo al acuífero de Yermasogia ilustra el uso acoplado de las técnicas de modelación y de SIG con el fin de examinar sistemas acuíferos costeros a escala regional.

  4. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    PubMed

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  5. Value for money assessment for public-private partnerships : a primer.

    DOT National Transportation Integrated Search

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of primers.

  6. Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.

    PubMed Central

    Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C

    1996-01-01

    In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291

  7. A multiple-alignment based primer design algorithm for genetically highly variable DNA targets

    PubMed Central

    2013-01-01

    Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160

  8. Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

    PubMed

    Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

    2013-06-01

    Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and reliable genotyping tool to assist hybrid cotton breeding.

  9. MRPrimerW: a tool for rapid design of valid high-quality primers for multiple target qPCR experiments.

    PubMed

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo

    2016-07-08

    Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Presentación del estudio “Links” de hombres que tienes sexo con hombres en Buenos Aires, Argentina

    PubMed Central

    Carballo-Diéguez, Alex; Ávila, María M; Balán, Iván C.; Marone, Rubén; Pando, María A.; Barreda, Victoria

    2011-01-01

    Resumen Estudios previos en Buenos Aires reportaron altas prevalencias de HIV entre HSH, con valores que oscilan entre 9 y 14% durante casi 10 años de continuo testeo. El objetivo principal de este estudio fue la evaluación de factores relacionados al comportamiento de alto riesgo para transmisión del HIV entre HSH entre los que se incluyen el conocimiento y factores emocionales, socioculturales y ambientales. Por otro lado se realizó la estimación de prevalencia e incidencia de HIV utilizando RDS (Respondent Driven Sampling), así como la presencia de otras infecciones de transmisión sexual. Por último se evaluaron los hábitos de testeo para HIV indagando que factores facilitan o impiden su realización. El estudio constó de dos fases, en primer lugar una fase cualitativa y posteriormente una fase cuantitativa con una duración total de 4 años y medio. Durante la fase cualitativa se realizaron 44 entrevistas individuales en profundidad, 8 grupos focales y 10 observaciones etnográficas (hoteles, baños públicos (“teteras”), cines pornográficos, fiestas privadas, dark rooms y discotecas). Durante la fase cuantitativa del estudio se realizó el reclutamiento de 500 participantes que provinieron de la Ciudad Autónoma de Buenos Aires, así como del Gran Buenos Aires. El reclutamiento se comenzó con 16 participantes llamados semillas. Se realizó el diagnóstico de infección por HIV, hepatitis B y C (HBV y HCV), Treponema pallidum, Virus Papiloma Humano (HPV) y Chlamidias. La colaboración establecida entre los grupos de trabajo enfocados en áreas diversas posibilitó el abordaje conjunto de nuevas estrategias de investigación antes no exploradas en nuestro país. Los resultados más relevantes de esta investigación serán progresivamente publicados en sucesivos números de Actualizaciones en SIDA. PMID:25264397

  11. Correlation of the level of full-length CFTR transcript with pulmonary phenotype in patients carrying R117H and 1342-1,-2delAG mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hamosh, A.; Cutting, G.R.; Oates, R.

    The R117H mutation occurs on two chromosome backgrounds, one associated with a 7 thymidine tract (7T-R11H) in the splice-acceptor site of intron 8, the other with a 5 thymidine tract (5T-R117H). We examined exon 9 splicing efficiency in 5 patients of genotype R117H/{delta}F508 and one carrying 1342-1,-2delAG{delta}F508, an obligate exon 9 slice site mutation. Four patients carried R117H on a 7T background -- three adult men with congenital bilateral absence of the vas deferens and one adolescent female with pancreatitis and borderline sweat chloride concentration. The patient with R117H on a 5T background had pancreatic sufficient CF (PS-CF). The 1342-1,-2delAGmore » patient has classic pancreatic insufficient CF (PI-CF). cDNA was synthesized from total RNA extracted from nasal epithlial cells and analyzed for CFTR splicing by 35 cycle PCR using primers in exon 7 and 11. The quantity of full length transcript derived from the R117H or {delta}F508 alleles was assessed by allele-specific oligonucleotide hybridization. While 91.4% of transcript from the 5T-R117H allele was full-length, only 42.2% of CFTR transcript from the 5T-R117H allele was full length. Since CBAVD patients have no lung disease and PS-CF patients do, this indicates that the threshold of developing CF lung disease is crossed when the amount of CFTR transcript bearing R117H is reduced by half. Interestingly, 17.1% of transcript derived from the 1342-1,-2delAG allele (or 8.6% of total CFTR transcript) was normal and full length. This suggests that up to 9% of full length wild-type CFTR transcript may be inadequate to escape the lung disease of CF and that a 9 thymidine tract followed by AAC (the result of the AG deletion) can be used as a splice donor with 2-9% efficiency.« less

  12. Microsatellite markers for Vellozia gigantea (Velloziaceae), a narrowly endemic species to the Brazilian campos rupestres.

    PubMed

    Martins, Ana Paula V; Proite, Karina; Kalapothakis, Evanguedes; Santos, Fabrício R; Chaves, Anderson V; Borba, Eduardo L

    2012-07-01

    Microsatellite primers were developed for the first time in Velloziaceae, in the endangered species Vellozia gigantea. Using two different protocols, seven primer sets were characterized in three populations of V. gigantea. The primers amplified di- and trinucleotide repeats with six to 12 alleles per locus. These revealed high levels of genetic variation, presenting an average observed heterozygosity of 0.508 in V. gigantea. The seven primers were tested for cross-amplification in three Vellozia species. All primers successfully amplified in V. auriculata. Six primers amplified in V. compacta and three in V. hirsuta. The new marker set described here will be useful for studies of population genetics of V. gigantea. The cross-amplification results indicate the utility of primers for studies in other Vellozia species.

  13. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  14. A tool for design of primers for microRNA-specific quantitative RT-qPCR.

    PubMed

    Busk, Peter K

    2014-01-28

    MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.

  15. URPD: a specific product primer design tool

    PubMed Central

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  16. The removal of RNA primers from DNA synthesized by the reverse transcriptase of the retrotransposon Tf1 is stimulated by Tf1 integrase.

    PubMed

    Herzig, Eytan; Voronin, Nickolay; Hizi, Amnon

    2012-06-01

    The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process.

  17. The Removal of RNA Primers from DNA Synthesized by the Reverse Transcriptase of the Retrotransposon Tf1 Is Stimulated by Tf1 Integrase

    PubMed Central

    Herzig, Eytan; Voronin, Nickolay

    2012-01-01

    The Tf1 retrotransposon represents a group of long terminal repeat retroelements that use an RNA self-primer for initiating reverse transcription while synthesizing the minus-sense DNA strand. Tf1 reverse transcriptase (RT) was found earlier to generate the self-primer in vitro. Here, we show that this RT can remove from the synthesized cDNA the entire self-primer as well as the complete polypurine tract (PPT) sequence (serving as a second primer for cDNA synthesis). However, these primer removals, mediated by the RNase H activity of Tf1 RT, are quite inefficient. Interestingly, the integrase of Tf1 stimulated the specific Tf1 RT-directed cleavage of both the self-primer and PPT, although there was no general enhancement of the RT's RNase H activity (and the integrase by itself is devoid of any primer cleavage). The RTs of two prototype retroviruses, murine leukemia virus and human immunodeficiency virus, showed only a partial and nonspecific cleavage of both Tf1-associated primers with no stimulation by Tf1 integrase. Mutagenesis of Tf1 integrase revealed that the complete Tf1 integrase protein (excluding its chromodomain) is required for stimulating the Tf1 RT primer removal activity. Nonetheless, a double mutant integrase that has lost its integration functions can still stimulate the RT's activity, though heat-inactivated integrase cannot enhance primer removals. These findings suggest that the enzymatic activity of Tf1 integrase is not essential for stimulating the RT-mediated primer removal, while the proper folding of this protein is obligatory for this function. These results highlight possible new functions of Tf1 integrase in the retrotransposon's reverse transcription process. PMID:22491446

  18. URPD: a specific product primer design tool.

    PubMed

    Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong

    2012-06-19

    Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  19. Hybrid Materials for Thermal Management in Thin Films and Bulk Composites

    DTIC Science & Technology

    2012-02-01

    enamel  that  cures  via  oxidative...polymerization   in   air  ( Enamel ),  a  waterborne  flat   latex  that  cures  by  coalescing  while  air  drying  (Flat...Wood   Bare   Primer   Primer   +  KPF6     Bare   Primer   Primer   +  KPF6     Bare   Primer   Enamel  

  20. Mapping the Rural Adolescent Girls' Participation in Residential Non-Formal Education Program--A Study in Lunkaransar Block, Rajasthan, India

    ERIC Educational Resources Information Center

    Sharma, Shilpa

    2002-01-01

    The present study, "Mapping Rural Adolescent Girl's Participation in Residential Non- Formal Education Program--A Study in Lunkaransar Block, Rajasthan", was an attempt to understand the dimensions of rural adolescent girls' participation in the "Balika Shivir" Program. It is a six month residential non-formal education program…

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna

    ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less

  2. Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.

    PubMed

    Lee, Jaikoo; Lee, Sangsun; Young, J Peter W

    2008-08-01

    A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.

  3. WASP: a Web-based Allele-Specific PCR assay designing tool for detecting SNPs and mutations

    PubMed Central

    Wangkumhang, Pongsakorn; Chaichoompu, Kridsadakorn; Ngamphiw, Chumpol; Ruangrit, Uttapong; Chanprasert, Juntima; Assawamakin, Anunchai; Tongsima, Sissades

    2007-01-01

    Background Allele-specific (AS) Polymerase Chain Reaction is a convenient and inexpensive method for genotyping Single Nucleotide Polymorphisms (SNPs) and mutations. It is applied in many recent studies including population genetics, molecular genetics and pharmacogenomics. Using known AS primer design tools to create primers leads to cumbersome process to inexperience users since information about SNP/mutation must be acquired from public databases prior to the design. Furthermore, most of these tools do not offer the mismatch enhancement to designed primers. The available web applications do not provide user-friendly graphical input interface and intuitive visualization of their primer results. Results This work presents a web-based AS primer design application called WASP. This tool can efficiently design AS primers for human SNPs as well as mutations. To assist scientists with collecting necessary information about target polymorphisms, this tool provides a local SNP database containing over 10 million SNPs of various populations from public domain databases, namely NCBI dbSNP, HapMap and JSNP respectively. This database is tightly integrated with the tool so that users can perform the design for existing SNPs without going off the site. To guarantee specificity of AS primers, the proposed system incorporates a primer specificity enhancement technique widely used in experiment protocol. In particular, WASP makes use of different destabilizing effects by introducing one deliberate 'mismatch' at the penultimate (second to last of the 3'-end) base of AS primers to improve the resulting AS primers. Furthermore, WASP offers graphical user interface through scalable vector graphic (SVG) draw that allow users to select SNPs and graphically visualize designed primers and their conditions. Conclusion WASP offers a tool for designing AS primers for both SNPs and mutations. By integrating the database for known SNPs (using gene ID or rs number), this tool facilitates the awkward process of getting flanking sequences and other related information from public SNP databases. It takes into account the underlying destabilizing effect to ensure the effectiveness of designed primers. With user-friendly SVG interface, WASP intuitively presents resulting designed primers, which assist users to export or to make further adjustment to the design. This software can be freely accessed at . PMID:17697334

  4. PREFACE: FLUIDOS 2010: XI Meeting on Recent Advances in the Physics of Fluids and their Applications

    NASA Astrophysics Data System (ADS)

    Bove, Italo; Cabeza, Cecilia; Martí, Arturo C.; Sarasúa, Gustavo

    2011-04-01

    The papers published in this volume of the Journal of Physics: Conference Series were selected from the manuscripts submitted to the XI Meeting on Recent Advances in the Physics of Fluids and their Applications (FLUIDOS2010), which was held in Colonia del Sacramento, Uruguay, 3-5 November 2010. FLUIDOS takes place every two years, usually in November, with the aim of gathering together researchers from all areas of the Physics of Fluids, to update themselves on the latest technical developments and applications, share knowledge and stimulate new ideas. This 11th meeting continues the successful experience of the previous ones which were held in different Argentinian cities. For the first time, the meeting was celebrated in Uruguay, more specifically, in the peaceful town of Colonia del Sacramento, designated a World Heritage Site by UNESCO. The conference presented an outstanding program of papers covering the most recent advances in Physics of Fluids in the following areas: General Fluid Dynamics General and non-Newtonian Flows Magnetohydrodynamics Electrohydrodynamics and Plasmas Hydraulics, Thermohydraulics and Multiple Phase Flows A website with full details of the conference program, abstracts and other information can be found at http://fluidos2010.fisica.edu.uy. We would like to thank all the participants, especially those who contributed with talks, posters and manuscripts, for making FLUDOS2010 such a successful conference. Our thanks also go to our colleagues for their support and encouragement, particularly in the refereeing of papers. We would like to acknowledge additional financial support from Comisión Sectorial de Investigación Científica (Universidad de la República, Uruguay), Programa de Desarrollo de las Ciencias Básicas (Uruguay) and the Centro Latinoamericano de Física (CLAF). Our thanks are extended to the local government of Colonia del Sacramento. The next FLUIDOS conference will be held in November 2013, in Buenos Aires, Argentina. We anticipate enjoying another successful FLUIDOS meeting to be held in one of the main cultural centres of the continent. Italo Bove, Cecilia Cabeza, Arturo C Martí, and Gustavo SarasúaEditors

  5. Preparación de los adultos mayores en los Estados Unidos para hacer frente a los desastres naturales: encuesta a escala nacional*

    PubMed Central

    Al-rousan, Tala M.; Rubenstein, Linda M.; Wallace, Robert B.

    2015-01-01

    Objetivos. Nos propusimos determinar el grado de preparación frente a los desastres naturales de los adultos mayores en los Estados Unidos y evaluar los factores que pueden afectar negativamente la salud y la seguridad durante este tipo de incidentes. Métodos. Obtuvimos una muestra de adultos de 50 años en adelante (n = 1 304) de la encuesta del 2010 del Estudio de la Salud y la Jubilación (HRS por su sigla en inglés). La encuesta recogió datos sobre las características demográficas generales, el estado de discapacidad o las limitaciones funcionales, y también sobre factores y comportamientos relacionados con la preparación frente a los desastres. Calculamos una puntuación global de preparación mediante indicadores individuales a fin de evaluar el grado de preparación general. Resultados. La media de la edad de los participantes (n = 1 304) fue de 70 años (desviación estándar [DE] = 9,3). Solo 34,3% informaron que habían participado en un programa formativo o que habían leído materiales sobre la preparación para los desastres. Casi 15% indicaron que usaban dispositivos médicos eléctricos que podían correr riesgo de no funcionar si se interrumpiera el suministro eléctrico. La puntuación de preparación indicó que la edad más avanzada, la discapacidad física y el menor nivel de escolaridad y de ingresos se asociaban independiente y significativamente a un grado de preparación general inferior. Conclusiones. A pesar de la mayor vulnerabilidad ante los desastres y del número cada vez mayor de adultos mayores en los Estados Unidos, muchos de los problemas sustanciales que encontramos son remediables y requieren atención en los sectores de la sociedad dedicados a la atención clínica, a la salud pública y al manejo de situaciones de emergencia.

  6. Estereotipos Sexuales y su Relación con Conductas Sexuales Riesgosas1,2,3

    PubMed Central

    Pérez-Jiménez, David; Orengo-Aguayo, Rosaura E.

    2012-01-01

    Resumen Los estereotipos sexuales son creencias generalmente aceptadas y poco cuestionadas que podrían contribuir a cómo los hombres y las mujeres debemos expresar nuestra sexualidad. Los objetivos de este estudio eran identificar cuántos hombres y mujeres heterosexuales en Puerto Rico endosaban ciertos estereotipos acerca de la sexualidad masculina y femenina y explorar la relación entre el endoso de estos estereotipos sexuales y las actitudes hacia el condón masculino y su uso en relaciones sexuales vaginales Llevamos a cabo un estudio descriptivo-correlacional mediante el cual le administramos dos escalas, una sobre sexualidad masculina y otra sobre sexualidad femenina a un grupo de 429 personas heterosexuales. Encontramos que los hombres endosaron estereotipos sexuales masculinos y femeninos más que las mujeres y que estos tienden a tener una visión más conservadora respecto a la sexualidad femenina que la que tienen sobre su propia sexualidad. Las mujeres, por otra parte, tienden a ver su propia sexualidad y la sexualidad masculina en términos menos estereotipados y más equitativos. También encontramos que a mayor endoso de creencias tradicionales sobre la sexualidad masculina y femenina, peor la actitud hacia el uso del condón masculino. Sin embargo, el endosar estereotipos sexuales masculinos y/o femeninos no se relacionó con el uso del condón. Estos hallazgos contradicen la literatura que sugiere que estos estereotipos sexuales y de género resultan en conductas sexuales de alto riesgo, lo cual tiene implicaciones importantes para el desarrollo e implementación de programas de prevención. PMID:24575164

  7. Identificación de Intervenciones para el Desarrollo Positivo de la Juventud

    PubMed Central

    Sardiñas, Lili M.; Padilla, Viviana; Aponte, Mari; Boscio, Ana Morales; Pedrogo, Coralee Pérez; Santiago, Betzaida; Morales, Ángela Pérez; Dávila, Paloma Torres; Cesáreo, Marizaida Sánchez

    2017-01-01

    Resumen En el mundo hay más personas en la etapa de la juventud que en cualquier otra etapa del desarrollo. La juventud en Puerto Rico enfrenta muchas situaciones que inciden en su desarrollo y preparación para la adultez. Por lo tanto, es imperante identificar intervenciones para el desarrollo positivo de la juventud que han demostrado ser basadas en la evidencia. Además, a partir de dicha identificación, desarrollar prácticas que ayuden a los jóvenes a desarrollarse para prevenir situaciones adversas, promover experiencias positivas y propiciar que los niños y jóvenes estén involucrados y comprometidos. Se identificaron 147 intervenciones a través de una revisión tradicional de la literatura científica estadounidense. Los resultados reflejan que las intervenciones atienden la reducción de factores de riesgo y el incremento de factores de protección. Sin embargo, ninguna intervención propicia que los niños y jóvenes estén involucrados y comprometidos con su desarrollo óptimo y con sus comunidades. No obstante, todas brindan herramientas que podrían ser de utilidad para fomentar dichas prácticas en el contexto de Puerto Rico. De las 147 intervenciones identificadas seis están diseñadas para la población puertorriqueña residente en la Isla. Con el propósito de hacer la información accesible a los profesionales y la comunidad se expandió la colección del Archivo de Programas y Prácticas Basadas en Evidencia para la Prevención. PMID:28919943

  8. 30 CFR 56.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  9. Antimicrobial and physical characteristics of orthodontic primers containing antimicrobial agents.

    PubMed

    Chung, Shin-Hye; Cho, Soha; Kim, Kyungsun; Lim, Bum-Soon; Ahn, Sug-Joon

    2017-03-01

    To compare the antimicrobial and physical properties of experimental primers containing chlorhexidine (CHX) or ursolic acid (UA) with a commercial primer. Two antibacterial agents, 3 mg each of CHX and UA were incorporated respectively into 1 ml of Transbond XT primer (TX) to form antibacterial primers, TX-CHX and TX-UA. The antimicrobial activity of the three primers (TX, TX-CHX, and TX-UA) against Streptococcus mutans in both planktonic and biofilm phases was analyzed by determining minimum inhibitory and bactericidal concentrations and by performing growth and biofilm assays. Growth and biofilm assays were performed in both the absence and presence of thermocycling in a water tank to analyze the effects of water aging on the antimicrobial activities of primers. After bonding brackets onto bovine incisors using the primers, shear bond strength and mode of fracture were analyzed to compare physical properties. TX-CHX had stronger antimicrobial activity against S. mutans in the planktonic and biofilm phases than did TX or TX-UA. When applied, TX-CHX completely inhibited the growth and biofilm formation of S. mutans . In addition, the antimicrobial activity of TX-CHX was maintained after thermocycling. However, TX-UA did not show significant antimicrobial activity compared with TX. There was no significant difference in either shear bond strength or bond failure interface among the primers. Incorporation of CHX into an orthodontic primer may help prevent enamel demineralization around surfaces without compromising its physical properties.

  10. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  11. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE PAGES

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.; ...

    2018-03-27

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  12. Impact of primer dimers and self-amplifying hairpins on reverse transcription loop-mediated isothermal amplification detection of viral RNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Meagher, Robert J.; Priye, Aashish; Light, Yooli K.

    Loop-mediated isothermal amplification (LAMP), coupled with reverse transcription (RT), has become a popular technique for detection of viral RNA due to several desirable characteristics for use in point-of-care or low-resource settings. The large number of primers in LAMP (six per target) leads to an increased likelihood of primer-dimer interactions, and the inner primers in particular are prone to formation of stable hairpin structures due to their length (typically 40-45 bases). Although primer-dimers and hairpin structures are known features to avoid in nucleic acid amplification techniques, there is little quantitative information in literature regarding the impact of these structures on LAMPmore » or RT-LAMP assays. In this study, we examine the impact of primer-dimers and hairpins on previously-published primer sets for dengue virus and yellow fever virus. We demonstrate that minor changes to the primers to eliminate amplifiable primer dimers and hairpins improves the performance of the assays when monitored in real time with intercalating dyes, and when monitoring a fluorescent endpoint using the QUASR technique. We also discuss the thermodynamic implications of these minor changes on the overall stability of amplifiable secondary structures, and we present a single thermodynamic parameter to predict the probability of non-specific amplification associated with LAMP primers.« less

  13. The corrosion protection of 2219-T87 aluminum by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electro-chemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. the galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 micro A/cm(exp 2) and 23.7 micro A/cm(exp 2) for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  14. COMplementary Primer ASymmetric PCR (COMPAS-PCR) Applied to the Identification of Salmo salar, Salmo trutta and Their Hybrids

    PubMed Central

    2016-01-01

    Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658

  15. The corrosion protection of AISI(TM) 1010 steel by organic and inorganic zinc-rich primers

    NASA Technical Reports Server (NTRS)

    Danford, M. D.; Mendrek, M. J.

    1995-01-01

    The behavior of zinc-rich primer-coated AISI 1010 steel in 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR), were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electromechanical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 1010 steel cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high current between the steel cathode and both zinc-rich primer anodes (38.8 and 135.2 microns A/sq cm for the organic and inorganic primers, respectively). The results of corrosion rate determinations demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. EIS equivalent circuit parameters confirmed this conclusion. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application on solid rocket booster steel hardware.

  16. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    1998-01-01

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  17. Limited-life cartridge primers

    DOEpatents

    Makowiecki, Daniel M.; Rosen, Robert S.

    2005-04-19

    A cartridge primer which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML's would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers.

  18. SP-Designer: a user-friendly program for designing species-specific primer pairs from DNA sequence alignments.

    PubMed

    Villard, Pierre; Malausa, Thibaut

    2013-07-01

    SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.

  19. Direct role for the RNA polymerase domain of T7 primase in primer delivery

    PubMed Central

    Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.

    2010-01-01

    Gene 4 protein (gp4) encoded by bacteriophage T7 contains a C-terminal helicase and an N-terminal primase domain. After synthesis of tetraribonucleotides, gp4 must transfer them to the polymerase for use as primers to initiate DNA synthesis. In vivo gp4 exists in two molecular weight forms, a 56-kDa form and the full-length 63-kDa form. The 56-kDa gp4 lacks the N-terminal Cys4 zinc-binding motif important in the recognition of primase sites in DNA. The 56-kDa gp4 is defective in primer synthesis but delivers a wider range of primers to initiate DNA synthesis compared to the 63-kDa gp4. Suppressors exist that enable the 56-kDa gp4 to support the growth of T7 phage lacking gene 4 (T7Δ4). We have identified 56-kDa DNA primases defective in primer delivery by screening for their ability to support growth of T7Δ4 phage in the presence of this suppressor. Trp69 is critical for primer delivery. Replacement of Trp69 with lysine in either the 56- or 63-kDa gp4 results in defective primer delivery with other functions unaffected. DNA primase harboring lysine at position 69 fails to stabilize the primer on DNA. Thus, a primase subdomain not directly involved in primer synthesis is involved in primer delivery. The stabilization of the primer by DNA primase is necessary for DNA polymerase to initiate synthesis. PMID:20439755

  20. Development of a molecular diagnostic system to discriminate Dreissena polymorpha (zebra mussel) and Dreissena bugensis (quagga mussel)

    USGS Publications Warehouse

    Hoy, M.S.; Kelly, K.; Rodriguez, R.J.

    2010-01-01

    A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.

  1. Limited-life cartridge primers

    DOEpatents

    Makowiecki, D.M.; Rosen, R.S.

    1998-06-30

    A cartridge primer is described which utilizes an explosive that can be designed to become inactive in a predetermined period of time: a limited-life primer. The explosive or combustible material of the primer is an inorganic reactive multilayer (RML). The reaction products of the RML are sub-micron grains of non-corrosive inorganic compounds that would have no harmful effects on firearms or cartridge cases. Unlike use of primers containing lead components, primers utilizing RML`s would not present a hazard to the environment. The sensitivity of an RML is determined by the physical structure and the stored interfacial energy. The sensitivity lowers with time due to a decrease in interfacial energy resulting from interdiffusion of the elemental layers. Time-dependent interdiffusion is predictable, thereby enabling the functional lifetime of an RML primer to be predetermined by the initial thickness and materials selection of the reacting layers. 10 figs.

