Renal Sinus Fat Invasion and Tumoral Thrombosis of the Inferior Vena Cava-Renal Vein: Only Confined to Renal Cell Carcinoma

PubMed Central

Harman, Mustafa; Guneyli, Serkan; Sen, Sait; Elmas, Nevra

2014-01-01

Epithelioid angiomyolipoma (E-AML), accounting for 8% of renal angiomyolipoma, is usually associated with tuberous sclerosis (TS) and demonstrates aggressive behavior. E-AML is macroscopically seen as a large infiltrative necrotic tumor with occasional extension into renal vein and/or inferior vena cava. However, without history of TS, renal sinus and venous invasion E-AML would be a challenging diagnosis, which may lead radiologists to misinterpret it as a renal cell carcinoma (RCC). In this case presentation, we aimed to report cross-sectional imaging findings of two cases diagnosed as E-AML and pathological correlation of these aforementioned masses mimicking RCC. PMID:25506021

Renal sinus fat invasion and tumoral thrombosis of the inferior vena cava-renal vein: only confined to renal cell carcinoma.

PubMed

Acar, Turker; Harman, Mustafa; Guneyli, Serkan; Sen, Sait; Elmas, Nevra

2014-01-01

Epithelioid angiomyolipoma (E-AML), accounting for 8% of renal angiomyolipoma, is usually associated with tuberous sclerosis (TS) and demonstrates aggressive behavior. E-AML is macroscopically seen as a large infiltrative necrotic tumor with occasional extension into renal vein and/or inferior vena cava. However, without history of TS, renal sinus and venous invasion E-AML would be a challenging diagnosis, which may lead radiologists to misinterpret it as a renal cell carcinoma (RCC). In this case presentation, we aimed to report cross-sectional imaging findings of two cases diagnosed as E-AML and pathological correlation of these aforementioned masses mimicking RCC.

Renal mass biopsy using Raman spectroscopy identifies malignant and benign renal tumors: potential for pre-operative diagnosis.

PubMed

Liu, Yufei; Du, Zhebin; Zhang, Jin; Jiang, Haowen

2017-05-30

The accuracy of renal mass biopsy to diagnose malignancy can be affected by multiple factors. Here, we investigated the feasibility of Raman spectroscopy to distinguish malignant and benign renal tumors using biopsy specimens. Samples were collected from 63 patients who received radical or partial nephrectomy, mass suspicious of cancer and distal parenchyma were obtained from resected kidney using an 18-gauge biopsy needle. Four Raman spectra were obtained for each sample, and Discriminant Analysis was applied for data analysis. A total of 383 Raman spectra were eventually gathered and each type of tumor had its characteristic spectrum. Raman could separate tumoral and normal tissues with an accuracy of 82.53%, and distinguish malignant and benign tumors with a sensitivity of 91.79% and specificity of 71.15%. It could classify low-grade and high-grade tumors with an accuracy of 86.98%. Besides, clear cell renal carcinoma was differentiated with oncocytoma and angiomyolipoma with accuracy of 100% and 89.25%, respectively. And histological subtypes of cell carcinoma were distinguished with an accuracy of 93.48%. When compared with final pathology and biopsy, Raman spectroscopy was able to correctly identify 7 of 11 "missed" biopsy diagnoses. These results suggested that Raman may serve as a promising non-invasive approach in the future for pre-operative diagnosis.

Treatment of caval vein thrombosis associated with renal tumors.

PubMed

Jiménez-Romero, Carlos; Conde, María; de la Rosa, Federico; Manrique, Alejandro; Calvo, Jorge; Caso, Óscar; Muñoz, Carlos; Marcacuzco, Alberto; Justo, Iago

2017-03-01

Renal carcinoma represents 3% of all solid tumors and is associated with renal or inferior caval vein (IVC) thrombosis between 2-10% of patients, extending to right atrial in 1% of cases. This is a retrospective study that comprises 5 patients who underwent nephrectomy and thrombectomy by laparotomy because of renal tumor with IVC thrombosis level iii. Four patients were males and one was female, and the mean age was 57,2 years (range: 32-72). Most important clinical findings were hematuria, weight loss, weakness, anorexia, and pulmonary embolism. Diagnostic confirmation was performed by CT scanner. Metastatic disease was diagnosed before surgery in 3 patients. Suprahepatic caval vein and hepatic hilium (Pringle's maneouver) were clamped in 4 patients, and ligation of infrarrenal caval vein was carry out in one patient. Five patients developed mild complications (Clavien I/II). No patient died and the mean hospital stay was 8,6 days. All patients were treated with chemotherapy, and 3 died because distant metastasis, but 2 are alive, without recurrence, at 5 and 60 months, respectively. Nephrectomy and thrombectomy in renal tumors with caval thrombosis can be curative in absence of metastasis or, at less, can increase survival or quality of live. Then these patients must be treated in liver transplant units because major surgical and anesthesiologic expertise. Adjuvant treatment with tyrosin kinase inhibitors must be validate in the future with wider experiences. Copyright © 2017 AEC. Publicado por Elsevier España, S.L.U. All rights reserved.

Comparing renal function preservation after laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy for clinical T1a renal tumor: using a 3D parenchyma measurement system.

PubMed

Zhu, Liangsong; Wu, Guangyu; Huang, Jiwei; Wang, Jianfeng; Zhang, Ruiyun; Kong, Wen; Xue, Wei; Huang, Yiran; Chen, Yonghui; Zhang, Jin

2017-05-01

To compare the renal function preservation between laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy. Data were analyzed from 246 patients who underwent laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy for solitary cT1a renal cell carcinoma from January 2013 to July 2015. To reduce the intergroup difference, we used a 1:1 propensity matching analysis. The functional renal parenchyma volume preservation were measured preoperative and 12 months after surgery. The total renal function recovery and spilt GFR was compared. Multivariable logistic analysis was used for predictive factors for renal function decline. After 1:1 propensity matching, each group including 100 patients. Patients in the laparoscopic radio frequency ablation assisted tumor enucleation had a smaller decrease in estimate glomerular filtration rate at 1 day (-7.88 vs -20.01%, p < 0.001), 3 months (-2.31 vs -10.39%, p < 0.001), 6 months (-2.16 vs -7.99%, p = 0.015), 12 months (-3.26 vs -8.03%, p = 0.012) and latest test (-3.24 vs -8.02%, p = 0.040), also had better functional renal parenchyma volume preservation (89.19 vs 84.27%, p < 0.001), lower decrease of the spilt glomerular filtration rate (-9.41 vs -17.13%, p < 0.001) at 12 months. The functional renal parenchyma volume preservation, warm ischemia time and baseline renal function were the important independent factors in determining long-term functional recovery. The laparoscopic radio frequency ablation assisted tumor enucleation technology has unique advantage and potential in preserving renal parenchyma without ischemia damage compared to conventional laparoscopic partial nephrectomy, and had a better outcome, thus we recommend this technique in selected T1a patients.

A Survey of Mesenchyme-related Tumors of the Rat Kidney in the National Toxicology Program Archives, with Particular Reference to Renal Mesenchymal Tumor.

PubMed

Hard, Gordon C; Seely, John Curtis; Betz, Laura J

2016-08-01

In order to harmonize diagnostic terminology, confirm diagnostic criteria, and describe aspects of tumor biology characteristic of different tumor types, a total of 165 cases of mesenchyme-related tumors and nephroblastomas of the rat kidney were reexamined from the National Toxicology Program (NTP) Archives. This survey demonstrated that renal mesenchymal tumor (RMT) was the most common spontaneous nonepithelial tumor in the rat kidney, also occurring more frequently in the NTP studies than nephroblastoma. Renal sarcoma was a distinct but very rare tumor entity, representing a malignant, monomorphous population of densely crowded, fibroblast-like cells, in which, unlike RMT, preexisting tubules did not persist. Nephroblastoma was characterized by early death of affected animals, suggesting an embryonal origin for this tumor type. Male and female rats were equally disposed to developing RMT, but most of the cases of nephroblastoma occurred in female rats and liposarcoma occurred mostly in male rats. This survey confirmed discrete histopathological and biological differences between the mesenchyme-related renal tumor types and between RMT and nephroblastoma. Statistical analysis also demonstrated a lack of any relationship of these renal tumor types to test article administration in the NTP data bank. © 2016 by The Author(s) 2016.

Zonal NePhRO scoring system: a superior renal tumor complexity classification model.

PubMed

Hakky, Tariq S; Baumgarten, Adam S; Allen, Bryan; Lin, Hui-Yi; Ercole, Cesar E; Sexton, Wade J; Spiess, Philippe E

2014-02-01

Since the advent of the first standardized renal tumor complexity system, many subsequent scoring systems have been introduced, many of which are complicated and can make it difficult to accurately measure data end points. In light of these limitations, we introduce the new zonal NePhRO scoring system. The zonal NePhRO score is based on 4 anatomical components that are assigned a score of 1, 2, or 3, and their sum is used to classify renal tumors. The zonal NePhRO scoring system is made up of the (Ne)arness to collecting system, (Ph)ysical location of the tumor in the kidney, (R)adius of the tumor, and (O)rganization of the tumor. In this retrospective study, we evaluated patients exhibiting clinical stage T1a or T1b who underwent open partial nephrectomy performed by 2 genitourinary surgeons. Each renal unit was assigned both a zonal NePhRO score and a RENAL (radius, exophytic/endophytic properties, nearness of tumor to the collecting system or sinus in millimeters, anterior/posterior, location relative to polar lines) score, and a blinded reviewer used the same preoperative imaging study to obtain both scores. Additional data points gathered included age, clamp time, complication rate, urine leak rate, intraoperative blood loss, and pathologic tumor size. One hundred sixty-six patients underwent open partial nephrectomy. There were 37 perioperative complications quantitated using the validated Clavien-Dindo system; their occurrence was predicted by the NePhRO score on both univariate and multivariate analyses (P = .0008). Clinical stage, intraoperative blood loss, and tumor diameter were all correlated with the zonal NePhRO score on univariate analysis only. The zonal NePhRO scoring system is a simpler tool that accurately predicts the surgical complexity of a renal lesion. Copyright © 2014 Elsevier Inc. All rights reserved.

Deterministic Evolutionary Trajectories Influence Primary Tumor Growth: TRACERx Renal.

PubMed

Turajlic, Samra; Xu, Hang; Litchfield, Kevin; Rowan, Andrew; Horswell, Stuart; Chambers, Tim; O'Brien, Tim; Lopez, Jose I; Watkins, Thomas B K; Nicol, David; Stares, Mark; Challacombe, Ben; Hazell, Steve; Chandra, Ashish; Mitchell, Thomas J; Au, Lewis; Eichler-Jonsson, Claudia; Jabbar, Faiz; Soultati, Aspasia; Chowdhury, Simon; Rudman, Sarah; Lynch, Joanna; Fernando, Archana; Stamp, Gordon; Nye, Emma; Stewart, Aengus; Xing, Wei; Smith, Jonathan C; Escudero, Mickael; Huffman, Adam; Matthews, Nik; Elgar, Greg; Phillimore, Ben; Costa, Marta; Begum, Sharmin; Ward, Sophia; Salm, Max; Boeing, Stefan; Fisher, Rosalie; Spain, Lavinia; Navas, Carolina; Grönroos, Eva; Hobor, Sebastijan; Sharma, Sarkhara; Aurangzeb, Ismaeel; Lall, Sharanpreet; Polson, Alexander; Varia, Mary; Horsfield, Catherine; Fotiadis, Nicos; Pickering, Lisa; Schwarz, Roland F; Silva, Bruno; Herrero, Javier; Luscombe, Nick M; Jamal-Hanjani, Mariam; Rosenthal, Rachel; Birkbak, Nicolai J; Wilson, Gareth A; Pipek, Orsolya; Ribli, Dezso; Krzystanek, Marcin; Csabai, Istvan; Szallasi, Zoltan; Gore, Martin; McGranahan, Nicholas; Van Loo, Peter; Campbell, Peter; Larkin, James; Swanton, Charles

2018-04-19

The evolutionary features of clear-cell renal cell carcinoma (ccRCC) have not been systematically studied to date. We analyzed 1,206 primary tumor regions from 101 patients recruited into the multi-center prospective study, TRACERx Renal. We observe up to 30 driver events per tumor and show that subclonal diversification is associated with known prognostic parameters. By resolving the patterns of driver event ordering, co-occurrence, and mutual exclusivity at clone level, we show the deterministic nature of clonal evolution. ccRCC can be grouped into seven evolutionary subtypes, ranging from tumors characterized by early fixation of multiple mutational and copy number drivers and rapid metastases to highly branched tumors with >10 subclonal drivers and extensive parallel evolution associated with attenuated progression. We identify genetic diversity and chromosomal complexity as determinants of patient outcome. Our insights reconcile the variable clinical behavior of ccRCC and suggest evolutionary potential as a biomarker for both intervention and surveillance. Copyright © 2018 Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

Spontaneous renal tumors suspected of being familial in sprague-dawley rats.

PubMed

Kudo, Kayoko; Hoshiya, Toru; Nakazawa, Tomomi; Saito, Tsubasa; Shimoyama, Natsumi; Suzuki, Isamu; Tamura, Kazutoshi; Seely, John Curtis

2012-12-01

Spontaneous renal tubule tumors (RTTs), with a distinctive morphological phenotype, were present in three Sprague-Dawley rats, 1 male and 2 females, out a total of 120 animals of each sex from untreated and placebo control groups in a 2-year carcinogenicity study. One female had one carcinoma, adenoma and hyperplasia, and the other female had five adenomas and many hyperplastic lesions; the male case had one carcinoma. From these cases, a biological continuum of hyperplasia, adenoma and carcinoma could be recognized. The tumors were present in the renal cortex and appeared as solid lobulated growths with occasional central necrosis. The lobules were divided by a small amount of fibrovascular tissue. Occasionally the larger tumors contained a cystic area. Tumor cells appeared distinctive and exhibited variable amounts of eosinophilic/amphophilic and vacuolated cytoplasm. Nuclei were round to oval with a prominent nucleolus. Mitotic figures were uncommon, and no distant metastasis was noted. The tumors were seen as multiple and bilateral lesions in two animals and had no apparent relationship to chronic progressive nephropathy (CPN). Foci of tubule hyperplasia were also noted to contain the same type of cellular morphology. The morphological and biological features of these 3 cases resembled the amphophilic-vacuolar (AV) variant of RTT that has been posited to be of familial origin. This is a report of spontaneous familial renal tumors in Sprague-Dawley rats from Japan.

Intratumoral peripheral small papillary tufts: a diagnostic clue of renal tumors associated with Birt-Hogg-Dubé syndrome.

PubMed

Kuroda, Naoto; Furuya, Mitsuko; Nagashima, Yoji; Gotohda, Hiroko; Moritani, Suzuko; Kawakami, Fumi; Imamura, Yoshiaki; Bando, Yoshimi; Takahashi, Masayuki; Kanayama, Hiro-omi; Ota, Satoshi; Michal, Michal; Hes, Ondrej; Nakatani, Yukio

2014-06-01

In this article, we searched for the common histologic characteristic of renal tumors in patients with Birt-Hogg-Dubé syndrome (BHDS). We selected 6 patients with histologically confirmed renal tumor in BHDS. Germline FLCN gene mutation has been identified in 5 patients. Multifocality and bilaterality of the renal tumors were pathologically or radiologically confirmed in 5 and 2 cases, respectively. Histologic subtypes of the dominant tumor included 3 previously described hybrid oncocytic tumors, one composite chromophobe/papillary/clear cell renal cell carcinoma (RCC) and one unclassified RCC resembling hybrid chromophobe/clear cell RCC. In one case, chromophobe RCC and clear cell RCC were separately observed. Small papillary lesions located in the peripheral area of the tumor, which we designated as intratumoral peripheral small papillary tufts, were identified in all patients. In conclusion, multifocality/bilaterality of renal tumors, discordance of histologic subtypes, and the presence of intratumoral peripheral small papillary tufts may be important clues to identify BHDS-associated renal tumors. Copyright © 2014 Elsevier Inc. All rights reserved.

Congenital renal rhabdoid tumor with placental metastases: immunohistochemistry, cytogenetic, and ultrastructural findings.

PubMed

de Tar, Michael; Sanford Biggerstaff, Julie

2006-01-01

Malignant congenital tumors of fetal origin are rare lesions, the most common type being congenital neuroblastoma. Although prenatal diagnosis is possible in large tumors, occasionally the tumor will be diagnosed first by its metastatic involvement of the placenta. Placental metastases can reflect either maternal or fetal primary sites, and each has relatively specific patterns of placental involvement. We describe the clinical and pathologic features of a widely metastatic congenital renal rhabdoid tumor with its placental and autopsy findings, and include the immunohistochemical, cytogenetic, and ultrastructural features. The pathologic features of the placenta in congenital renal rhabdoid tumor with placental metastasis have not been previously described. The examination of the placenta in this case led to the initial diagnosis and obviated the need for additional diagnostic procedures.

Renal Mass Biopsy to Guide Treatment Decisions for Small Incidental Renal Tumors: A Cost-effectiveness Analysis1

PubMed Central

Gervais, Debra A.; Hartman, Rebecca I.; Harisinghani, Mukesh G.; Feldman, Adam S.; Mueller, Peter R.; Gazelle, G. Scott

2010-01-01

Purpose: To evaluate the effectiveness, cost, and cost-effectiveness of using renal mass biopsy to guide treatment decisions for small incidentally detected renal tumors. Materials and Methods: A decision-analytic Markov model was developed to estimate life expectancy and lifetime costs for patients with small (≤4-cm) renal tumors. Two strategies were compared: renal mass biopsy to triage patients to surgery or imaging surveillance and empiric nephron-sparing surgery. The model incorporated biopsy performance, the probability of track seeding with malignant cells, the prevalence and growth of benign and malignant tumors, treatment effectiveness and costs, and patient outcomes. An incremental cost-effectiveness analysis was performed to identify strategy preference under a willingness-to-pay threshold of $75 000 per quality-adjusted life-year (QALY). Effects of changes in key parameters on strategy preference were evaluated in sensitivity analysis. Results: Under base-case assumptions, the biopsy strategy yielded a minimally greater quality-adjusted life expectancy (4 days) than did empiric surgery at a lower lifetime cost ($3466), dominating surgery from a cost-effectiveness perspective. Over the majority of parameter ranges tested in one-way sensitivity analysis, the biopsy strategy dominated surgery or was cost-effective relative to surgery based on a $75 000-per-QALY willingness-to-pay threshold. In two-way sensitivity analysis, surgery yielded greater life expectancy when the prevalence of malignancy and propensity for biopsy-negative cancers to metastasize were both higher than expected or when the sensitivity and specificity of biopsy were both lower than expected. Conclusion: The use of biopsy to guide treatment decisions for small incidentally detected renal tumors is cost-effective and can prevent unnecessary surgery in many cases. © RSNA, 2010 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.10092013/-/DC1 PMID

Application and analysis of retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping for patients with multiple renal tumor: initial experience.

PubMed

Zhu, Jundong; Jiang, Fan; Li, Pu; Shao, Pengfei; Liang, Chao; Xu, Aiming; Miao, Chenkui; Qin, Chao; Wang, Zengjun; Yin, Changjun

2017-09-11

To explore the feasibility and safety of retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping for the patients with multiple renal tumor of who have solitary kidney or contralateral kidney insufficiency. Nine patients who have undergone retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping between October 2010 and January 2017 were retrospectively analyzed. Clinical materials and parameters during and after the operation were summarized. Nineteen tumors were resected in nine patients and the operations were all successful. The operation time ranged from 100 to 180 min (125 min); clamping time of segmental renal artery was 10 ~ 30 min (23 min); the amount of blood loss during the operation was 120 ~ 330 ml (190 ml); hospital stay after the operation is 3 ~ 6d (5d). There was no complication during the perioperative period, and the pathology diagnosis after the surgery showed that there were 13 renal clear cell carcinomas, two papillary carcinoma and four perivascular epithelioid cell tumors with negative margins from the 19 tumors. All patients were followed up for 3 ~ 60 months, and no local recurrence or metastasis was detected. At 3-month post-operation follow-up, the mean serum creatinine was 148.6 ± 28.1 μmol/L (p = 0.107), an increase of 3.0 μmol/L from preoperative baseline. For the patients with multiple renal tumors and solitary kidney or contralateral kidney insufficiency, retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping was feasible and safe, which minimized the warm ischemia injury to the kidney and preserved the renal function effectively.

Permanent renal loss following tumor necrosis factor α antagonists for arthritis.

PubMed

Chen, Tzu-Jen; Yang, Ya-Fei; Huang, Po-Hao; Lin, Hsin-Hung; Huang, Chiu-Ching

2010-06-01

Tumor necrosis factor alpha (TNF-alpha) antagonists are now widely used in the treatment of aggressive rheumatoid arthritis and are generally well tolerated. Although rare, they could induce systemic lupus erythematosus, glomerulonephritis, and antineutrophil cytoplasmic antibody associated systemic vasculitis. Tumor necrosis factor alpha antagonists associated glomerulonephritis usually subsides after discontinuation of the therapy and subsequent initiation of corticosteroids and immunosuppressive agents. Here we describe crescentic glomerulonephritis progression to end-stage renal disease in a patient following two doses of TNF-alpha antagonists for the treatment of reactive arthritis. To our knowledge, dialysis dependent permanent renal loss after TNF-alpha antagonists has not yet been reported. We suggest the renal function should be closely monitored in patients treated with TNF-alpha antagonists by rheumatologists.

The perioperative outcomes between renal hilar and non-hilar tumors following robotic-assisted partial nephrectomy (RAPN).

PubMed

Lu, Shih-Yen; Chung, Hsiao-Jen; Huang, Eric Yi-Hsiu; Lin, Tzu-Pin; Lin, Alex T L

2018-03-15

The aim of this study was to compare the perioperative outcomes between renal hilar tumors and non-hilar tumors after robotic-assisted partial nephrectomy (RAPN). A retrospective review of consecutive patients who underwent RAPN from December 2009 to September 2015 at our institution was recruited. Perioperative outcomes including demographic characteristics, perioperative, pathological and renal function outcomes were compared between the hilar group (n = 30) and non-hilar group (n = 170). In characteristics, hilar group was younger (52.4 vs. 58 years, p = 0.04) and had less body mass index (23.7 vs. 25.4 kg/m 2 , p = 0.018). Hilar group had larger tumor size (4.8 vs. 3.7 cm, p = 0.009), higher Preoperative Aspects and Dimensions Used for an Anatomical (PADUA) score (10.7 vs. 8.5, p < 0.001) and higher RENAL (radius, exophytic/endophytic properties of the tumor, nearness of tumor deepest portion to the collecting system or sinus, anterior/posterior description and the location relative to polar lines) score (9.0 vs. 7.4, p < 0.001). Hilar tumor was associated with longer operative time (293.6 vs. 240.5 min, p = 0.001) and warm ischemia time (39.9 vs. 21.8 min, p < 0.001). But there was no statistically difference in estimated blood loss (EBL), postoperative stay and complication rate. For pathological outcomes, there was no difference of positive margin rate and pathological T stage between these groups. For renal function outcomes, hilar tumor patients had no difference of the change of creatinine and estimated glomerular filtration rate (eGFR) at postoperative 6 and 12 month as compared with non-hilar tumor patients. For renal hilar tumor, RAPN could provide acceptable results of perioperative, pathological and renal function outcome as compared with non-hilar tumor group. Thus RAPN is a safe and effective nephron-sparing surgery technique for renal hilar tumors. Copyright © 2018. Published by Elsevier Taiwan LLC.

Spontaneous Renal Tumors Suspected of Being Familial in Sprague-Dawley Rats

PubMed Central

Kudo, Kayoko; Hoshiya, Toru; Nakazawa, Tomomi; Saito, Tsubasa; Shimoyama, Natsumi; Suzuki, Isamu; Tamura, Kazutoshi; Seely, John Curtis

2012-01-01

Spontaneous renal tubule tumors (RTTs), with a distinctive morphological phenotype, were present in three Sprague-Dawley rats, 1 male and 2 females, out a total of 120 animals of each sex from untreated and placebo control groups in a 2-year carcinogenicity study. One female had one carcinoma, adenoma and hyperplasia, and the other female had five adenomas and many hyperplastic lesions; the male case had one carcinoma. From these cases, a biological continuum of hyperplasia, adenoma and carcinoma could be recognized. The tumors were present in the renal cortex and appeared as solid lobulated growths with occasional central necrosis. The lobules were divided by a small amount of fibrovascular tissue. Occasionally the larger tumors contained a cystic area. Tumor cells appeared distinctive and exhibited variable amounts of eosinophilic/amphophilic and vacuolated cytoplasm. Nuclei were round to oval with a prominent nucleolus. Mitotic figures were uncommon, and no distant metastasis was noted. The tumors were seen as multiple and bilateral lesions in two animals and had no apparent relationship to chronic progressive nephropathy (CPN). Foci of tubule hyperplasia were also noted to contain the same type of cellular morphology. The morphological and biological features of these 3 cases resembled the amphophilic-vacuolar (AV) variant of RTT that has been posited to be of familial origin. This is a report of spontaneous familial renal tumors in Sprague-Dawley rats from Japan. PMID:23345931

Renal cell tumors with clear cell histology and intact VHL and chromosome 3p: a histological review of tumors from the Cancer Genome Atlas database.

PubMed

Favazza, Laura; Chitale, Dhananjay A; Barod, Ravi; Rogers, Craig G; Kalyana-Sundaram, Shanker; Palanisamy, Nallasivam; Gupta, Nilesh S; Williamson, Sean R

2017-11-01

Clear cell renal cell carcinoma is by far the most common form of kidney cancer; however, a number of histologically similar tumors are now recognized and considered distinct entities. The Cancer Genome Atlas published data set was queried (http://cbioportal.org) for clear cell renal cell carcinoma tumors lacking VHL gene mutation and chromosome 3p loss, for which whole-slide images were reviewed. Of the 418 tumors in the published Cancer Genome Atlas clear cell renal cell carcinoma database, 387 had VHL mutation, copy number loss for chromosome 3p, or both (93%). Of the remaining, 27/31 had whole-slide images for review. One had 3p loss based on karyotype but not sequencing, and three demonstrated VHL promoter hypermethylation. Nine could be reclassified as distinct or emerging entities: translocation renal cell carcinoma (n=3), TCEB1 mutant renal cell carcinoma (n=3), papillary renal cell carcinoma (n=2), and clear cell papillary renal cell carcinoma (n=1). Of the remaining, 6 had other clear cell renal cell carcinoma-associated gene alterations (PBRM1, SMARCA4, BAP1, SETD2), leaving 11 specimens, including 2 high-grade or sarcomatoid renal cell carcinomas and 2 with prominent fibromuscular stroma (not TCEB1 mutant). One of the remaining tumors exhibited gain of chromosome 7 but lacked histological features of papillary renal cell carcinoma. Two tumors previously reported to harbor TFE3 gene fusions also exhibited VHL mutation, chromosome 3p loss, and morphology indistinguishable from clear cell renal cell carcinoma, the significance of which is uncertain. In summary, almost all clear cell renal cell carcinomas harbor VHL mutation, 3p copy number loss, or both. Of tumors with clear cell histology that lack these alterations, a subset can now be reclassified as other entities. Further study will determine whether additional entities exist, based on distinct genetic pathways that may have implications for treatment.

Renal transplantation-related risk factors for the development of uterine adenomatoid tumors.

PubMed

Mizutani, Teruyuki; Yamamuro, Osamu; Kato, Noriko; Hayashi, Kazumasa; Chaya, Junya; Goto, Norihiko; Tsuzuki, Toyonori

2016-08-01

•We analyzed the epidemiological factors for clinical manifestations of uterine adenomatoid tumors.•Renal transplantation with immunosuppression therapy is risk factor for the development of uterine adenomatoid tumors.•The length of time on dialysis is risk factor for the development of uterine adenomatoid tumors.

Mini-flank supra-12th rib incision for open partial nephrectomy for renal tumor with RENAL nephrometry score ≥10: an innovation of traditional open surgery.

PubMed

Wang, Hang; Sun, Li-an; Wang, Yiwei; Xiang, Zhuoyi; Zhou, Lin; Guo, Jianming; Wang, Guomin

2015-04-01

The skill of supra-12th rib mini-flank approach for open partial nephrectomy (MI-OPN) provides an advanced operative method for renal tumor. Compared with laparoscopic and robotic surgery, it may be a feasible selection for the complex renal tumors. We describe our techniques and results of MI-OPN in complex renal tumors with high RENAL nephrometry score (RENAL nephrometry score ≥10). Fifty-five patients diagnosed with renal tumors between January 2009 and July 2013 were included in this study. Eligibility criteria comprised of patients with complex renal tumor (RENAL score ≥10) being candidates for partial nephrectomy (PN). All patients received MI-OPN and all surgeries were performed by a single urologist. The preoperative workup comprised of medical history, physical examination, and routine laboratory tests. Serum creatinine was recorded preoperatively and 2 to 3 months after operation. Operative time, ischemia time, blood loss, operative and postoperative complications, renal function, and pathology parameters were recorded. MI-OPN was successfully performed in all cases. Mean tumor size was 4.7 cm (range: 2.5-8.1). Mean warm ischemia time was 28.1 minutes (range: 21-39), mean operative time was 105 minutes (range: 70-150) and mean estimated blood loss was 68 mL (range: 10-400). Mean postoperative hospital stay was 6.5 days (range: 5-12). Postoperative complications were found in 3 patients (5.5%). The mean pre- and postoperative serum creatinine levels were 76.2 μmol/L (range: 47-132) and 87.1 μmol/L (range: 61-189) with significant difference (P = 0.004). The mean pre- and postoperative estimated glomerular filtration rate (eGFR) were 91.5 (range: 34-133) and 82.5 (range: 22-126.5), respectively with significant difference (P = 0.024). In an average follow-up of 19.9 months (range: 8-50), no local recurrence or systemic progression occurred. In conclusion, MI-OPN can combine the benefits of both minimal invasive and traditional open

Differentiation of Solid Renal Tumors with Multiparametric MR Imaging.

PubMed

Lopes Vendrami, Camila; Parada Villavicencio, Carolina; DeJulio, Todd J; Chatterjee, Argha; Casalino, David D; Horowitz, Jeanne M; Oberlin, Daniel T; Yang, Guang-Yu; Nikolaidis, Paul; Miller, Frank H

2017-01-01

Characterization of renal tumors is critical to determine the best therapeutic approach and improve overall patient survival. Because of increased use of high-resolution cross-sectional imaging in clinical practice, renal masses are being discovered with increased frequency. As a result, accurate imaging characterization of these lesions is more important than ever. However, because of the wide array of imaging features encountered as well as overlapping characteristics, identifying reliable imaging criteria for differentiating malignant from benign renal masses remains a challenge. Multiparametric magnetic resonance (MR) imaging based on various anatomic and functional parameters has an important role and adds diagnostic value in detection and characterization of renal masses. MR imaging may allow distinction of benign solid renal masses from several renal cell carcinoma (RCC) subtypes, potentially suggest the histologic grade of a neoplasm, and play an important role in ensuring appropriate patient management to avoid unnecessary surgery or other interventions. It is also a useful noninvasive imaging tool for patients who undergo active surveillance of renal masses and for follow-up after treatment of a renal mass. The purpose of this article is to review the characteristic MR imaging features of RCC and common benign renal masses and propose a diagnostic imaging approach to evaluation of solid renal masses using multiparametric MR imaging. © RSNA, 2017.

Fish oil supplementation reduces cachexia and tumor growth while improving renal function in tumor-bearing rats.

PubMed

Coelho, Isabela; Casare, Fernando; Pequito, Danielle C T; Borghetti, Gina; Yamazaki, Ricardo K; Brito, Gleisson A P; Kryczyk, Marcelo; Fernandes, Luiz Claudio; Coimbra, Terezila M; Fernandez, Ricardo

2012-11-01

The objective of the present work was to study the renal function of healthy and tumor-bearing rats chronically supplemented with fish oil (FO), a source of n-3 polyunsaturated fatty acids. Weanling male rats were divided in two groups, one control (C) and another orally supplemented for 70 days with FO (1 g/kg body weight). After this time, half the animals of each group were injected in the right flank with a suspension of Walker 256 tumor cells (W and WFO). The W group had less proteinemia reflecting cachectic proteolysis, FO reversed this fact. Tumor weight gain was also reduced in WFO. Glomerular filtration rate (GFR) was not different in FO or W compared to C, but was higher in WFO. Renal plasma flow (RPF) was higher in the FO supplemented groups. The W group had lower plasma osmolality than the C group, but FO supplementation resulted in normalization of this parameter. Fractional sodium excretion (FE(Na+)) of FO rats was similar to C. Proximal Na(+) reabsorption, evaluated by lithium clearance, was similar among the groups. Urinary thromboxane B(2) (TXB(2)) excretion was lower in the supplemented groups. The number of macrophages in renal tissue was higher in W compared to C rats, but was lower in WFO rats compared to W rats. In conclusion, FO supplementation resulted in less tumor growth and cachexia, and appeared to be renoprotective, as suggested by higher RPF and GFR.

Quantitative Contour Analysis as an Image-based Discriminator Between Benign and Malignant Renal Tumors.

PubMed

Yap, Felix Y; Hwang, Darryl H; Cen, Steven Y; Varghese, Bino A; Desai, Bhushan; Quinn, Brian D; Gupta, Megha Nayyar; Rajarubendra, Nieroshan; Desai, Mihir M; Aron, Manju; Liang, Gangning; Aron, Monish; Gill, Inderbir S; Duddalwar, Vinay A

2018-04-01

To investigate whether morphologic analysis can differentiate between benign and malignant renal tumors on clinically acquired imaging. Between 2009 and 2014, 3-dimensional tumor volumes were manually segmented from contrast-enhanced computerized tomography (CT) images from 150 patients with predominantly solid, nonmacroscopic fat-containing renal tumors: 100 renal cell carcinomas and 50 benign lesions (eg, oncocytoma and lipid-poor angiomyolipoma). Tessellated 3-dimensional tumor models were created from segmented voxels using MATLAB code. Eleven shape descriptors were calculated: sphericity, compactness, mean radial distance, standard deviation of the radial distance, radial distance area ratio, zero crossing, entropy, Feret ratio, convex hull area and convex hull perimeter ratios, and elliptic compactness. Morphometric parameters were compared using the Wilcoxon rank-sum test to investigate whether malignant renal masses demonstrate more morphologic irregularity than benign ones. Only CHP in sagittal orientation (median 0.96 vs 0.97) and EC in coronal orientation (median 0.92 vs 0.93) differed significantly between malignant and benign masses (P = .04). When comparing these 2 metrics between coronal and sagittal orientations, similar but nonsignificant trends emerged (P = .07). Other metrics tested were not significantly different in any imaging plane. Computerized image analysis is feasible using shape descriptors that otherwise cannot be visually assessed and used without quantification. Shape analysis via the transverse orientation may be reasonable, but encompassing all 3 planar dimensions to characterize tumor contour can achieve a more comprehensive evaluation. Two shape metrics (CHP and EC) may help distinguish benign from malignant renal tumors, an often challenging goal to achieve on imaging and biopsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Embolization of renal angiomyolipomas: short-term and long-term outcomes, complications, and tumor shrinkage.

PubMed

Lee, Shen-Yang; Hsu, Hsiang-Hao; Chen, Yung-Chang; Huang, Chen-Chih; Wong, Yon-Cheong; Wang, Li-Jen; Chuang, Cheng-Keng; Yang, Chih-Wei

2009-11-01

This study retrospectively evaluated outcomes, complications, and tumor shrinkage in renal angiomyolipomas after transcatheter arterial embolization (TAE). All renal angiomyolipoma patients who underwent TAE between August 2000 and December 2008 and had short-term (6 months) follow-up images were evaluated. Complications and tumor relapse after TAE were reviewed. The sizes of embolized tumors were measured to calculate size reductions and reduction rates after TAE. Differences in tumor size, size reduction, and reduction rate between different time points (pre-TAE, short-term follow-up, and long-term follow-up) and groups (completely and incompletely embolized) were determined. Eleven renal angiomyolipoma patients who had undergone TAE were included. Seven (63.6%) patients had postembolization syndrome and one had abscess formation following TAE. Two patients had a tumor relapse (18.2%). The mean tumor size was 8.57+/-2.66 cm on pre-TAE images. The mean size reduction was 3.1 cm (33.3%) and 3.8 cm (43.0%) at short-term and long-term follow-up. Tumor sizes differed significantly between pre-TAE and short-term (p=0.004) or long-term images (p=0.022) but not between short-term and long-term images (p=0.059). Results stratified by the completeness of embolization indicate that only the short-term size reduction rate differed significantly (p=0.025), while the long-term reduction rate and short- and long-term follow-up tumor size and size reduction were comparable between the two groups. In conclusion, selective TAE is effective for tumor shrinkage in most renal angiomyolipomas, with acceptable complication and relapse rates. Tumor shrinkage occurring within 6 months after TAE may reflect the long-term effect of TAE.

Clinical and Molecular Features of Renal and Pheochromocytoma/Paraganglioma Tumor Association Syndrome (RAPTAS): Case Series and Literature Review.

PubMed

Casey, Ruth T; Warren, Anne Y; Martin, Jose Ezequiel; Challis, Benjamin G; Rattenberry, Eleanor; Whitworth, James; Andrews, Katrina A; Roberts, Thomas; Clark, Graeme R; West, Hannah; Smith, Philip S; Docquier, France M; Rodger, Fay; Murray, Vicki; Simpson, Helen L; Wallis, Yvonne; Giger, Olivier; Tran, Maxine; Tomkins, Susan; Stewart, Grant D; Park, Soo-Mi; Woodward, Emma R; Maher, Eamonn R

2017-11-01

The co-occurrence of pheochromocytoma (PC) and renal tumors was linked to the inherited familial cancer syndrome von Hippel-Lindau (VHL) disease more than six decades ago. Subsequently, other shared genetic causes of predisposition to renal tumors and to PC, paraganglioma (PGL), or head and neck paraganglioma (HNPGL) have been described, but case series of non-VHL-related cases of renal tumor and pheochromocytoma/paraganglioma tumor association syndrome (RAPTAS) are rare. To determine the clinical and molecular features of non-VHL RAPTAS by literature review and characterization of a case series. A review of the literature was performed and a retrospective study of referrals for investigation of genetic causes of RAPTAS. Literature review revealed evidence of an association, in addition to VHL disease, between germline mutations in SDHB, SDHC, SDHD, TMEM127, and MAX genes and RAPTAS [defined here as the co-occurrence of tumors from both classes (PC/PGL/HNPGL and renal tumors) in the same individual or in first-degree relatives]. In both the literature review and our case series of 22 probands with non-VHL RAPTAS, SDHB mutations were the most frequent cause of non-VHL RAPTAS. A genetic cause was identified in 36.3% (8/22) of kindreds. Renal tumors and PC/PGL/HNPGL tumors share common molecular features and their co-occurrence in an individual or family should prompt genetic investigations. We report a case of MAX-associated renal cell carcinoma and confirm the role of TMEM127 mutations with renal cell carcinoma predisposition. Copyright © 2017 Endocrine Society

Aggressive Renal Angiomyolipoma in a Patient with Tuberous Sclerosis Resulting in Pulmonary Tumor Embolus and Pulmonary Infarction.

PubMed

Mettler, John; Al-Katib, Sayf

2018-06-07

Renal angiomyolipoma (AML) is the most commonly encountered mesenchymal tumor of the kidney which can present spontaneously or in association with tuberous sclerosis complex. Rarely, renal AMLs may demonstrate aggressive features such as renal vein invasion. This common entity and its uncommon complications are diagnosed based on physical examination and computed tomography results. Here we report imaging findings of a renal AML with renal vein and inferior vena cava invasion resulting in pulmonary tumor embolus and pulmonary infarction. Copyright © 2018. Published by Elsevier Inc.

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma.

PubMed

Ambrosio, Maria R; Rocca, Bruno J; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T; Tripodi, Sergio A; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis.

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma

PubMed Central

Ambrosio, Maria R.; Rocca, Bruno J.; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T.; Tripodi, Sergio A.; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis. PMID:26425551

MUTATIONS IN THE VHL GENE FRIOM POTASSIUM BROMATE-INDUCED RAT CLEAR CELL RENAL TUMORS

EPA Science Inventory

Potassium bromate (KBrO3) is a rat renal carcinogen and a major drinking water disinfection by-product in water disinfected with ozone. Clear cell renal tumors, the most common form of human renal epithelial neoplasm, are rare in animals but are inducible by KBrO3 in F344 rats. ...

Anatomic and Radiologic Study of Renal Avascular Plane (Brödel's Line) and Its Potential Relevance on Percutaneous and Surgical Approaches to the Kidney.

PubMed

Macchi, Veronica; Picardi, Edgardo; Inferrera, Antonino; Porzionato, Andrea; Crestani, Alessandro; Novara, Giacomo; De Caro, Raffaele; Ficarra, Vincenzo

2018-02-01

The aim of the present anatomic and radiologic study was to evaluate the location, extension, and characteristics of the Brödel's plane and eventually define its different patterns. We evaluated 15 human normal kidneys sampled from unembalmed cadavers without clinical history or anatomical evidence of renal diseases. Kidneys with the surrounding perirenal fat tissue were removed en bloc with the abdominal segment of the aorta. The renal artery was injected with acrylic and radiopaque resins. A CT examination of the injected kidneys was performed. After the imaging acquisition, the specimens were treated with sodium hydroxide for removal of the parenchyma to obtain the vascular casts. All the CT images were elaborated using dedicated three-dimensional (3D) software with the aim to improve the possibility to identify the Brödel's plane. The avascular plane was identified directly on the vascular casts and confirmed on the corresponding 3D images. The avascular plane was located in all cases medially to the lateral convex border of the kidneys. The recorded mean distance was 2.04 cm (range 1.8-2.4 cm). Three patterns of distribution of the Brödel's line were identified. In five (33.3%) cases the avascular plane was extended from the apical to the inferior segment of the kidneys (type 1); in six (40%) from the superior to the inferior segment (type 2); and in four (26.7%) from the apical to the middle segment (type 3). Fourth and fifth order vessels crossing the Brödel's line were detected in all the analyzed cases. The renal avascular plane showed a different extension allowing us to cluster three different patterns. Preoperative identification of the Brödel's line patterns could help surgeons to minimize hemorrhagic complications during percutaneous and surgical procedures requiring an incision of the renal parenchyma such as traditional or robot-assisted nephrolithotomy or partial nephrectomy for endophytic renal tumors. Radiologic studies validated that

Prospective Evaluation of (99m)Tc-sestamibi SPECT/CT for the Diagnosis of Renal Oncocytomas and Hybrid Oncocytic/Chromophobe Tumors.

PubMed

Gorin, Michael A; Rowe, Steven P; Baras, Alexander S; Solnes, Lilja B; Ball, Mark W; Pierorazio, Phillip M; Pavlovich, Christian P; Epstein, Jonathan I; Javadi, Mehrbod S; Allaf, Mohamad E

2016-03-01

Nuclear imaging offers a potential noninvasive means of determining the histology of renal tumors. The aim of this study was to evaluate the accuracy of technetium-99m ((99m)Tc)-sestamibi single-photon emission computed tomography/x-ray computed tomography (SPECT/CT) for the differentiation of oncocytomas and hybrid oncocytic/chromophobe tumors (HOCTs) from other renal tumor histologies. In total, 50 patients with a solid clinical T1 renal mass were imaged with (99m)Tc-sestamibi SPECT/CT prior to surgical resection. Preoperative SPECT/CT scans were reviewed by two blinded readers, and their results were compared with centrally reviewed surgical pathology data. Following surgery, 6 (12%) tumors were classified as renal oncocytomas and 2 (4%) as HOCTs. With the exception of 1 (2%) angiomyolipoma, all other tumors were renal cell carcinomas (82%). (99m)Tc-sestamibi SPECT/CT correctly identified 5 of 6 (83.3%) oncocytomas and 2 of 2 (100%) HOCTs, resulting in an overall sensitivity of 87.5% (95% confidence interval [CI], 47.4-99.7%). Only two tumors were falsely positive on SPECT/CT, resulting in a specificity of 95.2% (95% CI, 83.8-99.4%). In summary, (99m)Tc-sestamibi SPECT/CT is a promising imaging test for the noninvasive diagnosis of renal oncocytomas and HOCTs. We found that the imaging test (99m)Tc-sestamibi SPECT/CT can be used to accurately diagnose two types of benign kidney tumors. This test may be eventually used to help better evaluate patients diagnosed with a renal tumor. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Cryoablation of Bone Metastases from Renal Cell Carcinoma for Local Tumor Control.

PubMed

Gardner, Carly S; Ensor, Joe E; Ahrar, Kamran; Huang, Steven Y; Sabir, Sharjeel H; Tannir, Nizar M; Lewis, Valerae O; Tam, Alda L

2017-11-15

Patients with bone metastases from renal cell carcinoma often are not surgical candidates and have a poor prognosis. There are limited data on the use of cryoablation as a locoregional therapy for bone metastases. Our objective was to assess the local tumor-control rate following cryoablation of bone metastases in the setting of renal cell carcinoma. We retrospectively reviewed the medical records of patients with metastatic renal cell carcinoma who underwent cryoablation for bone metastases between 2007 and 2014. We excluded patients if the intent of treatment was for pain palliation only, if cryoablation was performed without an attempt for complete tumor control (cytoreduction), or if the patient had no further follow-up beyond the cryoablation procedure. We recorded patient demographics, procedural variables, and complications. Cross-sectional imaging and clinical follow-up were reviewed to determine disease recurrence. The median overall survival and recurrence-free survival were determined using the Kaplan-Meier method. Forty patients (30 male and 10 female) with 50 bone metastases were included for analysis. The mean patient age was 62 years (range, 47 to 82 years). The median follow-up was 35 months (95% confidence interval [CI], 22.7 to 74.4 months). Twenty-five (62.5%) of the 40 patients had oligometastatic disease, defined as ≤5 metastases at the time of ablation. The mean tumor size was 3.4 ± 1.5 cm. Metastases in the pelvic region represented 68% of the treated tumors (34 of 50). The overall local tumor-control rate per lesion was 82% (41 of 50). Patients with oligometastatic disease experienced better local tumor control (96% [24 of 25]) compared with patients who had >5 metastases (53.3% [8 of 15]) (p = 0.001). The local tumor-control rate was better for lesions for which a larger mean difference between maximum ice-ball diameter and maximum lesion diameter was achieved (2.2 ± 0.9 cm for those without recurrence versus 1.35 ± 1.2 cm for those

Retro-peritoneoscopic assisted cryoablation for small renal tumors: the first cases treated in Romania.

PubMed

Ghervan, L; Lucan, V; Elec, F; Suciu, M; Bologa, F; Iacob, Gh; Lucan, M

2007-01-01

Nephron-sparing surgery (NSS), has been demonstrated to be a safe and effective alternative to radical nephrectomy for selected cases. Retro-peritoneoscopic cryoablation (RCA), combine the benefits of minimal invasiveness of the laparoscopy with the advantage of preserving renal function of the nephron sparing surgery. The aim of our study was to assess the initial results with RCA of small renal tumors. Since Jan 2007, twelve consecutive patients, with small renal tumors (mean tumor size 3.89 cm) underwent RCA at our institution. The patients were assessed using: clinical exam, lab exam, ultrasound, contrast enhanced CT scan. For cryoablation, we used the Galil Medical SeedNet with 17 Gauge cryoprobes, under combined retro-peritoneoscopic and ultrasound guidance. Protocol follow-up design includes clinical exam, lab exam and contrast enhanced CT scan at 3,6 and 12 months and annually thereafter. Mean surgical time was 145.42 min. and mean blood loss was 179.17 ml. Two patients presented: bleeding at the extraction of the cryoprobes and urinary fistula which healed with surgical treatment. Histological examination of the core biopsy revealed clear cell carcinoma in 8 patients, papillary carcinoma in 3 patients and angiomyolipoma in 1 patient. Cryosurgical ablation of small renal tumors using multiple ultrathin 17 Gauge cryoprobes is a feasible treatment option. Retro-peritoneoscopic approach allows optimal access to the kidney and endoscopic real-time ultrasound control of the freezing process.

Is Anatomic Complexity Associated with Renal Tumor Growth Kinetics Under Active Surveillance?

PubMed Central

Mehrazin, Reza; Smaldone, Marc C.; Egleston, Brian; Tomaszewski, Jeffrey J.; Concodora, Charles W.; Ito, Timothy K.; Abbosh, Philip H.; Chen, David Y.T.; Kutikov, Alexander; Uzzo, Robert G.

2015-01-01

Introduction Linear growth rate (LGR) is the most commonly employed trigger for definitive intervention in patients with renal masses managed with an initial period of active surveillance (AS). Using our institutional cohort, we explored the association between tumor anatomic complexity at presentation and LGR in patients managed with AS. Methods and Materials Enhancing renal masses managed expectantly for at least 6 months were included for analysis. The association between NS and LGR was assessed using generalized estimating equations, adjusting for age, Charlson score, race, sex, and initial tumor size. Results 346 patients (401 masses) met inclusion criteria (18% ≥cT1b), with a median follow-up of 37 months (range: 6-169). 44% of patients progressed to definitive intervention with a median duration of 27 months (range: 6-130). Comparing patients managed expectantly to those requiring intervention, no difference was seen in median tumor size at presentation (2.2 vs. 2.2 cm), while significant differences in median age (74 vs. 65 years, p<0.001), Charlson co-morbidity score (3 vs. 2, p<0.001), and average LGR (0.23 vs. 0.49 cm/year, p<0.001) were observed between groups. Following adjustment, for each 1-point increase in NS sum, the average tumor LGR increased by 0.037 cm/year (p=0.002). Of the entire cohort, 6 patients (1.7%) progressed to metastatic disease. Conclusions The demonstrated association between anatomic tumor complexity at presentation and LGR of clinical stage 1 renal masses under AS may afford a clinically useful cue to tailor individual patient radiographic surveillance schedules and warrants further evaluation. PMID:25778696

Is anatomic complexity associated with renal tumor growth kinetics under active surveillance?

PubMed

Mehrazin, Reza; Smaldone, Marc C; Egleston, Brian; Tomaszewski, Jeffrey J; Concodora, Charles W; Ito, Timothy K; Abbosh, Philip H; Chen, David Y T; Kutikov, Alexander; Uzzo, Robert G

2015-04-01

Linear growth rate (LGR) is the most commonly employed trigger for definitive intervention in patients with renal masses managed with an initial period of active surveillance (AS). Using our institutional cohort, we explored the association between tumor anatomic complexity at presentation and LGR in patients managed with AS. Enhancing renal masses managed expectantly for at least 6 months were included for analysis. The association between Nephrometry Score and LGR was assessed using generalized estimating equations, adjusting for the age, Charlson score, race, sex, and initial tumor size. Overall, 346 patients (401 masses) met the inclusion criteria (18% ≥ cT1b), with a median follow-up of 37 months (range: 6-169). Of these, 44% patients showed progression to definitive intervention with a median duration of 27 months (range: 6-130). On comparing patients managed expectantly to those requiring intervention, no difference was seen in median tumor size at presentation (2.2 vs. 2.2 cm), whereas significant differences in median age (74 vs. 65 y, P < 0.001), Charlson comorbidity score (3 vs. 2, P<0.001), and average LGR (0.23 vs. 0.49 cm/y, P < 0.001) were observed between groups. Following adjustment, for each 1-point increase in Nephrometry Score sum, the average tumor LGR increased by 0.037 cm/y (P = 0.002). Of the entire cohort, 6 patients (1.7%) showed progression to metastatic disease. The demonstrated association between anatomic tumor complexity at presentation and renal masses of LGR of clinical stage 1 under AS may afford a clinically useful cue to tailor individual patient radiographic surveillance schedules and warrants further evaluation. Copyright © 2015 Elsevier Inc. All rights reserved.

UBE2QL1 is Disrupted by a Constitutional Translocation Associated with Renal Tumor Predisposition and is a Novel Candidate Renal Tumor Suppressor Gene

PubMed Central

Wake, Naomi C; Ricketts, Christopher J; Morris, Mark R; Prigmore, Elena; Gribble, Susan M; Skytte, Anne-Bine; Brown, Michael; Clarke, Noel; Banks, Rosamonde E; Hodgson, Shirley; Turnell, Andrew S; Maher, Eamonn R; Woodward, Emma R

2013-01-01

Investigation of rare familial forms of renal cell carcinoma (RCC) has led to the identification of genes such as VHL and MET that are also implicated in the pathogenesis of sporadic RCC. In order to identify a novel candidate renal tumor suppressor gene, we characterized the breakpoints of a constitutional balanced translocation, t(5;19)(p15.3;q12), associated with familial RCC and found that a previously uncharacterized gene UBE2QL1 was disrupted by the chromosome 5 breakpoint. UBE2QL1 mRNA expression was downregulated in 78.6% of sporadic RCC and, although no intragenic mutations were detected, gene deletions and promoter region hypermethylation were detected in 17.3% and 20.3%, respectively, of sporadic RCC. Reexpression of UBE2QL1 in a deficient RCC cell line suppressed anchorage-independent growth. UBE2QL1 shows homology to the E2 class of ubiquitin conjugating enzymes and we found that (1) UBE2QL1 possesses an active-site cysteine (C88) that is monoubiquitinated in vivo, and (2) UBE2QL1 interacts with FBXW7 (an F box protein providing substrate recognition to the SCF E3 ubiquitin ligase) and facilitates the degradation of the known FBXW7 targets, CCNE1 and mTOR. These findings suggest UBE2QL1 as a novel candidate renal tumor suppressor gene. PMID:24000165

Clinical implications of a rare renal entity: Pleomorphic Hyalinizing Angiectatic Tumor (PHAT).

PubMed

Scalici Gesolfo, Cristina; Serretta, Vincenzo; Di Maida, Fabrizio; Giannone, Giulio; Barresi, Elisabetta; Franco, Vito; Montironi, Rodolfo

2017-02-01

Pleomorphic Hyalinizing Angiectatic Tumor (PHAT) is a rare benign lesion characterized by slow growth, infiltrative behavior and high rate of local recurrences. Only one case has been described in retroperitoneum, at renal hilum, but not involving pelvis or parenchyma. Here we present the first case of PHAT arising in the renal parenchyma. A nodular lesion in right kidney lower pole was diagnosed to a 61 year old woman. The patient underwent right nephrectomy. Microscopically, the lesion showed solid and pseudo-cystic components with hemorrhagic areas characterized by aggregates of ectatic blood vessels. Pleomorphic cells were characterized by large eosinophilic cytoplasm with irregular and hyperchromatic nuclei. Immunohistochemistry was performed and the lesion was classified as a Pleomorphic Hyalinizing Angiectatic Tumor (PHAT). Due to the clinical behavior of this tumor, in spite of its benign nature, review of the surgical margins and close follow up after partial nephrectomy are mandatory. Copyright © 2016. Published by Elsevier GmbH.

Surgical management of renal cell cancer with tumor thrombus through an exclusive transabdominal approach.

PubMed

González, Javier; Angulo, J; Ciancio, G

2011-04-01

Renal cell cancer with tumor thrombus is present in 4-15% of cases. The prognostic significance of this entity has been object of intense debate. Nowadays, it is considered, that the presence of thrombus itself does not have a negative prognostic impact on survival rates if the thrombus could be excised satisfactorily. Complete removal of renal malignant tissue is the only curative strategy for the treatment of this kind of tumors. During the last three decades, there has been steady improvements in surgical technique and preoperative care fields that have favorably modified the surgeons' ability to safely excise these tumors. In this sense, the experience provided by multiorgan, kidney-pancreas and liver procurement and transplantation techniques led the urologists reexamine their approaches to the inferior vena cava and retroperitoneum, thus they could result useful in the always challenging resection of these complex tumors with neoplasic extension into the vena cava.

Oncocytoma-Like Renal Tumor With Transformation Toward High-Grade Oncocytic Carcinoma

PubMed Central

Sirintrapun, Sahussapont J.; Geisinger, Kim R.; Cimic, Adela; Snow, Anthony; Hagenkord, Jill; Monzon, Federico; Legendre, Benjamin L.; Ghazalpour, Anatole; Bender, Ryan P.; Gatalica, Zoran

2014-01-01

Abstract Renal oncocytoma is a benign tumor with characteristic histologic findings. We describe an oncocytoma-like renal tumor with progression to high-grade oncocytic carcinoma and metastasis. A 74-year-old man with no family history of cancer presented with hematuria. Computed tomography showed an 11 cm heterogeneous multilobulated mass in the right kidney lower pole, enlarged aortocaval lymph nodes, and multiple lung nodules. In the nephrectomy specimen, approximately one third of the renal tumor histologically showed regions classic for benign oncocytoma transitioning to regions of high-grade carcinoma without sharp demarcation. With extensive genomic investigation using single nucleotide polymorphism-based array virtual karyotyping, multiregion sequencing, and expression array analysis, we were able to show a common lineage between the benign oncocytoma and high-grade oncocytic carcinoma regions in the tumor. We were also able to show karyotypic differences underlying this progression. The benign oncocytoma showed no chromosomal aberrations, whereas the high-grade oncocytic carcinoma showed loss of the 17p region housing FLCN (folliculin [Birt–Hogg–Dubé protein]), loss of 8p, and gain of 8q. Gene expression patterns supported dysregulation and activation of phosphoinositide 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homolog (Akt), mitogen-activated protein kinase (MAPK)/extracellular-signal-regulated kinase (ERK), and mechanistic target of rapamycin (serine/threonine kinase) (mTOR) pathways in the high-grade oncocytic carcinoma regions. This was partly attributable to FLCN underexpression but further accentuated by overexpression of numerous genes on 8q. In the high-grade oncocytic carcinoma region, vascular endothelial growth factor A along with metalloproteinases matrix metallopeptidase 9 and matrix metallopeptidase 12 were overexpressed, facilitating angiogenesis and invasiveness. Genetic molecular testing provided evidence for the

Development and Validity of a Silicone Renal Tumor Model for Robotic Partial Nephrectomy Training.

PubMed

Monda, Steven M; Weese, Jonathan R; Anderson, Barrett G; Vetter, Joel M; Venkatesh, Ramakrishna; Du, Kefu; Andriole, Gerald L; Figenshau, Robert S

2018-04-01

To provide a training tool to address the technical challenges of robot-assisted laparoscopic partial nephrectomy, we created silicone renal tumor models using 3-dimensional printed molds of a patient's kidney with a mass. In this study, we assessed the face, content, and construct validity of these models. Surgeons of different training levels completed 4 simulations on silicone renal tumor models. Participants were surveyed on the usefulness and realism of the model as a training tool. Performance was measured using operation-specific metrics, self-reported operative demands (NASA Task Load Index [NASA TLX]), and blinded expert assessment (Global Evaluative Assessment of Robotic Surgeons [GEARS]). Twenty-four participants included attending urologists, endourology fellows, urology residents, and medical students. Post-training surveys of expert participants yielded mean results of 79.2 on the realism of the model's overall feel and 90.2 on the model's overall usefulness for training. Renal artery clamp times and GEARS scores were significantly better in surgeons further in training (P ≤.005 and P ≤.025). Renal artery clamp times, preserved renal parenchyma, positive margins, NASA TLX, and GEARS scores were all found to improve across trials (P <.001, P = .025, P = .024, P ≤.020, and P ≤.006, respectively). Face, content, and construct validity were demonstrated in the use of a silicone renal tumor model in a cohort of surgeons of different training levels. Expert participants deemed the model useful and realistic. Surgeons of higher training levels performed better than less experienced surgeons in various study metrics, and improvements within individuals were observed over sequential trials. Future studies should aim to assess model predictive validity, namely, the association between model performance improvements and improvements in live surgery. Copyright © 2018 Elsevier Inc. All rights reserved.

Subtype differentiation of renal tumors using voxel-based histogram analysis of intravoxel incoherent motion parameters.

PubMed

Gaing, Byron; Sigmund, Eric E; Huang, William C; Babb, James S; Parikh, Nainesh S; Stoffel, David; Chandarana, Hersh

2015-03-01

The aim of this study was to determine if voxel-based histogram analysis of intravoxel incoherent motion imaging (IVIM) parameters can differentiate various subtypes of renal tumors, including benign and malignant lesions. A total of 44 patients with renal tumors who underwent surgery and had histopathology available were included in this Health Insurance Portability and Accountability Act-compliant, institutional review board-approved, single-institution prospective study. In addition to routine renal magnetic resonance imaging examination performed on a 1.5-T system, all patients were imaged with axial diffusion-weighted imaging using 8 b values (range, 0-800 s/mm). A biexponential model was fitted to the diffusion signal data using a segmented algorithm to extract the IVIM parameters perfusion fraction (fp), tissue diffusivity (Dt), and pseudodiffusivity (Dp) for each voxel. Mean and histogram measures of heterogeneity (standard deviation, skewness, and kurtosis) of IVIM parameters were correlated with pathology results of tumor subtype using unequal variance t tests to compare subtypes in terms of each measure. Correction for multiple comparisons was accomplished using the Tukey honestly significant difference procedure. A total of 44 renal tumors including 23 clear cell (ccRCC), 4 papillary (pRCC), 5 chromophobe, and 5 cystic renal cell carcinomas, as well as benign lesions, 4 oncocytomas (Onc) and 3 angiomyolipomas (AMLs), were included in our analysis. Mean IVIM parameters fp and Dt differentiated 8 of 15 pairs of renal tumors. Histogram analysis of IVIM parameters differentiated 9 of 15 subtype pairs. One subtype pair (ccRCC vs pRCC) was differentiated by mean analysis but not by histogram analysis. However, 2 other subtype pairs (AML vs Onc and ccRCC vs Onc) were differentiated by histogram distribution parameters exclusively. The standard deviation of Dt [σ(Dt)] differentiated ccRCC (0.362 ± 0.136 × 10 mm/s) from AML (0.199 ± 0.043 × 10 mm/s) (P = 0

Lin28 sustains early renal progenitors and induces Wilms tumor

PubMed Central

Urbach, Achia; Yermalovich, Alena; Zhang, Jin; Spina, Catherine S.; Zhu, Hao; Perez-Atayde, Antonio R.; Shukrun, Rachel; Charlton, Jocelyn; Sebire, Neil; Mifsud, William; Dekel, Benjamin; Pritchard-Jones, Kathy; Daley, George Q.