  2. Plastid primers for angiosperm phylogenetics and phylogeography.

    PubMed

    Prince, Linda M

    2015-06-01

    PCR primers are available for virtually every region of the plastid genome. Selection of which primer pairs to use is second only to selection of the genic region. This is particularly true for research at the species/population interface. Primer pairs for 130 regions of the chloroplast genome were evaluated in 12 species distributed across the angiosperms. Likelihood of amplification success was inferred based upon number and location of mismatches to target sequence. Intraspecific sequence variability was evaluated under three different criteria in four species. Many published primer pairs should work across all taxa sampled, with the exception of failure due to genomic reorganization events. Universal barcoding primers were the least likely to work (65% success). The list of most variable regions for use within species has little in common with the lists identified in prior studies. Published primer sequences should amplify a diversity of flowering plant DNAs, even those designed for specific taxonomic groups. "Universal" primers may have extremely limited utility. There was little consistency in likelihood of amplification success for any given publication across lineages or within lineage across publications.

  3. Evaluation of Different Oligonucleotide Base Substitutions at CpG Binding sites in Multiplex Bisulfite-PCR sequencing.

    PubMed

    Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt

    2017-03-22

    Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.

  4. Improved Selection of Internal Transcribed Spacer-Specific Primers Enables Quantitative, Ultra-High-Throughput Profiling of Fungal Communities

    PubMed Central

    Bokulich, Nicholas A.

    2013-01-01

    Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949

  5. Invading stacking primer: A trigger for high-efficiency isothermal amplification reaction with superior selectivity for detecting microRNA variants.

    PubMed

    Liu, Weipeng; Zhu, Minjun; Liu, Hongxing; Wei, Jitao; Zhou, Xiaoming; Xing, Da

    2016-07-15

    Searching for a strategy to enhance the efficiency of nucleic acid amplification and achieve exquisite discrimination of nucleic acids at the single-base level for biological detection has become an exciting research direction in recent years. Here, we have developed a simple and universal primer design strategy which produces a fascinating effect on isothermal strand displacement amplification (iSDA). We refer to the resultant primer as "invading stacking primer (IS-Primer)" which is based on contiguous stacking hybridization and toehold-mediated exchange reaction and function by merely changing the hybridization location of the primer. Using the IS-Primer, the sensitivity in detecting the target miR-21 is improved approximately five fold compared with the traditional iSDA reaction. It was further demonstrated that the IS-Primer acts as an invading strand to initiate branch migration which can increase the efficiency of the untwisting of the hairpin probe. This effect is equivalent to reducing the free energy of the stem, and the technique shows superior selectivity for single-base mismatches. By demonstrating the enhanced effect of the IS-Primer in the iSDA reaction, this work may provide a potentially new avenue for developing more sensitive and selective nucleic acids assays. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Improved Performance of Loop-Mediated Isothermal Amplification Assays via Swarm Priming.

    PubMed

    Martineau, Rhett L; Murray, Sarah A; Ci, Shufang; Gao, Weimin; Chao, Shih-Hui; Meldrum, Deirdre R

    2017-01-03

    This work describes an enhancement to the loop-mediated isothermal amplification (LAMP) reaction which results in improved performance. Enhancement is achieved by adding a new set of primers to conventional LAMP reactions. These primers are termed "swarm primers" based on their relatively high concentration and their ability to create new amplicons despite the theoretical lack of single-stranded annealing sites. The primers target a region upstream of the FIP/BIP primer recognition sequences on opposite strands, substantially overlapping F1/B1 sites. Thus, despite the addition of a new primer set to an already complex assay, no significant increase in assay complexity is incurred. Swarm priming is presented for three DNA templates: Lambda phage, Synechocystis sp. PCC 6803 rbcL gene, and human HFE. The results of adding swarm primers to conventional LAMP reactions include increased amplification speed, increased indicator contrast, and increased reaction products. For at least one template, minor improvements in assay repeatability are also shown. In addition, swarm priming is shown to be effective at increasing the reaction speed for RNA amplification via RT-LAMP. Collectively, these results suggest that the addition of swarm primers will likely benefit most if not all existing LAMP assays based on state-of-the-art, six-primer reactions.

  7. Bond strength of self-etch adhesives after saliva contamination at different application steps.

    PubMed

    Cobanoglu, N; Unlu, N; Ozer, F F; Blatz, M B

    2013-01-01

    This study evaluated and compared the effect of saliva contamination and possible decontamination methods on bond strengths of two self-etching adhesive systems (Clearfil SE Bond [CSE], Optibond Solo Plus SE [OSE]). Flat occlusal dentin surfaces were created on 180 extracted human molar teeth. The two bonding systems and corresponding composite resins (Clearfil AP-X, Kerr Point 4) were bonded to the dentin under six surface conditions (n=15/group): group 1 (control): primer/bonding/composite; group 2: saliva/drying/primer/bonding/composite; group 3: primer/saliva/rinsing/drying/primer/bonding/composite; group 4: primer/saliva/rinsing/drying/bonding/composite; group 5: primer/bonding (cured)/saliva/rinsing/drying/primer/bonding/composite; group 6: primer/bonding (cured)/saliva/removing contaminated layer with a bur/rinsing/drying/primer/bonding/composite. Shear bond strength was tested after specimens were stored in distilled water at 37°C for 24 hours. One-way analysis of variance and Tukey post hoc tests were used for statistical analyses. For CSE, groups 2, 3, and 4 and for OSE, groups 6, 2, and 4 showed significantly lower bond strengths than the control group (p<0.05). CSE groups 5 and 6 and OSE groups 3 and 5 revealed bond strengths similar to the control. When saliva contamination occurred after light polymerization of the bonding agent, repeating the bonding procedure recovered the bonding capacity of both self-etch adhesives. However, saliva contamination before or after primer application negatively affected their bond strength.

  8. Primer selection impacts specific population abundances but not community dynamics in a monthly time-series 16S rRNA gene amplicon analysis of coastal marine bacterioplankton.

    PubMed

    Wear, Emma K; Wilbanks, Elizabeth G; Nelson, Craig E; Carlson, Craig A

    2018-03-09

    Primers targeting the 16S small subunit ribosomal RNA marker gene, used to characterize bacterial and archaeal communities, have recently been re-evaluated for marine planktonic habitats. To investigate whether primer selection affects the ecological interpretation of bacterioplankton populations and community dynamics, amplicon sequencing with four primer sets targeting several hypervariable regions of the 16S rRNA gene was conducted on both mock communities constructed from cloned 16S rRNA genes and a time-series of DNA samples from the temperate coastal Santa Barbara Channel. Ecological interpretations of community structure (delineation of depth and seasonality, correlations with environmental factors) were similar across primer sets, while population dynamics varied. We observed substantial differences in relative abundances of taxa known to be poorly resolved by some primer sets, such as Thaumarchaeota and SAR11, and unexpected taxa including Roseobacter clades. Though the magnitude of relative abundances of common OTUs differed between primer sets, the relative abundances of the OTUs were nonetheless strongly correlated. We do not endorse one primer set but rather enumerate strengths and weaknesses to facilitate selection appropriate to a system or experimental goal. While 16S rRNA gene primer bias suggests caution in assessing quantitative population dynamics, community dynamics appear robust across studies using different primers. © 2018 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

  9. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    PubMed

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Bond Strength of Resin Cements to Zirconia Ceramic Using Adhesive Primers.

    PubMed

    Stefani, Ariovaldo; Brito, Rui Barbosa; Kina, Sidney; Andrade, Oswaldo Scopin; Ambrosano, Gláucia Maria Bovi; Carvalho, Andreia Assis; Giannini, Marcelo

    2016-07-01

    To evaluate the influence of adhesive primers on the microshear bond strength of resin cements to zirconia ceramic. Fifty zirconia plates (12 mm × 5 mm × 1.5 mm thick) of a commercially available zirconium oxide ceramic (ZirCad) were sintered, sandblasted with aluminum oxide particles, and cleaned ultrasonically before bonding. The plates were randomly divided into five groups of 10. Three resin cements were selected (RelyX ARC, Multilink Automix, Clearfil SA Cement self-adhesive resin cement), along with two primers (Metal-Zirconia Primer, Alloy Primer) and one control group. The primers and resin cements were used according to manufacturers' recommendations. The control group comprised the conventional resin cement (RelyX ARC) without adhesive primer. Test cylinders (0.75 mm diameter × 1 mm high) were formed on zirconia surfaces by filling cylindrical Tygon tube molds with resin cement. The specimens were stored in distilled water for 24 hours at 37°C, then tested for shear strength on a Shimadzu EZ Test testing machine at 0.5 mm/min. Bond strength data were analyzed statistically by two-way ANOVA and Dunnett's test (5%). The bond strength means in MPa (± s.d.) were: RelyX ARC: 28.1 (6.6); Multilink Automix: 37.6 (4.5); Multilink Automix + Metal-Zirconia Primer: 55.7 (4.0); Clearfil SA Cement: 46.2 (3.3); and Clearfil SA Cement + Alloy Primer: 47.0 (4.1). Metal-Zirconia Primer increased the bond strength of Multilink Automix resin cement to zirconia, but no effect was observed for Alloy Primer using Clearfil SA Cement. RelyX ARC showed the lowest bond strength to zirconia. © 2015 by the American College of Prosthodontists.

  11. An innovative SNP genotyping method adapting to multiple platforms and throughputs.

    PubMed

    Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L

    2017-03-01

    An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.

  12. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    NASA Astrophysics Data System (ADS)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  13. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    PubMed

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.

  14. Novel ITS1 Fungal Primers for Characterization of the Mycobiome

    PubMed Central

    Usyk, Mykhaylo; Zolnik, Christine P.; Patel, Hitesh; Levi, Michael H.

    2017-01-01

    ABSTRACT Studies of the human microbiome frequently omit characterization of fungal communities (the mycobiome), which limits our ability to investigate how fungal communities influence human health. The internal transcribed spacer 1 (ITS1) region of the eukaryotic ribosomal cluster has features allowing for wide taxonomic coverage and has been recognized as a suitable barcode region for species-level identification of fungal organisms. We developed custom ITS1 primer sets using iterative alignment refinement. Primer performance was evaluated using in silico testing and experimental testing of fungal cultures and human samples. Using an expanded novel reference database, SIS (18S-ITS1-5.8S), the newly designed primers showed an average in silico taxonomic coverage of 79.9% ± 7.1% compared to a coverage of 44.6% ± 13.2% using previously published primers (P = 0.05). The newly described primer sets recovered an average of 21,830 ± 225 fungal reads from fungal isolate culture samples, whereas the previously published primers had an average of 3,305 ± 1,621 reads (P = 0.03). Of note was an increase in the taxonomic coverage of the Candida genus, which went from a mean coverage of 59.5% ± 13% to 100.0% ± 0.0% (P = 0.0015) comparing the previously described primers to the new primers, respectively. The newly developed ITS1 primer sets significantly improve general taxonomic coverage of fungal communities infecting humans and increased read depth by an order of magnitude over the best-performing published primer set tested. The overall best-performing primer pair in terms of taxonomic coverage and read recovery, ITS1-30F/ITS1-217R, will aid in advancing research in the area of the human mycobiome. IMPORTANCE The mycobiome constitutes all the fungal organisms within an environment or biological niche. The fungi are eukaryotes, are extremely heterogeneous, and include yeasts and molds that colonize humans as part of the microbiome. In addition, fungi can also infect humans and cause disease. Characterization of the bacterial component of the microbiome was revolutionized by 16S rRNA gene fragment amplification, next-generation sequencing technologies, and bioinformatics pipelines. Characterization of the mycobiome has often not been included in microbiome studies because of limitations in amplification systems. This report revisited the selection of PCR primers that amplify the fungal ITS1 region. We have identified primers with superior identification of fungi present in the database. We have compared the new primer sets against those previously used in the literature and show a significant improvement in read count and taxon identification. These primers should facilitate the study of fungi in human physiology and disease states. PMID:29242834

  15. Chemical and mechanical aspects of HMR primer in relationship to wood bonding

    Treesearch

    Alfred W. Christiansen

    2005-01-01

    The mechanism by which hydroxymethylated resorcinol (HMR) primer improves the durability of various adhesives to wood has been hypothesized as covalent chemical links between the adhesive and primer and possibly between the primer and wood. The present work presents experiments to test this hypothesis. In the first test, some resorcinol was displaced by 2- methylres-...

  16. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi

    1989-01-01

    Hydrophylic polyacids, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests.

  17. Progress in the Development of a Multiphase Turbulent Model of the Gas/Particle Flow in a Small-Caliber Ammunition Primer

    DTIC Science & Technology

    2006-08-01

    Maneuver Ammunition Systems is acknowledged for continued support of this effort. This research was performed while the first author held a National...the ignition system (i.e., the primer in small-caliber guns, the primer and flashtube in medium-caliber guns, and the primer and igniter-tube in large...primer model that is compatible with the ARL- NGEN3 IB code is the subject of this report. The conventional ignition system for a large-caliber (120 mm

  18. Healthy Start Programa Madrina: A Promotora Home Visiting Outreach and Education Program to Improve Perinatal Health among Latina Pregnant Women

    ERIC Educational Resources Information Center

    Bill, Debra E.; Hock-Long, Linda; Mesure, Maryann; Bryer, Pamela; Zambrano, Neydary

    2009-01-01

    The purpose of this article is to describe the development, implementation, and evaluation of Healthy Start Programa Madrina (HSPM), a home visiting promotora outreach and education program for Latina pregnant women and to present the 10-year findings of the program (1996-2005). Perinatal health disparities continue to persist among low-income…

  19. What Have We Learned from the War on Drugs? An Assessment of Mexico’s Counternarcotics Strategy

    DTIC Science & Technology

    2011-06-01

    Policía Judicial Federal (Mexico) [Mexican Judicial Federal Police] PNCD Programa Nacional para el Control de Drogas (Mexico) [National Drug...Institucional (Mexico) [Institutional Revolutionary Party] PRONASOL Programa Nacional de Solidaridad (Mexico) [National Solidarity Program] SCJN...Mexicano de Derecho Comparado no.127 (2010), 349-351. Translated by Google. 272 Guillermo Zepeda Lecuona, ―La reforma constitucional en materia

  20. A Counter Insurgency Study: An Analysis of Local Defenses

    DTIC Science & Technology

    2004-09-01

    Derrota de Sendero Luminoso; Programa Institucional de Investigación y Proyeccion en el Area de Gobernabilidad y Politica Publica, IEP ediciones...Corporation, Santa Monica CA. Kruijt, D. (1996), Sociedad de Terror: Guerrillas y Contrainsurgencia en Guatemala y El Peru; Cuadcien, Programa ... en El Salvador (1981 – 1992); Centro de Paz, El Latinoamericano; Retrieved on 7/16/2004 from http://www.stormpages.com/marting/laguerrasalvador.htm

  1. An Investigation to Improve Quality Evaluations of Primers and Propellant for 20mm Munitions

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Holmes, C.; McGrory, J.; Schimmel, M. L.

    1997-01-01

    To reduce the frequency of electrically initiated, 20mm munition hangfires (delayed ignitions), a joint Army/NASA investigation was conducted to recommend quality evaluation improvements for acceptance of both primers and gun propellant. This effort focused only on evaluating ignition and combustion performance as potential causes of hangfires: poor electrical initiation of the primer, low output performance of the primer, low ignition sensitivity of the gun propellant, and the effects of cold temperature. The goal was to determine the "best" of the Army and NASA test methods to assess the functional performance of primers and gun propellants. The approach was to evaluate the performance of both high-quality and deliberately defective primers to challenge the sensitivity of test methods. In addition, the ignition sensitivity of different manufacturing batches of gun propellants was evaluated. The results of the investigation revealed that improvements can be made in functional evaluations that can assist in identifying and reducing ignition and performance variations. The "best" functional evaluation of primers and propellant is achieved through a combination of both Army and NASA test methods. Incorporating the recommendations offered in this report may provide for considerable savings in reducing the number of cartridge firings, while significantly lowering the rejection rate of primer, propellant and cartridge lots. The most probable causes for ignition and combustion-related hangfires were the lack of calcium silicide in the primer mix, a low output performance of primers, and finally, poor ignition sensitivity of gun propellant. Cold temperatures further reduce propellant ignition sensitivity, as well as reducing burn rate and chamber pressures.

  2. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    PubMed

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  3. Detection of N2O-producing fungi in environment using nitrite reductase gene (nirK)-targeting primers.

    PubMed

    Chen, Huaihai; Yu, Fangbo; Shi, Wei

    2016-12-01

    Fungal denitrification has been increasingly investigated, but its community ecology is poorly understood due to the lack of culture-independent tools. In this work, four pairs of nirK-targeting primers were designed and evaluated for primer specificity and efficiency using thirty N 2 O-producing fungal cultures and an agricultural soil. All primers amplified nirK from fungi and soil, but their efficiency and specificity were different. A primer set, FnirK_F3/R2 amplified ∼80 % of tested fungi, including Aspergillus, Fusarium, Penicillium, and Trichoderma, as compared to ∼40-70 % for other three primers. The nirK fragments of fungal and soil DNA amplified by FnirK_F3/R2 were phylogenetically related to denitrifying fungi in the orders Eurotiales, Hypocreales, and Sordariales; and clone sequences were also distributed in the clusters of Chaetomium, Metarhizium, and Myceliophthora that were uncultured from soil in our previous work. This proved the wide-range capability of primers for amplifying diverse denitrifying fungi from environment. However, our primers and recently-developed other primers amplified bacterial nirK from soil and this co-amplification of fungal and bacterial nirK was theoretically discussed. The FnirK_F3/R2 was further compared with published primers; results from clone libraries demonstrated that FnirK_F3/R2 was more specifically targeted on fungi and had broader taxonomical coverage than some others. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  4. Comparison of PCR primer-based strategies for characterization of ammonia oxidizer communities in environmental samples.

    PubMed

    Mahmood, Shahid; Freitag, Thomas E; Prosser, James I

    2006-06-01

    PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.

  5. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    PubMed

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  6. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR

    PubMed Central

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859

  7. Employment of Near Full-Length Ribosome Gene TA-Cloning and Primer-Blast to Detect Multiple Species in a Natural Complex Microbial Community Using Species-Specific Primers Designed with Their Genome Sequences.

    PubMed

    Zhang, Huimin; He, Hongkui; Yu, Xiujuan; Xu, Zhaohui; Zhang, Zhizhou

    2016-11-01

    It remains an unsolved problem to quantify a natural microbial community by rapidly and conveniently measuring multiple species with functional significance. Most widely used high throughput next-generation sequencing methods can only generate information mainly for genus-level taxonomic identification and quantification, and detection of multiple species in a complex microbial community is still heavily dependent on approaches based on near full-length ribosome RNA gene or genome sequence information. In this study, we used near full-length rRNA gene library sequencing plus Primer-Blast to design species-specific primers based on whole microbial genome sequences. The primers were intended to be specific at the species level within relevant microbial communities, i.e., a defined genomics background. The primers were tested with samples collected from the Daqu (also called fermentation starters) and pit mud of a traditional Chinese liquor production plant. Sixteen pairs of primers were found to be suitable for identification of individual species. Among them, seven pairs were chosen to measure the abundance of microbial species through quantitative PCR. The combination of near full-length ribosome RNA gene library sequencing and Primer-Blast may represent a broadly useful protocol to quantify multiple species in complex microbial population samples with species-specific primers.

  8. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    PubMed

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  9. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    PubMed Central

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  10. Polyacid macromolecule primers

    DOEpatents

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  11. Effect of surface preparation on service life of top-coats applied to weathered primer paint

    Treesearch

    R. Sam Williams; Mark Knaebe; Peter Sotos

    2008-01-01

    Paint companies usually recommend that topcoats be applied to primer paint within two weeks. Unfortunately, this is not always possible. For example, onset of winter weather shortly after applying primer may delay topcoat application until spring. Scuff sanding or repriming are often recommended remedial methods for preparing a weathered primer for topcoats, but there...

  12. Association of the ACE, GSTM1, IL-6, NOS3, and CYP1A1 polymorphisms with susceptibility of mycoplasma pneumoniae pneumonia in Chinese children

    PubMed Central

    Zhao, Jie; Zhang, Wen; Shen, Li; Yang, Xiaomeng; Liu, Yi; Gai, Zhongtao

    2017-01-01

    Abstract Mycoplasma pneumoniae is a common cause of community-acquired pneumonia (CAP) and the clinical presentation of mycoplasma pneumoniae pneumonia (MPP) varies widely. Genetic variability affecting the host response may also influence the susceptibility to MPP. Several studies have investigated the association between single nucleotide polymorphism (SNP) of some genes and the risks of CAP; however, the results were inconsistent. Here, we investigated the association of 5 functional genes and the risks of MPP, including ACE (rs4340), GSTM1 (Ins/del), IL-6 (rs1800795), NOS3 (rs1799983), and CYP1A1 (rs2606345) in a total of 715 subjects (415 cases, 300 controls) by using tetra-primer allele-specific polymerase chain reaction (PCR) and Sanger sequencing. The gene–gene interactions were analyzed using the Multifactor Dimensionality Reduction and cumulative genetic risk score approaches. Our results showed that 3 SNPs of ACE rs4340, IL-6 rs1800795, and NOS3 rs1799983 were significantly associated with the risks of MPP, while no differences were observed in genotype frequencies of GSTM1 (Ins/del) and CYP1A1 rs2606345 between both groups. The combinations of ACE rs4340D/NOS3 rs1799983T/CYP1A1 rs2606345G and ACE rs4340D/NOS3 rs1799983T contribute to the genetic susceptibility of MPP in Chinese children. PMID:28403117

  13. [Rapid prenatal genetic diagnosis of a fetus with a high risk for Morquio A syndrome].

    PubMed

    Guo, Yi-bin; Ai, Yang; Zhao, Yan; Tang, Jia; Jiang, Wei-ying; Du, Min-lian; Ma, Hua-mei; Zhong, Yan-fang

    2012-04-01

    To provide rapid and accurate prenatal genetic diagnosis for a fetus with high risk of Morquio A syndrome. Based on ascertained etiology of the proband and genotypes of the parents, particular mutations of the GALNS gene were screened at 10th gestational week with amplification refractory mutation system (ARMS), denaturing high performance liquid chromatography (DHPLC), and direct DNA sequencing. DHPLC screening has identified abnormal double peaks in the PCR products of exons 1 and 10, whilst only a single peak was detected in normal controls. Amplification of ARMS specific primers derived a specific product for the fetus's gene, whilst no similar product was detected in normal controls. Sequencing of PCR products confirmed that exons 1 and 10 of the GALNS gene from the fetus contained a heterozygous paternal c.106-111 del (p.L36-L37 del) deletion and a heterozygous maternal c.1097 T>C (p.L366P) missense mutation, which resulted in a compound heterozygote status. The fetus was diagnosed with Morquio A syndrome and a genotype similar to the proband. Termination of the pregnancy was recommended. Combined ARMS, DHPLC and DNA sequencing are effective for rapid and accurate prenatal diagnosis for fetus with a high risk for Morquio A syndrome. Such methods are particularly suitable for early diagnosis when pathogenesis is clear. Furthermore, combined ARMS and DHPLC are suitable for rapid processing of large numbers of samples for the identification of new mutations.

  14. DEVELOPMENT OF METRICS FOR TECHNICAL PRODUCTION: QUALIS BOOKS AND BOOK CHAPTERS.

    PubMed

    Ribas-Filho, Jurandir Marcondes; Malafaia, Osvaldo; Czeczko, Nicolau Gregori; Ribas, Carmen A P Marcondes; Nassif, Paulo Afonso Nunes

    2015-01-01

    To propose metrics to qualify the publication in books and chapters, and from there, establish guidance for the evaluation of the Medicine III programs. Analysis of some of the 2013 area documents focusing this issue. Were analyzed the following areas: Computer Science; Biotechnology; Biological Sciences I; Public Health; Medicine I. Except for the Medicine I, which has not adopted the metric for books and chapters, all other programs established metrics within the intellectual production, although with unequal percentages. It´s desirable to include metrics for books and book chapters in the intellectual production of post-graduate programs in Area Document with percentage-value of 5% in publications of Medicine III programs. Propor a métrica para qualificar a produção veiculada através de livros e capítulos e, a partir daí, estabelecer orientação para a avaliação dos programas de pós-graduação da Medicina III. Análise dos documentos de área de 2013 dos programas de pós-graduação senso estrito das áreas: Ciência da Computação; Biotecnologia; Ciências Biológicas I; Saúde Coletiva; Medicina I. Excetuando-se o programa da Medicina I, que não adotou a métrica para classificação de livros e capítulos, todos os demais estabeleceram-na dentro da sua produção intelectual, embora com percentuais desiguais. É desejável inserir a métrica de livros e capitulos de livros na produção intelectual do Documento de Área dos programas, ortorgando a ela percentual de 5% das publicações qualificadas dos programas da Medicina III.

  15. Simple sequence repeat marker loci discovery using SSR primer.

    PubMed

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  16. Nucleic acid amplification using modular branched primers

    DOEpatents

    Ulanovsky, Levy; Raja, Mugasimangalam C.

    2001-01-01

    Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.

  17. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    PubMed Central

    Housley, Donna JE; Zalewski, Zachary A; Beckett, Stephanie E; Venta, Patrick J

    2006-01-01

    Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported), we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species) used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair), the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC<50%, 74.2% amplified), the degree of protein conservation (R2 = 0.14) and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3%) (excluding primers in which dog was an index species) were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9%) produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion of successful amplifications are the number of index species mismatches, GC-richness of the target amplimer, and the relatedness of the target species to the index species, at least under the single PCR condition used. The 1147 cross-species primer pairs can be used in a high throughput manner to generate data for studies on the genetics and genomics of non-sequenced mammalian genomes. PMID:17029642

  18. Present and Future of the United States-Bolivia Relations

    DTIC Science & Technology

    2009-12-11

    Programa de Gobierno-MAS-IPSP,” Archivo Chile , http://www.archivochile.com/Portada/bol_elecciones05/bolelecciones0009.pdf (accessed May 2, 2009...accessed November 9, 2009). Movimiento al Socialismo. “ Programa de Gobierno-MAS-IPSP.” Archivo Chile . http://www.archivochile.com/Portada/bol_elecciones05...partidos en Bolivia,” Futuros Revista Trimestral Latinoamericana y Caribeña de Desarrollo Sustentable, http://www.revistafuturos.info/ futuros_9

  19. A comparison of orthodontic bracket shear bond strength on enamel deproteinized by 5.25% sodium hypochlorite using total etch and self-etch primer

    NASA Astrophysics Data System (ADS)

    Ongkowidjaja, F.; Soegiharto, B. M.; Purbiati, M.

    2017-08-01

    The shear bond strength (SBS) can be increased by removing protein pellicles from the enamel surface by deproteinization using 5.25% sodium hypochlorite (NaOCl). The SBS of a self-etch primer is lower than that of a total etch primer; nonetheless, it prevents white spot lesions. This study aimed to assess the SBS of the Anyetch (AE) total etch primer and FL-Bond II Shofu (FL) self-etch primer after enamel deproteinization using 5.25% NaOCl. Forty eight human maxillary first premolars were extracted, cleaned, and divided into four groups. In group A, brackets were bonded to the enamel without deproteinization before etching (A1: 10 teeth using total etch primer (AE); A2: 10 teeth using self-etch primer (FL)). In group B, brackets were bonded to the enamel after deproteinization with 5.25% NaOCl before etching (B1: 10 teeth using total etch primer (AE); B2: 10 teeth using self-etch primer (FL)). Brackets were bonded using Transbond XT, stored in artificial saliva for 24 h at 37°C, mounted on acrylic cylinders, and debonded using a Shimadzu AG-5000 universal testing machine. There were no significant differences in SBS between the total etch (AE) groups (p > 0.05) and between the self-etch (FL) groups (p > 0.05). There were significant differences in SBS between groups A and B. The mean SBS for groups A1, A2, B1, and B2 was 12.91±3.99, 4.46±2.47, 13.06±3.66, and 3.62±2.36 MPa, respectively. Deproteinization using NaOCl did not affect the SBS of the total etch primer (AE) group; it reduced the SBS of the self-etch primer (FL) group, but not with a statistically significant difference.

  20. Genic and Intergenic SSR Database Generation, SNPs Determination and Pathway Annotations, in Date Palm (Phoenix dactylifera L.).

    PubMed

    Mokhtar, Morad M; Adawy, Sami S; El-Assal, Salah El-Din S; Hussein, Ebtissam H A

    2016-01-01

    The present investigation was carried out aiming to use the bioinformatics tools in order to identify and characterize, simple sequence repeats within the third Version of the date palm genome and develop a new SSR primers database. In addition single nucleotide polymorphisms (SNPs) that are located within the SSR flanking regions were recognized. Moreover, the pathways for the sequences assigned by SSR primers, the biological functions and gene interaction were determined. A total of 172,075 SSR motifs was identified on date palm genome sequence with a frequency of 450.97 SSRs per Mb. Out of these, 130,014 SSRs (75.6%) were located within the intergenic regions with a frequency of 499 SSRs per Mb. While, only 42,061 SSRs (24.4%) were located within the genic regions with a frequency of 347.5 SSRs per Mb. A total of 111,403 of SSR primer pairs were designed, that represents 291.9 SSR primers per Mb. Out of the 111,403, only 31,380 SSR primers were in the genic regions, while 80,023 primers were in the intergenic regions. A number of 250,507 SNPs were recognized in 84,172 SSR flanking regions, which represents 75.55% of the total SSR flanking regions. Out of 12,274 genes only 463 genes comprising 896 SSR primers were mapped onto 111 pathways using KEGG data base. The most abundant enzymes were identified in the pathway related to the biosynthesis of antibiotics. We tested 1031 SSR primers using both publicly available date palm genome sequences as templates in the in silico PCR reactions. Concerning in vitro validation, 31 SSR primers among those used in the in silico PCR were synthesized and tested for their ability to detect polymorphism among six Egyptian date palm cultivars. All tested primers have successfully amplified products, but only 18 primers detected polymorphic amplicons among the studied date palm cultivars.

  1. Effectiveness of the standard and an alternative set of Streptococcus pneumoniae multi locus sequence typing primers.

    PubMed

    Adamiak, Paul; Vanderkooi, Otto G; Kellner, James D; Schryvers, Anthony B; Bettinger, Julie A; Alcantara, Joenel

    2014-06-03

    Multi-locus sequence typing (MLST) is a portable, broadly applicable method for classifying bacterial isolates at an intra-species level. This methodology provides clinical and scientific investigators with a standardized means of monitoring evolution within bacterial populations. MLST uses the DNA sequences from a set of genes such that each unique combination of sequences defines an isolate's sequence type. In order to reliably determine the sequence of a typing gene, matching sequence reads for both strands of the gene must be obtained. This study assesses the ability of both the standard, and an alternative set of, Streptococcus pneumoniae MLST primers to completely sequence, in both directions, the required typing alleles. The results demonstrated that for five (aroE, recP, spi, xpt, ddl) of the seven S. pneumoniae typing alleles, the standard primers were unable to obtain the complete forward and reverse sequences. This is due to the standard primers annealing too closely to the target regions, and current sequencing technology failing to sequence the bases that are too close to the primer. The alternative primer set described here, which includes a combination of primers proposed by the CDC and several designed as part of this study, addresses this limitation by annealing to highly conserved segments further from the target region. This primer set was subsequently employed to sequence type 105 S. pneumoniae isolates collected by the Canadian Immunization Monitoring Program ACTive (IMPACT) over a period of 18 years. The inability of several of the standard S. pneumoniae MLST primers to fully sequence the required region was consistently observed and is the result of a shift in sequencing technology occurring after the original primers were designed. The results presented here introduce clear documentation describing this phenomenon into the literature, and provide additional guidance, through the introduction of a widely validated set of alternative primers, to research groups seeking to undertake S. pneumoniae MLST based studies.

  2. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less

  3. Photoaffinity labeling of the primer binding domain in murine leukemia virus reverse transcriptase.

    PubMed

    Tirumalai, R S; Modak, M J

    1991-07-02

    We have labeled the primer binding domain of murine leukemia virus reverse transcriptase (MuLV RT) by covalently cross-linking 5' end labeled d(T)8 to MuLV RT, using ultraviolet light energy. The specificity and the functional significance of the primer cross-linking reaction were demonstrated by the fact that (i) other oligomeric primers, tRNAs, and also template-primers readily compete with radiolabeled d(T)8 for the cross-linking reaction, (ii) under similar conditions, the competing primers and template-primer also inhibit the DNA polymerase activity of MuLV RT to a similar extent, (iii) substrate deoxynucleotides have no effect, and (iv) the reaction is sensitive to high ionic strength. In order to identify the primer binding domains/sites in MuLV RT; tryptic digests prepared from the covalently cross-linked MuLV RT and [32P]d(T)8 complexes were resolved on C-18 columns by reverse-phase HPLC. Three distinct radiolabeled peptides were found to contain the majority of the bound primer. Of these, peptide I contained approximately 65% radioactivity, while the remainder was associated with peptides II and III. Amino acid composition and sequence analyses of the individual peptides revealed that peptide I spans amino acid residues 72-80 in the primary amino acid sequence of MuLV RT and is located in the polymerase domain. The primer cross-linking site appears to be at or near Pro-76. Peptides II and III span amino acid residues 602-609 and 615-622, respectively, and are located in the RNase H domain. The probable cross-linking sites in peptides II and III are suggested to be at or near Leu-604 and Leu-618, respectively.

  4. Development of internal COI primers to improve and extend barcoding of fruit flies (Diptera: Tephritidae: Dacini).

    PubMed

    Krosch, Matt N; Strutt, Francesca; Blacket, Mark J; Batovska, Jana; Starkie, Melissa; Clarke, Anthony R; Cameron, Stephen L; Schutze, Mark K

    2018-06-06

    Accurate species-level identifications underpin many aspects of basic and applied biology; however, identifications can be hampered by a lack of discriminating morphological characters, taxonomic expertise or time. Molecular approaches, such as DNA 'barcoding' of the cytochrome c oxidase (COI) gene, are argued to overcome these issues. However, nuclear encoding of mitochondrial genes (numts) and poor amplification success of suboptimally preserved specimens can lead to erroneous identifications. One insect group for which these molecular and morphological problems are significant are the dacine fruit flies (Diptera: Tephritidae: Dacini). We addressed these issues associated with COI barcoding in the dacines by first assessing several 'universal' COI primers against public mitochondrial genome and numt sequences for dacine taxa. We then modified a set of four primers that more closely matched true dacine COI sequence and amplified two overlapping portions of the COI barcode region. Our new primers were tested alongside universal primers on a selection of dacine species, including both fresh preserved and decades-old dry specimens. Additionally, Bactrocera tryoni mitochondrial and nuclear genomes were compared to identify putative numts. Four numt clades were identified, three of which were amplified using existing universal primers. In contrast, our new primers preferentially amplified the 'true' mitochondrial COI barcode in all dacine species tested. The new primers also successfully amplified partial barcodes from dry specimens for which full length barcodes were unobtainable. Thus we recommend these new primers be incorporated into the suites of primers used by diagnosticians and quarantine labs for the accurate identification of dacine species. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. Linkage analysis with multiplexed short tandem repeat polymorphisms using infrared fluorescence and M13 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Lee, H.K.; Flanders, D.J.

    The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less

  6. Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.

    PubMed

    Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena

    2009-08-01

    Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.

  7. Effects of different orthodontic primers on enamel demineralization around orthodontic brackets.

    PubMed

    Baysal, Asli; Yasa, Asli; Sogut, Ozlem; Ozturk, Mehmet Ali; Uysal, Tancan

    2015-09-01

    The purpose of this work is to evaluate the effectiveness of one self-etching and two filled orthodontic primers on enamel demineralization around orthodontic brackets. Brackets were bonded to 84 bovine teeth and the vestibular enamel surfaces covered with acid-resistant nail varnish exposing 1 mm of space on each side of the bracket base. The teeth were allocated to four groups, using either Transbond XT conventional primer on etched enamel (group 1), Transbond Plus Self-Etching Primer on untreated enamel (group 2), Pro Seal filled resin primer on etched enamel (group 3), or Opal Seal filled resin primer on etched enamel (group 4). Each tooth was subjected to 15,000 strokes of brushing followed by exposure to an acid challenge. Calcium-ion release from each sample was calculated using atomic absorption spectrophotometry. Data were analyzed using one-way ANOVA and a post hoc Tukey test. Differences were considered statistically significant at p ≤ 0.05. Statistically significant differences were observed between the four groups (p < 0.001). No significant difference was found between the controls (group 1) and the Opal Seal group. Higher calcium release was observed in the Pro Seal group and the self-etching primer group compared to the controls. The highest calcium release was recorded in the self-etching primer group. Filled sealants may not have a protective effect against enamel demineralization. Transbond Plus Self-Etching Primer should be used cautiously, considering the risk of demineralization involved in its application.

  8. [Effect of a chemical primer on the bond strength of a zirconia ceramic with self-adhesive resin cement].

    PubMed

    Zhang, Hong; Jing, Ye; Nie, Rongrong; Meng, Xiangfeng

    2015-10-01

    To evaluate the bond strength and durability of a self-adhesive resin cement with a zirconia ceramic pretreated by a zirconia primer. Zirconia ceramic (Vita Inceram YZ) plates with a thickness of 2.5 mm were fired, polished, and then cleaned. Half of the polished ceramic plates were sandblasted with 50 μm alumina particles at 0.3 MPa for 20 s. The surface compound weight ratios were measured via X-ray fluorescence microscopy. The polished and sandblasted ceramic plates were directly bonded with self-adhesive resin cement (Biscem) or were pretreated by a zirconia primer (Z Primer Plus) before bonding with Biscem. The specimens of each test group were divided into two subgroups (n=10) and subjected to the shear test after 0 and 10,000 thermal cycles. The data were analyzed via three-way ANOVA. After air abrasion, 8.27% weight ratio of alumina attached to the zirconia surface. Compared with air abrasion, primer treatment more significantly improved the primary resin bond strength of the zirconia ceramic. The primary resin bond strength of the zirconia ceramic with no primer treatment was not affected by thermocycling (P>0.05). However, the primary resin bond strength of the zirconia ceramic with primer treatment was significantly decreased by thermocycling (P<0.05). Primer treatment can improve the primary resin bond strengths of zirconia ceramics. However, the bond interface of the primer is not stable and rapidly degraded during thermocycling.

  9. Analysis of short tandem repeat polymorphisms using infrared fluorescence with M18 tailed primers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oetting, W.S.; Wiesner, G.; Laken, S.

    The use of short tandem repeat polymorphisms (STRPs) are becoming increasingly important as markers for linkage analysis due to their large numbers of the human genome and their high degree of polymorphism. Fluorescence based detection of the STRP pattern using the LI-COR model 4000S automated DNA sequencer eliminates the need for radioactivity and produces a digitized image that can be used for the analysis of the polymorphisms. In an effort to reduce the cost of STRP analysis, we have synthesized primers with a 19 bp extension complementary to the sequence of the M13 primer on the 5{prime} end of onemore » of the two primers used in the amplification of the STRP instead of using primers with direct conjugation of the infrared fluorescent dye. Up to 5 primer pairs can be multiplexed together with the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye. Comparisons between primers that have been directly conjugated to the fluor with those having the M13 sequence extension show no difference in the ability to determine the STRP pattern. At present, the entire Weber 4A set of STRP markers is available with the M13 5{prime} extension. We are currently using this technique for linkage analysis of familial breast cancer and asthma. The combination of STRP analysis using fluorescence detection will allow this technique to be fully automated for allele scoring and linkage analysis.« less

  10. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    USGS Publications Warehouse

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  11. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  12. De-MetaST-BLAST: A Tool for the Validation of Degenerate Primer Sets and Data Mining of Publicly Available Metagenomes

    PubMed Central

    Gulvik, Christopher A.; Effler, T. Chad; Wilhelm, Steven W.; Buchan, Alison

    2012-01-01

    Development and use of primer sets to amplify nucleic acid sequences of interest is fundamental to studies spanning many life science disciplines. As such, the validation of primer sets is essential. Several computer programs have been created to aid in the initial selection of primer sequences that may or may not require multiple nucleotide combinations (i.e., degeneracies). Conversely, validation of primer specificity has remained largely unchanged for several decades, and there are currently few available programs that allows for an evaluation of primers containing degenerate nucleotide bases. To alleviate this gap, we developed the program De-MetaST that performs an in silico amplification using user defined nucleotide sequence dataset(s) and primer sequences that may contain degenerate bases. The program returns an output file that contains the in silico amplicons. When De-MetaST is paired with NCBI’s BLAST (De-MetaST-BLAST), the program also returns the top 10 nr NCBI database hits for each recovered in silico amplicon. While the original motivation for development of this search tool was degenerate primer validation using the wealth of nucleotide sequences available in environmental metagenome and metatranscriptome databases, this search tool has potential utility in many data mining applications. PMID:23189198

  13. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification

    PubMed Central

    Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo

    2018-01-01

    Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604

  14. MRPrimerV: a database of PCR primers for RNA virus detection

    PubMed Central

    Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo

    2017-01-01

    Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620

  15. Evaluation of revised polymerase chain reaction primers for more inclusive quantification of ammonia-oxidizing archaea and bacteria.

    PubMed

    Meinhardt, Kelley A; Bertagnolli, Anthony; Pannu, Manmeet W; Strand, Stuart E; Brown, Sally L; Stahl, David A

    2015-04-01

    Ammonia-oxidizing archaea (AOA) and bacteria (AOB) fill key roles in the nitrogen cycle. Thus, well-vetted methods for characterizing their distribution are essential for framing studies of their significance in natural and managed systems. Quantification of the gene coding for one subunit of the ammonia monooxygenase (amoA) by polymerase chain reaction is frequently employed to enumerate the two groups. However, variable amplification of sequence variants comprising this conserved genetic marker for ammonia oxidizers potentially compromises within- and between-system comparisons. We compared the performance of newly designed non-degenerate quantitative polymerase chain reaction primer sets to existing primer sets commonly used to quantify the amoA of AOA and AOB using a collection of plasmids and soil DNA samples. The new AOA primer set provided improved quantification of model mixtures of different amoA sequence variants and increased detection of amoA in DNA recovered from soils. Although both primer sets for the AOB provided similar results for many comparisons, the new primers demonstrated increased detection in environmental application. Thus, the new primer sets should provide a useful complement to primers now commonly used to characterize the environmental distribution of AOA and AOB. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  16. Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.

    PubMed

    Schnitzler, P; Darai, G

    1993-10-01

    The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).

  17. Multiplex Degenerate Primer Design for Targeted Whole Genome Amplification of Many Viral Genomes

    DOE PAGES

    Gardner, Shea N.; Jaing, Crystal J.; Elsheikh, Maher M.; ...

    2014-01-01

    Background . Targeted enrichment improves coverage of highly mutable viruses at low concentration in complex samples. Degenerate primers that anneal to conserved regions can facilitate amplification of divergent, low concentration variants, even when the strain present is unknown. Results . A tool for designing multiplex sets of degenerate sequencing primers to tile overlapping amplicons across multiple whole genomes is described. The new script, run_tiled_primers, is part of the PriMux software. Primers were designed for each segment of South American hemorrhagic fever viruses, tick-borne encephalitis, Henipaviruses, Arenaviruses, Filoviruses, Crimean-Congo hemorrhagic fever virus, Rift Valley fever virus, and Japanese encephalitis virus. Eachmore » group is highly diverse with as little as 5% genome consensus. Primer sets were computationally checked for nontarget cross reactions against the NCBI nucleotide sequence database. Primers for murine hepatitis virus were demonstrated in the lab to specifically amplify selected genes from a laboratory cultured strain that had undergone extensive passage in vitro and in vivo. Conclusions . This software should help researchers design multiplex sets of primers for targeted whole genome enrichment prior to sequencing to obtain better coverage of low titer, divergent viruses. Applications include viral discovery from a complex background and improved sensitivity and coverage of rapidly evolving strains or variants in a gene family.« less

  18. Development of ultra-short PCR assay to reveal BRAF V600 mutation status in Thai colorectal cancer tissues.

    PubMed

    Chat-Uthai, Nunthawut; Vejvisithsakul, Pichpisith; Udommethaporn, Sutthirat; Meesiri, Puttarakun; Danthanawanit, Chetiya; Wongchai, Yannawan; Teerapakpinyo, Chinachote; Shuangshoti, Shanop; Poungvarin, Naravat

    2018-01-01

    The protein kinase BRAF is one of the key players in regulating cellular responses to extracellular signals. Somatic mutations of the BRAF gene, causing constitutive activation of BRAF, have been found in various types of human cancers such as malignant melanoma, and colorectal cancer. BRAF V600E and V600K, most commonly observed mutations in these cancers, may predict response to targeted therapies. Many techniques suffer from a lack of diagnostic sensitivity in mutation analysis in clinical samples with a low cancer cell percentage or poor-quality fragmented DNA. Here we present allele-specific real-time PCR assay for amplifying 35- to 45-base target sequences in BRAF gene. Forward primer designed for BRAF V600E detection is capable of recognizing both types of BRAF V600E mutation, i.e. V600E1 (c.1799T>A) and V600E2 (c.1799_1800delTGinsAA), as well as complex tandem mutation caused by nucleotide changes in codons 600 and 601. We utilized this assay to analyze Thai formalin-fixed paraffin-embedded tissues. Forty-eight percent of 178 Thai colorectal cancer tissues has KRAS mutation detected by highly sensitive commercial assays. Although these DNA samples contain low overall yield of amplifiable DNA, our newly-developed assay successfully revealed BRAF V600 mutations in 6 of 93 formalin-fixed paraffin-embedded colorectal cancer tissues which KRAS mutation was not detected. Ultra-short PCR assay with forward mutation-specific primers is potentially useful to detect BRAF V600 mutations in highly fragmented DNA specimens from cancer patients.

  19. Effectiveness of personalized face-to-face and telephone nursing counseling interventions for cardiovascular risk factors: a controlled clinical trial.

    PubMed

    Vílchez Barboza, Vivian; Klijn, Tatiana Paravic; Salazar Molina, Alide; Sáez Carrillo, Katia Lorena

    2016-08-08

    to evaluate the effect and gender differences of an innovative intervention involving in-person and telephone nursing counseling to control cardiovascular risk factors (arterial hypertension, dyslipidemia, and overweight), improve health-related quality of life and strengthen self-efficacy and social support in persons using the municipal health centers' cardiovascular health program. a randomized controlled clinical trial involving participants randomized into the intervention group who received traditional consultation plus personalized and telephone nursing counseling for 7 months (n = 53) and the control group (n = 56). The study followed the Consolidated Standards of Reporting Trials Statement. women in the intervention group presented a significant increase in the physical and mental health components compared to the control group, with decreases in weight, abdominal circumference, total cholesterol, low-density lipoprotein cholesterol, and the atherogenic index. The effects attributable to the intervention in the men in the intervention group were increased physical and emotional roles and decreased systolic and diastolic pressure, waist circumference, total cholesterol, low-density lipoprotein cholesterol, atherogenic index, cardiovascular risk factor, and 10-year coronary risk. this intervention is an effective strategy for the control of three cardiovascular risk factors and the improvement of health-related quality of life. evaluar efecto y diferencias por sexo de una intervención innovadora "Consejería de Enfermería Personalizada y Telefónica", dirigida al control de factores de riesgo cardiovascular (hipertensión arterial, dislipidemia y sobrepeso) y al mejoramiento de la calidad de vida relacionada con la salud, fortaleciendo la autoeficacia y el apoyo social en personas usuarias del programa de salud cardiovascular de los Centros de Salud Municipales de Concepción. ensayo clínico controlado aleatoriamente y selección aleatoria de participantes; grupo intervención con consulta tradicional más consejería de enfermería personalizada y telefónica durante 7 meses (n=53); y grupo control (n=56); siguiendo la declaración del Consolidated Standards of Reporting Trials. mujeres del grupo intervención, presentaron aumento significativo con respecto al grupo control, en componentes de salud física y mental; disminución de: peso, circunferencia abdominal, colesterol total, colesterol lipoproteínas de baja densidad e índice de aterogenicidad. En hombres del grupo intervención se reflejó como efectos atribuibles a la intervención: 1) aumento en dimensiones del rol físico y emocional; 2) disminución: presión sistólica y diastólica, circunferencia abdominal, colesterol total, colesterol lipoproteínas de baja densidad, índice de aterogenicidad, factor de riesgo cardiovascular y riesgo coronario a 10 años. esta intervención es una estrategia efectiva para el control de tres factores de riesgo cardiovascular y mejoría de calidad de vida relacionada con la salud. avaliar o efeito e as diferenças por sexo de uma intervenção inovadora: o aconselhamento personalizado e por telefone em enfermagem, visando o controle de fatores de risco cardiovascular (hipertensão arterial, dislipidemia e sobrepeso) e a melhora na qualidade de vida relacionada à saúde, fortalecendo a autoeficácia e o apoio social a pessoas que usam o programa de saúde cardiovascular de Centros Municipais de Saúde. ensaio clínico controlado e randomizado, participantes randomizados, grupo de intervenção: consulta tradicional mais aconselhamento personalizado e por telefone em enfermagem por 7 meses (n = 53); e grupo de controle (n = 56); seguindo a declaração Consolidated Standards of Reporting Trials Statement. mulheres do grupo intervenção apresentaram um aumento significativo, em relação ao grupo controle, nos componentes de saúde mental e física, com diminuição do peso, circunferência abdominal, colesterol total, colesterol de lipoproteínas de baixa densidade e índice aterogênico. Em homens do grupo intervenção, os efeitos atribuíveis à intervenção foram: aumentos nos papeis físicos e emocionais, com diminuições na pressão sistólica e diastólica, circunferência abdominal, colesterol total, colesterol de lipoproteínas de baixa densidade, índice aterogênico, fator de risco cardiovascular e risco coronariano em 10 anos. essa intervenção é uma estratégia eficaz para o controle dos três fatores de risco cardiovascular e a melhora da qualidade de vida relacionada à saúde.