2014-01-01

Wilms Tumor, the most common pediatric kidney cancer, evolves from the failure of terminal differentiation of the embryonic kidney. Here we show that overexpression of the heterochronic regulator Lin28 during kidney development in mice markedly expands nephrogenic progenitors by blocking their final wave of differentiation, ultimately resulting in a pathology highly reminiscent of Wilms tumor. Using lineage-specific promoters to target Lin28 to specific cell types, we observed Wilms tumor only when Lin28 is aberrantly expressed in multiple derivatives of the intermediate mesoderm, implicating the cell of origin as a multipotential renal progenitor. We show that withdrawal of Lin28 expression reverts tumorigenesis and markedly expands the numbers of glomerulus-like structures and that tumor formation is suppressed by enforced expression of Let-7 microRNA. Finally, we demonstrate overexpression of the LIN28B paralog in a significant percentage of human Wilms tumor. Our data thus implicate the Lin28/Let-7 pathway in kidney development and tumorigenesis. PMID:24732380

Value of percutaneous needle biopsy of small renal tumors in patients referred for cryoablation.

PubMed

Iguchi, Toshihiro; Hiraki, Takao; Gobara, Hideo; Fujiwara, Hiroyasu; Sakurai, Jun; Matsui, Yusuke; Araki, Motoo; Nasu, Yasutomo; Kanazawa, Susumu

2017-04-01

To retrospectively evaluate the safety and diagnostic yield of needle biopsy of small renal tumors, and the clinical consequences of performing needle biopsy in patients referred for percutaneous cryoablation before their treatment. Biopsy was performed for 120 tumors (mean diameter, 2.2 cm) in 119 patients. All procedures were divided into diagnostic and non-diagnostic biopsies. Various variables were compared between the two groups. All cryoablation procedures were divided into two groups: procedures with or without simultaneous biopsy. The rates of benign or non-diagnostic tumors in each group were compared. After performing 120 initial and eight repeat biopsies, Grade 1 bleedings occurred in 44 cases. Six tumors were non-diagnostic and 114 were pathologically diagnosed. There were no significant variables between the diagnostic and non-diagnostic biopsies. Unnecessary cryoablation was avoided in nine benign lesions by performing biopsy in advance. Cryoablation performed simultaneously with biopsy included significantly more benign or non-diagnostic tumors than cryoablation performed after biopsy (15.2% vs. 1.4%; p = .01). Percutaneous biopsy of small renal tumors referred for cryoablation was a safe procedure with high diagnostic yield. The confirmation of pathological diagnosis prior to cryoablation is necessary because patients with benign tumors can avoid unnecessary treatment.

Renal arteriography

MedlinePlus

Renal angiogram; Angiography - kidney; Renal angiography; Renal artery stenosis - arteriography ... an artery by a blood clot Renal artery stenosis Renal cell cancer Angiomyolipomas (noncancerous tumors of the ...

Ochratoxin a and mitotic disruption: mode of action analysis of renal tumor formation by ochratoxin A.

PubMed

Mally, Angela

2012-06-01

The mycotoxin and food contaminant ochratoxin A (OTA) is a potent renal carcinogen in rodents, but its mode of action (MoA) is still poorly defined. In 2006, the European Food Safety Authority concluded that there is a "lack of evidence for the existence of OTA-DNA adducts" and thus insufficient evidence to establish DNA reactivity as a MoA for tumor formation by OTA. In reviewing the available database on OTA toxicity, a MoA for renal carcinogenicity of OTA is developed that involves a combination of genetic instability and increased proliferative drive as consequences of OTA-mediated disruption of mitosis, whereby the organ- and site-specificity of tumor formation by OTA is determined by selective renal uptake of OTA into the proximal tubule epithelium. The proposed MoA is critically assessed with respect to concordance of dose-response of the suggested key events and tumor formation, their temporal association, consistency, and biological plausibility. Uncertainties, data gaps and needs for further research are highlighted.

Molecular analysis of tumor margins by MALDI mass spectrometry in renal carcinoma.

PubMed

Oppenheimer, Stacey R; Mi, Deming; Sanders, Melinda E; Caprioli, Richard M

2010-05-07

The rate of tumor recurrence post resection suggests that there are underlying molecular changes in nearby histologically normal tissue that go undetected by conventional diagnostic methods that utilize contrast agents and immunohistochemistry. MALDI MS is a molecular technology that has the specificity and sensitivity to monitor and identify molecular species indicative of these changes. The current study utilizes this technology to assess molecular distributions within a tumor and adjacent normal tissue in clear cell renal cell carcinoma biopsies. Results indicate that the histologically normal tissue adjacent to the tumor expresses many of the molecular characteristics of the tumor. Proteins of the mitochondrial electron transport system are examples of such distributions. This work demonstrates the utility of MALDI MS for the analysis of tumor tissue in the elucidation of aberrant molecular changes in the tumor microenvironment.

PO-60 - Renal tumors with extensive vascular disease: management challenges in a pediatric series from the Hospital for Sick Children.

PubMed

Zamperlini-Netto, G; Zanette, A; Wehbi, E; Williams, S; Grant, R M; Brandao, L R

2016-04-01

Venous thrombotic events (VTE) are becoming more and more common in children, particularly in the hospital setting. To date, 1 in 200 children admitted to tertiary pediatric hospitals are now being recognized to develop VTE. Amongst those patients with an identified thrombotic occlusion, pediatric patients diagnosed with renal tumors have long been recognized, but their ideal management in the instances of vascular invasion remains controversial. We describe the clinical behavior of patients diagnosed with renal tumors and extra renal vascular involvement at The Hospital for Sick Children in Toronto, Canada. A retrospective analysis was conducted in patients diagnosed from 1990 to 2012. Data collected included: age, gender, symptoms at presentation, staging, pathology report, radiological evidence of intravascular thrombus [i.e. renal veins (RV), inferior vena cava (IVC) and right atrium (RA)], intraoperative findings, therapeutic protocol implemented and anticoagulation; for outcomes, tumor and/or thrombus recurrence, thromboembolic phenomena [i.e. pulmonary embolism (PE)] and survival. Of 299 patients with renal tumors identified, 292 were included: Wilms (219), Renal Cell Carcinoma (RCC, 29), Clear Cell Sarcoma of the Kidney (CCSK, 12), others (32). The median age of the group was 4.53years (4days - 18 years). Extra renal vascular disease was identified in 29 patients, with a median age 7.05years (0.6-16 years; p=0.03), including Wilms tumors (22/219, 10%), RCC (2/29, 7%), CCSK (1/12, 8.3%) and others (4/32, 12.5%; p=0.01). Vascular involvement comprised exclusive evidence of RV disease (7), IVC disease (19; 15 infra-hepatic), RA disease (3) and PE (5).Treatment escalation because of vascular disease included neo-adjuvant chemotherapy (12; Wilms [11], RCC [1]), intraoperative cavectomy/ thrombectomy (1; Wilms), and cavotomies (11 Wilms [7], RCC [1], CCSK [1], PNET [1], sarcoma [1]). Four patients were placed under cardiopulmonary bypass. Anticoagulation was

Hyperpolarized 13C MR Markers of Renal Tumor Aggressiveness

DTIC Science & Technology

2014-10-01

as a biomarker of tumor aggressiveness in a MR compatible 3D cell and tissue culture bioreactor ” to be presented at the ISMRM Workshop on Magnetic... Cell Carcinoma, Hyperpolarized 13C MR, Sub-renal capsule, patient derived tissue slice cultures , bioreactor 3. OVERALL PROJECT SUMMARY: Aim...grade from high grade RCCs using human TSCs cultured in a bioreactor . Aim 2:Identify HP 13C metabolic markers that discriminate low grade from

Extraordinarily Large Renal Cell Carcinoma With Metasynchronous Neuroendocrine Tumor of the Ileocecal Valve: A Rare Presentation of Disease.

PubMed

Edwards, Daniel C; Gitman, Robert; May, Noah R; Amster, Melanie I

2017-01-01

A 71-year-old female presented with a large, protuberant abdominal mass, and was found to have both a left renal mass and a biopsy-proven neuroendocrine tumor of the ileocecal valve. Ultimately, right hemicolectomy revealed a well-differentiated and low-grade neuroendocrine tumor of the ileocecal valve, whereas left radical nephrectomy revealed a 23 cm × 22 cm × 15 cm renal cell carcinoma, chromophobe-type (RCC-CT) weighing 3564 g. RCC-CT represents a small portion of diagnosed RCC, and generally portends a more favorable prognosis than other variants. Modern reports of renal tumors exceeding 20 cm are exceedingly rare. In spite of massive size, favorable histology may allow for surgical cure. Copyright © 2016 Elsevier Inc. All rights reserved.

Surgical treatment of a rare primary renal carcinoid tumor with liver metastasis

PubMed Central

Gedaly, Roberto; Jeon, Hoonbae; Johnston, Thomas D; McHugh, Patrick P; Rowland, Randall G; Ranjan, Dinesh

2008-01-01

Background Carcinoid tumors are characteristically low grade malignant neoplasms with neuroendocrine differentiation that arise in various body sites, most commonly the lung and gastrointestinal tract, but less frequently the kidneys, breasts, ovaries, testes, prostate and other locations. We report a case of a carcinoid of renal origin with synchronous single liver metastases on radiological studies. Case presentation A 45 year-old patient who presented with abdominal pain was found on CT scan to have lesions in the right ovary, right kidney, and left hepatic lobe. CA-125, CEA, and CA 19-9 were within normal limits, as were preoperative liver function tests and renal function. Biopsy of the liver mass demonstrated metastatic neuroendocrine tumor. At laparotomy, the patient underwent total abdominal hysterectomy with bilateral salpingo-oophorectomy, radical right nephrectomy with lymphadenectomy, and left hepatectomy. Pathology evaluation reported a right ovarian borderline serous tumor, well-differentiated neuroendocrine carcinoma of the kidney (carcinoid) with 2 positive retroperitoneal lymph nodes, and a single liver metastasis. Immunohistochemistry revealed that this lesion was positive for synaptophysin and CD56, but negative for chromogranin as well as CD10, CD7, and CD20, consistent with a well-differentiated neuroendocrine tumor. She is doing well one year after her initial surgery, with no evidence of tumor recurrence. Conclusion Early surgical intervention, together with careful surveillance and follow-up, can achieve successful long-term outcomes in patients with this rare malignancy. PMID:18430248

Inferior vena cava tumor thrombus after partial nephrectomy for renal cell carcinoma.

PubMed

Akatsuka, Jun; Suzuki, Yasutomo; Hamasaki, Tsutomu; Shindo, Takao; Yanagi, Masato; Kimura, Go; Yamamoto, Yoichiro; Kondo, Yukihiro

2014-03-29

Partial nephrectomy is now the gold standard treatment for small renal tumors. Local recurrence is a major problem after partial nephrectomy, and local recurrence in the remnant kidney after partial nephrectomy is common. A 77-year-old man underwent right partial nephrectomy for a T1 right renal cell carcinoma. Microscopic examination revealed a clear cell renal carcinoma, grade 2, stage pT3a. Although the surgical margin was negative, the carcinoma invaded the perirenal fat, and vascular involvement was strongly positive. Thirty months after partial nephrectomy, an enhanced computed tomographic scan showed local recurrence of the renal cell carcinoma extending into the inferior vena cava without renal mass. Hence, we performed right radical nephrectomy and intracaval thrombectomy. Microscopic examination revealed a clear cell carcinoma grade 2, stage pT3a + b. The patient is still alive with no evidence of recurrence 10 months post-procedure. To our knowledge, local recurrence of renal cell carcinoma extending into the inferior vena cava after partial nephrectomy has not been reported in the literature. Our case report emphasizes the importance of strict surveillance of patients after partial nephrectomy, especially for those with renal cell carcinoma positive for microvessel involvement.

Association between residential proximity to environmental pollution sources and childhood renal tumors.

PubMed

García-Pérez, Javier; Morales-Piga, Antonio; Gómez, José; Gómez-Barroso, Diana; Tamayo-Uria, Ibon; Pardo Romaguera, Elena; Fernández-Navarro, Pablo; López-Abente, Gonzalo; Ramis, Rebeca

2016-05-01

Few risk factors for childhood renal tumors are well established. While a small fraction of cases might be attributable to susceptibility genes and congenital anomalies, the role of environmental factors needs to be assessed. To explore the possible association between residential proximity to environmental pollution sources (industrial and urban areas, and agricultural crops) and childhood renal cancer, taking into account industrial groups and toxic substances released. We conducted a population-based case-control study of childhood renal cancer in Spain, including 213 incident cases gathered from the Spanish Registry of Childhood Tumors (period 1996-2011), and 1278 controls individually matched by year of birth, sex, and region of residence. Distances were computed from the respective subject's residences to the 1271 industries, the 30 urban areas with ≥75,000 inhabitants, and the agricultural crops located in the study area. Using logistic regression, odds ratios (ORs) and 95% confidence intervals (95%CIs) for categories of distance to pollution sources were calculated, with adjustment for matching variables and socioeconomic confounders. Excess risk (OR; 95%CI) of childhood renal tumors was observed for children living near (≤2.5km) industrial installations as a whole (1.97; 1.13-3.42) - particularly glass and mineral fibers (2.69; 1.19-6.08), galvanization (2.66; 1.14-6.22), hazardous waste (2.59; 1.25-5.37), ceramic (2.35; 1.06-5.21), surface treatment of metals (2.25; 1.24-4.08), organic chemical industry (2.22; 1.15-4.26), food and beverage sector (2.19; 1.18-4.07), urban and waste-water treatment plants (2.14; 1.07-4.30), and production and processing of metals (1.98; 1.03-3.82) -, and in the proximity of agricultural crops (3.16; 1.54-8.89 for children with percentage of crop surface ≥24.35% in a 1-km buffer around their residences). Our study provides some epidemiological evidence that living near certain industrial areas and agricultural crops

Pain control requirements for percutaneous ablation of renal tumors: cryoablation versus radiofrequency ablation--initial observations.

PubMed

Allaf, Mohamad E; Varkarakis, Ioannis M; Bhayani, Sam B; Inagaki, Takeshi; Kavoussi, Louis R; Solomon, Stephen B

2005-10-01

To retrospectively compare the pain control requirements of patients undergoing computed tomography (CT)-guided percutaneous radiofrequency (RF) ablation with those of patients undergoing CT-guided percutaneous cryoablation of small (< or = 4-cm) renal tumors. The study was HIPAA compliant and received institutional review board exemption; informed consent was not required. Medical and procedure records of patients who underwent RF ablation and cryoablation of renal tumors from June 19, 2003, to February 28, 2004, were retrospectively reviewed for clinical data, tumor characteristics, and anesthesia information. During the study period, 10 men (mean age, 66.5 years) underwent cryoablation of 11 renal lesions, and 14 patients (11 men, four women; mean age, 68.1 years) underwent RF ablation of 15 renal tumors. Analgesic and sedative requirements during the procedure were compared. Standard anesthesia consisted of 5 mL of 1% lidocaine injected locally, and conscious sedation consisted of 50 microg of fentanyl and 1 mg of midazolam administered intravenously. The Fisher exact test and Student t test were used to compare clinical factors and drug requirements between the two groups. There was no difference in terms of patient demographics, tumor diameter, or distribution of central versus noncentral lesions between the two groups. Cryoablation was associated with a significantly lower dose of fentanyl (165.0 microg [RF group] vs 75.0 microg [cryoablation group]; P < .001) and midazolam (2.9 mg [RF group] vs 1.6 mg [cryoablation group]; P = .026). In the RF group, one patient required general anesthesia, one patient required supplemental narcotics (5 mg of oxycodone) and sedatives (1 mg lorezapam), and one patient became apneic for a brief interval after receiving additional narcotics for pain during the procedure. An additional RF session was terminated early in one patient because of pain, and further medication could not be administered owing to bradycardia. No

The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

PubMed

Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

2016-01-01

This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

Outcomes of Robot-assisted Partial Nephrectomy for Clinical T2 Renal Tumors: A Multicenter Analysis (ROSULA Collaborative Group).

PubMed

Bertolo, Riccardo; Autorino, Riccardo; Simone, Giuseppe; Derweesh, Ithaar; Garisto, Juan D; Minervini, Andrea; Eun, Daniel; Perdona, Sisto; Porter, James; Rha, Koon Ho; Mottrie, Alexander; White, Wesley M; Schips, Luigi; Yang, Bo; Jacobsohn, Kenneth; Uzzo, Robert G; Challacombe, Ben; Ferro, Matteo; Sulek, Jay; Capitanio, Umberto; Anele, Uzoma A; Tuderti, Gabriele; Costantini, Manuela; Ryan, Stephen; Bindayi, Ahmet; Mari, Andrea; Carini, Marco; Keehn, Aryeh; Quarto, Giuseppe; Liao, Michael; Chang, Kidon; Larcher, Alessandro; De Naeyer, Geert; De Cobelli, Ottavio; Berardinelli, Francesco; Zhang, Chao; Langenstroer, Peter; Kutikov, Alexander; Chen, David; De Luyk, Nicolo; Sundaram, Chandru P; Montorsi, Francesco; Stein, Robert J; Haber, Georges Pascal; Hampton, Lance J; Dasgupta, Prokar; Gallucci, Michele; Kaouk, Jihad; Porpiglia, Francesco

2018-05-18

While partial nephrectomy (PN) represents the standard surgical management for cT1 renal masses, its role for cT2 tumors is controversial. Robot-assisted PN (RAPN) is being increasingly implemented worldwide. To analyze perioperative, functional, and oncological outcomes of RAPN for cT2 tumors. Retrospective analysis of a large multicenter, multinational dataset of patients with nonmetastatic cT2 masses treated with robotic surgery (ROSULA: RObotic SUrgery for LArge renal mass). Robotic-assisted PN. Patients' demographics, lesion characteristics, perioperative variables, renal functional data, pathology, and oncological data were analyzed. Univariable and multivariable regression analyses assessed the relationships with the risk of intra-/postoperative complications, recurrence, and survival. A total of 298 patients were analyzed. Median tumor size was 7.6 (7-8.5) cm. Median RENAL score was 9 (8-10). Median ischemia time was 25 (20-32) min. Median estimated blood loss was 150 (100-300) ml. Sixteen patients had intraoperative complications (5.4%), whereas 66 (22%) had postoperative complications (5% were Clavien grade ≥3). Multivariable analysis revealed that a lower RENAL score (odds ratio [OR] 0.46, 95% confidence interval [CI] 0.21-0.65, p=0.02) and pathological pT2 stage (OR 0.51, 95% CI 0.12-0.86, p=0.001) were protective against postoperative complications. A total of 243 lesions (82%) were malignant. Twenty patients (8%) had positive surgical margins. Ten deaths and 25 recurrences/metastases occurred at a median follow-up of 12 (5-35) mo. At univariable analysis, higher pT stage was predictive of a likelihood of recurrences/metastases (p=0.048). While there was a significant deterioration of renal function at discharge, this remained stable over time at 1-yr follow-up. The main limitation of this study is its retrospective design. RAPN in the setting of select cT2 renal masses can safely be performed with acceptable outcomes. Further studies are warranted

Epithelioid PEComa (epithelioid angiomyolipoma) of the kidney: a rare tumor subtype for patients presenting with an enhancing renal mass.

PubMed

Shrewsberry, Adam B; Sica, Gabriel L; Osunkoya, Adeboye O; Canter, Daniel J

2013-02-01

Epithelioid angiomyolipomas, or perivascular epithelioid cell tumors (epithelioid PEComas) of the kidney, are histologically related to renal angiomyolipomas (AMLs). However, in contrast to typical AMLs, this rare tumor can exhibit an aggressive clinical course with approximately 50% of reported cases demonstrating disease progression. In this report, we present a case of a 24-year-old female with a history of stone disease who was incidentally found to have a 9.0 cm right renal mass that was difficult to characterize radiographically preoperatively. The patient underwent a right radical nephrectomy, and pathology revealed a renal epithelioid PEComa.

A case of huge colon carcinoma and right renal angiomyolipoma accompanied by proximal deep venous thrombosis, pulmonary embolism and tumor thrombus in the renal vein.

PubMed

Ban, Daisuke; Yamamoto, Seiichiro; Kuno, Hirofumi; Fujimoto, Hiroyuki; Fujita, Shin; Akasu, Takayuki; Moriya, Yoshihiro

2008-10-01

A preoperative inferior vena cava (IVC) filter is reported to be effective in surgical cases with proximal deep venous thrombosis (DVT) or in which pulmonary embolism (PE) has already developed, and considered to be at high risk of developing secondary fatal PE during or after surgery. However, guidelines for using an IVC filter have yet to be established. The patient in the present report had two huge tumors, ascending colon cancer and renal angiomyolipoma, which occupied the entire right half of the abdomen, coexisting PE, DVT and tumor thrombus in the right renal vein. Secondary PE is fatal in the perioperative period, therefore, the vena cava filters were preoperatively inserted into the supra- and the infrarenal IVC. We successfully removed the tumors without complications. The patient is alive without tumor recurrence and PE or recurrent DVT 1 year and 6 months after surgery. The coexistence of two huge abdominal tumors as potential causes of PE and DVT is extremely rare, and we could have safely undergone the operation, using two vena cava filters in the supra- and infrarenal IVC.

DNA methylation profile distinguishes clear cell sarcoma of the kidney from other pediatric renal tumors.

PubMed

Ueno, Hitomi; Okita, Hajime; Akimoto, Shingo; Kobayashi, Kenichiro; Nakabayashi, Kazuhiko; Hata, Kenichiro; Fujimoto, Junichiro; Hata, Jun-Ichi; Fukuzawa, Masahiro; Kiyokawa, Nobutaka

2013-01-01

A number of specific, distinct neoplastic entities occur in the pediatric kidney, including Wilms' tumor, clear cell sarcoma of the kidney (CCSK), congenital mesoblastic nephroma (CMN), rhabdoid tumor of the kidney (RTK), and the Ewing's sarcoma family of tumors (ESFT). By employing DNA methylation profiling using Illumina Infinium HumanMethylation27, we analyzed the epigenetic characteristics of the sarcomas including CCSK, RTK, and ESFT in comparison with those of the non-neoplastic kidney (NK), and these tumors exhibited distinct DNA methylation profiles in a tumor-type-specific manner. CCSK is the most frequently hypermethylated, but least frequently hypomethylated, at CpG sites among these sarcomas, and exhibited 490 hypermethylated and 46 hypomethylated CpG sites in compared with NK. We further validated the results by MassARRAY, and revealed that a combination of four genes was sufficient for the DNA methylation profile-based differentiation of these tumors by clustering analysis. Furthermore, THBS1 CpG sites were found to be specifically hypermethylated in CCSK and, thus, the DNA methylation status of these THBS1 sites alone was sufficient for the distinction of CCSK from other pediatric renal tumors, including Wilms' tumor and CMN. Moreover, combined bisulfite restriction analysis could be applied for the detection of hypermethylation of a THBS1 CpG site. Besides the biological significance in the pathogenesis, the DNA methylation profile should be useful for the differential diagnosis of pediatric renal tumors.

Downregulated microRNA-510-5p acts as a tumor suppressor in renal cell carcinoma.

PubMed

Chen, Duqun; Li, Yuchi; Yu, Zuhu; Li, Yifan; Su, Zhengming; Ni, Liangchao; Yang, Shangqi; Gui, Yaoting; Lai, Yongqing

2015-08-01

MicroRNA (miR)-510-5p has been demonstrated to be involved in a number of types of malignancy; however, the function of miR-510-5p in renal cancer remains unclear. The present study aimed to determine the expression of miR-510-5p in renal cell carcinoma (RCC) specimens and analyzed the impact of miR-510-5p on renal cancer by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, wound scratch and apoptosis assays. The results showed that miR-510-5p was significantly downregulated in RCC specimens compared with normal renal specimens. Overexpression of miR-510-5p by synthetic mature mimics reduced cell proliferation and migration and induced an increase in cell apoptosis, indicating that miR-510-5p may act as a tumor suppressor in RCC. The present study firstly revealed that downregulated miR-510-5p functioned as a tumor suppressor by reducing cellular proliferation and migration, and inducing apoptosis in RCC. Further research is required to define target genes of miR-510-5p to determine the cellular mechanism of miR-510-5p in the carcinogenesis of RCC.

Robotic partial nephrectomy for renal cell carcinomas with venous tumor thrombus.

PubMed

Abaza, Ronney; Angell, Jordan

2013-06-01

To describe the first report of robotic partial nephrectomies (RPNs) for renal cell carcinoma (RCC) with venous tumor thrombus (VTT). Partial nephrectomy for RCC extending into the renal vein has been described in limited fashion, but such a complex procedure has not previously been reported in minimally-invasive fashion. We demonstrate the feasibility of robotic nephron-sparing surgery despite vein thrombi and the results of the initial four highly-selected patients to have undergone this novel procedure. Two patients underwent RPN for RCC with VTT involving intraparenchymal vein branches, and 2 others had VTT involving the main renal vein. Mean patient age was 65 years (range 50-74 years). Mean tumor size was 7.75 cm (range 4.3-12.8 cm) with mean RENAL (radius, exophytic/endophytic, nearness to collecting system, anterior/posterior, and location) nephrometry score of 9.75 (range 8-12). Mean warm ischemia time was 24.2 minutes (range 19-27 minutes) and mean estimated blood loss was 168.8 mL (range 100-300 mL). No patients required transfusion, and there were no intraoperative complications. No patients required conversion to open or standard laparoscopic surgery. All 4 patients were discharged home on the first postoperative day. A single postoperative complication occurred in 1 patient who was readmitted with an ileus that resolved spontaneously. All patients had negative surgical margins. Two patients developed metastatic disease on surveillance imaging. RPN in patients with VTT is safe and feasible in selected patients. Given the risk of metastatic disease in patients with pathologic stage T3a RCC, the role of nephron sparing requires further evaluation such that radical nephrectomy remains the standard of care. Copyright © 2013 Elsevier Inc. All rights reserved.

Primary Renal Rhabdomyosarcoma in an Adolescent With Tumor Thrombosis in the Inferior Vena Cava and Right Atrium: A Case Report and Review of the Literature.

PubMed

Lin, Wei-Ching; Chen, Jeon-Hor; Westphalen, Antonio; Chang, Han; Chiang, I-Ping; Chen, Cheng-Hong; Wu, Hsi-Chin; Lin, Chien-Heng

2016-05-01

Although the second peak of the age distribution of rhabdomyosarcoma (RMS) is at adolescence, renal RMS is extremely rare at this age group. This tumor is indistinguishable from other renal tumors based on clinical and imaging findings, and the diagnosis relies on histology and immunohistochemical staining. We report a unique case of adolescent renal RMS associated with tumor thrombus extending into the inferior vena cava (IVC) and right atrium.An 18-year-old female adolescent presented with shortness of breath and palpitations, associated with right flank discomfort, and hematuria. A pleomorphic-type renal RMS with Budd-Chiari syndrome and arrhythmia induced by IVC and RA thrombosis was diagnosed. Despite complete tumor resection, the patient developed multiple lung metastases a month after surgery. Chemotherapy was recommended, but the patient declined. She died within a year of the initial operation.Adolescent renal RMS is rare and associated with poor outcome. Early aggressive multimodal therapy seems to be appropriate, in particular, in the presence of tumor thrombosis.

Complexity of tumor vasculature in clear cell renal cell carcinoma.

PubMed

Qian, Chao-Nan; Huang, Dan; Wondergem, Bill; Teh, Bin Tean

2009-05-15

Clear cell renal cell carcinoma (CCRCC) is a highly vascularized cancer resistant to conventional chemotherapy and radiotherapy. Antiangiogenic therapy has achieved some effectiveness against this unique malignancy. The complexity of the tumor vasculature in CCRCC has led to differences in correlating tumor microvessel density with patient prognosis. The authors' recent findings demonstrated that there were at least 2 major categories of tumor vessels in CCRCC-namely, undifferentiated and differentiated-correlating with patient prognosis in contrasting ways, with higher undifferentiated vessel density indicating poorer prognosis, and higher differentiated vessel density correlating with better prognosis. Furthermore, the presence of pericytes supporting the differentiated vessels varied in CCRCC. The distributions of pericyte coverage and differentiated vessels in CCRCC were uneven. The tumor margin had a higher pericyte coverage rate for differentiated vessels than did the inner tumor area. The uneven distributions of pericyte coverage and differentiated vessels in CCRCC prompted the authors to revisit the mechanism of tumor central necrosis, which was also known to be a prognostic indicator for CCRCC. The discrepancy of prognostic correlation between protein and messenger RNA levels of vascular endothelial growth factor in CCRCC was discussed. The complexity of the tumor vasculature in CCRCC also led the authors to begin to re-evaluate the therapeutic effects of antiangiogenic agents for each type of tumor vessel, which will in turn significantly broaden understanding of tumor angiogenesis and improve therapeutic effect. (c) 2009 American Cancer Society.

The Nephrologist’s Tumor: Basic Biology and Management of Renal Cell Carcinoma

PubMed Central

Hu, Susie L.; Chang, Anthony; Perazella, Mark A.; Okusa, Mark D.; Jaimes, Edgar A.

2016-01-01

Kidney cancer, or renal cell carcinoma (RCC), is a disease of increasing incidence that is commonly seen in the general practice of nephrology. However, RCC is under-recognized by the nephrology community, such that its presence in curricula and research by this group is lacking. In the most common form of RCC, clear cell renal cell carcinoma (ccRCC), inactivation of the von Hippel–Lindau tumor suppressor is nearly universal; thus, the biology of ccRCC is characterized by activation of hypoxia-relevant pathways that lead to the associated paraneoplastic syndromes. Therefore, RCC is labeled the internist’s tumor. In light of this characterization and multiple other metabolic abnormalities recently associated with ccRCC, it can now be viewed as a metabolic disease. In this review, we discuss the basic biology, pathology, and approaches for treatment of RCC. It is important to distinguish between kidney confinement and distant spread of RCC, because this difference affects diagnostic and therapeutic approaches and patient survival, and it is important to recognize the key interplay between RCC, RCC therapy, and CKD. Better understanding of all aspects of this disease will lead to optimal patient care and more recognition of an increasingly prevalent nephrologic disease, which we now appropriately label the nephrologist’s tumor. PMID:26961346

Lymphatic Drainage from Renal Tumors In Vivo: A Prospective Sentinel Node Study Using SPECT/CT Imaging.

PubMed

Kuusk, Teele; De Bruijn, Roderick; Brouwer, Oscar R; De Jong, Jeroen; Donswijk, Maarten; Grivas, Nikolaos; Hendricksen, Kees; Horenblas, Simon; Prevoo, Warner; Valdés Olmos, Renato A; Van Der Poel, Henk G; Van Rhijn, Bas W G; Wit, Esther M; Bex, Axel

2018-06-01

Lymphatic drainage from renal tumors is unpredictable. In vivo drainage studies of primary lymphatic landing sites may reveal the variability and dynamics of lymphatic connections. The purpose of this study was to investigate the lymphatic drainage pattern of renal tumors in vivo with single photon emission/computerized tomography after intratumor radiotracer injection. We performed a phase II, prospective, single arm study to investigate the distribution of sentinel nodes from renal tumors on single photon emission/computerized tomography. Patients with cT1-3 (less than 10 cm) cN0M0 renal tumors of any subtype were enrolled in analysis. After intratumor ultrasound guided injection of 0.4 ml 99m Tc-nanocolloid we performed preoperative imaging of sentinel nodes with lymphoscintigraphy and single photon emission/computerized tomography. Sentinel and locoregional nonsentinel nodes were resected with a γ probe combined with a mobile γ camera. The primary study end point was the location of sentinel nodes outside the locoregional retroperitoneal templates on single photon emission/computerized tomography. Using a Simon minimax 2-stage design to detect a 25% extralocoregional retroperitoneal template location of sentinel nodes on imaging at α = 0.05 and 80% power at least 40 patients with sentinel node imaging on single photon emission/computerized tomography were needed. Of the 68 patients 40 underwent preoperative single photon emission/computerized tomography of sentinel nodes and were included in primary end point analysis. Lymphatic drainage outside the locoregional retroperitoneal templates was observed in 14 patients (35%). Eight patients (20%) had supradiaphragmatic sentinel nodes. Sentinel nodes from renal tumors were mainly located in the respective locoregional retroperitoneal templates. Simultaneous sentinel nodes were located outside the suggested lymph node dissection templates, including supradiaphragmatic sentinel nodes in more than a third of the

Renal Tumor Necrosis Factor α Contributes to Hypertension in Dahl Salt-Sensitive Rats

PubMed Central

Huang, Baorui; Cheng, Yuan; Usa, Kristie; Liu, Yong; Baker, Maria Angeles; Mattson, David L.; He, Yongcheng; Wang, Niansong; Liang, Mingyu

2016-01-01

Tumor necrosis factor α (TNFα) is a major proinflammatory cytokine and its level is elevated in hypertensive states. Inflammation occurs in the kidneys during the development of hypertension. We hypothesized that TNFα specifically in the kidney contributes to the development of hypertension and renal injury in Dahl salt-sensitive (SS) rats, a widely used model of human salt-sensitive hypertension and renal injury. SS rats were chronically instrumented for renal interstitial infusion and blood pressure measurement in conscious, freely moving state. Gene expression was measured using real-time PCR and renal injury assessed with histological analysis. The abundance of TNFα in the renal medulla of SS rats, but not the salt-insensitive congenic SS.13BN26 rats, was significantly increased when rats had been fed a high-salt diet for 7 days (n = 6 or 9, p < 0.01). The abundance of TNFα receptors in the renal medulla was significantly higher in SS rats than SS.13BN26 rats. Renal interstitial administration of Etanercept, an inhibitor of TNFα, significantly attenuated the development of hypertension in SS rats on a high-salt diet (n = 7–8, p < 0.05). Glomerulosclerosis and interstitial fibrosis were also significantly ameliorated. These findings indicate intrarenal TNFα contributes to the development of hypertension and renal injury in SS rats. PMID:26916681

The Adverse Survival Implications of Bland Thrombus in Renal Cell Carcinoma With Venous Tumor Thrombus.

PubMed

Hutchinson, Ryan; Rew, Charles; Chen, Gong; Woldu, Solomon; Krabbe, Laura-Maria; Meissner, Matthew; Sheth, Kunj; Singla, Nirmish; Shakir, Nabeel; Master, Viraj A; Karam, Jose A; Matin, Surena F; Borregales, Leonardo D; Wood, Christopher; Masterson, Timothy; Thompson, R Houston; Boorjian, Stephen A; Leibovich, Bradley C; Abel, E Jason; Bagrodia, Aditya; Margulis, Vitaly

2018-05-01

To characterize the presence of bland (nontumor) thrombus in advanced renal cell carcinoma and assess the impact of this finding on cancer-specific survival. A multi-institutional database of patients treated with nephrectomy with caval thrombectomy for locally-advanced renal tumors was assembled from 5 tertiary care medical centers. Using clinicopathologic variables including patient age, body mass index, Eastern Cooperative Oncology Group performance status, tumor stage, grade, nodal status and histology, and nearest-neighbor and multiple-matching propensity score matched cohorts of bland thrombus vs nonbland thrombus patients were assessed. Multivariable analysis for predictors of cancer-specific survival was performed. From an initial cohort of 579 patients, 446 met inclusion criteria (174 with bland thrombus, 272 without). At baseline, patients with bland thrombus had significantly worse performance status, higher tumor stage, higher prevalence of regional nodal metastases and higher nuclear grade (P < .01 for all). In both nearest-neighbor and multiple-matching propensity score matched cohorts, the presence of bland thrombus presence was associated with inferior median cancer-specific survival (28.1 months vs 156.8 months, and 28.1 months vs 76.7 months, P < .001 for both). The presence of bland thrombus remained independently associated with an increased risk of cancer-specific mortality on multivariable analysis (hazard ratio 4.33, 95% confidence interval 2.79-6.73, P < .001). Presence of bland thrombus is associated with adverse survival outcomes in patients treated surgically for renal tumors with venous tumor thrombus. These findings may have important implications in patient counseling, selection for surgery and inclusion in clinical trials. Copyright © 2018 Elsevier Inc. All rights reserved.

POTASSIUM BROMATE-INDUCED RAT CLEAR CELL RENAL TUMOR IS INDEPENDENT OF CODING REGION MUTATIONS IN THE VON HIPPEL- LINDAU GENE

EPA Science Inventory

Potassium bromate (KBr03) is a rat renal carcinogen and a major drinking water disinfection by-product from ozonization. While KBr03 is a human nephro- and neuro-toxicant, its carcinogenicity in humans is unknown. Clear cell renal tumors, the common form of human renal carcinomas...

Clinical application of calculated split renal volume using computed tomography-based renal volumetry after partial nephrectomy: Correlation with technetium-99m dimercaptosuccinic acid renal scan data.

PubMed

Lee, Chan Ho; Park, Young Joo; Ku, Ja Yoon; Ha, Hong Koo

2017-06-01

To evaluate the clinical application of computed tomography-based measurement of renal cortical volume and split renal volume as a single tool to assess the anatomy and renal function in patients with renal tumors before and after partial nephrectomy, and to compare the findings with technetium-99m dimercaptosuccinic acid renal scan. The data of 51 patients with a unilateral renal tumor managed by partial nephrectomy were retrospectively analyzed. The renal cortical volume of tumor-bearing and contralateral kidneys was measured using ImageJ software. Split estimated glomerular filtration rate and split renal volume calculated using this renal cortical volume were compared with the split renal function measured with technetium-99m dimercaptosuccinic acid renal scan. A strong correlation between split renal function and split renal volume of the tumor-bearing kidney was observed before and after surgery (r = 0.89, P < 0.001 and r = 0.94, P < 0.001). The preoperative and postoperative split estimated glomerular filtration rate of the operated kidney showed a moderate correlation with split renal function (r = 0.39, P = 0.004 and r = 0.49, P < 0.001). The correlation between reductions in split renal function and split renal volume of the operated kidney (r = 0.87, P < 0.001) was stronger than that between split renal function and percent reduction in split estimated glomerular filtration rate (r = 0.64, P < 0.001). The split renal volume calculated using computed tomography-based renal volumetry had a strong correlation with the split renal function measured using technetium-99m dimercaptosuccinic acid renal scan. Computed tomography-based split renal volume measurement before and after partial nephrectomy can be used as a single modality for anatomical and functional assessment of the tumor-bearing kidney. © 2017 The Japanese Urological Association.

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications.

PubMed

Muranen, Taru A; Greco, Dario; Fagerholm, Rainer; Kilpivaara, Outi; Kämpjärvi, Kati; Aittomäki, Kristiina; Blomqvist, Carl; Heikkilä, Päivi; Borg, Ake; Nevanlinna, Heli

2011-09-20

Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels.Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation 1100delC. On these regions, we identified

Breast tumors from CHEK2 1100delC-mutation carriers: genomic landscape and clinical implications

PubMed Central

2011-01-01

Introduction Checkpoint kinase 2 (CHEK2) is a moderate penetrance breast cancer risk gene, whose truncating mutation 1100delC increases the risk about twofold. We investigated gene copy-number aberrations and gene-expression profiles that are typical for breast tumors of CHEK2 1100delC-mutation carriers. Methods In total, 126 breast tumor tissue specimens including 32 samples from patients carrying CHEK2 1100delC were studied in array-comparative genomic hybridization (aCGH) and gene-expression (GEX) experiments. After dimensionality reduction with CGHregions R package, CHEK2 1100delC-associated regions in the aCGH data were detected by the Wilcoxon rank-sum test. The linear model was fitted to GEX data with R package limma. Genes whose expression levels were associated with CHEK2 1100delC mutation were detected by the bayesian method. Results We discovered four lost and three gained CHEK2 1100delC-related loci. These include losses of 1p13.3-31.3, 8p21.1-2, 8p23.1-2, and 17p12-13.1 as well as gains of 12q13.11-3, 16p13.3, and 19p13.3. Twenty-eight genes located on these regions showed differential expression between CHEK2 1100delC and other tumors, nominating them as candidates for CHEK2 1100delC-associated tumor-progression drivers. These included CLCA1 on 1p22 as well as CALCOCO1, SBEM, and LRP1 on 12q13. Altogether, 188 genes were differentially expressed between CHEK2 1100delC and other tumors. Of these, 144 had elevated and 44, reduced expression levels. Our results suggest the WNT pathway as a driver of tumorigenesis in breast tumors of CHEK2 1100delC-mutation carriers and a role for the olfactory receptor protein family in cancer progression. Differences in the expression of the 188 CHEK2 1100delC-associated genes divided breast tumor samples from three independent datasets into two groups that differed in their relapse-free survival time. Conclusions We have shown that copy-number aberrations of certain genomic regions are associated with CHEK2 mutation

Serum and Urinary Levels of Tumor Necrosis Factor-Alpha in Renal Transplant Patients.

PubMed

Senturk Ciftci, Hayriye; Demir, Erol; Savran Karadeniz, Meltem; Tefik, Tzevat; Yazici, Halil; Nane, Ismet; Savran Oguz, Fatma; Aydin, Filiz; Turkmen, Aydin

2017-12-18

Allograft rejection is an important cause of early and long-term graft loss in kidney transplant recipients. Tumor necrosis factor-alpha promotes T-cell activation, the key reaction leading to allograft rejection. Here, we investigated whether serum and urinary tumor necrosis factor-alpha levels can predict allograft rejection. This study included 65 living related-donor renal transplant recipients with mean follow-up of 26 ± 9 months. Serum and urinary tumor necrosis factor-alpha levels were measured at pretransplant and at posttransplant time points (days 1 and 7 and months 3 and 6); serum creatinine levels were also monitored during posttransplant follow-up. Standard enzyme-linked immunoabsorbent assay was used to detect tumor necrosis factor-alpha levels. Clinical variables were monitored. Nine of 65 patients (13.8%) had biopsy-proven rejection during follow-up. Preoperative serum and urinary tumor necrosis factor-alpha levels were not significantly different when we compared patients with and without rejection. Serum tumor necrosis factor-alpha levels (in pg/mL) were significantly higher in the allograft rejection versus nonrejection group at day 7 (11.5 ± 4.7 vs 15.4 ± 5.8; P = .029) and month 1 (11.1 ± 4.8 vs 17.8 ± 10.9; P =.003). Urinary tumor necrosis factor-alpha levels (in pg/mL) were also elevated in the allograft rejection versus the nonrejection group at days 1 (10.2 ± 2.5 vs 14.1 ± 6.8; P = .002) and 7 (9.8 ± 2.2 vs 14.5 ± 2.7; P < .001) and at months 1 (8.0 ± 1.7 vs 11.8 ± 2.4; P < .001), 3 (7.7 ± 1.6 vs 9.6 ± 1.7; P = .002), and 6 (7.4 ± 1.6 vs 8.9 ± 0.9; P = .005). Our preliminary findings suggest that tumor necrosis factor-alpha has a role in diagnosing renal transplant rejection. Serum and urinary tumor necrosis factor-alpha levels may be a possible predictor for allograft rejection.

Multiple Renal Artery Pseudoaneurysms in Patients Undergoing Renal Artery Embolization Following Partial Nephrectomy: Correlation with RENAL Nephrometry Scores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Nakul; Patel, Anish; Ensor, Joe

PurposeTo describe the incidence of multiple renal artery pseudoaneurysms (PSA) in patients referred for renal artery embolization following partial nephrectomy and to study its relationship to RENAL nephrometry scores.Materials and MethodsThe medical records of 25 patients referred for renal artery embolization after partial nephrectomy were retrospectively reviewed for the following parameters: size and number of tumors, RENAL nephrometry scores, angiographic abnormalities, technical and clinical outcomes, and estimated glomerular filtration rates (eGFRs) after embolization.ResultsTwenty-four patients had primary renal tumors, while 1 patient had a pancreatic tumor invading the kidney. Multiple tumors were resected in 4 patients. Most patients (92 %) were symptomatic,more » presenting with gross hematuria, flank pain, or both. Angiography revealed PSA with (n = 5) or without (n = 20) AV fistulae. Sixteen patients (64 %) had multiple PSA involving multiple renal vessels. Higher RENAL nephrometry scores were associated with an increasing likelihood of multiple PSA. Multiple vessels were embolized in 14 patients (56 %). Clinical success was achieved after one (n = 22) or two (n = 3) embolization sessions in all patients. Post-embolization eGFR values at different time points after embolization were not significantly different from the post-operative eGFR.ConclusionA majority of patients requiring renal artery embolization following partial nephrectomy have multiple pseudoaneurysms, often requiring selective embolization of multiple vessels. Higher RENAL nephrometry score is associated with an increasing likelihood of multiple pseudoaneurysms. We found transarterial embolization to be a safe and effective treatment option with no long-term adverse effect on renal function in all but one patient with a solitary kidney.« less

Comparing Zero Ischemia Laparoscopic Radio Frequency Ablation Assisted Tumor Enucleation and Laparoscopic Partial Nephrectomy for Clinical T1a Renal Tumor: A Randomized Clinical Trial.

PubMed

Huang, Jiwei; Zhang, Jin; Wang, Yanqing; Kong, Wen; Xue, Wei; Liu, Dongming; Chen, YongHui; Huang, Yiran

2016-06-01

We evaluated the functional outcome, safety and efficacy of zero ischemia laparoscopic radio frequency ablation assisted tumor enucleation compared with conventional laparoscopic partial nephrectomy. A prospective randomized controlled trial was conducted from April 2013 to March 2015 in patients with cT1a renal tumor scheduled for laparoscopic nephron sparing surgery. All patients were followed for at least 12 months. Patients in the laparoscopic radio frequency ablation assisted tumor enucleation group underwent tumor enucleation after radio frequency ablation without hilar clamping. The primary outcome was the change in glomerular filtration rate of the affected kidney by renal scintigraphy at 12 months. Secondary outcomes included changes in estimated glomerular filtration rate, estimated blood loss, operative time, hospital stay, postoperative complications and oncologic outcomes. The Pearson chi-square or Fisher exact, Student t-test and Wilcoxon rank sum tests were used. The trial ultimately enrolled 89 patients, of whom 44 were randomized to the laparoscopic radio frequency ablation assisted tumor enucleation group and 45 to the laparoscopic partial nephrectomy group. In the laparoscopic partial nephrectomy group 1 case was converted to radical nephrectomy. Compared with the laparoscopic partial nephrectomy group, patients in the laparoscopic radio frequency ablation assisted tumor enucleation group had a smaller decrease in glomerular filtration rate of the affected kidney at 3 months (10.2% vs 20.5%, p=0.001) and 12 months (7.6% vs 16.2%, p=0.002). Patients in the laparoscopic radio frequency ablation assisted tumor enucleation group had a shorter operative time (p=0.002), lower estimated blood loss (p <0.001) and a shorter hospital stay (p=0.029) but similar postoperative complications (p=1.000). There were no positive margins or local recurrence in this study. Zero ischemia laparoscopic radio frequency ablation assisted tumor enucleation enables tumor

Simple enucleation for the treatment of highly complex renal tumors: Perioperative, functional and oncological results.

PubMed

Serni, S; Vittori, G; Frizzi, J; Mari, A; Siena, G; Lapini, A; Carini, M; Minervini, A

2015-07-01

To assess the role of simple enucleation (SE) for the treatment of highly complex renal tumors. Overall, 96 Preoperative Aspects and Dimensions Used for an Anatomical (PADUA) classification score 10 to 13 renal tumors were treated with SE at our institution. All conventional perioperative variables, surgical, functional and oncological results were gathered in a prospectively maintained database. Survival curves were generated using a Kaplan-Meier method. Univariate analysis assessed the outcome differences. Mean (± 1s.d.) clinical tumor diameter was 4.8 (± 1.6 cm). 70.8% of patients had ≥ cT1b stage. The PADUA score was recorded as 10, 11, 12 and 13 in 57.3%, 29.2%, 11.5%, and 2.1% of tumors respectively. Overall, 76 patients were treated with an open approach and 20 robotically. Mean warm ischemia time (WIT) was 19.2 min, and WIT greater than 25 min occurred in 14.6% of cases. Positive surgical margin (PSM) rate was 3.6% and trifecta was achieved in 64.3% of patients. Postoperative surgical complications occurred in 24% of patients, with 14.6% Clavien-Dindo grade 1-2, 8.3% grade 3, and 1% grade 4. Five-year cancer specific survival (CSS), recurrent free survival (RFS), and overall survival (OS) rates resulted 96.1%, 90.8% and 88.0%, respectively. Overall, 4.2% of patients experienced progressive disease. At follow-up, the mean decrease of eGFR from preoperative value was 13.9 ml/min. This was not significantly correlated with PADUA score (p = 0.69). The surgical approach was neither a predictor of Trifecta outcome, nor of postoperative complications, WIT > 25 min or PSM rate. SE is an effective treatment for highly-complex renal tumors, with a potential key role to widen the NSS (nephron sparing surgery) indications according to guidelines. Copyright © 2015 Elsevier Ltd. All rights reserved.

Hemorrhagic Complications of Percutaneous Cryoablation for Renal Tumors: Results from a 7-year Prospective Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kakarala, Bharat, E-mail: bkakara1@jhmi.edu, E-mail: bharat.kakarala@gmail.com; Frangakis, Constantine E., E-mail: cfrangak@jhsph.edu; Rodriguez, Ron, E-mail: rodriguezr32@uthscsa.edu

PurposeCryoablation of renal tumors is assumed to have a higher risk of hemorrhagic complications compared to other ablative modalities. Our purpose was to establish the exact risk and to identify hemorrhagic risk factors.Materials and MethodsThis IRB approved, 7-year prospective study included 261 renal cryoablations. Procedures were under conscious sedation and CT guidance. Pre- and postablation CT was obtained, and hemorrhagic complications were CTCAE tabulated. Age, gender, tumor size, histology, and probes number were tested based on averages or proportions using their exact permutation distribution. “High-risk” subgroups (those exceeding the thresholds of all variables) were tested for each variable alone, andmore » for all combinations of variable threshold values. We compared the subgroup with the best PPV using one variable, with the subgroup with the best PPV using all variables (McNemmar test).ResultsThe hemorrhagic complication rate was 3.5 %. Four patients required transfusions, two required emergent angiograms, one required both a transfusion and angiogram, and two required bladder irrigation for outlet obstruction. Perirenal space hemorrhage was more clinically significant than elsewhere. Univariate risks were tumor size >2 cm, number of probes >2, and malignant histology (P = 0.005, 0.002, and 0.033, respectively). Multivariate analysis showed that patients >55 years with malignant tumors >2 cm requiring 2 or more probes yielded the highest PPV (7.5 %).ConclusionsAlthough older patients (>55 years old) with larger (>2 cm), malignant tumors have an increased risk of hemorrhagic complications, the low PPV does not support the routine use of embolization. Percutaneous cryoablation has a 3.5 % risk of significant hemorrhage, similar to that reported for other types of renal ablative modalities.« less

Tumor-Like Liver Abscess Mimicking Malignancy With Lung Metastases in a Patient With Acute Renal Failure

PubMed Central

Wang, Chih Hsin; Sun, Cheuk-Kay; Jiang, Jiunn-Song; Tsai, Ming Hsien

2016-01-01

Abstract The worldwide incidence of Klebsiella pneumoniae liver abscess (KLA) is increasing. It is important to accurately diagnose this life-threatening disease to provide timely and appropriate treatment. Here we report the case of a 38-year-old man with acute renal failure and a tumor-like liver abscess and septic pulmonary embolism. Initially, his clinical symptoms, laboratory tests, and radiological findings presented equivocal results of malignancy with metastases. Fine needle aspiration of liver tumor was performed, which showed purulent material with a culture positive for K pneumoniae. KLA symptoms are atypical, and radiological findings may mimic a malignancy with tumor necrosis. In some circumstances, liver aspiration biopsy may be necessary to confirm the real etiology, leading to prompt and timely treatment. Moreover, we should be alert for the impression of KLA when facing a diabetic patient with liver mass lesion and acute renal failure. PMID:26986170

Pediatric Renal Neoplasms.

PubMed

Ranganathan, Sarangarajan

2009-03-01

Renal tumors in childhood consist of a diverse group of tumors ranging from the most common Wilms' tumor, to the uncommon and often fatal rhabdoid tumor. Diagnosis is based on morphologic features and aided by ancillary techniques such as immunohistochemistry and cytogenetics. Molecular techniques have helped identify a group of pediatric renal cell carcinomas that have specific translocations, called translocation-associated carcinomas. Differential diagnosis of the various tumors is discussed. Pathogenesis and nephroblastomatosis, the precursor lesions of Wilms tumor, also are discussed briefly, as are the handling of these tumor specimens and prognostic factors. Copyright © 2009 Elsevier Inc. All rights reserved.

Renal cell carcinoma: the influence of new diagnostic imaging techniques on the size and stage of tumors diagnosed over the past 26 years.

PubMed

Touloupidis, Stavros; Papathanasiou, Athanasios; Kalaitzis, Christos; Fatles, Georgios; Manavis, Ioannis; Rombis, Vassilios

2006-01-01

We have analyzed data collected over a 26-year period for influences of new diagnostic imaging techniques (ultrasound, computed tomography, and magnetic resonance imaging) on the size, stage, and other parameters of renal cell carcinomas at the time of first diagnosis. We reviewed retrospectively the records of 203 patients who underwent operations at our institutions from 1973 to 1999. All the patients suffered from renal cell carcinoma. With this study we attempted to answer four questions regarding changes over this time span: (1) have new imaging techniques lead to a reduction in the median diameter of the tumor upon first diagnosis, (2) has the tumor stage decreased due to earlier diagnosis, (3) is there any correlation between tumor size and tumor stage, and (4) are the patient's early diagnoses at a younger age? Other parameters such as infiltration of the renal pelvis and the cell type were also examined. The tumor size and stage at the time of diagnosis and treatment are positively correlated, and both decrease significantly over the time span examined. There is also a strong association between tumor size and infiltration of the renal pelvis. The median age of the patients did not significantly change over time. The wider use of improved imaging techniques has significantly changed the clinical appearance of the renal cell carcinoma. The question is whether these techniques have also affected the prognosis of the disease.

Renal Tumors in Children Younger Than 12 Months of Age: A 65-Year Single Institution Review.

PubMed

Lamb, Margaret G; Aldrink, Jennifer H; O'Brien, Sarah H; Yin, Han; Arnold, Michael A; Ranalli, Mark A

2017-03-01

Wilms tumor (WT) is the most prevalent pediatric renal tumor and most commonly occurs between ages 1 and 5 years. Data are lacking on children younger than 12 months with renal tumors. The cancer registry at the authors' institution was queried to identify patients 12 months and younger with renal masses. Demographics, clinical presentation, histopathology, stage, and survival outcomes were reviewed. The most common presenting symptoms included an asymptomatic abdominal mass (73%) and hematuria (9%). Histopathology revealed WT in 73% of patients, mesoblastic nephroma in 20%. Of those infants younger than 1 month of age, mesoblastic nephroma was the most common histopathology (68%). The 5-year overall survival (OS) was 93%, and 5-year event-free survival (EFS) was 93% for the entire group. For patients with WT, 5-year OS was 88% and 5-year EFS was 83%. Outcomes for congenital mesoblastic nephroma were excellent with 5-year OS and EFS of 100%. Reasons for good prognosis may be multifactorial and may include frequent well child checks in the first year of life and favorable histology. Patients in this age group are more likely to be classified as very low risk and may be treated with surgical resection alone.

Inter-rater reliability of surgical reviews for AREN03B2: a COG renal tumor committee study.

PubMed

Hamilton, Thomas E; Barnhart, Douglas; Gow, Kenneth; Ferrer, Fernando; Kandel, Jessica; Glick, Richard; Dasgupta, Roshni; Naranjo, Arlene; He, Ying; Gratias, Eric; Geller, James; Mullen, Elizabeth; Ehrlich, Peter

2014-01-01

The Children's Oncology Group (COG) renal tumor study (AREN03B2) requires real-time central review of radiology, pathology, and the surgical procedure to determine appropriate risk-based therapy. The purpose of this study was to determine the inter-rater reliability of the surgical reviews. Of the first 3200 enrolled AREN03B2 patients, a sample of 100 enriched for blood vessel involvement, spill, rupture, and lymph node involvement was selected for analysis. The surgical assessment was then performed independently by two blinded surgical reviewers and compared to the original assessment, which had been completed by another of the committee surgeons. Variables assessed included surgeon-determined local tumor stage, overall disease stage, type of renal procedure performed, presence of tumor rupture, occurrence of intraoperative tumor spill, blood vessel involvement, presence of peritoneal implants, and interpretation of residual disease. Inter-rater reliability was measured using the Fleiss' Kappa statistic two-sided hypothesis tests (Kappa, p-value). Local tumor stage correlated in all 3 reviews except in one case (Kappa=0.9775, p<0.001). Similarly, overall disease stage had excellent correlation (0.9422, p<0.001). There was strong correlation for type of renal procedure (0.8357, p<0.001), presence of tumor rupture (0.6858, p<0.001), intraoperative tumor spill (0.6493, p<0.001), and blood vessel involvement (0.6470, p<0.001). Variables that had lower correlation were determination of the presence of peritoneal implants (0.2753, p<0.001) and interpretation of residual disease status (0.5310, p<0.001). The inter-rater reliability of the surgical review is high based on the great consistency in the 3 independent review results. This analysis provides validation and establishes precedent for real-time central surgical review to determine treatment assignment in a risk-based stratagem for multimodal cancer therapy. © 2014.

[Cystic renal neoplasms. New entities and molecular findings].

PubMed

Moch, H

2010-10-01

Renal neoplasms with dominant cysts represent a broad spectrum of known as well as novel renal tumor entities. Established renal tumors with dominant cysts include cystic nephroma, mixed epithelial and stromal tumor, synovial sarcoma and multilocular cystic renal cancer (WHO classification 2004). Novel tumor types have recently been reported, which are also characterized by marked cyst formation. Examples are tubulocystic renal cancer and renal cancer in end-stage renal disease. These tumors are very likely to be included in a future WHO classification due to their characteristic phenotype and molecular features. Cysts and clear cell renal cell carcinoma frequently coexist in the kidneys of patients with von Hippel-Lindau disease. Cysts are also a component of many sporadic clear cell renal cell carcinomas. Multilocular cystic renal cell carcinoma is composed almost exclusively of cysts and is regarded as a specific subtype of clear cell renal cancer. Recent molecular findings suggest that clear cell renal cancer may develop via a cyst-dependent mechanism in von Hippel-Lindau syndrome as well as via cyst-independent molecular pathways in sporadic clear cell renal cancer.

Cystic renal cell carcinoma carries an excellent prognosis regardless of tumor size.

PubMed

Winters, Brian R; Gore, John L; Holt, Sarah K; Harper, Jonathan D; Lin, Daniel W; Wright, Jonathan L

2015-12-01

Cystic renal cell carcinoma (cystic RCC) is thought to carry an improved prognosis relative to clear cell RCC (CCRCC); however, this is based on small case series. We used a population-based tumor registry to compare clinicopathologic features and cancer-specific mortality (CSM) of cystic RCC with those of CCRCC. The Surveillance, Epidemiology, and End Results database was queried for all patients diagnosed and treated for cystic RCC and CCRCC between 2001 and 2010. Clinical and pathologic factors were compared using t tests and chi-square tests as appropriate. Kaplan-Meier survival analysis compared CSM differences between cystic RCC and CCRCC. A total of 678 patients with cystic RCC and 46,677 with CCRCC were identified. The mean follow-up duration was 52 and 40 months, respectively. When compared with CCRCC patients, those with cystic RCC were younger (mean age 58 vs. 61 y, P < 0.001), more commonly black (22% vs. 9%, P < 0.001), and female (45% vs. 41%, P = 0.02). Cystic RCCs were more commonly T1a tumors (66% vs. 55%, P < 0.001), well differentiated (33% vs. 16%, P < 0.001), and smaller (mean size = 3.8 vs. 4.5 cm, P < 0.001). Cystic RCC was associated with a reduction in CSM when compared with CCRCC (P = 0.002). In a subset analysis, this reduction in CSM was seen only for those with T1b/T2 tumors (P = 0.01) but not for those with T1a RCCs lesions (P = 0.31). We report the largest series of cystic RCC and corroborate the findings of improved CSM when compared with CCRCC for larger tumors; however, no difference was noted in smaller tumors, suggesting that tumor biology becomes more relevant to prognosis with increasing size. These data may suggest a role for active surveillance in appropriately selected patients with small, cystic renal masses. Copyright © 2015 Elsevier Inc. All rights reserved.

Cystic renal cell carcinoma carries an excellent prognosis regardless of tumor size

PubMed Central

Winters, Brian R.; Gore, John L.; Holt, Sarah K.; Harper, Jonathan D.; Lin, Daniel W.; Wright, Jonathan L.

2016-01-01

Introduction Cystic renal cell carcinoma (cystic RCC) is thought to carry an improved prognosis relative to clear cell RCC (CCRCC); however, this is based on small case series. We used a population-based tumor registry to compare clinicopathologic features and cancer-specific mortality (CSM) of cystic RCC with those of CCRCC. Materials and methods The Surveillance, Epidemiology, and End Results database was queried for all patients diagnosed and treated for cystic RCC and CCRCC between 2001 and 2010. Clinical and pathologic factors were compared using t tests and chi-square tests as appropriate. Kaplan-Meier survival analysis compared CSM differences between cystic RCC and CCRCC. Results A total of 678 patients with cystic RCC and 46,677 with CCRCC were identified. The mean follow-up duration was 52 and 40 months, respectively. When compared with CCRCC patients, those with cystic RCC were younger (mean age 58 vs. 61 y, P < 0.001), more commonly black (22% vs. 9%, P < 0.001), and female (45% vs. 41%, P = 0.02). Cystic RCCs were more commonly T1a tumors (66% vs. 55%, P < 0.001), well differentiated (33% vs. 16%, P < 0.001), and smaller (mean size 3.8 vs. 4.5 cm, P < 0.001). Cystic RCC was associated with a reduction in CSM when compared with CCRCC (P = 0.002). In a subset analysis, this reduction in CSM was seen only for those with T1b/T2 tumors (P = 0.01) but not for those with T1a RCCs lesions (P = 0.31). Conclusions We report the largest series of cystic RCC and corroborate the findings of improved CSM when compared with CCRCC for larger tumors; however, no difference was noted in smaller tumors, suggesting that tumor biology becomes more relevant to prognosis with increasing size. These data may suggest a role for active surveillance in appropriately selected patients with small, cystic renal masses. PMID:26319351

Expression and clinical value of the soluble major histocompatibility complex class I-related chain A molecule in the serum of patients with renal tumors.

PubMed

Zhao, Y-K; Jia, C-M; Yuan, G-J; Liu, W; Qiu, Y; Zhu, Q-G

2015-06-29

We investigated the expression and clinical value of the soluble major histocompatibility complex class I-related chain A (sMICA) molecule in the serum of patients with renal tumors. Sixty patients diagnosed with renal tumors were enrolled in the experimental group, whereas 20 healthy volunteers served as the control group. The sMICA levels were measured via enzyme-linked immunosorbent assay, and the results were analyzed in combination with data from pathol-ogy examination. The experimental group had a statistically significant higher sMICA level (P < 0.05) than the control group. The sMICA level was higher in patients with malignant tumors than in those with be-nign tumors. We also observed a positive relationship among different tumor-node-metastasis (TNM) pathological stages with more advanced diseases exhibiting higher sMICA levels. As a tumor-associated antigen, MICA has a close relationship with renal tumorigenesis and immune es-cape. Our results indicated that sMICA levels were related to tumor pathol-ogy, TNM stage, and metastasis. Therefore, sMICA might be a potential marker for tumor characteristics, prognosis, and recurrence prediction.

Renal hybrid oncocytic/chromophobe tumors - a review.

PubMed

Hes, Ondrej; Petersson, Fredrik; Kuroda, Naoto; Hora, Milan; Michal, Michal

2013-10-01

Hybrid oncocytic/chromophobe tumors (HOCT) occur in three clinico-pathologic situations; (1) sporadically, (2) in association with renal oncocytomatosis and (3) in patients with Birt-Hogg-Dubé syndrome (BHD). There are no specific clinical symptoms in patients with sporadic or HOCT associated with oncocytosis/oncocytomatosis. HOCT in patients with BHD are usually encountered on characteristic BHD clinicopathologic background. Sporadic HOCT are composed of neoplastic cells with eosinophilic oncocytic cytoplasm. Tumors are usually arranged in a solid-alveolar pattern. Some neoplastic cells may have a perinuclear halo, no raisinoid nuclei are present. HOCT occurring in patients with oncocytomatosis are morphologically identical to sporadic HOCT. HOCT in BHD frequently display 3 morphologic patterns, either in isolation or in combination; (1) An admixture of areas typical of RO and CHRCC, respectively, (2) Scattered chromophobe cells in the background of a typical RO, (3) Large eosinophilic cells with intracytoplasmic vacuoles. The immunohistochemical profiles of HOCT in all clinicopathologic and morphologic groups differ slightly. The majority of tumors express parvalbumin, antimitochondrial antigen and CK 7. CD117 is invariably positive. HOCT show significant molecular genetic heterogeneity. The highest degree of variability in numerical chromosomal changes is present in sporadic HOCT. HOCT in the setting of oncocytomatosis have revealed a lesser degree of variability in the chromosomal numerical aberrations. HOCT in patients with BHD display FLCN gene mutations, which are absent in the other groups. HOCT (all three clinicopathologic groups) seem to behave indolently, as no evidence of aggressive behavior has been documented. However, no report with follow up longer than 10 years has been published.

Renal, hepatic, pulmonary and adrenal tumors induced by prenatal inorganic arsenic followed by dimethylarsinic acid in adulthood in CD1 mice

PubMed Central

Tokar, Erik J.; Diwan, Bhalchandra A.; Waalkes, Michael P.

2012-01-01

Inorganic arsenic, an early life carcinogen in humans and mice, can initiate lesions promotable by other agents in later life. The biomethylation product of arsenic, dimethylarsinic acid (DMA), is a multi-site tumor promoter. Thus, pregnant CD1 mice were given drinking water (0 or 85 ppm arsenic) from gestation day 8 to 18 and after weaning male offspring received DMA (0 or 200 ppm; drinking water) for up to 2 years. No renal tumors occurred in controls or DMA alone treated mice while gestational arsenic exposure plus later DMA induced a significant renal tumor incidence of 17% (primarily renal cell carcinoma). Arsenic plus DMA or arsenic alone also increased renal hyperplasia over control but DMA alone did not. Arsenic alone, DMA alone and arsenic plus DMA all induced urinary bladder hyperplasia (33–35%) versus control (2%). Compared to control (6%), arsenic alone tripled hepatocellular carcinoma (20%), and arsenic plus DMA doubled this rate again (43%), but DMA alone had no effect. DMA alone, arsenic alone, and arsenic plus DMA increased lung adenocarcinomas and adrenal adenomas versus control. Overall, DMA in adulthood promoted tumors/lesions initiated by prenatal arsenic in the kidney and liver, but acted independently in the urinary bladder, lung and adrenal. PMID:22230260

Study of Kidney Tumors in Younger Patients

ClinicalTrials.gov

2017-11-27

Clear Cell Sarcoma of the Kidney; Congenital Mesoblastic Nephroma; Diffuse Hyperplastic Perilobar Nephroblastomatosis; Rhabdoid Tumor of the Kidney; Stage I Renal Cell Cancer; Stage I Wilms Tumor; Stage II Renal Cell Cancer; Stage II Wilms Tumor; Stage III Renal Cell Cancer; Stage III Wilms Tumor; Stage IV Renal Cell Cancer; Stage IV Wilms Tumor; Stage V Wilms Tumor

Transferrin receptor 1 upregulation in primary tumor and downregulation in benign kidney is associated with progression and mortality in renal cell carcinoma patients

PubMed Central

Greene, Christopher J.; Attwood, Kristopher; Sharma, Nitika J.; Gross, Kenneth W.; Smith, Gary J.; Xu, Bo; Kauffman, Eric C.

2017-01-01

The central dysregulated pathway of clear cell (cc) renal cell carcinoma (RCC), the von Hippel Lindau/hypoxia inducible factor-α axis, is a key regulator of intracellular iron levels, however the role of iron uptake in human RCC tumorigenesis and progression remains unknown. We conducted a thorough, large-scale investigation of the expression and prognostic significance of the primary iron uptake protein, transferrin receptor 1 (TfR1/CD71/TFRC), in RCC patients. TfR1 immunohistochemistry was performed in over 1500 cores from 574 renal cell tumor patient tissues (primary tumors, matched benign kidneys, metastases) and non-neoplastic tissues from 36 different body sites. TfR1 levels in RCC tumors, particularly ccRCC, were significantly associated with adverse clinical prognostic features (anemia, lower body mass index, smoking), worse tumor pathology (size, stage, grade, multifocality, sarcomatoid dedifferentiation) and worse survival outcomes, including after adjustments for tumor pathology. Highest TfR1 tissue levels in the non-gravid body were detected in benign renal tubule epithelium. Opposite to TfR1 changes in the primary tumor, TfR1 levels in benign kidney dropped during tumor progression and were inversely associated with worse survival outcomes, independent of tumor pathology. Quantitative measurement of TfR1 subcellular localization in cell lines demonstrated mixed cytoplasmic and membranous expression with increased TfR1 in clusters in ccRCC versus benign renal cell lines. Results of this study support an important role for TfR1 in RCC progression and identify TfR1 as a novel RCC biomarker and therapeutic target. PMID:29291011

Histotripsy and metastasis: Assessment in a renal VX-2 rabbit tumor model

NASA Astrophysics Data System (ADS)

Styn, Nicholas R.; Hall, Timothy L.; Fowlkes, J. Brian; Cain, Charles A.; Roberts, William W.

2012-10-01

Histotripsy is a non-invasive, pulsed ultrasound technology where controlled cavitation is used to homogenize targeted tissue. We sought to assess the possibility that histotripsy may increase metastatic spread of tumor by quantifying the number of lung metastasis apparent after histotripsy treatment of aggressive renal VX-2 tumor compared to nontreated controls. VX-2 tumor was implanted in the left kidneys of 28 New Zealand White rabbits. Twenty rabbits were treated with histotripsy (day 13 after implantation) while 8 served as controls. All rabbits underwent left nephrectomy (day 14) and then were euthanized (day 19). This study was powered to detect a doubling in metastatic rate. Homogenized tumor was seen in all treated nephrectomy specimens. Whole-mount, coronal lung sections were viewed to calculate number and density of metastases. Viable tumor was present in all 28 lungs examined. Histology confirmed fractionation of tumor in all treatment rabbits. There was not a statistical difference in total lung metastases (88.7 vs. 72.5; p=0.29) or metastatic density (8.9 vs. 7.0 mets/cm2; p=0.22) between treated and control rabbits. Further investigation is planned to validate these results in the VX-2 model and to assess metastatic rates in less aggressive tumors treated with histotripsy.

Perioperative outcomes of zero ischemia radiofrequency ablation-assisted tumor enucleation for renal cell carcinoma: results of 182 patients.

PubMed

Zhang, Chengwei; Zhao, Xiaozhi; Guo, Suhan; Ji, Changwei; Wang, Wei; Guo, Hongqian

2018-05-15

To evaluate the perioperative outcomes of zero ischemia radiofrequency ablation-assisted tumor enucleation. Patients undergoing zero ischemia radiofrequency ablation-assisted tumor enucleation were retrospectively identified from July 2008 to March 2013. The tumor was enucleated after RFA treatment. R.E.N.A.L., PADUA and centrality index (C-index) score systems were used to assess each tumor case. We analyzed the correlation of perioperative outcomes with these scores. Postoperative complications were graded with Clavien-Dindo system. Multivariate logistic regression analyses were used to assess risk of complications. Among 182 patients assessed, median tumor size, estimated blood loss, hospital stay and operative time were 3.2 cm (IQR 2.8-3.4), 80 ml (IQR 50-120), 7 days (IQR 6-8) and 100 min (IQR 90-120), respectively. All three scoring systems were strongly correlated with estimated blood loss, hospital stay and operative time. We found 3 (1.6%) intraoperative and 23 (12.6%, 13 [7.1%] Grade 1 and 10 [5.5%] Grade 2 & 3a) postoperative complications. The median follow-up was 55.5 months (IQR 45-70). Additionally, the complexities of R.E.N.A.L., PADUA and C-index scores were significantly correlated with complication grades (P < 0.001; P < 0.001; P < 0.001; respectively). As the representative, R.E.N.A.L. score was an independent predictive factor for postoperative complications and patients with a high complexity had an over 24-fold higher risk compared to those with a low complexity (OR 24.360, 95% CI 4.412-134.493, P < 0.001). Zero ischemia radiofrequency ablation-assisted tumor enucleation is considered an effective nephron-sparing treatment. Scoring systems could be useful for predicting perioperative outcomes of radiofrequency ablation-assisted tumor enucleation.

Differentiation of low- and high-grade clear cell renal cell carcinoma: Tumor size versus CT perfusion parameters.

PubMed

Chen, Chao; Kang, Qinqin; Xu, Bing; Guo, Hairuo; Wei, Qiang; Wang, Tiegong; Ye, Hui; Wu, Xinhuai

To compare the utility of tumor size and CT perfusion parameters for differentiation of low- and high-grade clear cell renal cell carcinoma (RCC). Tumor size, Equivalent blood volume (Equiv BV), permeability surface-area product (PS), blood flow (BF), and Fuhrman pathological grading of clear cell RCC were retrospectively analyzed. High-grade clear cell RCC had significantly higher tumor size and lower PS than low grade. Tumor size positively correlated with Fuhrman grade, but PS negatively did. Tumor size and PS were significantly independent indexes for differentiating high-grade from low-grade clear cell RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

[Case report of rare co-occurrence of renal cell carcinoma and crossed renal dystopia (L-shaped kidney)].

PubMed

Bakov, V N; Los, M S

2017-10-01

L-shaped kidney refers to a rare anomaly of the relative kidney positioning. Due to low prevalence, the literature on the co-occurrence of this anomaly with malignancy is lacking. And, if the diagnosis of a renal anomaly does not present difficulties, if a tumor is detected in such a kidney, even MSCT does not always help differentiate a pelvic tumor from a tumor of the renal parenchyma spreading to the pelvicalyceal system. This has important implications for choosing an appropriate surgical strategy. A feature of the presented clinical observation is the co-occurrence of the rare anomaly of kidney position and locally advanced renal cell carcinoma spreading to the renal pelvis. Due to the massive spread of the tumor, an organ-sparing surgery was not feasible. Due to the suspicion of tumor spread to the renal pelvis, the patient underwent nephrureterectomy of the L-shaped kidney. Introduction to renoprival state with transfer to chronic hemodialysis became the only option to maintain homeostasis and extend the patients life. Histological examination revealed clear cell renal cell carcinoma with invasion of the pelvis and renal capsule, with no clear demarcation between the fused kidneys.

Clinical management of renal cell carcinoma with venous tumor thrombus.

PubMed

Agochukwu, Nnenaya; Shuch, Brian

2014-06-01

Venous invasion is common in advanced renal cell carcinoma (RCC) due to the unique biology of this cancer. The presence of a tumor thrombus often makes clinical management challenging. In this review, we detail specific preoperative, perioperative, and surgical strategies involving the care of the complex kidney cancer patient with venous tumor involvement. We performed a comprehensive review of selected peer-reviewed publications regarding RCC tumor thrombus biology, medical and surgical management techniques, and immediate and long-term outcomes. The perioperative management may require special imaging techniques, preoperative testing, very recent imaging, and consultation with other surgical services. There are various approaches to these patients as the clinical presentation, stage of disease, primary tumor size, level of thrombus, degree of venous occlusion, presence of bland thrombus, and primary tumor laterality influence management. Select patients with metastatic disease can do well with cytoreductive nephrectomy and thrombectomy. Those with localized disease have a high risk of recurrence; however, some patients can exhibit durable survival with surgery alone. The evolving surgical and medical treatments are discussed. Even when these surgeries are performed in high volume centers, significant perioperative complications are common and greater complications are seen with higher thrombus extent. If surgery is attempted, it is important for urologic oncologists to follow strict attention to specific surgical principles. These general principles include complete vascular control, avoidance of thrombus embolization, close hemodynamic monitoring, and institutional resources for caval resection/replacement and venous bypass if necessary.

Breast cancer metastatic to the kidney with renal vein involvement.

PubMed

Nasu, Hatsuko; Miura, Katsutoshi; Baba, Megumi; Nagata, Masao; Yoshida, Masayuki; Ogura, Hiroyuki; Takehara, Yasuo; Sakahara, Harumi

2015-02-01

The common sites of breast cancer metastases include bones, lung, brain, and liver. Renal metastasis from the breast is rare. We report a case of breast cancer metastatic to the kidney with extension into the renal vein. A 40-year-old woman had undergone left mastectomy for breast cancer at the age of 38. A gastric tumor, which was later proved to be metastasis from breast cancer, was detected by endoscopy. Computed tomography performed for further examination of the gastric tumor revealed a large left renal tumor with extension into the left renal vein. It mimicked a primary renal tumor. Percutaneous biopsy of the renal tumor confirmed metastasis from breast cancer. Surgical intervention of the stomach and the kidney was avoided, and she was treated with systemic chemotherapy. Breast cancer metastatic to the kidney may present a solitary renal mass with extension into the renal vein, which mimics a primary renal tumor.

Dendritic-cell-based immunotherapy evokes potent anti-tumor immune responses in CD105+ human renal cancer stem cells.

PubMed

Zhang, Xiao-Fei; Weng, De-Sheng; Pan, Ke; Zhou, Zi-Qi; Pan, Qiu-Zhong; Zhao, Jing-Jing; Tang, Yan; Jiang, Shan-Shan; Chen, Chang-Long; Li, Yong-Qiang; Zhang, Hong-Xia; Chang, Alfred E; Wicha, Max S; Zeng, Yi-Xin; Li, Qiao; Xia, Jian-Chuan

2017-11-01

Cancer stem cells (CSCs) are responsible for tumor initiation, progression, and resistance to therapeutic agents; they are usually less sensitive to conventional cancer therapies, and could cause tumor relapse. An ideal therapeutic strategy would therefore be to selectively target and destroy CSCs, thereby preventing tumor relapse. The aim of the present study was to evaluate the effectiveness of dendritic cells (DCs) pulsed with antigen derived from CD105+ human renal cell carcinoma (RCC) CSCs against renal cancer cells in vitro and in vivo. We identified "stem-like" characteristics of CD105+ cells in two human RCC cell lines: A498 and SK-RC-39. Loading with cell lysates did not change the characteristics of the DCs. However, DCs loaded with lysates derived from CD105+ CSCs induced more functionally specific active T cells and specific antibodies against CSCs, and clearly depressed the tumor growth in mice. Our results could form the basis for a novel strategy to improve the efficacy of DC-based immunotherapy for human RCC. © 2017 Wiley Periodicals, Inc.

Low enhancement on multiphase contrast-enhanced CT images: an independent predictor of the presence of high tumor grade of clear cell renal cell carcinoma.

PubMed

Zhu, Ye-Hua; Wang, Xun; Zhang, Jin; Chen, Yong-Hui; Kong, Wen; Huang, Yi-Ran

2014-09-01

The purpose of this study was to assess the relation between tumor enhancement on multiphase contrast-enhanced CT images and Fuhrman grade of clear cell renal cell carcinoma. A single-institution retrospective review was conducted on the records of 255 patients who underwent radical or partial nephrectomy and received a histologic diagnosis of clear cell renal cell carcinoma. Two radiologists recorded the radiographic features of each patient, including the attenuation value of the lesion, lesion size, calcification within the lesion, cystic versus solid appearance, and margin regularity. Parameters representing the extent of tumor enhancement were defined and calculated. The association between tumor enhancement and Fuhrman grade was analyzed, and multivariate analysis was performed to find independent predictors of high tumor grade. Significant differences existed in tumor enhancement among different Fuhrman grades (p < 0.001). High-grade tumors had significantly lower enhancement (p < 0.001). The enhancement parameter had a sensitivity of 0.84 and specificity of 0.93 in prediction of high tumor grade. In the multivariate analysis, more advanced age, irregular margin, and low tumor enhancement were the three independent predictors of high tumor grade. Tumor enhancement of clear cell renal cell carcinoma on multiphase contrast-enhanced CT images is associated with Fuhrman grade. Low tumor enhancement in the corticomedullary phase is an independent predictor of high tumor grade. This system may be helpful in clinical decision making about the care of patients treated by nonsurgical approaches.

[Pleural metastases of renal carcinoma].

PubMed

Giigoruk, O G; Lazarev, A F; Doroshenko, V S

2007-01-01

Metastases in renal carcinoma are diagnosed at initial diagnosis in 25% examinees. Traditional renal carcinoma has higher metastatic potential, is associated with worse survival of the patients compared to papillary cancer. We studied cytological characteristics of renal carcinoma metastases to the pleura in comparison with histological studies of the primary lesion using immunohistochemical findings. We examined cytologically pleural liquid in renal carcinoma metastases to the pleura in 6 patients (2.3% of carcinomatous pleuricies). High efficacy was shown by a cytocentrifuge CYTOSPIN-4. In 3 cases initial cancer was renal cell carcinoma, pleural exudation developed 2 years later, clear cell carcinoma appeared 6 years later and papillary cancer--10 years later. In the other 3 cases malignant cells were detected in new-onset cases. Renal carcinoma was diagnosed in one case. Cytological preparations were studied with identification of cytological signs typical for classic clear cell, granulocell and papillary renal cancer. Immunohistochemical examination of primary tumor lesion in the kidney discovered high proliferative activity of tumor cells by Ki-67 index to 5.28%. The tumors had solitary Bcl-2 positive cells. Expression of mutant p-53 took place in 0.93%. Her-2/neu hyperexpression was not found in the tumors of the above patients. Such immunohistochemical parameters point to poor prognosis. This is confirmed by renal carcinoma metastases to the pleura.

Pattern multiplicity and fumarate hydratase (FH)/S-(2-succino)-cysteine (2SC) staining but not eosinophilic nucleoli with perinucleolar halos differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas from kidney tumors without FH gene alteration.

PubMed

Muller, Marie; Guillaud-Bataille, Marine; Salleron, Julia; Genestie, Catherine; Deveaux, Sophie; Slama, Abdelhamid; de Paillerets, Brigitte Bressac; Richard, Stéphane; Benusiglio, Patrick R; Ferlicot, Sophie

2018-02-06

Hereditary leiomyomatosis and renal cell carcinoma syndrome is characterized by an increased risk of agressive renal cell carcinoma, often of type 2 papillary histology, and is caused by FH germline mutations. A prominent eosinophilic macronucleolus with a perinucleolar clear halo is distinctive of hereditary leiomyomatosis and renal cell carcinoma syndrome-associated renal cell carcinoma according to the 2012 ISUP and 2016 WHO kidney tumor classification. From an immunohistochemistry perspective, tumors are often FH-negative and S-(2-succino)-cysteine (2SC) positive. We performed a pathology review of 24 renal tumors in 23 FH mutation carriers, and compared them to 12 type 2 papillary renal cell carcinomas from FH wild-type patients. Prominent eosinophilic nucleoli with perinucleolar halos were present in almost all FH-deficient renal cell carcinomas (23/24). Unexpectedly, they were also present in 58% of type 2 papillary renal cell carcinomas from wild-type patients. Renal cell carcinoma in mutation carriers displayed a complex architecture with multiple patterns, typically papillary, tubulopapillary, and tubulocystic, but also sarcomatoid and rhabdoid. Such pattern diversity was not seen in non-carriers. FH/2SC immunohistochemistry was informative as all hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas were either FH- or 2SC+. For FH and 2SC immunohistochemistries taken separately, sensitivity of negative anti-FH immunohistochemistry was 87.5% and specificity was 100%. For positive anti-2SC immunohistochemistry, sensitivity, and specificity were 91.7% and 91.7%, respectively. All FH wild-type renal cell carcinoma were FH-positive, and all but one were 2SC-negative. In conclusion, multiplicity of architectural patterns, rhabdoid/sarcomatoid components and combined FH/2SC staining, but not prominent eosinophilic nucleoli with perinucleolar halos, differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal

Optical-resolution photoacoustic microscopy of the metabolic rate of oxygen in a mouse renal tumor model

NASA Astrophysics Data System (ADS)

Yeh, Chenghung; Hu, Song; Liang, Jinyang; Li, Lei; Soetikno, Brian; Lu, Zhi Hong; Sohn, Rebecca E.; Maslov, Konstantin; Arbeit, Jeffrey M.; Wang, Lihong V.

2015-03-01

We propose using noninvasive longitudinal optical-resolution photoacoustic microscopy (L-ORPAM) to quantify blood flow flux, oxygen saturation (sO2), and thereby the metabolic rate of oxygen (MRO2), for a renal tumor model in the same mouse over weeks to months. Experiments showed that the sO2 difference between the artery and vein decreased greatly due to the arteriovenous shunting effect during tumor growth. Moreover, hypermetabolism was exhibited by an increase in MRO2.

Tumor-Like Liver Abscess Mimicking Malignancy With Lung Metastases in a Patient With Acute Renal Failure: A Case Report.

PubMed

Wang, Chih Hsin; Sun, Cheuk-Kay; Jiang, Jiunn-Song; Tsai, Ming Hsien

2016-03-01

The worldwide incidence of Klebsiella pneumoniae liver abscess (KLA) is increasing. It is important to accurately diagnose this life-threatening disease to provide timely and appropriate treatment. Here we report the case of a 38-year-old man with acute renal failure and a tumor-like liver abscess and septic pulmonary embolism. Initially, his clinical symptoms, laboratory tests, and radiological findings presented equivocal results of malignancy with metastases. Fine needle aspiration of liver tumor was performed, which showed purulent material with a culture positive for K pneumoniae. KLA symptoms are atypical, and radiological findings may mimic a malignancy with tumor necrosis. In some circumstances, liver aspiration biopsy may be necessary to confirm the real etiology, leading to prompt and timely treatment. Moreover, we should be alert for the impression of KLA when facing a diabetic patient with liver mass lesion and acute renal failure.

Long-term High Fat Ketogenic Diet Promotes Renal Tumor Growth in a Rat Model of Tuberous Sclerosis.

PubMed

Liśkiewicz, Arkadiusz D; Kasprowska, Daniela; Wojakowska, Anna; Polański, Krzysztof; Lewin-Kowalik, Joanna; Kotulska, Katarzyna; Jędrzejowska-Szypułka, Halina

2016-02-19

Nutritional imbalance underlies many disease processes but can be very beneficial in certain cases; for instance, the antiepileptic action of a high fat and low carbohydrate ketogenic diet. Besides this therapeutic feature it is not clear how this abundant fat supply may affect homeostasis, leading to side effects. A ketogenic diet is used as anti-seizure therapy i.a. in tuberous sclerosis patients, but its impact on concomitant tumor growth is not known. To examine this we have evaluated the growth of renal lesions in Eker rats (Tsc2+/-) subjected to a ketogenic diet for 4, 6 and 8 months. In spite of existing opinions about the anticancer actions of a ketogenic diet, we have shown that this anti-seizure therapy, especially in its long term usage, leads to excessive tumor growth. Prolonged feeding of a ketogenic diet promotes the growth of renal tumors by recruiting ERK1/2 and mTOR which are associated with the accumulation of oleic acid and the overproduction of growth hormone. Simultaneously, we observed that Nrf2, p53 and 8-oxoguanine glycosylase α dependent antitumor mechanisms were launched by the ketogenic diet. However, the pro-cancerous mechanisms finally took the ascendency by boosting tumor growth.

The Utility of the Remnant Kidney Volume/Body Surface Area Ratio and Tumor Diameter as Predictors of Postoperative Degree of Renal Functional Decline in Patients With Renal Cell Carcinoma Treated by Radical Nephrectomy.

PubMed

Sejima, Takehiro; Yamaguchi, Noriya; Iwamoto, Hideto; Masago, Toshihiko; Morizane, Shuichi; Ono, Koji; Koumi, Tsutomu; Honda, Masashi; Takenaka, Atsushi

2015-08-01

To characterize the preoperative factors affecting renal cell carcinoma patients as predictive of post-radical nephrectomy (RN) mild (M-decline) or severe (S-decline) renal functional decline and to elucidate the histopathologic features of the resected normal kidney cortex, as well as the occurrence of cardiovascular disease (CVD) in both M-decline and S-decline patients. M-decline and S-decline were categorized as a percentage of postoperative estimated glomerular filtration rate decline of <20 and of >40, respectively. The preoperative factors analyzed were patient demographics, comorbidities, and radiographic findings, including remnant kidney status and tumor size. The factors based on postoperative information analyzed were tumor and normal cortex pathology and CVD events. In 175 patient cohort, 21 and 32 cases were categorized as M-decline and S-decline, respectively. Absence of comorbidities, larger remnant kidney volume (RKV)/body surface area (BSA) ratio, and larger tumor diameter were significantly predictive of M-decline, whereas smaller tumor diameter was significantly predictive of S-decline. The global glomerulosclerosis extent in nephrectomized normal cortex of S-decline cases was significantly higher than in other types of cases. No CVD event was observed in M-decline cases. This is the first report to identify the RKV/BSA ratio as a promising predictor of post-RN degree of renal functional decline. Post-RN prevention of life-threatening outcomes according to preoperative and postoperative information, including the degree of post-RN renal functional decline and histopathology of the nephrectomized normal cortex, should be considerable in future urological tasks. Copyright © 2015 Elsevier Inc. All rights reserved.

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report.

PubMed

Zhu, Guanchen; Qiu, Xuefeng; Chen, Xianchen; Liu, Guangxiang; Zhang, Gutian; Gan, Weidong; Guo, Hongqian

2015-12-01

Renal cell carcinoma (RCC) accounts for 85-90% of kidney cancers, which in turn account for 2-3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7-10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC.

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report

PubMed Central

ZHU, GUANCHEN; QIU, XUEFENG; CHEN, XIANCHEN; LIU, GUANGXIANG; ZHANG, GUTIAN; GAN, WEIDONG; GUO, HONGQIAN

2015-01-01

Renal cell carcinoma (RCC) accounts for 85–90% of kidney cancers, which in turn account for 2–3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7–10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC. PMID:26788164

Tissue polypeptide specific antigen (TPS) as a tumor marker in renal cell carcinoma.

PubMed

Chang, Chao-Hsiang; Wu, His-Chin; Yen, Ruoh-Fang; Kao, Albert; Lin, Cheng-Chieh; Lee, Cheng-Chun

2002-01-01

Tissue polypeptide specific antigen (TPS) is a new tumor marker that indicates tumor proliferative rate rather than tumor burden. The purpose of this study was to assess the clinical value of TPS in patients with renal cell carcinoma (RCC). Serum levels of TPS were measured in 30 patients with locoregional and in 20 patients with advanced disease before and after therapy. The results showed that: (1) the detection sensitivity of TPS for RCC is 60.0%; (2) the detection sensitivity of TPS in advanced RCC (100.0%) was significantly higher than in locoregional RCC (33.3%); (3) the 10 locoregional RCC patients without recurrence had normal serum TPS levels during a follow-up period of 1 year; and (4) the 8 advanced RCC patients with good response during therapy had normal serum TPS levels, while 12 patients with poor disease had significantly elevated serum TPS levels during a follow-up period of 1 year. Our results suggest that TPS may have a potential clinical role as a valuable tumor marker for RCC, especially in advanced diseases and follow-up therapy response.

A renal epithelioid angiomyolipoma/perivascular epithelioid cell tumor with TFE3 gene break visualized by FISH.

PubMed

Ohe, Chisato; Kuroda, Naoto; Hes, Ondrej; Michal, Michal; Vanecek, Tomas; Grossmann, Petr; Tanaka, Yukichi; Tanaka, Mio; Inui, Hidekazu; Komai, Yoshihiro; Matsuda, Tadashi; Uemura, Yoshiko

2012-12-01

We present a case of renal epithelioid angiomyolipoma (eAML)/perivascular epithelioid cell tumor (PEComa) with a TFE3 gene break visible by fluorescence in situ hybridization (FISH). Histologically, the tumor was composed of mainly epithelioid cells forming solid arrangements with small foci of spindle cells. In a small portion of the tumor, neoplastic cells displayed nuclear pleomorphism, such as polygonal and enlarged vesicular nuclei with prominent nucleoli. Marked vascularity was noticeable in the background, and perivascular hyaline sclerosis was also seen. Immunohistochemically, neoplastic cells were diffusely positive for α-smooth muscle actin and melanosome in the cytoplasm. Nuclei of many neoplastic cells were positive for TFE3. FISH analysis of the TFE3 gene break using the Poseidon TFE3 (Xp11) Break probe revealed positive results. Reverse transcriptase-polymerase chain reactions (RT-PCR) for ASPL/TFE3, PRCC/TFE3, CLTC/TFE3, PSF/TFE3, and NonO/TFE3 gene fusions all revealed negative results. This is the first reported case of renal eAML/PEComa with a TFE3 gene break, and it has unique histological findings as compared to previously reported TFE3 gene fusion-positive PEComas. Pathologists should recognize that PEComa with TFE3 gene fusion can arise even in the kidney.

Renin-secreting tumors.

PubMed

Roswell, R H

1990-02-01

Hypertension resulting from a renin-secreting tumor was first reported in 1967 by Robertson et al. Kihara and coworkers subsequently coined the term juxtaglomerular cell tumor for a similar tumor in a young woman with hyperreninemic hypertension. Since the description of these first two cases, it has become clear that renin-secreting tumors of both renal and nonrenal origin can cause surgically curable hypertension. Primary reninism has been suggested as a more appropriate term for the clinical syndrome associated with renin-secreting tumors, both renal and extrarenal, whether benign or malignant.

Renal lymph nodes for tumor staging: appraisal of 871 nephrectomies with examination of hilar fat.

PubMed

Mehta, Vikas; Mudaliar, Kumaran; Ghai, Ritu; Quek, Marcus L; Milner, John; Flanigan, Robert C; Picken, Maria M

2013-11-01

Despite decades of research, the role of lymphadenectomy in the management of renal cell carcinoma (RCC) is still not clearly defined. Before the implementation of targeted therapies, lymph node metastases were considered to be a portent of markedly decreased survival, regardless of the tumor stage. However, the role of lymphadenectomy and the relative benefit of retroperitoneal lymph node dissection in the context of modern adjunctive therapies have not been conclusively addressed in the clinical literature. The current pathologic literature does not offer clear recommendations with regard to the minimum number of lymph nodes that should be examined in order to accurately stage the pN in renal cell carcinoma. Although gross examination of the hilar fat to assess the nodal status is performed routinely, it has not yet been determined whether this approach is adequate. To evaluate the status of lymph nodes and their rate of identification in the pathologic examination of nephrectomy specimens in adult renal malignancies. We reviewed the operative and pathology reports of 871 patients with renal malignancies treated by nephrectomy. All tumors were classified according to the seventh edition of the Tumor-Nodes-Metastasis classification. Patients were divided into 3 groups: Nx, no lymph nodes recovered; N0, negative; and N1, with positive lymph nodes. Grossly visible lymph nodes were submitted separately; as per grossing protocol, hilar fatty tissue was submitted for microscopic examination. We evaluated the factors that affected the number of lymph nodes identified and the variables that allowed the prediction of nodal involvement. Lymph nodes were recovered in 333 of 871 patients (38%): hilar in 125 patients, nonhilar in 137 patients, and hilar and nonhilar in 71 patients. Patients with positive lymph nodes (n = 87) were younger, had larger primary tumors, and had lymph nodes of average size, as well as a higher pT stage, nuclear grade, and rate of metastases

Mitochondrial ASncmtRNA-1 and ASncmtRNA-2 as potent targets to inhibit tumor growth and metastasis in the RenCa murine renal adenocarcinoma model

PubMed Central

Borgna, Vincenzo; Villegas, Jaime; Burzio, Verónica A.; Belmar, Sebastián; Araya, Mariela; Jeldes, Emanuel; Lobos-González, Lorena; Silva, Verónica; Villota, Claudio; Oliveira-Cruz, Luciana; Lopez, Constanza; Socias, Teresa; Castillo, Octavio; Burzio, Luis O.

2017-01-01

Knockdown of antisense noncoding mitochondrial RNAs (ASncmtRNAs) induces apoptosis in several human and mouse tumor cell lines, but not normal cells, suggesting this approach for a selective therapy against different types of cancer. Here we show that in vitro knockdown of murine ASncmtRNAs induces apoptotic death of mouse renal adenocarcinoma RenCa cells, but not normal murine kidney epithelial cells. In a syngeneic subcutaneous RenCa model, treatment delayed and even reversed tumor growth. Since the subcutaneous model does not reflect the natural microenviroment of renal cancer, we used an orthotopic model of RenCa cells inoculated under the renal capsule. These studies showed inhibition of tumor growth and metastasis. Direct metastasis assessment by tail vein injection of RenCa cells also showed a drastic reduction in lung metastatic nodules. In vivo treatment reduces survivin, N-cadherin and P-cadherin levels, providing a molecular basis for metastasis inhibition. In consequence, the treatment significantly enhanced mouse survival in these models. Our results suggest that the ASncmtRNAs could be potent and selective targets for therapy against human renal cell carcinoma. PMID:28620146

Mitochondrial ASncmtRNA-1 and ASncmtRNA-2 as potent targets to inhibit tumor growth and metastasis in the RenCa murine renal adenocarcinoma model.

PubMed

Borgna, Vincenzo; Villegas, Jaime; Burzio, Verónica A; Belmar, Sebastián; Araya, Mariela; Jeldes, Emanuel; Lobos-González, Lorena; Silva, Verónica; Villota, Claudio; Oliveira-Cruz, Luciana; Lopez, Constanza; Socias, Teresa; Castillo, Octavio; Burzio, Luis O

2017-07-04

Knockdown of antisense noncoding mitochondrial RNAs (ASncmtRNAs) induces apoptosis in several human and mouse tumor cell lines, but not normal cells, suggesting this approach for a selective therapy against different types of cancer. Here we show that in vitro knockdown of murine ASncmtRNAs induces apoptotic death of mouse renal adenocarcinoma RenCa cells, but not normal murine kidney epithelial cells. In a syngeneic subcutaneous RenCa model, treatment delayed and even reversed tumor growth. Since the subcutaneous model does not reflect the natural microenviroment of renal cancer, we used an orthotopic model of RenCa cells inoculated under the renal capsule. These studies showed inhibition of tumor growth and metastasis. Direct metastasis assessment by tail vein injection of RenCa cells also showed a drastic reduction in lung metastatic nodules. In vivo treatment reduces survivin, N-cadherin and P-cadherin levels, providing a molecular basis for metastasis inhibition. In consequence, the treatment significantly enhanced mouse survival in these models. Our results suggest that the ASncmtRNAs could be potent and selective targets for therapy against human renal cell carcinoma.

Spontaneous renal hemorrhage associated with renal tumors.

PubMed

Mydlo, J H; Kaplan, J; Thelmo, W; Macchia, R J

1997-01-01

Spontaneous ruptures of the kidney sometimes require emergency surgery, at which time the etiology for the rupture becomes evident. Because the patient with previously existing renal pathology is asymptomatic, when these ruptures do occur one should be suspect of underlying disease. We present a case and discuss the relevant aspects of such entities.

Early impact of robot-assisted partial nephrectomy on renal function as assessed by renal scintigraphy.

PubMed

Luciani, Lorenzo G; Chiodini, Stefano; Donner, Davide; Cai, Tommaso; Vattovani, Valentino; Tiscione, Daniele; Giusti, Guido; Proietti, Silvia; Chierichetti, Franca; Malossini, Gianni

2016-06-01

To measure the early impact of robot-assisted partial nephrectomy (RAPN) on renal function as assessed by renal scan (Tc 99m-DTPA), addressing the issue of risk factors for ischemic damage to the kidney. All patients undergoing RAPN for cT1 renal masses between June 2013 and May 2014 were included in this prospective study. Renal function as expressed by glomerular filtration rate (GFR) was assessed by Technetium 99m-diethylenetriaminepentaacetic acid (Tc 99m-DTPA) renal scan preoperatively and postoperatively at 1 month in every patient. A multivariable analysis was used for the determination of independent factors predictive of GFR decrease of the operated kidney. Overall, 32 patients underwent RAPN in the time interval. Median tumor size, blood loss, and ischemia time were 4 cm, 200 mL, and 24 min, respectively. Two grade III complications occurred (postoperative bleeding in the renal fossa, urinoma). The GFR of the operated kidney decreased significantly from 51.7 ± 15.1 mL/min per 1.73 m(2) preoperatively to 40, 12 ± 12.4 mL/min per 1.73 m(2) 1 month postoperatively (p = 0.001) with a decrease of 22.4 %. On multivariable analysis, only tumor size (p = 0.05) was a predictor of GFR decrease of the operated kidney. Robotic-assisted partial nephrectomy had a detectable impact on early renal function in a series of relatively large tumors and prevailing intermediate nephrometric risk. A mean decrease of 22 % of GFR as assessed by renal scan in the operated kidney was found at 1 month postoperatively. In multivariable analysis, tumor size only was a significant predictor of renal function loss.

The Perlman syndrome: familial renal dysplasia with Wilms tumor, fetal gigantism and multiple congenital anomalies.

PubMed

Neri, G; Martini-Neri, M E; Katz, B E; Opitz, J M

1984-09-01

We describe a familial syndrome of renal dysplasia, Wilms tumor, hyperplasia of the endocrine pancreas, fetal gigantism, multiple congenital anomalies and mental retardation. This condition was previously described by Perlman et al [1973, 1975] and we propose to call it the "Perlman syndrome." It appears to be transmitted as an autosomal recessive trait. The possible relationships between dysplasia, neoplasia and malformation are discussed.

Radiofrequency Ablation of Renal Tumors with an Expandable Multitined Electrode: Results, Complications, and Pilot Evaluation of Cooled Pyeloperfusion for Collecting System Protection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rouviere, Olivier; Badet, Lionel; Murat, Francois Joseph

2008-05-15

The objective of this study was to retrospectively evaluate the results of radiofrequency ablation (RFA) of renal tumors with an impedance-based system using an expandable multitined electrode. Twenty-two patients (30 tumors) were treated with RFA over a 7-year period, percutaneously (16 tumors) or intraoperatively (14 tumors). Follow-up imaging was performed at 1-3, 6, and 12 months and yearly thereafter. Twenty-seven of 30 tumors (19/22 patients) showed no residual tumor on the first imaging control. Two residual tumors were successfully ablated by a second RFA procedure. Our mean follow-up period was 35 months (range, 3-84 months). Two tumors that had beenmore » completely ablated based on imaging criteria recurred 11 and 48 months after RFA. One was treated by partial nephrectomy. The other one was not treated because the patient developed bone metastases. One patient had nephrectomy because of an RFA-induced ureteropelvic junction stricture. Nine patients (11 sessions) had a pyeloperfusion of cooled saline during RFA. None developed symptomatic complications, even though in three patients the ablation zone extended to the closest calyx (3-5 mm from the tumor). We conclude that RFA of renal tumors is promising, but serious complications to the collecting system must be taken into consideration. Prophylactic per-procedural cooling of the collecting system is feasible but needs further assessment.« less

Multidetector Computed Tomography Features in Differentiating Exophytic Renal Angiomyolipoma from Retroperitoneal Liposarcoma

PubMed Central

Wang, Qiushi; Juan, Yu-Hsiang; Li, Yong; Xie, Jia-Jun; Liu, Hui; Huang, Hongfei; Liu, Zaiyi; Zheng, Junhui; Saboo, Ujwala S.; Saboo, Sachin S.; Liang, Changhong

2015-01-01

Abstract This study aims to evaluate the multidetector computed tomography (CT) imaging features in differentiating exophytic renal angiomyolipoma (AML) from retroperitoneal liposarcoma. We retrospectively enrolled 42 patients with confirmed exophytic renal AML (31 patients) or retroperitoneal liposarcoma (11 patients) during 8 years period to assess: renal parenchymal defect at site of tumor contact, supply from branches of renal artery, tumoral vessel extending through the renal parenchyma, dilated intratumoral vessels, hemorrhage, non–fat-containing intratumoral nodules with postcontrast enhancement, calcification, renal sinus enlargement, anterior displacement of kidneys, and other associated AML. Renal parenchymal defect, renal arterial blood supply, tumoral vessel through the renal parenchyma, dilated intratumoral vessels, intratumoral/perirenal hemorrhage, renal sinus enlargement, and associated AML were seen only or mainly in exophytic renal AML (all P value < 0.05); however, non–fat-attenuating enhancing intratumoral nodules, intratumoral calcification, and anterior displacement of the kidney were more common in liposarcoma (all P value < 0.05). AMLs reveal renal parenchymal defect at the site of tumor contact, supply from renal artery, tumoral vessel extending through the renal parenchyma, dilated intratumoral vessels, intratumoral and/or perirenal hemorrhage, renal sinus enlargement, and associated AML. Non–fat-attenuating enhancing intratumoral nodules, intratumoral calcifications, and anterior displacement of kidney were more commonly seen in liposarcoma. PMID:26376398

Combination Chemotherapy, Radiation Therapy, and/or Surgery in Treating Patients With High-Risk Kidney Tumors

ClinicalTrials.gov

2017-06-22

Childhood Renal Cell Carcinoma; Clear Cell Renal Cell Carcinoma; Clear Cell Sarcoma of the Kidney; Papillary Renal Cell Carcinoma; Rhabdoid Tumor of the Kidney; Stage I Renal Cell Cancer; Stage I Renal Wilms Tumor; Stage II Renal Cell Cancer; Stage II Renal Wilms Tumor; Stage III Renal Cell Cancer; Stage III Renal Wilms Tumor; Stage IV Renal Cell Cancer; Stage IV Renal Wilms Tumor

Successful Endovascular Control of Renal Artery in a Transplant Kidney During Nephron Sparing Surgery (NSS) for Large Centrally Located Tumor.

PubMed

Shprits, Sagi; Moskovits, Boaz; Sachner, Robert; Nativ, Ofer

2016-05-01

Renal cell carcinoma in a transplant kidney is a rare condition. Nephron Sparing Surgery (NSS) is the treatment of choice. One of the main technical challenges is obtaining adequate vascular control. We present a rare case of large centrally located hillar tumor in a kidney 18 years after transplantation treated with NSS. Vascular control was achieved by using a novel approach. Post-operative course was uneventful with minimal decrease in renal function. We believe that this unique choice of treatment can be used in cases of NSS where the access to the renal pedicle is limited.

Induction of Renal Cell Tumors in Rats and Mice, and Enhancement of Hepatocellular Tumor Development in Mice after Long‐term Hydroquinone Treatment

PubMed Central

Hirose, Masao; Tanaka, Hikaru; Asakawa, Emiko; Shirai, Tomoyuki; Ito, Nobuyuki

1991-01-01

Hydroquinone (HQ) was administered to F344 rats and B6C3F1 mice of both sexes at a level of 0.8% in the diet for two years. This treatment induced renal tubular hyperplasia as well as adenomas, predominantly in males of both species, and was associated with chronic nephropathy in rats. In addition, the occurrence of epithelial hyperplasia of the renal papilla was increased in male rats. Foci of cellular alteration of the liver were significantly reduced in number by HQ in rats, but in contrast, were increased in mice, where development of hepatocellular adenoma was also enhanced in males. The incidence of squamous cell hyperplasia of the forestomach epithelium was significantly higher in mice of both sexes given HQ than in the controls, but no corresponding increase in tumor development was observed. The present study strongly indicates potential renal carcinogenicity of HQ in male rats and hepatocarcinogenicity in male mice. Thus, it is possible that HQ, which is present in the human environment, may play a role in cancer development in man. PMID:1752780

The genetic locus NRC-1 within chromosome 3p12 mediates tumor suppression in renal cell carcinoma independently of histological type, tumor microenvironment, and VHL mutation.

PubMed

Lovell, M; Lott, S T; Wong, P; El-Naggar, A; Tucker, S; Killary, A M

1999-05-01

Human chromosome 3p cytogenetic abnormalities and loss of heterozygosity have been observed at high frequency in the nonpapillary form of sporadic renal cell carcinoma (RCC). The von Hippel-Lindau (VHL) gene has been identified as a tumor suppressor gene for RCC at 3p25, and functional studies as well as molecular genetic and cytogenetic analyses have suggested as many as two or three additional regions of 3p that could harbor tumor suppressor genes for sporadic RCC. We have previously functionally defined a novel genetic locus nonpapillary renal carcinoma-1 (NRC-1) within chromosome 3p12, distinct from the VHL gene, that mediates tumor suppression and rapid cell death of RCC cells in vivo. We now report the suppression of tumorigenicity of RCC cells in vivo after the transfer of a defined centric 3p fragment into different histological types of RCC. Results document the functional involvement of NRC-1 in not only different cell types of RCC (i.e., clear cell, mixed granular cell/clear cell, and sarcomatoid types) but also in papillary RCC, a less frequent histological type of RCC for which chromosome 3p LOH and genetic aberrations have only rarely been observed. We also report that the tumor suppression observed in functional genetic screens was independent of the microenvironment of the tumor, further supporting a role for NRC-1 as a more general mediator of in vivo growth control. Furthermore, this report demonstrates the first functional evidence for a VHL-independent pathway to tumorigenesis in the kidney via the genetic locus NRC-1.

Excisional treatment of renal hydatid cyst mimicking renal tumor with diode laser technique: A case report.

PubMed

Uçar, Murat; Karagözlü Akgül, Ahsen; Çelik, Fatih; Kılıç, Nizamettin

2016-08-01

Cystic echinococcosis, which is one of the most important helminthic infestations, is a serious life-threatening health problem in developing countries. Hydatid cyst of the kidney is a rare condition in children that can be treated with medical therapy or surgical treatment in some resistant cases. Here, we present a case of renal hydatid cyst that was treated with laparoscopic excision with diode laser. A 15-year-old female patient was admitted with abdominal pain. Abdominal ultrasonography revealed a 32 × 23 × 19-mm solid mass with cystic component at lower pole of right kidney. An indirect hemagglutination (IHA) test for echinococcosis granulosus was positive at a 1:320 titer. Other laboratory tests were within normal limits. The patient received albendazole therapy for 3 months. The follow-up magnetic resonance imaging showed a solitary lesion with exophytic extensions that contained large separations. No contrast enhancement could be detected after gadolinium injection. As no regression could be detected radiologically, surgical treatment was planned. Laparoscopic renal lower pole mass cyst excision with diode laser was performed (Figure). The patient was hospitalized for 1 day without any blood transfusion. Histopathological examination was consistent with hydatid cyst of the kidney. Diagnosis of hydatid cyst of the kidney is generally made incidentally and can be misdiagnosed as a primary kidney tumor. Radiological studies may be insufficient for accurate diagnosis. In our case, laparoscopic excision of cyst and histopathological examination confirmed the diagnosis of cyst hydatid. At the postoperative second month the ultrasonography of kidneys were normal. For patients from endemic areas, hydatid cyst should always be included in the differential diagnosis. Laparoscopic excision of renal hydatid cysts with diode laser is a feasible and safe technique for resistant cases. Copyright © 2016 Journal of Pediatric Urology Company. Published by Elsevier

Analysis of papillary renal adenocarcinoma.

PubMed

Mydlo, J H; Bard, R H

1987-12-01

A retrospective review was conducted comparing the angiographic findings, tumor volumes, staging, and survival of patients with papillary renal adenocarcinoma as compared with the more common clear and granular cell renal adenocarcinoma. The data suggest that the papillary histopathologic organization confers an improved prognosis, which concurs with previous findings. We speculate on why this tumor behaves differently from clear cell carcinoma.

Management of localized and locally advanced renal tumors. A contemporary review of current treatment options.

PubMed

Brookman-May, S; Langenhuijsen, J F; Volpe, A; Minervini, A; Joniau, S; Salagierski, M; Roscigno, M; Akdogan, B; Vandromme, A; Rodriguez-Faba, O; Marszalek, M

2013-06-01

About 70% of patients with renal cell carcinoma present with localized or locally advanced disease at primary diagnosis. Whereas these patients are potentially curable by surgical treatment alone, a further 20% to 30% of patients are diagnosed with primary metastatic disease. Although over the past years medical treatment for metastatic patients has nearly completely changed from immunotherapy to effective treatment with targeted agents, metastatic disease still represents a disease status which is not curable. Also in patients with metastatic disease, surgical treatment of the primary tumor plays an important role, since local tumor related complications can be avoided or minimized by surgery. Furthermore, also improvement of overall survival has been proven for surgery in metastatic patients when combined with cytokine treatment. Hence, surgical combined with systemic treatment as a multi-modal, adjuvant, and neo-adjuvant treatment is also required in patients with advanced or metastatic disease. A growing number of elderly and comorbid patients are currently diagnosed with small renal masses, which has led to increased attention paid to alternative ablative treatment modalities as well as active surveillance strategies, which are applied in order to avoid unnecessary overtreatment in these patients. Since surgical treatment also might enhance the risk of chronic kidney disease with consecutive cardiac disorders as well as reduced overall survival, ablative techniques and active surveillance are increasingly applied. In this review article we focus on current surgical and none-surgical treatment options for the management of patients with localized, locally advanced, and metastatic renal cell carcinoma.

Abnormalities at chromosome region 3p12-14 characterize clear cell renal carcinoma.

PubMed

Carroll, P R; Murty, V V; Reuter, V; Jhanwar, S; Fair, W R; Whitmore, W F; Chaganti, R S

1987-06-01

In an effort to determine whether or not any characteristic chromosomal abnormalities exist in renal cancer, cytogenetic findings were correlated with tumor histology in nine cases of renal adenocarcinoma. Metaphase preparations adequate for analysis were obtained from cultures harvested between day 3 and day 21. Model chromosome number was diploid in three cases, hypodiploid in three, and hyperdiploid in the remaining three. One clear cell adenocarcinoma failed to reveal any chromosomal abnormality. Two tumors, a tubular/papillary carcinoma and an acinar/papillary carcinoma, showed the clonal abnormalities del(1)(p2l),+2,+7,+8,+12,+13,+16,+17,-21 and t(2;10)(q14-21;q26),+7q,+11q,-18, respectively. Interestingly, five of six clear cell tumors studied had clonal abnormalities affecting the short arm of chromosome #3 in the 3p12-21 region, and in the remaining case, of 15 karyotyped metaphases suitable for interpretation, one showed a deletion in 3p. These data indicate that clear cell carcinoma of the kidney may be associated with a nonrandom chromosomal abnormality involving the 3p12-14 region.

Cytoplasmic expression of CD133 stemness marker is associated with tumor aggressiveness in clear cell renal cell carcinoma.

PubMed

Saeednejad Zanjani, Leili; Madjd, Zahra; Abolhasani, Maryam; Andersson, Yvonne; Rasti, Arezoo; Shariftabrizi, Ahmad; Asgari, Mojgan

2017-10-01

Prominin-1 (CD133) is one of the most commonly used markers for cancer stem cells (CSCs), which are characterized by their ability for self-renewal and tumorigenicity. However, the clinical and prognostic significance of CSCs in renal cell carcinoma (RCC) remains unclear. The aim of this study was to investigate the expression patterns and prognostic significance of the cancer stem cell marker CD133 in different histological subtypes of RCC. CD133 expression was evaluated using immunohistochemistry in 193 well-defined renal tumor samples on tissue microarrays, including 136 (70.5%) clear cell renal cell carcinomas (CCRCCs), 26 (13.5%) papillary RCCs, and 31 (16.1%) chromophobe RCCs. The association between CD133 expression and clinicopathological features as well as the survival outcomes was determined. There was a statistically significant difference between CD133 expression among the different RCC subtypes. In CCRCC, higher cytoplasmic expression of CD133 was significantly associated with increase in grade, stage, microvascular invasion (MVI) and lymph node invasion (LNI), while no association was found with the membranous expression. Moreover, on multivariate analysis, TNM stage and nuclear grade were independent prognostic factors for overall survival (OS) in cytoplasmic expression. We showed that higher cytoplasmic CD133 expression was associated with more aggressive tumor behavior and more advanced disease in CCRCC but not in the other examined subtypes. Our results demonstrated that higher cytoplasmic CD133 expression is clinically significant in CCRCC and is associated with increased tumor aggressiveness and is useful for predicting cancer progression. Copyright © 2017 Elsevier Inc. All rights reserved.

R.E.N.A.L. Nephrometry Score: A Preoperative Risk Factor Predicting the Fuhrman Grade of Clear-Cell Renal Carcinoma

PubMed Central

Chen, Shao-Hao; Wu, Yu-Peng; Li, Xiao-Dong; Lin, Tian; Guo, Qing-Yong; Chen, Ye-Hui; Huang, Jin-Bei; Wei, Yong; Xue, Xue-Yi; Zheng, Qing-Shui; Xu, Ning

2017-01-01

Objective: The purpose of this study was to evaluate the efficacy and feasibility of the R.E.N.A.L. Nephrometry Score to postoperatively predict high-grade clear-cell renal carcinoma (ccRCC). Methods: The study included 288 patients diagnosed with ccRCC who had complete CT/CTA data and R.E.N.A.L. Nephrometry Scores and underwent renal surgery at our center between January 2012 and December 2015. The relationship between the pathological grade of renal masses and R.E.N.A.L. Nephrometry Score was evaluated. Results: Univariate analysis indicated that diagnostic modality, cystic necrosis, enlargement of the regional lymph node, distant metastasis, clinical T stage, TNM stage, surgical modality, tumor size, nearness of the tumor to the collecting system or sinus, total Nephrometry Score and individual anatomic descriptor components were significantly associated with postoperative tumor grade (P < 0.05). Multivariate analysis showed that tumor size, the maximal diameter (R score), exophytic/endophytic properties (E score) and the location relative to the polar lines (L score) were independent prognostic factors to preoperatively predicting ccRCC pathological grade. The areas under the ROC curve with respect to the multi-parameter regression model (0.935, 95%CI: 0.904-0.966), tumor size (0.901, 95%CI: 0.866-0.937), R score (0.868, 95%CI: 0.825-0.911), E score (0.511, 95%CI: 0.442-0.581) and L score (0.842, 95%CI: 0.791-0.892) were calculated and compared. Conclusion: Tumor size, as well as R, E, and L scores were independent prognostic factors for high-grade pathology. Lager tumor sizes and higher R, E and L scores were more likely to be associated with high-grade pathological outcomes. Thus, the R.E.N.A.L. Score is of practical significance in facilitating urologists to make therapeutic decisions. PMID:29151960

Stages of Renal Cell Cancer

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

BHD Tumor Cell Line and Renal Cell Carcinoma Line | NCI Technology Transfer Center | TTC

Cancer.gov

Scientists at the National Cancer Institute  have developed a novel renal cell carcinoma (RCC) cell line designated UOK257, which was derived from the surgical kidney tissue of a patient with hereditary Birt-Hogg-Dube''''(BHD) syndrome and companion cell line UOK257-2 in which FLCN expression has been restored by lentivirus infection. The NCI Urologic Oncology Branch seeks parties interested in licensing or collaborative research to co-develop, evaluate, or commercialize kidney cancer tumor cell lines.

Anatomic features of enhancing renal masses predict malignant and high-grade pathology: a preoperative nomogram using the RENAL Nephrometry score.

PubMed

Kutikov, Alexander; Smaldone, Marc C; Egleston, Brian L; Manley, Brandon J; Canter, Daniel J; Simhan, Jay; Boorjian, Stephen A; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

2011-08-01

Counseling patients with enhancing renal mass currently occurs in the context of significant uncertainty regarding tumor pathology. We evaluated whether radiographic features of renal masses could predict tumor pathology and developed a comprehensive nomogram to quantitate the likelihood of malignancy and high-grade pathology based on these features. We retrospectively queried Fox Chase Cancer Center's prospectively maintained database for consecutive renal masses where a Nephrometry score was available. All patients in the cohort underwent either partial or radical nephrectomy. The individual components of Nephrometry were compared with histology and grade of resected tumors. We used multiple logistic regression to develop nomograms predicting the malignancy of tumors and likelihood of high-grade disease among malignant tumors. Nephrometry score was available for 525 of 1750 renal masses. Nephrometry score correlated with both tumor grade (p < 0.0001) and histology (p < 0.0001), such that small endophytic nonhilar tumors were more likely to represent benign pathology. Conversely, large interpolar and hilar tumors more often represented high-grade cancers. The resulting nomogram from these data offers a useful tool for the preoperative prediction of tumor histology (area under the curve [AUC]: 0.76) and grade (AUC: 0.73). The model was subjected to out-of-sample cross-validation; however, lack of external validation is a limitation of the study. The current study is the first to objectify the relationship between tumor anatomy and pathology. Using the Nephrometry score, we developed a tool to quantitate the preoperative likelihood of malignant and high-grade pathology of an enhancing renal mass. Copyright © 2011 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Renal Cell Carcinoma With Chromosome 6p Amplification Including the TFEB Gene: A Novel Mechanism of Tumor Pathogenesis?

PubMed

Williamson, Sean R; Grignon, David J; Cheng, Liang; Favazza, Laura; Gondim, Dibson D; Carskadon, Shannon; Gupta, Nilesh S; Chitale, Dhananjay A; Kalyana-Sundaram, Shanker; Palanisamy, Nallasivam

2017-03-01

Amplification of chromosome 6p has been implicated in aggressive behavior in several cancers, but has not been characterized in renal cell carcinoma (RCC). We identified 9 renal tumors with amplification of chromosome 6p including the TFEB gene, 3 by fluorescence in situ hybridization, and 6 from the Cancer Genome Atlas (TCGA) databases. Patients' ages were 28 to 78 years (median, 61 y). Most tumors were high stage (7/9 pT3a, 2/9 pN1). Using immunohistochemistry, 2/4 were positive for melanocytic markers and cathepsin K. Novel TFEB fusions were reported by TCGA in 2; however, due to a small composition of fusion transcripts compared with full-length transcripts (0.5/174 and 3.3/132 FPKM), we hypothesize that these represent secondary fusions due to amplification. Five specimens (4 TCGA, 1 fluorescence in situ hybridization) had concurrent chromosome 3p copy number loss or VHL deletion. However, these did not resemble clear cell RCC, had negative carbonic anhydrase IX labeling, lacked VHL mutation, and had papillary or unclassified histology (2/4 had gain of chromosome 7 or 17). One tumor each had somatic FH mutation and SMARCB1 mutation. Chromosome 6p amplification including TFEB is a previously unrecognized cytogenetic alteration in RCC, associated with heterogenous tubulopapillary eosinophilic and clear cell histology. The combined constellation of features does not fit cleanly into an existing tumor category (unclassified), most closely resembling papillary or translocation RCC. The tendency for high tumor stage, varied tubulopapillary morphology, and a subset with melanocytic marker positivity suggests the possibility of a unique tumor type, despite some variation in appearance and genetics.