  20. Difficulties of First Years Elementary School Teachers with the Teaching of Astronomy. (Breton Title: Dificuldades de Professores dos Anos Iniciais do Ensino Fundamental em Relação ao Ensino da Astronomia. ) Dificultades de LOS Profesores de los Primeros Años de la Escuela Primaria en Relación a la Enseñanza de la Astronomía

    NASA Astrophysics Data System (ADS)

    Langhi, Rodolfo; Nardi, Roberto

    2005-12-01

    This paper reports Primary School teachers' discourses analysis about their difficulties related to the teaching of Astronomy. It reports partial data of a master's level research carried out in the last two years, named "An exploratory study for inserting Astronomy in primary school teachers' education" (LANGHI, 2004). The study took into consideration students' and teachers' common sense conceptions about astronomical phenomena, conceptual mistakes in textbooks, and Astronomy's suggestions given by the PCN (Parâmetros Curriculares Nacionais - The Brazilian National Curriculum Standards). The paper aims to characterize teachers' difficulties, in order to provide subsides to the implementation of an initial or continuing education program. This study is justified by the fact that courses plans like these only will be adapted to the teacher's (and students') reality, if there is a primary investigation about what the teachers really need to know about Astronomy. This fact was possible here by the enunciations interpretation of a teachers' sample using semi-structured interviews, according to discourse analysis procedures. The research outcomes show difficulties related to factors like: those of personal order, methodological, on teacher's formation, educational infrastructure and other related to information sources for educators. Este artigo, que relata as dificuldades de professores em relação ao ensino da Astronomia, faz parte de um estudo exploratório para a inserção da Astronomia na formação de professores dos anos iniciais do Ensino Fundamental. Esse estudo leva em consideração as concepções alternativas de alunos e professores sobre fenômenos astronômicos, os erros conceituais em livros didáticos e as sugestões de conteúdos de Astronomia constantes nos PCN (Parâmetros Curriculares Nacionais). Caracterizar as dificuldades dos professores é a questão central deste texto, apontando para o objetivo de contribuir com subsídios para um futuro programa de formação continuada neste tema. O estudo se justifica mediante o fato de que planejamentos de cursos como estes só se adequarão à realidade do professor (e do aluno) se houver uma investigação antecipada sobre o que os docentes precisam saber e saber fazer a respeito da Astronomia, o que se concretizou em nosso caso pela interpretação dos discursos de uma amostra de professores coletados através de entrevistas semi-estruturadas, utilizando para interpretação os princípios e métodos da análise do discurso em sua linha francesa. Os resultados da pesquisa indicaram dificuldades de ordem pessoal, metodológica, de formação, de infra-estrutura e outras relacionadas às fontes de informações para docentes. Este artículo que relata las dificultades de los profesores en relación a la enseñanza da laAstronomía es parte de un estudio preliminar para la implantación dela Astrnomía enla formación de profesores de ls primeros años del ciclo primario.El estudio considera las concepciones alternativas de alumnos y profesores respecto a los fenómenos astronómicos, los errores conceptuales en los libros didácticos y las sugerencias de contenidos de Astronomía que constan en los Parámetros Curriculares Nacionales del Brasil. Caracterizar las dificultades de los profesores constituye la cuestión central de este texto, apuntando para el objetivo de contribuir para un futuro programa de educación contínua en este tema. El estudio se justifica mediante el hecho que la planificación de cursos de este tipo solo se adecuarán a la realidade del profesor (y del alumno) si existe una investigación anterior a respecto de lo que los docentes precisan saber y saber realizar en Astronomía, lo cual se concretó en nuestro caso por medio de la interpretación de los discursos de una muestra de profesores obtenidos através de entrevistas semiestructuradas, utilizand para esta interpretación los principios y métodos de análisis del discurso en su línea francesa. Los resultados mostraron dificultades de orden personal, metodológica, formativa, de infraestructura y otras relacionadas a las fuentes de información para los docentes.

  1. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    PubMed

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  2. Immunological properties of the primer-independent glucosyltransferase of Streptococcus mutans serotypes d and g.

    PubMed

    Yamashita, Y; Shigeoka, T; Hanada, N; Takehara, T

    1988-05-01

    Streptococcus mutans serotype g secretes at least three kinds of glucosyltransferase with different enzymological and immunological properties. One of them is a primer-independent enzyme and seems to be the source of primer for the others, both of which are primer-dependent enzymes. Recently, we purified the primer-independent enzyme, the third glucosyltransferase in this group from S. mutans strain AHT-k serotype g. In the present study, we examined the specificity of the antiserum against the primer-independent glucosyltransferase using extracellular culture-conditioned fluids of many strains of the various serotypes of S. mutans. The antiserum cross-reacted with the extracellular culture fluids from strains of serotypes d and a, in addition to serotype g, but not with those of other serotypes, indicating that the primer-independent glucosyltransferase is secreted by the S. sobrinus and S. cricetus, but not by S. mutans and S. rattus. The antiserum did not completely inhibit the activity of the enzyme, even at more than twofold antibody excess, determined by indirect precipitation with immobilized staphylococcal protein A.

  3. Sensitivity of different Trypanosoma vivax specific primers for the diagnosis of livestock trypanosomosis using different DNA extraction methods.

    PubMed

    Gonzales, J L; Loza, A; Chacon, E

    2006-03-15

    There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.

  4. CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design

    PubMed Central

    Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven

    2003-01-01

    We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413

  5. UniPrime2: a web service providing easier Universal Primer design.

    PubMed

    Boutros, Robin; Stokes, Nicola; Bekaert, Michaël; Teeling, Emma C

    2009-07-01

    The UniPrime2 web server is a publicly available online resource which automatically designs large sets of universal primers when given a gene reference ID or Fasta sequence input by a user. UniPrime2 works by automatically retrieving and aligning homologous sequences from GenBank, identifying regions of conservation within the alignment, and generating suitable primers that can be used to amplify variable genomic regions. In essence, UniPrime2 is a suite of publicly available software packages (Blastn, T-Coffee, GramAlign, Primer3), which reduces the laborious process of primer design, by integrating these programs into a single software pipeline. Hence, UniPrime2 differs from previous primer design web services in that all steps are automated, linked, saved and phylogenetically delimited, only requiring a single user-defined gene reference ID or input sequence. We provide an overview of the web service and wet-laboratory validation of the primers generated. The system is freely accessible at: http://uniprime.batlab.eu. UniPrime2 is licenced under a Creative Commons Attribution Noncommercial-Share Alike 3.0 Licence.

  6. Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.

    PubMed

    Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca

    2017-11-23

    DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.

  7. Viviendo Con Incendios: Una guia para los duenos de casas en Nuevo Mexico [Living with Fire: A Guide for the Homeowner-New Mexico

    Treesearch

    U.S. Department of the Interior Bureau of Land Management

    2008-01-01

    La posibilidad de perdidas humanas y de propiedad en Nuevo Mexico debido a un incendio forestal ha ido incrementando. Para responder a este peligro, entidades locales, estatales, federales, particulares y sin fines de lucro se han unido para crear Como Reducir la Amenaza de Incendios Forestales, un programa dirigido a los propietarios de casas. Este no es un programa...

  8. Study of the Generation of Intense Pulsed Electron Beams Using Glow Discharges

    DTIC Science & Technology

    1988-02-01

    de Investigaciones Opticas, Rep. Argentina. (2) On leave from PROFET (UNCPBA) Programa de Fisica Experimental Tandil, Rep. Argentina. (3) Edwards... de Investigaciones Opticas, (CIC-BA) Rep. Argentina. Section III-D. Measurements of the plasma density andB. T. Szapiro is on leave from Programa de ...discussed. The radial profiles Szapiro was supported by a fellowship from the Universidad Nacional de show the presence of a high-current-density

  9. White primer permits a corrosion-resistant coating of minimum weight

    NASA Technical Reports Server (NTRS)

    Albrecht, R. H.; Jensen, D. P.; Schnake, P.

    1966-01-01

    White primer for coating 2219 aluminum alloy supplies a base for a top coating of enamel. A formulation of pigments and vehicle results in a primer with high corrosion resistance and minimum film thickness.

  10. Economics : pricing, demand, and economic efficiency : a primer.

    DOT National Transportation Integrated Search

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  11. Species specific identification of spore-producing microbes using the gene sequence of small acid-soluble spore coat proteins for amplification based diagnostics

    DOEpatents

    McKinney, Nancy

    2002-01-01

    PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.

  12. Uncoupling primer and releaser responses to pheromone in honey bees

    NASA Astrophysics Data System (ADS)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  13. Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.

    PubMed

    Campos, Maria Jorge; Quesada, Alberto

    2017-01-01

    PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.

  14. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae)

    PubMed Central

    2010-01-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers. PMID:21637499

  15. Comparative study on the use of specific and heterologous microsatellite primers in the stingless bees Melipona rufiventris and M. mondury (Hymenoptera, Apidae).

    PubMed

    Lopes, Denilce Meneses; de Oliveira Campos, Lúcio Antônio; Salomão, Tânia Maria Fernandes; Tavares, Mara Garcia

    2010-04-01

    Due to their high degree of polymorphism, microsatellites are considered useful tools for studying population genetics. Nevertheless, studies of genetic diversity in stingless bees by means of these primers have revealed a low level of polymorphism, possibly the consequence of the heterologous primers used, since in most cases these were not specifically designed for the species under consideration. Herein we compared the number of polymorphic loci and alleles per locus, as well as observed heterozygosity in Melipona rufiventris and M. mondury populations, using specific and heterologous primers. The use of specific primers placed in evidence the greater frequency of polymorphic loci and alleles per locus, besides an expressive increase in observed heterozygosity in M. rufiventris and M. mondury, thereby reinforcing the idea that populational studies should be undertaken by preferably using species-specific microsatellite primers.

  16. Molecular method for determining sex of walruses

    USGS Publications Warehouse

    Fischbach, Anthony S.; Jay, C.V.; Jackson, J.V.; Andersen, L.W.; Sage, G.K.; Talbot, S.L.

    2008-01-01

    We evaluated the ability of a set of published trans-species molecular sexing primers and a set of walrus-specific primers, which we developed, to accurately identify sex of 235 Pacific walruses (Odobenus rosmarus divergens). The trans-species primers were developed for mammals and targeted the X- and Y-gametologs of the zinc finger protein genes (ZFX, ZFY). We extended this method by using these primers to obtain sequence from Pacific and Atlantic walrus (0. r. rosmarus) ZFX and ZFY genes to develop new walrus-specific primers, which yield polymerase chain reaction products of distinct lengths (327 and 288 base pairs from the X- and Y-chromosome, respectively), allowing them to be used for sex determination. Both methods yielded a determination of sex in all but 1-2% of samples with an accuracy of 99.6-100%. Our walrus-specific primers offer the advantage of small fragment size and facile application to automated electrophoresis and visualization.

  17. Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

    PubMed Central

    Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

    1984-01-01

    Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

  18. MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool

    PubMed Central

    Zhou, Quan

    2017-01-01

    An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876

  19. Comparison of shear bond strength of orthodontic brackets using various zirconia primers.

    PubMed

    Lee, Ji-Yeon; Kim, Jin-Seok; Hwang, Chung-Ju

    2015-07-01

    The aim of this study was to compare the shear bond strength (SBS) of orthodontic brackets bonded to zirconia surfaces using three different zirconia primers and one silane primer, and subjected to thermocycling. We designed 10 experimental groups following the surface treatment and thermocycling. The surface was treated with one of the following method: no-primer (NP), Porcelain Conditioner (PC), Z-PRIME Plus (ZP), Monobond Plus (MP) and Zirconia Liner Premium (ZL) (n=20). Then each group was subdivided to non-thermocycled and thermocycled groups (NPT, PC, ZPT, MPT, ZLT) (n=10). Orthodontic brackets were bonded to the specimens using Transbond™ XT Paste and light cured for 15 s at 1,100 mW/cm(2). The SBS was measured at a 1 mm/min crosshead speed. The failure mode was assessed by examination with a stereomicroscope and the amount of bonding resin remaining on the zirconia surface was scored using the modified adhesive remnant index (ARI). The SBS of all experimental groups decreased after thermocycling. Before thermocycling, the SBS was ZL, ZP ≥ MP ≥ PC > NP but after thermocycling, the SBS was ZLT ≥ MPT ≥ ZPT > PCT = NPT (p > 0.05). For the ARI score, both of the groups lacking primer (NP and NPT) displayed adhesive failure modes, but the groups with zirconia primers (ZP, ZPT, MP, MPT, ZL, and ZLT) were associated with mixed failure modes. Surface treatment with a zirconia primer increases the SBS relative to no-primer or silane primer application between orthodontic brackets and zirconia prostheses.

  20. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    PubMed

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  1. The Astronomy Club of Araranguá: Educating Science Teachers as Science Communicators. (Breton Title: Clube de Astronomia de AraranguÁ: a Formação de Professores de Ciências Como Divulgadores Científicos. ) Club de Astronomía de Araranguá: la Formación del Profesorado Como Comunicadores de la Ciencia

    NASA Astrophysics Data System (ADS)

    Damasio, Felipe; Allain, Olivier; Antunes Rodrigues, Adriano

    2013-07-01

    The study reported in this work takes place since 2009 at the Federal Institute of Education, Science and Technology of Santa Catarina, Campus Araranguá. Our main goal is to help form teachers, training undergraduate students in Natural Sciences with specialization in Physics as science communicators, as well as to promote actions of broader scientific popularization in the region of the town of Araranguá through an Astronomy Club called CA2. Among the actions of scientific popularization that the students promote are: video production, radio broadcasts, lectures, nightly observations, preparation and exhibition of posters, physics teaching for children, continuing education activities for teachers and regular physics teaching using Astronomy as a theme. The Club's teacher education and scientific dissemination work is based on the Theory of Meaningful Learning, always trying to reach the student's predisposition to learn and produce potentially meaningful material, the two essential conditions for meaningful learning to occur. O estudo que este trabalho relata ocorre desde 2009 no Instituto Federal de Educação, Ciência e Tecnologia de Santa Catarina, campus Araranguá. Nele procura-se formar divulgadores científicos durante a formação inicial de docentes do curso de Licenciatura em Ciências da Natureza com habilitação em Física, além de promover ações de divulgação científica para o público geral da região da cidade de Araranguá por meio de um Clube de Astronomia chamado CA² (Clube de Astronomia de Araranguá). Entre as ações de divulgação científica que os licenciandos promovem estão: produção de vídeos, programas de rádio, palestras, observações noturnas, confecção e exposição de pôsteres, ensino de física para crianças, formação continuada de professores em atividades e ensino de Física regular utilizando a Astronomia como tema gerador. O trabalho de formação docente e divulgação científica do Clube fundamenta-se na Teoria da Aprendizagem Significativa, sempre procurando alcançar a pré-disposição em aprender e produzir material potencialmente significativo, as duas condições necessárias para que a aprendizagem significativa ocorra. El estudio relatado en este trabajo se lleva a cabo desde 2009 en el Instituto Federal de Educação, Ciência e Tecnología de Santa Catarina, campus Araranguá. En él se busca formar a comunicadores de la ciencia durante la formación inicial de los docentes Licenciatura en Ciencias Naturales con especialidad en Física, y también promover acciones de divulgación científica para el público en general en la región de Araranguá a través de un club de astronomía llamado CA2 (Clube de Astronomia Araranguá). Entres las acciones de los estudiantes que se promueven están: producción de videos, programas de radio, conferencias, observaciones nocturnas, la preparación y exposición de carteles, la educación en física para los niños, actividades de formación permanente del profesorado y enseñanza de la física de con el tema generador Astronomía. El trabajo de la formación del profesorado y la difusión de club científico se basa en la teoría del aprendizaje significativo, buscando siempre la predisposición para aprender y producir material potencialmente significativo, las dos condiciones necesarias para que ocurra el aprendizaje significativo.

  2. Nursing interventions for rehabilitation in Parkinson's disease: cross mapping of terms.

    PubMed

    Tosin, Michelle Hyczy de Siqueira; Campos, Débora Moraes; Andrade, Leonardo Tadeu de; Oliveira, Beatriz Guitton Renaud Baptista de; Santana, Rosimere Ferreira

    2016-08-08

    to perform a cross-term mapping of nursing language in the patient record with the Nursing Interventions Classification system, in rehabilitation patients with Parkinson's disease. a documentary research study to perform cross mapping. A probabilistic, simple random sample composed of 67 records of patients with Parkinson's disease who participated in a rehabilitation program, between March of 2009 and April of 2013. The research was conducted in three stages, in which the nursing terms were mapped to natural language and crossed with the Nursing Interventions Classification. a total of 1,077 standard interventions that, after crossing with the taxonomy and refinement performed by the experts, resulted in 32 interventions equivalent to the Nursing Interventions Classification (NIC) system. The NICs, "Education: The process of the disease.", "Contract with the patient", and "Facilitation of Learning" were present in 100% of the records. For these interventions, 40 activities were described, representing 13 activities by intervention. the cross mapping allowed for the identification of corresponding terms with the nursing interventions used every day in rehabilitation nursing, and compared them to the Nursing Interventions Classification. realizar o mapeamento cruzado de termos da linguagem de Enfermagem, com o sistema de Classificação das Intervenções de Enfermagem, em prontuários de pacientes com doença de Parkinson em reabilitação. estudo de pesquisa documental, para realização de mapeamento cruzado. Amostra probabilística, do tipo aleatória simples, composta por 67 prontuários de pacientes com doença de Parkinson que participaram de programa de reabilitação, entre março de 2009 e abril de 2013. Pesquisa realizada em três etapas onde foram mapeados os termos de Enfermagem em linguagem livre e cruzados com o sistema de Classificação das Intervenções de Enfermagem. foram identificadas 1.077 intervenções normalizadas que, após o cruzamento com a taxonomia e o refinamento feito pelos especialistas, resultaram em 32 intervenções equivalentes ao sistema de Classificação das Intervenções de Enfermagem. "Ensino: Processo da doença", "Contrato com o Paciente" e "Facilitação da Aprendizagem" estiveram presentes em 100% dos prontuários. Para essas, foram descritas 40 atividades, representando 13 atividades por intervenção prescrita. o mapeamento cruzado permitiu levantar os termos correspondentes às Intervenções de Enfermagem utilizados no cotidiano dos enfermeiros de reabilitação e compará-los ao sistema de Classificação das Intervenções de Enfermagem. realizar el mapeo cruzado de términos del lenguaje de Enfermería con el Sistema de Clasificación de las Intervenciones de Enfermería en historias clínicas de pacientes con enfermedad de Parkinson en rehabilitación. estudio de investigación documental para realización de mapeo cruzado. Muestra probabilística de tipo aleatoria simple, compuesta por 67 historias clínicas de pacientes con enfermedad de Parkinson que participaron del programa de rehabilitación entre marzo de 2009 y abril de 2013. Investigación realizada en tres etapas donde fueron mapeados los términos de Enfermería en lenguaje libre y cruzados con el sistemas de Clasificación de Intervenciones de Enfermería. se identificaron 1077 intervenciones normalizadas que, después del cruzamiento con la taxonomía y el refinamiento hecho por los especialistas, resultaron en 32 intervenciones equivalentes al sistema de Clasificación de Intervenciones de Enfermería. "Enseñanza: Proceso de la enfermedad", "Contrato con el paciente" y "Facilitación del aprendizaje" estuvieron presentes en 100% de las historias clínicas. Para éstas, se describieron 40 actividades, representando 13 actividades por cada intervención prescripta. el mapeo cruzado permitió encontrar los términos correspondientes a las Intervenciones en Enfermería utilizados en el día a día de los enfermeros de rehabilitación y compararlos con el sistema de Clasificación de Intervenciones de Enfermería.

  3. Electro-Deposited Primer Development and Low-Polluting Primer Evaluation

    DTIC Science & Technology

    1989-08-01

    in the use of spray-applied primers are nonuniform corrosion protection, poor control of primer thickness, and variable strength of the adhesive bond...AL=)r- U’) LA C) .LAV) . L" () - C:’. L L :0 3c’. ) %D r- LAIr - LA I r-.%D ’D( o oD𔃺t- LA Ln DLI m to r- 0 0l- I cn M - in C.0 CD I (n m~ : c) = I V

  4. Design of a Percussion and Electric Primer Gun Firing Power Supply

    DTIC Science & Technology

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  5. ITS fungal barcoding primers versus 18S AMF-specific primers reveal similar AMF-based diversity patterns in roots and soils of three mountain vineyards.

    PubMed

    Berruti, Andrea; Desirò, Alessandro; Visentin, Stefano; Zecca, Odoardo; Bonfante, Paola

    2017-10-01

    ITS primers commonly used to describe soil fungi are flawed for AMF although it is unknown the extent to which they distort the interpretation of community patterns. Here, we focus on how the use of a specific ITS2 fungal barcoding primer pair biased for AMF changes the interpretation of AMF community patterns from three mountain vineyards compared to a novel AMF-specific approach on the 18S. We found that although discrepancies were present in the taxonomic composition of the two resulting datasets, the estimation of diversity patterns among AMF communities was similar and resulted in both primer systems being able to correctly assess the community-structuring effect of location, compartment (root vs. soil) and environment. Both methodologies made it possible to detect the same alpha-diversity trend among the locations under study but not between root and soil transects. We show that the ITS2 primer system for fungal barcoding provides a good estimate of both AMF community structure and relation to environmental variables. However, this primer system does not fit in with cross-compartment surveys (roots vs. soil) as it can underestimate AMF diversity in soil samples. When specifically focusing on AMF, the 18S primer system resulted in wide coverage and marginal non-target amplification. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  6. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    PubMed

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  7. Aluminum Rich Epoxy Primer for Ground and Air Vehicles

    DTIC Science & Technology

    2017-03-01

    UNCLASSIFIED DOCUMENT Aluminum Rich Epoxy Primer for Ground and Air Vehicles Monthly Technical Report for the Period: January 20, 2017...Objective: To further develop the Aluminum Rich Epoxy Primer systems for Air and Ground Vehicles while addressing the objective requirements

  8. A primer on safety performance measures for the transportation planning process

    DOT National Transportation Integrated Search

    2009-09-01

    This Primer is a tool to help State and local practitioners, transportation planners, and decision-makers identify, select, and use safety performance measures as a part of the transportation planning process. The Primer draws from current literature...

  9. Primer on consumer marketing research : procedures, methods, and tools

    DOT National Transportation Integrated Search

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  10. Factors associated with the implementation of programs for drug abuse prevention in schools.

    PubMed

    Pereira, Ana Paula Dias; Paes, Ângela Tavares; Sanchez, Zila M

    2016-08-04

    To analyze if characteristics of managers, schools, and curriculum are associated with the implementation of programs for drug abuse prevention in elementary and high schools. Cross-sectional study, with random sample of 263 school managers. Data were collected between 2012 and 2013 by a program that sends forms via internet. A closed self-filling questionnaire was applied online. Statistical analysis included Chi-square tests and logistic regression models. The outcome variable was the presence of program for drug abuse prevention inserted in the daily life and educational program of the school. The explanatory variables were divided into: demographic data of the manager; characteristics of the school and of the curriculum; health education; and drug use in the school. We found that 42.5% (95%CI 36.1-49.1) of the evaluated schools had programs for drug abuse prevention. With the multiple logistic regression model, we observed that the more time the manager has worked with education, the chance of the school having a program increased at about 4.0%. Experimenting with innovative teaching techniques also increased at about six times the chance of the school developing a program for drug abuse prevention. The difficulties in the implementation of the programs were more present in state and municipal schools, when compared with private schools, due to, for instance: lack of teaching materials, lack of money, and competing demands for teaching other subjects. The implementation of programs for drug abuse prevention in the city of Sao Paulo is associated with the experience of the manager in education and with the teaching strategies of the school. Analisar se características dos dirigentes, das escolas e do currículo escolar estão associadas à implantação de programas de prevenção ao uso de drogas nas escolas do ciclo fundamental II e médio. Estudo transversal, com amostra aleatória sistemática de 263 dirigentes escolares. Os dados foram coletados nos anos de 2012 e 2013 por meio de um programa de envio de formulários pela internet. Aplicou-se questionário fechado, de autopreenchimento on-line. A análise estatística incluiu testes Qui-quadrado e modelos de regressão logística. A variável desfecho foi a presença de programa de prevenção ao uso de drogas inserido no cotidiano e no programa pedagógico da escola. As variáveis explicativas foram divididas em: dados demográficos do dirigente; características da escola e do currículo; educação em saúde; e consumo de drogas na escola. Constatou-se que 42,5% (IC95% 36,1-49,1) das escolas avaliadas possuíam programa de prevenção ao uso de drogas. Com o modelo de regressão logística múltipla, observou-se que, a cada ano de atuação do dirigente na educação, a chance de a escola ter um programa aumentava em aproximadamente 4,0%. O fato de experimentar técnicas de ensino inovadoras também aumentou em cerca de seis vezes a chance de a escola desenvolver um programa de prevenção ao uso de drogas. As dificuldades na implantação dos programas foram mais presentes nas redes estadual e municipal, quando comparadas à rede privada, destacando-se: a falta de material didático, a falta de dinheiro e as demandas concorrentes para ensino de outras disciplinas. A implantação de programas de prevenção ao uso de drogas no município de São Paulo está associada à experiência do dirigente escolar na educação e nas estratégias de ensino da escola.

  11. Antibacterial Effect and Tensile Bond Strength of Self-etching Adhesive Resins with and without Methacryloyloxydodecylpyridinium Bromide: An in vitro Study.

    PubMed

    Krishnamurthy, Madhuram; Kumar, V Naveen; Leburu, Ashok; Dhanavel, Chakravarthy; Selvendran, Kasiswamy E; Praveen, Nehrudhas

    2018-04-01

    Aim: The aim of the present study was to compare the antibacterial activity of a self-etching primer containing antibacterial monomer methacryloyloxydodecylpyridinium bromide (MDPB) (Clearfil protect bond) with a conventional self-etching primer without MDPB (Clearfil SE bond) against Streptococcus mutans and the effect of incorporation of MDPB on the tensile bond strength of the experimental self-etching primer (Clearfil protect bond). Materials and methods: The antibacterial activity of the self-etching primers was assessed using agar disk diffusion method and the diameters of the zones of inhibition were measured and ranked. For tensile bond strength testing, 20 noncarious human molars were selected and randomly divided into two groups comprising 10 teeth in each group. Group I specimens were treated with Clearfil SE bond (without MDPB). Group II specimens were treated with Clearfil protect bond (with MDPB). Composite material was placed incrementally and cured for 40 seconds in all the specimens. Tensile bond strength was estimated using the Instron Universal testing machine at a crosshead speed of 1 mm/min. Results: The addition of MDPB into a self-etching primer exerts potential antibacterial effect against S. mutans. The tensile bond strength of MDPB containing self-etching primer was slightly lower than that of the conventional self-etching Clearfil protect bond primer, but the difference was not statistically significant. Conclusion: Thus, a self-etching primer containing MDPB will be a boon to adhesive dentistry as it has bactericidal property with adequate tensile bond strength. Clinical significance: The concept of prevention of extension in adhesive dentistry would result in micro/nanoleakage due to the presence of residual bacteria in the cavity. Self-etching primers with MDPB would improve the longevity of such restorations by providing adequate antibacterial activity without compromising the bond strength. Keywords: Antibacterial property, Methacryloyloxydodecy-lpyridinium bromide, Self-etching primers, Tensile bond strength.