Tumor Mutational Load and Immune Parameters across Metastatic Renal Cell Carcinoma Risk Groups.

PubMed

de Velasco, Guillermo; Miao, Diana; Voss, Martin H; Hakimi, A Ari; Hsieh, James J; Tannir, Nizar M; Tamboli, Pheroze; Appleman, Leonard J; Rathmell, W Kimryn; Van Allen, Eliezer M; Choueiri, Toni K

2016-10-01

Patients with metastatic renal cell carcinoma (mRCC) have better overall survival when treated with nivolumab, a cancer immunotherapy that targets the immune checkpoint inhibitor programmed cell death 1 (PD-1), rather than everolimus (a chemical inhibitor of mTOR and immunosuppressant). Poor-risk mRCC patients treated with nivolumab seemed to experience the greatest overall survival benefit, compared with patients with favorable or intermediate risk, in an analysis of the CheckMate-025 trial subgroup of the Memorial Sloan Kettering Cancer Center (MSKCC) prognostic risk groups. Here, we explore whether tumor mutational load and RNA expression of specific immune parameters could be segregated by prognostic MSKCC risk strata and explain the survival seen in the poor-risk group. We queried whole-exome transcriptome data in renal cell carcinoma patients (n = 54) included in The Cancer Genome Atlas who ultimately developed metastatic disease or were diagnosed with metastatic disease at presentation and did not receive immune checkpoint inhibitors. Nonsynonymous mutational load did not differ significantly by the MSKCC risk group, nor was the expression of cytolytic genes-granzyme A and perforin-or selected immune checkpoint molecules different across MSKCC risk groups. In conclusion, this analysis revealed that mutational load and expression of markers of an active tumor microenvironment did not correlate with MSKCC risk prognostic classification in mRCC. Cancer Immunol Res; 4(10); 820-2. ©2016 AACR. ©2016 American Association for Cancer Research.

Microarray gene expression profiling using core biopsies of renal neoplasia.

PubMed

Rogers, Craig G; Ditlev, Jonathon A; Tan, Min-Han; Sugimura, Jun; Qian, Chao-Nan; Cooper, Jeff; Lane, Brian; Jewett, Michael A; Kahnoski, Richard J; Kort, Eric J; Teh, Bin T

2009-01-01

We investigate the feasibility of using microarray gene expression profiling technology to analyze core biopsies of renal tumors for classification of tumor histology. Core biopsies were obtained ex-vivo from 7 renal tumors-comprised of four histological subtypes-following radical nephrectomy using 18-gauge biopsy needles. RNA was isolated from these samples and, in the case of biopsy samples, amplified by in vitro transcription. Microarray analysis was then used to quantify the mRNA expression patterns in these samples relative to non-diseased renal tissue mRNA. Genes with significant variation across all non-biopsy tumor samples were identified, and the relationship between tumor and biopsy samples in terms of expression levels of these genes was then quantified in terms of Euclidean distance, and visualized by complete linkage clustering. Final pathologic assessment of kidney tumors demonstrated clear cell renal cell carcinoma (4), oncocytoma (1), angiomyolipoma (1) and adrenalcortical carcinoma (1). Five of the seven biopsy samples were most similar in terms of gene expression to the resected tumors from which they were derived in terms of Euclidean distance. All seven biopsies were assigned to the correct histological class by hierarchical clustering. We demonstrate the feasibility of gene expression profiling of core biopsies of renal tumors to classify tumor histology.

Versican Promotes Tumor Progression, Metastasis and Predicts Poor Prognosis in Renal Carcinoma.

PubMed

Mitsui, Yozo; Shiina, Hiroaki; Kato, Taku; Maekawa, Shigekatsu; Hashimoto, Yutaka; Shiina, Marisa; Imai-Sumida, Mitsuho; Kulkarni, Priyanka; Dasgupta, Pritha; Wong, Ryan Kenji; Hiraki, Miho; Arichi, Naoko; Fukuhara, Shinichiro; Yamamura, Soichiro; Majid, Shahana; Saini, Sharanjot; Deng, Guoren; Dahiya, Rajvir; Nakajima, Koichi; Tanaka, Yuichiro

2017-07-01

The proteoglycan versican (VCAN) promotes tumor progression and enhances metastasis in several cancers; however, its role in clear cell renal cell carcinoma (ccRCC) remains unknown. Recent evidence suggests that VCAN is an important target of chromosomal 5q gain, one of the most prevalent genetic abnormalities in ccRCC. Thus, we investigated whether VCAN expression is associated with the pathogenesis of ccRCC. VCAN expression was analyzed using three RCC and normal kidney cell lines as well as a clinical cohort of 84 matched ccRCC and normal renal tissues. Functional analyses on growth and progression properties were performed using VCAN-depleted ccRCC cells. Microarray expression profiling was employed to investigate the target genes and biologic pathways involved in VCAN-mediated ccRCC carcinogenesis. ccRCC had elevated VCAN expression in comparison with normal kidney in both cell lines and clinical specimens. The elevated expression of VCAN was significantly correlated with metastasis ( P < 0.001) and worse 5-year overall survival after radical nephrectomy ( P = 0.014). In vitro , VCAN knockdown significantly decreased cell proliferation and increased apoptosis in Caki-2 and 786-O cells, and this was associated with alteration of several TNF signaling-related genes such as TNFα, BID , and BAK Furthermore, VCAN depletion markedly decreased cell migration and invasion which correlated with reduction of MMP7 and CXCR4. These results demonstrate that VCAN promotes ccRCC tumorigenesis and metastasis and thus is an attractive target for novel diagnostic, prognostic, and therapeutic strategies. Implications: This study highlights the oncogenic role of VCAN in renal cell carcinogenesis and suggests that this gene has therapeutic and/or biomarker potential for renal cell cancer. Mol Cancer Res; 15(7); 884-95. ©2017 AACR . ©2017 American Association for Cancer Research.

Age- and Tumor Subtype–Specific Breast Cancer Risk Estimates for CHEK2*1100delC Carriers

PubMed Central

Hogervorst, Frans; van Hien, Richard; Cornelissen, Sten; Broeks, Annegien; Adank, Muriel A.; Meijers, Hanne; Waisfisz, Quinten; Hollestelle, Antoinette; Schutte, Mieke; van den Ouweland, Ans; Hooning, Maartje; Andrulis, Irene L.; Anton-Culver, Hoda; Antonenkova, Natalia N.; Antoniou, Antonis C.; Arndt, Volker; Bermisheva, Marina; Bogdanova, Natalia V.; Bolla, Manjeet K.; Brauch, Hiltrud; Brenner, Hermann; Brüning, Thomas; Burwinkel, Barbara; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Couch, Fergus J.; Cox, Angela; Cross, Simon S.; Czene, Kamila; Dunning, Alison M.; Fasching, Peter A.; Figueroa, Jonine; Fletcher, Olivia; Flyger, Henrik; Galle, Eva; García-Closas, Montserrat; Giles, Graham G.; Haeberle, Lothar; Hall, Per; Hillemanns, Peter; Hopper, John L.; Jakubowska, Anna; John, Esther M.; Jones, Michael; Khusnutdinova, Elza; Knight, Julia A.; Kosma, Veli-Matti; Kristensen, Vessela; Lee, Andrew; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Margolin, Sara; Meindl, Alfons; Milne, Roger L.; Muranen, Taru A.; Newcomb, Polly A.; Offit, Kenneth; Park-Simon, Tjoung-Won; Peto, Julian; Pharoah, Paul D.P.; Robson, Mark; Rudolph, Anja; Sawyer, Elinor J.; Schmutzler, Rita K.; Seynaeve, Caroline; Soens, Julie; Southey, Melissa C.; Spurdle, Amanda B.; Surowy, Harald; Swerdlow, Anthony; Tollenaar, Rob A.E.M.; Tomlinson, Ian; Trentham-Dietz, Amy; Vachon, Celine; Wang, Qin; Whittemore, Alice S.; Ziogas, Argyrios; van der Kolk, Lizet; Nevanlinna, Heli; Dörk, Thilo; Bojesen, Stig; Easton, Douglas F.

2016-01-01

Purpose CHEK2*1100delC is a well-established breast cancer risk variant that is most prevalent in European populations; however, there are limited data on risk of breast cancer by age and tumor subtype, which limits its usefulness in breast cancer risk prediction. We aimed to generate tumor subtype- and age-specific risk estimates by using data from the Breast Cancer Association Consortium, including 44,777 patients with breast cancer and 42,997 controls from 33 studies genotyped for CHEK2*1100delC. Patients and Methods CHEK2*1100delC genotyping was mostly done by a custom Taqman assay. Breast cancer odds ratios (ORs) for CHEK2*1100delC carriers versus noncarriers were estimated by using logistic regression and adjusted for study (categorical) and age. Main analyses included patients with invasive breast cancer from population- and hospital-based studies. Results Proportions of heterozygous CHEK2*1100delC carriers in controls, in patients with breast cancer from population- and hospital-based studies, and in patients with breast cancer from familial- and clinical genetics center–based studies were 0.5%, 1.3%, and 3.0%, respectively. The estimated OR for invasive breast cancer was 2.26 (95%CI, 1.90 to 2.69; P = 2.3 × 10−20). The OR was higher for estrogen receptor (ER)–positive disease (2.55 [95%CI, 2.10 to 3.10; P = 4.9 × 10−21]) than it was for ER-negative disease (1.32 [95%CI, 0.93 to 1.88; P = .12]; P interaction = 9.9 × 10−4). The OR significantly declined with attained age for breast cancer overall (P = .001) and for ER-positive tumors (P = .001). Estimated cumulative risks for development of ER-positive and ER-negative tumors by age 80 in CHEK2*1100delC carriers were 20% and 3%, respectively, compared with 9% and 2%, respectively, in the general population of the United Kingdom. Conclusion These CHEK2*1100delC breast cancer risk estimates provide a basis for incorporating CHEK2*1100delC into breast cancer risk prediction models and into

Age- and Tumor Subtype-Specific Breast Cancer Risk Estimates for CHEK2*1100delC Carriers.

PubMed

Schmidt, Marjanka K; Hogervorst, Frans; van Hien, Richard; Cornelissen, Sten; Broeks, Annegien; Adank, Muriel A; Meijers, Hanne; Waisfisz, Quinten; Hollestelle, Antoinette; Schutte, Mieke; van den Ouweland, Ans; Hooning, Maartje; Andrulis, Irene L; Anton-Culver, Hoda; Antonenkova, Natalia N; Antoniou, Antonis C; Arndt, Volker; Bermisheva, Marina; Bogdanova, Natalia V; Bolla, Manjeet K; Brauch, Hiltrud; Brenner, Hermann; Brüning, Thomas; Burwinkel, Barbara; Chang-Claude, Jenny; Chenevix-Trench, Georgia; Couch, Fergus J; Cox, Angela; Cross, Simon S; Czene, Kamila; Dunning, Alison M; Fasching, Peter A; Figueroa, Jonine; Fletcher, Olivia; Flyger, Henrik; Galle, Eva; García-Closas, Montserrat; Giles, Graham G; Haeberle, Lothar; Hall, Per; Hillemanns, Peter; Hopper, John L; Jakubowska, Anna; John, Esther M; Jones, Michael; Khusnutdinova, Elza; Knight, Julia A; Kosma, Veli-Matti; Kristensen, Vessela; Lee, Andrew; Lindblom, Annika; Lubinski, Jan; Mannermaa, Arto; Margolin, Sara; Meindl, Alfons; Milne, Roger L; Muranen, Taru A; Newcomb, Polly A; Offit, Kenneth; Park-Simon, Tjoung-Won; Peto, Julian; Pharoah, Paul D P; Robson, Mark; Rudolph, Anja; Sawyer, Elinor J; Schmutzler, Rita K; Seynaeve, Caroline; Soens, Julie; Southey, Melissa C; Spurdle, Amanda B; Surowy, Harald; Swerdlow, Anthony; Tollenaar, Rob A E M; Tomlinson, Ian; Trentham-Dietz, Amy; Vachon, Celine; Wang, Qin; Whittemore, Alice S; Ziogas, Argyrios; van der Kolk, Lizet; Nevanlinna, Heli; Dörk, Thilo; Bojesen, Stig; Easton, Douglas F

2016-08-10

CHEK2*1100delC is a well-established breast cancer risk variant that is most prevalent in European populations; however, there are limited data on risk of breast cancer by age and tumor subtype, which limits its usefulness in breast cancer risk prediction. We aimed to generate tumor subtype- and age-specific risk estimates by using data from the Breast Cancer Association Consortium, including 44,777 patients with breast cancer and 42,997 controls from 33 studies genotyped for CHEK2*1100delC. CHEK2*1100delC genotyping was mostly done by a custom Taqman assay. Breast cancer odds ratios (ORs) for CHEK2*1100delC carriers versus noncarriers were estimated by using logistic regression and adjusted for study (categorical) and age. Main analyses included patients with invasive breast cancer from population- and hospital-based studies. Proportions of heterozygous CHEK2*1100delC carriers in controls, in patients with breast cancer from population- and hospital-based studies, and in patients with breast cancer from familial- and clinical genetics center-based studies were 0.5%, 1.3%, and 3.0%, respectively. The estimated OR for invasive breast cancer was 2.26 (95%CI, 1.90 to 2.69; P = 2.3 × 10(-20)). The OR was higher for estrogen receptor (ER)-positive disease (2.55 [95%CI, 2.10 to 3.10; P = 4.9 × 10(-21)]) than it was for ER-negative disease (1.32 [95%CI, 0.93 to 1.88; P = .12]; P interaction = 9.9 × 10(-4)). The OR significantly declined with attained age for breast cancer overall (P = .001) and for ER-positive tumors (P = .001). Estimated cumulative risks for development of ER-positive and ER-negative tumors by age 80 in CHEK2*1100delC carriers were 20% and 3%, respectively, compared with 9% and 2%, respectively, in the general population of the United Kingdom. These CHEK2*1100delC breast cancer risk estimates provide a basis for incorporating CHEK2*1100delC into breast cancer risk prediction models and into guidelines for intensified screening and follow-up. © 2016

A tumor suppressor locus within 3p14-p12 mediates rapid cell death of renal cell carcinoma in vivo.

PubMed Central

Sanchez, Y; el-Naggar, A; Pathak, S; Killary, A M

1994-01-01

High frequency loss of alleles and cytogenetic aberrations on the short arm of chromosome 3 have been documented in renal cell carcinoma (RCC). Potentially, three distinct regions on 3p could encode tumor suppressor genes involved in the genesis of this cancer. We report that the introduction of a centric fragment of 3p, encompassing 3p14-q11, into a highly malignant RCC cell line resulted in a dramatic suppression of tumor growth in athymic nude mice. Another defined deletion hybrid contained the region 3p12-q24 of the introduced human chromosome and failed to suppress tumorigenicity. These data functionally define a tumor suppressor locus, nonpapillary renal carcinoma-1 (NRC-1), within 3p14-p12, the most proximal region of high frequency allele loss in sporadic RCC as well as the region containing the translocation breakpoint in familial RCC. Furthermore, we provide functional evidence that NRC-1 controls the growth of RCC cells by inducing rapid cell death in vivo. Images PMID:8159756

Microarray gene expression profiling using core biopsies of renal neoplasia

PubMed Central

Rogers, Craig G.; Ditlev, Jonathon A.; Tan, Min-Han; Sugimura, Jun; Qian, Chao-Nan; Cooper, Jeff; Lane, Brian; Jewett, Michael A.; Kahnoski, Richard J.; Kort, Eric J.; Teh, Bin T.

2009-01-01

We investigate the feasibility of using microarray gene expression profiling technology to analyze core biopsies of renal tumors for classification of tumor histology. Core biopsies were obtained ex-vivo from 7 renal tumors—comprised of four histological subtypes—following radical nephrectomy using 18-gauge biopsy needles. RNA was isolated from these samples and, in the case of biopsy samples, amplified by in vitro transcription. Microarray analysis was then used to quantify the mRNA expression patterns in these samples relative to non-diseased renal tissue mRNA. Genes with significant variation across all non-biopsy tumor samples were identified, and the relationship between tumor and biopsy samples in terms of expression levels of these genes was then quantified in terms of Euclidean distance, and visualized by complete linkage clustering. Final pathologic assessment of kidney tumors demonstrated clear cell renal cell carcinoma (4), oncocytoma (1), angiomyolipoma (1) and adrenalcortical carcinoma (1). Five of the seven biopsy samples were most similar in terms of gene expression to the resected tumors from which they were derived in terms of Euclidean distance. All seven biopsies were assigned to the correct histological class by hierarchical clustering. We demonstrate the feasibility of gene expression profiling of core biopsies of renal tumors to classify tumor histology. PMID:19966938

Tumor Control Outcomes After Hypofractionated and Single-Dose Stereotactic Image-Guided Intensity-Modulated Radiotherapy for Extracranial Metastases From Renal Cell Carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zelefsky, Michael J., E-mail: zelefskm@mskcc.org; Greco, Carlo; Motzer, Robert

2012-04-01

Purpose: To report tumor local progression-free outcomes after treatment with single-dose, image-guided, intensity-modulated radiotherapy and hypofractionated regimens for extracranial metastases from renal cell primary tumors. Patients and Methods: Between 2004 and 2010, 105 lesions from renal cell carcinoma were treated with either single-dose, image-guided, intensity-modulated radiotherapy to a prescription dose of 18-24 Gy (median, 24) or hypofractionation (three or five fractions) with a prescription dose of 20-30 Gy. The median follow-up was 12 months (range, 1-48). Results: The overall 3-year actuarial local progression-free survival for all lesions was 44%. The 3-year local progression-free survival for those who received a highmore » single-dose (24 Gy; n = 45), a low single-dose (<24 Gy; n = 14), or hypofractionation regimens (n = 46) was 88%, 21%, and 17%, respectively (high single dose vs. low single dose, p = .001; high single dose vs. hypofractionation, p < .001). Multivariate analysis revealed the following variables were significant predictors of improved local progression-free survival: 24 Gy dose compared with a lower dose (p = .009) and a single dose vs. hypofractionation (p = .008). Conclusion: High single-dose, image-guided, intensity-modulated radiotherapy is a noninvasive procedure resulting in high probability of local tumor control for metastatic renal cell cancer generally considered radioresistant according to the classic radiobiologic ranking.« less

Tumor Control Outcomes Following Hypofractionated and Single-Dose Stereotactic Image-Guided Intensity-Modulated Radiotherapy for Extracranial Metastases from Renal Cell Carcinoma

PubMed Central

Zelefsky, Michael J; Greco, Carlo; Motzer, Robert; Magsanoc, Juan Martin; Pei, Xin; Lovelock, Michael; Mechalakos, Jim; Zatcky, Joan; Fuks, Zvi; Yamada, Yoshiya

2014-01-01

Purpose To report tumor local progression-free outcomes following treatment with single-dose image-guided intensity-modulated radiotherapy (SD-IGRT) and hypofractionated regimens for extracranial metastases from renal cell primary tumors. Methods and Materials Between 2004 and 2010, a total of 105 lesions from renal cell carcinomas were treated with either SD-IGRT to prescription doses of 18–24 Gy (median, 24 Gy) or hypofractionation (3 or 5 fractions) with prescription doses ranging between 20 and 30 Gy. The median follow-up was 12 months (range, 1–48 months). Results The overall 3-year actuarial local progression-free survival (LPFS) for all lesions was 44%. The 3-year LPFS for those who received high single-dose (24 Gy; n = 45), low single-dose (< 24 Gy; n = 14), and hypofractionation regimens (n = 46) were 88%, 21%, and 17%, respectively (high single dose versus low single dose, p = 0.001; high single dose versus hypofractionation, p < 0.001). Multivariate analysis revealed the following variables as significant predictors of improved LPFS: dose of 24 Gy compared with lower dose (p = 0.009), and single dose versus hypofractionation (p = 0.008). Conclusion High-dose SD-IGRT is a non-invasive procedure resulting in high probability of local tumor control for metastatic renal cell cancers, generally considered radioresistant according to classical radiobiological ranking. PMID:21596489

Physical and functional mapping of a tumor suppressor locus for renal cell carcinoma within chromosome 3p12.

PubMed

Lott, S T; Lovell, M; Naylor, S L; Killary, A M

1998-08-15

Using a functional genetic approach, we previously identified a novel genetic locus, NRC-1 (Nonpapillary Renal Cell Carcinoma 1), that mediated tumor suppression and rapid cell death of renal cell carcinoma (RCC) cells in vivo. For these experiments, a defined subchromosomal fragment of human chromosome 3p was transferred into a sporadic RCC cell line via microcell fusion, and microcell hybrid clones were tested for tumorigenicity in vivo. The results indicated functional evidence for a novel tumor suppressor locus within the 3p14-p12 interval known to contain the most common fragile site of the human genome (FRA3B), the FHIT gene, and the breakpoint region associated with the familial form of RCC. We now report the physical mapping of the NRC-1 critical region by detailed microsatellite analyses of novel microcell hybrid clones containing transferred fragments of chromosome 3p in the RCC cell background that were phenotypically suppressed or unsuppressed for tumorigenicity in vivo. The results limit the region containing the tumor suppressor locus within chromosome 3p12. The FHIT gene, FRA3B, and the familial RCC breakpoint region were excluded from the NRC-1 critical region. Furthermore, the NRC-1 locus falls within a well-characterized homozygous deletion region of 5-7 Mb associated with a small cell lung carcinoma cell line, U2020, suggesting that a more general tumor suppressor gene may reside in this region.

Oncological outcomes after cytoreductive nephrectomy for patients with metastatic renal cell carcinoma with inferior vena caval tumor thrombus.

PubMed

Miyake, Hideaki; Sugiyama, Takayuki; Aki, Ryota; Matsushita, Yuto; Tamura, Keita; Motoyama, Daisuke; Ito, Toshiki; Otsuka, Atsushi

2018-06-01

To evaluate the oncological outcomes of patients with metastatic renal cell carcinoma (mRCC) involving the inferior vena cava (IVC) who received cytoreductive nephrectomy. This study included 75 consecutive metastatis renal cell carcinoma (mRCC) patients with inferior vena cava (IVC) tumor thrombus undergoing cytoreductive nephrectomy and tumor thrombectomy followed by systemic therapy. Of the 75 patients, 11, 33, 24 and 7 had level I, II, III and IV IVC thrombus, respectively. Following surgical treatment, 25 (group A), 27 (group B) and 23 (group C) received cytokine therapy alone, molecular-targeted therapy alone and both therapies, respectively, as management for metastatic diseases. The median overall survival (OS) of the 75 patients was 16.2 months. No significant differences in OS were noted according to the level of the IVC tumor thrombus. There were no significant differences in OS among groups A, B and C; however, OS in groups B and C was significantly superior to that in group A. Furthermore, multivariate analysis of several parameters identified the following independent predictors of poor OS-elevated C-reactive protein, liver metastasis and postoperative treatment with cytokine therapy alone. The prognosis of mRCC patients with IVC thrombus undergoing cytoreductive nephrectomy may be significantly affected by the type of postoperative systemic therapy rather than the level of the IVC tumor thrombus. Accordingly, cytoreductive nephrectomy should be considered as a major therapeutic option for patients with mRCC involving the IVC, particularly in the era of targeted therapy.

[The WHO/ISUP grading system for renal carcinoma].

PubMed

Moch, H

2016-07-01

Histological tumor grading is an accepted prognostic parameter of renal cell carcinoma (RCC). In 2012, the International Society of Urologic Pathologists (ISUP) proposed a novel grading system for RCC, mainly based on the evaluation of nucleoli: grade 1 tumors have nucleoli that are inconspicuous and basophilic at ×400 magnification; grade 2 tumors have nucleoli that are clearly visible at ×400 magnification and eosinophilic; grade 3 tumors have clearly visible nucleoli at ×100 magnification; and grade 4 tumors have extreme pleomorphism or rhabdoid and/or sarcomatoid morphology. This grading system was validated for clear cell renal cell carcinoma and papillary renal cell carcinoma. At the same time, the ISUP proposed not grading chromophobe renal cell carcinomas according to this system. At a consensus conference in Zurich the World Health Organization (WHO) recommended the ISUP grading system; thus, the WHO/ISUP grading system is now going to be implemented internationally. The ISUP/WHO grading system has not been validated as a prognostic parameter for other tumor subtypes, but can be used for descriptive purposes.

Comprehensive Molecular Characterization of Papillary Renal Cell Carcinoma

PubMed Central

Linehan, W. Marston; Spellman, Paul T.; Ricketts, Christopher J.; Creighton, Chad J.; Fei, Suzanne S.; Davis, Caleb; Wheeler, David A.; Murray, Bradley A.; Schmidt, Laura; Vocke, Cathy D.; Peto, Myron; Al Mamun, Abu Amar M.; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W. Kimryn; Brooks, Angela N.; Hoadley, Katherine A.; Robertson, A. Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J.; Bootwalla, Moiz; Baylin, Stephen B.; Laird, Peter W.; Cherniack, Andrew D.; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B.; Akbani, Rehan; Leiserson, Mark D.M.; Raphael, Benjamin J.; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K.; Czerniak, Bogdan; Godwin, Andrew K.; Hakimi, A. Ari; Ho, Thai; Hsieh, James; Ittmann, Michael; Kim, William Y.; Krishnan, Bhavani; Merino, Maria J.; Mills Shaw, Kenna R.; Reuter, Victor E.; Reznik, Ed; Shelley, Carl Simon; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D.; Penny, Robert J.; Shelton, Candace; Shelton, W. Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T.; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A.; Felau, Ina; Hutter, Carolyn M.; Sheth, Margi; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S.N.; Carlsen, Rebecca; Carter, Scott L.; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R.; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, HarshaVardhan; Drummond, Jennifer; Gabriel, Stacey B.; Gibbs, Richard A.; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D. Neil; Holt, Robert A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Steven J.M.; Jones, Corbin D.; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A.; Moore, Richard A.; Morton, Donna; Mose, Lisle E.; Mungall, Andrew J.; Muzny, Donna; Parker, Joel S.; Perou, Charles M.; Roach, Jeffrey; Schein, Jacqueline E.; Schumacher, Steven E.; Shi, Yan; Simons, Janae V.; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G.; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D.; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N.; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J. Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L.; Boice, Lori; Bollag, Roni J.; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C.; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K.; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L.; Slaton, Joel; Stanton, Melissa; Thompson, R. Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M.; Winemiller, Cythnia; Zach, Leigh Anne; Zuna, Rosemary

2016-01-01

Background Papillary renal cell carcinoma, accounting for 15% of renal cell carcinoma, is a heterogeneous disease consisting of different types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal cell carcinoma; no effective forms of therapy for advanced disease exist. Methods We performed comprehensive molecular characterization utilizing whole-exome sequencing, copy number, mRNA, microRNA, methylation and proteomic analyses of 161 primary papillary renal cell carcinomas. Results Type 1 and Type 2 papillary renal cell carcinomas were found to be different types of renal cancer characterized by specific genetic alterations, with Type 2 further classified into three individual subgroups based on molecular differences that influenced patient survival. MET alterations were associated with Type 1 tumors, whereas Type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-ARE pathway. A CpG island methylator phenotype (CIMP) was found in a distinct subset of Type 2 papillary renal cell carcinoma characterized by poor survival and mutation of the fumarate hydratase (FH) gene. Conclusions Type 1 and Type 2 papillary renal cell carcinomas are clinically and biologically distinct. Alterations in the MET pathway are associated with Type 1 and activation of the NRF2-ARE pathway with Type 2; CDKN2A loss and CIMP in Type 2 convey a poor prognosis. Furthermore, Type 2 papillary renal cell carcinoma consists of at least 3 subtypes based upon molecular and phenotypic features. PMID:26536169

Treatment Options for Renal Cell Cancer

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

Treatment Option Overview (Renal Cell Cancer)

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

Small Renal Masses in Close Proximity to the Collecting System and Renal Sinus Are Enriched for Malignancy and High Fuhrman Grade and Should Be Considered for Early Intervention.

PubMed

Correa, Andres F; Toussi, Amir; Amin, Milon; Hrebinko, Ronald L; Gayed, Bishoy A; Parwani, Anil V; Maranchie, Jodi K

2018-02-05

Recent reports show a correlation between renal tumor radiographic characteristics and pathologic features. We hypothesize that a more central location within the relatively hypoxic renal medulla might confer a more aggressive tumor phenotype. To test this, radiographic tumor characteristics were compared with tumor grade and histology. We retrospectively reviewed renal masses <4 cm in diameter that underwent resection between 2008 and 2013. Tumor location was recorded using standard R.E.N.A.L. Nephrometry Score. Multivariate logistic regression was performed to compare independent anatomic features with incidence of malignancy and high nuclear grade. A total of 334 renal tumors had information available for analysis. Univariate analysis showed that increasing endophycity and proximity to the collecting system (<4 mm) were predictors of malignancy and high-grade features. In multivariate analysis, proximity to the collecting system <4 mm remained the as the only anatomical variable predictive of malignancy (odds ratio [OR], 3.58; 95% confidence interval [CI], 1.06-12.05; P = .04) and high nuclear grade (OR, 2.81; 95% CI, 1.44-5.51; P = .003). Malignancy and high tumor grade occur with much greater frequency when tumors are located deep in the kidney, in close proximity to the collecting system and renal sinus. Ninety-six percent of small renal masses in this region were cancers and nearly half were Fuhrman Grade 3 or 4, suggesting that these small centrally located tumors should be targeted for early intervention. Copyright © 2018 Elsevier Inc. All rights reserved.

Fibroblast Growth Factor 9 Imparts Hierarchy and Vasoreactivity to the Microcirculation of Renal Tumors and Suppresses Metastases*

PubMed Central

Yin, Hao; Frontini, Matthew J.; Arpino, John-Michael; Nong, Zengxuan; O'Neil, Caroline; Xu, Yiwen; Balint, Brittany; Ward, Aaron D.; Chakrabarti, Subrata; Ellis, Christopher G.; Gros, Robert; Pickering, J. Geoffrey

2015-01-01

Tumor vessel normalization has been proposed as a therapeutic paradigm. However, normal microvessels are hierarchical and vasoreactive with single file transit of red blood cells through capillaries. Such a network has not been identified in malignant tumors. We tested whether the chaotic tumor microcirculation could be reconfigured by the mesenchyme-selective growth factor, FGF9. Delivery of FGF9 to renal tumors in mice yielded microvessels that were covered by pericytes, smooth muscle cells, and a collagen-fortified basement membrane. This was associated with reduced pulmonary metastases. Intravital microvascular imaging revealed a haphazard web of channels in control tumors but a network of arterioles, bona fide capillaries, and venules in FGF9-expressing tumors. Moreover, whereas vasoreactivity was absent in control tumors, arterioles in FGF9-expressing tumors could constrict and dilate in response to adrenergic and nitric oxide releasing agents, respectively. These changes were accompanied by reduced hypoxia in the tumor core and reduced expression of the angiogenic factor VEGF-A. FGF9 was found to selectively amplify a population of PDGFRβ-positive stromal cells in the tumor and blocking PDGFRβ prevented microvascular differentiation by FGF9 and also worsened metastases. We conclude that harnessing local mesenchymal stromal cells with FGF9 can differentiate the tumor microvasculature to an extent not observed previously. PMID:26183774

Oncocytoma-like renal tumor with transformation toward high-grade oncocytic carcinoma: a unique case with morphologic, immunohistochemical, and genomic characterization.

PubMed

Sirintrapun, Sahussapont J; Geisinger, Kim R; Cimic, Adela; Snow, Anthony; Hagenkord, Jill; Monzon, Federico; Legendre, Benjamin L; Ghazalpour, Anatole; Bender, Ryan P; Gatalica, Zoran

2014-10-01

Renal oncocytoma is a benign tumor with characteristic histologic findings. We describe an oncocytoma-like renal tumor with progression to high-grade oncocytic carcinoma and metastasis. A 74-year-old man with no family history of cancer presented with hematuria. Computed tomography showed an 11 cm heterogeneous multilobulated mass in the right kidney lower pole, enlarged aortocaval lymph nodes, and multiple lung nodules. In the nephrectomy specimen, approximately one third of the renal tumor histologically showed regions classic for benign oncocytoma transitioning to regions of high-grade carcinoma without sharp demarcation. With extensive genomic investigation using single nucleotide polymorphism-based array virtual karyotyping, multiregion sequencing, and expression array analysis, we were able to show a common lineage between the benign oncocytoma and high-grade oncocytic carcinoma regions in the tumor. We were also able to show karyotypic differences underlying this progression. The benign oncocytoma showed no chromosomal aberrations, whereas the high-grade oncocytic carcinoma showed loss of the 17p region housing FLCN (folliculin [Birt-Hogg-Dubé protein]), loss of 8p, and gain of 8q. Gene expression patterns supported dysregulation and activation of phosphoinositide 3-kinase (PI3K)/v-akt murine thymoma viral oncogene homolog (Akt), mitogen-activated protein kinase (MAPK)/extracellular-signal-regulated kinase (ERK), and mechanistic target of rapamycin (serine/threonine kinase) (mTOR) pathways in the high-grade oncocytic carcinoma regions. This was partly attributable to FLCN underexpression but further accentuated by overexpression of numerous genes on 8q. In the high-grade oncocytic carcinoma region, vascular endothelial growth factor A along with metalloproteinases matrix metallopeptidase 9 and matrix metallopeptidase 12 were overexpressed, facilitating angiogenesis and invasiveness. Genetic molecular testing provided evidence for the development of an

An uncommon and insidious presentation of renal cell carcinoma with tumor extending into the inferior vena cava and right atrium: a case report.

PubMed

Lu, Hou Tee; Chong, Jen Lim; Othman, Norliza; Vendargon, Simon; Omar, Shamsuddin

2016-05-03

Renal cell carcinoma is a potentially lethal cancer with aggressive behavior and it tends to metastasize. Renal cell carcinoma involves the inferior vena cava in approximately 15% of cases and it rarely extends into the right atrium. A majority of renal cell carcinoma are detected as incidental findings on imaging studies obtained for unrelated reasons. At presentation, nearly 25% of patients either have distant metastases or significant local-regional disease with no symptoms that can be attributed to renal cell carcinoma. A 64-year-old Indian male with a past history of coronary artery bypass graft surgery, congestive heart failure, and diabetes mellitus complained of worsening shortness of breath for 2 weeks. Incidentally, a transthoracic echocardiography showed a "thumb-like" mass in his right atrium extending into his right ventricle through the tricuspid valve with each systole. Abdomen magnetic resonance imaging revealed a heterogenous lobulated mass in the upper and mid-pole of his right kidney with a tumor extending into his inferior vena cava and right atrium, consistent with our diagnosis of advanced renal cell carcinoma which was later confirmed by surgical excision and histology. Radical right nephrectomy, lymph nodes clearance, inferior vena cava cavatomy, and complete tumor thrombectomy were performed successfully. Perioperatively, he did not require cardiopulmonary bypass or deep hypothermic circulatory arrest. He had no recurrence during the follow-up period for more than 2 years after surgery. Advanced extension of renal cell carcinoma can occur with no apparent symptoms and be detected incidentally. In rare circumstances, atypical presentation of renal cell carcinoma should be considered in a patient presenting with right atrial mass detected by echocardiography. Renal cell carcinoma with inferior vena cava and right atrium extension is a complex surgical challenge, but excellent results can be obtained with proper patient selection, meticulous

Comprehensive Molecular Characterization of Papillary Renal-Cell Carcinoma.

PubMed

Linehan, W Marston; Spellman, Paul T; Ricketts, Christopher J; Creighton, Chad J; Fei, Suzanne S; Davis, Caleb; Wheeler, David A; Murray, Bradley A; Schmidt, Laura; Vocke, Cathy D; Peto, Myron; Al Mamun, Abu Amar M; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W Kimryn; Brooks, Angela N; Hoadley, Katherine A; Robertson, A Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J; Bootwalla, Moiz; Baylin, Stephen B; Laird, Peter W; Cherniack, Andrew D; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B; Akbani, Rehan; Leiserson, Mark D M; Raphael, Benjamin J; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K; Czerniak, Bogdan; Godwin, Andrew K; Hakimi, A Ari; Ho, Thai H; Hsieh, James; Ittmann, Michael; Kim, William Y; Krishnan, Bhavani; Merino, Maria J; Mills Shaw, Kenna R; Reuter, Victor E; Reznik, Ed; Shelley, Carl S; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D; Penny, Robert J; Shelton, Candace; Shelton, W Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T; Bowen, Jay; Gastier-Foster, Julie M; Gerken, Mark; Leraas, Kristen M; Lichtenberg, Tara M; Ramirez, Nilsa C; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A; Felau, Ina; Hutter, Carolyn M; Sheth, Margi; Sofia, Heidi J; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C; Zhang, Jiashan; Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S N; Carlsen, Rebecca; Carter, Scott L; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, Harsha V; Drummond, Jennifer A; Gabriel, Stacey B; Gibbs, Richard A; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D Neil; Holt, Robert A; Hoyle, Alan P; Jefferys, Stuart R; Jones, Steven J M; Jones, Corbin D; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A; Moore, Richard A; Morton, Donna; Mose, Lisle E; Mungall, Andrew J; Muzny, Donna; Parker, Joel S; Perou, Charles M; Roach, Jeffrey; Schein, Jacqueline E; Schumacher, Steven E; Shi, Yan; Simons, Janae V; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L; Boice, Lori; Bollag, Roni J; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L; Slaton, Joel; Stanton, Melissa; Thompson, R Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M; Winemiller, Cynthia; Zach, Leigh Anne; Zuna, Rosemary

2016-01-14

Papillary renal-cell carcinoma, which accounts for 15 to 20% of renal-cell carcinomas, is a heterogeneous disease that consists of various types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal-cell carcinoma, and no effective forms of therapy for advanced disease exist. We performed comprehensive molecular characterization of 161 primary papillary renal-cell carcinomas, using whole-exome sequencing, copy-number analysis, messenger RNA and microRNA sequencing, DNA-methylation analysis, and proteomic analysis. Type 1 and type 2 papillary renal-cell carcinomas were shown to be different types of renal cancer characterized by specific genetic alterations, with type 2 further classified into three individual subgroups on the basis of molecular differences associated with patient survival. Type 1 tumors were associated with MET alterations, whereas type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-antioxidant response element (ARE) pathway. A CpG island methylator phenotype (CIMP) was observed in a distinct subgroup of type 2 papillary renal-cell carcinomas that was characterized by poor survival and mutation of the gene encoding fumarate hydratase (FH). Type 1 and type 2 papillary renal-cell carcinomas were shown to be clinically and biologically distinct. Alterations in the MET pathway were associated with type 1, and activation of the NRF2-ARE pathway was associated with type 2; CDKN2A loss and CIMP in type 2 conveyed a poor prognosis. Furthermore, type 2 papillary renal-cell carcinoma consisted of at least three subtypes based on molecular and phenotypic features. (Funded by the National Institutes of Health.).

Cytogenetic and morphologic typing of 58 papillary renal cell carcinomas: evidence for a cytogenetic evolution of type 2 from type 1 tumors.

PubMed

Gunawan, Bastian; von Heydebreck, Anja; Fritsch, Thekla; Huber, Wolfgang; Ringert, Rolf-Hermann; Jakse, Gerhard; Füzesi, László

2003-10-01

We evaluated clinical characteristics, patient outcome (mean follow-up, 47 months), and cytogenetic abnormalities in the largest as yet reported cytogenetic series of 47 primary and 11 secondary papillary renal cell carcinomas for differences between the recently proposed type 1 and type 2 subtypes. Secondary tumors were more often of type 2 morphology (P = 0.02), whereas primary type 2 tumors were associated with higher clinical stage (P = 0.001) and worse patient outcome (P = 0.02). Although both subtypes had at least one of the primary chromosomal gains at 17q, 7, and 16q, type 2 tumors had moderately lower frequencies of primary gains at 17p (61 versus 94%; P = 0.007) and 17q (72 versus 97%; P = 0.02). On the other hand, type 2 tumors overall had more chromosomal alterations than type 1 tumors (P = 0.01), particularly gains of 1q (28 versus 3%; P = 0.02) and losses of 8p (33 versus 0%; P = 0.001), 11 (28 versus 3%; P = 0.02), and 18 (44 versus 9%; P = 0.01). Hierarchical clustering suggested cytogenetic patterns common but not restricted to type 2 morphology, one characterized by multiple additional gains, and another predominantly showing additional losses. These findings provide genetic evidence that type 1 and type 2 tumors arise from common cytogenetic pathways and that type 2 tumors evolve from type 1 tumors. Independently of type, losses of 9p were statistically correlated with advanced disease (P = 0.0008) and may serve as a potential adverse prognostic marker in papillary renal cell carcinomas.

Clear cell papillary renal cell carcinoma as part of histologically discordant multifocal renal cell carcinoma: A case report and review of literature.

PubMed

Shao, Tiffany; Yousef, Peter; Shipilova, Irina; Saleeb, Rola; Lee, Jason Y; Krizova, Adriana

2016-03-01

Multifocal renal cell carcinoma of different histological subtypes within a single kidney is rare. We report a recently classified clear cell (tubulo) papillary renal cell carcinoma as part of an unusual case of multifocal renal cell carcinoma of discordant histological subtypes. A 57 year-old-man was found to have multiple renal tumors and cysts on imaging and underwent a laparoscopic left radical nephrectomy. Pathological review showed multifocal renal cell carcinoma (clear cell (tubulo) papillary, clear cell and papillary renal cell carcinomas and papillary adenomas). Morphology of clear cell papillary renal cell carcinoma was supported by immunohistochemical profile (CK7+, HMWK+, CAIX+, AMACR-, CD10-, TFE3-). This is the first report of clear cell papillary renal cell carcinoma as part of multifocal renal cell carcinoma of different histological subtypes. Related lineage of clear cell renal cell carcinoma and papillary renal cell carcinoma is supported by the highest prevalence of their combination within multifocal renal cell carcinoma of different histological subtypes along with their molecular interconnection. Clear cell papillary renal cell carcinoma may be uniquely placed between clear cell and papillary renal cell carcinomas since it shows morphological features intermediate between clear cell and papillary renal cell carcinoma along with overlapping but unique immunohistochemical profile. Clear cell papillary renal cell carcinoma may be molecularly related to clear cell and papillary renal cell carcinomas since the tumors overexpress markers of HIF pathway activation with normal/elevated VHL mRNA expression and some tumors show losses of chromosome 3. Due to the overlapping morphology, it is possible that cases of clear cell papillary renal cell carcinoma may have been misclassified as papillary or clear cell renal cell carcinoma in the literature, incorrectly increasing their reported prevalence. Identification of multifocal RCCs may be related to the

Comparison between laparoscopic and open radical nephrectomy for the treatment of primary renal tumors in children: single-center experience over a 5-year period.

PubMed

Romao, R L P; Weber, B; Gerstle, J T; Grant, R; Pippi Salle, J L; Bägli, D J; Figueroa, V H; Braga, L H P; Farhat, W A; Koyle, M A; Lorenzo, A J

2014-06-01

To compare the outcomes of laparoscopic nephrectomy (LN) with open radical nephrectomy (ORN) in the management of consecutive pediatric neoplasms. Retrospective cohort study of consecutive children treated for primary renal tumors between 2006 and 2011, segregated based on surgical modality (LN/ORN). Pre-, intra- and postoperative data and outcomes were collected. Demographics from the 45 patients (13 LN, 32 ORN) were similar, and tumors in the LN group were smaller [6.59 ± 1.8 cm vs. 10.99 ± 2.99 cm ORN (p < 0.05)]. Six patients had preoperative chemotherapy (two LN, four ORN). No tumor ruptures occurred with either technique. Wilms tumor (seven LN, 24 ORN) was the most common diagnosis, followed by renal cell carcinoma (four LN, four ORN). Procedure length was similar between groups (282 ± 79 LN, 263 ± 81 min ORN). Mean length of stay was significantly shorter for LN (2.9 vs. 5.9 days; p = 0.002). Postoperative narcotic requirements and use of nasogastric tube were higher in the ORN group. After a median follow-up of 18 (LN) and 33 months (ORN), 1 and 4 recurrences occurred, respectively. LN is an attractive alternative to open surgery in carefully selected cases of pediatric renal tumors. Procedure length and incidence of intra-operative rupture were not increased, while post-operative recovery and hospital stay were shorter for LN. Longer follow-up is mandatory to confirm comparable oncological outcomes to ORN. Copyright © 2013 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

Renal Cell Carcinoma Presenting as Right Atrial Tumor with Successful Removal Using Cardiopulmonary Bypass

PubMed Central

Paul, Joy G.; Rhodes, Donald B.; Skow, James R.

1975-01-01

A 58-year-old male presented with signs and symptoms of right sided heart failure. Diagnostic evaluation revealed a right renal cell carcinoma with extension into the vena cava and right atrium. Surgical management included radical right nephrectomy with retroperitoneal lymph node dissection, inferior vena caval resection, and removal of the intra-atrial tumor thrombus using a cardiopulmonary bypass. Two years after surgery the patient is alive and well with no evidence of recurrent disease. ImagesFig. 1.Fig. 2a.Fig. 2b.Fig. 3. PMID:1130867

NSS for an RCC in a patient with renal insufficiency after heart transplant because of right ventricular tumor.

PubMed

Prokopowicz, Grzegorz; Zyczkowski, Marcin; Nowakowski, Krzysztof; Bryniarski, Piotr; Paradysz, Andrzej

2013-01-01

The effect of the immunosuppressive therapy on the development of neoplasms has become the object of an ever increasing interest for clinicians all over the world. The literature on neoplasms development in the course of therapy following transplants has confirmed a considerable increase in the incidence of neoplasms of the skin and lymph nodes. Organ neoplasms developing in patients after transplants are characterized by increased progression, poor cellular diversification and a more unfavorable prognosis than in the general population The aim of the study is to present the case of a nephron-sparing surgery of a renal tumor (NSS) without any intraoperative ischaemia in a 55-year-old female patient with an orthotopic heart transplant and renal insufficiency following a prolonged immune suppression. It is estimated that the patients at the highest risk of neoplasm development are those in the first months after transplant, especially heart transplant. They require maximum doses of immunosuppressive drugs. In the case of patients with initial renal insufficiency the duration of ischaemia of the organ operated on should be minimized, and if possible, surgery should be conducted without clamping the renal pedicle. The surgical treatment of RCC (renal cell carcinoma) in transplant patients does not require any reduction in the amount of the immunosuppressive drugs.

Renal localization of /sup 67/Ga-citrate in renal amyloidosis: case reports

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bekerman, C.; Vyas, M.I.

1976-10-01

In scans taken 72 hr after intravenous administration of 5 mCi of /sup 67/Ga-citrate, both kidneys were clearly visible in two cases of histologically proven renal amyloidosis. Neither patient had clinical manifestations or laboratory evidence of concurrent inflammatory disease or tumor involving the kidneys. Increased renal concentration of lysosomal organelles and increased affinity of /sup 67/Ga for amyloid material contained in the organelles could explain the renal uptake of /sup 67/Ga in amyloidosis.

Benefits and shortcomings of superselective transarterial embolization of renal tumors before zero ischemia laparoscopic partial nephrectomy.

PubMed

D'Urso, L; Simone, G; Rosso, R; Collura, D; Castelli, E; Giacobbe, A; Muto, G L; Comelli, S; Savio, D; Muto, G

2014-12-01

To report feasibility, safety and effectiveness of "zero-ischemia" laparoscopic partial nephrectomy (LPN) following preoperative superselective transarterial embolization (STE) for clinical T1 renal tumors. We retrospectively reviewed perioperative data of 23 consecutive patients, who underwent STE prior LPN between March 2010 and November 2012 for incidental clinical T1 renal mass. STE was performed by two experienced radiologists the day before surgery. Surgical procedures were performed in extended flank position, transperitoneally, by a single surgeon. Mean patients age was 68 years (range 56-74), mean tumor size was 3.5 cm (range 2.2-6.3 cm). STE was successfully completed in 16 patients 12-15 h before surgery. In 4 cases STE failed to provide a complete occlusion of all feeding arteries, while in 3 cases the ischemic area was larger than expected. LPN was successfully completed in all patients but one where open conversion was necessary; a "zero-ischemia" approach was performed in 19/23 patients (82.6%) while hilar clamp was necessary in 4 cases, with a mean warm-ischemia time of 14.8 min (range 5-22). Mean operative time was 123 min (range 115-130) and mean intraoperative blood loss was 250 mL (range 20-450). No patient experienced postoperative acute renal failure and no patient developed new onset IV stage chronic kidney disease at 1-yr follow-up. STE is a viable option to perform "zero-ischemia" LPN at beginning of learning curve; however, hilar clamp was necessary to achieve a relatively blood-less field in 17.4% of cases. Copyright © 2014 Elsevier Ltd. All rights reserved.

Expression of EphA2 protein is positively associated with age, tumor size and Fuhrman nuclear grade in clear cell renal cell carcinomas.

PubMed

Wang, Longxin; Hu, Haibing; Tian, Feng; Zhou, Wenquan; Zhou, Shuigen; Wang, Jiandong

2015-01-01

The receptor tyrosine kinase of EphA2 has been shown frequently overexpressed in various types of human carcinomas, which implicated that it plays important roles in carcinogenesis. Although EphA2 protein expression has been investigated in many types of human carcinomas, the relationship between the expression of EphA2 protein in clear cell renal cell carcinoma was not well documented. In the present study, using specific anit-EphA2 polyclonal antibody and immunohistochemistry, we evaluated EphA2 protein expression levels in clear cell RCC specimens surgically resected from 90 patients. Our results shows that EphA2 protein was positively expressed in all normal renal tubes of 90 samples (100%, 3+), which was expressed at low levels in renal cortex but high levels in the collecting ducts of the renal medulla and papilla. EphA2 was negatively or weakly expressed in 30 out of 90 samples (33.3%, 0/1+), moderately expressed in 24 samples (26.7%, 2+) and strongly expressed in 36 samples (40%, 3+). Expression of EphA2 was positively associated with age (P=0.029), tumor diameters (P<0.001) and Fuhrman nuclear grade (P<0.001). Our results indicate that EphA2 variably expressed in clear cell renal cell carcinomas. High expression of EphA2 was more often found in big size and high nuclear grade tumors, which indicated EphA2 protein may be used as a new marker for the prognosis of clear cell renal cell carcinoma.

Pre-Clinical Evaluation of UAB30 in Pediatric Renal and Hepatic Malignancies

PubMed Central

Waters, Alicia M.; Stewart, Jerry E.; Atigadda, Venkatram R.; Mroczek-Musulman, Elizabeth; Muccio, Donald D.; Grubbs, Clinton J.; Beierle, Elizabeth A.

2016-01-01

Rare tumors of solid organs remain some of the most difficult pediatric cancers to cure. These difficult tumors include rare pediatric renal malignancies such as malignant rhabdoid kidney tumors (MRKT) and non-osseous renal Ewing sarcoma, and hepatoblastoma, a pediatric liver tumor that arises from immature liver cells. There are data in adult renal and hepatic malignancies demonstrating the efficacy of retinoid therapy. The investigation of retinoic acid therapy in cancer is not a new strategy, but the widespread adoption of this therapy has been hindered by toxicities. Our laboratory has been investigating a novel synthetic rexinoid, UAB30, which exhibits a more favorable side effect profile. In this current study, we hypothesized that UAB30 would diminish the growth of tumor cells from both rare renal and liver tumors in vitro and in vivo. We successfully demonstrated decreased cellular proliferation, invasion and migration, cell cycle arrest and increased apoptosis after treatment with UAB30. Additionally, in in vivo murine models of human hepatoblastoma or rare human renal tumors, there were significantly decreased tumor xenograft growth and increased animal survival after UAB30 treatment. UAB30 should further be investigated as a developing therapeutic in these rare and difficult to treat, pediatric solid organ tumors. PMID:26873726

Metastatic renal cell carcinoma associated with acquired cystic kidney disease 15 years after successful renal transplantation.

PubMed

Lien, Y H; Kam, I; Shanley, P F; Schröter, G P

1991-12-01

Renal cell carcinoma (RCC) is a relatively uncommon cancer in renal transplant patients. From 1968 to 1987, 101 cases of RCC of native kidneys have been reported to the Cincinnati Transplant Tumor Registry. We describe here a case of metastatic RCC associated with acquired cystic kidney disease (ACKD) 15 years after successful renal transplantation. The patient presented with a subcutaneous nodule, which led to discovery of a large primary tumor in the left kidney. ACKD was present in the atrophic right kidney. The reported cases of ACKD-associated RCC in renal transplant recipients were reviewed. Most of these cases are middle-aged men with a long posttransplant course, good graft function, and usage of azathioprine and prednisone as immunosuppressive agents. ACKD can develop or persist and progress to RCC many years after successful renal transplantation. Transplant patients with flank pain, hematuria, or other suspicious symptoms should have imaging studies of their native kidneys.

First collaborative experience with thulium laser ablation of localized upper urinary tract urothelial tumors using retrograde intra-renal surgery.

PubMed

Defidio, Lorenzo; De Dominicis, Mauro; Di Gianfrancesco, Luca; Fuchs, Gerhard; Patel, Anup

2011-09-01

Thulium laser ablation (TLA) outcomes with blinded performance evaluation after retrograde intra-renal surgical (RIRS) treatment of upper urinary tract transitional cell carcinomas (UUT-TCC). A UUT-TCC patient cohort undergoing RIRS-TLA by an international endoscopic surgical collaboration in a European center (April 2005-July 2009), underwent outcomes evaluation. All 4 surgeons were blinded and independently scored both TLA and Holmium:YAG laser ablation performance aspects annually using a Likert scoring system (0-10). All patients (n = 59, median age 66 years, 9 with solitary kidney) had complete UUT inspection. Presenting lesion(s) were intra-renal (n = 30, 51%), ureteral (n = 13, 22%), and combined (n = 16, 27%). Single-stage TLA sufficed in 81.4% (tumors < 1.5 cm). Significant recurrence free survival differences occurred according to primary tumor size >/< 1.5 cm and multi-focality, but location made no difference. Median Likert scores were i) fiber-tip stability --5.5/8.75, p = 0.016; ii) reduced bleeding--5/8.5, p = 0.004; iii)fiber-tip precision--5.5/8.5, p = 0.003; iv) mucosal perforation reduction--3.5/7.5, p = 0.001; v) ablation efficiency tumors < 1.5 cm--6/9, p = 0.017; tumors > 1.5 cm--6.75/6.75, p = 1, and vi) overall efficiency--6/7.5, p = 0.09, for Holmium:YAG and TLA, respectively. The Thulium laser delivered non-inferior recurrence free survival to RIRS-UUT-TCC Holmium:YAG laser ablation, but better median parameter performance scores in fiber-tip stability, precision, reduced bleeding and mucosal perforation reduction in expert ratings. Despite improved photothermal coagulation, and endo-visualization for tumors < 1.5 cm, both ablation and overall efficiency remained challenging for larger tumors with both existing laser technologies.

Significant impact of R.E.N.A.L. nephrometry score on changes in postoperative renal function early after robot-assisted partial nephrectomy.

PubMed

Miyake, Hideaki; Furukawa, Junya; Hinata, Nobuyuki; Muramaki, Mototsugu; Tanaka, Kazushi; Fujisawa, Masato

2015-06-01

Our objective was to evaluate the significance of the R.E.N.A.L. nephrometry score (RNS)--developed to quantitatively evaluate the complexity of renal tumors in a reproducible manner--in perioperative and renal functional outcomes following robot-assisted partial nephrectomy (RAPN). This study assessed 48 consecutive patients with renal tumors who underwent RAPN. Preoperative RNS for each patient was calculated, and its impact on several parameters associated with perioperative outcomes, including postoperative renal function, was investigated with Spearman's rank correlation test. Mean RNS in the 48 patients was 6.8; of these 48 patients, 21 (43.7%), 24 (50.0%), and three (6.3%) were classified into low-, moderate-, and high-complexity groups, respectively. The RNS was significantly correlated with resected tumor weight and postoperative changes in estimated glomerular filtration rate (eGFR) at both 1 and 4 weeks--but not age, body mass index (BMI), preoperative eGFR, operative time, warm ischemia time, estimated blood loss, postoperative complications, or eGFR-- after RAPN. No component of the RNS (R: radius; E: exophytic/endophytic properties; N: nearness of tumor to the collecting system or sinus; A: anterior/posterior; L: location relative to polar lines) alone had a significant impact on postoperative changes in eGFR at 1 and 4 weeks, whereas resected tumor weight was significantly associated with the R and E subcategories. Measurement of total RNS is useful for predicting renal functional outcomes early after RAPN.

Intensity ratio curve analysis of small renal masses on T2-weighted magnetic resonance imaging: Differentiation of fat-poor angiomyolipoma from renal cell carcinoma.

PubMed

Moriyama, Shingo; Yoshida, Soichiro; Tanaka, Hajime; Tanaka, Hiroshi; Yokoyama, Minato; Ishioka, Junichiro; Matsuoka, Yoh; Saito, Kazutaka; Kihara, Kazunori; Fujii, Yasuhisa

2018-03-25

To assess the diagnostic ability of a pixel intensity-based analysis in evaluating the magnetic resonance imaging characteristics of small renal masses, especially in differentiating fat-poor angiomyolipoma from renal cell carcinoma. T2-weighted images from 121 solid small renal masses (<4 cm) without visible fat (14 fat-poor angiomyolipomas, 92 clear cell renal cell carcinomas, six chromophobe renal cell carcinomas and nine papillary renal cell carcinomas) were retrospectively evaluated. An intensity ratio curve was plotted using intensity ratios, which were ratios of signal intensities of tumor pixels (each pixel along a linear region of interest drawn across the renal tumor on T2-weighted image) to the signal intensity of a normal renal cortex. The diagnostic ability of the intensity ratio curve analysis was evaluated. The tumors were classified into three types: intensity ratio fat-poor angiomyolipoma (n = 19) with no pseudocapsule, iso-low intensity and no heterogeneity; intensity ratio clear cell renal cell carcinoma (n = 76) with a pseudocapsule, iso-high intensity and heterogeneity; and other type of intensity ratio (n = 26), including tumors that did not fall into the above two categories. The sensitivity/specificity/accuracy of the intensity ratio curve analysis in diagnosing fat-poor angiomyolipoma was 93%/94%/94%, respectively. When the intensity ratio curve analysis was applied only to the tumor with undetermined radiological diagnosis, the sensitivity for diagnosing fat-poor angiomyolipoma compared with subjective reading alone significantly improved (93% vs 50%; P = 0.014). Our novel semiquantitative model for combined assessment of key features of fat-poor angiomyolipoma, including low intensity, homogeneity and absence of a pseudocapsule on T2-weighted image, might make diagnosis of fat-poor angiomyolipoma more accurate. © 2018 The Japanese Urological Association.

Renal pelvis urothelial carcinoma of the upper moiety in complete right renal duplex: a case report.

PubMed

Zhang, Yiran; Yu, Quanfeng; Zhang, Zhihong; Liu, Ranlu; Xu, Yong

2015-01-01

Urothelial carcinoma (UC) originated from renal pelvis is the common tumor of the urinary system, however, neoplasia of the renal pelvis in duplex kidneys is extremely rare, especially in the complete renal and ureteral duplex cases. We present the first case of renal pelvis UC of the upper moiety in a complete right renal duplex. This male patient has bilateral complete renal and ureteral duplex. To the best of our knowledge, this is the first reported case of renal pelvis UC in a complete renal duplex system. After this experience we feel that the diagnosis of renal pelvis UC in duplex kidneys is not so easy, and once the diagnosis is determined, the whole renal duplex units and bladder cuff or ectopic orifice should be excised radically.

miR-192, miR-194 and miR-215: a convergent microRNA network suppressing tumor progression in renal cell carcinoma.

PubMed

Khella, H W Z; Bakhet, M; Allo, G; Jewett, M A S; Girgis, A H; Latif, A; Girgis, H; Von Both, I; Bjarnason, G A; Yousef, G M

2013-10-01

MicroRNAs (miRNAs) play a crucial role in tumor progression and metastasis. We, and others, recently identified a number of miRNAs that are dysregulated in metastatic renal cell carcinoma compared with primary renal cell carcinoma. Here, we investigated three miRNAs that are significantly downregulated in metastatic tumors: miR-192, miR-194 and miR-215. Gain-of-function analyses showed that restoration of their expression decreases cell migration and invasion in renal cell carcinoma cell line models, whereas knockdown of these miRNAs resulted in enhancing cellular migration and invasion abilities. We identified three targets of these miRNAs with potential role in tumor aggressiveness: murine double minute 2, thymidylate synthase, and Smad Interacting protein 1/zinc finger E-box binding homeobox 2. We observed a convergent effect (the same molecule can be targeted by all three miRNAs) and a divergent effect (the same miRNA can control multiple targets) for these miRNAs. We experimentally validated these miRNA-target interactions using three independent approaches. First, we observed that miRNA overexpression significantly reduces the mRNA and protein levels of their targets. In the second, we observed significant reduction of the luciferase signal of a vector containing the 3'UTR of the target upon miRNA overexpression. Finally, we show the presence of inverse correlation between miRNA changes and the expression levels of their targets in patient specimens. We also examined the prognostic significance of miR-215 in renal cell carcinoma. Lower expression of miR-215 is associated with significantly reduced disease-free survival time. These findings were validated on an independent data set from The Cancer Genome Atlas. These results can pave the way to the clinical use of miRNAs as prognostic markers and therapeutic targets.

Kidney (Renal Cell) Cancer—Health Professional Version

Cancer.gov

Kidney cancer has three main types. Renal cell cancer, or renal cell adenocarcinoma, forms in the tubules of the kidney. Transitional cell carcinoma forms in the renal pelvis and ureter. Wilms tumors are common in children. Find evidence-based information on kidney cancer treatment, research, genetics, and statistics.

Inflammatory Myofibroblastic Tumor of the Kidney: A Rare Renal Tumor.

PubMed

Pothadiyil, Alvin Jose; Bhat, Suresh; Paul, Fredrick; Mampatta, Jithesh; Srinivas, Mahesh

2016-11-01

Inflammatory Myofibroblastic Tumour (IMT) or 'pseudotumour' of the kidney is a rare benign tumour of unknown aetiology affecting mostly young adults. A subset of IMT is neoplastic and harbours translocations of activin receptor-like kinase-1 (ALK-1) gene and can recur or rarely metastasize. Presentation varies from an incidentaloma to gross haematuria. Clinical examination and radiological investigations are usually inconclusive. Often, biopsy is inconclusive necessitating a management similar to that of Renal Cell Cancer (RCC). Diagnosis is based on immunohistochemistry. We are reporting a case of IMT in a 50-year-old male patient who presented with left flank mass which on evaluation was suggestive of left renal cell carcinoma. Excision of the tumour, histopathological examination and Immunohistochemistry proved the tumour to be IMT.

Renal cell carcinoma, unclassified with medullary phenotype: poorly differentiated adenocarcinomas overlapping with renal medullary carcinoma.

PubMed

Sirohi, Deepika; Smith, Steven C; Ohe, Chisato; Colombo, Piergiuseppe; Divatia, Mukul; Dragoescu, Ema; Rao, Priya; Hirsch, Michelle S; Chen, Ying-Bei; Mehra, Rohit; Amin, Mahul B

2017-09-01

Renal medullary carcinoma (RMC) is a highly aggressive renal cell carcinoma arising in the collecting system and requiring careful correlation with status of sickle cell trait. A panel of international experts has recently proposed provisional diagnostic terminology, renal cell carcinoma, unclassified, with medullary phenotype, based on encountering an extraordinarily rare tumor with RMC morphology and immunophenotype in an individual proven not to have a hemoglobinopathy. Herein, we extend this observation to a cohort of 5 such tumors, morphologically similar to RMC, lacking SMARCB1 expression by immunohistochemistry, but each without evidence of a hemoglobinopathy. The tumors arose in 4 men and 1 woman with a mean age of 44 years, occurring in 3 left and 2 right kidneys. Clinically, aggression was apparent with involvement of perinephric adipose tissue in all 5 cases, nodal metastasis in 4 of 5 cases, and death of disease in 4 of 5 cases within 3-27 months. Histologic sections showed poorly differentiated adenocarcinoma, often with solid and nested growth patterns, as well as infiltrative glandular, tubulopapillary, cribriform, or reticular growth. Rhabdoid and sarcomatoid cytomorphology was seen in a subset. All tumors showed PAX8 nuclear positivity and SMARCB1 loss, with OCT3/4 expression in 4 of 5 cases. In summary, this first series of renal cell carcinoma, unclassified, with medullary phenotype documents tumors with morphologic, immunophenotypic, and prognostic features of RMC occurring in individuals without sickle cell trait. Although greater biologic and molecular understanding is needed, the available evidence points to these cases representing a sporadic counterpart to sickle cell trait-associated RMC. Copyright © 2017 Elsevier Inc. All rights reserved.

Tumor necrosis factor-α: regulation of renal function and blood pressure

PubMed Central

Garvin, Jeffrey L.

2013-01-01

Tumor necrosis factor-α (TNF-α) is a pleiotropic cytokine that becomes elevated in chronic inflammatory states such as hypertension and diabetes and has been found to mediate both increases and decreases in blood pressure. High levels of TNF-α decrease blood pressure, whereas moderate increases in TNF-α have been associated with increased NaCl retention and hypertension. The explanation for these disparate effects is not clear but could simply be due to different concentrations of TNF-α within the kidney, the physiological status of the subject, or the type of stimulus initiating the inflammatory response. TNF-α alters renal hemodynamics and nephron transport, affecting both activity and expression of transporters. It also mediates organ damage by stimulating immune cell infiltration and cell death. Here we will summarize the available findings and attempt to provide plausible explanations for such discrepancies. PMID:23515717

Retroperitoneal Laparoscopic Partial Nephrectomy Versus Radical Nephrectomy for Clinical T1 Renal Hilar Tumor: Comparison of Perioperative Characteristics and Short-Term Functional and Oncologic Outcomes.

PubMed

Yang, Chuance; Wang, Zhenlong; Huang, Shanlong; Xue, Li; Fu, Delai; Chong, Tie

2018-04-18

To present our single-center experience with retroperitoneal laparoscopic partial nephrectomy (LPN) and retroperitoneal laparoscopic radical nephrectomy (LRN) for T1 renal hilar tumors and evaluate which one is better. A retrospective review of 63 patients with hilar tumors undergoing retroperitoneal LPN or LRN was performed. The perioperative characteristics, change in estimated glomerular filtration rate (eGFR) from baseline to month 3, and oncologic outcomes were summarized. In total, 25 patients underwent LPN, and 38 patients underwent LRN. The mean tumor size in the LPN and LRN groups was 4.5 and 4.9 cm, respectively. The mean operation time was longer in the LPN group than that in the LRN group (212.5 minutes versus 160.7 minutes, respectively; P < .05). Patients undergoing the LPN had a longer median length of hospital stay after surgery (9 days versus 7 days, P < .05). Four percent of patients in the LPN group experienced postoperative complications compared with 5% of patients in the LRN group, which was not significantly different. Compared with preoperative eGFR, postoperative eGFR at 3 months decreased by 15.2 mL/min/1.73 m 2 and 27.8 mL/min/1.73 m 2 in the LPN and the LRN groups, respectively (P < .05). There was one local recurrence in the LPN group and three local or distant recurrences in the LRN group (P > .05). In experienced hands, although retroperitoneal LRN can result in shorter operation times and shorter lengths of stay, retroperitoneal LPN can preserve renal function better than LRN. Retroperitoneal LPN should be the priority in selected patients with T1 renal hilar tumors, especially for patients with renal insufficiency.

Tumor biology of non-metastatic stages of clear cell renal cell carcinoma; overexpression of stearoyl desaturase-1, EPO/EPO-R system and hypoxia-related proteins.

PubMed

Stoyanoff, Tania Romina; Rodríguez, Juan Pablo; Todaro, Juan Santiago; Espada, Joaquín Diego; Colavita, Juan Pablo Melana; Brandan, Nora Cristina; Torres, Adriana Mónica; Aguirre, María Victoria

2016-10-01

Clear cell renal cell carcinoma (ccRCC) is the most common subtype of renal carcinomas. There is great interest to know the molecular basis of the tumor biology of ccRCC that might contribute to a better understanding of the aggressive biological behavior of this cancer and to identify early biomarkers of disease. This study describes the relationship among proliferation, survival, and apoptosis with the expression of key molecules related to tumoral hypoxia (hypoxia-inducible factor (HIF)-1α, erythropoietin (EPO), vascular endothelial growth factor (VEGF)), their receptors (EPO-R, VEGFR-2), and stearoyl desaturase-1 (SCD-1) in early stages of ccRCC. Tissue samples were obtained at the Urology Unit of the J.R. Vidal Hospital (Corrientes, Argentina), from patients who underwent radical nephrectomy for renal cancer between 2011 and 2014. Four experimental groups according to pathological stage and nuclear grade were organized: T1G1 (n = 6), T2G1 (n = 4), T1G2 (n = 7), and T2G2 (n = 7). The expression of HIF-1α, EPO, EPO-R, VEGF, VEGFR-2, Bcl-x L , and SCD-1 were evaluated by immunohistochemistry, Western blotting, and/or RT-PCR. Apoptosis was assessed by the TUNEL in situ assay, and tumor proliferation was determined by Ki-67 immunohistochemistry. Data revealed that HIF-1α, EPO, EPO-R, VEGF, and VEGF-R2 were overexpressed in most samples. The T1G1 group showed the highest EPO levels, approximately 200 % compared with distal renal tissue. Bcl-x L overexpression was concomitant with the enhancement of proliferative indexes. SCD-1 expression increased with the tumor size and nuclear grade. Moreover, the direct correlations observed between SCD-1/HIF-1α and SCD-1/Ki-67 increments suggest a link among these molecules, which would determine tumor progression in early stages of ccRCC. Our results demonstrate the relationship among proliferation, survival, and apoptosis with the expression of key molecules related to tumoral hypoxia (HIF-1α, EPO, VEGF), their

[A case of xp11.2 translocation renal cell carcinoma].

PubMed

Horie, Kengo; Kikuchi, Mina; Miwa, Kosei; Minamidate, Yuzuru; Yokoi, Shigeaki; Nakano, Masahiro; Deguchi, Takashi; Ehara, Hidetoshi; Asano, Nami; Hirose, Yoshinobu

2011-03-01

Xp11.2/TFE3 translocation renal cell carcinoma (RCC), a recently classified distinct subtype, is a rare tumor that usually affects children and adolescents. The morphology and biological behavior are not widely recognized, Xp11.2 translocation RCC is suggestive of early metastases despite the small tumor size. The definitive diagnosis requires the evidence of several different reciprocal translocations involving the TFE3 gene located on chromosome Xp11.2. Here, we present a case of Xp11.2 translocation RCC in an 18-yearold male. He was referred to our hospital because of a right renal tumor with macroscopic hematuria and right flank colic. The radiographic evaluation including magnetic resonance imaging (MRI) suggested it to be a typical papillary renal cell carcinoma or benign renal tumor. He underwent laparoscopic nephrectomy against the repeat symptom in spite of small tumor (3.5 cm in diameter). The immunohistochemical study revealed nuclear staining for TFE3 protein in the cancer cells. The urologic and radiologic outcomes were satisfactory after more than 1 year of follow-up.

Adrenocortical carcinoma with inferior vena cava, left renal vein and right atrium tumor thrombus extension

PubMed Central

Annamaria, Pronio; Silvia, Piroli; Bernardo, Ciamberlano; Alessandro, De Luca; Antonino, Marullo; Antonio, Barretta; Giuseppe, Mazzesi; Massimo, Rossi; Montesani, Chiara

2015-01-01

Introduction Adrenocortical carcinoma (ACC) is a rare, but highly aggressive type of tumor with an annual incidence of 1–2 cases per million. The prognosis is poor with a five-year overall survival rate of ∼35%. The poor prognosis may be related to the advanced stage at which the majority of ACCs are detected. Complete surgical resection remains the most effective treatment. Presentation of the case A 51-year-old female patient with recent onset of dyspepsia, ascites and peripheral edema was referred to our institution. Computed tomography (CT) and Magnetic Resonance Imaging (MRI) displayed a 8 cm Ø right adrenal mass. Moreover a tumor thrombus jutted out into the IVC, left renal vein and right atrium. An echocardiographic evaluation confirmed the presence of the tumor thrombus in the right atrium. The patient underwent adrenalectomy with removal of its intravascular extension with the assistance of cardiopulmonary bypass and hypothermia. Discussion ACC is a rare malignancy and ACC with tumor thrombus extension is a rare presentation. Patients can present with a variety of sign and symptoms, depending on the extent of the tumor. CT scan of chest and abdomen represents the gold standard in ACC staging while magnetic resonance imaging (MRI) is preferred for tumor thrombus characterization. Complete surgical resection with a negative margin, R0 resection, is the only curative option for localized disease. Kidney sparing surgery should be performed when possible. Conclusion We present a rare case of Adrenocortical carcinoma with tumor thrombus extending into the IVC and right atrium. Complete resection with negative margins represents the best therapeutic chance for these patients. PMID:26355237

Adrenocortical carcinoma with inferior vena cava, left renal vein and right atrium tumor thrombus extension.

PubMed

Annamaria, Pronio; Silvia, Piroli; Bernardo, Ciamberlano; Alessandro, De Luca; Antonino, Marullo; Antonio, Barretta; Giuseppe, Mazzesi; Massimo, Rossi; Montesani, Chiara

2015-01-01

Adrenocortical carcinoma (ACC) is a rare, but highly aggressive type of tumor with an annual incidence of 1-2 cases per million. The prognosis is poor with a five-year overall survival rate of ∼35%. The poor prognosis may be related to the advanced stage at which the majority of ACCs are detected. Complete surgical resection remains the most effective treatment. A 51-year-old female patient with recent onset of dyspepsia, ascites and peripheral edema was referred to our institution. Computed tomography (CT) and Magnetic Resonance Imaging (MRI) displayed a 8cm Ø right adrenal mass. Moreover a tumor thrombus jutted out into the IVC, left renal vein and right atrium. An echocardiographic evaluation confirmed the presence of the tumor thrombus in the right atrium. The patient underwent adrenalectomy with removal of its intravascular extension with the assistance of cardiopulmonary bypass and hypothermia. ACC is a rare malignancy and ACC with tumor thrombus extension is a rare presentation. Patients can present with a variety of sign and symptoms, depending on the extent of the tumor. CT scan of chest and abdomen represents the gold standard in ACC staging while magnetic resonance imaging (MRI) is preferred for tumor thrombus characterization. Complete surgical resection with a negative margin, R0 resection, is the only curative option for localized disease. Kidney sparing surgery should be performed when possible. We present a rare case of Adrenocortical carcinoma with tumor thrombus extending into the IVC and right atrium. Complete resection with negative margins represents the best therapeutic chance for these patients. Copyright © 2015. Published by Elsevier Ltd.

Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) enhances vascular and renal damage induced by hyperlipidemic diet in ApoE-knockout mice.

PubMed

Muñoz-García, Begoña; Moreno, Juan Antonio; López-Franco, Oscar; Sanz, Ana Belén; Martín-Ventura, José Luis; Blanco, Julia; Jakubowski, Aniela; Burkly, Linda C; Ortiz, Alberto; Egido, Jesús; Blanco-Colio, Luis Miguel

2009-12-01

Tumor necrosis factor-like weak inducer of apoptosis (TWEAK) is a member of the tumor necrosis factor superfamily of cytokines. TWEAK binds and activates the Fn14 receptor, and may regulate apoptosis, inflammation, and angiogenesis, in different pathological conditions. We have evaluated the effect of exogenous TWEAK administration as well as the role of endogenous TWEAK on proinflammatory cytokine expression and vascular and renal injury severity in hyperlipidemic ApoE-knockout mice. ApoE(-/-) mice were fed with hyperlipidemic diet for 4 to 10 weeks, then randomized and treated with saline (controls), TWEAK (10 microg/kg/d), anti-TWEAK neutralizing mAb (1000 microg/kg/d), TWEAK plus anti-TWEAK antibody (10 microg TWEAK +1000 microg anti-TWEAK/kg/d), or nonspecific IgG (1000 microg/kg/d) daily for 9 days. In ApoE(-/-) mice, exogenous TWEAK administration in ApoE(-/-) mice induced activation of NF-kappaB, a key transcription factor implicated in the regulation of the inflammatory response, in vascular and renal lesions. Furthermore, TWEAK treatment increased chemokine expression (RANTES and MCP-1), as well as macrophage infiltration in atherosclerotic plaques and renal lesions. These effects were associated with exacerbation of vascular and renal damage. Conversely, treatment of ApoE(-/-) mice with an anti-TWEAK blocking mAb decreased NF-kappaB activation, proinflammatory cytokine expression, macrophage infiltration, and vascular and renal injury severity, indicating a pathological role for endogenous TWEAK. Finally, in murine vascular smooth muscle cells or tubular cells, either ox-LDL or TWEAK treatment increased expression and secretion of both RANTES and MCP-1. Furthermore, ox-LDL and TWEAK synergized for induction of MCP-1 and RANTES expression and secretion. Our results suggest that TWEAK exacerbates the inflammatory response associated with a high lipid-rich diet. TWEAK may be a novel therapeutic target to prevent vascular and renal damage associated with

Activation of the PI3K/AKT pathway induces urothelial carcinoma of the renal pelvis: identification in human tumors and confirmation in animal models.

PubMed

Qian, Chao-Nan; Furge, Kyle A; Knol, Jared; Huang, Dan; Chen, Jindong; Dykema, Karl J; Kort, Eric J; Massie, Aaron; Khoo, Sok Kean; Vanden Beldt, Kristin; Resau, James H; Anema, John; Kahnoski, Richard J; Morreau, Hans; Camparo, Philippe; Comperat, Eva; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Vieillefond, Annick; Eng, Charis; Williams, Bart O; Teh, Bin Tean

2009-11-01

Urothelial carcinoma of the renal pelvis is a deadly disease with an unclear tumorigenic mechanism. We conducted gene expression profiling on a set of human tumors of this type and identified a phosphatidylinositol 3-kinase (PI3K)/AKT activation expression signature in 76.9% (n = 13) of our samples. Sequence analysis found both activating mutations of PIK3CA (13.6%, n = 22) and loss of heterozygosity at the PTEN locus (25%, n = 8). In contrast, none of the other subtypes of kidney neoplasms (e.g., clear-cell renal cell carcinoma) harbored PIK3CA mutations (n = 87; P < 0.001). Immunohistochemical analysis of urothelial carcinoma samples found loss of PTEN protein expression (36.4%, n = 11) and elevation of phosphorylated mammalian target of rapamycin (mTOR; 63.6%, n = 11). To confirm the role of the PI3K/AKT pathway in urothelial carcinoma, we generated mice containing biallelic inactivation of Pten in the urogenital epithelia. These mice developed typical renal pelvic urothelial carcinomas, with an incidence of 57.1% in mice older than 1 year. Laser capture microdissection followed by PCR confirmed the deletion of Pten exons 4 and 5 in the animal tumor cells. Immunohistochemical analyses showed increased phospho-mTOR and phospho-S6K levels in the animal tumors. Renal lymph node metastases were found in 15.8% of the animals with urothelial carcinoma. In conclusion, we identified and confirmed an important role for the PI3K/AKT pathway in the development of urothelial carcinoma and suggested that inhibitors of this pathway (e.g., mTOR inhibitor) may serve as effective therapeutic agents.

Activation of the PI3K/AKT pathway induces urothelial carcinoma of the renal pelvis: Identification in human tumors and confirmation in animal models

PubMed Central

Qian, Chao-Nan; Furge, Kyle A.; Knol, Jared; Huang, Dan; Chen, Jindong; Dykema, Karl J.; Kort, Eric J.; Massie, Aaron; Khoo, Sok Kean; VandenBeldt, Kristin; Resau, James H.; Anema, John; Kahnoski, Richard J.; Morreau, Hans; Camparo, Philippe; Comperat, Eva; Sibony, Mathilde; Denoux, Yves; Molinie, Vincent; Vieillefond, Annick; Eng, Charis; Williams, Bart O.; Teh, Bin Tean

2009-01-01

Urothelial carcinoma of the renal pelvis is a deadly disease with an unclear tumorigenic mechanism. We conducted gene expression profiling on a set of human tumors of this type, and identified a PI3K/AKT activation expression signature in 76.9% (n=13) of our samples. Sequence analysis found both activating mutations of PIK3CA (13.6%, n = 22) and loss of heterozygosity at the PTEN locus (25%, n = 8). In contrast, none of the other subtypes of kidney neoplasms (e.g., clear cell renal cell carcinoma) harbored PIK3CA mutations (n = 87; P < 0.001). Immunohistochemical analysis of urothelial carcinoma samples found loss of PTEN protein expression (36.4%, n = 11) and elevation of phospho-mTOR (63.6%, n = 11). To confirm the role of the PI3K/AKT pathway in urothelial carcinoma, we generated mice containing biallelic inactivation of Pten in the urogenital epithelia. These mice developed typical renal pelvic urothelial carcinomas, with an incidence of 57.1% in mice older than one year. Laser capture microdissection followed by PCR confirmed the deletion of Pten exons 4 and 5 in the animal tumor cells. Immunohistochemical analyses demonstrated increased phospho-mTOR and phospho-S6K levels in the animal tumors. Renal lymph node metastases were found in 15.8% of the animals with urothelial carcinoma. In conclusion, we identified and confirmed an important role for the PI3K/AKT pathway in the development of urothelial carcinoma and suggested that inhibitors of this pathway (e.g. mTOR inhibitor) may serve as effective therapeutic agents. PMID:19843858

Everolimus affects vasculogenic mimicry in renal carcinoma resistant to sunitinib

PubMed Central

Serova, Maria; Tijeras-Raballand, Annemilaï; Santos, Celia Dos; Martinet, Matthieu; Neuzillet, Cindy; Lopez, Alfred; Mitchell, Dianne C.; Bryan, Brad A.; Gapihan, Guillaume; Janin, Anne; Bousquet, Guilhem; Riveiro, Maria Eugenia; Bieche, Ivan; Faivre, Sandrine

2016-01-01

Angiogenesis is hallmark of clear cell renal cell carcinogenesis. Anti-angiogenic therapies have been successful in improving disease outcome; however, most patients treated with anti-angiogenic agents will eventually progress. In this study we report that clear cell renal cell carcinoma was associated with vasculogenic mimicry in both mice and human with tumor cells expressing endothelial markers in the vicinity of tumor vessels. We show that vasculogenic mimicry was efficiently targeted by sunitinib but eventually associated with tumor resistance and a more aggressive phenotype both in vitro and in vivo. Re-challenging these resistant tumors in mice, we showed that second-line treatment with everolimus particularly affected vasculogenic mimicry and tumor cell differentiation compared to sorafenib and axitinib. Finally, our results highlighted the phenotypic and genotypic changes at the tumor cell and microenvironment levels during sunitinib response and progression and the subsequent improvement second-line therapies bring to the current renal cell carcinoma treatment paradigm. PMID:27509260

Detection of tumor angiogenesis factor in adenocarcinoma of kidney.

PubMed

Bard, R H; Mydlo, J H; Freed, S Z

1986-05-01

Implantation of human renal adenocarcinoma in the rabbit cornea has resulted in new vascular growth from the limbus toward the tumor implant. This suggests that renal adenocarcinoma elaborates tumor angiogenesis factor (TAF) which stimulates endothelial cell growth. Such a substance could conceivably be responsible for the luxuriant vascularity of most renal adenocarcinomas. Conversely, absence or diminished secretion of TAF may be responsible for the hypovascular papillary renal adenocarcinomas and their recognized relatively benign clinical behavior.

Partial nephrectomy for renal tumors: lack of correlation between margin status and local recurrence.

PubMed

Antic, Tatjana; Taxy, Jerome B

2015-05-01

To evaluate the relationship between a positive resection margin in partial nephrectomy (PN) and local recurrence. From January 2005 through December 2012, there were 473 PNs in 466 patients at the University of Chicago. A positive margin was defined as tumor extending to the inked specimen edge, either the parenchymal interface or the peripheral fibroadipose tissue. A local recurrence was defined as an ipsilateral tumor of identical histologic type. Renal cell carcinoma (RCC) accounted for 406 tumors: 243 clear cell RCCs (CRCCs), 77 papillary RCCs (PRCCs), and 47 chromophobe RCCs (CHRCCs). Sixty-one RCCs had positive margins: 43 CRCCs, six PRCCs, nine CHRCCs, and three miscellaneous cell types. Of the 61 positive margins, four CRCCs (all originally multifocal) had a local recurrence, two of which occurred in the same patient. One translocation RCC also recurred. Six cases with negative resection margins had a recurrence. A literature review of 3,803 cases, including our study, shows positive margins in 173, of which 13 recurred; however, 39 with negative margins also recurred. A positive margin in PN seldom correlates with a local recurrence. However, protection from recurrence is not ensured by a negative margin. Copyright© by the American Society for Clinical Pathology.

A Mathematical Method to Calculate Tumor Contact Surface Area: An Effective Parameter to Predict Renal Function after Partial Nephrectomy.

PubMed

Hsieh, Po-Fan; Wang, Yu-De; Huang, Chi-Ping; Wu, Hsi-Chin; Yang, Che-Rei; Chen, Guang-Heng; Chang, Chao-Hsiang

2016-07-01

We proposed a mathematical formula to calculate contact surface area between a tumor and renal parenchyma. We examined the applicability of using contact surface area to predict renal function after partial nephrectomy. We performed this retrospective study in patients who underwent partial nephrectomy between January 2012 and December 2014. Based on abdominopelvic computerized tomography or magnetic resonance imaging, we calculated the contact surface area using the formula (2*π*radius*depth) developed by integral calculus. We then evaluated the correlation between contact surface area and perioperative parameters, and compared contact surface area and R.E.N.A.L. (Radius/Exophytic/endophytic/Nearness to collecting system/Anterior/Location) score in predicting a reduction in renal function. Overall 35, 26 and 45 patients underwent partial nephrectomy with open, laparoscopic and robotic approaches, respectively. Mean ± SD contact surface area was 30.7±26.1 cm(2) and median (IQR) R.E.N.A.L. score was 7 (2.25). Spearman correlation analysis showed that contact surface area was significantly associated with estimated blood loss (p=0.04), operative time (p=0.04) and percent change in estimated glomerular filtration rate (p <0.001). On multivariate analysis contact surface area and R.E.N.A.L. score independently affected percent change in estimated glomerular filtration rate (p <0.001 and p=0.03, respectively). On ROC curve analysis contact surface area was a better independent predictor of a greater than 10% change in estimated glomerular filtration rate compared to R.E.N.A.L. score (AUC 0.86 vs 0.69). Using this simple mathematical method, contact surface area was associated with surgical outcomes. Compared to R.E.N.A.L. score, contact surface area was a better predictor of functional change after partial nephrectomy. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Wilms' tumor blastemal stem cells dedifferentiate to propagate the tumor bulk.

PubMed

Shukrun, Rachel; Pode-Shakked, Naomi; Pleniceanu, Oren; Omer, Dorit; Vax, Einav; Peer, Eyal; Pri-Chen, Sara; Jacob, Jasmine; Hu, Qianghua; Harari-Steinberg, Orit; Huff, Vicki; Dekel, Benjamin

2014-07-08

An open question remains in cancer stem cell (CSC) biology whether CSCs are by definition at the top of the differentiation hierarchy of the tumor. Wilms' tumor (WT), composed of blastema and differentiated renal elements resembling the nephrogenic zone of the developing kidney, is a valuable model for studying this question because early kidney differentiation is well characterized. WT neural cell adhesion molecule 1-positive (NCAM1(+)) aldehyde dehydrogenase 1-positive (ALDH1(+)) CSCs have been recently isolated and shown to harbor early renal progenitor traits. Herein, by generating pure blastema WT xenografts, composed solely of cells expressing the renal developmental markers SIX2 and NCAM1, we surprisingly show that sorted ALDH1(+) WT CSCs do not correspond to earliest renal stem cells. Rather, gene expression and proteomic comparative analyses disclose a cell type skewed more toward epithelial differentiation than the bulk of the blastema. Thus, WT CSCs are likely to dedifferentiate to propagate WT blastema.

Wilms’ Tumor Blastemal Stem Cells Dedifferentiate to Propagate the Tumor Bulk

PubMed Central

Shukrun, Rachel; Pode-Shakked, Naomi; Pleniceanu, Oren; Omer, Dorit; Vax, Einav; Peer, Eyal; Pri-Chen, Sara; Jacob, Jasmine; Hu, Qianghua; Harari-Steinberg, Orit; Huff, Vicki; Dekel, Benjamin

2014-01-01

Summary An open question remains in cancer stem cell (CSC) biology whether CSCs are by definition at the top of the differentiation hierarchy of the tumor. Wilms’ tumor (WT), composed of blastema and differentiated renal elements resembling the nephrogenic zone of the developing kidney, is a valuable model for studying this question because early kidney differentiation is well characterized. WT neural cell adhesion molecule 1-positive (NCAM1+) aldehyde dehydrogenase 1-positive (ALDH1+) CSCs have been recently isolated and shown to harbor early renal progenitor traits. Herein, by generating pure blastema WT xenografts, composed solely of cells expressing the renal developmental markers SIX2 and NCAM1, we surprisingly show that sorted ALDH1+ WT CSCs do not correspond to earliest renal stem cells. Rather, gene expression and proteomic comparative analyses disclose a cell type skewed more toward epithelial differentiation than the bulk of the blastema. Thus, WT CSCs are likely to dedifferentiate to propagate WT blastema. PMID:25068119

Human renal adipose tissue induces the invasion and progression of renal cell carcinoma.

PubMed

Campo-Verde-Arbocco, Fiorella; López-Laur, José D; Romeo, Leonardo R; Giorlando, Noelia; Bruna, Flavia A; Contador, David E; López-Fontana, Gastón; Santiano, Flavia E; Sasso, Corina V; Zyla, Leila E; López-Fontana, Constanza M; Calvo, Juan C; Carón, Rubén W; Creydt, Virginia Pistone

2017-11-07

We evaluated the effects of conditioned media (CMs) of human adipose tissue from renal cell carcinoma located near the tumor (hRATnT) or farther away from the tumor (hRATfT), on proliferation, adhesion and migration of tumor (786-O and ACHN) and non-tumor (HK-2) human renal epithelial cell lines. Human adipose tissues were obtained from patients with renal cell carcinoma (RCC) and CMs from hRATnT and hRATfT incubation. Proliferation, adhesion and migration were quantified in 786-O, ACHN and HK-2 cell lines incubated with hRATnT-, hRATfT- or control-CMs. We evaluated versican, adiponectin and leptin expression in CMs from hRATnT and hRATfT. We evaluated AdipoR1/2, ObR, pERK, pAkt y pPI3K expression on cell lines incubated with CMs. No differences in proliferation of cell lines was found after 24 h of treatment with CMs. All cell lines showed a significant decrease in cell adhesion and increase in cell migration after incubation with hRATnT-CMs vs. hRATfT- or control-CMs. hRATnT-CMs showed increased levels of versican and leptin, compared to hRATfT-CMs. AdipoR2 in 786-O and ACHN cells decreased significantly after incubation with hRATfT- and hRATnT-CMs vs. control-CMs. We observed a decrease in the expression of pAkt in HK-2, 786-O and ACHN incubated with hRATnT-CMs. This result could partially explain the observed changes in migration and cell adhesion. We conclude that hRATnT released factors, such as leptin and versican, could enhance the invasive potential of renal epithelial cell lines and could modulate the progression of the disease.

Human renal adipose tissue induces the invasion and progression of renal cell carcinoma

PubMed Central

Campo-Verde-Arbocco, Fiorella; López-Laur, José D.; Romeo, Leonardo R.; Giorlando, Noelia; Bruna, Flavia A.; Contador, David E.; López-Fontana, Gastón; Santiano, Flavia E.; Sasso, Corina V.; Zyla, Leila E.; López-Fontana, Constanza M.; Calvo, Juan C.; Carón, Rubén W.; Creydt, Virginia Pistone

2017-01-01

We evaluated the effects of conditioned media (CMs) of human adipose tissue from renal cell carcinoma located near the tumor (hRATnT) or farther away from the tumor (hRATfT), on proliferation, adhesion and migration of tumor (786-O and ACHN) and non-tumor (HK-2) human renal epithelial cell lines. Human adipose tissues were obtained from patients with renal cell carcinoma (RCC) and CMs from hRATnT and hRATfT incubation. Proliferation, adhesion and migration were quantified in 786-O, ACHN and HK-2 cell lines incubated with hRATnT-, hRATfT- or control-CMs. We evaluated versican, adiponectin and leptin expression in CMs from hRATnT and hRATfT. We evaluated AdipoR1/2, ObR, pERK, pAkt y pPI3K expression on cell lines incubated with CMs. No differences in proliferation of cell lines was found after 24 h of treatment with CMs. All cell lines showed a significant decrease in cell adhesion and increase in cell migration after incubation with hRATnT-CMs vs. hRATfT- or control-CMs. hRATnT-CMs showed increased levels of versican and leptin, compared to hRATfT-CMs. AdipoR2 in 786-O and ACHN cells decreased significantly after incubation with hRATfT- and hRATnT-CMs vs. control-CMs. We observed a decrease in the expression of pAkt in HK-2, 786-O and ACHN incubated with hRATnT-CMs. This result could partially explain the observed changes in migration and cell adhesion. We conclude that hRATnT released factors, such as leptin and versican, could enhance the invasive potential of renal epithelial cell lines and could modulate the progression of the disease. PMID:29212223

Distinctive expression patterns of glycoprotein non-metastatic B and folliculin in renal tumors in patients with Birt–Hogg–Dubé syndrome

PubMed Central

Furuya, Mitsuko; Hong, Seung-Beom; Tanaka, Reiko; Kuroda, Naoto; Nagashima, Yoji; Nagahama, Kiyotaka; Suyama, Takahito; Yao, Masahiro; Nakatani, Yukio

2015-01-01

Birt–Hogg–Dubé syndrome (BHD) is an inherited disorder associated with a germline mutation of the folliculin gene (FLCN). The affected families have a high risk for developing multiple renal cell carcinomas (RCC). Diagnostic markers that distinguish between FLCN-related RCC and sporadic RCC have not been investigated, and many patients with undiagnosed BHD fail to receive proper medical care. We investigated the histopathology of 27 RCCs obtained from 18 BHD patients who were diagnosed by genetic testing. Possible somatic mutations of RCC lesions were investigated by DNA sequencing. Western blotting and immunohistochemical staining were used to compare the expression levels of FLCN and glycoprotein non-metastatic B (GPNMB) between FLCN-related RCCs and sporadic renal tumors (n = 62). The expression of GPNMB was also evaluated by quantitative RT-PCR. Histopathological analysis revealed that the most frequent histological type was chromophobe RCC (n = 12), followed by hybrid oncocytic/chromophobe tumor (n = 6). Somatic mutation analysis revealed small intragenic mutations in six cases and loss of heterozygosity in two cases. Western blot and immunostaining analyses revealed that FLCN-related RCCs showed overexpression of GPNMB and underexpression of FLCN, whereas sporadic tumors showed inverted patterns. GPNMB mRNA in FLCN-related RCCs was 23-fold more abundant than in sporadic tumors. The distinctive expression patterns of GPNMB and FLCN might identify patients with RCCs who need further work-up for BHD. PMID:25594584

A shower of second hit events as the cause of multifocal renal cell carcinoma in tuberous sclerosis complex

PubMed Central

Tyburczy, Magdalena E.; Jozwiak, Sergiusz; Malinowska, Izabela A.; Chekaluk, Yvonne; Pugh, Trevor J.; Wu, Chin-Lee; Nussbaum, Robert L.; Seepo, Sara; Dzik, Tomasz; Kotulska, Katarzyna; Kwiatkowski, David J.

2015-01-01

Tuberous sclerosis complex (TSC) is a genetic disorder characterized by seizures and tumor formation in multiple organs, mainly in the brain, skin, kidney, lung and heart. Renal cell carcinoma (RCC) occurs in ∼3% of TSC patients, and typically develops at age <50. Here we describe genetic findings in two TSC patients with multiple renal tumors, each of whom had the germline mutation TSC2 p.R905Q. The first (female) TSC patient had a left followed by a right nephrectomy at ages 24 and 27. Both kidneys showed multifocal TSC-associated papillary RCC (PRCC). Targeted, next-generation sequencing (NGS) analysis of TSC2 in five tumors (four from the left kidney, one from the right) showed loss of heterozygosity in one tumor, and four different TSC2 point mutations (p.E1351*, p.R1032*, p.R1713H, c.4178_4179delCT) in the other four samples. Only one of the 11 other tumors available from this patient had one of the TSC2 second hit mutations identified. Whole-exome analysis of the five tumors identified a very small number of additional mutated genes, with an average of 3.4 nonsilent coding, somatic mutations per tumor, none of which were seen in >1 tumor. The second (male) TSC patient had bilateral partial nephrectomies (both at age 36), with similar findings of multifocal PRCC. NGS analysis of TSC2 in two of these tumors identified a second hit mutation c.2355+1G>T in one sample that was not seen in other tumors. In conclusion, we report the first detailed genetic analysis of RCCs in TSC patients. Molecular studies indicate that tumors developed independently due to various second hit events, suggesting that these patients experienced a ‘shower’ of second hit mutations in TSC2 during kidney development leading to this severe phenotype. PMID:25432535

VHL-regulated miR-204 Suppresses Tumor Growth through Inhibition of LC3B-mediated Autophagy in Renal Clear Cell Carcinoma

PubMed Central

Mikhaylova, Olga; Stratton, Yiwen; Hall, Daniel; Kellner, Emily; Ehmer, Birgit; Drew, Angela F.; Gallo, Catherine A.; Plas, David R.; Biesiada, Jacek; Meller, Jarek; Czyzyk-Krzeska, Maria F.

2012-01-01

Summary The von Hippel-Lindau tumor-suppressor gene (VHL) is lost in most clear cell renal cell carcinomas (ccRCC). Here, using human ccRCC specimens, VHL-deficient cells, and xenograft models, we show that miR-204 is a VHL-regulated tumor suppressor acting by inhibiting macroautophagy, with MAP1LC3B (LC3B) as a direct and functional target. Importantly, higher tumor grade of human ccRCC was correlated with a concomitant decrease in miR-204 and increase in LC3B levels, indicating that LC3B-mediated macroautophagy is necessary for RCC progression. VHL, in addition to inducing endogenous miR-204, triggered the expression of LC3C, an HIF-regulated LC3B paralog, that suppressed tumor growth. These data reveal a function of VHL as a tumor suppressing regulator of autophagic programs. PMID:22516261

A medical oncologist's approach to immunotherapy for advanced renal tumors: is nephrectomy indicated?

PubMed

Cooney, Matthew M; Remick, Scot C; Vogelzang, Nicholas J

2004-02-01

Metastatic renal cell carcinoma is highly resistant to systemic therapy. Although interleukin-2 and interferon remain the most active agents for this disease, long-term survival rates remain poor. Two phase 3 trials, European Organization Research and Treatment of Cancer 30947 and Southwest Oncology Group 8949, have demonstrated a survival benefit of nephrectomy followed by interferon versus interferon alone in patients having an excellent performance status (PS 0 and 1). Removal of the primary tumor followed by interferon is not recommended for patients with a moderate or poor PS (PS 2-4). Even with this aggressive approach, most patients eventually will die from their kidney cancer; therefore, every patient with metastatic disease should be considered for enrollment into clinical trials.

Type 1 papillary renal cell carcinoma in a patient with schwannomatosis: Mosaic versus loss of SMARCB1 expression in respectively schwannoma and renal tumor cells.

PubMed

Hulsebos, Theo J M; Kenter, Susan; Baas, Frank; Nannenberg, Eline A; Bleeker, Fonnet E; van Minkelen, Rick; van den Ouweland, Ans M W; Wesseling, Pieter; Flucke, Uta

2016-04-01

In schwannomatosis, germline SMARCB1 or LZTR1 mutations predispose to the development of multiple benign schwannomas. Besides these, other tumors may occur in schwannomatosis patients. We present a 45-year-old male patient who developed multiple schwannomas and in addition a malignant type 1 papillary renal cell carcinoma (pRCC1). We identified a duplication of exon 7 of SMARCB1 on chromosome 22 in the constitutional DNA of the patient (c.796-2246_986 + 5250dup7686), resulting in the generation of a premature stop codon in the second exon 7 copy (p.Glu330*). The mutant SMARCB1 allele proved to be retained in three schwannomas and in the pRCC1 of the patient. Loss of heterozygosity analysis demonstrated partial loss of the wild-type SMARCB1 allele containing chromosome 22, suggesting loss of that chromosome in only a subset of tumor cells, in all four tumors. Immunohistochemical staining with a SMARCB1 antibody revealed a mosaic SMARCB1 expression pattern in the three benign schwannomas, but absence of expression in the malignant tumor cells of the pRCC1. To our knowledge, this difference in SMARCB1 protein expression has not been reported before. We conclude that a germline SMARCB1 mutation may predispose to the development of pRCC1, thereby further widening the spectrum of tumors that can develop in the context of schwannomatosis. © 2016 Wiley Periodicals, Inc.

Cytoplasmic expression of Twist1, an EMT-related transcription factor, is associated with higher grades renal cell carcinomas and worse progression-free survival in clear cell renal cell carcinoma.

PubMed

Rasti, Arezoo; Madjd, Zahra; Abolhasani, Maryam; Mehrazma, Mitra; Janani, Leila; Saeednejad Zanjani, Leili; Asgari, Mojgan

2018-05-01

Twist1 is a key transcription factor, which confers tumor cells with cancer stem cell (CSC)-like characteristics and enhances epithelial-mesenchymal transition in pathological conditions including tumor malignancy and metastasis. This study aimed to evaluate the expression patterns and clinical significance of Twist1 in renal cell carcinoma (RCC). The cytoplasmic and nuclear expression of Twist1 were examined in 252 well-defined renal tumor tissues, including 173 (68.7%) clear cell renal cell carcinomas (ccRCC), 45 (17.9%) papillary renal cell carcinomas (pRCC) and 34 (13.5%) chromophobe renal cell carcinoma, by immunohistochemistry on a tissue microarray. The association between expression of this marker and clinicopathologic parameters and survival outcomes were then analyzed. Twist1 was mainly localized to the cytoplasm of tumor cells (98.8%). Increased cytoplasmic expression of Twist1 was associated with higher grade tumors (P = 0.045), renal vein invasion (P = 0.031) and microvascular invasion (P = 0.044) in RCC. It was positively correlated with higher grade tumors (P = 0.026), shorter progression-free survival time (P = 0.027) in patients with ccRCC, and also with higher stage in pRCC patients (P = 0.036). Significantly higher cytoplasmic expression levels of Twist1 were found in ccRCC and pRCC subtypes, due to their more aggressive tumor behavior. Increased cytoplasmic expression of Twist1 had a critical role in worse prognosis in ccRCC. These findings suggest that cytoplasmic, rather than nuclear expression of Twist1 can be considered as a prognostic and therapeutic marker for targeted therapy of RCC, especially for ccRCC patients.

Anatomic renal artery branch microdissection to facilitate zero-ischemia partial nephrectomy.

PubMed

Ng, Casey K; Gill, Inderbir S; Patil, Mukul B; Hung, Andrew J; Berger, Andre K; de Castro Abreu, Andre Luis; Nakamoto, Masahiko; Eisenberg, Manuel S; Ukimura, Osamu; Thangathurai, Duraiyah; Aron, Monish; Desai, Mihir M

2012-01-01

Robot-assisted and laparoscopic partial nephrectomies (PNs) for medial tumors are technically challenging even with the hilum clamped and, until now, were impossible to perform with the hilum unclamped. Evaluate whether targeted vascular microdissection (VMD) of renal artery branches allows zero-ischemia PN to be performed even for challenging medial tumors. A prospective cohort evaluation of 44 patients with renal masses who underwent robot-assisted or laparoscopic zero-ischemia PN either with anatomic VMD (group 1; n=22) or without anatomic VMD (group 2; n=22) performed by a single surgeon from April 2010 to January 2011. Zero-ischemia PN with VMD incorporates four maneuvers: (1) preoperative computed tomographic reconstruction of renal arterial branch anatomy, (2) anatomic dissection of targeted, tumor-specific tertiary or higher-order renal arterial branches, (3) neurosurgical aneurysm microsurgical bulldog clamp(s) for superselective tumor devascularization, and (4) transient, controlled reduction of blood pressure, if necessary. Baseline, perioperative, and postoperative data were collected prospectively. Group 1 tumors were larger (4.3 vs 2.6 cm; p=0.011), were more often hilar (41% vs 9%; p=0.09), were medial (59% and 23%; p=0.017), were closer to the hilum (1.46 vs 3.26 cm; p=0.0002), and had a lower C index score (2.1 vs 3.9; p=0.004) and higher RENAL nephrometry scores (7.7 vs 6.2; p=0.013). Despite greater complexity, no group 1 tumor required hilar clamping, and perioperative outcomes were similar to those of group 2: operating room time (4.7 and 4.1h), median blood loss (200 and 100ml), surgical margins for cancer (all negative), major complications (0% and 9%), and minor complications (18% and 14%). The median serum creatinine level was similar 2 mo postoperatively (1.2 and 1.3mg/dl). The study was limited by the relatively small sample size. Anatomic targeted dissection and superselective control of tumor-specific renal arterial branches facilitate

A 3D Human Renal Cell Carcinoma-on-a-Chip for the Study of Tumor Angiogenesis.

PubMed

Miller, Chris P; Tsuchida, Connor; Zheng, Ying; Himmelfarb, Jonathan; Akilesh, Shreeram

2018-06-01

Tractable human tissue-engineered 3D models of cancer that enable fine control of tumor growth, metabolism, and reciprocal interactions between different cell types in the tumor microenvironment promise to accelerate cancer research and pharmacologic testing. Progress to date mostly reflects the use of immortalized cancer cell lines, and progression to primary patient-derived tumor cells is needed to realize the full potential of these platforms. For the first time, we report endothelial sprouting induced by primary patient tumor cells in a 3D microfluidic system. Specifically, we have combined primary human clear cell renal cell carcinoma (ccRCC) cells from six independent donors with human endothelial cells in a vascularized, flow-directed, 3D culture system ("ccRCC-on-a-chip"). The upregulation of key angiogenic factors in primary human ccRCC cells, which exhibited unique patterns of donor variation, was further enhanced when they were cultured in 3D clusters. When embedded in the matrix surrounding engineered human vessels, these ccRCC tumor clusters drove potent endothelial cell sprouting under continuous flow, thus recapitulating the critical angiogenic signaling axis between human ccRCC cells and endothelial cells. Importantly, this phenotype was driven by a primary tumor cell-derived biochemical gradient of angiogenic growth factor accumulation that was subject to pharmacological blockade. Our novel 3D system represents a vascularized tumor model that is easy to image and quantify and is fully tunable in terms of input cells, perfusate, and matrices. We envision that this ccRCC-on-a-chip will be valuable for mechanistic studies, for studying tumor-vascular cell interactions, and for developing novel and personalized antitumor therapies. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Stereotactic Body Radiotherapy (SBRT) for Pulmonary Metastases in Ewing Sarcoma, Rhabdomyosarcoma, and Wilms Tumors

ClinicalTrials.gov

2018-01-31

Ewing Sarcoma; Rhabdomyosarcoma; Wilms Tumor; Osteosarcoma; Non-Rhabdomyosarcoma Soft Tissue Sarcoma, Nos; Renal Tumor; Rhabdoid Tumor; Clear Cell Renal Cell Carcinoma; Sarcoma; Sarcoma, Ewing; Soft Tissue Sarcoma

Tc-99m Hydroxymethylene Diphosphonate (HMDP) Renal Uptake as a Surrogate Marker of Postoperative Impairment of the Glomerular Filtration Rate in Renal Tumor Patients Following Nephron-Sparing Surgery.

PubMed

Choi, Hongyoon; Lee, Won Woo; So, Young; Ha, Seunggyun; Byun, Seok-Soo; Kim, Sang Eun

2014-12-01

We investigated Tc-99m hydroxymethylene diphosphonate (HMDP) scintigraphy findings in renal tumor patients from the perspective of postoperative renal dysfunction following nephron-sparing surgery (NSS). Forty-three renal tumor patients (M:F = 28:15, age 53.9 ± 12.5 years) who had undergone Tc-99m HMDP scintigraphy after NSS were enrolled. The patients were divided into HMDP(+) or HMDP(-) groups by visual assessment, and the asymmetric index (ASI) was calculated using a region-of-interest analysis. In 16 patients, the total and split glomerular filtration rate (GFR) was assessed using Tc-99m diethylenetriaminepentaacetic acid (DTPA) scintigraphy at baseline and at 3 and 6 months post-NSS. High Tc-99m HMDP uptake was observed in the operated kidneys, but this did not persist later than 7 days post-NSS. Split GFR of the operated kidneys at baseline (58.5 ± 9.3 ml/min) was significantly reduced at 6 months post-NSS (40.1 ± 5.9 ml/min, p < 0.001) in only those who showed intense uptake of Tc-99m HMDP. Declines in both total GFR (p = 0.010 and p = 0.002 for 3 and 6 months, respectively) and split GFR of the operated kidneys (p < 0.001 and p < 0.001 for 3 and 6 months, respectively) were clearly evidenced at 3 and 6 months post-NSS only in patients with high Tc-99m HMDP in the operated kidneys. The ASI was negatively correlated with %change in the split GFR of these operated kidneys at 6 months post-NSS (rho =-0.578, p = 0.0304). Tc-99m HMDP uptake within 1 week following NSS is a surrogate marker of GFR impairment over 6 months post-NSS.

High fidelity of driver chromosomal alterations among primary and metastatic renal cell carcinomas: implications for tumor clonal evolution and treatment.

PubMed

Kouba, Eril J; Eble, John N; Simper, Novae; Grignon, David J; Wang, Mingsheng; Zhang, Shaobo; Wang, Lisha; Martignoni, Guido; Williamson, Sean R; Brunelli, Matteo; Luchini, Claudio; Calió, Anna; Cheng, Liang

2016-11-01

Recent studies have demonstrated considerable genomic heterogeneity in both primary and metastatic renal cell carcinoma (RCC). This mutational diversity has serious implications for the development and implementation of targeted molecular therapies. We evaluated 39 cases of primary RCC tumors with their matched metastatic tumors to determine if the hallmark chromosomal anomalies of these tumors are preserved over the course of disease progression. Thirty-nine matched pairs of primary and metastatic RCCs (20 clear cell RCC, 16 papillary RCC, and 3 chromophobe RCC) were analyzed. All clear cell RCC and papillary RCC tumors were evaluated for chromosome 3p deletion, trisomy 7 and 17 using fluorescence in situ hybridization. Chromophobe RCC tumors were evaluated for genetic alterations in chromosomes 1, 2, 6, 10, and 17. Of the 20 clear cell RCC tumors, 18 primary tumors (90%) showed a deletion of chromosome 3p and were disomic for chromosomes 7 and 17. All molecular aberrations were conserved within the matched metastatic tumor. Of the 16 papillary RCC tumors, 10 primary tumors (62%) showed trisomy for both chromosomes 7 and 17 without 3p deletion. These molecular aberrations and others were conserved in the paired metastatic tumors. Of the three chromophobe RCC tumors, multiple genetic anomalies were identified in chromosomes 1, 2, 6, 10, and 17. These chromosomal aberrations were conserved in the matched metastatic tumors. Our results demonstrated genomic fidelity among the primary and metastatic lesions in RCCs. These findings may have important clinical and diagnostic implications.

Coexistence between renal cell cancer and Hodgkin's lymphoma: A rare coincidence

PubMed Central

Jimenez I, Victor H

2006-01-01

Background Renal cell carcinoma is the most common kidney tumor in adults and accounts for approximately 3% of adult malignancies. An increased incidence of second malignancies has been well documented in a number of different disorders, such as head and neck tumors, and hairy cell leukemia. In addition, treatment associated second malignancies (usually leukemias and lymphomas but also solid tumors) have been described in long term survivors of Hodgkin's lymphoma (HL), Non Hodgkin's lymphoma and in various pediatric tumors. Case presentation We present the case of a 66 year-old woman with abdominal pain and dyspnea. We performed a thorax CT scan that showed lymph nodes enlargement and subsequently by presence of abdominal pain was performed an abdominal and pelvis CT scan that showed a right kidney tumor of 4 × 5 cms besides of abdominal lymph nodes enlargement. A radical right nephrectomy was designed and Hodgkin's lymphoma was diagnosed in the abdominal lymph nodes while renal cell tumor exhibited a renal cell cancer. Patient received EVA protocol achieving complete response. Conclusion We described the first case reported in the medical literature of the coexistence between Hodgkin's lymphoma and renal cell cancer. Previous reports have shown the relationship of lymphoid neoplasms with solid tumors, but they have usually described secondary forms of cancer related to chemotherapy. PMID:16549035

[Sarcomatoid renal cell carcinoma].

PubMed

Arnoux, V; Lechevallier, E; Pamela, A; Long, J-A; Rambeaud, J-J

2013-06-01

The objective was to perform a systematic review of literature concerning epidemiology, clinical and biological data, prognosis and therapy of sarcomatoid renal cell carcinomas. Data on sarcomatoid renal cell carcinomas have been sought by querying the server Medline with MeSH terms following or combination of them: "renal carcinoma", "renal cell carcinoma," "renal cancer", "sarcomatoid" "sarcomatoid transformation" and "sarcomatoid differentiation." The articles obtained were selected according to their methodology, the language in English or French, the relevance and the date of publication. Twenty papers were selected. According to the literature, a sarcomatoid contingent can be observed in all subtypes of renal cell carcinomas, with a frequency of 1 to 15% of cases. The median age at diagnosis was 60 years with a majority of symptomatic patients (90%), mainly with abdominal pain and hematuria. These tumors were often found in patients with locally advanced or metastatic (45-77%). The imaging was not specific for the diagnosis and biopsy had a low sensitivity for identifying a sarcomatoid contingent. The treatment was based on a combination of maximal surgical resection whenever possible and systemic therapy for metastastic disease. Pathological data often showed large tumors, Furhman 4 grades, combined biphasic carcinomatous contingent (clear cell carcinoma in most cases) and sarcomatoid. Genetically, there was no specific abnormality but a complex association of chromosomal additions and deletions. The prognosis was pejorative with a specific median survival of 5 to 19 months without any impact of the sarcomatoid contingent rate. Sarcomatoid renal cell carcinoma is a form not to ignore despite its rarity. Mainly symptomatic and discovered at an advanced stage, it has a poor prognosis, requiring multidisciplinary management quickly and correctly. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Aflac ST0901 CHOANOME - Sirolimus in Solid Tumors

ClinicalTrials.gov

2018-05-15

Ewing's Sarcoma; Osteosarcoma; Astrocytoma; Atypical Teratoid/Rhabdoid Tumor; Ependymoma; Germ Cell Tumor; Glioma; Medulloblastoma; Rhabdoid Tumor; Retinoblastoma; Clear Cell Sarcoma; Renal Cell Carcinoma; Wilms Tumor; Hepatoblastoma; Neuroblastoma; Rhabdomyosarcoma

Wilms Tumor and Other Childhood Kidney Tumors Treatment (PDQ®)—Health Professional Version

Cancer.gov

Wilms tumor is the most common type of childhood kidney tumor. Other types include renal cell carcinoma, congenital mesoblastic lymphoma, nephroblastomatosis, and rhabdoid, clear cell, Ewing, and anaplastic sarcoma of the kidney. Get detailed information about the associated syndromes, presentation, diagnosis, genomics, prognosis, and treatment for newly diagnosed and recurrent Wilms tumor and other kidney tumors in this summary for clinicians.

Renal arteries (image)

MedlinePlus

... then injected into the renal artery through the catheter, and images of the vessels of the kidney are taken. The test is a useful aid in evaluating kidney function and diagnosing any narrowing of the arteries, blood clots, tumors or aneurysms.

[Multifocal tubulopapillary tumors of the kidney. Morphologic features and prognosis. Three cases].

PubMed

Abdelmoula, N B; Boudawara, T; Bahloul, A; Hmida, M B; Hachicha, J; Rebai, T; Mhiri, N; Jlidi, R

1999-01-01

Tubulopapillary tumors of the kidney represent a particular group of renal tumors characterized by their less aggressive behavior. These tumors are distinguished from non papillary tumors by their morphologic, cytochemical and genotypic features. They correspond to a continuous spectrum of tumors ranging from papillary renal cell adenoma to papillary renal cell carcinoma. These TTPR show multifocal, bilateral development and chronic lesions of the kidney parenchyma in nearly all cases. The authors report three cases of multifocal TTPR, including one bilateral case. Based on analysis of these cases and a review of the literature, they discuss the histogenetic features and prognosis of TTPR.

Aortic intimal sarcoma masquerading as bilateral renal artery stenosis.

PubMed

Sethi, Supreet; Pothineni, Naga Krishna; Syal, Gaurav; Ali, Syed Mujtaba; Krause, Michelle W

2013-01-01

Aortic intimal sarcoma is a rare tumor with poor prognosis. The most common manifestations are thromboembolic phenomena and vascular obstruction. We present a case of aortic intimal sarcoma causing bilateral renal artery stenosis which manifested as resistant hypertension and acute kidney inury. Multiple attempts to stent the renal arteries were unsuccessful. Eventually the patient developed acute limb ischemia and oliguric kidney failure as complications of the primary tumor.

[Molecular biology of renal cancer: bases for genetic directed therapy in advanced disease].

PubMed

Maroto Rey, José Pablo; Cillán Narvaez, Elena

2013-06-01

There has been expansion of therapeutic options in the management of metastatic renal cell carcinoma due to a better knowledge of the molecular biology of kidney cancers. There are different tumors grouped under the term renal cell carcinoma, being clear cell cancer the most frequent and accounting for 80% of kidney tumors. Mutations in the Von Hippel-Lindau gene can be identified in up to 80% of sporadic clear cell cancer, linking a genetically inheritable disease where vascular tumors are frequent, with renal cell cancer. Other histologic types present specific alterations in molecular pathways, like c-MET in papillary type I tumors, and Fumarase Hydratase in papillary type II tumors. Identification of the molecular alteration for a specific tumor may offer an opportunity for treatment selection based on biomarkers, and, in the future, for developing an engineering designed genetic treatment.

Contrast media enhancement reduction predicts tumor response to presurgical molecular-targeting therapy in patients with advanced renal cell carcinoma.

PubMed

Hosogoe, Shogo; Hatakeyama, Shingo; Kusaka, Ayumu; Hamano, Itsuto; Tanaka, Yoshimi; Hagiwara, Kazuhisa; Hirai, Hideaki; Morohashi, Satoko; Kijima, Hiroshi; Yamamoto, Hayato; Tobisawa, Yuki; Yoneyama, Tohru; Yoneyama, Takahiro; Hashimoto, Yasuhiro; Koie, Takuya; Ohyama, Chikara

2017-07-25

A quantitative tumor response evaluation to molecular-targeting agents in advanced renal cell carcinoma (RCC) is debatable. We aimed to evaluate the relationship between radiologic tumor response and pathological response in patients with advanced RCC who underwent presurgical therapy. Of 34 patients, 31 underwent scheduled radical nephrectomy. Presurgical therapy agents included axitinib (n = 26), everolimus (n = 3), sunitinib (n = 1), and axitinib followed by temsirolimus (n = 1). The major presurgical treatment-related adverse event was grade 2 or 3 hypertension (44%). The median radiologic tumor response by RECIST, Choi, and CMER were -19%, -24%, and -49%, respectively. Among the radiologic tumor response tests, CMER showed a higher association with tumor necrosis in surgical specimens than others. Ki67/MIB1 status was significantly decreased in surgical specimens than in biopsy specimens. The magnitude of the slope of the regression line associated with the tumor necrosis percentage was greater in CMER than in Choi and RECIST. Between March 2012 and December 2016, we prospectively enrolled 34 locally advanced and/or metastatic RCC who underwent presurgical molecular-targeting therapy followed by radical nephrectomy. Primary endpoint was comparison of radiologic tumor response among Response Evaluation Criteria in Solid Tumors (RECIST), Choi, and contrast media enhancement reduction (CMER). Secondary endpoint included pathological downstaging, treatment related adverse events, postoperative complications, Ki67/MIB1 status, and tumor necrosis. CMER may predict tumor response after presurgical molecular-targeting therapy. Larger prospective studies are needed to develop an optimal tumor response evaluation for molecular-targeting therapy.

Three-Dimensional Printing as an Interdisciplinary Communication Tool: Preparing for Removal of a Giant Renal Tumor and Atrium Neoplastic Mass.

PubMed

Golab, Adam; Slojewski, Marcin; Brykczynski, Miroslaw; Lukowiak, Magdalena; Boehlke, Marek; Matias, Daniel; Smektala, Tomasz

2016-08-22

Three-dimensional (3D) printing involves preparing 3D objects from a digital model. These models can be used to plan and practice surgery. We used 3D printing to plan for a rare complicated surgery involving the removal of a renal tumor and neoplastic mass, which reached the heart atrium. A printed kidney model was an essential element of communication for physicians with different specializations.

Small renal masses: The molecular markers associated with outcome of patients with kidney tumors 7 cm or less

NASA Astrophysics Data System (ADS)

Spirina, L. V.; Usynin, Y. A.; Kondakova, I. V.; Yurmazov, Z. A.; Slonimskaya, E. M.; Pikalova, L. V.