  12. Evaluation of new gyrB-based real-time PCR system for the detection of B. fragilis as an indicator of human-specific fecal contamination.

    PubMed

    Lee, Chang Soo; Lee, Jiyoung

    2010-09-01

    A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.

  13. PCR Primers for Metazoan Nuclear 18S and 28S Ribosomal DNA Sequences

    PubMed Central

    Machida, Ryuji J.; Knowlton, Nancy

    2012-01-01

    Background Metagenetic analyses, which amplify and sequence target marker DNA regions from environmental samples, are increasingly employed to assess the biodiversity of communities of small organisms. Using this approach, our understanding of microbial diversity has expanded greatly. In contrast, only a few studies using this approach to characterize metazoan diversity have been reported, despite the fact that many metazoan species are small and difficult to identify or are undescribed. One of the reasons for this discrepancy is the availability of universal primers for the target taxa. In microbial studies, analysis of the 16S ribosomal DNA is standard. In contrast, the best gene for metazoan metagenetics is less clear. In the present study, we have designed primers that amplify the nuclear 18S and 28S ribosomal DNA sequences of most metazoan species with the goal of providing effective approaches for metagenetic analyses of metazoan diversity in environmental samples, with a particular emphasis on marine biodiversity. Methodology/Principal Findings Conserved regions suitable for designing PCR primers were identified using 14,503 and 1,072 metazoan sequences of the nuclear 18S and 28S rDNA regions, respectively. The sequence similarity of both these newly designed and the previously reported primers to the target regions of these primers were compared for each phylum to determine the expected amplification efficacy. The nucleotide diversity of the flanking regions of the primers was also estimated for genera or higher taxonomic groups of 11 phyla to determine the variable regions within the genes. Conclusions/Significance The identified nuclear ribosomal DNA primers (five primer pairs for 18S and eleven for 28S) and the results of the nucleotide diversity analyses provide options for primer combinations for metazoan metagenetic analyses. Additionally, advantages and disadvantages of not only the 18S and 28S ribosomal DNA, but also other marker regions as targets for metazoan metagenetic analyses, are discussed. PMID:23049971

  14. Primer design for a prokaryotic differential display RT-PCR.

    PubMed Central

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-01-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

  15. Primer design for a prokaryotic differential display RT-PCR.

    PubMed

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  16. Primer and platform effects on 16S rRNA tag sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tremblay, Julien; Singh, Kanwar; Fern, Alison

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  17. Primer and platform effects on 16S rRNA tag sequencing

    DOE PAGES

    Tremblay, Julien; Singh, Kanwar; Fern, Alison; ...

    2015-08-04

    Sequencing of 16S rRNA gene tags is a popular method for profiling and comparing microbial communities. The protocols and methods used, however, vary considerably with regard to amplification primers, sequencing primers, sequencing technologies; as well as quality filtering and clustering. How results are affected by these choices, and whether data produced with different protocols can be meaningfully compared, is often unknown. Here we compare results obtained using three different amplification primer sets (targeting V4, V6–V8, and V7–V8) and two sequencing technologies (454 pyrosequencing and Illumina MiSeq) using DNA from a mock community containing a known number of species as wellmore » as complex environmental samples whose PCR-independent profiles were estimated using shotgun sequencing. We find that paired-end MiSeq reads produce higher quality data and enabled the use of more aggressive quality control parameters over 454, resulting in a higher retention rate of high quality reads for downstream data analysis. While primer choice considerably influences quantitative abundance estimations, sequencing platform has relatively minor effects when matched primers are used. In conclusion, beta diversity metrics are surprisingly robust to both primer and sequencing platform biases.« less

  18. Validation of a PCR-based method for the detection of various rendered materials in feedstuffs using a forensic DNA extraction kit.

    PubMed

    Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha

    2006-01-01

    A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.

  19. Considerations for high occupancy vehicle (HOV) to high occupancy toll (HOT) lanes conversions primer.

    DOT National Transportation Integrated Search

    2007-09-01

    This primer presents key issues and challenges related to the conversion of high occupancy vehicle (HOV) lanes to high occupancy toll (HOT) lanes. The primer is intended for community leaders, administrators, : the public, and other stakeholders resp...

  20. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.; Mowrey, C.; Reis, E.

    1985-01-01

    Results of lap shear tests of various silane primers are presented in graphs and tables. The OH-absorption of these primers (FTIR area values) are correlated with the lap shear tests of coated panels.

  1. Comparison of Primer Sets for Use in Automated Ribosomal Intergenic Spacer Analysis of Aquatic Bacterial Communities: an Ecological Perspective▿

    PubMed Central

    Jones, Stuart E.; Shade, Ashley L.; McMahon, Katherine D.; Kent, Angela D.

    2007-01-01

    Two primer sets for automated ribosomal intergenic spacer analysis (ARISA) were used to assess the bacterial community composition (BCC) in Lake Mendota, Wisconsin, over 3 years. Correspondence analysis revealed differences in community profiles generated by different primer sets, but overall ecological patterns were conserved in each case. ARISA is a powerful tool for evaluating BCC change through space and time, regardless of the specific primer set used. PMID:17122397

  2. A method for predicting service life of zinc rich primers on carbon steel

    NASA Technical Reports Server (NTRS)

    Hoppesch, C. W.

    1986-01-01

    The service life of zinc rich primers on carbon steel can be estimated by immersing a primer coated glass slide into an aqueous copper sulfate solution and measuring the amount of zinc that reacts with the copper in 15 minutes. This zinc availability test was used to evaluate eleven primers currently available for which marine beach exposure data was available from previous programs. Results were evaluated and a correlation between zinc availability and ASTM rust grade was shown.

  3. The effect of zoledronate-containing primer on dentin bonding of a universal adhesive.

    PubMed

    Zenobi, Walter; Feitosa, Victor Pinheiro; Moura, Maria Elisa Martins; D'arcangelo, Camillo; Rodrigues, Lidiany Karla de Azevedo; Sauro, Salvatore

    2018-01-01

    To evaluate the bonding ability and nanoleakage of a universal adhesive applied to dentin pre-treated using a zoledronate-containing primer (zol-primer) before and after mechanical load cycling. Flat dentin surfaces obtained from human molars were assigned to one of the following adhesion procedures (n=6): 1-Single Bond Universal (SBU) applied in etch-and-rinse mode; 2- SBU applied as etch-and-rinse after the application of zol-primer; 3- SBU applied in self-etch strategy; 4- SBU applied as self-etch after the use of zol-primer. Half of the specimens were processed for microtensile bond strength test after 24h, while the other half part was submitted to 200,000 mechanical cycles. Further specimens were silver-impregnated and assessed for interface nanoleakage by SEM. Data were analyzed with two-way ANOVA and Tukey's test (p<0.05). At 24h evaluation, the four groups presented similar bond strengths, whilst both groups bonded with etch-and-rinse technique showed significant bond strength reduction after mechanical load (p<0.05), with the highest drop in bond strength for the specimens pre-treated with the zol-primer. No negative effects were found for self-etch strategy (p>0.05) in microtensile test. Lower nanoleakage expression was observed for etch-and-rinse specimens treated with zol-primer. However, noteworthy reduction of adhesive layer thickness was observed when combining the zol-primer with the self-etch bonding approach. It can be concluded that zol-primer should not be used along with a universal adhesive in etch-and-rinse mode, but its application before self-etch application may provide less degradation of the resin-dentin interface. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Development of a Prokaryotic Universal Primer for Simultaneous Analysis of Bacteria and Archaea Using Next-Generation Sequencing

    PubMed Central

    Takahashi, Shunsuke; Tomita, Junko; Nishioka, Kaori; Hisada, Takayoshi; Nishijima, Miyuki

    2014-01-01

    For the analysis of microbial community structure based on 16S rDNA sequence diversity, sensitive and robust PCR amplification of 16S rDNA is a critical step. To obtain accurate microbial composition data, PCR amplification must be free of bias; however, amplifying all 16S rDNA species with equal efficiency from a sample containing a large variety of microorganisms remains challenging. Here, we designed a universal primer based on the V3-V4 hypervariable region of prokaryotic 16S rDNA for the simultaneous detection of Bacteria and Archaea in fecal samples from crossbred pigs (Landrace×Large white×Duroc) using an Illumina MiSeq next-generation sequencer. In-silico analysis showed that the newly designed universal prokaryotic primers matched approximately 98.0% of Bacteria and 94.6% of Archaea rRNA gene sequences in the Ribosomal Database Project database. For each sequencing reaction performed with the prokaryotic universal primer, an average of 69,330 (±20,482) reads were obtained, of which archaeal rRNA genes comprised approximately 1.2% to 3.2% of all prokaryotic reads. In addition, the detection frequency of Bacteria belonging to the phylum Verrucomicrobia, including members of the classes Verrucomicrobiae and Opitutae, was higher in the NGS analysis using the prokaryotic universal primer than that performed with the bacterial universal primer. Importantly, this new prokaryotic universal primer set had markedly lower bias than that of most previously designed universal primers. Our findings demonstrate that the prokaryotic universal primer set designed in the present study will permit the simultaneous detection of Bacteria and Archaea, and will therefore allow for a more comprehensive understanding of microbial community structures in environmental samples. PMID:25144201

  5. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    PubMed

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  6. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    PubMed

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  7. The self primer of the long terminal repeat retrotransposon Tf1 is not removed during reverse transcription.

    PubMed

    Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L; Levin, Henry L

    2006-08-01

    The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5' end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer.

  8. Modelizacion, control e implementacion de un procesador energetico paralelo para aplicacion en sistemas multisalida

    NASA Astrophysics Data System (ADS)

    Ferreres Sabater, Agustin

    Cualquier sistema electronico que incluya un procesado o tratamiento de la senal, y ademas, algun tipo de actuador mecanico generalmente necesita, como minimo, dos tensiones diferentes de alimentacion. Excluyendo los sistemas de alimentacion distribuida, la solucion tecnica mas utilizada para proporcionar dos o mas tensiones consiste en las fuentes de alimentacion multisalida. En una fuente de alimentacion multisalida los diferentes circuitos que conforman cada salida comparten un mismo transformador de potencia optimizando coste, masa, y volumen. Las ventajas obtenidas con este procedimiento tienen en su contra el efecto que sobre cada salida individual provocan las demas en su conjunto debido, principalmente, a los efectos de los elementos parasitos de los componentes. Un cambio de carga en una de las salidas produce un transitorio que es visto por todas las demas como un efecto de impedancia cruzada, y al final del transitorio, la tension de cada salida es diferente respecto a la que tenian antes del transitorio. Este ultimo resultado se conoce como regulacion cruzada. La disminucion de los efectos de la regulacion cruzada ha sido objeto de estudio durante los ultimos anos. El objetivo ha sido el desarrollo de distintas estrategias que permiten, desde disminuir los efectos de la regulacion cruzada hasta los niveles deseables, a eliminarla completamente. El resultado final suele suponer una penalizacion sobre el diseno del sistema directamente proporcional al grado de regulacion a conseguir en las distintas salidas. Entre las soluciones propuestas para eliminar la regulacion cruzada las tecnicas de post-regulacion se han consolidado como la opcion mas aceptada ya que, pueden aplicarse a cualquier convertidor y no suponen ninguna complejidad adicional a la hora de plantear el diseno. En esta Tesis Doctoral se abordara el estudio de la tecnica conocida como postregulacion mediante transformador controlado, que si bien se ha empleado en convertidores resonantes, su modelizacion, y aplicacion en convertidores PWM, esta aun por estudiar y valorar. El primer Capitulo consiste en una breve introduccion al problema de la regulacion cruzada y la impedancia cruzada para posteriormente describir las tecnicas de post-regulacion actualmente mas empleadas, con especial atencion al post-regulador con transformador controlado. El Capitulo segundo trata del estudio de las caracteristicas estaticas del postregulador con transformador controlado. Partiendo de los estudios disponibles sobre el postregulador se plantean mejoras en su modo de actuacion y se discuten tres alternativas diferentes para controlar el transformador. Las dos primeras consisten en emplear un convertidor auxiliar Boost en sus dos modos de funcionamiento, continuo y discontinuo. La tercera consiste en controlar el transformador con una tension PWM directamente, sin filtrado. Finalmente se comprueba experimentalmente, para el estado estacionario, el funcionamiento del post-regulador para cada uno de los tres metodos de control. El Capitulo tercero trata de la dinamica de la salida controlada con el post-regulador cuando este emplea un convertidor auxiliar tipo Boost. Mediante la tecnica de promediado de variables de estado se propone el modelo de pequena senal, tanto para el modo continuo como para el modo discontinuo de funcionamiento del convertidor auxiliar. Los resultados mas significativos de esta seccion son las expresiones analiticas de las impedancias cruzadas y de la impedancia de la salida post-regulada. Como complemento al modelo de pequena senal se plantea un modelo de gran senal implementado sobre el simulador Pspice. Con este nuevo modelo se reproducen los resultados obtenidos con el modelo de pequena senal y ademas es posible simular los transitorios en las tensiones de salida ante cambios de carga. La modelizacion del convertidor cuando el transformador se controla con una tension PWM sin filtrar es el objetivo del Capitulo 4. En las secciones siguientes del Capitulo se plantea el correspondiente modelo de gran senal aplicado a un nuevo prototipo experimental, de mayor tension de entrada y mayores corrientes de salida. El final del Capitulo contrasta los resultados experimentales con los teoricos confirmando la utilidad del modelo de gran senal como una herramienta basica de diseno. Finalmente, en el Capitulo 5, se presentan las conclusiones y la valoracion de los diferentes estudios plateados a lo largo de la Tesis Doctoral.

  9. Initialization of Formation Flying Using Primer Vector Theory

    NASA Technical Reports Server (NTRS)

    Mailhe, Laurie; Schiff, Conrad; Folta, David

    2002-01-01

    In this paper, we extend primer vector analysis to formation flying. Optimization of the classical rendezvous or free-time transfer problem between two orbits using primer vector theory has been extensively studied for one spacecraft. However, an increasing number of missions are now considering flying a set of spacecraft in close formation. Missions such as the Magnetospheric MultiScale (MMS) and Leonardo-BRDF (Bidirectional Reflectance Distribution Function) need to determine strategies to transfer each spacecraft from the common launch orbit to their respective operational orbit. In addition, all the spacecraft must synchronize their states so that they achieve the same desired formation geometry over each orbit. This periodicity requirement imposes constraints on the boundary conditions that can be used for the primer vector algorithm. In this work we explore the impact of the periodicity requirement in optimizing each spacecraft transfer trajectory using primer vector theory. We first present our adaptation of primer vector theory to formation flying. Using this method, we then compute the AV budget for each spacecraft subject to different formation endpoint constraints.

  10. Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.

    PubMed

    Kalendar, Ruslan; Lee, David; Schulman, Alan H

    2011-08-01

    The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.

  11. Genus-specific PCR Primers Targeting Intracellular Parasite Euduboscquella (Dinoflagellata: Syndinea)

    NASA Astrophysics Data System (ADS)

    Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok

    2018-03-01

    We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.

  12. Multiplex primer prediction software for divergent targets

    PubMed Central

    Gardner, Shea N.; Hiddessen, Amy L.; Williams, Peter L.; Hara, Christine; Wagner, Mark C.; Colston, Bill W.

    2009-01-01

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets to amplify all members of large, diverse and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers (∼3700 18-mers or ∼2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus (FMDV), hemagglutinin (HA) and neuraminidase (NA) segments of influenza A virus, Norwalk virus, and HIV-1. We empirically demonstrated the application of the software with a multiplex set of 16 short (10 nt) primers designed to amplify the Poxviridae family to produce a specific amplicon from vaccinia virus. PMID:19759213

  13. Primer sets for cloning the human repertoire of T cell Receptor Variable regions.

    PubMed

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-08-29

    Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT, the ImMunoGeneTics information system. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets.

  14. Shear bond strengths of an indirect composite layering material to a tribochemically silica-coated zirconia framework material.

    PubMed

    Iwasaki, Taro; Komine, Futoshi; Fushiki, Ryosuke; Kubochi, Kei; Shinohara, Mitsuyo; Matsumura, Hideo

    2016-01-01

    This study evaluated shear bond strengths of a layering indirect composite material to a zirconia framework material treated with tribochemical silica coating. Zirconia disks were divided into two groups: ZR-PRE (airborne-particle abrasion) and ZR-PLU (tribochemical silica coating). Indirect composite was bonded to zirconia treated with one of the following primers: Clearfil Ceramic Primer (CCP), Clearfil Mega Bond Primer with Clearfil Porcelain Bond Activator (MGP+Act), ESPE-Sil (SIL), Estenia Opaque Primer, MR. Bond, Super-Bond PZ Primer Liquid A with Liquid B (PZA+PZB), and Super-Bond PZ Primer Liquid B (PZB), or no treatment. Shear bond testing was performed at 0 and 20,000 thermocycles. Post-thermocycling shear bond strengths of ZR-PLU were higher than those of ZR-PRE in CCP, MGP+Act, SIL, PZA+PZB, and PZB groups. Application of silane yielded better durable bond strengths of a layering indirect composite material to a tribochemically silica-coated zirconia framework material.

  15. Do we need primer for orthodontic bonding? A randomized controlled trial.

    PubMed

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P < 0.0001). As the study was only performed by one operator, the results can therefore only be truly be applied to their practice. Also this study was powered to ascertain if there was no difference between the 2 groups up to 5%, however orthodontists may consider a change in the bracket failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown statistically to be non-inferior to bonding with primer (P =0.08). There was no significant difference in bond-up times. Bond failure was more likely to happen at the composite-enamel interface when bonded without a primer. No conflict of interest for all authors. No funding sources were used. Study was not registered on external databases. © The Author 2014. Published by Oxford University Press on behalf of the European Orthodontic Society. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Optimization of nested polymerase chain reaction assays for identification of Aeromonas salmonicida, Yersinia ruckeri and Flavobacterium psychrophilum

    USGS Publications Warehouse

    Taylor, P.W.; Winton, J.R.

    2002-01-01

    Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.

  17. Innovations in bonding to zirconia-based materials. Part II: Focusing on chemical interactions.

    PubMed

    Aboushelib, Moustafa N; Mirmohamadi, Hesam; Matinlinna, Jukka P; Kukk, Edwin; Ounsi, Hani F; Salameh, Ziad

    2009-08-01

    The zirconia-resin bond strength was enhanced using novel engineered zirconia primers in combination with selective infiltration etching as a surface pre-treatment. The aim of this study was to evaluate the effect of artificial aging on the chemical stability of the established bond and to understand the activation mechanism of the used primers. Selective infiltration etched zirconia discs (Procera; NobelBiocare) were coated with one of four novel engineered zirconia primers containing reactive monomers and were bonded to resin-composite discs (Panavia F2.0). Fourier transform infrared spectroscopy (FT-IR) was carried out to examine the chemical activation of zirconia primers from mixing time and up to 60min. The bilayered specimens were cut into microbars (1mm(2) in cross-section area) and zirconia-resin microtensile bond strength (MTBS) was evaluated immediately and after 90 days of water storage at 37 degrees C. Scanning electron microscopy (SEM) was used to analyze the fracture surface. There was a significant drop in MTBS values after 90 days of water storage for all tested zirconia primers from ca. 28-41MPa to ca. 15-18MPa after completion of artificial aging. SEM revealed increase in percentage of interfacial failure after water storage. FTIR spectra suggested adequate activation of the experimental zirconia primers within 1h of mixing time. The novel engineered zirconia primers produced initially high bond strength values which were significantly reduced after water storage. Long-term bond stability requires developing more stable primers.

  18. PD5: a general purpose library for primer design software.

    PubMed

    Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.

  19. Shop primer as part of the corrosion protective coating for submerged steel structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bjordal, M.; Steinsmo, U.

    In Norwegian workshops the standard pre-treatment procedures for steel structures intended for sub-sea use, normally include removal of shop primer by blast cleaning to Sa 2 1/2 before application of corrosion protective coatings. This is also stated in the Norwegian offshore standard NORSOK. Omitting this stage in fabrication will represent large reductions in both time consumption and costs, and reduce the volume of waste from the blast cleaning. This report presents results from investigations of how a shop primer will influence on the coating properties. The aim of the investigation was to test whether the systems are good enough ifmore » the shop primer is left on the surface. Two different zinc silicate shop primers have been included in the investigation. As protective coatings the authors have used three different epoxy mastic systems with Al pigments. In addition to panels with original shop primer, they have also tested shop primed panels pre-treated in various ways, such as heated, corroded and blast cleaned to various degrees before coating. The coatings have been tested in the ASTM-G8 121 test and in a long term test in sea water polarized with a Zn anode. They have found that coatings including the zinc silicate shop primer are more susceptible to cathodic disbonding than the coating applied directly on blast cleaned steel. It is however possible to meet the NORSOK criteria with a zinc silicate shop primer as first coat.« less

  20. Inmetro - Instituto Nacional de Metrologia, Qualidade e Tecnologia

    Science.gov Websites

    Consumidor Laboratórios Legislação Comunicação Social Programa de Monitoramento BPL Produtos analisados de selos Indique! Sugestão para o Programa de Análise de Produtos Licitações Material de Portal do Governo Brasileiro mdic Carta de Serviços Inmetro nos Estados Acre Alagoas AmapÃ

  1. Building Trust and Capacity: Disarmament, Demobilization, and Reintegration to Transition Pro-Government Non-State Armed Groups

    DTIC Science & Technology

    2009-05-11

    de Pau. “Cambodia.” Escola de Cultura de Pau, http://www.escolapau.org/img/ programas /desarme/mapa/camboyai.pdf (accessed March 20, 2009). 69...Escola de Cultura de Pau. “Eritrea.” Escola de Cultura de Pau, http://www.escolapau.org/img/ programas /desarme/mapa/eritreai.pdf (accessed March 20...government authorized the formation and support of “rondas” or Comites de auto defensa (Committees of Self Defense) as the government fought the

  2. The International Symposium on Equatorial Aeronomy (10th) Held in Antalya, Turkey on May 17-23, 2000

    DTIC Science & Technology

    2000-10-23

    Paulo - FAPESP, and the Programa de Nicleos de Excelencia - PRONEX. Nu- merical values for the model tides were taken from the GSWM homepage at http...FAPESP, and the Programa de Nilcleos de Excel~ncia-PRONEX. References Batista, P. P., B. R. Clemesha, I. S. Batista and D. M. Simonich, Characteristics...based on M. J. Taylor, H. Takahashi, D. Gobbi, and A. Chemical and Dynamical Processes, Tarun Kumar F. de Medeiros. Pant and R. SRIDHARAN. 13. 17:30-17

  3. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  4. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  5. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  6. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  7. 40 CFR 63.3120 - What reports must I submit?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... deviation. (8) Deviations: separate electrodeposition primer bake oven capture and control limitations. If you used the separate electrodeposition primer bake oven capture and control limitations in § 63.3092... dates of each month during which there was a deviation from the separate electrodeposition primer bake...

  8. Fungal diversity in oil palm leaves showing symptoms of Fatal Yellowing disease

    PubMed Central

    de Assis Costa, Ohana Yonara; Tupinambá, Daiva Domenech; Bergmann, Jessica Carvalho; Barreto, Cristine Chaves

    2018-01-01

    Oil palm (Elaeis guineensis Jacq.) is an excellent source of vegetable oil for biodiesel production; however, there are still some limitations for its cultivation in Brazil such as Fatal Yellowing (FY) disease. FY has been studied for many years, but its causal agent has never been determined. In Colombia and nearby countries, it was reported that the causal agent of Fatal Yellowing (Pudrición del Cogollo) is the oomycete Phytophthora palmivora, however, several authors claim that Fatal Yellowing and Pudrición del Cogollo (PC) are different diseases. The major aims of this work were to test, using molecular biology tools, Brazilian oil palm trees for the co-occurrence of the oomycete Phytophthora and FY symptoms, and to characterize the fungal diversity in FY diseased and healthy leaves by next generation sequencing. Investigation with specific primers for the genus Phytophthora showed amplification in only one of the samples. Analysis of the fungal ITS region demonstrated that, at the genus level, different groups predominated in all symptomatic samples, while Pyrenochaetopsis and unclassified fungi predominated in all asymptomatic samples. Our results show that fungal communities were not the same between samples at the same stage of the disease or among all the symptomatic samples. This is the first study that describes the evolution of the microbial community in the course of plant disease and also the first work to use high throughput next generation sequencing to evaluate the fungal community associated with leaves of oil palm trees with and without symptoms of FY. PMID:29370299

  9. Lekking behavior of Anastrepha Fraterculus (Diptera: Tephritidae)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Segura, D.; Petit-Marty, N.; Cladera, J.

    Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) displays a lek mating system. Males form groups in which they simultaneously display signals (acoustical, visual, or chemical) to attract females with the purpose of mating. Females visit the lek and choose among signaling and courting males to mate. Scarce information is available in A. fraterculus about the main factors involved in female choice and the behavior of displaying males. This information could be important within the context of pest control programs with a sterile insect technique (SIT) component, because departures from normal sexual behavior caused by artificial rearing could affect males' performance in themore » field. In this study we assessed A. fraterculus male behavior within the leks and analyzed the importance of behavioral and morphological traits on their copulatory success. The existence of preferred places for lek formation was evaluated in field cages with trees inside and analyzed by dividing the trees in sectors according to a 3-dimensional system. Males were individually weighed, marked, and observed every 15 min. Morphometric and behavioral characteristics of successful and unsuccessful males were compared. Most successful males grouped in a region of the tree characterized by the highest light intensity in the first 2 h of the morning. Results showed that pheromone calling activity is positively associated with copulatory success. Copulations were more frequent for males calling inside the lek, indicating that pheromone calling activity and presence in the lek are key factors for copulatory success. A positive association between copulatory success and eye length was found; some characteristics of the face were also associated with copula duration and latency. (author) [Spanish] Anastrepha fraterculus (Wiedemann) (Diptera: Tephritidae) presenta un sistema de apareamiento tipo lek. Los machos forman grupos y, en forma conjunta, emiten senales (acusticas, visuales, o quimicas) para atraer a las hembras con el proposito de aparearse. Las hembras visitan el lek y eligen entre los machos para copular. La informacion acerca de los principales factores involucrados en la eleccion de la hembra y de la influencia del comportamiento de los machos en los leks en esta eleccion es escasa para A. fraterculus . Esta informacion es importante en el contexto de programas de control que incluyen la Tecnica del Insecto Esteril. En el presente estudio se evaluo el comportamiento sexual de machos de A. fraterculus dentro de los leks, y la asociacion de su comportamiento y de rasgos morfometricos con el exito copulatorio. El lugar preferido de agrupamiento de los machos fue evaluado en jaulas de campo con arboles en su interior y dividiendo el arbol en sectores de acuerdo a un sistema de tres dimensiones. Los machos fueron individualmente pesados, marcados y observados cada quince minutos. Luego de finalizado el ensayo se midieron los rasgos morfometricos. El mayor exito correspondio a machos agrupados en una region del arbol caracterizada por tener la mayor intensidad de luz en las dos primeras horas de la manana. Los resultados mostraron que la actividad de llamado con feromonas esta asociada con el exito copulatorio. Las copulas fueron mas frecuentes para machos que llamaron dentro del lek, indicando que la actividad de llamado con feromonas y la presencia dentro del lek son factores importantes en la obtencion de la copula. Los analisis morfometricos revelaron una asociacion positiva entre el exito copulatorio y el largo del ojo, y que algunas caracteristicas de la cara estan asociadas ademas con la duracion de la copula y la latencia. (author)« less

  10. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes

    EPA Science Inventory

    EPA recently released a primer that provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entiti...

  11. A Primer on Sampling for Statewide Assessment.

    ERIC Educational Resources Information Center

    Jaeger, Richard M.

    This paper is a primer on sampling procedures for statewide assessment. The careful reader should gain substantial knowledge about the promises and pitfalls of sampling for assessment. The primer has three basic objectives: (1) to define terms and concepts basic to sampling theory and its application, including population, sampling unit, sampling…

  12. GSP: A web-based platform for designing genome-specific primers in polyploids

    USDA-ARS?s Scientific Manuscript database

    The sequences among subgenomes in a polyploid species have high similarity. This makes difficult to design genome-specific primers for sequence analysis. We present a web-based platform named GSP for designing genome-specific primers to distinguish subgenome sequences in the polyploid genome backgr...

  13. 30 CFR 57.6304 - Primer protection.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  14. PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S. N.

    2013-08-08

    Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.

  15. Development of acceptance criteria for batches of silane primer for external tank thermal protection system bonding applications

    NASA Technical Reports Server (NTRS)

    Mikes, F.

    1985-01-01

    Fourier transform infrared spectroscopy is currently the best technique for observing hydrolytic changes in DC 1200 silane the primers caused by moisture in the atmosphere. To further prove that FTIR can be used as a criterion test for acceptance of silane primer lots, intensities of the FTIR OH- band are being compared with primer adhesive bond strength using a mechanical test suggested by NASA. Results of tests for shear strength and Oh-absorption are tabulated and compared with FTIR absorption intensities in the OH-region.

  16. Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿

    PubMed Central

    Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.

    2006-01-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755

  17. The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription

    PubMed Central

    Atwood-Moore, Angela; Yan, Kenneth; Judson, Robert L.; Levin, Henry L.

    2006-01-01

    The long terminal repeat retrotransposon Tf1 of Schizosaccharomyces pombe uses a unique mechanism of self priming to initiate reverse transcription. Instead of using a tRNA, Tf1 primes minus-strand synthesis with an 11-nucleotide RNA removed from the 5′ end of its own transcript. We tested whether the self primer of Tf1 was similar to tRNA primers in being removed from the cDNA by RNase H. Our analysis of Tf1 cDNA extracted from virus-like particles revealed the surprising observation that the dominant species of cDNA retained the self primer. This suggests that integration of the cDNA relies on mechanisms other than reverse transcription to remove the primer. PMID:16873283

  18. Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.

    PubMed

    Roque, H D; Vieira, R; Rato, S; Luz-Martins, M

    2006-12-01

    This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.

  19. Application of microsatellite primers developed for Polistes in the independent-founding wasp Polists satan Bequaert (Hymenoptera: Vespidae).

    PubMed

    Komatsu, K; Mateus, S; Zucchi, R; Nascimento, F; Kudô, K

    2012-06-01

    Microsatellite primers developed for a given species are sometimes useful for another in the same genus and in other genera within the same family, making possible to search for pre-existing suitable primers in the databanks such as GenBank. We examined whether existing primers developed for Polistes could be used for Polistes satan Bequaert. We tested 50 microsatellite primers from three Polistes species and found that six microsatellite loci show polymorphism in size in P. satan. These six loci were highly polymorphic, having four to 15 alleles in P. satan with an expected heterozygosity of 0.525-0.832. These loci can be used to study parameters concerning genetic relatedness such as social interactions in colonies and genetic conflicts of interest among nestmate individuals.

  20. Multiplexing Short Primers for Viral Family PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gardner, S N; Hiddessen, A L; Hara, C A

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

  1. A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms

    PubMed Central

    Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.

    2003-01-01

    A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708

  2. swga: a primer design toolkit for selective whole genome amplification.

    PubMed

    Clarke, Erik L; Sundararaman, Sesh A; Seifert, Stephanie N; Bushman, Frederic D; Hahn, Beatrice H; Brisson, Dustin

    2017-07-15

    Population genomic analyses are often hindered by difficulties in obtaining sufficient numbers of genomes for analysis by DNA sequencing. Selective whole-genome amplification (SWGA) provides an efficient approach to amplify microbial genomes from complex backgrounds for sequence acquisition. However, the process of designing sets of primers for this method has many degrees of freedom and would benefit from an automated process to evaluate the vast number of potential primer sets. Here, we present swga , a program that identifies primer sets for SWGA and evaluates them for efficiency and selectivity. We used swga to design and test primer sets for the selective amplification of Wolbachia pipientis genomic DNA from infected Drosophila melanogaster and Mycobacterium tuberculosis from human blood. We identify primer sets that successfully amplify each against their backgrounds and describe a general method for using swga for arbitrary targets. In addition, we describe characteristics of primer sets that correlate with successful amplification, and present guidelines for implementation of SWGA to detect new targets. Source code and documentation are freely available on https://www.github.com/eclarke/swga . The program is implemented in Python and C and licensed under the GNU Public License. ecl@mail.med.upenn.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  3. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    PubMed

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  4. Assessment of primer/template mismatch effects on real-time PCR amplification of target taxa for GMO quantification.

    PubMed

    Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc

    2009-10-28

    GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.

  5. Molecular Tools for the Detection of Nitrogen Cycling Archaea

    PubMed Central

    Rusch, Antje

    2013-01-01

    Archaea are widespread in extreme and temperate environments, and cultured representatives cover a broad spectrum of metabolic capacities, which sets them up for potentially major roles in the biogeochemistry of their ecosystems. The detection, characterization, and quantification of archaeal functions in mixed communities require Archaea-specific primers or probes for the corresponding metabolic genes. Five pairs of degenerate primers were designed to target archaeal genes encoding key enzymes of nitrogen cycling: nitrite reductases NirA and NirB, nitrous oxide reductase (NosZ), nitrogenase reductase (NifH), and nitrate reductases NapA/NarG. Sensitivity towards their archaeal target gene, phylogenetic specificity, and gene specificity were evaluated in silico and in vitro. Owing to their moderate sensitivity/coverage, the novel nirB-targeted primers are suitable for pure culture studies only. The nirA-targeted primers showed sufficient sensitivity and phylogenetic specificity, but poor gene specificity. The primers designed for amplification of archaeal nosZ performed well in all 3 criteria; their discrimination against bacterial homologs appears to be weakened when Archaea are strongly outnumbered by bacteria in a mixed community. The novel nifH-targeted primers showed high sensitivity and gene specificity, but failed to discriminate against bacterial homologs. Despite limitations, 4 of the new primer pairs are suitable tools in several molecular methods applied in archaeal ecology. PMID:23365509

  6. Comparison of the antibacterial activity of different self-etching primers and adhesives.

    PubMed

    Korkmaz, Yonca; Ozalp, Meral; Attar, Nuray

    2008-11-01

    The aim of this study was to evaluate the antibacterial effects of different one-step and two-step self-etching primer/adhesives on Streptococcus mutans (S. mutans), Lactobacillus casei (L. casei), and Lactobacillus acidophilus (L. acidophilus). The antibacterial effects of Clearfil Protect Bond Primer and Bonding agent; AdheSE Primer and Bonding agent; Adper Prompt L-Pop; Futurabond NR; Clearfil Tri S Bond; and Cervitec (positive control, 1% chlorhexidine varnish) were tested against standard strains of S. mutans, L. Casei, and L. acidophilus using the disk diffusion method. Standard filter paper disks (n=5) impregnated with 20 microL of each material were prepared. After incubation at 37 masculineC for 48 hours in a 5-10% CO2 atmosphere, the diameter of inhibition zones were measured in millimeters. Data were analyzed using one way analysis of variance (ANOVA) and multivariate analysis of variance (MANOVA). Duncan's Multiple Range Test was used for pairwise comparison. The size of inhibition zones produced by primer/adhesives varied among the brands. AdheSE Primer: S. mutans (20.6+/-1.51); L. casei (14.8+/-1.78); L. acidophilus (11.4+/-0.54). Adper Prompt L-Pop: S. mutans (19.6+/-1.51); L. casei (13.8+/-1.64); L. acidophilus (13.8+/-1.09). Cervitec: S. mutans (23+/-0.00); L. casei (27+/-0.70); L. acidophilus (22.4+/-0.54). Clearfil Protect Bond Primer: S. mutans (17+/-0.00); L. casei (17.6+/-0.54); L. acidophilus (22.4+/-0.54). Futurabond NR was found effective only against S. mutans (14.6+/-1.67). Of all the materials tested, AdheSE Bonding agent, Clearfil Protect Bond Bonding agent, and Clearfil Tri S Bond exhibited no inhibition zone (-) for all bacteria tested. Among the adhesives tested Clearafil Protect Bond Primer based upon monomer methacryloyloxydodecylpyridiniium bromide (MDPB) was found to be the most potent material against L. acidophilus and L. casei. AdheSE Primer and Adper Prompt L-Pop are highly effective against S. mutans. Compared with other adhesive systems, Clearfil Protect Bond Primer (containing MDPB) showed a high antibacterial effect against all microorganizms tested. Two-step, self-etching primer/adhesive system Clearfil Protect Bond might be a suitable choice under minimally invasive restorations. The recently developed one-step, self-etching system Clearfil Tri S Bond showed no antibacterial effect against microorgazims tested.

  7. Bonding to new CAD/CAM resin composites: influence of air abrasion and conditioning agents as pretreatment strategy.

    PubMed

    Reymus, Marcel; Roos, Malgorzata; Eichberger, Marlis; Edelhoff, Daniel; Hickel, Reinhard; Stawarczyk, Bogna

    2018-04-27

    Because of their industrially standardized process of manufacturing, CAD/CAM resin composites show a high degree of conversion, making a reliable bond difficult to achieve. The purpose of this experiment was to investigate the tensile bond strength (TBS) of luting composite to CAD/CAM resin composite materials as influenced by air abrasion and pretreatment strategies. The treatment factors of the present study were (1) brand of the CAD/CAM resin composite (Brilliant Crios [Coltene/Whaledent], Cerasmart [GC Europe], Shofu Block HC [Shofu], and Lava Ultimate [3M]); (2) air abrasion vs. no air abrasion; and (3) pretreatment using a silane primer (Clearfil Ceramic Primer, Kuraray) vs. a resin primer (One Coat 7 Universal, Coltene/Whaledent). Subsequently, luting composite (DuoCem, Coltene/Whaledent) was polymerized onto the substrate surface using a mold. For each combination of the levels of the three treatment factors (4 (materials) × 2 (air abrasion vs. no air abrasion; resin) × 2 (primer vs. silane primer)), n = 15, specimens were prepared. After 24 h of water storage at 37 °C and 5000 thermo-cycles (5/55 °C), TBS was measured and failure types were examined. The resulting data was analyzed using Kaplan-Meier estimates of the cumulative failure distribution function with Breslow-Gehan tests and non-parametric ANOVA (Kruskal-Wallis test) followed by the multiple pairwise Mann-Whitney U test with α-error adjustment using the Benjamini-Hochberg procedure and chi-square test (p < 0.05). The additional air abrasion step increased TBS values and lowered failure rates. Specimens pretreated using a resin primer showed significantly higher TBS and lower failure rates than those pretreated using a silane primer. The highest failure rates were observed for groups pretreated with a silane primer. Within the Shofu Block HC group, all specimens without air abrasion and pretreatment with a silane primer debonded during the aging procedure. Before fixation of CAD/CAM resin composites, the restorations should be air abraded and pretreated using a resin primer containing methyl-methacrylate to successfully bond to the luting composite. The pretreatment of the CAD/CAM resin composite using merely a silane primer results in deficient adhesion. For a reliable bond of CAD/CAM resin composites to the luting composite, air abrasion and a special pretreatment strategy are necessary in order to achieve promising long-term results.

  8. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bowman, Stephen M

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VImore » in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of using SCALE/KENO-VI for criticality analyses; the SCALE/KENO-VI manual provides information on the use of SCALE/KENO-VI and all its modules. The primer also contains an appendix with sample input files.« less

  9. Divulgación del Programa Consolider-GTC

    NASA Astrophysics Data System (ADS)

    Ruiz Zelmanovitch, N.; Mass Hesse, M.; Alfaro, E.

    2013-05-01

    The Gran Telescopio Canarias (GTC) is the biggest telescope of its class in the world. The CONSOLIDER INGENIO 2010-GTC project, First Science with the GTC: Spanish Astron- omy on the Forefront of the European Astronomy, funded by the Spanish Ministry of Science and Innovation, MICINN (now the Ministry of Economy and competitiveness, MINECO) has used the GTC to: (i) obtain leading science with its data, (ii) increase the involvement of the Spanish astronomical community in developing astronomical instrumentation, (iii) get an important Spanish participation in the new extremely large telescopes generation (ELTs), and (iv) make outreach and communicating to the society the main results. The project CONSOLIDER INGENIO 2010-GTC is structured and defined by objectives: 1) GTC: To optimize the GTC and its instruments; 2) SCIENCE: To develop leading science with the GTC; 3) E-ELT: To take advantage of the technological experience obtained with the GTC for the new generation of giant telescopes; 4) INSTRUMENTATION: To promote the Spanish participation in the new instrument developments for the GTC, VLT and the future ELTs; 5) EDUCATION: International School for Advanced Instrumentation (IScAI); and 6) OUTREACH: Outreach and communication of the project scientific results. This poster resumes five years of science communication around the Consolider-GTC project.

  10. Thermodynamically balanced inside-out (TBIO) PCR-based gene synthesis: a novel method of primer design for high-fidelity assembly of longer gene sequences

    PubMed Central

    Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.

    2003-01-01

    A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936

  11. Safe surgery: validation of pre and postoperative checklists.

    PubMed

    Alpendre, Francine Taporosky; Cruz, Elaine Drehmer de Almeida; Dyniewicz, Ana Maria; Mantovani, Maria de Fátima; Silva, Ana Elisa Bauer de Camargo E; Santos, Gabriela de Souza Dos

    2017-07-10

    to develop, evaluate and validate a surgical safety checklist for patients in the pre and postoperative periods in surgical hospitalization units. methodological research carried out in a large public teaching hospital in the South of Brazil, with application of the principles of the Safe Surgery Saves Lives Programme of the World Health Organization. The checklist was applied to 16 nurses of 8 surgical units and submitted for validation by a group of eight experts using the Delphi method online. the instrument was validated and it was achieved a mean score ≥1, level of agreement ≥75% and Cronbach's alpha >0.90. The final version included 97 safety indicators organized into six categories: identification, preoperative, immediate postoperative, immediate postoperative, other surgical complications, and hospital discharge. the Surgical Safety Checklist in the Pre and Postoperative periods is another strategy to promote patient safety, as it allows the monitoring of predictive signs and symptoms of surgical complications and the early detection of adverse events. elaborar, avaliar e validar um checklist de segurança cirúrgica para os períodos pré e pós-operatório de unidades de internação cirúrgica. pesquisa metodológica, realizada em hospital de ensino público de grande porte do Sul do Brasil, com aplicação dos fundamentos do Programa Cirurgias Seguras Salvam Vidas da Organização Mundial da Saúde. O checklist foi aplicado a 16 enfermeiros de oito unidades cirúrgicas, e submetido à validação por meio da técnica Delphi on-line com oito especialistas. o instrumento foi validado, obtendo-se ranking médio ≥1, grau de concordância ≥75% e Alfa de Cronbach >0,90. A versão final contemplou 97 indicadores de segurança organizados em seis categorias: identificação, pré-operatório, pós-operatório imediato, pós-operatório mediato, outras complicações cirúrgicas, e alta hospitalar. o Checklist de Segurança Cirúrgica Pré e Pós-Operatório é mais uma estratégia na promoção da segurança do paciente, pois possibilita monitorar sinais e sintomas preditivos de complicações cirúrgicas e detecção precoce de eventos adversos. desarrollar, evaluar y validar un checklist de seguridad quirúrgica para los períodos pre y postoperatorio de unidades de hospitalización quirúrgica.. investigación metodológica llevada a cabo en un amplio hospital público de enseñanza del Sur de Brasil, con aplicación de los principios del Programa de Cirugía Segura Salva Vidas de la Organización Mundial de la Salud. El checklist se aplicó a 16 enfermeros de 8 unidades quirúrgicas y fue sometida a validación por ocho expertos utilizando el método Delphi en línea. el instrumento fue validado y se logró una puntuación media ≥1, grado de acuerdo ≥75% y alfa de Cronbach >0.90. La versión final incluyó 97 indicadores de seguridad organizados en seis categorías: identificación, preoperatorio, postoperatorio inmediato, postoperatorio inmediato, otras complicaciones quirúrgicas y alta hospitalaria. el Checklist de Seguridad Quirúrgica en el Período Pre y Postoperatorio es otra estrategia más para promover la seguridad del paciente, ya que permite monitorear los signos y síntomas predictivos de las complicaciones quirúrgicas y la detección temprana de eventos adversos.

  12. Factors associated with young adults' knowledge regarding family history of Stroke.

    PubMed

    Lima, Maria Jose Melo Ramos; Moreira, Thereza Maria Magalhães; Florêncio, Raquel Sampaio; Braga, Predro

    2016-11-21

    to analyze the factors associated with young adults' knowledge regarding family history of stroke. an analytical transversal study, with 579 young adults from state schools, with collection of sociodemographic, clinical and risk factor-related variables, analyzed using logistic regression (backward elimination). a statistical association was detected between age, civil status, and classification of arterial blood pressure and abdominal circumference with knowledge of family history of stroke. In the final logistic regression model, a statistical association was observed between knowledge regarding family history of stroke and the civil status of having a partner (ORa=1.61[1.07-2.42]; p=0.023), abdominal circumference (ORa=0.98[0.96-0.99]; p=0.012) and normal arterial blood pressure (ORa=2.56[1.19-5.52]; p=0.016). an association was observed between socioeconomic factors and risk factors for stroke and knowledge of family history of stroke, suggesting the need for health education or even educational programs on this topic for the clientele in question. analisar os fatores associados ao conhecimento dos adultos jovens sobre histórico familiar de Acidente Vascular Cerebral (AVC). estudo transversal analítico, com 579 adultos jovens de escolas públicas, com coleta de variáveis sociodemográficas, clínicas e de fatores de risco em formulário, analisados utilizando-se regressão logística (backward elimination). detectou-se associação estatística de idade, situação conjugal, classificação da pressão arterial e circunferência abdominal com conhecimento do histórico familiar de AVC. No modelo final de regressão logística, observou-se associação estatística do conhecimento sobre histórico familiar de AVC com situação conjugal com companheiro (ORa=1,61[1,07-2,42]; p=0,023), circunferência abdominal (ORa=0,98[0,96-0,99]; p=0,012) e pressão arterial normal (ORa=2,56[1,19-5,52]; p=0,016). foi constatada associação de fatores socioeconômicos e de risco para AVC com o conhecimento do histórico familiar de AVC, sugerindo a necessidade de educação em saúde ou mesmo de programas educacionais sobre o tema junto à clientela em estudo. analizar los factores asociados al conocimiento de los adultos jóvenes sobre el histórico familiar de Accidente Vascular Cerebral (AVC). estudio transversal analítico en 579 adultos jóvenes de escuelas públicas, con recolección de variables sociodemográficas, clínicas y de factores de riesgo en formulario, los datos fueron analizados utilizando la regresión logística (backward elimination). se detectó asociación estadística de edad, situación conyugal, clasificación de la presión arterial y circunferencia abdominal con el conocimiento del histórico familiar de AVC. En el modelo final de regresión logística, se observó una asociación estadística del conocimiento sobre el histórico familiar de AVC con: situación conyugal con compañero (ORa=1,61[1,07-2,42] p=0,023); circunferencia abdominal (ORa=0,98[0,96-0,99] p=0,012); y presión arterial normal (ORa=2,56[1,19-5,52] p=0,016). fue constatada asociación de factores socioeconómicos y de riesgo para AVC con el conocimiento del histórico familiar de AVC; se sugiere la necesidad de realizar acciones de educación en salud o inclusive de preparar programas educacionales sobre el tema para la población estudiada.

  13. Primer for identifying cold-water refuges to protect and restore thermal diversity in riverine landscapes - EPA 910-C-12-001

    EPA Science Inventory

    This primer provides guidance to Region 10 Tribes, States, and local watershed community groups to support the identification, protection, and restoration of critical cold water refuges for the protection of salmonids. This primer will assist these entities in implementing the E...

  14. Charter School Primer. Peter Lang Primer. Volume 34

    ERIC Educational Resources Information Center

    Tryjankowski, Anne Marie

    2012-01-01

    The "Charter School Primer" presents an overview of public charter schools in the United States. The book discusses what charter schools are; the history of public charter school choice in the United States; the role of teachers, parents, boards, and unions in the charter school movement; and gives examples of innovations in education made…

  15. Reading Assessment: A Primer for Teachers and Tutors.

    ERIC Educational Resources Information Center

    Caldwell, JoAnne Schudt

    This primer provides the basic information that teachers and tutors need to get started on the complex process of reading assessment. Designed for maximum utility in today's standards-driven classroom, the primer presents simple, practical assessment strategies that are based on theory and research. It takes teachers step by step through learning…

  16. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    USDA-ARS?s Scientific Manuscript database

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  17. 40 CFR 63.3091 - What emission limits must I meet for an existing affected source?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... bonding primer, and glass bonding adhesive operations plus all coatings and thinners, except for deadener materials and for adhesive and sealer materials that are not components of glass bonding systems, used in... from primer-surfacer, topcoat, final repair, glass bonding primer, and glass bonding adhesive...

  18. Murrinh Nganki (Our Language), 1.

    ERIC Educational Resources Information Center

    Street, Chester; And Others

    This primer is the first in a series of four trial primers intended to teach the speakers of the Murrinh-patha language to read and write in their mother tongue. The approach and method of this primer is eclectic, based on principles developed by Dr. Sarah Gudschinsky. It has been designed to teach the vowels…

  19. A Primer on Brain Imaging in Developmental Psychopathology: What Is It Good For?

    ERIC Educational Resources Information Center

    Pine, Daniel S.

    2006-01-01

    This primer introduces a Special Section on brain imaging, which includes a commentary and 10 data papers presenting applications of brain imaging to questions on developmental psychopathology. This primer serves two purposes. First, the article summarizes the strength and weaknesses of various brain-imaging techniques typically employed in…

  20. Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.

    PubMed

    Robertson, Amber L; Phillips, Allison R

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.

  1. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    PubMed Central

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  2. Real-time PCR (qPCR) primer design using free online software.

    PubMed

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  3. Identification of cultivars and validation of genetic relationships in Mangifera indica L. using RAPD markers.

    PubMed

    Schnell, R J; Ronning, C M; Knight, R J

    1995-02-01

    Twenty-five accessions of mango were examined for random amplified polymorphic DNA (RAPD) genetic markers with 80 10-mer random primers. Of the 80 primers screened, 33 did not amplify, 19 were monomorphic, and 28 gave reproducible, polymorphic DNA amplification patterns. Eleven primers were selected from the 28 for the study. The number of bands generated was primer- and genotype-dependent, and ranged from 1 to 10. No primer gave unique banding patterns for each of the 25 accessions; however, ten different combinations of 2 primer banding patterns produced unique fingerprints for each accession. A maternal half-sib (MHS) family was included among the 25 accessions to see if genetic relationships could be detected. RAPD data were used to generate simple matching coefficients, which were analyzed phenetically and by means of principal coordinate analysis (PCA). The MHS clustered together in both the phenetic and the PCA while the randomly selected accessions were scattered with no apparent pattern. The uses of RAPD analysis for Mangifera germ plasm classification and clonal identification are discussed.

  4. Molecular Properties of Poliovirus Isolates: Nucleotide Sequence Analysis, Typing by PCR and Real-Time RT-PCR.

    PubMed

    Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M

    2016-01-01

    Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.

  5. Novel Primer Sets for Next Generation Sequencing-Based Analyses of Water Quality

    PubMed Central

    Lee, Elvina; Khurana, Maninder S.; Whiteley, Andrew S.; Monis, Paul T.; Bath, Andrew; Gordon, Cameron; Ryan, Una M.; Paparini, Andrea

    2017-01-01

    Next generation sequencing (NGS) has rapidly become an invaluable tool for the detection, identification and relative quantification of environmental microorganisms. Here, we demonstrate two new 16S rDNA primer sets, which are compatible with NGS approaches and are primarily for use in water quality studies. Compared to 16S rRNA gene based universal primers, in silico and experimental analyses demonstrated that the new primers showed increased specificity for the Cyanobacteria and Proteobacteria phyla, allowing increased sensitivity for the detection, identification and relative quantification of toxic bloom-forming microalgae, microbial water quality bioindicators and common pathogens. Significantly, Cyanobacterial and Proteobacterial sequences accounted for ca. 95% of all sequences obtained within NGS runs (when compared to ca. 50% with standard universal NGS primers), providing higher sensitivity and greater phylogenetic resolution of key water quality microbial groups. The increased selectivity of the new primers allow the parallel sequencing of more samples through reduced sequence retrieval levels required to detect target groups, potentially reducing NGS costs by 50% but still guaranteeing optimal coverage and species discrimination. PMID:28118368

  6. Rapid identification of red-flesh loquat cultivars using EST-SSR markers based on manual cultivar identification diagram strategy.

    PubMed

    Li, X Y; Xu, H X; Chen, J W

    2014-04-29

    Manual cultivar identification diagram is a new strategy for plant cultivar identification based on DNA markers, providing information to efficiently separate cultivars. We tested 25 pairs of apple EST-SSR primers for amplification of PCR products from loquat cultivars. These EST-SSR primers provided clear amplification products from the loquat cultivars, with a relatively high transferability rate of 84% to loquat; 11 pairs of primers amplified polymorphic products. After analysis of 24 red-fleshed loquat accessions, we found that only 7 pairs of primers could clearly separate all of them. A cultivar identification diagram of the 24 cultivars was constructed using polymorphic bands from the DNA fingerprints and EST-SSR primers. Any two of the 24 cultivars could be rapidly separated from each other, according to the polymorphic bands from the cultivars; the corresponding primers were marked in the correct position on the cultivar identification diagram. This red-flesh loquat cultivar identification diagram can separate the 24 red-flesh loquat cultivars, which is of benefit for loquat cultivar identification for germplasm management and breeding programs.

  7. Primer sets for cloning the human repertoire of T cell Receptor Variable regions

    PubMed Central

    Boria, Ilenia; Cotella, Diego; Dianzani, Irma; Santoro, Claudio; Sblattero, Daniele

    2008-01-01

    Background Amplification and cloning of naïve T cell Receptor (TR) repertoires or antigen-specific TR is crucial to shape immune response and to develop immuno-based therapies. TR variable (V) regions are encoded by several genes that recombine during T cell development. The cloning of expressed genes as large diverse libraries from natural sources relies upon the availability of primers able to amplify as many V genes as possible. Results Here, we present a list of primers computationally designed on all functional TR V and J genes listed in the IMGT®, the ImMunoGeneTics information system®. The list consists of unambiguous or degenerate primers suitable to theoretically amplify and clone the entire TR repertoire. We show that it is possible to selectively amplify and clone expressed TR V genes in one single RT-PCR step and from as little as 1000 cells. Conclusion This new primer set will facilitate the creation of more diverse TR libraries than has been possible using currently available primer sets. PMID:18759974

  8. Effect of thione primers on adhesive bonding between an indirect composite material and Ag-Pd-Cu-Au alloy.

    PubMed

    Imai, Hideyuki; Koizumi, Hiroyasu; Shimoe, Saiji; Hirata, Isao; Matsumura, Hideo; Nikawa, Hiroki

    2014-01-01

    The current study evaluated the effect of primers on the shear bond strength of an indirect composite material joined to a silverpalladium-copper-gold (Ag-Pd-Cu-Au) alloy (Castwell). Disk specimens were cast from the alloy and were air-abraded with alumina. Eight metal primers were applied to the alloy surface. A light-polymerized indirect composite material (Solidex) was bonded to the alloy. Shear bond strength was determined both before and after the application of thermocycling. Two groups primed with Metaltite (thione) and M. L. Primer (sulfide) showed the greatest post-thermocycling bond strength (8.8 and 6.5 MPa). The results of the X-ray photoelectron spectroscopic (XPS) analysis suggested that the thione monomer (MTU-6) in the Metaltite primer was strongly adsorbed onto the Ag-Pd-Cu-Au alloy surface even after repeated cleaning with acetone. The application of either the thione (MTU-6) or sulfide primer is effective for enhancing the bonding between a composite material and Ag-Pd-Cu-Au alloy.

  9. Comparison of the Chromium Distribution in New Super Koropon Primer to 30 Year Old Super Koropon Using Focused Ion Beam/Scanning Electron Microscopy

    NASA Technical Reports Server (NTRS)

    Lomness, Janice K.; Calle, Luz Marina

    2006-01-01

    Super Koropon primer (MB0125-055) plays a significant role in the corrosion protection of areas throughout the Orbiter. Because the Shuttle Program relies so heavily upon the performance of the Koropon primer, it is necessary to fully understand all aspects of the behavior of the coating. One area where little understanding of the Koropon primer still exists is the level of risk associated with age related degradation. Recently, efforts were undertaken to better understand the age life of the Koropon primer and to gain some insight into the aging process of this coating. In that study, an aluminum access panel from the Orbiter Enterprise was used to investigate the performance of the old Koropon film. A control panel was also used to study the performance of new Koropon coating. Preliminary investigations into the performance of aged Super Koropon primer indicated a significant decrease in corrosion protection. This investigation serves as an example of how Focused Ion Beam/Scanning Microscopy can be used to characterize the changes that occur as coatings age.

  10. [Not Available].

    PubMed

    Giner, Manel; Culebras, Jesús M; Meguid, Michael M

    2016-03-01

    En agosto de 1976, un joven llamado LeRoy cayó desde una cornisa fracturándose el fémur. Se sospechó una hemorragia interna importante. Durante una laparotomía se comprobó que todos los órganos internos estaban intactos y los cirujanos ortopédicos arreglaron la fractura. Treintadías después, LeRoy murió. Había comido poco; diariamente, tan solo había recibido tres litros de la glucosa, el equivalente a 510 calorías, por vía intravenosa. La glucosa fue insuficiente para satisfacer sus necesidades nutricionales, perdiendo más del 20% de su peso corporaldurante su estancia en el hospital. La causa de la muerte se debió a "desnutrición médicamente inducida". Mientras tanto, un artículo científico documentó que la prevalencia de desnutrición en los hospitales de Boston era del 44% y que la desnutrición en sí era un predictor de altas tasas de complicaciones y muerte.Como resultado, los médicos sensibilizados formaron una sociedad que creó programas de formación y alentó la formación de equipos de nutrición en los hospitales. La industria comercializó fórmulas de nutrición y catéteres. Las complicaciones en enfermos hospitalizados cayeron en picado, mientras que las tasas de supervivencia aumentaron. California aprobó una legislación para regular el soporte nutricional. Aunque la industria de la atención sanitaria reconoce la importancia de la nutrición en los cuidados al paciente, el Congreso no proporcionó apoyo fiscal para los equipos de nutrición. Como resultado, los hospitales disolvieron sus equipos de nutrición de reciente creación. La educación y las habilidades en nutrición disminuyeron, y las complicaciones hospitalarias y las tasas de mortalidad aumentaron de nuevo.

  11. Comunicación de pareja y VIH en mujeres en desventaja social

    PubMed Central

    Rosina Cianelli, A.; Lilian Ferrer, L.; Margarita Bernales, S.; Natalia Villegas, R.

    2009-01-01

    Introducción La epidemia de VIH y SIDA se ha diseminado rápidamente a nivel mundial tendiendo a la feminización, pauperización y heterosexualización. La comunicación de pareja en torno el VIH es descrita como uno de los factores protectores en la adquisición de esta enfermedad, favoreciendo la adopción de conductas sexuales seguras tales como la negociación de pareja y la utilización de preservativo, consideróndose como un pilar fundamental en la incorporación de medidas de autocuidado en la sexualidad femenina. Objetivo Determinar el nivel de comunicación de pareja en torno al VIH en mujeres chilenas en desventaja social. Metodología Cuatrocientas noventa y seis mujeres contestaron la entrevista inicial de la investigación “Testing an HIV/AIDS Prevention Intervention for Chilean Women” (RO1 TW 006977 PI Cianelli). Se utilizó la escala “Health protective sexual communication scale (HPC)” (0–10 puntos). Se realizó un análisis descriptivo utilizando el programa SPSS 16.0. Resultados El promedio del nivel de comunicación de pareja fue de 3,26 ± 2,7 puntos con la pareja principal, de 2,52 ± 2,48 puntos con una segunda pareja y de 0 puntos con una tercera pareja. Los temas de menor comunicación entre las parejas fueron el uso de preservativo y la realización del test para VIH antes de tener relaciones sexuales. Conclusión Las mujeres de la muestra presentan bajos niveles de comunicación de pareja en relación a VIH con todas sus parejas sexuales. Son necesarias estrategias que potencien este tópico dentro de las intervenciones de prevención de VIH y SIDA de manera de fortalecer la adopción de conductas de autocuidado en torno al tema. PMID:19936328

  12. Use of tannin anticorrosive reaction primer to improve traditional coating systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matamala, G.; Droguett, G.; Smeltzer, W.

    1994-04-01

    Different anticorrosive schemes applied over plain or previously shot-blasted surfaces of AISI 1010 (UNS G10100) steel plates were compared. Plates were painted with alkydic, vinylic, and epoxy anticorrosive schemes over metal treated previously with pine tannin reaction primer and over its own schemes without previous primer treatment. Anticorrosive tests were conducted in a salt fog chamber according to ASTM B 117-73. Rusting, blistering, and adhesion were assessed over time. The survey was complemented with potentiodynamic scanning tests in sodium chloride (NaCl) solution with a concentration equivalent to seawater. Corrosion currents were determined using Tafel and polarization resistance techniques. Results showedmore » the reaction primer inhibited corrosion by improving adherence. Advantages over traditional conversion primers formulated in a base of zinc chromate in phosphoric medium were evident.« less

  13. The Choice of PCR Primers Has Great Impact on Assessments of Bacterial Community Diversity and Dynamics in a Wastewater Treatment Plant

    PubMed Central

    Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie

    2013-01-01

    Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498

  14. Evaluation of six primer pairs targeting the nuclear rRNA operon for characterization of arbuscular mycorrhizal fungal (AMF) communities using 454 pyrosequencing.

    PubMed

    Van Geel, Maarten; Busschaert, Pieter; Honnay, Olivier; Lievens, Bart

    2014-11-01

    In the last few years, 454 pyrosequencing-based analysis of arbuscular mycorrhizal fungal (AMF; Glomeromycota) communities has tremendously increased our knowledge of the distribution and diversity of AMF. Nonetheless, comparing results between different studies is difficult, as different target genes (or regions thereof) and primer combinations, with potentially dissimilar specificities and efficacies, are being utilized. In this study we evaluated six primer pairs that have previously been used in AMF studies (NS31-AM1, AMV4.5NF-AMDGR, AML1-AML2, NS31-AML2, FLR3-LSUmBr and Glo454-NDL22) for their use in 454 pyrosequencing based on both an in silico approach and 454 pyrosequencing of AMF communities from apple tree roots. Primers were evaluated in terms of (i) in silico coverage of Glomeromycota fungi, (ii) the number of high-quality sequences obtained, (iii) selectivity for AMF species, (iv) reproducibility and (v) ability to accurately describe AMF communities. We show that primer pairs AMV4.5NF-AMDGR, AML1-AML2 and NS31-AML2 outperformed the other tested primer pairs in terms of number of Glomeromycota reads (AMF specificity and coverage). Additionally, these primer pairs were found to have no or only few mismatches to AMF sequences and were able to consistently describe AMF communities from apple roots. However, whereas most high-quality AMF sequences were obtained for AMV4.5NF-AMDGR, our results also suggest that this primer pair favored amplification of Glomeraceae sequences at the expense of Ambisporaceae, Claroideoglomeraceae and Paraglomeraceae sequences. Furthermore, we demonstrate the complementary specificity of AMV4.5NF-AMDGR with AML1-AML2, and of AMV4.5NF-AMDGR with NS31-AML2, making these primer combinations highly suitable for tandem use in covering the diversity of AMF communities. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. DNA polymerase preference determines PCR priming efficiency.

    PubMed

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.

  16. A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.

    PubMed

    Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh

    2015-06-01

    Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.

  17. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    PubMed

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  18. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    PubMed

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  19. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  20. Effect of clearfil protect bond and transbond plus self-etch primer on shear bond strength of orthodontic brackets

    PubMed Central

    Raji, S. Hamid; Ghorbanipour, Reza; Majdzade, Fateme

    2011-01-01

    Background: The aim of this study was to evaluate the shear bond strength of an antimicrobial and fluoride-releasing self-etch primer (clearfil protect bond) and compare it with transbond plus self-etch primer and conventional acid etching and priming system. Materials and Methods: Forty-eight extracted human premolars were divided randomly to three groups. In group 1, the teeth were bonded with conventional acid etching and priming method. In group 2, the teeth were bonded with clearfil protect bond self-etch primer, and transbond plus self-etch primer was used to bond the teeth in group 3. The samples were stored in 37°C distilled water and thermocycled. Then, the SBS of the sample was evaluated with Zwick testing machine. Descriptive statistics and the analysis of variances (ANOVA) and Tukey's test and Kruskal-Wallis were used to analyze the data. Results: The results of the ANOVA showed that the mean of group 3 was significantly lower than that of other groups. Most of the sample showed a pattern of failure within the adhesive resin. Conclusion: The shear bond strength of clearfil protect bond and transbond plus self-etch primer was enough for bonding the orthodontic brackets. The mode of failure of bonded brackets with these two self-etch primers is safe for enamel. PMID:23372605

  1. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    ERIC Educational Resources Information Center

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  2. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    ERIC Educational Resources Information Center

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  3. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-03-12

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  4. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-01-04

    clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable water filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...DATES COVERED 00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c

  5. Protective Coats For Zinc-Rich Primers

    NASA Technical Reports Server (NTRS)

    Macdowell, Louis G, III

    1993-01-01

    Report describes tests of topcoats for inorganic zinc-rich primers on carbon steel. Topcoats intended to provide additional protection against corrosion in acidic, salty seacoast-air/rocket-engine-exhaust environment of Space Shuttle launch site. Tests focused on polyurethane topcoats on epoxy tie coats on primers. Part of study involved comparison between "high-build" coating materials and thin-film coating materials.

  6. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Treesearch

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  7. Newly developed primers for complete YCF1 amplification in Pinus (Pinaceae) chloroplasts with possible family-wide utility

    Treesearch

    Matthew Parks; Aaron Liston; Rich Cronn

    2011-01-01

    Primers were designed to amplify the highly variable locus ycf1 from all 11 subsections of Pinus to facilitate plastome assemblies based on short sequence reads as well as future phylogenetic and population genetic analyses. Primer design was based on alignment of 33 Pinus and four Pinaceae plastomes with...

  8. The Household Detective Primer: Protecting Your Children from Toxins in the Home. CHEC's Guide to Environmental Childproofing.

    ERIC Educational Resources Information Center

    Schubert, Sandra; Zelinsky, Benjamin

    Designed for parents, this primer presents information on threats to children's health that can be found in every American home, including disinfectants, art supplies, pesticides, and toxins in food and drinking water. The primer also provides practical information on safe and environmentally friendly household cleaners and disinfectants, outlines…

  9. Primer ID Validates Template Sampling Depth and Greatly Reduces the Error Rate of Next-Generation Sequencing of HIV-1 Genomic RNA Populations

    PubMed Central

    Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr

    2015-01-01

    ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299

  10. Effects of dual antibacterial agents MDPB and nano-silver in primer on microcosm biofilm, cytotoxicity and dentin bond properties

    PubMed Central

    Zhang, Ke; Cheng, Lei; Imazato, Satoshi; Antonucci, Joseph M.; Lin, Nancy J.; Lin-Gibson, Sheng; Bai, Yuxing; Xu, Hockin H. K.

    2013-01-01

    Objectives The objective of this study was to investigate the effects of dentin primer containing dual antibacterial agents, namely, 12-methacryloyloxydodecylpyridinium bromide (MDPB) and nanoparticles of silver (NAg), on dentin bond strength, dental plaque microcosm biofilm response, and fibroblast cytotoxicity for the first time. Methods Scotchbond Multi-Purpose (SBMP) was used as the parent bonding agent. Four primers were tested: SBMP primer control (referred to as “P”), P+5%MDPB, P+0.05%NAg, and P+5%MDPB+0.05%NAg. Dentin shear bond strengths were measured using extracted human teeth. Biofilms from the mixed saliva of 10 donors were cultured to investigate metabolic activity, colony-forming units (CFU), and lactic acid production. Human fibroblast cytotoxicity of the four primers was tested in vitro. Results Incorporating MDPB and NAg into primer did not reduce dentin bond strength compared to control (p>0.1). SEM revealed well-bonded adhesive-dentin interfaces with numerous resin tags. MDPB or NAg each greatly reduced biofilm viability and acid production, compared to control. Dual agents MDPB+NAg had a much stronger effect than either agent alone (p<0.05), increasing inhibition zone size and reducing metabolic activity, CFU and lactic acid by an order of magnitude, compared to control. There was no difference in cytotoxicity between commercial control and antibacterial primers (p>0.1). Conclusions The method of using dual agents MDPB+NAg in the primer yielded potent antibacterial properties. Hence, this method may be promising to combat residual bacteria in tooth cavity and invading bacteria at the margins. The dual agents MDPB+NAg may have wide applicability to other adhesives, composites, sealants and cements to inhibit biofilms and caries. PMID:23402889

  11. Dental primer and adhesive containing a new antibacterial quaternary ammonium monomer dimethylaminododecyl methacrylate

    PubMed Central

    Cheng, Lei; Weir, Michael D.; Zhang, Ke; Arola, Dwayne D.; Zhou, Xuedong; Xu, Hockin H. K.

    2013-01-01

    Objectives The main reason for restoration failure is secondary caries caused by biofilm acids. Replacing the failed restorations accounts for 50–70% of all operative work. The objectives of this study were to incorporate a new quaternary ammonium monomer (dimethylaminododecyl methacrylate, DMADDM) and nanoparticles of silver (NAg) into a primer and an adhesive, and to investigate their effects on antibacterial and dentin bonding properties. Methods Scotchbond Multi-Purpose (SBMP) served as control. DMADDM was synthesized and incorporated with NAg into primer/adhesive. A dental plaque microcosm biofilm model with human saliva was used to investigate metabolic activity, colony-forming units (CFU), and lactic acid. Dentin shear bond strengths were measured. Results Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of the new DMADDM were orders of magnitude lower than those of a previous quaternary ammonium dimethacrylate (QADM). Uncured primer with DMADDM had much larger inhibition zones than QADM (p<0.05). Cured primer/adhesive with DMADDM-NAg greatly reduced biofilm metabolic activity (p<0.05). Combining DMADDM with NAg in primer/adhesive resulted in less CFU than DMADDM alone (p<0.05). Lactic acid production by biofilms was reduced by 20-fold via DMADDM-NAg, compared to control. Incorporation of DMADDM and NAg into primer/adhesive did not adversely affect dentin bond strength. Conclusions A new antibacterial monomer DMADDM was synthesized and incorporated into primer/adhesive for the first time. The bonding agents are promising to combat residual bacteria in tooth cavity and invading bacteria at tooth-restoration margins to inhibit caries. DMADDM and NAg are promising for use into a wide range of dental adhesive systems and restoratives. PMID:23353068

  12. Application of Locked Nucleic Acid (LNA) Primer and PCR Clamping by LNA Oligonucleotide to Enhance the Amplification of Internal Transcribed Spacer (ITS) Regions in Investigating the Community Structures of Plant-Associated Fungi.

    PubMed

    Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao

    2016-09-29

    The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.

  13. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    NASA Astrophysics Data System (ADS)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  14. Enhanced sensitivity of CpG island search and primer design based on predicted CpG island position.

    PubMed

    Park, Hyun-Chul; Ahn, Eu-Ree; Jung, Ju Yeon; Park, Ji-Hye; Lee, Jee Won; Lim, Si-Keun; Kim, Won

    2018-05-01

    DNA methylation has important biological roles, such as gene expression regulation, as well as practical applications in forensics, such as in body fluid identification and age estimation. DNA methylation often occurs in the CpG site, and methylation within the CpG islands affects various cellular functions and is related to tissue-specific identification. Several programs have been developed to identify CpG islands; however, the size, location, and number of predicted CpG islands are not identical due to different search algorithms. In addition, they only provide structural information for predicted CpG islands without experimental information, such as primer design. We developed an analysis pipeline package, CpGPNP, to integrate CpG island prediction and primer design. CpGPNP predicts CpG islands more accurately and sensitively than other programs, and designs primers easily based on the predicted CpG island locations. The primer design function included standard, bisulfite, and methylation-specific PCR to identify the methylation of particular CpG sites. In this study, we performed CpG island prediction on all chromosomes and compared CpG island search performance of CpGPNP with other CpG island prediction programs. In addition, we compared the position of primers designed for a specific region within the predicted CpG island using other bisulfite PCR primer programs. The primers designed by CpGPNP were used to experimentally verify the amplification of the target region of markers for body fluid identification and age estimation. CpGPNP is freely available at http://forensicdna.kr/cpgpnp/. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. Beam shaping for laser initiated optical primers

    NASA Astrophysics Data System (ADS)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  16. An Efficient Approach for the Development of Locus Specific Primers in Bread Wheat (Triticum aestivum L.) and Its Application to Re-Sequencing of Genes Involved in Frost Tolerance

    PubMed Central

    Babben, Steve; Perovic, Dragan; Koch, Michael; Ordon, Frank

    2015-01-01

    Recent declines in costs accelerated sequencing of many species with large genomes, including hexaploid wheat (Triticum aestivum L.). Although the draft sequence of bread wheat is known, it is still one of the major challenges to developlocus specific primers suitable to be used in marker assisted selection procedures, due to the high homology of the three genomes. In this study we describe an efficient approach for the development of locus specific primers comprising four steps, i.e. (i) identification of genomic and coding sequences (CDS) of candidate genes, (ii) intron- and exon-structure reconstruction, (iii) identification of wheat A, B and D sub-genome sequences and primer development based on sequence differences between the three sub-genomes, and (iv); testing of primers for functionality, correct size and localisation. This approach was applied to single, low and high copy genes involved in frost tolerance in wheat. In summary for 27 of these genes for which sequences were derived from Triticum aestivum, Triticum monococcum and Hordeum vulgare, a set of 119 primer pairs was developed and after testing on Nulli-tetrasomic (NT) lines, a set of 65 primer pairs (54.6%), corresponding to 19 candidate genes, turned out to be specific. Out of these a set of 35 fragments was selected for validation via Sanger's amplicon re-sequencing. All fragments, with the exception of one, could be assigned to the original reference sequence. The approach presented here showed a much higher specificity in primer development in comparison to techniques used so far in bread wheat and can be applied to other polyploid species with a known draft sequence. PMID:26565976

  17. Genetic diversity of Palestine landraces of faba bean (Vicia faba) based on RAPD markers.

    PubMed

    Basheer-Salimia, R; Shtaya, M; Awad, M; Abdallah, J; Hamdan, Y

    2013-09-03

    Until now, neither phenotypic nor molecular approaches have been used to characterize the landraces of Palestine faba beans (Vicia faba). We used PCR-based RAPD markers to determine the genetic diversity and relatedness among 26 Palestinian faba bean landraces (traditional farmers' varieties) from 8 localities in the West Bank, Palestine. In tests with 37 primers, 14 generated no polymorphic bands, 12 exhibited weak and unclear products, and 11 primers produced good amplification products with high intensity and pattern stability. Ninety-four DNA fragments (loci) were detected, with an average of 8.54 loci per primer and size ranging from 160 to 1370 bp. A minimum of 4 and a maximum of 14 DNA fragments were obtained using (OPA-05 and OPA-09) and (BC-261) primers, respectively. The maximum percentage of polymorphic markers was 71.4 (BC-298) and the minimum was 50.0 (OPA-05, -09, -16). The 11 primers exhibited relatively high collective resolving power (Rp) values of 26.316, and varied from 0.154 for the OPA-09 primer to 5.236 for the BC-261, with an overall mean of 2.392. The primers BC-261, -322, and -298 were found to be the most useful RAPD primers to assess the genetic diversity of Palestinian faba beans, as they revealed relatively high Rp rates (5.236, 3.618, and 3.150, respectively). Based on the Jaccard coefficient, the genetic distance ranged from 0.358 to 0.069, with a mean of 0.213. We conclude that the RAPD technique is useful for determining genetic diversity and for developing suitable fingerprints for faba bean landraces grown in Palestine.