2016-08-01

The investigation of molecular mechanisms of tumor cell behavior in small renal masses is required to achieve the better cancer survival. The aim of the study is to find molecular markers associated with outcome of patients with kidney tumors 7 cm or less. A homogenous group of 20 patients T1N0M0-1 (mean age 57.6 ± 2.2 years) with kidney cancer was selected for the present analysis. The content of transcription and growth factors was determined by ELISA. The levels of AKT-mTOR signaling pathway components were measured by Western blotting analysis. The molecular markers associated with unfavorable outcome of patients with kidney tumors 7 cm or less were high levels of NF-kB p50, NF-kB p65, HIF-1, HIF-2, VEGF and CAIX. AKT activation with PTEN loss also correlated with the unfavorable outcome of kidney cancer patients with tumor size 7 cm or less. It is observed that the biological features of kidney cancer could predict the outcome of patients.

Impact of Ischemia and Procurement Conditions on Gene Expression in Renal Cell Carcinoma

PubMed Central

Liu, Nick W.; Sanford, Thomas; Srinivasan, Ramaprasad; Liu, Jack L.; Khurana, Kiranpreet; Aprelikova, Olga; Valero, Vladimir; Bechert, Charles; Worrell, Robert; Pinto, Peter A.; Yang, Youfeng; Merino, Maria; Linehan, W. Marston; Bratslavsky, Gennady

2013-01-01

Purpose Previous studies have shown that ischemia alters gene expression in normal and malignant tissues. There are no studies that evaluated effects of ischemia in renal tumors. This study examines the impact of ischemia and tissue procurement conditions on RNA integrity and gene expression in renal cell carcinoma. Experimental Design Ten renal tumors were resected without renal hilar clamping from 10 patients with renal clear cell carcinoma. Immediately after tumor resection, a piece of tumor was snap frozen. Remaining tumor samples were stored at 4C, 22C and 37C and frozen at 5, 30, 60, 120, and 240 minutes. Histopathologic evaluation was performed on all tissue samples, and only those with greater than 80% tumor were selected for further analysis. RNA integrity was confirmed by electropherograms and quantitated using RIN index. Altered gene expression was assessed by paired, two-sample t-test between the zero time point and aliquots from various conditions obtained from the same tumor. Results One hundred and forty microarrays were performed. Some RNA degradation was observed 240 mins after resection at 37C. The expression of over 4,000 genes was significantly altered by ischemia times or storage conditions. The greatest gene expression changes were observed with longer ischemia time and warmer tissue procurement conditions. Conclusion RNA from kidney cancer remains intact for up to 4 hours post surgical resection regardless of storage conditions. Despite excellent RNA preservation, time after resection and procurement conditions significantly influence gene expression profiles. Meticulous attention to pre-acquisition variables is of paramount importance for accurate tumor profiling. PMID:23136194

The multislice CT findings of renal carcinoma associated with XP11.2 translocation/TFE gene fusion and collecting duct carcinoma.

PubMed

Zhu, Qing-Qiang; Wang, Zhong-Qiu; Zhu, Wen-Rong; Chen, Wen-Xin; Wu, Jing-Tao

2013-04-01

Renal cell carcinoma associated with Xp11.2 translocation and TFE gene fusion (Xp11.2/TFE RCC), and collecting duct carcinoma (CDC) are uncommon subtypes of renal cell carcinomas. To investigate the multislice CT (MSCT) characteristics of these two tumor types. Nine patients with Xp11.2/TFE RCC and 10 patients with CDC were studied retrospectively. MSCT was undertaken to investigate differences in tumor characteristics and enhancement patterns. All patients had single tumors centered in the renal medulla. Two patients with each tumor type had lymph node involvement and there was a single case of hepatic metastasis (Xp11.2/TFE RCC). The mean tumor diameter of Xp11.2/TFE RCC tumors was significantly larger than for CDC tumors. Two patients with Xp11.2/TFE RCC had cystic components as did eight patients with CDC (P < 0.05). Calcifications were present in six patients, each with CDC. Clear tumor boundaries were visible in two patients with CDC and in nine with Xp11.2/TFE RCC (P < 0.05). The density of Xp11.2/TFE RCC tumors was greater than that of CDC tumors, normal renal cortex, or medulla on unenhanced CT. Enhancement was higher with Xp11.2/TFE RCC than with CDC tumors during all phases. Xp11.2/TFE RCC enhancement was higher than in the renal medulla during cortical and medullary phase but lower than in normal renal medulla during the delayed phase. CDC tumor enhancement was lower than that for normal renal medulla during all enhanced phases. Both tumor types originated from the renal medulla. Distinguishing features included density on unenhanced CT, enhancement patterns, and capsule signs. Identifying these differences may aid diagnosis.

Treatment of renal nephroblastoma in an adult dog.

PubMed

Seaman, Rebecca L; Patton, Clark S

2003-01-01

An 8-year-old Labrador retriever was diagnosed with a unilateral malignant nephroblastoma and hypertrophic osteopathy. The histopathologically malignant tumor was confined to the renal capsule, but the sarcomatous component was anaplastic, resulting in its classification as a Stage I tumor with unfavorable histopathology. The dog was treated with unilateral nephrectomy, vincristine, and doxorubicin. This dog has remained disease free for >25 months. Reported treatments of renal nephroblastoma in the dog have not described disease-free intervals of >8 months.

[Renal elastography].

PubMed

Correas, Jean-Michel; Anglicheau, Dany; Gennisson, Jean-Luc; Tanter, Mickael

2016-04-01

Renal elastography has become available with the development of noninvasive quantitative techniques (including shear-wave elastography), following the rapidly growing field of diagnosis and quantification of liver fibrosis, which has a demonstrated major clinical impact. Ultrasound or even magnetic resonance techniques are leaving the pure research area to reach the routine clinical use. With the increased incidence of chronic kidney disease and its specific morbidity and mortality, the noninvasive diagnosis of renal fibrosis can be of critical value. However, it is difficult to simply extend the application from one organ to the other due to a large number of anatomical and technical issues. Indeed, the kidney exhibits various features that make stiffness assessment more complex, such as the presence of various tissue types (cortex, medulla), high spatial orientation (anisotropy), local blood flow, fatty sinus with variable volume and echotexture, perirenal space with variable fatty content, and the variable depth of the organ. Furthermore, the stiffness changes of the renal parenchyma are not exclusively related to fibrosis, as renal perfusion or hydronephrosis will impact the local elasticity. Renal elastography might be able to diagnose acute or chronic obstruction, or to renal tumor or pseudotumor characterization. Today, renal elastography appears as a promising application that still requires optimization and validation, which is the contrary for liver stiffness assessment. Copyright © 2016 Association Société de néphrologie. Published by Elsevier SAS. All rights reserved.

Dll4 Blockade Potentiates the Anti-Tumor Effects of VEGF Inhibition in Renal Cell Carcinoma Patient-Derived Xenografts

PubMed Central

Miles, Kiersten Marie; Seshadri, Mukund; Ciamporcero, Eric; Adelaiye, Remi; Gillard, Bryan; Sotomayor, Paula; Attwood, Kristopher; Shen, Li; Conroy, Dylan; Kuhnert, Frank; Lalani, Alshad S.; Thurston, Gavin; Pili, Roberto

2014-01-01

Background The Notch ligand Delta-like 4 (Dll4) is highly expressed in vascular endothelium and has been shown to play a pivotal role in regulating tumor angiogenesis. Blockade of the Dll4-Notch pathway in preclinical cancer models has been associated with non-productive angiogenesis and reduced tumor growth. Given the cross-talk between the vascular endothelial growth factor (VEGF) and Delta-Notch pathways in tumor angiogenesis, we examined the activity of a function-blocking Dll4 antibody, REGN1035, alone and in combination with anti-VEGF therapy in renal cell carcinoma (RCC). Methods and Results Severe combined immunodeficiency (SCID) mice bearing patient-derived clear cell RCC xenografts were treated with REGN1035 and in combination with the multi-targeted tyrosine kinase inhibitor sunitinib or the VEGF blocker ziv-aflibercept. Immunohistochemical and immunofluorescent analyses were carried out, as well as magnetic resonance imaging (MRI) examinations pre and 24 hours and 2 weeks post treatment. Single agent treatment with REGN1035 resulted in significant tumor growth inhibition (36–62%) that was equivalent to or exceeded the single agent anti-tumor activity of the VEGF pathway inhibitors sunitinib (38–54%) and ziv-aflibercept (46%). Importantly, combination treatments with REGN1035 plus VEGF inhibitors resulted in enhanced anti-tumor effects (72–80% growth inhibition), including some tumor regression. Magnetic resonance imaging showed a marked decrease in tumor perfusion in all treatment groups. Interestingly, anti-tumor efficacy of the combination of REGN1035 and ziv-aflibercept was also observed in a sunitinib resistant ccRCC model. Conclusions Overall, these findings demonstrate the potent anti-tumor activity of Dll4 blockade in RCC patient-derived tumors and a combination benefit for the simultaneous targeting of the Dll4 and VEGF signaling pathways, highlighting the therapeutic potential of this treatment modality in RCC. PMID:25393540

Renal cell -like carcinoma of the nasal cavity: a case report and review of the literature.

PubMed

Zhenwei-Chen; Zhaoming-Wang; Hongqi-Shi; Qinwei-Liu

2017-10-17

Sinonasal renal cell-like carcinoma (SRCLC) is an extremely rare low malignant tumor arising in the sinonasal tract, with histological mimicry of renal cell carcinoma. We present a case of sinonasal renal cell-like carcinoma in a 63-year-old male patient. Computer tomography(CT) scanning revealed a soft tissue mass at the left nasal cavity and choana. Histologically, the predominant tumor architecture was follicular to glandular with intervening fibrous septa. The tumor cells were uniform cuboidal to polyhedral with abundant clear or eosinophilic cytoplasm. Immunohistochemically, the tumor cells were strongly positive for CK7, EMA, vimentin, SOX10, S-100, and focally positive for CA9. During 6 months of follow-up, there was no clinical or radiological evidence of recurrence or metastasis. SRCLC has microscopic features which overlap with tumors that contain clear cells. Thus, several other tumors must be considered in the differential diagnosis of a tumor of the sinonasal region with clear cells, especially metastatic renal clear cell carcinoma. SRCLC is an indolent tumor and none of the reported SRCLC patients had metastatic disease.

Diagnostic Approach to Eosinophilic Renal Neoplasms

PubMed Central

Kryvenko, Oleksandr N.; Jorda, Merce; Argani, Pedram; Epstein, Jonathan I.

2015-01-01

Context Eosinophilic renal neoplasms include a spectrum of solid and papillary tumors ranging from indolent benign oncocytoma to highly aggressive malignancies. Recognition of the correct nature of the tumor, especially in biopsy specimens, is paramount for patient management. Objective To review the diagnostic approach to eosinophilic renal neoplasms with light microscopy and ancillary techniques. Data Sources Review of the published literature and personal experience. Conclusions The following tumors are in the differential diagnosis of oncocytic renal cell neoplasm: oncocytoma, chromophobe renal cell carcinoma (RCC), hybrid tumor, tubulocystic carcinoma, papillary RCC, clear cell RCC with predominant eosinophilic cell morphology, follicular thyroid-like RCC, hereditary leiomyomatosis–associated RCC, acquired cystic disease–associated RCC, rhabdoid RCC, microphthalmia transcription factor translocation RCC, epithelioid angiomyolipoma, and unclassified RCC. In low-grade nonpapillary eosinophilic neoplasms, distinction between oncocytoma and low-grade RCC mostly rests on histomorphology; however, cytokeratin 7 immunostain may be helpful. In high-grade nonpapillary lesions, there is more of a role for ancillary techniques, including immunohistochemistry for cytokeratin 7, CA9, CD10, racemase, HMB45, and Melan-A. In papillary eosinophilic neoplasms, it is important to distinguish sporadic type 2 papillary RCC from microphthalmia transcription factor translocation and hereditary leiomyomatosis–associated RCC. Histologic and cytologic features along with immunohistochemistry and fluorescence in situ hybridization tests for TFE3 (Xp11.2) and TFEB [t(6;11)] are reliable confirmatory tests. Eosinophilic epithelial neoplasms with architecture, cytology, and/or immunoprofile not qualifying for either of the established types of RCC should be classified as unclassified eosinophilic RCC and arbitrarily assigned a grade (low or high). PMID:25357116

Everolimus and Vatalanib in Treating Patients With Advanced Solid Tumors

ClinicalTrials.gov

2018-01-12

Gastrinoma; Glucagonoma; Insulinoma; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Pheochromocytoma; Pancreatic Polypeptide Tumor; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Melanoma; Recurrent Neuroendocrine Carcinoma of the Skin; Recurrent Non-small Cell Lung Cancer; Recurrent Pheochromocytoma; Recurrent Renal Cell Cancer; Somatostatinoma; Stage III Neuroendocrine Carcinoma of the Skin; Stage IV Melanoma; Stage IV Non-small Cell Lung Cancer; Stage IV Renal Cell Cancer; Thyroid Gland Medullary Carcinoma; Unspecified Adult Solid Tumor, Protocol Specific

Chromophobe Renal Cell Carcinoma is the Most Common Nonclear Renal Cell Carcinoma in Young Women: Results from the SEER Database.

PubMed

Daugherty, Michael; Blakely, Stephen; Shapiro, Oleg; Vourganti, Srinivas; Mollapour, Mehdi; Bratslavsky, Gennady

2016-04-01

The renal cell cancer incidence is relatively low in younger patients, encompassing 3% to 7% of all renal cell cancers. While young patients may have renal tumors due to hereditary syndromes, in some of them sporadic renal cancers develop without any family history or known genetic mutations. Our recent observations from clinical practice have led us to hypothesize that there is a difference in histological distribution in younger patients compared to the older cohort. We queried the SEER (Surveillance, Epidemiology and End Results) 18-registry database for all patients 20 years old or older who were surgically treated for renal cell carcinoma between 2001 and 2008. Patients with unknown race, grade, stage or histology and those with multiple tumors were excluded from study. Four cohorts were created by dividing patients by gender, including 1,202 females and 1,715 males younger than 40 years old, and 18,353 females and 30,891 males 40 years old or older. Chi-square analysis was used to compare histological distributions between the cohorts. While clear cell carcinoma was still the most common renal cell cancer subtype across all genders and ages, chromophobe renal cell cancer was the most predominant type of nonclear renal cell cancer histology in young females, representing 62.3% of all nonclear cell renal cell cancers (p <0.0001). In all other groups papillary renal cell cancer remained the most common type of nonclear renal cell cancer. It is possible that hormonal factors or specific pathway dysregulations predispose chromophobe renal cell cancer to develop in younger women. We hope that this work provides some new observations that could lead to further studies of gender and histology specific renal tumorigenesis. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Telangiectatic oncocytoma: a previously undescribed variant of renal oncocytoma.

PubMed

Xiao, Guang-Qian; Ko, Huai-Bin Mabel; Unger, Pamela

2013-07-01

To identify, describe, and investigate the clinical, radiologic, and pathologic features of 8 cases of telangiectatic oncocytoma. Fifty-three consecutive renal oncocytomas were reviewed for the telangiectatic pathologic features that were subsequently correlated with the demographic, clinical, and radiographic findings. Telangiectatic oncocytoma accounted for 15% of the 53 renal oncocytomas collected in the past 7 years in our institution. On radiology, almost all presented as an enhancing mass and were suspicious for or consistent with a renal malignant tumor. Grossly, the tumors ranged from 2.4 to 6.0 cm (mean, 3.5 cm) and macroscopically were hemorrhagic spongy or multicystic masses without a central stellate scar. Microscopically, they were characterized by variably sized blood-distended spaces (<0.1-mm to 2- to 3-mm blood lakes) lined by typical oncocytoma cells and without evidence of degenerative changes. With its unique radiologic and pathologic presentations in comparison with classic renal oncocytoma, it is important to recognize this new variant of renal oncocytoma.

Partial Nephrectomy Versus Radical Nephrectomy for Clinical T1b and T2 Renal Tumors: A Systematic Review and Meta-analysis of Comparative Studies.

PubMed

Mir, Maria Carmen; Derweesh, Ithaar; Porpiglia, Francesco; Zargar, Homayoun; Mottrie, Alexandre; Autorino, Riccardo

2017-04-01

Partial nephrectomy (PN) is the reference standard of management for a cT1a renal mass. However, its role in the management of larger tumors (cT1b and cT2) is still under scrutiny. To conduct a meta-analysis assessing functional, oncologic, and perioperative outcomes of PN and radical nephrectomy (RN) in the specific case of larger renal tumors (≥cT1b). The primary endpoint was an overall analysis of cT1b and cT2 masses. The secondary endpoint was a sensitivity analysis for cT2 only. A systematic literature review was performed up to December 2015 using multiple search engines to identify eligible comparative studies. A formal meta-analysis was performed for studies comparing PN to RN for both cT1b and cT2 tumors. In addition, a sensitivity analysis including the subgroup of studies comparing PN to RN for cT2 only was conducted. Pooled estimates were calculated using a fixed-effects model if no significant heterogeneity was identified; alternatively, a random-effects model was used when significant heterogeneity was detected. For continuous outcomes, the weighted mean difference (WMD) was used as summary measure. For binary variables, the odds ratio (OR) or risk ratio (RR) was calculated with 95% confidence interval (CI). Statistical analyses were performed using Review Manager 5 (Cochrane Collaboration, Oxford, UK). Overall, 21 case-control studies including 11204 patients (RN 8620; PN 2584) were deemed eligible and included in the analysis. Patients undergoing PN were younger (WMD -2.3 yr; p<0.001) and had smaller masses (WMD -0.65cm; p<0.001). Lower estimated blood loss was found for RN (WMD 102.6ml; p<0.001). There was a higher likelihood of postoperative complications for PN (RR 1.74, 95% CI 1.34-2.2; p<0.001). Pathology revealed a higher rate of malignant histology for the RN group (RR 0.97; p=0.02). PN was associated with better postoperative renal function, as shown by higher postoperative estimated glomerular filtration rate (eGFR; WMD 12.4ml/min; p<0

Renal autotransplantation: current perspectives.

PubMed

Stewart, B H; Banowsky, L H; Hewitt, C B; Straffon, R A

1977-09-01

Autotransplantation, with or without an extracorporeal renal operation, has been done 39 times in 37 patients. Indications for the procedure included several ureteral injury in 4 patients, failed supravesical diversion in 2, renal carcinoma in a solitary kidney in 1, renovascular hypertension in 1 and donor arterial reconstruction before renal transplantation in 29. Success was obtained in all but 2 procedures, both of which involved previously operated kidneys with severe inflammation and adhesions involving the renal pelvis and pedicle. Based on our experience and a review of currently available literature we believe that renal autotransplantation and extracorporeal reconstruction can provide the best solution for patients with severe renovascular and ureteral disease not correctable by conventional operative techniques. The technique can be of particular value in removing centrally located tumors in solitary kidneys and in preparing donor kidneys with abnormal arteries for renal transplantation. The role of autotransplantation in the management of advanced renal trauma and calculus disease is less clear. A long-term comparison of patients treated by extracorporeal nephrolithotomy versus conventional lithotomy techniques will be necessary before a conclusion is reached in these disease categories.

Renal autotransplantation: current perspectives.

PubMed

Stewart, B H; Banowsky, L H; Hewitt, C B; Straffon, R A

1976-01-01

Autotransplantation, with or without an extracorporeal renal operation, has been done 39 times in 37 patients. Indications for the procedure included severe ureteral injury in 4 patients, failed supravesical diversion in 2, renal carcinoma in a solitary kidney in 1, renovascular hypertension in 1 and donor arterial reconstruction before renal transplantation in 29. Success was obtained in all but 2 procedures, both of which involved previously operated kidneys with severe inflammation and adhesions involving the renal pelvis and pedicle. Based on our experience and a review of currently available literature we believe that renal autotransplantation and extracorporeal reconstruction can provide the best solution for patients with severe renovascular and ureteral disease not correctable by conventional operative techniques. The technique can be of particular value in removing centrally located tumors in solitary kidneys and in preparing donor kidneys with abnormal arteries for renal transplantation. The role of autotransplantation in the management of advanced renal trauma and calculus disease is less clear. A long-term comparison of patients treated by extracorporeal nephrolithotomy versus conventional lithotomy techniques will be necessary before a conclusion is reached in these disease categories.

Modern Pathologic Diagnosis of Renal Oncocytoma.

PubMed

Wobker, Sara E; Williamson, Sean R

2017-01-01

Oncocytoma is a well-defined benign renal tumor, with classic gross and histologic features, including a tan or mahogany-colored mass with central scar, microscopic nested architecture, bland cytology, and round, regular nuclei with prominent central nucleoli. As a result of variations in this classic appearance, difficulty in standardizing diagnostic criteria, and entities that mimic oncocytoma, such as eosinophilic variant chromophobe renal cell carcinoma and succinate dehydrogenase-deficient renal cell carcinoma, pathologic diagnosis remains a challenge. This review addresses the current state of pathologic diagnosis of oncocytoma, with emphasis on modern diagnostic markers, areas of controversy, and emerging techniques for less invasive diagnosis, including renal mass biopsy and advanced imaging.

Multi-Quadrant Biopsy Technique Improves Diagnostic Ability in Large Heterogeneous Renal Masses.

PubMed

Abel, E Jason; Heckman, Jennifer E; Hinshaw, Louis; Best, Sara; Lubner, Meghan; Jarrard, David F; Downs, Tracy M; Nakada, Stephen Y; Lee, Fred T; Huang, Wei; Ziemlewicz, Timothy

2015-10-01

Percutaneous biopsy obtained from a single location is prone to sampling error in large heterogeneous renal masses, leading to nondiagnostic results or failure to detect poor prognostic features. We evaluated the accuracy of percutaneous biopsy for large renal masses using a modified multi-quadrant technique vs a standard biopsy technique. Clinical and pathological data for all patients with cT2 or greater renal masses who underwent percutaneous biopsy from 2009 to 2014 were reviewed. The multi-quadrant technique was defined as multiple core biopsies from at least 4 separate solid enhancing areas in the tumor. The incidence of nondiagnostic findings, sarcomatoid features and procedural complications was recorded, and concordance between biopsy specimens and nephrectomy pathology was compared. A total of 122 biopsies were performed for 117 tumors in 116 patients (46 using the standard biopsy technique and 76 using the multi-quadrant technique). Median tumor size was 10 cm (IQR 8-12). Biopsy was nondiagnostic in 5 of 46 (10.9%) standard and 0 of 76 (0%) multi-quadrant biopsies (p=0.007). Renal cell carcinoma was identified in 96 of 115 (82.0%) tumors and nonrenal cell carcinoma tumors were identified in 21 (18.0%). One complication occurred using the standard biopsy technique and no complications were reported using the multi-quadrant technique. Sarcomatoid features were present in 23 of 96 (23.9%) large renal cell carcinomas studied. Sensitivity for identifying sarcomatoid features was higher using the multi-quadrant technique compared to the standard biopsy technique at 13 of 15 (86.7%) vs 2 of 8 (25.0%) (p=0.0062). The multi-quadrant percutaneous biopsy technique increases the ability to identify aggressive pathological features in large renal tumors and decreases nondiagnostic biopsy rates. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Osthole ameliorates renal ischemia-reperfusion injury by inhibiting inflammatory response.

PubMed

Zheng, Yi; Lu, Min; Ma, Lulin; Zhang, Shudong; Qiu, Min; Ma, Xin

2013-01-01

Renal ischemia-reperfusion (I/R) injury is a primary cause of acute renal failure that results in high mortality. This study aimed to investigate the effect of osthole, a natural coumarin derivative, on renal I/R injury in a rat model. Rats were randomly allocated to the sham operation + vehicle, I/R + vehicle, and I/R + osthole groups. Renal I/R injury was induced by clamping the left renal artery for 45 min followed by 12 h of reperfusion and a contralateral nephrectomy. Osthole (40 mg/kg) was intraperitoneally injected 30 min before inducing I/R. Renal function and histological damage were determined subsequently. Myeloperoxidase activity, monocyte/macrophage infiltration, as well as tumor necrosis factor-α, IL-1β, and activated p38 mitogen-activated protein kinase expression in kidneys were also assessed. Osthole treatment significantly ameliorated I/R-induced renal functional and morphological injuries. Moreover, osthole treatment attenuated myeloperoxidase activity, monocyte/macrophage infiltration, and tumor necrosis factor-α, IL-1β, and activated p38 mitogen-activated protein kinase expression in kidneys. Osthole treatment ameliorates renal I/R injury by inhibiting inflammatory responses in kidneys. Thus, osthole may represent a novel practical strategy to prevent renal I/R injury. Copyright © 2013 S. Karger AG, Basel.

[Exceptional etiology of acute renal: Burkitt's lymphoma].

PubMed

Dial, Cherif; Doh, Kwame; Thiam, Ibou; Faye, Mariam; Woto-Gaye, Gisèle

2018-02-05

Burkitt's lymphoma (BL) is an exceptional cause of acute renal failure (ARF). The origin of the tumor clone may be lymphoid follicles secondary to renal Epstein-Barr virus (EBV) infection. With the presentation of this clinical case, the pathogenesis, diagnostic criteria and evolution of this extremely rare affection will be discussed. A 4-year-old patient with a recent history of acute osteomyelitis of the right thigh presented an ARF without indications of post-infectious glomerulonephritis. Ultrasound showed enlarged kidneys without dilation of the excretory cavities. Diffuse interstitial infiltration of atypical lymphoid cells of medium size were noted upon renal biopsy. The tumor cells expressed antibodies against CD20, CD10, Bcl6, and Ki67 but not against Bcl2 or CD3. The search for an EBV infection was positive. A few days after diagnosis, the evolution was spontaneously fatal. BL of the kidney is a rare condition that accounts for less than 1 % of kidney tumors, associated almost invariably with EBV infection. The diagnosis is confirmed histologically by renal biopsy and the criteria of Malbrain affirms the primitive character of the lymphoma. BL of the kidney is a diagnostic and therapeutic emergency and may be fatal. Copyright © 2018 Société francophone de néphrologie, dialyse et transplantation. Published by Elsevier Masson SAS. All rights reserved.

Mapping of Carboxypeptidase M in Normal Human Kidney and Renal Cell Carcinoma

PubMed Central

Denis, Catherine J.; Van Acker, Nathalie; De Schepper, Stefanie; De Bie, Martine; Andries, Luc; Fransen, Erik; Hendriks, Dirk; Kockx, Mark M.

2013-01-01

Although the kidney generally has been regarded as an excellent source of carboxypeptidase M (CPM), little is known about its renal-specific expression level and distribution. This study provides a detailed localization of CPM in healthy and diseased human kidneys. The results indicate a broad distribution of CPM along the renal tubular structures in the healthy kidney. CPM was identified at the parietal epithelium beneath the Bowman’s basement membrane and in glomerular mesangial cells. Capillaries, podocytes, and most interstitial cells were CPM negative. Tumor cells of renal cell carcinoma subtypes lose CPM expression upon dedifferentiation. Tissue microarray analysis demonstrated a correlation between low CPM expression and tumor cell type. CPM staining was intense on phagocytotic tumor-associated macrophages. Immunoreactive CPM was also detected in the tumor-associated vasculature. The absence of CPM in normal renal blood vessels points toward a role for CPM in angiogenesis. Coexistence of CPM and the epidermal growth factor receptor (EGFR) was detected in papillary renal cell carcinoma. However, the different subcellular localization of CPM and EGFR argues against an interaction between these h proteins. The description of the distribution of CPM in human kidney forms the foundation for further study of the (patho)physiological activities of CPM in the kidney. PMID:23172796

[Value of contrast-enhanced ultrasound (CEUS) in the differential diagnosis between benign and malignant renal neoplasms].

PubMed

Zhang, Sheng; Wang, Xiao-qing; Xin, Xiao-jie; Xu, Yong

2013-05-01

To investigate the value of contrast enhanced ultrasound (CEUS) imaging in the differential diagnosis between benign and malignant renal neoplasms. Two hundred and forty-five cases of renal space-occupying lesions confirmed by biopsy or surgical pathology were included in this study. The CEUS features of the renal space-occupying lesions, i.e., the enhancement degree, homogeneity of enhancement, washing-in and washing-out time and enhancement pattern, were retrospectively analyzed. There were 210 cases of malignant renal tumors and 35 cases of benign lesions. The CEUS modes of the malignant renal tumors included "quick in and quick out" 82 cases, "quick in and slow out" 64 cases, "slow in and quick out" 18 cases and "slow in and slow out" 46 cases; good enhancement 150 cases (71.4%) and inhomogeneous enhancement 180 cases (85.7%).Both the contrast agent filling defect area and solid component enhancement of solid-cystic tumors were important features of malignant renal tumors. In the 35 cases of benign lesions,the CEUS modes included "quick in and quick out" 4 cases, "quick in and slow out" 8 cases, "slow in and quick out" 10 cases and "slow in and slow out" 13 cases. Most of the benign tumors showed low enhancement 51.4% (18/35) and inhomogeneous enhancement 54.3% (19/35). There were significant differences between the malignant and benign renal neoplasms in CEUS mode, degree of enhancement and homogeneity of enhancement (P < 0.05), and in time of increasing, peak time, peak intensity and peak intensity ratio (P < 0.05). The accuracy rates of contrast-enhanced ultrasound for diagnosis of benign and malignant tumors were 77.1% and 83.8%, respectively, while the two-dimensional ultrasound diagnosis of benign and malignant tumors were 68.6% and 76.7%, respectively, with a significant difference (P < 0.05). CEUS may provide more information to improve the diagnostic accuracy for renal neoplasms, and may play important role in differential diagnosis between benign and

A Literature Review of Renal Surgical Anatomy and Surgical Strategies for Partial Nephrectomy

PubMed Central

Klatte, Tobias; Ficarra, Vincenzo; Gratzke, Christian; Kaouk, Jihad; Kutikov, Alexander; Macchi, Veronica; Mottrie, Alexandre; Porpiglia, Francesco; Porter, James; Rogers, Craig G.; Russo, Paul; Thompson, R. Houston; Uzzo, Robert G.; Wood, Christopher G.; Gill, Inderbir S.

2016-01-01

Context A detailed understanding of renal surgical anatomy is necessary to optimize preoperative planning and operative technique and provide a basis for improved outcomes. Objective To evaluate the literature regarding pertinent surgical anatomy of the kidney and related structures, nephrometry scoring systems, and current surgical strategies for partial nephrectomy (PN). Evidence acquisition A literature review was conducted. Evidence synthesis Surgical renal anatomy fundamentally impacts PN surgery. The renal artery divides into anterior and posterior divisions, from which approximately five segmental terminal arteries originate. The renal veins are not terminal. Variations in the vascular and lymphatic channels are common; thus, concurrent lymphadenectomy is not routinely indicated during PN for cT1 renal masses in the setting of clinically negative lymph nodes. Renal-protocol contrast-enhanced computed tomography or magnetic resonance imaging is used for standard imaging. Anatomy-based nephrometry scoring systems allow standardized academic reporting of tumor characteristics and predict PN outcomes (complications, remnant function, possibly histology). Anatomy-based novel surgical approaches may reduce ischemic time during PN; these include early unclamping, segmental clamping, tumor-specific clamping (zero ischemia), and unclamped PN. Cancer cure after PN relies on complete resection, which can be achieved by thin margins. Post-PN renal function is impacted by kidney quality, remnant quantity, and ischemia type and duration. Conclusions Surgical renal anatomy underpins imaging, nephrometry scoring systems, and vascular control techniques that reduce global renal ischemia and may impact post-PN function. A contemporary ideal PN excises the tumor with a thin negative margin, delicately secures the tumor bed to maximize vascularized remnant parenchyma, and minimizes global ischemia to the renal remnant with minimal complications. Patient summary In this report

A Literature Review of Renal Surgical Anatomy and Surgical Strategies for Partial Nephrectomy.

PubMed

Klatte, Tobias; Ficarra, Vincenzo; Gratzke, Christian; Kaouk, Jihad; Kutikov, Alexander; Macchi, Veronica; Mottrie, Alexandre; Porpiglia, Francesco; Porter, James; Rogers, Craig G; Russo, Paul; Thompson, R Houston; Uzzo, Robert G; Wood, Christopher G; Gill, Inderbir S

2015-12-01

A detailed understanding of renal surgical anatomy is necessary to optimize preoperative planning and operative technique and provide a basis for improved outcomes. To evaluate the literature regarding pertinent surgical anatomy of the kidney and related structures, nephrometry scoring systems, and current surgical strategies for partial nephrectomy (PN). A literature review was conducted. Surgical renal anatomy fundamentally impacts PN surgery. The renal artery divides into anterior and posterior divisions, from which approximately five segmental terminal arteries originate. The renal veins are not terminal. Variations in the vascular and lymphatic channels are common; thus, concurrent lymphadenectomy is not routinely indicated during PN for cT1 renal masses in the setting of clinically negative lymph nodes. Renal-protocol contrast-enhanced computed tomography or magnetic resonance imaging is used for standard imaging. Anatomy-based nephrometry scoring systems allow standardized academic reporting of tumor characteristics and predict PN outcomes (complications, remnant function, possibly histology). Anatomy-based novel surgical approaches may reduce ischemic time during PN; these include early unclamping, segmental clamping, tumor-specific clamping (zero ischemia), and unclamped PN. Cancer cure after PN relies on complete resection, which can be achieved by thin margins. Post-PN renal function is impacted by kidney quality, remnant quantity, and ischemia type and duration. Surgical renal anatomy underpins imaging, nephrometry scoring systems, and vascular control techniques that reduce global renal ischemia and may impact post-PN function. A contemporary ideal PN excises the tumor with a thin negative margin, delicately secures the tumor bed to maximize vascularized remnant parenchyma, and minimizes global ischemia to the renal remnant with minimal complications. In this report we review renal surgical anatomy. Renal mass imaging allows detailed delineation of the

Liver Metastases From Renal Oncocytoma With Vascular Extension.

PubMed

Cacciamani, Giovanni; Cima, Luca; Ficial, Miriam; Novella, Giovanni; Siracusano, Salvatore; Tedeschi, Umberto; Balzarro, Matteo; Montin, Umberto; Cerruto, Maria A; De Marco, Vincenzo; Porcaro, Antonio B; Hes, Ondrej; DʼErrico, Antonia; Martignoni, Guido; Ghimenton, Claudio; Zaza, Gianluigi; Artibani, Walter; Brunelli, Matteo; Eccher, Albino

2017-07-04

The 2016 World Health Organization Renal Tumor Classification defines renal oncocytoma (RO) as a benign epithelial tumor; however, malignant histopathologic features have been documented. Rare cases with metastases have been reported. We describe the case of a 62-year-old woman who was referred to the Urology Clinic for a routine work-up. Magnetic resonance imaging and computerized tomography showed a 7-cm mass in the middle and lower portions of the left kidney and 2 suspected liver metastases. The patient underwent surgery. Microscopically both renal and liver lesions presented solid, solid-nested, and microcystic architecture, composed predominantly of large eosinophilic cells without any worrisome pattern except the vascular extension. The cells were positive for S100A1, CD117, and PAX-8 and negative for CAIX, CK7, and AMACR. Fluorescence in situ hybridization showed a disomic profile for the chromosomes 1, 2, 6, 7, 10, 17. No mutation of coding sequence of the SDHB, SDHC, SDHD, VHL, and BHD genes and no loss of heterozygosity at 3p were found. The final diagnosis was "RO" according to the 2016 World Health Organization Renal Tumor Classification with "liver metastases." This report provides a wide clinical-pathologic, immunophenotypical and molecular documentation of a RO with liver metastases.

Biomarkers of Renal Tumor Burden and Progression in TSC

DTIC Science & Technology

2013-09-01

found no significant increase in CKD in those TSC patients with cysts versus those with normal renal anatomy , excluding patients with PKD, 8 and...similarly no significant increase in CKD in patients with “undisturbed” AMLs versus those with cysts or normal renal anatomy . Biopsy of AMLs had no...SMDF (NRG1 Isoform), Soggy-1, Sonic Hedgehog (ShhN-terminal), SPARC, Spinesin, TACI (TNFRSF13B), Tarc, TCCR (WSX-1), TECK (CCL25), TFPI, TGF alpha, TGF

Challenges in Pathologic Staging of Renal Cell Carcinoma: A Study of Interobserver Variability Among Urologic Pathologists.

PubMed

Williamson, Sean R; Rao, Priya; Hes, Ondrej; Epstein, Jonathan I; Smith, Steven C; Picken, Maria M; Zhou, Ming; Tretiakova, Maria S; Tickoo, Satish K; Chen, Ying-Bei; Reuter, Victor E; Fleming, Stewart; Maclean, Fiona M; Gupta, Nilesh S; Kuroda, Naoto; Delahunt, Brett; Mehra, Rohit; Przybycin, Christopher G; Cheng, Liang; Eble, John N; Grignon, David J; Moch, Holger; Lopez, Jose I; Kunju, Lakshmi P; Tamboli, Pheroze; Srigley, John R; Amin, Mahul B; Martignoni, Guido; Hirsch, Michelle S; Bonsib, Stephen M; Trpkov, Kiril

2018-06-06

Staging criteria for renal cell carcinoma differ from many other cancers, in that renal tumors are often spherical with subtle, finger-like extensions into veins, renal sinus, or perinephric tissue. We sought to study interobserver agreement in pathologic stage categories for challenging cases. An online survey was circulated to urologic pathologists interested in kidney tumors, yielding 89% response (31/35). Most questions included 1 to 4 images, focusing on: vascular and renal sinus invasion (n=24), perinephric invasion (n=9), and gross pathology/specimen handling (n=17). Responses were collapsed for analysis into positive and negative/equivocal for upstaging. Consensus was regarded as an agreement of 67% (2/3) of participants, which was reached in 20/33 (61%) evaluable scenarios regarding renal sinus, perinephric, or vein invasion, of which 13/33 (39%) had ≥80% consensus. Lack of agreement was especially encountered regarding small tumor protrusions into a possible vascular lumen, close to the tumor leading edge. For gross photographs, most were interpreted as suspicious but requiring histologic confirmation. Most participants (61%) rarely used special stains to evaluate vascular invasion, usually endothelial markers (81%). Most agreed that a spherical mass bulging well beyond the kidney parenchyma into the renal sinus (71%) or perinephric fat (90%) did not necessarily indicate invasion. Interobserver agreement in pathologic staging of renal cancer is relatively good among urologic pathologists interested in kidney tumors, even when selecting cases that test the earliest and borderline thresholds for extrarenal extension. Disagreements remain, however, particularly for tumors with small, finger-like protrusions, closely juxtaposed to the main mass.

Renal cell carcinoma with t(6:11) (p21;q12). A case report highlighting distinctive immunohistologic features of this rare tumor.

PubMed

Arneja, Sarabjeet Kaur; Gujar, Neeraj

2015-01-01

Renal cell carcinoma (RCC) with t(6:11) (p21;q12) are extremely rare, fewer than 30 cases have been reported in literature. These tumors are characterized by specific chromosomal translocation involving TFEB, as against the more commonly known TFE3 (Xp11.2) translocation associated RCCs. The distinctive immnohistologic features are helpful in enabling a diagnosis of this rare tumor, otherwise diagnosed by fluorescence in situ hybridization assay, specific for detecting TFEB gene rearrangement. Herein, we report a case of this rare tumor in a 11 years old boy, with the objective of highlighting distinctive light microscopic and immuno-phenotypic features of this rare sub-type of translocation associated renal cell carcinoma, otherwise diagnosed by fluorescence in situ hybridization technique. Morphologically tumor showed distinctive biphasic population of cells, large epitheloid cells with voluminous eosinophillic cytoplasm and smaller cells with much lesser amount of cytoplasm and small rounded nuclei. The smaller cells at places clustered around hyaline pink material forming "pseudorosettes". population. Immunohistochemically both types of tumor cells showed negativity for pan CK (cytokeratin), EMA (epitheleal membrane antigen) and TFE3 (transcription factor E3). HMB 45 (human melanoma black 45) and Melan- A /MART 1 (melanoma antigen recognized by T cells) were moderate to strongly expressed. On review of literature, most RCCs with t(6;11) translocation have been reported to be negative for pan cytokeratins and EMA. Published literature also shows that the most distinctive immunohistochemical feature of t(6;11) translocation RCC is nuclear staining for TFEB protein. Immunostains for TFE3 have always been negative in the reported cases. It is noteworthy that immunoreactivity for melanocytic markers HMB45 and Melan A and immunonegativity for epithelial markers pan CK and EMA may lead to misdiagnosis of angiomyolipoma to the unwary. Knowledge of distinctive

Microwave treatment of renal cell carcinoma adjacent to renal sinus.

PubMed

Gao, Yongyan; Liang, Ping; Yu, Xiaoling; Yu, Jie; Cheng, Zhigang; Han, Zhiyu; Duan, Shaobo; Huang, Hui

2016-11-01

To evaluate the efficacy and safety of ultrasound (US)-guided percutaneous microwave ablation (MWA) for renal cell carcinoma (RCC) adjacent to renal sinus. This retrospective study included 41 patients who underwent US-guided percutaneous MWA of 41 RCCs adjacent to the renal sinus from April 2006 to December 2015. Contrast-enhanced images of US and computed tomography (CT) or magnetic resonance (MR) imaging were performed at pre-ablation and 1day, 1 month, 3 months, and every 6 months after ablation. Initial ablation success (IAS), disease-free survival (DFS), RCC-related survival (RRS), and overall survival (OS) were recorded at the follow-up visits. IAS was achieved in 92.7% (38/41) of the study subjects. The IAS significantly differed between patients with RCCs ≤4cm (100%, 29/29) and RCCs >4cm (75%, 9/12, p=0.021). During the median follow-up of 37.6 (range, 3.0-97.3) months, the estimated 1-, 3-, and 5-year DFS of patients with an initial tumor of ≤4cm were 100%, 89.7%, and 81.5%, respectively. The 1-, 3-, and 5-year RRS were 100%, 93.3%, and 93.3%, respectively. The 1-, 3-, and 5-year OS were 97.1%, 87.8%, and 83.6%, respectively. The multivariate analysis using the Cox proportional hazard model revealed no independent predictor of recurrence among all the variables. There were no MWA-related deaths among the study subjects. One patient developed a retroperitoneal abscess after ablation. US-guided percutaneous MWA appears to be a promising method for RCCs adjacent to renal sinus, especially for tumors ≤4cm. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Hilar Parenchymal Oversew: a novel technique for robotic partial nephrectomy hilar tumor renorrhaphy.

PubMed

Chavali, Jaya Sai S; Nelson, Ryan; Maurice, Matthew J; Kara, Onder; Mouracade, Pascal; Dagenais, Julien; Reese, Jeremy; Bayona, Pilar; Haber, Georges-Pascal; Stein, Robert J

2018-01-01

A renorrhaphy technique which is effective for hemostasis but does not place undue tension on the branch vessels of the renal sinus remains one of the challenging steps after hilar tumor resection during robotic partial nephrectomy (RPN). The published V-hilar suture (VHS) technique is one option for reconstruction after an RPN involving the hilum. The objective of this video is to show a novel renorrhaphy technique, Hilar Parenchymal Oversew that has been effective for such cases. We present two cases of RPN for renal hilar tumors. The first case depicts use of the VHS renorrhaphy technique for a tumor that abuts the renal hilum along 20% of its diameter. The second case demonstrates tumor resection and reconstruction for a tumor that has >50% involvement of the hilum along its diameter. After tumor resection, individual sinus vessels can be selectively oversewn with 2-0 Vicryl suture on SH needle. The remaining exposed parenchyma is controlled using the Hilar Parenchymal Oversew technique with a #0 Vicryl on CT-1 needle. For the Hilar Parenchymal Oversew surgery operative time was 225 min, estimated blood loss was 140 ml, warm ischemia time was 19 minutes, and there were no intraoperative complications. Pathology was consistent with clear cell renal cancer with negative margins. Robotic partial nephrectomy with the Hilar Parenchymal Oversew technique is a good alternative to VHS renorrhaphy in the management of renal hilar tumors "bulging" into the renal sinus with >50% of the tumor diameter abutting the hilum. Copyright® by the International Brazilian Journal of Urology.

Renal Cell Carcinoma, Unclassified with Medullary Phenotype and Synchronous Renal Clear Cell Carcinoma Present in a Patient with No Sickle Cell Trait/Disease: Diagnostic and Therapeutic Challenges.

PubMed

Lai, Jenny Z; Lai, H Henry; Cao, Dengfeng

2018-06-01

Renal medullary carcinoma (RMC) is an aggressive high-grade renal cell carcinoma (RCC) associated almost exclusively with sickle cell trait or sickle cell disease. However, RCC with RMC features has rarely been reported in patients with no sickle cell trait or disease. Renal cell carcinoma unclassified with medullary phenotype (RCCU-MP) is a newly-coined term used by an international panel of experts to describe renal cell carcinoma showing morphologic and immunohistochemical features of renal medullary carcinoma in patients without sickle cell trait/disease. So far, only one study in the English literature has described five such cases. Here, we report a case with unique clinical and pathological features in a 76-year-old male patient without sickle cell trait. The patient had a history of colon cancer with liver and lung metastases and was found to have a new renal mass in his right kidney during the follow up. A right nephrectomy was performed and showed two separate masses (tumor 1 and tumor 2). Tumor 1 had histologic features of RMC and the tumor cells were positive for CK7, Pax8, and OCT4 and showed loss of nuclear INI1 expression. Tumor 1 was diagnosed as RCCU-MP (6.3 cm, pT3aNx, WHO/ISUP nuclear grade 3). Tumor 2 showed features of clear cell type of RCC (0.6 cm, pT1aNx, WHO/ISUP grade 2) with intact nuclear INI1 expression. Three-months post-nephrectomy, the patient developed lung metastasis of RCCU-MP. To the best of our knowledge, this was the first documented case with synchronous RCCU-MP and clear cell RCC presenting in a patient without sickle cell trait. Careful histologic assessment with a panel of immunohistochemical biomarkers was helpful to render a correct diagnosis for early aggressive treatment. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Renal cell carcinoma primary cultures maintain genomic and phenotypic profile of parental tumor tissues.

PubMed

Cifola, Ingrid; Bianchi, Cristina; Mangano, Eleonora; Bombelli, Silvia; Frascati, Fabio; Fasoli, Ester; Ferrero, Stefano; Di Stefano, Vitalba; Zipeto, Maria A; Magni, Fulvio; Signorini, Stefano; Battaglia, Cristina; Perego, Roberto A

2011-06-13

Clear cell renal cell carcinoma (ccRCC) is characterized by recurrent copy number alterations (CNAs) and loss of heterozygosity (LOH), which may have potential diagnostic and prognostic applications. Here, we explored whether ccRCC primary cultures, established from surgical tumor specimens, maintain the DNA profile of parental tumor tissues allowing a more confident CNAs and LOH discrimination with respect to the original tissues. We established a collection of 9 phenotypically well-characterized ccRCC primary cell cultures. Using the Affymetrix SNP array technology, we performed the genome-wide copy number (CN) profiling of both cultures and corresponding tumor tissues. Global concordance for each culture/tissue pair was assayed evaluating the correlations between whole-genome CN profiles and SNP allelic calls. CN analysis was performed using the two CNAG v3.0 and Partek software, and comparing results returned by two different algorithms (Hidden Markov Model and Genomic Segmentation). A very good overlap between the CNAs of each culture and corresponding tissue was observed. The finding, reinforced by high whole-genome CN correlations and SNP call concordances, provided evidence that each culture was derived from its corresponding tissue and maintained the genomic alterations of parental tumor. In addition, primary culture DNA profile remained stable for at least 3 weeks, till to third passage. These cultures showed a greater cell homogeneity and enrichment in tumor component than original tissues, thus enabling a better discrimination of CNAs and LOH. Especially for hemizygous deletions, primary cultures presented more evident CN losses, typically accompanied by LOH; differently, in original tissues the intensity of these deletions was weaken by normal cell contamination and LOH calls were missed. ccRCC primary cultures are a reliable in vitro model, well-reproducing original tumor genetics and phenotype, potentially useful for future functional approaches

USE OF THE SPONTANEOUS TSC2 KNOCKOUT (EKER) RAT MODEL OF HEREDITARY RENAL CELL CARCINOMA FOR THE STUDY OF RENAL CARCINOGENS

EPA Science Inventory

The kidney is a frequent site for chemically induced cancers in rodents and among the ten most frequent sites for cancer in human patients. Renal cell carcinoma (RCC) is the most frequent upper urinary tract cancer in humans and accounts for 80-85% of malignant renal tumors. He...

Renal hemangiopericytoma secondary to refractory hypertension in a child: A case report.

PubMed

Hu, Qingfeng; Fang, Zujun; Zhou, Zhongwen; Zheng, Jie

2014-12-01

Hemangiopericytoma is a rare perivascular tumor that often involves the extremities, pelvis, head and neck, and meninges, but rarely occurs in the kidney. The differentiation from renal cancer prior to surgery is extremely challenging; therefore, almost all cases of renal hemangiopericytoma are diagnosed by pathological examination. The majority of cases are identified in patients between the ages of 20 and 50 years of age, and a considerable proportion of patients exhibit hypertension, hypoglycaemia or additional paraneoplastic syndromes. The current study reports a rare case of renal hemangiopericytoma with drug refractory hypertension in a 14-year-old female. Following the complete resection of the tumor, the patient's blood pressure returned to normal. No evidence of recurrence or metastasis was observed during a follow-up of 12 months following surgery. The present case indicated that surgery provides satisfactory outcomes and appears to be the most effective modality of treatment for renal hemangiopericytoma. Furthermore, this case also demonstrated that secondary hypertension may also recover following tumor excision.

Auto Transplant for High Risk or Relapsed Solid or CNS Tumors

ClinicalTrials.gov

2018-04-24

Ewing's Family Tumors; Renal Tumors; Hepatoblastoma; Rhabdomyosarcoma; Soft Tissue Sarcoma; Primary Malignant Brain Neoplasms; Retinoblastoma; Medulloblastoma; Supra-tentorial Primative Neuro-Ectodermal Tumor (PNET); Atypical Teratoid/Rhabdoid Tumor (AT/RT); CNS Tumors; Germ Cell Tumors

Renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions: findings on MRI and computed tomography imaging.

PubMed

Liu, Kefu; Xie, Ping; Peng, Weijun; Zhou, Zhengrong

2014-08-01

To retrospectively analyze MRI and computed tomographic (CT) findings from renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions (Xp11-RCC). Institutional review board permission was obtained to review patient medical records, and the requirement for informed consent was waved . The clinical and MRI/CT features of five cases with Xp11-RCC that were confirmed by pathology were analyzed retrospectively. The image characteristics included the lesion location and size, contribution of cystic and solid components, intratumoral necrosis or hemorrhage, invasion of perinephric tissue and renal sinus, lymphadenopathy, major venous or arterial vascular invasion, pattern of the tumor growth, intratumor calcification and lipids, homogeneity of SI on T2-weighted images, attenuation and SI of the mass with respect to the normal renal cortex on precontrast and contrasted CT/MRI images, tumor SIs, tumor attenuations and tumor-to-cortex indices, homogeneity of enhancement on the contrasted images. The mean age was 32 years (range, 15-47 years). Most patients (4/5) were women. All tumors showed a cortical location. The average tumor size was 9 cm (range, 4-18 cm). Four tumors comprised a predominantly solid lesion with focal necrosis, and one tumor comprised a solid lesion with significant necrosis. All tumors showed intertumor hemorrhage, infiltrative growth and invasion of the perirenal adipose/renal sinus. Four cases showed retroperitoneal lymphadenopathy, of which one case showed simultaneous mediastinal and supraclavicular lymphadenopathy. All tumors from four cases showed mild hyperintensity on T1-weighted MRI images, and three tumors showed hypointensity on T2-weighted MRI images relative to the renal cortex except for 1 tumor that showed significant hemorrhage and a relative hyperintensity. For 3 cases who were imaged with CT, two tumors imaged using nonenhanced CT images showed mild hyperdensity relative to the renal cortex. Calcification was noted in all

Pío del Río-Hortega: A Visionary in the Pathology of Central Nervous System Tumors

PubMed Central

Ramon y Cajal Agüeras, Santiago

2016-01-01

The last 140 years have seen considerable advances in knowledge of central nervous system tumors. However, the main tumor types had already been described during the early years of the twentieth century. The studies of Dr. Pío del Río Hortega have been ones of the most exhaustive histology and cytology-based studies of nervous system tumors. Río Hortega's work was performed using silver staining methods, which require a high level of practical skill and were therefore difficult to standardize. His technical aptitude and interest in nervous system tumors played a key role in the establishment of his classification, which was based on cell lineage and embryonic development. Río Hortega's approach was controversial when he proposed it. Current classifications are not only based on cell type and embryonic lineage, as well as on clinical characteristics, anatomical site, and age. PMID:26973470

Renal cancer and pregnancy in two different female cohorts.

PubMed

Mydlo, Jack H; Chawla, Sameer; Dorn, Spencer; Volpe, Michael A; Shah, Sovrin; Imperato, Pascal J

2002-10-01

Although human renal cell carcinoma (RCC) is considered refractive to hormone therapy, this lesion can be induced in the Syrian hamster by exogenous estrogen. Human RCC also has been demonstrated to contain estrogen receptors. Since there are significant changes of estrogen levels during pregnancy, we wanted to investigate if there were any associations between the hormonal variations of pregnancy and renal cancer in women using two distinct cohorts. We reviewed the charts of 57 females who presented for treatment of renal cancer. We assessed the size of each tumor radiologically and pathologically, the tumor stage, the number of pregnancies and/or abortions/miscarriages, age at menarche, and use of oral contraceptives. We compared this cohort to a sample of 985 nuns, and then reviewed the literature on the association of pregnancy, contraceptives and renal cell carcinoma. We used analysis of multiple variables (ANOVA) and the student's t test to determine any significance (p<0.05). Our age range was 39 to 67 years, with a mean of 51. The tumor volumes ranged from 9 cm(3) to 1500 cm(3), and the number of pregnancies ranged from 1 to 14. Menarche ranged from 8 to 14. We did not find any significant correlation between menarche or the number of pregnancies and the size or stage of renal cancers. However, our nun population did not reveal any incidence or illness from renal cell carcinoma over a 20 year review. Although our first cohort did not demonstrate any significant associations between the number of pregnancies or age at menarche and RCC, our second cohort and a review of the literature supports the notion that pregnancy is a risk factor for renal cell carcinoma.

Acute lymphoblastic leukemia mimicking Wilms tumor at presentation.

PubMed

Singh, Amitabh; Mandal, Anirban; Guru, Vijay; Seth, Rachna

2016-09-01

Acute lymphoblastic leukemia (ALL), the commonest malignancy of childhood, is known to manifest with a myriad of atypical presentations. Nephromegaly is a rare presentation of childhood ALL with hepatic mass being even rarer. We present a 3 year-old child with unilateral renal mass and hepatic mass lesion with normal blood counts, initially suspected to have metastatic Wilms tumor based on clinical, radiological and WT1 positivity on immunocytochemistry of renal mass. He was later diagnosed as ALL with peripheral blood flowcytometry and bone marrow examination. Renomegaly at presentation of acute leukemia is not necessarily due to leukemic infiltration and rarely leads to renal impairment. The radiological differential of such a renal mass includes both benign and malignant entities including metastasis. Over-expression of WT1 mRNA has been found in a number of solid tumors and hematological malignancies and is far from being diagnostic of Wilms tumor. Again, a small number of children with acute leukemia may have a deceptively normal complete blood count at presentation. Though, initial all (clinical, radiological, hematological, and immunocytological) parameters pointed towards a diagnosis of Wilms tumor in our case, the subsequent development of thrombocytopenia and lymphocytic leukocytosis prompted further investigation and final diagnosis of ALL. WT1 positivity is a known phenomenon in childhood ALL and undifferentiated lymphoblasts may be positive for WT1 and negative for Leucocyte common antigen. Acute leukemia with renal and hepatic mass with normal blood counts at presentation is a diagnostic challenge.

Acid, basic, and neutral peptidases present different profiles in chromophobe renal cell carcinoma and in oncocytoma.

PubMed

Blanco, Lorena; Larrinaga, Gorka; Pérez, Itxaro; López, José I; Gil, Javier; Agirregoitia, Ekaitz; Varona, Adolfo

2008-04-01

Renal cell carcinomas (RCCs) are neoplasias with high prevalence and mortality. We previously reported that several peptidases may be involved in the pathophysiology of clear cell renal cell carcinoma (CCRCC). Now, to gain insight into the reasons that lead the various RCC types to behave very differently with regard to aggressiveness and response to anticancer treatments, we analyzed subsets of chromophobe renal cell carcinoma (ChRCC), and renal oncocytoma (RO), a benign tumor; as well as different grades and stages of CCRCCs. Particulate APN, APB, and APA activities were decreased in both ChRCC and RO (tumor vs. nontumor tissues). Interestingly, activities were downregulated in a tumor-type specific way and the intensities of the decreases were stronger in the benign tumor than in the malignant type. Moreover, when two key histopathological parameters for tumor prognosis (high vs. low stage and grade) were analyzed, increases of activity were also observed in several of these cell surface peptidases (APN, APB). Some soluble activities (APB, Asp-AP) were also downregulated in the RCCs. With respect to genetic expression, PSA and APN were in a positive correlation related to their activities in both ChRCC and RO; but not APB, Asp-AP, APA, and PGI. These results may suggest an involvement of several peptidases in the pathophysiology of renal cancer, since they presented different patterns of activity and expression in tumors with different behaviors.

Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.

PubMed

Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L

2010-01-01

Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.

Percutaneous Microwave Ablation of Renal Angiomyolipomas.

PubMed

Cristescu, Mircea; Abel, E Jason; Wells, Shane; Ziemlewicz, Timothy J; Hedican, Sean P; Lubner, Megan G; Hinshaw, J Louis; Brace, Christopher L; Lee, Fred T

2016-03-01

To evaluate the safety and efficacy of US-guided percutaneous microwave (MW) ablation in the treatment of renal angiomyolipoma (AML). From January 2011 to April 2014, seven patients (5 females and 2 males; mean age 51.4) with 11 renal AMLs (9 sporadic type and 2 tuberous sclerosis associated) with a mean size of 3.4 ± 0.7 cm (range 2.4-4.9 cm) were treated with high-powered, gas-cooled percutaneous MW ablation under US guidance. Tumoral diameter, volume, and CT/MR enhancement were measured on pre-treatment, immediate post-ablation, and delayed post-ablation imaging. Clinical symptoms and creatinine were assessed on follow-up visits. All ablations were technically successful and no major complications were encountered. Mean ablation parameters were ablation power of 65 W (range 60-70 W), using 456 mL of hydrodissection fluid per patient, over 4.7 min (range 3-8 min). Immediate post-ablation imaging demonstrated mean tumor diameter and volume decreases of 1.8% (3.4-3.3 cm) and 1.7% (27.5-26.3 cm(3)), respectively. Delayed imaging follow-up obtained at a mean interval of 23.1 months (median 17.6; range 9-47) demonstrated mean tumor diameter and volume decreases of 29% (3.4-2.4 cm) and 47% (27.5-12.1 cm(3)), respectively. Tumoral enhancement decreased on immediate post-procedure and delayed imaging by CT/MR parameters, indicating decreased tumor vascularity. No patients required additional intervention and no patients experienced spontaneous bleeding post-ablation. Our early experience with high-powered, gas-cooled percutaneous MW ablation demonstrates it to be a safe and effective modality to devascularize and decrease the size of renal AMLs.

Magnetic resonance imaging (MRI) of the renal sinus.

PubMed

Krishna, Satheesh; Schieda, Nicola; Flood, Trevor A; Shanbhogue, Alampady Krishna; Ramanathan, Subramaniyan; Siegelman, Evan

2018-04-09

This article presents methods to improve MR imaging approach of disorders of the renal sinus which are relatively uncommon and can be technically challenging. Multi-planar Single-shot T2-weighted (T2W) Fast Spin-Echo sequences are recommended to optimally assess anatomic relations of disease. Multi-planar 3D-T1W Gradient Recalled Echo imaging before and after Gadolinium administration depicts the presence and type of enhancement and relation to arterial, venous, and collecting system structures. To improve urographic phase MRI, concentrated Gadolinium in the collecting systems should be diluted. Diffusion-Weighted Imaging (DWI) should be performed before Gadolinium administration to minimize T2* effects. Renal sinus cysts are common but can occasionally be confused for dilated collecting system or calyceal diverticula, with the latter communicating with the collecting system and filling on urographic phase imaging. Vascular lesions (e.g., aneurysm, fistulas) may mimic cystic (or solid) lesions on non-enhanced MRI but can be suspected by noting similar signal intensity to the blood pool and diagnosis can be confirmed with MR angiogram/venogram. Multilocular cystic nephroma commonly extends to the renal sinus, however, to date are indistinguishable from cystic renal cell carcinoma (RCC). Solid hilar tumors are most commonly RCC and urothelial cell carcinoma (UCC). Hilar RCC are heterogeneous, hypervascular with epicenter in the renal cortex compared to UCC which are centered in the collecting system, homogeneously hypovascular, and show profound restricted diffusion. Diagnosis of renal sinus invasion in RCC is critically important as it is the most common imaging cause of pre-operative under-staging of disease. Fat is a normal component of the renal sinus; however, amount of sinus fat correlates with cardiovascular disease and is also seen in lipomatosis. Fat-containing hilar lesions include lipomas, angiomyolipomas, and less commonly other tumors which engulf sinus

Bilateral renal oncocytoma in a Greyhound dog.

PubMed

Buergelt, C D; Adjiri-Awere, A

2000-03-01

A bilateral, locally invasive renal oncocytoma was diagnosed in a 10-year-old spayed female Greyhound dog. The diagnosis was based on positive staining of the tumor with the periodic acid-Schiff reaction prior to diastase treatment, on the immunohistochemical expression of cytoplasmic cytokeratin, and on the prominence of mitochondria in the tumor cells.

Rapidly progressing renal cell carcinoma associated with Xp11.2 translocations: a case report

PubMed Central

2012-01-01

Introduction Renal cell carcinoma associated with Xp11.2 translocations is frequently reported in children, but adult-onset is rare. Here, the case of an adult male who developed a renal cell carcinoma associated with Xp11.2 translocations is presented. Case presentation A 38-year-old Asian man presented with left back pain and macroscopic hematuria. Computed tomography revealed a left renal tumor (T3N2M0), and a left radical nephrectomy was performed. Hematoxylin-eosin staining revealed papillary architecture and clear or eosinophilic cytoplasm, and the diagnosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion was made by the immunohistochemical determination of transcription factor E3 protein. In spite of adjuvant therapy with α-interferon, a recurrent tumor was found in his left lung by computed tomography three months after the nephrectomy. Interleukin-2, tyrosine kinase inhibitors and mammalian target of rapamycin inhibitors showed no effect on tumor progression. Conclusions Renal cell carcinomas associated with Xp11.2 translocations have an aggressive clinical course in adults. Strict diagnosis using the immunohistochemistry of transcription factor E3 protein is important to predict the prognosis of such patients and new strategies need to be determined to treat patients with these tumors PMID:22738297

Rapidly progressing renal cell carcinoma associated with Xp11.2 translocations: a case report.

PubMed

Morii, Akihiro; Fujiuchi, Yasuyoshi; Nomoto, Kazuhiro; Komiya, Akira; Fuse, Hideki

2012-06-27

Renal cell carcinoma associated with Xp11.2 translocations is frequently reported in children, but adult-onset is rare. Here, the case of an adult male who developed a renal cell carcinoma associated with Xp11.2 translocations is presented. A 38-year-old Asian man presented with left back pain and macroscopic hematuria. Computed tomography revealed a left renal tumor (T3N2M0), and a left radical nephrectomy was performed. Hematoxylin-eosin staining revealed papillary architecture and clear or eosinophilic cytoplasm, and the diagnosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion was made by the immunohistochemical determination of transcription factor E3 protein. In spite of adjuvant therapy with α-interferon, a recurrent tumor was found in his left lung by computed tomography three months after the nephrectomy. Interleukin-2, tyrosine kinase inhibitors and mammalian target of rapamycin inhibitors showed no effect on tumor progression. Renal cell carcinomas associated with Xp11.2 translocations have an aggressive clinical course in adults. Strict diagnosis using the immunohistochemistry of transcription factor E3 protein is important to predict the prognosis of such patients and new strategies need to be determined to treat patients with these tumors.

Xp11.2 translocation renal cell carcinoma with egg-shell calcification mimicking a benign renal tumour: A case report.

PubMed

Liang, Wenjie; Xu, Shunliang

2015-11-01

The present study reports the case of a 20-year-old female who was identified to have a left renal angiomyolipoma (AML) with hemorrhage. Following temporary conservative observation, the patient received continuous ultrasonic follow-up. Due to the rapid growth of the lesion, further examinations were performed. Computed tomography (CT) plain scans revealed a partly high-density mass with marginal egg-shell calcification. Enhanced CT revealed a solid tumor with a rich blood supply. Since no fats were detected, the possibility of a typical AML was excluded, but the diagnoses of epithelioid AML or renal cancer were considered. Finally, the left kidney was partially excised laparoscopically. The intraoperative frozen section indicated a diagnosis of renal cell carcinoma (RCC). The left kidney was subsequently radically excised. Routine histopathological and immunohistochemical tests confirmed that the lesion was an RCC with an Xp11.2 translocation. The present study introduces the pitfalls in the diagnosis of Xp11.2 translocation RCC, which is a rare RCC subtype accompanied with uncommon imaging manifestations. The study suggests that when a rapidly-growing AML is detected by ultrasound, renal cancer with marginal calcification should be considered. Moreover, although egg-shell calcification mostly occurs in benign renal lesions, further examinations, such as enhanced CT, are recommended for identifying the nature of the masses and excluding the possibility of malignant tumors.

Xp11.2 translocation renal cell carcinoma with egg-shell calcification mimicking a benign renal tumour: A case report

PubMed Central

LIANG, WENJIE; XU, SHUNLIANG

2015-01-01

The present study reports the case of a 20-year-old female who was identified to have a left renal angiomyolipoma (AML) with hemorrhage. Following temporary conservative observation, the patient received continuous ultrasonic follow-up. Due to the rapid growth of the lesion, further examinations were performed. Computed tomography (CT) plain scans revealed a partly high-density mass with marginal egg-shell calcification. Enhanced CT revealed a solid tumor with a rich blood supply. Since no fats were detected, the possibility of a typical AML was excluded, but the diagnoses of epithelioid AML or renal cancer were considered. Finally, the left kidney was partially excised laparoscopically. The intraoperative frozen section indicated a diagnosis of renal cell carcinoma (RCC). The left kidney was subsequently radically excised. Routine histopathological and immunohistochemical tests confirmed that the lesion was an RCC with an Xp11.2 translocation. The present study introduces the pitfalls in the diagnosis of Xp11.2 translocation RCC, which is a rare RCC subtype accompanied with uncommon imaging manifestations. The study suggests that when a rapidly-growing AML is detected by ultrasound, renal cancer with marginal calcification should be considered. Moreover, although egg-shell calcification mostly occurs in benign renal lesions, further examinations, such as enhanced CT, are recommended for identifying the nature of the masses and excluding the possibility of malignant tumors. PMID:26722310

Paraneoplastic Cushing Syndrome Due To Wilm's Tumor.

PubMed

Faizan, Mahwish; Manzoor, Jaida; Saleem, Muhammad; Anwar, Saadia; Mehmood, Qaiser; Hameed, Ambreen; Ali, Agha Shabbir

2017-05-01

Paraneoplastic syndromes are rare disorders that are triggered by an altered immune system response to neoplasm. Paraneoplastic syndromes may be the first or the most prominent manifestations of cancer. Wilm's tumor is the most frequent pediatric renal malignancy and usually presents with abdominal mass. Unusual presentations like acquired von Willebrand disease, sudden death due to pulmonary embolism and Cushing syndrome have been described in the literature. Cushing syndrome, as the presenting symptom of a malignant renal tumor in children, is a very rare entity. Few case reports are available in the literature exploring the option of preoperative chemotherapy as well as upfront nephrectomy. We report a rare case of paraneoplastic Cushing syndrome due to a Wilm's tumor. Based on gradual decrease of postoperative weight, blood pressure, serum adrenocorticotropic hormone, and plasma cortisol levels, along with histological confirmation of Wilm's tumor, paraneoplastic Cushing syndrome due to Wilm's tumor was confirmed.

Technical difficulties in retro-peritoneoscopic radical nephrectomy. Is tumor location important?

PubMed

Lucan, M; Lucan, V; Ghervan, L; Elec, F; Iacob, G; Barbos, A

2007-01-01

Tumor location on the posterior aspect of the kidney or close to the renal hilum could increase the difficulty of the retro-peritoneoscopic radical nephrectomy. The aim of our study was to assess how tumor location influences the difficulty of the retro-peritoneoscopic radical nephrectomy. We performed a nonrandomized prospective study in 116 patients with localized renal cell carcinoma who underwent RRN, between Jan. 2000 and Jan. 2005. Twenty-nine patients with a tumor located close to the renal hilum or on the posterior aspect of the kidney (Gr.A) were compared with 87 patients with a tumor at a distance from the renal hilum (Gr.B) in terms of operative time, intraoperative blood loss, and difficulty of the dissection. The difficulty of the dissection was subjectively estimated by the main surgeon using a three degree scale (G1-easy, G2-medium, and G3-difficult). All the operations were finalized by retro-peritoneoscopy and G4-very difficult degree--was not recorded. In the Gr. A, the operative time was longer (117.28 min vs. 94.63 min, p < 0.001) and blood loss was higher (291.86 ml vs. 199.54 ml, p < 0.001). The dissection of the renal pedicle was also more difficult in the Gr. A either for artery dissection (G3 27.59% vs. 11.49%, p = 0.0202) or for vein dissection (G3 20.69% vs. 8.05%, p = 0.0321), while peri-fascial dissection was less frequently difficult (G3 10.34% vs. 28.74%, p = 0.0237). Tumor location close to the renal hilum or on the posterior aspect of the kidney increases the difficulty of renal pedicle dissection.

An Xp11.2 translocation renal cell carcinoma with SMARCB1 (INI1) inactivation in adult end-stage renal disease: a case report.

PubMed

Yu, Lu; Li, Jun; Xu, Sanpeng; Navia Miranda, Mariajose; Wang, Guoping; Duan, Yaqi

2016-10-12

Xp11.2 translocation/transcription factor E3 (TFE3) rearrangement renal cell carcinoma (RCC) is a rare subtype of RCC with limited clinical and pathological data. Here we present an unusual high-grade Xp11.2 translocation RCC with a rhabdoid feature and SMARCB1 (INI1) inactivation in a 40-year-old man with end-stage kidney disease. The histological examination of the dissected left renal tumor showed an organoid architecture of the eosinophilic or clear neoplastic cells with necrosis and high mitotic activity. In some areas, non-adhesive tumor cells with eccentric nuclei were observed. Immunohistochemically (IHC), the tumor cells are positive for TFE3 and the renal tubular markers (PAX2 and PAX8), and completely negative for SMARCB1, an oncosuppressor protein. Break-apart florescence in situ hybridization and reverse transcription polymerase chain reaction confirmed TFE3 rearrangement on Xp11.2 and the presence of ASPSCR1-TFE3 fusion gene. DNA sequencing revealed a frameshift mutation in exon 4 of SMARCB1 gene. It is important to recognize this rare RCC with both TFE3 rearrangement and SMARCB1 inactivation, as the prognosis and therapeutic strategies, particularly targeted therapies for such tumors, might be different.

Localized chromophobe renal cell carcinoma: preoperative imaging judgment and laparoscopic simple enucleation for treatment.

PubMed

Ren, Wenbiao; Xue, Bichen; Qu, Jiandong; Liu, Longfei; Li, Chao; Zu, Xiongbing

2018-04-30

To evaluate the preoperative imaging manifestation and therapeutic effect of laparoscopic simple enucleation (SE) for localized chromophobe renal cell carcinoma (chRCC). Clinical data of 36 patients who underwent laparoscopic SE of localized chRCC at our institute were retrospectively analyzed. All patients underwent preoperative renal protocol CT (unenhanced, arterial, venous, and delayed images). CT scan characteristics were evaluated. After intraoperative occlusion of the renal artery, the tumor was free bluntly along the pseudocapsule and enucleated totally. The patients were followed up regularly after the operation. Mean tumor diameter was 3.9±1.0 cm, 80% of tumors were homogeneous and all the tumors had complete pseudocapsule. The attenuation values were slightly lower than normal renal cortex and degree of enhancement of the tumors were significantly lower than normal renal cortex. Mean operation time was 104.3±18.2 min. Mean warm ischemia time (WIT) was 21.3±3.5 min. Mean blood loss was 78.6±25.4 mL. No positive surgical margin was identified. Mean postoperative hospital stay was 5.3±1.5 d. Hematuria occurred in 3 patients and all disappeared within 3 days. After a mean follow-up of 32.1±20.6 months, no patient had local recurrence or metastatic progression. Localized chRCCs have a great propensity for homogeneity and complete pseudocapsule. The attenuation values were slightly lower than normal renal cortex and small degree of enhancement. Laparoscopic SE is a safe and effective treatment for localized chRCC. The oncological results were satisfactory. Copyright® by the International Brazilian Journal of Urology.

Renal oncocytoma with invasive histopathologic features -  case report.

PubMed

Kolníková, G; Marinová, P; Gál, V; Mečiarová, I; Mišanko, V; Rampalová, J; Jáni, P; Orthová, S; Ondriaš, F; Caňo, M

2014-01-01

Renal oncocytoma is an uncommon tumor, classified as a benign renal neoplasm in the World Health Organisation classification of renal tumours. Despite it there were described several reports with invasive histopathologic features. We describe a case of renal oncocytoma with bizzare cells and invasion of renal sinus fat tissue. We performed immunohistochemical analysis of the case and a review of relevant literature. In order to set up the right dia-gnosis the perfect co- operation of clinicians and pathologists is necessary. In our opinion, in accordance with other authors, the renal oncocytomas should be considered as having a very low rather than no malignant potential, in spite of clinically benign behavior, supplementing a hypothesis, whether renal oncocytomas may be considered as a precancerous lesion of chromophobe carcinoma.

Xp11.2 translocation tumor: a rare cause of gross hematuria.

PubMed

Asaki, Howard E; Moshero, Gianni; Stanton, Melissa L; Humphreys, Mitchell R

2014-02-01

Xp11.2 translocation tumor is a rare but aggressive form of renal cell carcinoma that predominantly occurs in children but also may be found in young adults. Because this type of cancer is diagnosed via histologic and chromosomal analysis, clinicians should consider translocation tumor in the differential diagnosis of patients with renal lesions and gross hematuria.

[Renal angiomyolipoma rupture as a cause of lumbar pain: report of one case].

PubMed

Cifuentes, Melissa; Calleja, Félix; Hola, José; Daviú, Antonio; Jara, Danilo; Vallejos, Humberto

2008-08-01

Renal angiomyolipoma is a benign tumor formed by smooth muscle, adipose tissue and blood vessels. It is commonly found incidentally and its clinical manifestations are pain and abdominal mass or spontaneous tumor rupture with retroperitoneal bleeding. The clinical presentation of a hemorrhagic shock secondary to a retroperitoneal hematoma is uncommon. We report a 40 year-old male who presented to the emergency room with lumbar pain and deterioration of hemodynamic parameters. The CT scan showed a left renal injury associated to an expansive retroperitoneal process. The abdominal exploration, vascular control of the renal pedicle and nephrectomy allowed a successful outcome.

Von Hippel–Lindau and myotonic dystrophy of Steinert along with pancreatic neuroendocrine tumor and renal clear cell carcinomal neoplasm: Case report and review of the literature

PubMed Central

Addeo, A.; Bini, R.; Viora, T.; Bonaccorsi, L.; Leli, R.

2013-01-01

INTRODUCTION Myotonic dystrophy of Steinert, DM1, is the most common adult muscular dystrophy and generally is not associated to development on multiple site neoplasm. Von Hippel-Lindau (VHL) disease is a dominantly inherited familial cancer syndrome that is associated to tumors such as hemangioblastoma of the retina or central nervous system, clear-cell renal carcinoma (RCC) and endocrine tumors, most commonly pheochromocytoma and non-secretory pancreatic islet cell cancers. No data exist in literature describing the coexistence of both DM1 and VHL. PRESENTATION OF CASE Herein we report a case of renal and pancreatic neoplasm in a young adult female affected by DM1 and VHL simultaneously. DISCUSSION DM1 is due to an unstable trinucleotide (CTG) expansion in the 30 antranslated region of the dystrophia myotonica-protein kinase (DMPK) gene, located on chromosome 19q13.3. Several molecular mechanisms thought to be determining the classical DM phenotype have been shown. VHL disease is characterized by marked phenotypic variability and the most common tumors are hemangioblastomas of the retina or central nervous system, clear-cell renal carcinoma (RCC) and endocrine tumors, most commonly pheochromocytoma and non-secretory pancreatic islet cell cancers. The pancreatic manifestations seen in patients with VHL disease are divided into 2 categories: pancreatic neuroendocrine tumor (PNET) as solid tumors, and cystic lesions, including a simple cyst and serous cystadenoma. The surgical approach for these cistic lesions is to consider as golden standard. Blansfield has proposed 3 criteria to predict metastatic disease of PNET in patients with VHL disease: (1) tumor size greater than or equal to 3 cm; (2) presence of a mutation in exon 3; and (3) tumor doubling time less than 500 d. If the patient has none of these criteria the patient could be followed with physical examination and radiological surveillance on a 2/3 years base.4 If the patient has 1 criterion, the patient

Renal Lymphoma: Primary or First Manifestation of Aggressive Pediatric B-cell Lymphoma.

PubMed

Coca, Pragnya; Linga, Vijay Gandhi; Gundeti, Sadashivudu; Tandon, Ashwani

2017-01-01

Renal lymphoma is an uncommon renal tumor in children. Unlike renal lymphomas presenting as bilateral disease and renal failure, we report a boy who presented with unilateral renal involvement. After initial nephrectomy, he achieved remission with multiagent chemotherapy but relapsed systemically within 3 months. He was initiated on salvage chemotherapy with autologous bone marrow transplant. Even though the initial manifestation was localized lymphoma eventually, it turned out to be a systemic disease. He succumbed to disease at 14 months from diagnosis.

Laparoscopic partial nephrectomy for endophytic hilar tumors: feasibility and outcomes.

PubMed

Di Pierro, G B; Tartaglia, N; Aresu, L; Polara, A; Cielo, A; Cristini, C; Grande, P; Gentile, V; Grosso, G

2014-06-01

To analyze feasibility and outcomes of laparoscopic partial nephrectomy (LPN) for endophytic hilar tumors in low-intermediate (ASA I-II) risk patients. This is a single centre retrospective study. From May 2009 to September 2011, 208 LPNs were performed at our institution. Overall 11 (5.2%) elective LPNs were for hilar tumors not visible on kidney surface. Hilar tumor was defined as a mass located in the renal hilum and in contact with a major renal vessel on preoperative imaging. Procedures were carried out by a single experienced surgeon (G.G.) via retroperitoneal approach by clamping the only main renal artery. Mean (range) age of patients was 45.3 years (38.2-64.1), tumor size 1.6 cm (1.2-2.0), warm ischemia time 24 min (19-32), operative time 140 min (110-200) and estimated blood loss 270 ml (100-750). Two collecting system injuries were observed and repaired intraoperatively. No conversion to open surgery was required. Final pathological examination revealed 10 renal cell carcinomas and 1 oncocytoma. A negative surgical margin was obtained in 10/11 (91%) patients. Renal function and serum hemoglobin were nearly unaltered pre and post-surgery. No tumor recurrence was observed at mean (range) follow-up of 34 months (15-43). In experienced hands, LPN represents a feasible, safe and effective treatment for selected patients diagnosed with endophytic hilar masses. A larger number of patients and longer follow-up are required to draw definitive conclusions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Evaluation of effect of preoperative chemotherapy on Wilms' tumor histopathology.

PubMed

Taskinen, Seppo; Lohi, Jouko; Koskenvuo, Minna; Taskinen, Mervi

2017-10-06

To evaluate usefulness of cutting needle biopsy (CNB) to recognize pediatric renal tumors and to predict the evolution of histology during preoperative chemotherapy of Wilms tumors. Ninety pediatric patients were operated for renal tumors at our institution in 1988-2015. We included all 64 patients who had undergone CNB at diagnosis and whose CNB and nephrectomy samples were available for re-evaluation. The CNB was diagnostic in all 59 Wilms tumors but only in two out of five non-Wilms tumors. Anaplasia was missed by CNB in one of three with diffuse anaplasia in nephrectomy specimens. In Wilms tumors the proportions of the blastemal, stromal and epithelial components were 55% (IQR 25-85), 28% (IQR 10-58) and 2% (IQR 0-10) in CNB samples and 5% (IQR 0-64), 15% (IQR 0-50) and 15% (IQR 0-44) in the nephrectomy specimens (p-values 0.002, 0.599 and 0.005 respectively). The degree of tumor necrosis was in median 80% (IQR 21-97), after preoperative chemotherapy. The degree of tumor necrosis after chemotherapy had a positive correlation with the proportion of blastemal component (p=0.008) and a negative correlation with proportion of epithelial component in pre-chemotherapy CNB samples (p<0.001). Wilms tumors are usually recognizable unlike non-Wilms tumors in CNB at diagnosis. In Wilms tumors, high blastemal cell content is associated with significant tumor necrosis during pre-operative chemotherapy. Our results do not support routine use of CNB in diagnosis of renal tumors. Retrospective review. Level III. Copyright © 2017 Elsevier Inc. All rights reserved.

The normal and pathologic renal medulla: a comprehensive overview.

PubMed

López, José I; Larrinaga, Gorka; Kuroda, Naoto; Angulo, Javier C

2015-04-01

The renal medulla comprises an intricate system of tubules, blood vessels and interstitium that is not well understood by most general pathologists. We conducted an extensive review of the literature on the renal medulla, in both normal and pathologic conditions. We set out in detail the points of key interest to pathologists: normal and pathological development, physiology, microscopic anatomy, histology and immunohistochemistry; and the specific and most common other types of disease associated with this part of the kidney: developmental abnormalities, (multicystic dysplastic kidney, autosomal dominant and recessive polycystic kidney diseases, medullary cystic kidney disease), inflammatory conditions (xanthogranulomatous pyelonephritis, malakoplakia), hyperplasia and dysplasia, and neoplastic processes (oncocytoma, atypical oncocytic tumors, chromophobe cell carcinoma, collecting duct carcinoma, urothelial carcinoma, other carcinomas, renal medullary fibroma and metastatic tumors). This condensed overview of the origin, function and pathology of the renal medulla, both in terms of development, inflammation and neoplastic processes, should help focus the interest of clinical pathologists on this widely overlooked part of the kidney. Copyright © 2014 Elsevier GmbH. All rights reserved.

Renal Tumor Anatomic Complexity: Clinical Implications for Urologists.

PubMed

Joshi, Shreyas S; Uzzo, Robert G

2017-05-01

Anatomic tumor complexity can be objectively measured and reported using nephrometry. Various scoring systems have been developed in an attempt to correlate tumor complexity with intraoperative and postoperative outcomes. Nephrometry may also predict tumor biology in a noninvasive, reproducible manner. Other scoring systems can help predict surgical complexity and the likelihood of complications, independent of tumor characteristics. The accumulated data in this new field provide provocative evidence that objectifying anatomic complexity can consolidate reporting mechanisms and improve metrics of comparisons. Further prospective validation is needed to understand the full descriptive and predictive ability of the various nephrometry scores. Copyright © 2017 Elsevier Inc. All rights reserved.

Inhibition of Focal Adhesion Kinase (FAK) Leads to Abrogation of the Malignant Phenotype in Aggressive Pediatric Renal Malignancies

PubMed Central

Megison, Michael L.; Gillory, Lauren A.; Stewart, Jerry E.; Nabers, Hugh C.; Mrozcek-Musulman, Elizabeth; Beierle, Elizabeth A.

2014-01-01

Despite the tremendous advances in the treatment of childhood kidney tumors, there remain subsets of pediatric renal tumors that continue to pose a therapeutic challenge, mainly malignant rhabdoid kidney tumors and non-osseous renal Ewing sarcoma. Children with advanced, metastatic or relapsed disease have a disease-free survival rate under 30%. Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase that is important in many facets of tumor development and progression. FAK has been found in other pediatric solid tumors and in adult renal cellular carcinoma, leading us to hypothesize that FAK would be present in pediatric kidney tumors and would impact their cellular survival. In the current study, we showed that FAK was present and phosphorylated in pediatric kidney tumor specimens. We also examined the effects of FAK inhibition upon G401 and SK-NEP-1 cell lines utilizing a number of parallel approaches to block FAK including RNAi and small molecule FAK inhibitors. FAK inhibition resulted in decreased cellular survival, invasion and migration, and increased apoptosis. Further, small molecule inhibition of FAK led to decreased tumor growth in a nude mouse SK-NEP-1 xenograft model. The findings from this study will help to further our understanding of the regulation of tumorigenesis in rare pediatric renal tumors, and may provide desperately needed novel therapeutic strategies and targets for these rare, but difficult to treat, malignancies. PMID:24464916

[Progressive renal insufficiency in a 55-year-old man with psoriasis].

PubMed

Herfurth, K; Busch, M; Gröne, H J; Wolf, G

2018-06-05

Treatment with tumor necrosis factor alpha (TNF-α) inhibitors is a well-established therapeutic strategy for various autoimmune diseases. However, little is known about renal complications and possible causality of renal injury due to this treatment. The following case of a patient with psoriasis demonstrates the difficulties in classifying renal complications of anti-TNF-α therapy versus kidney involvement caused by the underlying disease.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

The International Society of Urological Pathology (ISUP) Vancouver Classification of Renal Neoplasia.

PubMed

Srigley, John R; Delahunt, Brett; Eble, John N; Egevad, Lars; Epstein, Jonathan I; Grignon, David; Hes, Ondrej; Moch, Holger; Montironi, Rodolfo; Tickoo, Satish K; Zhou, Ming; Argani, Pedram

2013-10-01

The classification working group of the International Society of Urological Pathology consensus conference on renal neoplasia was in charge of making recommendations regarding additions and changes to the current World Health Organization Classification of Renal Tumors (2004). Members of the group performed an exhaustive literature review, assessed the results of the preconference survey and participated in the consensus conference discussion and polling activities. On the basis of the above inputs, there was consensus that 5 entities should be recognized as new distinct epithelial tumors within the classification system: tubulocystic renal cell carcinoma (RCC), acquired cystic disease-associated RCC, clear cell (tubulo) papillary RCC, the MiT family translocation RCCs (in particular t(6;11) RCC), and hereditary leiomyomatosis RCC syndrome-associated RCC. In addition, there are 3 rare carcinomas that were considered as emerging or provisional new entities: thyroid-like follicular RCC; succinate dehydrogenase B deficiency-associated RCC; and ALK translocation RCC. Further reports of these entities are required to better understand the nature and behavior of these highly unusual tumors. There were a number of new concepts and suggested modifications to the existing World Health Organization 2004 categories. Within the clear cell RCC group, it was agreed upon that multicystic clear cell RCC is best considered as a neoplasm of low malignant potential. There was agreement that subtyping of papillary RCC is of value and that the oncocytic variant of papillary RCC should not be considered as a distinct entity. The hybrid oncocytic chromophobe tumor, which is an indolent tumor that occurs in 3 settings, namely Birt-Hogg-Dubé Syndrome, renal oncocytosis, and as a sporadic neoplasm, was placed, for the time being, within the chromophobe RCC category. Recent advances related to collecting duct carcinoma, renal medullary carcinoma, and mucinous spindle cell and tubular RCC

Radiologic Assessment of Native Renal Vasculature: A Multimodality Review.

PubMed

Al-Katib, Sayf; Shetty, Monisha; Jafri, Syed Mohammad A; Jafri, Syed Zafar H

2017-01-01

A wide range of clinically important anatomic variants and pathologic conditions may affect the renal vasculature, and radiologists have a pivotal role in the diagnosis and management of these processes. Because many of these entities may not be suspected clinically, renal artery and vein assessment is an essential application of all imaging modalities. An understanding of the normal vascular anatomy is essential for recognizing clinically important anatomic variants. An understanding of the protocols used to optimize imaging modalities also is necessary. Renal artery stenosis is the most common cause of secondary hypertension and is diagnosed by using both direct ultrasonographic (US) findings at the site of stenosis and indirect US findings distal to the stenosis. Fibromuscular dysplasia, while not as common as atherosclerosis, remains an important cause of renal artery hypertension, especially among young female individuals. Fibromuscular dysplasia also predisposes individuals to renal artery aneurysms and dissection. Although most renal artery dissections are extensions of aortic dissections, on rare occasion they occur in isolation. Renal artery aneurysms often are not suspected clinically before imaging, but they can lead to catastrophic outcomes if they are overlooked. Unlike true aneurysms, pseudoaneurysms are typically iatrogenic or posttraumatic. However, multiple small pseudoaneurysms may be seen with underlying vasculitis. Arteriovenous fistulas also are commonly iatrogenic, whereas arteriovenous malformations are developmental (ie, congenital). Both of these conditions involve a prominent feeding artery and draining vein; however, arteriovenous malformations contain a nidus of tangled vessels. Nutcracker syndrome should be suspected when there is distention of the left renal vein with abrupt narrowing as it passes posterior to the superior mesenteric artery. Filling defects in a renal vein can be due to a bland or tumor thrombus. A tumor thrombus is

Study of the Glutaminase Inhibitor CB-839 in Solid Tumors

ClinicalTrials.gov

2016-08-18

Solid Tumors; Triple-Negative Breast Cancer; Non Small Cell Lung Cancer; Renal Cell Carcinoma; Mesothelioma; Fumarate Hydratase (FH)-Deficient Tumors; Succinate Dehydrogenase (SDH)-Deficient Gastrointestinal Stromal Tumors (GIST); Succinate Dehydrogenase (SDH)-Deficient Non-gastrointestinal Stromal Tumors; Tumors Harboring Isocitrate Dehydrogenase-1 (IDH1) and IDH2 Mutations; Tumors Harboring Amplifications in the cMyc Gene

Primary Adult Renal Ewing's Sarcoma: A Rare Entity

PubMed Central

Mukkunda, Ravindra; Venkitaraman, Ramachandran; Thway, Khin; Min, Toon; Fisher, Cyril; Horwich, Alan; Judson, Ian

2009-01-01

Background. Ewing's sarcoma of extraskeletal origin is uncommon and that is of primary renal origin in adults are rare. There is no consensus on the optimal management of Ewing's tumors of renal origin. Methods. A retrospective review of the clinical features, treatment, and outcome of adult patients with primary renal extra-skeletal Ewing's sarcoma who were treated at the Royal Marsden hospital from January 1993–December 2007 is reported. Results. Seven adult patients with primary renal Ewing's sarcoma were identified. All four patients with nonmetastatic disease had radical nephrectomy and received adjuvant chemotherapy +/− radiotherapy. Two developed metastatic disease while on adjuvant chemotherapy, and one patient relapsed after 55 months. The three patients with metastatic disease at presentation did not have nephrectomy and were treated with chemotherapy. All three patients had disease progression with a dismal outcome. Only one patient in the whole group is alive and disease free. The median overall survival was 62.8 months, and the median disease-free survival in patients with nonmetastatic disease after combined modality treatment was 30.3 months. Conclusion. Primary adult renal Ewing's sarcoma is an aggressive tumor with a propensity for early metastasis. Radical nephrectomy with adjuvant combination chemotherapy produced the best results but the outlook remained poor with only one patient experiencing long disease-free survival. PMID:19478963

SWI/SNF Protein Expression Status in Fumarate Hydratase-deficient Renal Cell Carcinoma: Immunohistochemical Analysis of 32 Tumors from 28 Patients.

PubMed

Agaimy, Abbas; Amin, Mahul B; Gill, Anthony J; Popp, Bernt; Reis, André; Berney, Daniel M; Magi-Galluzzi, Cristina; Sibony, Mathilde; Smith, Steven C; Suster, Saul; Trpkov, Kiril; Hes, Ondřej; Hartmann, Arndt

2018-04-21

Fumarate hydratase-deficient renal cell carcinoma (FH-RCC) is a rare, aggressive RCC type, originally described in the setting of hereditary leiomyomatosis and renal cell carcinoma (HLRCC) syndrome which is defined by germline FH gene inactivation. Inactivation of components of the SWI/SNF chromatin remodelling complex is involved in renal medullary carcinoma (SMARCB1/INI1 loss), clear cell RCC (PBRM1 loss) and in subsets of dedifferentiated RCC of clear cell, chromophobe and papillary types (loss of different SWI/SNF components). FH-RCC and SWI/SNF-deficient RCC share anaplastic nuclear features and highly aggressive course. We analysed 32 FH-RCCs from 28 patients using seven commercially available SWI/SNF antibodies (SMARCB1/INI1, SMARCA2, SMARCA4, SMARCC1, SMARCC2, PBRM1 and ARID1A). Variable loss of SMARCB1, ARID1A and SMARCC1 was observed in 1/31, 2/31 and 1/29 evaluable cases, respectively; three of these four SWI/SNF-deficient tumors had confirmed FH mutations. No correlation of SWI/SNF loss with solid or sarcomatoid features was observed. Two tumors with SMARCB1 and ARID1A deficiency had available SWI/SNF molecular data; both lacked SMARCB1 and ARID1A mutations. The remaining five SWI/SNF components were intact in all cases. Especially PBRM1 seems not to be involved in the pathogenesis or progression of FH-deficient RCC. Our data showed that, a subset of FH-RCC (12%) have a variable loss of SWI/SNF complex subunits, likely as secondary genetic events. This should not be confused with SWI/SNF-deficient RCC of other types. Evaluation of FH and SWI/SNF together with comprehensive molecular-genetic profiling is needed to explore possible prognostic implications of FH/SWI-SNF double deficiency and to better understand the somatic mutation landscape in high-grade RCC. Copyright © 2018. Published by Elsevier Inc.

Thyroid metastasis as initial presentation of clear cell renal carcinoma

PubMed Central

Ramírez-Plaza, César Pablo; Domínguez-López, Marta Elena; Blanco-Reina, Francisco

2015-01-01

Introduction Metastatic tumors account for 1.4–2.5% of thyroid malignancies. About 25–30% of patients with clear cell renal carcinoma (CCRC) have distant metastasis at the time of diagnosis, being the thyroid gland a rare localization [5%]. Presentation of the case A 62-year woman who underwent a cervical ultrasonography and a PAAF biopsy reporting atypical follicular proliferation with a few intranuclear vacuoles “suggestive” of thyroid papillary cancer in the context of a multinodular goiter was reported. A total thyroidectomy was performed and the histology of a clear cell renal carcinoma (CCRC) was described in four nodules of the thyroid gland. A CT scan was performed and a renal giant right tumor was found. The patient underwent an eventful radical right nephrectomy and the diagnosis of CCRC was confirmed. Discussion Thyroid metastasis (TM) from CCRC are usually apparent in a metachronic context during the follow-up of a treated primary (even many years after) but may sometimes be present at the same time than the primary renal tumor. Our case is exceptional because the TM was the first evidence of the CCRC, which was subsequently diagnosed and treated. Conclusion The possibility of finding of an incidental metastatic tumor in the thyroid gland from a previous unknown and non-diganosed primary (as CCRC in our case was) is rare and account only for less than 1% of malignancies. Nonetheless, the thyroid gland is a frequent site of metastasis and the presence of “de novo” thyroid nodules in oncologic patients must be always considered and studied. PMID:25827295

Robot-assisted partial nephrectomy for hilar tumors: perioperative outcomes.

PubMed

Eyraud, Rémi; Long, Jean-Alexandre; Snow-Lisy, Devon; Autorino, Riccardo; Hillyer, Shahab; Klink, Joseph; Rizkala, Emad; Stein, Robert J; Kaouk, Jihad H; Haber, Georges-Pascal

2013-06-01

To compare perioperative outcomes of robot-assisted partial nephrectomy (RAPN) for hilar vs nonhilar tumors. The study retrospectively reviewed 364 patients with available computed tomography scans undergoing RAPN. Demographic data and perioperative outcomes results were compared between the hilar (group 1, n = 70) and nonhilar tumors (group 2, n = 294). Multivariate analysis was used to identify predictors of warm ischemia time (WIT), estimated blood loss (EBL), major perioperative complications, and postoperative renal function. There were no differences with respect to demographic variables. Hilar tumors had higher RENAL (radius, exophytic/endophytic properties of the tumor, nearness of tumor deepest portion to the collecting system or sinus, anterior/posterior descriptor and the location relative to polar lines) scores (P <.001) and were larger (3.9 vs 2.6 cm, P <.001). Surgeries for hilar tumors were associated with greater operative time (210 vs 180 minutes, P <.001), longer WIT (27 vs 17 minutes, P <.001), and increased EBL (250 vs 200 mL, P = .04). No differences were noted in transfusion rate, length of stay, complications (overall and major) and positive margins. Postoperative estimated glomerular filtration rate showed no significant difference between hilar vs nonhilar patients on postoperative day 3 (70.12 vs 74.71 mL/min/1.73 m(2), P = .31) or at last follow-up (72.62 vs 75.78 mL/min/1.73 m(2), P = .40), respectively. Multivariate analysis found hilar location was independently associated with increased WIT without significant changes in EBL, major complications, or postoperative renal function. RAPN represents a safe and effective procedure for hilar tumors. Hilar location for patients undergoing RAPN in a high-volume institution seems not be associated with an increased risk of transfusions, major complications, or decline of early postoperative renal function. Copyright © 2013 Elsevier Inc. All rights reserved.

Meta-analysis of Clear Cell Renal Cell Carcinoma Gene Expression Defines a Variant Subgroup and Identifies Gender Influences on Tumor Biology

PubMed Central

Brannon, A. Rose; Haake, Scott M.; Hacker, Kathryn E.; Pruthi, Raj S.; Wallen, Eric M.; Nielsen, Matthew E.; Rathmell, W. Kimryn

2011-01-01

Background Clear cell renal cell carcinoma (ccRCC) displays molecular and histologic heterogeneity. Previously described subsets of this disease, ccA and ccB, were defined based on multigene expression profiles, but it is unclear whether these subgroupings reflect the full spectrum of disease or how these molecular subtypes relate to histologic descriptions or gender. Objective Determine whether additional subtypes of ccRCC exist and whether these subtypes are related to von Hippel-Lindau (VHL) inactivation, hypoxia-inducible factor (HIF) 1 and 2 expression, tumor histology, or gender. Design, setting, and participants Six large, publicly available ccRCC gene expression databases were identified that cumulatively provided data for 480 tumors for meta-analysis via meta-array compilation. Measurements Unsupervised consensus clustering was performed on the meta-arrays. Tumors were examined for the relationship of multigene-defined consensus subtypes and expression signatures of VHL mutation and HIF status, tumor histology, and gender. Results and limitations Two dominant subsets of ccRCC were observed. However, a minor third cluster was revealed that correlated strongly with a wild type (WT) VHL expression profile and indications of variant histologies. When variant histologies were removed, ccA tumors naturally divided by gender. This technique is limited by the potential for persistent batch effect, tumor sampling bias, and restrictions of annotated information. Conclusions The ccA and ccB subsets of ccRCC are robust in meta-analysis among histologically conventional ccRCC tumors. A third group of tumors was identified that may represent a new variant of ccRCC. Within definitively clear cell tumors, gender may delineate tumors in such a way that it could have implications regarding current treatments and future drug development. PMID:22030119

Renal pelvic anatomy is associated with incidence, grade, and need for intervention for urine leak following partial nephrectomy.

PubMed

Tomaszewski, Jeffrey J; Cung, Bic; Smaldone, Marc C; Mehrazin, Reza; Kutikov, Alexander; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

2014-11-01

Although the effect of tumor complexity on perioperative outcome measures is well established, the impact of renal pelvic anatomy on perioperative outcomes remains poorly defined. To evaluate renal pelvic anatomy as an independent predictor of urine leak in moderate- and high-complexity tumors undergoing nephron-sparing surgery. Patients undergoing open partial nephrectomy (PN) for localized RCC were stratified into intermediate- and high-complexity groups using a nephrometry score (7-9 and 10-12, respectively). A renal pelvic score (RPS) was defined by the percentage of renal pelvis contained inside the volume of the renal parenchyma. On this basis, patients were categorized as having an intraparenchymal (>50%) or extraparenchymal (<50%) renal pelvis. Characteristics of patients with and without an intraparenchymal renal pelvic anatomy were compared. Inclusion criteria were met by 255 patients undergoing PN for intermediate (73.6%) and complex (26.4%) localized renal tumors (mean size: 4.6±2.9cm). Twenty-four (9.6%) renal pelves were classified as completely intraparenchymal. Following stratification by RPS, groups differed with respect to Charlson comorbidity index, body mass index, and largest tumor size, while no differences were observed between hospital length of stay, nephrometry score, estimated blood loss, operative time, and age. Intrarenal pelvic anatomy was associated with a markedly increased risk of urine leak (75% vs 6.5%; p=0.001), secondary intervention (37.5% vs 3.9%; p<0.001), and prolonged duration of urine leak (93±62 d vs 56±29 d; p=0.025). Intraparenchymal renal pelvic anatomy is an uncommon anatomic variant associated with an increased rate of urine leak following PN. Elevated pressures within a small intraparenchymal renal pelvis might explain the increased risk. Preoperative imaging characteristics suggestive of increased risk for urine leak should be considered in perioperative management algorithms. Copyright © 2013. Published by

The perioperative management of an inferior vena caval tumor thrombus in patients with renal cell carcinoma.

PubMed

Woodruff, Daniel Y; Van Veldhuizen, Peter; Muehlebach, Gregory; Johnson, Phillip; Williamson, Timothy; Holzbeierlein, Jeffrey M

2013-07-01

Inferior vena caval tumor thrombus (IVC-TT) occurs in 10% of patients diagnosed with renal cell carcinoma (RCC). The perioperative management of these patients remains challenging. Despite multiple publications outlining surgical approaches and outcomes there have been few studies detailing the best peri-operative management of patients with IVC-TT. Our goal was to define the optimal management of patients with RCC and IVC-TT. A review of all published literature regarding the management of RCC with IVC-TT was performed utilizing Pub Med and the Cochrane Database. Reviews were also made of all relevant literature regarding the need for cardiopulmonary bypass and recommendations regarding thrombus in any location in patients with malignancy. Specific items critically examined included: need for preoperative heart catheterization, need for anticoagulation and type of anticoagulation, need for additional studies such as lower extremity duplex or venogram, and indications for vena caval filter placement. The results were then presented to a multidisciplinary group made up of experts in the fields of Urology, Hematology, Oncology, Cardiothoracic Surgery, Interventional Radiology, and Pulmonary/Critical Care. Based on the available literature a best practice guidelines regarding the management of RCC with IVC-TT was established at our institution. Our institutional recommendations include (1) preoperative cardiac catheterization in all patients believed to require cardiopulmonary bypass for removal of the thrombus but only cardiac clearance for those who bypass is unlikely, (2) preoperative anticoagulation using a low molecular weight heparin such as enoxaparin unless contraindicated due to bleeding from the tumor or other contraindication, (3) avoidance of vena caval filters whenever possible is recommended due the potential for caval thrombosis and the difficulties they present during surgical resection. This study identified the available literature on the management

Stereotactic Body Radiotherapy for the Treatment of Renal Tumors☆

PubMed Central

Hanzly, Michael; Creighton, Terrance; Mix, Michael; Zeeck, Kevin; Fung-Kee-Fung, Simon; Singh, Anurag K.; Schwaab, Thomas

2014-01-01

The purpose of this study was to evaluate the response of actively growing renal masses to stereotactic body radiation therapy (SBRT). We retrospectively reviewed our institutional review board–approved kidney database and identified 4 patients who underwent SBRT, 15 Gy dose, for their rapidly growing renal masses. Three patients had a decreased tumor size after radiation treatment by 20.8%, 38.1%, and 20%. The other patient had a size gain of 5.6%. This patient maintained a similar tumor growth rate before and after SBRT. Mean follow-up time was 13.8 months. SBRT represents an effective management option in select patients with larger rapidly growing kidney masses. PMID:26958469

Hilar location is an independent prognostic factor for recurrence in T1 renal cell carcinoma after nephrectomy.

PubMed

Shim, Myungsun; Song, Cheryn; Park, Sejun; Kim, Aram; Choi, Seung-Kwon; Kim, Choung-Soo; Ahn, Hanjong

2015-01-01

We investigated the prognostic significance of tumor location at the renal hilum near the sinus structure on the recurrence in T1 renal cell carcinoma (RCC). A total of 1,818 T1 RCC patients who underwent radical (RN) or partial nephrectomy (PN) from 1997 to 2011 were retrospectively reviewed. A hilar tumor was defined as a tumor abutting the main renal artery and/or vein or its segmental branches, without invasion. We compared the recurrence-free survival (RFS) rates between hilar and nonhilar T1 RCC and analyzed predictors of RFS after nephrectomy. Patients with hilar tumors showed a poorer 5-year RFS compared with nonhilar tumors both in T1a (89.7 vs. 98.5 %, p < 0.001) and T1b (81.6 vs. 95.1 %, p < 0.001) RCCs. Among patients who underwent RN and PN, hilar tumors were associated with lower 5-year RFS (87.6 vs. 97.2 % for RN, 78.1 vs. 98.2 % for PN, both p < 0.001). In T1a hilar tumor, PN was associated with poorer 5-year RFS than RN (79.5 vs. 93.0 %, p < 0.001). In multivariate analysis, a hilar location remained as an independent predictor of recurrence in both T1a and T1b tumors (both p = 0.001). Hilar tumors show a higher recurrence rate than nonhilar counterparts in T1 RCC. In T1a hilar tumors, PN demonstrated poorer RFS than RN. Potential intrinsic renal anatomical or lymphovascular structural differences as well as differences in cancer characteristics need further investigations.

Clear cell renal cell carcinoma: a comparative study of histological and chromosomal characteristics between primary tumors and their corresponding metastases.

PubMed

Dagher, Julien; Kammerer-Jacquet, Solène-Florence; Dugay, Frédéric; Beaumont, Marion; Lespagnol, Alexandra; Cornevin, Laurence; Verhoest, Grégory; Bensalah, Karim; Rioux-Leclercq, Nathalie; Belaud-Rotureau, Marc-Antoine

2017-07-01

Clear cell renal cell carcinoma (ccRCC) has a poor prognosis with a 50% risk of metastases. Little is known about the phenotypic and molecular profiles of metastases regarding their corresponding primary tumors. This study aimed to screen phenotypic and genotypic differences between metastases and their corresponding primary tumors. We selected four cases with available frozen material. The histological, immunohistochemical (VEGFA, CD31, SMA, Ki67, p53, PAR-3), FISH (VHL gene), next-generation sequencing (VHL and c-MET genes), multiplex ligation-dependent probe amplification, and array-(comparative genomic hybridization) CGH analyses were realized. Metastases were nodal, hepatic (synchronous), adrenal, and pulmonary (metachronous). High-grade tumor cells were significantly more frequent in metastases (p = 0.019). Metastases and high-grade zones of primary tumors shared similar characteristics compared to low-grade zones: a lower microscopic vascular density (43.5 vs 382.5 vessels/mm 2 ; p = 0.0027), a higher expression of VEGF (73 vs 10%, p = 0.045), Ki67 (37.6 vs 8.3%; p = 0.011), and p53 (54 vs 10.6%; p = 0.081), and a cytoplasmic and membranous PAR-3 staining. Metastases exhibited more chromosomal imbalances than primary tumors in total (18.75 ± 6.8; p = 0.044) with more genomic gains (13.5 ± 7; p = 0.013). The loss of chromosome 9 and gain of Xq were found in both primary tumors and metastases but gains of loci or chromosomes 2p, 3q, 5, 8q, 12, and 20 were only found in metastases. The VHL gene status was similar in each tumor couple. Although metastases and primary tumors share common histological features, this study highlights chromosomal differences specific to metastases which could be involved in ccRCC metastatic evolution.

Renal cell metastases versus liver hemangioma.

PubMed

Mydlo, J H; Shore, N; Herr, H W

1991-03-01

We present the case of a man with presumed metastatic renal cell carcinoma based on radiologic examination and weight loss, who refused treatment of any kind for one year. A surgical exploration to control hematuria revealed a Stage I tumor.

Sunitinib benefits patients with renal cell carcinoma

Cancer.gov

Findings from clinical trial patients with metastatic renal cell carcinoma, a common kidney cancer, show they did not have accelerated tumor growth after treatment with sunitinib, in contrast to some study results in animals.

Targeting Vasculature in Urologic Tumors: Mechanistic and Therapeutic Significance

PubMed Central

Sakamoto, Shinichi; Ryan, A. Jacqueline; Kyprianou, Natasha

2008-01-01

Recent advances toward understanding the molecular mechanisms regulating cancer initiation and progression provide new insights into the therapeutic value of targeting tumor vascularity by interfering with angiogenic signaling pathways. The functional contribution of key angiogenic factors toward increased vascularity characterizing metastatic tumors and their therapeutic exploitation is considered in three major urologic malignancies, renal, bladder, and prostate cancer. With the realization that the success of the therapeutic efficacy of the various anti-angiogenic approaches for the treatment of urologic tumors has yet to be proven clinically, the challenge remains to select critical angiogenesis pathways that can be targeted for an individual tumor. Here we discuss the major mechanisms that support formation of vasculature in renal, bladder, and prostate tumors and the current results of targeting of specific molecules/regulators for therapeutic intervention against metastastic disease. PMID:17668426

Renal mass anatomic characteristics and perioperative outcomes of laparoscopic partial nephrectomy: a critical analysis.

PubMed

Tsivian, Matvey; Ulusoy, Said; Abern, Michael; Wandel, Ayelet; Sidi, A Ami; Tsivian, Alexander

2012-10-01

Anatomic parameters determining renal mass complexity have been used in a number of proposed scoring systems despite lack of a critical analysis of their independent contributions. We sought to assess the independent contribution of anatomic parameters on perioperative outcomes of laparoscopic partial nephrectomy (LPN). Preoperative imaging studies were reviewed for 147 consecutive patients undergoing LPN for a single renal mass. Renal mass anatomy was recorded: Size, growth pattern (endo-/meso-/exophytic), centrality (central/hilar/peripheral), anterior/posterior, lateral/medial, polar location. Multivariable models were used to determine associations of anatomic parameters with warm ischemia time (WIT), operative time (OT), estimated blood loss (EBL), intra- and postoperative complications, as well as renal function. All models were adjusted for the learning curve and relevant confounders. Median (range) tumor size was 3.3 cm (1.5-11 cm); 52% were central and 14% hilar. While 44% were exophytic, 23% and 33% were mesophytic and endophytic, respectively. Anatomic parameters did not uniformly predict perioperative outcomes. WIT was associated with tumor size (P=0.068), centrality (central, P=0.016; hilar, P=0.073), and endophytic growth pattern (P=0.017). OT was only associated with tumor size (P<0.001). No anatomic parameter predicted EBL. Tumor centrality increased the odds of overall and intraoperative complications, without reaching statistical significance. Postoperative renal function was not associated with any of the anatomic parameters considered after adjustment for baseline function and WIT. Learning curve, considered as a confounder, was independently associated with reduced WIT and OT as well as reduced odds of intraoperative complications. This study provides a detailed analysis of the independent impact of renal mass anatomic parameters on perioperative outcomes. Our findings suggest diverse independent contributions of the anatomic parameters to

Hand-assisted laparoscopic radical nephrectomy in the treatment of a renal cell carcinoma with a level II vena cava thrombus.

PubMed

Kovac, Jason R; Luke, Patrick P

2010-01-01

Excision of renal cell carcinoma (RCC) with corresponding vena cava thrombus is a technical challenge requiring open resection and vascular clamping. A 58 year old male with a right kidney tumor presented with a thrombus extending 1 cm into the vena cava. Using a hand-assisted transperitoneal approach through a 7 cm gel-port, the right kidney was dissected and the multiple vascular collaterals supplying the tumor were identified and isolated. The inferior vena cava was mobilized 4 cm cephalad and 4 cm caudal to the right renal vein. Lateral manual traction was applied to the right kidney allowing the tumor thrombus to be retracted into the renal vein, clear of the vena cava. After laparoscopic ultrasonographic confirmation of the location of the tip of the tumor thrombus, an articulating laparoscopic vascular stapler was used to staple the vena cava at the ostium of the right renal vein. This allowed removal of the tumor thrombus without the need for a Satinsky clamp. The surgery was completed in 243 minutes with no intra-operative complications. The entire kidney and tumor thrombus was removed with negative surgical margins. Estimated blood loss was 300 cc. We present a laparoscopic resection of a renal mass with associated level II thrombus using a hand-assisted approach. In patients with minimal caval involvement, our surgical approach presents an option to the traditional open resection of a renal mass.

Establishment of an ASPL-TFE3 renal cell carcinoma cell line (S-TFE).

PubMed

Hirobe, Megumi; Masumori, Naoya; Tanaka, Toshiaki; Kitamura, Hiroshi; Tsukamoto, Taiji

2013-06-01

Xp11 translocation renal cell carcinoma is a rare disease diagnosed in children and adolescents in the advanced stage with an aggressive clinical course. Various gene fusions including the transcription factor E3 (TFE3) gene located on chromosome X cause the tumor. We established an Xp11 translocation renal cell carcinoma cell line from a renal tumor in a 18-y-old Japanese female and named it "S-TFE." The cell line and its xenograft demonstrated definite gene fusion including TFE3. They showed strong nuclear staining for TFE3 in immunohistochemistry, TFE3 gene rearrangement in dual-color, break-apart FISH analysis and ASPL-TFE3 type 1 fusion transcripts detected by RT-PCR and direct DNA sequencing. Although many renal cell carcinoma cell lines have been established and investigated, only a few cell lines are recognized as Xp11.2 translocation carcinoma. S-TFE will be useful to examine the characteristics and drug susceptibility of Xp11 translocation renal cell carcinoma.

Melanotic Translocation Renal Cell Carcinoma With a Novel ARID1B-TFE3 Gene Fusion.

PubMed

Antic, Tatjana; Taxy, Jerome B; Alikhan, Mir; Segal, Jeremy

2017-11-01

A 36-year-old male was found to have a 7.0 cm left upper pole renal mass on renal ultrasound. Following nephrectomy, the mass was grossly ill-demarcated, friable and red-brown, invading renal parenchyma, hilar fat and the renal vein. Microscopically, the tumor had a nested and papillary architecture. The cells demonstrated abundant clear and eosinophilic cytoplasm and focal intracytoplasmic melanin pigment. Nucleoli were prominent. By immunohistochemistry, the tumor was positive for TFE3; HMB-45 stained approximately 5% of tumor cells corresponding to the histologic melanin pigment, which was confirmed with Fontana-Masson stain with bleach. Immunostains for PAX8, CD10, MiTF, and CAIX were negative; keratins Cam 5.2 and AE1/AE3 were focally positive. Targeted next-generation sequencing revealed an ARID1B-TFE3 gene fusion. Melanotic Xp11 renal cell carcinoma is a rare, pigment containing translocation variant demonstrating overlapping features with melanoma and is usually associated with an SFPQ-TFE3 gene fusion. The patient is alive and without evidence of disease 7 years after his diagnosis. The combination of high grade histopathology, the presence of melanin, absent PAX8, keratin positivity, and relatively indolent clinical behavior with a unique translocation may warrant recognition as a distinct renal cell carcinoma translocation subtype.

Renal tubular-cell neoplasms in black-footed ferrets (Mustela nigripes)--38 cases.

PubMed

Lair, S; Barker, I K; Mehren, K G; Williams, E S

2006-05-01

Thirty-eight cases of renal tubular cell neoplasms were diagnosed in 184 captive, adult (>1-year-old), black-footed ferrets (Mustela nigripes) examined from 1985 to 1996. This prevalence (20.7%) is one of the highest reported for this neoplasm in a population of animals. These tumors rarely metastasized (1/38), and usually were incidental postmortem findings, associated clinical disease being present in only 3 (8%) of the 38 cases. The prevalence of renal tubular cell neoplasms found at postmortem examination increased linearly with age, up to 67% in ferrets >8 years old. Both males (prevalence = 19%) and females (prevalence = 24%) were affected. Multiple renal tumors were common, and seven ferrets (18.4% of affected animals) had bilateral tumors. The cause of this neoplastic syndrome could not be determined. Since most of the animals affected by this condition were in their postreproductive years of life, the impact of this neoplastic syndrome on the captive propagation of this species is negligible.

DNA methylation profiling distinguishes histological subtypes of renal cell carcinoma

PubMed Central

Slater, Amy A.; Alokail, Majed; Gentle, Dean; Yao, Masahiro; Kovacs, Gyula; Maher, Eamonn R.

2013-01-01

Renal cell carcinoma (RCC) accounts for around 3% of cancers in the UK, and both incidence and mortality are increasing with the aging population. RCC can be divided into several subtypes: conventional RCC (the most common, comprising 75% of all cases), papillary RCC (15%) and chromophobe RCC (5%). Renal oncocytoma is a benign tumor and accounts for 5% of RCC. Cancer and epigenetics are closely associated, with DNA hypermethylation being widely accepted as a feature of many cancers. In this study the DNA methylation profiles of chromophobe RCC and renal oncocytomas were investigated by utilizing the Infinium HumanMethylation450 BeadChips. Cancer-specific hypermethylation was identified in 9.4% and 5.2% of loci in chromophobe RCC and renal oncocytoma samples, respectively, while the majority of the genome was hypomethylated. Thirty (hypermethylated) and 41 (hypomethylated) genes were identified as differentially methylated between chromophobe RCC and renal oncocytomas (p < 0.05). Pathway analysis identified some of the differentially hypermethylated genes to be involved in Wnt (EN2), MAPK (CACNG7) and TGFβ (AMH) signaling, Hippo pathway (NPHP4), and cell death and apoptosis (SPG20, NKX6-2, PAX3 and BAG2). In addition, we analyzed ccRCC and papillary RCC data available from The Cancer Genome Atlas portal to identify differentially methylated loci in chromophobe RCC and renal oncocytoma in relation to the other histological subtypes, providing insight into the pathology of RCC subtypes and classification of renal tumors. PMID:23428843

Radiofrequency Ablation in Combination with Embolization in Metachronous Recurrent Renal Cancer in Solitary Kidney after Contralateral Tumor Nephrectomy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gebauer, Bernhard, E-mail: bernhard.gebauer@charite.de; Werk, Michael; Lopez-Haenninen, Enrique

Purpose. To evaluate the feasibility and safety of minimally invasive, percutaneous techniques in metachronous recurrent renal cell cancers (RCCs) in solitary kidneys. Methods. In 4 patients, recurrent RCC was treated by radiofrequency ablation (RFA) (RITA, StarBurst) alone, and in 2 patients by RFA in combination with superselective transarterial particle-lipiodol embolization using 3 Fr microcatheters. RFA was guided by computed tomography in 5 patients, and by magnetic resonance imaging in 1 patient. Mean tumor diameter was 26.7 mm (range 10-45 mm). All interventions were technically successful; during follow-up 1 patient developed recurrent RCC, which was retreated by RFA after embolization. Results.more » No major peri- or postprocedural complications occurred. Changes in creatinine (pre- vs. post-intervention, 122 vs. 127 {mu}mol/l) and calculated creatinine clearance (pre- vs. post-intervention, 78 vs. 73 ml/min) after ablation were minimal. Conclusion. In single kidneys, percutaneous, minimally invasive techniques are safe and feasible. In large tumors, or where there are adjacent critical structures, we prefer a combination of embolization and thermal ablation (RFA)« less

Tumores neonatales y malformaciones congénitas

PubMed Central

Tornero, O. Berbel; García, J.A. Ortega; Tortajada, J. Ferrís i; Castell, J. García; Colomer, J. Donat i; Soldin, O.P.; Soler, J.L. Fuster

2013-01-01

Introducción La asociación entre tumores y malformaciones congénitas está bien establecida, pero no existen datos exclusivos en el período neonatal y se desconocen los mecanismos subyacentes que generan dicha relación. Objetivos Este trabajo tiene dos objetivos: primero, analizar la frecuencia de los tumores neonatales asociados a malformaciones congénitas, y segundo, comentar las posibles hipótesis etiopatogénicas de la relación entre ambas entidades. Materiales y método Estudio retrospectivo de las historias clínicas de los tumores neonatales, en el Hospital Universitario Materno- Infantil La Fe de Valencia, desde enero de 1990 hasta diciembre de 1999. Selección y descripción de las variedades histológicas asociadas a malformaciones congénitas. Éstas se han agrupado siguiendo los criterios de la Clasificación Internacional de Enfermedades CIE-9, códigos 740.0–759.9. Revisión sistemática bibliográfica de los últimos 25 años, obtenida del Medline, Cancerlit, Index Citation Science y Embase. El perfil de búsqueda utilizado fue la combinación de “neonatal/congenital-tumors/cancer/neoplasms” y “congenital malformations/birth defects”. Resultados Se identificaron 72 tumores neonatales (2,8 % del total de tumores pediátricos diagnosticados en dichos años) y 15 de ellos (20,8 %) asociados a malformaciones congénitas, enfermedades o síndromes congénitos. Las asociaciones entre tumores neonatales y malformaciones congénitas fueron las siguientes: a) angioma en 3 pacientes: con dos cardiopatías congénitas y una atresia de coanas-laringomalacia; b) neuroblastoma en 2 pacientes: uno con riñón en herradura y anomalías vertebrales, y otro con cardiopatía congénita; c) teratoma en 2 pacientes: uno con fisura palatina y anomalías vertebrales, y otro con metatarso varo; d) tumor del sistema nervioso central en un paciente con hernia de Bochdaleck; e) tumor cardíaco en 4 pacientes con esclerosis tuberosa; f) leucemia aguda en un

PD-L1 expression in Xp11.2 translocation renal cell carcinoma: Indicator of tumor aggressiveness.

PubMed

Chang, Kun; Qu, Yuanyuan; Dai, Bo; Zhao, Jian-Yuan; Gan, Hualei; Shi, Guohai; Zhu, Yiping; Shen, Yijun; Zhu, Yao; Zhang, Hailiang; Ye, Dingwei

2017-05-18

Programmed death ligand-1 (PD-L1), a promising antitumor target, has proven clinical value against many malignancies. However, the PD-L1 content of Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) and its correlation with clinical outcomes remain unclear. This study aimed to investigate PD-L1 expression in Xp11.2 RCC and to assess its prognostic value. Formalin-fixed paraffin-embedded specimens from 36 adult patients that were histologically confirmed (by fluorescence in situ hybridization) were subjected to immunohistochemical analysis. Of the 36 Xp11.2 RCC patients, 9 (25.0%) had tumors with positive PD-L1 expression and 27 (75.0%) had tumors with negative PD-L1 expression. Positive PD-L1 expression correlated with advanced tumor stage (P = 0.001), regional lymph node metastasis (P < 0.001), and distant metastasis (P < 0.001). A multivariate analysis identified positive PD-L1 expression was an independent adverse prognostic factor for both progression free survival (hazard ratio: 3.7, P = 0.018) and overall survival (hazard ratio: 4.5, P = 0.034). The median PFS and OS for the whole cohort were 13.0 months (95% confidence interval [CI], 9.4-16.6 months) and 36.0 months (95% CI, 23.9-48.1 months), respectively. Our findings suggest that positive PD-L1 expression is indicative of worse clinical outcome in Xp11.2 RCC. Further studies are needed to explore the potential efficacy of targeting PD-L1 in Xp11.2 RCC.