  18. Oligonucleotide primers, probes and molecular methods for the environmental monitoring of methanogenic archaea

    PubMed Central

    Narihiro, Takashi; Sekiguchi, Yuji

    2011-01-01

    Summary For the identification and quantification of methanogenic archaea (methanogens) in environmental samples, various oligonucleotide probes/primers targeting phylogenetic markers of methanogens, such as 16S rRNA, 16S rRNA gene and the gene for the α‐subunit of methyl coenzyme M reductase (mcrA), have been extensively developed and characterized experimentally. These oligonucleotides were designed to resolve different groups of methanogens at different taxonomic levels, and have been widely used as hybridization probes or polymerase chain reaction primers for membrane hybridization, fluorescence in situ hybridization, rRNA cleavage method, gene cloning, DNA microarray and quantitative polymerase chain reaction for studies in environmental and determinative microbiology. In this review, we present a comprehensive list of such oligonucleotide probes/primers, which enable us to determine methanogen populations in an environment quantitatively and hierarchically, with examples of the practical applications of the probes and primers. PMID:21375721

  19. Detection and identification of Brettanomyces/Dekkera sp. yeasts with a loop-mediated isothermal amplification method.

    PubMed

    Hayashi, Nobuyuki; Arai, Ritsuko; Tada, Setsuzo; Taguchi, Hiroshi; Ogawa, Yutaka

    2007-01-01

    Primer sets for a loop-mediated isothermal amplification (LAMP) method were developed to specifically identify each of the four Brettanomyces/Dekkera species, Dekkera anomala, Dekkera bruxellensis, Dekkera custersiana and Brettanomyces naardenensis. Each primer set was designed with target sequences in the ITS region of the four species and could specifically amplify the target DNA of isolates from beer, wine and soft drinks. Furthermore, the primer sets differentiated strains of the target species from strains belonging to other species, even within the genus Brettanomyces/Dekkera. Moreover, the LAMP method with these primer sets could detect about 1 x 10(1) cfu/ml of Brettanomyces/Dekkera yeasts from suspensions in distilled water, wine and beer. This LAMP method with primer sets for the identification of Brettanomyces/Dekkera yeasts is advantageous in terms of specificity, sensitivity and ease of operation compared with standard PCR methods.

  20. Information theory-based algorithm for in silico prediction of PCR products with whole genomic sequences as templates.

    PubMed

    Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping

    2005-07-26

    A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.

  1. Hexavalent Chromium IV-Free Primer Development

    NASA Technical Reports Server (NTRS)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  2. Detection of giardine gene in local isolates of Giardia duodenalis by polymerase chain reaction (PCR).

    PubMed

    Latifah, I; Teoh, K Y; Wan, K L; Rahmah, M; Normaznah, Y; Rohani, A

    2005-12-01

    Giardia duodenalis is an intestinal parasite that causes diarrhoea and malabsorption in children. The parasite also infects AIDS patients with a weak immune system. A study was carried out on six local isolates of Giardia duodenalis (110, 7304, 6304, M007, 2002 and 6307) from faeces of Orang Asli patients admitted to the Gombak Hospital. WB, a reference pathogenic strain from human and G. muris from a wild mouse, were commercially obtained from the American Type Culture Collection (ATCC). All the isolates were cultured axenically in TYI-S-33 medium. Two sets of primers were used for the techniques: primers LP1 and RP1 and primers LP2 and RP2. The sets of primers amplified giardine gene of 171 bp and 218 bp in sizes respectively. The study showed that the two sets of primers could detect G. duodenalis to the genus and species level specifically.

  3. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico

    PubMed Central

    Ramírez-Hernández, Dolores G.; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing. PMID:27563666

  4. Development of Primer Pairs from Molecular Typing of Rabies Virus Variants Present in Mexico.

    PubMed

    Bastida-González, Fernando; Ramírez-Hernández, Dolores G; Chavira-Suárez, Erika; Lara-Padilla, Eleazar; Zárate-Segura, Paola

    2016-01-01

    Nucleoprotein (N) gene from rabies virus (RABV) is a useful sequence target for variant studies. Several specific RABV variants have been characterized in different mammalian hosts such as skunk, dog, and bats by using anti-nucleocapsid monoclonal antibodies (MAbs) via indirect fluorescent antibody (IFA) test, a technique not available in many laboratories in Mexico. In the present study, a total of 158 sequences of N gene from RABV were used to design eight pairs of primers (four external and four internal primers), for typing four different RABV variants (dog, skunk, vampire bat, and nonhematophagous bat) which are most common in Mexico. The results indicate that the primer and the typing variant from the brain samples, submitted to nested and/or real-time PCR, are in agreement in all four singleplex reactions, and the designed primer pairs are an alternative for use in specific variant RABV typing.

  5. In vitro cytotoxicity of orthodontic primers.

    PubMed

    D'Antò, Vincenzo; Spagnuolo, Gianrico; Polito, Ilaria; Paduano, Sergio; Ambrosio, Luigi; Valletta, Rosa

    2009-01-01

    The aim of this study was to evaluate the cytotoxicity of four orthodontic primers: Transbond XT and Transbond MIP (3M, USA), Eagle Fluorsure (American Orthodontics, USA) and Ortho Solo (Ormco, USA). Balb 3T3 cells were exposed to different concentrations of primers (0-0.25 mg/ml). Mitochondrial dehydrogenase activity was evaluated by MTT assay and cell necrosis was measured by flow cytometry (propidium iodide staining). All the materials decreased cell viability in a dose related manner. Cytotoxicity of orthodontic primers based on concentrations which caused a 50% decrease of mitochondrial activity was ranked as follows: Transbond XT (45.57 mg/ml) > Eagle Fluorsure (49.27 mg/ml) > Transbond MIP (64.35 mg/ml) > Ortho solo (70.09 mg/ml). Our results suggest that the cytotoxic potencies demonstrated by orthodontic primers might be of clinical relevance since they disturbed cell metabolism and induced cell death in monolayer cultures.

  6. Focus and coverage of Bolsa Família Program in the Pelotas 2004 birth cohort.

    PubMed

    Schmidt, Kelen H; Labrecque, Jeremy; Santos, Iná S; Matijasevich, Alicia; Barros, Fernando C; Barros, Aluisio J D

    2017-03-30

    To describe the focalization and coverage of Bolsa Família Program among the families of children who are part of the 2004 Pelotas birth cohort (2004 cohort). The data used derives from the integration of information from the 2004 cohort and the Cadastro Único para Programas Sociais do Governo Federal (CadÚnico - Register for Social Programs of the Federal Government), in the 2004-2010 period. We estimated the program coverage (percentage of eligible people who receive the benefit) and its focus (proportion of eligible people among the beneficiaries). We used two criteria to define eligibility: the per capita household income reported in the cohort follow-ups and belonging to the 20% poorest families according to the National Economic Indicator (IEN), an asset index. Between 2004 and 2010, the proportion of families in the cohort that received the benefit increased from 11% to 34%. We observed an increase in all wealth quintiles. In 2010, by income and wealth quintiles (IEN), 62%-72% of the families were beneficiaries among the 20% poorest people, 2%-5% among the 20% richest people, and about 30% of families of the intermediate quintile. According to household income (minus the benefit) 29% of families were eligible in 2004 and 16% in 2010. By the same criteria, the coverage of the program increased from 43% in 2004 to 71% in 2010. In the same period, by the wealth criterion (IEN), coverage increased from 29% to 63%. The focalization of the program decreased from 78% in 2004 to 32% in 2010 according to income, and remained constant (37%) according to the IEN. Among the families of the 2004 cohort, there was a significant increase in the program coverage, from its inception until 2010, when it was near 70%. The focus of the program was below 40% in 2010, indicating that more than half of the beneficiaries did not belong to the target population. Descrever a focalização e a cobertura do Programa Bolsa Família nas famílias de crianças que fazem parte da coorte de nascimentos de Pelotas, 2004 (coorte de 2004). Os dados utilizados derivam da integração de informações da coorte de 2004 e do Cadastro Único para Programas Sociais do Governo Federal, no período de 2004 a 2010. Estimamos a cobertura do programa (percentual de elegíveis que recebem bolsa) e seu foco (proporção de elegíveis entre os beneficiários). Utilizamos dois critérios para definir elegibilidade: a renda familiar per capita relatada nas avaliações da coorte e pertencer aos 20,0% mais pobres pela classificação do Indicador Econômico Nacional, um índice de bens. Entre 2004 e 2010, a proporção de famílias beneficiárias da coorte passou de 11% para 34%. Houve aumento em todos os quintis de riqueza. Em 2010, por quintis de renda e Indicador Econômico Nacional, 62%-72% das famílias eram beneficiárias entre os 20% mais pobres, 2%-5% entre os 20% mais ricos, e cerca de 30% das famílias do quintil intermediário. Pelo critério de renda familiar, excluindo-se o valor do benefício do programa, 29% das famílias eram elegíveis em 2004 e 16% em 2010. Pelo mesmo critério, a cobertura do programa passou de 43% em 2004 para 71% em 2010. No mesmo período, pelo critério de riqueza (Indicador Econômico Nacional), a cobertura passou de 29% para 63%. A focalização do programa caiu de 78% em 2004 para 32% em 2010 de acordo com a renda e permaneceu constante (37%) de acordo com o Indicador Econômico Nacional. Entre as famílias da coorte de 2004, observa-se aumento importante da cobertura do programa, de seu início até 2010, quando ficou perto de 70%. O foco do programa ficou abaixo de 40% em 2010, indicando que mais da metade dos beneficiários não pertencem à população alvo.

  7. Implementacion de modulos constructivistas que atiendan "misconceptions" y lagunas conceptuales en temas de la fisica en estudiantes universitarios

    NASA Astrophysics Data System (ADS)

    Santacruz Sarmiento, Neida M.

    Este estudio se enfoco en los "misconception" y lagunas conceptuales en temas fundamentales de Fisica como son Equilibrio Termodinamico y Estatica de fluidos. En primer lugar se trabajo con la identificacion de "misconceptions" y lagunas conceptuales y se analizo en detalle la forma en que los estudiantes construyen sus propias teorias de fenomenos relacionados con los temas. Debido a la complejidad en la que los estudiantes asimilan los conceptos fisicos, se utilizo el metodo de investigacion mixto de tipo secuencial explicativo en dos etapas, una cuantitativa y otra cualitativa. La primera etapa comprendio cuatro fases: (1) Aplicacion de una prueba diagnostica para identificar el conocimiento previo y lagunas conceptuales. (2) Identificacion de "misconceptions" y lagunas del concepto a partir del conocimiento previo. (3) Implementacion de la intervencion por medio de modulos en el topico de Equilibrio Termodinamico y Estatica de Fluidos. (4) Y la realizacion de la pos prueba para analizar el impacto y la efectividad de la intervencion constructivista. En la segunda etapa se utilizo el metodo de investigacion cualitativo, por medio de una entrevista semiestructurada que partio de la elaboracion de un mapa conceptual y se finalizo con un analisis de datos conjuntamente. El desarrollo de este estudio permitio encontrar "misconceptions" y lagunas conceptuales a partir del conocimiento previo de los estudiantes participantes en los temas trabajados, que fueron atendidos en el desarrollo de las distintas actividades inquisitivas que se presentaron en el modulo constructivista. Se encontro marcadas diferencias entre la pre y pos prueba en los temas, esto se debio al requerimiento de habilidades abstractas para el tema de Estatica de Fluidos y al desarrollo intuitivo para el tema de Equilibrio Termodinamico, teniendo mejores respuestas en el segundo. Los participantes demostraron una marcada evolucion y/o cambio en sus estructuras de pensamiento, las pruebas estadisticas de t-pareada fueron significativas para ambos modulos a pesar que en la pos prueba no todos llegaron a la respuesta correcta. El analisis cualitativo de las respuestas de los participantes confirmo la dificultad de remover "misconception" y lagunas conceptuales.

  8. Defense Primer: A Guide for New Members

    DTIC Science & Technology

    2017-03-03

    1 President’s Constitutional Authority with Regard to the Armed Forces ................................... 1 The Department of Defense ...primers to give Members of Congress an overview of key aspects of the Department of Defense and how Congress exercises authority over it. A consolidated...for New Members Congressional Research Service 2 The Department of Defense CRS In Focus IF10543, Defense Primer: The Department of Defense , by

  9. Genome-wide characterization and selection of expressed sequence tag simple sequence repeat primers for optimized marker distribution and reliability in peach

    USDA-ARS?s Scientific Manuscript database

    Expressed sequence tag (EST) simple sequence repeats (SSRs) in Prunus were mined, and flanking primers designed and used for genome-wide characterization and selection of primers to optimize marker distribution and reliability. A total of 12,618 contigs were assembled from 84,727 ESTs, along with 34...

  10. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    PubMed

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  11. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  12. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi= solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  13. 40 CFR 63.5749 - How do I calculate the organic HAP content of aluminum wipedown solvents?

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... solvents, kilograms of HAP per liter of total coating solids from aluminum primers, top coats, and clear... = volume of aluminum primer, top coat, or clear coat i used in the past 12 months, liters. Solidsi = solids content aluminum primer, top coat, or clear coat i, liter solids per liter of coating. (b) Compliance is...

  14. Metastable Intermolecular Composites (MIC) Primers for Small Caliber Cartridges and Cartridge Actuated Devices

    DTIC Science & Technology

    2009-07-01

    24 iii ACRONYMS AND ABBREVIATIONS ATF Armaments Technology Facility ATK Alliant Techsystems, Inc. ARDEC Armament Research...Technology Facility ( ATF ) firings there, and was instrumental in producing the primers and loading the cartridges needed for the supplemental...and CADs known as the percussion primer. The novel properties associated with nanostructure materials have resulted in the development of thermite

  15. A Dozen Primers on Important Information Standards

    ERIC Educational Resources Information Center

    Dempsey, Kathy, Comp.

    2007-01-01

    This is a compilation of 12 primers on important information standards and protocols. These primers are: (1) Atom; (2) COinS; (3) MADS; (4) MARC 21/MARCXML; (5) MIX; (6) MXG; (7) OpenSearch; (8) PREMIS; (9) RESTful HTTP; (10) unAPI; (11) XMPP (aka Jabber); and (12) ZeeRex. The Atom Syndication Format defines a new XML-based syndication format for…

  16. Molecular Genetic Studies of Bone Mechanical Strain and of Pedigrees with Very High Bone Density

    DTIC Science & Technology

    2009-11-01

    mice. We used Cre-recombinase primer (F- TTA GCA CCA CGG CAG CAG GAG GTT and R-CAG GCC AGA TCT CCT GTG CAG CAT) and loxp primer (Primer 1, AGT GAT...Leprdb heterozygotes during breeding. Three types of littermates are produced from breeding these heterozygotes: the misty gray homozygote (m +/m +), the

  17. BchY-based degenerate primers target all types of anoxygenic photosynthetic bacteria in a single PCR.

    PubMed

    Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded

    2009-12-01

    To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.

  18. Electrocoat Process for Non-Chromate Primers in DoD Manufacturing

    DTIC Science & Technology

    2011-02-01

    requirements are uniquely  suited for aerospace  aluminum. ↑ O2 ↑ H2 Anode (+) Cathode (-) Deposited Film Alkaline  clean Rinse ElectrocoatSurface...Objectives ● Demonstration and validation of a novel, non‐chromated,  environmentally friendly,  electrodeposited  primer. ● The primers will be

  19. Universal primers for amplification of the complete mitochondrial control region in marine fish species.

    PubMed

    Cheng, Y Z; Xu, T J; Jin, X X; Tang, D; Wei, T; Sun, Y Y; Meng, F Q; Shi, G; Wang, R X

    2012-01-01

    Through multiple alignment analysis of mitochondrial tRNA-Thr and tRNA-Phe sequences from 161 fishes, new universal primers specially targeting the entire mitochondrial control region were designed. This new primer set successfully amplified the expected PCR products from various kinds of marine fish species, belonging to various families, and the amplified segments were confirmed to be the control region by sequencing. These primers provide a useful tool to study the control region diversity in economically important fish species, the possible mechanism of control region evolution, and the functions of the conserved motifs in the control region.

  20. FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".

    PubMed

    Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy

    2015-08-28

    Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.

  1. Primer on spontaneous heating and pyrophoricity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Not Available

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardousmore » material training.« less

  2. A physicists guide to The Los Alamos Primer

    NASA Astrophysics Data System (ADS)

    Reed, B. Cameron

    2016-11-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer, which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons.

  3. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    PubMed

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  4. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    PubMed Central

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  5. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    USGS Publications Warehouse

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  6. DNA-based species level detection of Glomeromycota: one PCR primer set for all arbuscular mycorrhizal fungi.

    PubMed

    Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur

    2009-01-01

    * At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.

  7. Genetic diversity analysis of tree peony germplasm using iPBS markers.

    PubMed

    Duan, Y B; Guo, D L; Guo, L L; Wei, D F; Hou, X G

    2015-07-06

    We examined the genetic diversity of 10 wild species (populations) and 55 varieties of tree peony using inter-primer binding site (iPBS) markers. From a total of 36 iPBS primers, 16 were selected based on polymorphic amplification. The number of bands amplified by each primer ranged from 9 to 19, with an average of 12.88 bands per primer. The length of bands ranged from 100 to 2000 bp, concentrated at 200 to 1800 bp. Sixteen primers amplified 206 bands in total, of which 173 bands were polymorphic with a polymorphism ratio of 83.98%. Each primer amplified 10.81 polymorphic bands on average. The data were then used to construct a phylogenetic tree using unweighted pair group method with arithmetic mean methods. Clustering analysis showed that the genetic relationships among the varieties were not only related to the genetic background or geographic origin, but also to the flowering phase, flower color, and flower type. Our data also indicated that iPBS markers were useful tools for classifying tree peony germplasms and for tree peony breeding, and the specific bands were helpful for molecular identification of tree peony varieties.

  8. A flexible and economical barcoding approach for highly multiplexed amplicon sequencing of diverse target genes

    PubMed Central

    Herbold, Craig W.; Pelikan, Claus; Kuzyk, Orest; Hausmann, Bela; Angel, Roey; Berry, David; Loy, Alexander

    2015-01-01

    High throughput sequencing of phylogenetic and functional gene amplicons provides tremendous insight into the structure and functional potential of complex microbial communities. Here, we introduce a highly adaptable and economical PCR approach to barcoding and pooling libraries of numerous target genes. In this approach, we replace gene- and sequencing platform-specific fusion primers with general, interchangeable barcoding primers, enabling nearly limitless customized barcode-primer combinations. Compared to barcoding with long fusion primers, our multiple-target gene approach is more economical because it overall requires lower number of primers and is based on short primers with generally lower synthesis and purification costs. To highlight our approach, we pooled over 900 different small-subunit rRNA and functional gene amplicon libraries obtained from various environmental or host-associated microbial community samples into a single, paired-end Illumina MiSeq run. Although the amplicon regions ranged in size from approximately 290 to 720 bp, we found no significant systematic sequencing bias related to amplicon length or gene target. Our results indicate that this flexible multiplexing approach produces large, diverse, and high quality sets of amplicon sequence data for modern studies in microbial ecology. PMID:26236305

  9. Colorimetric molecular diagnosis of the HIV gag gene using DNAzyme and a complementary DNA-extended primer.

    PubMed

    Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon

    2018-02-07

    We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.

  10. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR.

    PubMed

    Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.

  11. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    PubMed Central

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  12. A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.

    PubMed

    van der Linde, Sietse; Alexander, Ian; Anderson, Ian C

    2008-09-01

    To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.

  13. Formulation and Assessment of a Wash-Primer Containing Lanthanum "Tannate" for Steel Temporary Protection

    NASA Astrophysics Data System (ADS)

    D'Alessandro, Oriana; Selmi, Gonzalo J.; Deyá, Cecilia; Di Sarli, Alejandro; Romagnoli, Roberto

    2018-02-01

    Tannins are polyphenols synthesized by plants and useful for the coating industry as corrosion inhibitors. In addition, lanthanum salts have a great inhibitory effect on steel corrosion. The aim of this study was to obtain lanthanum "tannate" with adequate solubility to be incorporated as the corrosion inhibitor in a wash-primer. The "tannate" was obtained from commercial "Quebracho" tannin and 0.1 M La(NO3)3. The soluble tannin was determined by the Folin-Denis reagent, while the concentration of Lanthanum was obtained by a gravimetric procedure. The protective action of "tannate" on SAE 1010 steel was evaluated by linear polarization curves and corrosion potential measurements. Lanthanum "tannate" was incorporated in a wash-primer formulation and tested by corrosion potential and ionic resistance measurements. The corrosion rate was also determined by the polarization resistance technique. Besides, the primer was incorporated in an alkyd paint system and its anticorrosion performance assessed in the salt spray cabinet and by electrochemical impedance spectroscopy. Results showed that lanthanum "tannate" primer inhibits the development of deleterious iron oxyhydroxides on the steel substrate and incorporated into a paint system had a similar behavior to the primer formulated with zinc tetroxychromate.

  14. A New Primer to Amplify pmoA Gene From NC10 Bacteria in the Sediments of Dongchang Lake and Dongping Lake.

    PubMed

    Wang, Shenghui; Liu, Yanjun; Liu, Guofu; Huang, Yaru; Zhou, Yu

    2017-08-01

    Nitrite-dependent anaerobic methane oxidation (n-damo) is catalyzed by the NC10 phylum bacterium "Candidatus Methylomirabilis oxyfera" (M. oxyfera). Generally, the pmoA gene is applied as a functional marker to test and identify NC10-like bacteria. However, it is difficult to detect the NC10 bacteria from sediments of freshwater lake (Dongchang Lake and Dongping Lake) with the previous pmoA gene primer sets. In this work, a new primer cmo208 was designed and used to amplify pmoA gene of NC10-like bacteria. A newly nested PCR approach was performed using the new primer cmo208 and the previous primers cmo182, cmo682, and cmo568 to detect the NC10 bacteria. The obtained pmoA gene sequences exhibited 85-92% nucleotide identity and 95-97% amino acid sequence identity to pmoA gene of M. oxyfera. The obtained diversity of pmoA gene sequences coincided well with the diversity of 16S rRNA sequences. These results indicated that the newly designed pmoA primer cmo208 could give one more option to detect NC10 bacteria from different environmental samples.

  15. Characterization of Novel Di-, Tri-, and Tetranucleotide Microsatellite Primers Suitable for Genotyping Various Plant Pathogenic Fungi with Special Emphasis on Fusaria and Mycospherella graminicola

    PubMed Central

    Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander

    2012-01-01

    The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135

  16. Novel priming and crosslinking systems for use with isocyanatomethacrylate dental adhesives.

    PubMed

    Chappelow, C C; Power, M D; Bowles, C Q; Miller, R G; Pinzino, C S; Eick, J D

    2000-11-01

    (a) to design, formulate and evaluate prototype primers and a crosslinking agent for use with isocyanatomethacrylate-based comonomer adhesives and (b) to establish correlations between bond strength and solubility parameter differences between the adhesives and etched dentin, and the permeability coefficients of the adhesives. Equimolar mixtures of 2-isocyanatoethyl methacrylate (IEM) and a methacrylate comonomer were formulated with tri-n-butyl borane oxide (TBBO) as the free radical initiator to have cure times of 6-10 min. Shear bond strengths to dentin were determined for each adhesive mixture (n = 7) using standard testing protocols. Shear bond strengths for the three systems were also determined after application of "reactive primers" to the dentin surface. The "reactive primers" contained 10-20 parts by weight of the respective comonomer mixture and 3.5 parts by weight TBBO in acetone. Solubility parameters difference values (delta delta) and permeability coefficients (P) were approximated for each adhesive system and correlated with shear bond strength values. Additionally, a crosslinking agent was prepared by bulk reaction of an equimolar mixture containing IEM and a methacrylate comonomer. The effects of crosslinker addition on: (a) the setting time of IEM; and (b) the setting times and initiator requirements of selected IEM/comonomer mixtures were determined. Shear bond strength values (MPa): IEM/HEMA 13.6 +/- 2.0 (no primer), 20.1 +/- 2.0 (with primer); IEM/HETMA 9.3 +/- 3.3 (no primer), 20.8 +/- 8.1 (with primer); IEM/AAEMA 13.6 +/- 1.9 (no primer), 17.3 +/- 3.2 (with primer). Also, approximated permeability coefficients showed a significant correlation (r = +0.867, p < 0.001) with shear bond strength values. Crosslinker addition studies with IEM/4-META: (a) at 5-9 mol% reduced the setting time of IEM polymerization by 79%; and (b) at 6 mol% reduced initiator level requirements 60-70% to achieve a comparable setting time, and decreased setting times by ca. 75% for a given initiator level with selected IEM/methacrylate adhesive systems. The shear bond strengths of isocyanatomethacrylate-based dental adhesives can be enhanced by using reactive primers; their setting times and initiator requirements can be improved using a dimethacrylate crosslinker. Approximated permeability coefficients may be useful as indicators of bonding performance for dentin adhesive systems.

  17. Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.

    PubMed

    Poláková, H; Zmetáková, I; Kádasi, L'

    2003-06-01

    In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.

  18. Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.

    PubMed

    Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon

    2015-10-01

    Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.

  19. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2010-06-02

    States of 24 million barrels of oil.3 • Universal access to clean water. Nanotechnology water desalination and filtration systems may offer...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...00-00-2010 to 00-00-2010 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  20. Nanotechnology: A Policy Primer

    DTIC Science & Technology

    2008-05-20

    of oil.3 ! Universal access to clean water. Nanotechnology water desalination and filtration systems may offer affordable, scalable, and portable...Order Code RL34511 Nanotechnology : A Policy Primer May 20, 2008 John F. Sargent Specialist in Science and Technology Policy Resources, Science, and...REPORT DATE 20 MAY 2008 2. REPORT TYPE 3. DATES COVERED 00-00-2008 to 00-00-2008 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a

Top