Prevalence of renal insufficiency in elderly cancer patients in a tertiary cancer center

PubMed Central

Pontes, Lucíola de Barros; Antunes, Yuri Philippe Pimentel Vieira; Bugano, Diogo Diniz Gomes; Karnakis, Theodora; del Giglio, Auro; Kaliks, Rafael Aliosha

2014-01-01

Objective To estimate the prevalence of abnormal glomerular filtration rate in elderly patients with solid tumors. Methods A retrospective study with patients aged >65 years diagnosed with solid tumors between January 2007 and December 2011 in a cancer center. The following data were collected: sex, age, serum creatinine at the time of diagnosis and type of tumor. Renal function was calculated using abbreviated Modification of Diet in Renal Disease (MDRD) formulae and then staged in accordance with the clinical practice guidelines published by the Working Group of the National Kidney Foundation. Results A total of 666 patients were included and 60% were male. The median age was 74.2 years (range: 65 to 99 years). The most prevalent diagnosis in the study population were colorectal (24%), prostate (20%), breast (16%) and lung cancer (16%). The prevalence of elevated serum creatinine (>1.0mg/dL) was 30%. However, when patients were assessed using abbreviated MDRD formulae, 66% had abnormal renal function, stratified as follows: 45% with stage 2, 18% with stage 3, 3% with stage 4 and 0.3% with stage 5. Conclusion To the best of our knowledge, this was the first study to estimate the frequency of renal insufficiency in elderly cancer patients in Brazil. The prevalence of abnormal renal function among our cohort was high. As suspected, the absolute creatinine level does underestimate renal function impairment and should not be used as predictor of chemotherapy metabolism, excretion and consequent toxicity. PMID:25295449

Tumor mutational load and immune parameters across metastatic Renal Cell Carcinoma (mRCC) risk groups

PubMed Central

de Velasco, Guillermo; Miao, Diana; Voss, Martin H.; Hakimi, A. Ari; Hsieh, James J.; Tannir, Nizar M.; Tamboli, Pheroze; Appleman, Leonard J.; Rathmell, W. Kimryn; Van Allen, Eliezer M.; Choueiri, Toni K.

2016-01-01

Patients with metastatic renal cell carcinoma (mRCC) have better overall survival when treated with nivolumab, a cancer immunotherapy that targets the immune checkpoint inhibitor programmed cell death 1 (PD-1), rather than everolimus (a chemical inhibitor of mTOR and immunosuppressant). Poor-risk mRCC patients treated with nivolumab seemed to experience the greatest overall survival benefit, compared to patients with favorable or intermediate-risk, in an analysis of the CheckMate-025 trial subgroup of the Memorial Sloan Kettering Cancer Center (MSKCC) prognostic risk groups. Here we explore whether tumor mutational load and RNA expression of specific immune parameters could be segregated by prognostic MSKCC risk strata and explain the survival seen in the poor-risk group. We queried whole exome transcriptome data in RCC patients (n = 54) included in The Cancer Genome Atlas that ultimately developed metastatic disease or were diagnosed with metastatic disease at presentation and did not receive immune checkpoint inhibitors. Nonsynonymous mutational load did not differ significantly by MSKCC risk group, nor was the expression of cytolytic genes –granzyme A and perforin – or selected immune checkpoint molecules different across MSKCC risk groups. In conclusion, this analysis found that mutational load and expression of markers of an active tumor microenvironment did not correlate with MSKCC risk prognostic classification in mRCC. PMID:27538576

Need for intraoperative ultrasound and surgical recommendation for partial nephrectomy: correlation with tumor imaging features and urologist practice patterns.

PubMed

Sun, Maryellen R M; Wagner, Andrew A; San Francisco, Ignacio F; Brook, Alexander; Kavoussi, Louis; Russo, Paul; Steele, Graeme; Viterbo, Rosalia; Pedrosa, Ivan

2012-03-01

This study aimed to evaluate the need for intraoperative ultrasound (IOUS) and recommendation for surgical approach in the resection of renal tumors through a survey of practicing urologists, with correlation to tumor imaging features and urologist practice pattern. An institutional review board-approved retrospective review, compliant with the Health Insurance Portability and Accountability Act, of 44 renal tumors that underwent laparoscopic partial nephrectomy at the study institution was performed. The numeric component of the RENAL nephrometry score (radius [diameter], % exophytic, nearness [to collecting system/renal sinus], location) was calculated for each case using preoperative computed tomography/magnetic resonance imaging. Five anonymized images of each tumor were presented to 4 academic urologists with varying practice patterns. Reviewers independently scored each case for its need for IOUS, for recommendation of a surgical technique, and for the difficulty of the proposed surgery. The RENAL scores were as follows: RENAL 1 (low complexity, score 4-6; n = 19); RENAL 2 (moderate complexity, score 7-9; n = 23); RENAL 3 (high complexity, score 10-12; n = 2). The only RENAL score component significantly influencing need for IOUS was percentage exophytic (P = 0.00002). There was an inverse relationship between normalized and averaged need for IOUS and percentage exophytic (P < 0.0001). The predominant influence for recommendation of surgical method was the reviewer him/herself, with each reviewer's recommendations closely matching his/her practice pattern. Size and percentage exophytic represented the only tumor features significantly (P = 0.03) influencing surgical recommendation. There was a significant difference in the perceived need for IOUS and surgical recommendation when 4 academic urologists reviewed a series of renal masses requiring resection. Percentage exophytic correlated inversely with need for IOUS. Urologist's practice pattern and tumor size

Association between renal iron accumulation and renal interstitial fibrosis in a rat model of chronic kidney disease.

PubMed

Naito, Yoshiro; Fujii, Aya; Sawada, Hisashi; Oboshi, Makiko; Iwasaku, Toshihiro; Okuhara, Yoshitaka; Morisawa, Daisuke; Eguchi, Akiyo; Hirotani, Shinichi; Masuyama, Tohru

2015-07-01

Iron accumulation is associated with the pathophysiology of chronic kidney disease (CKD). Renal fibrosis is a final common feature that contributes to the progression of CKD; however, little is known about the association between renal iron accumulation and renal interstitial fibrosis in CKD. Here we investigate the effects of iron chelation on renal interstitial fibrosis in a rat model of CKD. CKD was induced by 5/6 nephrectomy in Sprague-Dawley rats. At 8 weeks after operation, 5/6 nephrectomized rats were administered an oral iron chelator, deferasirox (DFX), in chow for 8 weeks. Other CKD rats were given a normal diet. Sham-operative rats given a normal diet served as a control. CKD rats exhibited hypertension, glomerulosclerosis and renal interstitial fibrosis. Iron chelation with DFX did not change hypertension and glomerulosclerosis; however, renal interstitial fibrosis was attenuated in CKD rats. Consistent with these findings, renal gene expression of collagen type III and transforming growth factor-β was increased in CKD rats compared with the controls, while iron chelation suppressed these increments. In addition, a decrease in vimentin along an increase in E-cadherin in renal gene expression was observed in CKD rats with iron chelation. CKD rats also showed increased CD68-positive cells in the kidney, whereas its increase was attenuated by iron deprivation. Similarly, increased renal gene expression of CD68, tumor necrosis factor-α and monocyte chemoattractant protein-1 was suppressed in CKD rats with iron chelation. Renal iron accumulation seems to be associated with renal interstitial fibrosis in a rat model of CKD.

Sporadic renal angiomyolipoma in a patient with Birt-Hogg-Dubé: chaperones in pathogenesis.

PubMed

Sager, Rebecca A; Woodford, Mark R; Shapiro, Oleg; Mollapour, Mehdi; Bratslavsky, Gennady

2018-04-24

Birt-Hogg-Dubé (BHD) is an autosomal dominant genetic syndrome caused by germline mutations in the FLCN gene that predisposes patients to develop renal tumors. Renal angiomyolipoma (AML) is not a renal tumor sub-type associated with BHD. AML is, however, a common phenotypic manifestation of Tuberous Sclerosis Complex (TSC) syndrome caused by mutations in either the TSC1 or TSC2 tumor suppressor genes. Previous case reports of renal AML in patients with BHD have speculated on the molecular and clinical overlap of these two syndromes as a result of described involvement of the gene products in the mTOR pathway. Our recent work provided a new molecular link between these two syndromes by identifying FLCN and Tsc2 as clients of the molecular chaperone Hsp90. Folliculin interacting proteins FNIP1/2 and Tsc1 are important for FLCN and Tsc2 stability as new Hsp90 co-chaperones. Here we present a case of sporadic AML as a result of somatic Tsc1/2 loss in a patient with BHD. We further demonstrate that FNIP1 and Tsc1 are capable of compensating for each other in the chaperoning of mutated FLCN tumor suppressor. Our findings demonstrate interconnectivity and compensatory mechanisms between the BHD and TSC pathways.

Advances of multidetector computed tomography in the characterization and staging of renal cell carcinoma

PubMed Central

Tsili, Athina C; Argyropoulou, Maria I

2015-01-01

Renal cell carcinoma (RCC) accounts for approximately 90%-95% of kidney tumors. With the widespread use of cross-sectional imaging modalities, more than half of RCCs are detected incidentally, often diagnosed at an early stage. This may allow the planning of more conservative treatment strategies. Computed tomography (CT) is considered the examination of choice for the detection and staging of RCC. Multidetector CT (MDCT) with the improvement of spatial resolution and the ability to obtain multiphase imaging, multiplanar and three-dimensional reconstructions in any desired plane brought about further improvement in the evaluation of RCC. Differentiation of RCC from benign renal tumors based on MDCT features is improved. Tumor enhancement characteristics on MDCT have been found closely to correlate with the histologic subtype of RCC, the nuclear grade and the cytogenetic characteristics of clear cell RCC. Important information, including tumor size, localization, and organ involvement, presence and extent of venous thrombus, possible invasion of adjacent organs or lymph nodes, and presence of distant metastases are provided by MDCT examination. The preoperative evaluation of patients with RCC was improved by depicting the presence or absence of renal pseudocapsule and by assessing the possible neoplastic infiltration of the perirenal fat tissue and/or renal sinus fat compartment. PMID:26120380

Melanotic Xp11 translocation renal cancer: report of a case with a unique intratumoral sarcoid-like reaction.

PubMed

Ritterhouse, Lauren L; Cykowski, Matthew D; Hassell, Lewis A; Slobodov, Gennady; Bane, Barbara L

2014-04-15

Melanotic Xp11 translocation renal cancer is a rare tumor belonging to the family of microphthalmia-associated transcription factor (MiTF)/transcription factor E (TFE) neoplasms. This tumor family also includes alveolar soft part sarcoma, perivascular epithelioid cell neoplasms, Xp11 translocation renal cell carcinoma, and melanoma. To date, six confirmed melanotic Xp11 translocation cancers (five renal, one ovarian) have been reported in the literature. Here, we report the clinical, histologic, immunohistochemical, and molecular features of a unique melanotic Xp11 translocation renal cancer arising in a 34-year-old African-American female. Histologically, the tumor was composed of epithelioid tumor cells arranged in a nested pattern. The cells had clear to eosinophilic granular cytoplasm, vesicular nuclear chromatin, and prominent nucleoli. Multifocal intracytoplasmic deposits of granular brown melanin pigment were identified and confirmed by Fontana-Masson stain. An unusual histologic feature, not previously reported in melanotic Xp11 translocation renal cancer, was a sarcoid-like granulomatous reaction consisting of tight epithelioid granulomas with lymphocytic cuffing, numerous giant cells, and calcifications. Nuclear transcription factor E3 expression was identified by immunohistochemistry and TFE3 rearrangement was confirmed by fluorescence in situ hybridization. Additional immunohistochemical findings included immunoreactivity for HMB45, cathepsin K, and progesterone receptor; negative staining was seen with actin, desmin, cytokeratins, epithelial membrane antigen, CD10, vimentin, and PAX-8. The patient is currently free of disease, two years following initial clinicoradiologic presentation and twenty-two months following partial nephrectomy without additional therapy. This report further expands the spectrum of morphologic and clinical findings previously described in melanotic Xp11 translocation renal cancer, a distinctive tumor showing overlapping

[Differences in sports participation for children and adolescents with solitary kidney due to renal tumors across Europe. Time for harmonization].

PubMed

Spreafico, F; Terenziani, M; Ardissino, G; Calegari, M; Catania, S; Massimino, M

2015-02-01

As a result of advances in treatment, almost 90% of children diagnosed with Wilms tumor became long-term survivors, and have a sustainable quality of life. These patients' involvement in sports during their childhood is hopefully increasing too. The cornerstone of renal tumor cure remains radical nephrectomy, however, so survivors live with a solitary kidney. In most European countries and the USA, the involvement in sports of children with a solitary kidney depends on a responsible physician saying a "qualified yes", pending individual assessment. Unlike the case in the rest of Europe, in Italy having only one kidney automatically disqualifies an individual wishing to participate in any organized "competitive" sports carrying some risk of renal trauma, including basketball, soccer and sometime volleyball. This absolute restriction is based on ad hoc Ministerial rulings concerning "Health protection in sport activities". But available data do not seem to support such an absolute limitation on participation in sports based exclusively on the fact of having a single kidney. The sport-specific incidence of kidney injuries has been estimated at 2.3 injuries per million male athlete/exposures for basketball (2.5 for females), and 2.6 for soccer (6.0 for girls). Kidney injuries are significantly more rare than head or spine injuries. This article aims to provide Italian sport medicine specialists and policy-makers with the necessary background so that the current, over-protective "unquestionably no" response can be reconsidered, and converted into a still well-founded, more permissive attitude to the sports activities suitable for any children with a solitary normal kidney.

The radiologist's role in the management of papillary renal cell carcinoma.

PubMed

Corral de la Calle, M Á; Encinas de la Iglesia, J; Martín López, M R; Fernández Pérez, G C; Águeda Del Bas, D S

Papillary carcinoma is the second most common renal cell carcinoma. It has a better prognosis than the more frequent clear cell carcinoma, although this does not hold true for advanced cases, because no specific treatment exists. It presents as a circumscribed peripheral tumor (small and homogeneously solid or larger and cystic/hemorrhagic) or as an infiltrating lesion that invades the veins, which has a worse prognosis. Due to their low vascular density, papillary renal cell carcinomas enhance less than other renal tumors, and this facilitates their characterization. On computed tomography, they might not enhance conclusively, and in these cases they are impossible to distinguish from hyperattenuating cysts. Contrast-enhanced ultrasonography and magnetic resonance imaging are more sensitive for detecting vascularization. Other characteristics include a specific vascular pattern, hypointensity on T2-weighted images, restricted water diffusion, and increased signal intensity in opposed phase images. We discuss the genetic, histologic, clinical, and radiological aspects of these tumors in which radiologists play a fundamental role in management. Copyright © 2016 SERAM. Publicado por Elsevier España, S.L.U. All rights reserved.

Renal hemangiopericytoma: case report and literature review.

PubMed

Vetorazzo Filho, José Eduardo; Bahia, Leandro Augusto Costa; Esteves, Paulo Ebert; Maron, Paulo Eduardo Goulart; Vedovato, Bruno César; Fernandes, Roni de Carvalho; Perez, Marjo Deninson Cardenuto

2015-01-01

Hemangioperycytoma is a rare perivascular tumor that seldom involves the urogenital system. This tumor often appears with an unspecific clinical picture, and sometimes is associated with hematuria or hypertension. Diagnosis is based on a combination of histological and immunohistological findings. We report a case of a 52-year-old patient with renal hemangiopericytoma who underwent surgical treatment at our service. This report also includes a literature review on the subject.

Use of quantitative SPECT/CT reconstruction in 99mTc-sestamibi imaging of patients with renal masses.

PubMed

Jones, Krystyna M; Solnes, Lilja B; Rowe, Steven P; Gorin, Michael A; Sheikhbahaei, Sara; Fung, George; Frey, Eric C; Allaf, Mohamad E; Du, Yong; Javadi, Mehrbod S

2018-02-01

Technetium-99m ( 99m Tc)-sestamibi single-photon emission computed tomography/computed tomography (SPECT/CT) has previously been shown to allow for the accurate differentiation of benign renal oncocytomas and hybrid oncocytic/chromophobe tumors (HOCTs) apart from other malignant renal tumor histologies, with oncocytomas/HOCTs showing high uptake and renal cell carcinoma (RCC) showing low uptake based on uptake ratios from non-quantitative single-photon emission computed tomography (SPECT) reconstructions. However, in this study, several tumors fell close to the uptake ratio cutoff, likely due to limitations in conventional SPECT/CT reconstruction methods. We hypothesized that application of quantitative SPECT/CT (QSPECT) reconstruction methods developed by our group would provide more robust separation of hot and cold lesions, serving as an imaging framework on which quantitative biomarkers can be validated for evaluation of renal masses with 99m Tc-sestamibi. Single-photon emission computed tomography data were reconstructed using the clinical Flash 3D reconstruction and QSPECT methods. Two blinded readers then characterized each tumor as hot or cold. Semi-quantitative uptake ratios were calculated by dividing lesion activity by background renal activity for both Flash 3D and QSPECT reconstructions. The difference between median (mean) hot and cold tumor uptake ratios measured 0.655 (0.73) with the QSPECT method and 0.624 (0.67) with the conventional method, resulting in increased separation between hot and cold tumors. Sub-analysis of 7 lesions near the separation point showed a higher absolute difference (0.16) between QPSECT and Flash 3D mean uptake ratios compared to the remaining lesions. Our finding of improved separation between uptake ratios of hot and cold lesions using QSPECT reconstruction lays the foundation for additional quantitative SPECT techniques such as SPECT-UV in the setting of renal 99m Tc-sestamibi and other SPECT/CT exams. With robust

Kidney (Renal Cell) Cancer—Patient Version

Cancer.gov

Kidney cancer can develop in adults and children. The main types of kidney cancer are renal cell cancer, transitional cell cancer, and Wilms tumor. Certain inherited conditions increase the risk of kidney cancer. Start here to find information on kidney cancer treatment, research, and statistics.

Automated noninvasive classification of renal cancer on multiphase CT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linguraru, Marius George; Wang, Shijun; Shah, Furhawn

2011-10-15

Purpose: To explore the added value of the shape of renal lesions for classifying renal neoplasms. To investigate the potential of computer-aided analysis of contrast-enhanced computed-tomography (CT) to quantify and classify renal lesions. Methods: A computer-aided clinical tool based on adaptive level sets was employed to analyze 125 renal lesions from contrast-enhanced abdominal CT studies of 43 patients. There were 47 cysts and 78 neoplasms: 22 Von Hippel-Lindau (VHL), 16 Birt-Hogg-Dube (BHD), 19 hereditary papillary renal carcinomas (HPRC), and 21 hereditary leiomyomatosis and renal cell cancers (HLRCC). The technique quantified the three-dimensional size and enhancement of lesions. Intrapatient and interphasemore » registration facilitated the study of lesion serial enhancement. The histograms of curvature-related features were used to classify the lesion types. The areas under the curve (AUC) were calculated for receiver operating characteristic curves. Results: Tumors were robustly segmented with 0.80 overlap (0.98 correlation) between manual and semi-automated quantifications. The method further identified morphological discrepancies between the types of lesions. The classification based on lesion appearance, enhancement and morphology between cysts and cancers showed AUC = 0.98; for BHD + VHL (solid cancers) vs. HPRC + HLRCC AUC = 0.99; for VHL vs. BHD AUC = 0.82; and for HPRC vs. HLRCC AUC = 0.84. All semi-automated classifications were statistically significant (p < 0.05) and superior to the analyses based solely on serial enhancement. Conclusions: The computer-aided clinical tool allowed the accurate quantification of cystic, solid, and mixed renal tumors. Cancer types were classified into four categories using their shape and enhancement. Comprehensive imaging biomarkers of renal neoplasms on abdominal CT may facilitate their noninvasive classification, guide clinical management, and monitor responses to drugs or interventions.« less

New advances in renal amyloidosis.

PubMed

Nishi, Shinichi; Alchi, Bassam; Imai, Nofumi; Gejyo, Fumitake

2008-04-01

Renal amyloidosis is a rare and intractable disease that accounts for 0.2% of the original kidney diseases of dialysis patients in Japan. However, the number of patients with renal amyloidosis seems to be increasing in recent years. There have been some new concepts focusing on the mechanism of amyloidogenesis, such as molecular chaperones, seeding mechanism, and genetic polymorphisms of precursor protein. Clinical and histological features of renal amyloidosis vary according to the type. Significantly higher levels of urinary protein excretion are seen in the AL type, whereas microscopic haematuria is more prominent in the AA type. Histologically, amyloid deposition of AL type has stronger predilection for GBM than mesangium, and spicule formation is more frequently observed. In contrast, AA type has a higher affinity to TBM and interstitial area. For the histological diagnosis of renal amyloidosis, plural staining methods including Congo-red, Daylon and thioflavin-T stains are available. Combinations of these staining methods are necessary for establishing the precise diagnosis. The more recent and intensive treatments for renal amyloidosis are expected to improve patient outcome. For AL amyloidosis, high-dose melphalan plus high-dose dexamethasone or VAD, in conjunction with bone marrow stem cells transplantation, have shown a definitive effect on reducing urinary protein excretion. The biological agent, tumor necrosis factor (TNF alpha) blocker, improves the renal function in AA-type renal amyloidosis, as well as suppresses the inflammatory reactions in patients with rheumatoid arthritis. Clinical advances have been made in various aspects of renal amyloidosis.

Metastatic Renal Cell Carcinoma to the Pancreas: A Review.

PubMed

Cheng, Shaun Kian Hong; Chuah, Khoon Leong

2016-06-01

The pancreas is an unusual site for tumor metastasis, accounting for only 2% to 5% of all malignancies affecting the pancreas. The more common metastases affecting the pancreas include renal cell carcinomas, melanomas, colorectal carcinomas, breast carcinomas, and sarcomas. Although pancreatic involvement by nonrenal malignancies indicates widespread systemic disease, metastatic renal cell carcinoma to the pancreas often represents an isolated event and is thus amenable to surgical resection, which is associated with long-term survival. As such, it is important to accurately diagnose pancreatic involvement by metastatic renal cell carcinoma on histology, especially given that renal cell carcinoma metastasis may manifest more than a decade after its initial presentation and diagnosis. In this review, we discuss the clinicopathologic findings of isolated renal cell carcinoma metastases of the pancreas, with special emphasis on separating metastatic renal cell carcinoma and its various differential diagnoses in the pancreas.

Renal hemangiopericytoma: case report and literature review

PubMed Central

Vetorazzo, José Eduardo; Bahia, Leandro Augusto Costa; Esteves, Paulo Ebert; Maron, Paulo Eduardo Goulart; Vedovato, Bruno César; Fernandes, Roni de Carvalho; Perez, Marjo Deninson Cardenuto

2015-01-01

Hemangioperycytoma is a rare perivascular tumor that seldom involves the urogenital system. This tumor often appears with an unspecific clinical picture, and sometimes is associated with hematuria or hypertension. Diagnosis is based on a combination of histological and immunohistological findings. We report a case of a 52-year-old patient with renal hemangiopericytoma who underwent surgical treatment at our service. This report also includes a literature review on the subject. PMID:25946050

Neonatal Bartter syndrome and unilateral ectopic renal cyst as new renal causes of hydrops fetalis: two case reports and review of the literature.

PubMed

Çetinkaya, Merih; Durmaz, Oguzhan; Büyükkale, Gökhan; Ozbek, Sibel; Acar, Deniz; Kilicaslan, Isin; Kavuncuoglu, Sultan

2013-07-01

Non-immune hydrops fetalis (NIHF) is a challenging entity as it represents the end stage of several different disorders. Renal and genitourinary causes of NIHF are rare and include congenital renal malformations, tumors and ureter-urethra disorders. Herein, two NIHF cases with different renal causes were presented. The first case that had antenatal NIHF was diagnosed neonatal Bartter syndrome. The second case of NIHF with antenatal large cyst in the surrenal gland area required surgery and ectopic renal cyst was diagnosed. To our best of knowledge, these are the first reports of NIHF associated with neonatal Bartter syndrome and ectopic renal cyst in neonates. Although it may be coincidental, these cases suggest that both neonatal Bartter syndrome and unilateral ectopic renal cyst may cause NIHF development in neonates by several different mechanisms. Therefore, these two rare entities should be suspected in cases of NIHF with similar findings.

[Current strategies in the treatment of renal-cell cancer: targeted therapies].

PubMed

Trigo, José Manuel; Bellmunt, Joaquim

2008-03-22

Renal-cell carcinoma represents 95% of all renal tumours. The Von Hippel-Lindau (VHL) tumor-suppressor gene is mutated or silenced in most clear cell renal carcinomas. pVHL loss results in the stabilization of the heterodimeric transcription factor hypoxia-inducible factor (HIF) and enhanced transactivation of HIF target genes. HIF itself has been difficult to inhibit with drug-like molecules although a number of agents that indirectly inhibit HIF, including mTOR (mammalian target of rapamycin) inhibitors, have been identified. Moreover, a number of drugs have been developed that target HIF-responsive gene products, such as vascular endothelial growth factor (VEGF) and platelet-derived growth factor (PDGF), implicated in tumor angiogenesis. Many of these targeted therapies, especially sunitinib, have demonstrated significant activity in kidney cancer clinical trials and represent a substantive advance in the treatment of this disease.

Percutaneous Renal Cryoablation: Short-Axis Ice-Ball Margin as a Predictor of Outcome.

PubMed

Ge, Benjamin H; Guzzo, Thomas J; Nadolski, Gregory J; Soulen, Michael C; Clark, Timothy W I; Malkowicz, Stanley B; Wein, Alan J; Hunt, Stephen J; Stavropoulos, S William

2016-03-01

To determine if CT characteristics of intraprocedural ice balls correlate with outcomes after cryoablation. A retrospective review was performed on 63 consecutive patients treated with renal cryoablation. Preprocedural and intraprocedural images were used to identify the size and location of renal tumors and ice balls as well as the tumor coverage and ice-ball margins. Review of follow-up imaging (1 mo and then 3-6-mo intervals) distinguished successful ablations from cases of residual tumor. Patients who underwent successful ablation (n = 50; 79%) had a mean tumor diameter of 2.5 cm (range, 0.9-4.3 cm) and mean ice-ball margin of 0.4 cm (range, 0.2-1.2 cm). Patients with residual tumor (n = 13; 21%) had a mean tumor diameter of 3.8 cm (range, 1.8-4.5 cm) and mean ice-ball margin of -0.4 cm (range, -0.9 to 0.4 cm). Residual and undertreated tumors were larger and had smaller ice-ball margins than successfully treated tumors (P < .01). Ice-ball diameters were significantly smaller after image reformatting (P < .01). Ice-ball margins of 0.15 cm had 90% sensitivity, 92% specificity, and 98% positive predictive value for successful ablation. Success was independent of tumor location or number of cryoprobes. Ice-ball margin and real-time intraprocedural reformatting could be helpful in predicting renal cryoablation outcomes. Although a 0.5-cm margin is preferred, a well-centered ice ball with a short-axis margin greater than 0.15 cm strongly correlated with successful ablation. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

Renal cell carcinoma with Xp11.2 translocation in a 7-year-old boy.

PubMed

Jayasinghe, C; Siegler, N; Leuschner, I; Fleischhack, G; Born, M; Müller, A M

2010-05-01

More than 90% of pediatric renal tumors are nephroblastomas while renal cell carcinomas (RCC) are rare in children (< 5%). According to the clinical diagnoses of a nephroblastoma stage IV a 7-year-old boy with a kidney tumor and peripheral pulmonary lesion was preoperatively treated for 8 weeks with Vincristine, Actinomycin D and Adriamycin. The resected kidney displayed a RCC with Xp11.2 translocation. There was no tumor regression and the pulmonary lesion was no longer detectable. Hence chemotherapy was put to a halt. Fine needle aspiration biopsy (FNA) would have allowed to adjust the tumor subtype. Prognosis of pediatric RCC with translocation seems more favourable than without translocation though definitive evidence will only be possible by documentation in a clinical diagnose-related register.

Establishment of an ASPL-TFE3 renal cell carcinoma cell line (S-TFE)

PubMed Central

Hirobe, Megumi; Masumori, Naoya; Tanaka, Toshiaki; Kitamura, Hiroshi; Tsukamoto, Taiji

2013-01-01

Xp11 translocation renal cell carcinoma is a rare disease diagnosed in children and adolescents in the advanced stage with an aggressive clinical course. Various gene fusions including the transcription factor E3 (TFE3) gene located on chromosome X cause the tumor. We established an Xp11 translocation renal cell carcinoma cell line from a renal tumor in a 18-y-old Japanese female and named it “S-TFE.” The cell line and its xenograft demonstrated definite gene fusion including TFE3. They showed strong nuclear staining for TFE3 in immunohistochemistry, TFE3 gene rearrangement in dual-color, break-apart FISH analysis and ASPL-TFE3 type 1 fusion transcripts detected by RT-PCR and direct DNA sequencing. Although many renal cell carcinoma cell lines have been established and investigated, only a few cell lines are recognized as Xp11.2 translocation carcinoma. S-TFE will be useful to examine the characteristics and drug susceptibility of Xp11 translocation renal cell carcinoma. PMID:23760492

Internal validation of the renal pelvic score: a novel marker of renal pelvic anatomy that predicts urine leak after partial nephrectomy.

PubMed

Tomaszewski, Jeffrey J; Smaldone, Marc C; Cung, Bic; Li, Tianyu; Mehrazin, Reza; Kutikov, Alexander; Canter, Daniel J; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

2014-08-01

To internally validate the renal pelvic score (RPS) in an expanded cohort of patients undergoing partial nephrectomy (PN). Our prospective institutional renal cell carcinoma database was used to identify all patients undergoing PN for localized renal cell carcinoma from 2007 to 2013. Patients were classified by RPS as having an intraparenchymal or extraparenchymal renal pelvis. Multivariate logistic regression models were used to examine the relationship between RPS and urine leak. Eight hundred thirty-one patients (median age, 60 ± 11.6 years; 65.1% male) undergoing PN (57.3% robotic) for low (28.9%), intermediate (56.5%), and high complexity (14.5%) localized renal tumors (median size, 3.0 ± 2.3 cm; median nephrometry score, 7.0 ± 2.6) were included. Fifty-four patients (6.5%) developed a clinically significant or radiographically identified urine leak. Seventy-two of 831 renal pelvises (8.7%) were classified as intraparenchymal. Intrarenal pelvic anatomy was associated with a markedly increased risk of urine leak (43.1% vs 3.0%; P <.001), major urine leak requiring intervention (23.6% vs 1.7%; P <.001), and minor urine leak (19.4% vs 1.2%; P <.001) compared with that in patients with an extrarenal pelvis. After multivariate adjustment, RPS (intraparenchymal renal pelvis; odds ratio [OR], 24.8; confidence interval [CI], 11.5-53.4; P <.001) was the most predictive of urine leak as was tumor endophyticity ("E" score of 3 [OR, 4.5; CI, 1.3-15.5; P = .018]), and intraoperative collecting system entry (OR, 6.1; CI, 2.5-14.9; P <.001). Renal pelvic anatomy as measured by the RPS best predicts urine leak after open and robotic partial nephrectomy. Although external validation of the RPS is required, preoperative identification of patients at increased risk for urine leak should be considered in perioperative management and counseling algorithms. Copyright © 2014 Elsevier Inc. All rights reserved.

An unusual presentation of adult Wilms' tumor.

PubMed

Mydlo, J H; Horowitz, M; Del Rosario, C; Cosgrove, J; Macchia, R J

1996-01-01

Wilms' tumor (nephroblastoma), a primary renal neoplasm containing primitive blastema and embryonic glomerulotubular structures, is the most common malignant tumor of the urinary tract in children. There have been about 240 cases of adult Wilms' tumor reported in the world literature, however due to some differences in histologic findings, many cases have been reclassified as rhabdoid or clear cell sarcomas, both of which are recognized as separate entities. We report a case of an adult Wilms' tumor and discuss the clinical, radiographic and histologic features of this tumor.

RCDB: Renal Cancer Gene Database.

PubMed

Ramana, Jayashree

2012-05-18

Renal cell carcinoma or RCC is one of the common and most lethal urological cancers, with 40% of the patients succumbing to death because of metastatic progression of the disease. Treatment of metastatic RCC remains highly challenging because of its resistance to chemotherapy as well as radiotherapy, besides surgical resection. Whereas RCC comprises tumors with differing histological types, clear cell RCC remains the most common. A major problem in the clinical management of patients presenting with localized ccRCC is the inability to determine tumor aggressiveness and accurately predict the risk of metastasis following surgery. As a measure to improve the diagnosis and prognosis of RCC, researchers have identified several molecular markers through a number of techniques. However the wealth of information available is scattered in literature and not easily amenable to data-mining. To reduce this gap, this work describes a comprehensive repository called Renal Cancer Gene Database, as an integrated gateway to study renal cancer related data. Renal Cancer Gene Database is a manually curated compendium of 240 protein-coding and 269 miRNA genes contributing to the etiology and pathogenesis of various forms of renal cell carcinomas. The protein coding genes have been classified according to the kind of gene alteration observed in RCC. RCDB also includes the miRNAsdysregulated in RCC, along with the corresponding information regarding the type of RCC and/or metastatic or prognostic significance. While some of the miRNA genes showed an association with other types of cancers few were unique to RCC. Users can query the database using keywords, category and chromosomal location of the genes. The knowledgebase can be freely accessed via a user-friendly web interface at http://www.juit.ac.in/attachments/jsr/rcdb/homenew.html. It is hoped that this database would serve as a useful complement to the existing public resources and as a good starting point for researchers and

Prognostic value of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and TRAIL receptors in renal cell cancer.

PubMed

Macher-Goeppinger, Stephan; Aulmann, Sebastian; Tagscherer, Katrin E; Wagener, Nina; Haferkamp, Axel; Penzel, Roland; Brauckhoff, Antje; Hohenfellner, Markus; Sykora, Jaromir; Walczak, Henning; Teh, Bin T; Autschbach, Frank; Herpel, Esther; Schirmacher, Peter; Roth, Wilfried

2009-01-15

The death ligand tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and its receptors (TRAIL-R) are involved in immune surveillance and tumor development. Here, we studied a possible association between the expression of TRAIL/TRAIL-Rs and the prognosis in patients with renal cell carcinomas (RCC). A tissue microarray containing RCC tumor tissue samples and corresponding normal tissue samples from 838 patients was generated. Expression of TRAIL and TRAIL-Rs was examined by immunohistochemistry and the effect of TRAIL and TRAIL-R expression on disease-specific survival was assessed. High TRAIL-R2 expression levels were associated with high-grade RCCs (P < 0.001) and correlated negatively with disease-specific survival (P = 0.01). Similarly, high TRAIL expression was associated with a shorter disease-specific survival (P = 0.01). In contrast, low TRAIL-R4 expression was associated with high-stage RCCs (P < 0.001) as well as with the incidence of distant metastasis (P = 0.03) and correlated negatively with disease-specific survival (P = 0.02). In patients without distant metastasis, multivariate Cox regression analyses revealed that TRAIL-R2 and TRAIL are independent prognostic factors for cancer-specific survival (in addition to tumor extent, regional lymph node metastasis, grade of malignancy, and type of surgery). High TRAIL-R2, high TRAIL, and low TRAIL-R4 expression levels are associated with a worse disease-specific survival in patients with RCCs. Therefore, the assessment of TRAIL/TRAIL-R expression offers valuable prognostic information that could be used to select patients for adjuvant therapy studies. Moreover, our findings are of relevance for a potential experimental therapeutic administration of TRAIL-R agonists in patients with RCCs.

NFκB-mediated cyclin D1 expression by microRNA-21 influences renal cancer cell proliferation.

PubMed

Bera, Amit; Ghosh-Choudhury, Nandini; Dey, Nirmalya; Das, Falguni; Kasinath, Balakuntalam S; Abboud, Hanna E; Choudhury, Goutam Ghosh

2013-12-01

MicroRNAs regulate post-transcriptomic landscape in many tumors including renal cell carcinoma. We have recently shown significantly increased expression of miR-21 in renal tumors and that this miRNA contributes to the proliferation of renal cancer cells in culture. However, the mechanism by which miR-21 regulates renal cancer cell proliferation is poorly understood. Addiction to constitutive NFκB activity is hallmark of many cancers including renal cancer. Using miR-21 Sponge in renal cancer cells to block endogenous function of miR-21, we show inhibition of phosphorylation of p65 subunit of NFκB, IKKβ and IκB, which results in attenuation of NFκB transcriptional activity. Subtle reduction in the tumor suppressor PTEN has been linked to various malignancies. We showed previously that miR-21 targeted PTEN in renal cancer cells. Inhibition of PTEN by siRNAs restored miR-21 Sponge-induced suppression of phosphorylation of p65, IKKβ, IκB and NFκB transcriptional activity along with reversal of miR-21 Sponge-reduced phosphorylation of Akt. Expression of constitutively active Akt protected against miR-21 Sponge- and PTEN-mediated decrease in p65/IKKβ/IκB phosphorylation and NFκB transcriptional activity. Furthermore, IKKβ and p65 were required for miR-21-induced renal cancer cell proliferation. Interestingly, miR-21 controlled the expression of cyclin D1 through NFκB-dependent transcription. Finally, we demonstrate that miR-21-regulated renal cancer cell proliferation is mediated by cyclin D1 and CDK4. Together, our results establish a molecular order of a phosphatase-kinase couple involving PTEN/Akt/IKKβ and NFκB-dependent cyclin D1 expression for renal carcinoma cell proliferation by increased miR-21 levels. © 2013.

NFκB-mediated cyclin D1 expression by microRNA-21 influences renal cancer cell proliferation

PubMed Central

Bera, Amit; Ghosh-Choudhury, Nandini; Dey, Nirmalya; Das, Falguni; Kasinath, Balakuntalam S.; Abboud, Hanna E.; Choudhury, Goutam Ghosh

2013-01-01

MicroRNAs regulate post-transcriptomic landscape in many tumors including renal cell carcinoma. We have recently shown significantly increased expression of miR-21 in renal tumors and that this miRNA contributes to the proliferation of renal cancer cells in culture. However, the mechanism by which miR-21 regulates renal cancer cells proliferation is poorly understood. Addiction to constitutive NFκB activity is hallmark of many cancers including renal cancer. Using miR-21 Sponge in renal cancer cells to block endogenous function of miR-21, we show inhibition of phosphorylation of p65 subunit of NFκB, IKKβ and IκB, which results in attenuation of NFκB transcriptional activity. Subtle reduction in the tumor suppressor PTEN has been linked to various malignancies. We showed previously that miR-21 targeted PTEN in renal cancer cells. Inhibition of PTEN by siRNAs restored miR-21 Sponge-induced suppression of phosphorylation of p65, IKKβ, IκB and NFκB transcriptional activity along with reversal of miR-21 Sponge-reduced phosphorylation of Akt. Expression of constitutively active Akt protected against miR-21 Sponge- and PTEN-mediated decrease in p65/IKKβ/IκB phosphorylation and NFκB transcriptional activity. Furthermore, IKKβ and p65 were required for miR-21-induced renal cancer cell proliferation. Interestingly, miR-21 controlled the expression of cyclin D1 through NFκB-dependent transcription. Finally, we demonstrate that miR-21-regulated renal cancer cell proliferation is mediated by cyclin D1 and CDK4. Together, our results establish a molecular order of a phosphatase-kinase couple involving PTEN/Akt/IKKβ and NFκB-dependent cyclin D1 expression for renal carcinoma cell proliferation by increased miR-21 levels. PMID:23981302

Effect of Tumor Complexity and Technique on Efficacy and Complications after Percutaneous Microwave Ablation of Stage T1a Renal Cell Carcinoma: A Single-Center, Retrospective Study.

PubMed

Klapperich, Marki E; Abel, E Jason; Ziemlewicz, Timothy J; Best, Sara; Lubner, Meghan G; Nakada, Stephen Y; Hinshaw, J Louis; Brace, Christopher L; Lee, Fred T; Wells, Shane A

2017-07-01

Purpose To evaluate the effects of tumor complexity and technique on early and midterm oncologic efficacy and rate of complications for 100 consecutive biopsy-proved stage T1a renal cell carcinomas (RCCs) treated with percutaneous microwave ablation. Materials and Methods This HIPAA-compliant, single-center retrospective study was approved by the institutional review board. The requirement to obtain informed consent was waived. Ninety-six consecutive patients (68 men, 28 women; mean age, 66 years ± 9.4) with 100 stage T1a N0M0 biopsy-proved RCCs (median diameter, 2.6 cm ± 0.8) underwent percutaneous microwave ablation between March 2011 and June 2015. Patient and procedural data were collected, including body mass index, comorbidities, tumor histologic characteristics and grade, RENAL nephrometry score, number of antennas, generator power, and duration of ablation. Technical success, local tumor progression, and presence of complications were assessed at immediate and follow-up imaging. The Kaplan-Meier method was used for survival analyses. Results Technical success was achieved for all 100 tumors (100%), including 47 moderately and five highly complex RCCs. Median clinical and imaging follow-up was 17 months (range, 0-48 months) and 15 months (range, 0-44 months), respectively. No change in estimated glomerular filtration rate was noted after the procedure (P = .49). There were three (3%) procedure-related complications and six (6%) delayed complications, all urinomas. One case of local tumor progression (1%) was identified 25 months after the procedure. Three-year local progression-free survival, cancer-specific survival, and overall survival were 88% (95% confidence interval: 0.52%, 0.97%), 100% (95% confidence interval: 1.0%, 1.0%), and 91% (95% confidence interval: 0.51%, 0.99%), respectively. Conclusion Percutaneous microwave ablation is an effective and safe treatment option for stage T1a RCC, regardless of tumor complexity. Long-term follow-up is needed

Next-Generation Sequencing to Detect Deletion of RB1 and ERBB4 Genes in Chromophobe Renal Cell Carcinoma: A Potential Role in Distinguishing Chromophobe Renal Cell Carcinoma from Renal Oncocytoma.

PubMed

Liu, Qingqing; Cornejo, Kristine M; Cheng, Liang; Hutchinson, Lloyd; Wang, Mingsheng; Zhang, Shaobo; Tomaszewicz, Keith; Cosar, Ediz F; Woda, Bruce A; Jiang, Zhong

2018-04-01

Overlapping morphologic, immunohistochemical, and ultrastructural features make it difficult to diagnose chromophobe renal cell carcinoma (ChRCC) and renal oncocytoma (RO). Because ChRCC is a malignant tumor, whereas RO is a tumor with benign behavior, it is important to distinguish these two entities. We aimed to identify genetic markers that distinguish ChRCC from RO by using next-generation sequencing (NGS). NGS for hotspot mutations or gene copy number changes was performed on 12 renal neoplasms, including seven ChRCC and five RO cases. Matched normal tissues from the same patients were used to exclude germline variants. Rare hotspot mutations were found in cancer-critical genes (TP53 and PIK3CA) in ChRCC but not RO. The NGS gene copy number analysis revealed multiple abnormalities. The two most common deletions were tumor-suppressor genes RB1 and ERBB4 in ChRCC but not RO. Fluorescence in situ hybridization was performed on 65 cases (ChRCC, n = 33; RO, n = 32) to verify hemizygous deletion of RB1 (17/33, 52%) or ERBB4 (11/33, 33%) in ChRCC, but not in RO (0/32, 0%). In total, ChRCCs (23/33, 70%) carry either a hemizygous deletion of RB1 or ERBB4. The combined use of RB1 and ERBB4 fluorescence in situ hybridization to detect deletion of these genes may offer a highly sensitive and specific assay to distinguish ChRCC from RO. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Simvastatin With Topotecan and Cyclophosphamide in Relapsed and/or Refractory Pediatric Solid and CNS Tumors

ClinicalTrials.gov

2018-05-29

Retinoblastoma; Clear Cell Sarcoma; Renal Cell Carcinoma; Rhabdoid Tumor; Wilms Tumor; Hepatoblastoma; Neuroblastoma; Germ Cell Tumors; Ewings Sarcoma; Non-rhabdomyosarcoma Soft Tissue Sarcoma; Osteosarcoma; Rhabdomyosarcoma

Evaluation of anatomic and morphologic nomogram to predict malignant and high-grade disease in a cohort of patients with small renal masses.

PubMed

Bagrodia, Aditya; Harrow, Brian; Liu, Zhuo-Wei; Olweny, Ephrem O; Faddegon, Stephen; Yin, Gang; Tan, Yung Khan; Han, Woong Kyu; Lotan, Yair; Margulis, Vitaly; Cadeddu, Jeffrey A

2014-01-01

To evaluate a nomogram using the RENAL Nephrometry Score (RENAL-NS) that was developed to characterize masses as benign vs. malignant and high vs. low grade in our patients with small renal masses treated with partial nephrectomy (PN). The nomogram was previously developed and validated in patients with widely variable tumor sizes. Retrospective review of PN performed between 1/2003 and 7/2011. Imaging was reviewed by a urologic surgeon for RENAL-NS. Final pathology was used to classify tumors as benign or malignant and low (I/II) or high (III/IV) Fuhrman grade. Patient age, gender, and RENAL score were entered into the nomogram described by Kutikov et al. to determine probabilities of cancer and high-grade disease. Area under the curve was determined to assess agreement between observed and expected outcomes for prediction of benign vs. malignant disease and for prediction of high- vs. low-grade or benign disease. A total of 250 patients with 252 masses underwent PN during the study period; 179/250 (71.6%) had preoperative imaging available. RENAL-NS was assigned to 181 masses. Twenty-two percent of tumors were benign. Eighteen percent of tumors were high grade. Area under the curve was 0.648 for predicting benign vs. malignant disease and 0.955 for predicting low-grade or benign vs. high-grade disease. The RENAL-NS score nomogram by Kutikov does not discriminate well between benign and malignant disease for small renal masses. The nomogram may potentially be useful in identifying high-grade tumors. Further validation is required where the nomogram probability and final pathologic specimen are available. Copyright © 2014 Elsevier Inc. All rights reserved.

Impact of parenchymal loss on renal function after laparoscopic partial nephrectomy under warm ischemia.

PubMed

Bagheri, Fariborz; Pusztai, Csaba; Farkas, László; Kallidonis, Panagiotis; Buzogány, István; Szabó, Zsuzsanna; Lantos, János; Imre, Marianna; Farkas, Nelli; Szántó, Árpád

2016-12-01

To elucidate the impact of renal parenchymal loss and the ischemic reperfusion injury (RI) on the renal function after laparoscopic partial nephrectomy (LPN) under warm ischemia (WI). Thirty-five patients with a single polar renal mass ≤4 cm and normal contralateral kidney underwent LPN. Transperitoneal LPN with WI using en bloc hilar occlusion was performed. The total differential renal function (T-DRF) using 99m Tc-dimercaptosuccinic acid was evaluated preoperatively and postoperatively over a period of 1 year. A special region of interest (ROI) was selected on the non-tumorous pole of the involved kidney, and was compared with the same ROI in the contralateral kidney. The latter comparison was defined as partial differential renal function (P-DRF). Any postoperative decline in the P-DRF of the operated kidney was attributed to the RI. Subtraction of the P-DRF decline from the T-DRF decline was attributed to the parenchymal loss caused by the resection of the tumor and suturing of the normal parenchyma. The mean WI time was 22 min, and the mean weight of resected specimen was 18 g. The mean postoperative eGFR declined to 87 ml/min/1.73 m 2 from its baseline mean value of 97 ml/min/1.73 m 2 (p value = 0.075). Mean postoperative T-DRF and P-DRF of the operated kidney declined by 7 and 3 %, respectively. After LPN of small renal mass, decline in renal function is primarily attributed to parenchymal loss caused by tumor resection and suturing of the normal parenchyma rather than the RI.

Review of renal cell carcinoma and its common subtypes in radiology

PubMed Central

Low, Gavin; Huang, Guan; Fu, Winnie; Moloo, Zaahir; Girgis, Safwat

2016-01-01

Representing 2%-3% of adult cancers, renal cell carcinoma (RCC) accounts for 90% of renal malignancies and is the most lethal neoplasm of the urologic system. Over the last 65 years, the incidence of RCC has increased at a rate of 2% per year. The increased incidence is at least partly due to improved tumor detection secondary to greater availability of high-resolution cross-sectional imaging modalities over the last few decades. Most RCCs are asymptomatic at discovery and are detected as unexpected findings on imaging performed for unrelated clinical indications. The 2004 World Health Organization Classification of adult renal tumors stratifies RCC into several distinct histologic subtypes of which clear cell, papillary and chromophobe tumors account for 70%, 10%-15%, and 5%, respectively. Knowledge of the RCC subtype is important because the various subtypes are associated with different biologic behavior, prognosis and treatment options. Furthermore, the common RCC subtypes can often be discriminated non-invasively based on gross morphologic imaging appearances, signal intensity on T2-weighted magnetic resonance images, and the degree of tumor enhancement on dynamic contrast-enhanced computed tomography or magnetic resonance imaging examinations. In this article, we review the incidence and survival data, risk factors, clinical and biochemical findings, imaging findings, staging, differential diagnosis, management options and post-treatment follow-up of RCC, with attention focused on the common subtypes. PMID:27247714

[Renal angiomyolipomas without fat component: tomodensitometric and histologic characteristics, clinical course].

PubMed

Negre, T; Faure, A; Andre, M; Daniel, L; Coulange, C; Lechevallier, E

2011-11-01

Angiomyolipoma is the most frequent benign renal solid tumor. Because of the lack of fat component on the CT scan, diagnosis of this tumor is hard and can require percutaneous biopsy of unknown renal tumor. The follow-up of the poor fat CT scan component AML (PFCT AML) is uncertain. Five hundred percutaneous renal biopsy under tomodenstitometry have been realised between 1998 and 2008. There was 41 PFCT AML on the 500 biopsy. By definition, a PFCT AML is an AML where the diagnosis is done on a percutaneous biopsy but where there was no fat component on the first CT scan. We studied and compared clinical, tomodensitometric and histologic parameters of these 41 patients (mean age: 56, 9±11.04; sexe rate M/F: 6/35) where renal AML was diagnosed on percutaneous renal biopsy but without fat component on CT scan. Average size was 26.44±14.68mm. We phone-called 16 patients for the long-term follow-up. Average follow-up was 41±28.3 months. For four patients on 16, initial diagnosis was done in front of local symptoms, for one of the 16 diagnosis was done in front of general symptoms, for one of the diagnosis was done during Bourneville tuberous sclerosis evolution and 10 of the 16 was done fortuitously. After review of the initial CT scan, fat density was found on 24% of them. Ten percent was epithelioid angiomyolipoma. Four renal biopsy on 41 (10%) was epithelioid AML. No epithelioid AML had fat component after the second look of the CT scan. Among the 16 patients who were phone-called, three (19%) underwent a complication. Two had abdominal pain and was treated medically. Initial sizes were 26 and 30mm. Only one patient must be operated by radical nephrectomy for acute hemorrhage. Initial size was 45mm. No neoplasic degeneration was identified for those 16 patients. In our study, the PFCT AML rate was 8.2%. In 25% cases, CT scan read-through shown a fat component and could help for the diagnosis. PFCT AML evolution seems to be the same as a classic AML. Conservative

[MRI findings of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions].

PubMed

Zhong, Y; Wang, H Y; Chen, X; Guo, A T; Ma, L; Wang, Y W; Ye, H Y

2016-09-06

Objective: To analyze MRI findings of renal cell carcinoma associated with Xp11.2 translocation-TFE gene fusion(Xp11.2 RCC). Methods: MR imaging features of eleven patients with pathologically-proved Xp11.2 RCC were retrospectively analyzed from December 2008 to December 2015. The following MRI features of the lesions were analyzed in the study: location, maximal diameter, signal intensity, hemorrhage, necrosis, cystic change, enhancement features and metastasis. The data was analyzed by using t test. Results: Four men and seven women (mean age, 35.2 years; age range, 15-49 years) were included. Tumors occurred in the right kidney in 5 cases and the left kidney in 6 cases. On T 1 WI tumors showed heterogeneously hypo-intensity and iso-intensity, hyper-intensity in 10 cases, 1 cases, respectively. On T 2 WI tumors showed heterogeneously slight hypo-intensity, heterogeneously slight hyper-intensity and hyper-intensity in 6 cases, 4 cases, 1 case, respectively. On DWI tumors showed hyper-intensity and heterogeneously slight hype-intensity in 2 cases, 9 cases, respectively. ADC value of the tumors were statistically significant lower than that of renal cortex(×10 -3 mm 2 /s)(1.35±0.20 vs 2.09±0.11, P <0.05). Imaging findings were suggestive of hemorrhage( n =4) or necrosis ( n =1) or cystic change ( n =6) or lipid( n =1) in the tumors. On dynamic contrast-enhanced imaging, tumors showed lower signal intensity change (96%±93%, 110%±86% and 103%±46%, respectively) than did renal cortex (285%±109%, 254%±97% and 225%±90%, respectively) ( P <0.05). Tumor capsule showed in 7 cases. Enlarged lymph node was found in renal hilum in one case. Conclusion: MRI findings may show characteristic features of Xp11.2 RCC combined with patients' age and assist in preoperative correct diagnosis.

The Perlman syndrome: familial renal dysplasia with Wilms tumor, fetal gigantism and multiple congenital anomalies. 1984.

PubMed

Neri, Giovanni; Martini-Neri, Maria Enrica; Katz, Ben E; Opitz, John M

2013-11-01

The ensuing paper by Professor Giovanni Neri and colleagues was originally published in 1984, American Journal of Medical Genetics 19:195–207. The original article described a new family with a condition that the authors designated as the Perlman syndrome. This disorder, while uncommon, is an important multiple congenital anomaly and dysplasia syndrome; the causative gene was recently identified. This paper is a seminal work and is graciously republished by Wiley-Blackwell in the Special Festschrift issue honoring Professor Neri. We describe a familial syndrome of renal dysplasia, Wilms tumor, hyperplasia of the endocrine pancreas, fetal gigantism, multiple congenital anomalies and mental retardation. This condition was previously described by Perlman et al. [1973, 1975] and we propose to call it the "Perlman syndrome." It appears to be transmitted as an autosomal recessive trait. The possible relationships between dysplasia, neoplasia and malformation are discussed. © 2013 Wiley Periodicals, Inc.

Triiodothyronine regulates cell growth and survival in renal cell cancer.

PubMed

Czarnecka, Anna M; Matak, Damian; Szymanski, Lukasz; Czarnecka, Karolina H; Lewicki, Slawomir; Zdanowski, Robert; Brzezianska-Lasota, Ewa; Szczylik, Cezary

2016-10-01

Triiodothyronine plays an important role in the regulation of kidney cell growth, differentiation and metabolism. Patients with renal cell cancer who develop hypothyreosis during tyrosine kinase inhibitor (TKI) treatment have statistically longer survival. In this study, we developed cell based model of triiodothyronine (T3) analysis in RCC and we show the different effects of T3 on renal cell cancer (RCC) cell growth response and expression of the thyroid hormone receptor in human renal cell cancer cell lines from primary and metastatic tumors along with human kidney cancer stem cells. Wild-type thyroid hormone receptor is ubiquitously expressed in human renal cancer cell lines, but normalized against healthy renal proximal tube cell expression its level is upregulated in Caki-2, RCC6, SKRC-42, SKRC-45 cell lines. On the contrary the mRNA level in the 769-P, ACHN, HKCSC, and HEK293 cells is significantly decreased. The TRβ protein was abundant in the cytoplasm of the 786-O, Caki-2, RCC6, and SKRC-45 cells and in the nucleus of SKRC-42, ACHN, 769-P and cancer stem cells. T3 has promoting effect on the cell proliferation of HKCSC, Caki-2, ASE, ACHN, SK-RC-42, SMKT-R2, Caki-1, 786-0, and SK-RC-45 cells. Tyrosine kinase inhibitor, sunitinib, directly inhibits proliferation of RCC cells, while thyroid hormone receptor antagonist 1-850 (CAS 251310‑57-3) has less significant inhibitory impact. T3 stimulation does not abrogate inhibitory effect of sunitinib. Renal cancer tumor cells hypostimulated with T3 may be more responsive to tyrosine kinase inhibition. Moreover, some tumors may be considered as T3-independent and present aggressive phenotype with thyroid hormone receptor activated independently from the ligand. On the contrary proliferation induced by deregulated VHL and or c-Met pathways may transgress normal T3 mediated regulation of the cell cycle.

Temsirolimus and Vinorelbine Ditartrate in Treating Patients With Unresectable or Metastatic Solid Tumors

ClinicalTrials.gov

2016-06-09

Extensive Stage Small Cell Lung Cancer; Hereditary Paraganglioma; Male Breast Cancer; Malignant Paraganglioma; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Pheochromocytoma; Pancreatic Polypeptide Tumor; Recurrent Breast Cancer; Recurrent Cervical Cancer; Recurrent Endometrial Carcinoma; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Neuroendocrine Carcinoma of the Skin; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Ovarian Germ Cell Tumor; Recurrent Pheochromocytoma; Recurrent Prostate Cancer; Recurrent Renal Cell Cancer; Recurrent Small Cell Lung Cancer; Recurrent Uterine Sarcoma; Regional Gastrointestinal Carcinoid Tumor; Regional Pheochromocytoma; Stage III Cervical Cancer; Stage III Endometrial Carcinoma; Stage III Neuroendocrine Carcinoma of the Skin; Stage III Ovarian Epithelial Cancer; Stage III Ovarian Germ Cell Tumor; Stage III Prostate Cancer; Stage III Renal Cell Cancer; Stage III Uterine Sarcoma; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IIIC Breast Cancer; Stage IV Breast Cancer; Stage IV Endometrial Carcinoma; Stage IV Neuroendocrine Carcinoma of the Skin; Stage IV Non-small Cell Lung Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Ovarian Germ Cell Tumor; Stage IV Prostate Cancer; Stage IV Renal Cell Cancer; Stage IV Uterine Sarcoma; Stage IVA Cervical Cancer; Stage IVB Cervical Cancer; Thyroid Gland Medullary Carcinoma

Renin-angiotensin system (RAS) blockade attenuates growth and metastatic potential of renal cell carcinoma in mice.

PubMed

Araújo, Wedson F; Naves, Marcelo A; Ravanini, Juliana N; Schor, Nestor; Teixeira, Vicente P C

2015-09-01

Renal cell carcinoma (RCC) is the most frequent type of cancer among renal neoplasms in adults and responds poorly to radiotherapy and chemotherapy. There is evidence that blockade of the renin-angiotensin system (RAS) might have antineoplastic effects. The aim of this study was to investigate the effects of RAS blockade on RCC in a murine model. Murine renal cancer cells (Renca) were injected (1 × 10(5)) into the subcapsular space of the left kidney of BALB/c mice (8 wk of age). The animals were divided into 4 groups: a control group (no treatment), angiotensin-receptor blockers group (losartan 100mg/kg/d), angiotensin-converting enzyme inhibitor group (captopril 10mg/kg/d), and angiotensin-receptor blockers +angiotensin-converting enzyme inhibitor group (losartan 100mg/kg/d +captopril 10mg/kg/d). The animals received the drugs by gavage for 21 days after inoculation, beginning 2 days before tumor induction, and were then euthanized. After killing the animals, the kidneys and lungs were removed, weighed, and processed for histopathological and immunohistochemical analyses. Angiogenesis and vascular microvessels were assessed with the antibodies anti-vascular endothelial growth factor and anti-CD34. Angiotensin II-inoculated animals developed renal tumors. Treated animals presented smaller tumors, regardless of the therapeutic regimen, and far fewer lung metastases in both quantity and dimension compared with the controls. The expression of vascular endothelial growth factor and CD34 were significantly decreased in renal tumors of treated animals compared with the controls. Our findings suggest that blockade of RAS decreases tumor proliferation and metastatic capacity of RCC in this experimental model. Copyright © 2015 Elsevier Inc. All rights reserved.

Percutaneous cryoablation of metastatic renal cell carcinoma for local tumor control: feasibility, outcomes, and estimated cost-effectiveness for palliation.

PubMed

Bang, Hyun J; Littrup, Peter J; Goodrich, Dylan J; Currier, Brandt P; Aoun, Hussein D; Heilbrun, Lance K; Vaishampayan, Ulka; Adam, Barbara; Goodman, Allen C

2012-06-01

To assess complications, local tumor recurrences, overall survival (OS), and estimates of cost-effectiveness for multisite cryoablation (MCA) of oligometastatic renal cell carcinoma (RCC). A total of 60 computed tomography- and/or ultrasound-guided percutaneous MCA procedures were performed on 72 tumors in 27 patients (three women and 24 men). Average patient age was 63 years. Tumor location was grouped according to common metastatic sites. Established surgical selection criteria graded patient status. Median OS was determined by Kaplan-Meier method and defined life-years gained (LYGs). Estimates of MCA costs per LYG were compared with established values for systemic therapies. Total number of tumors and cryoablation procedures for each anatomic site are as follows: nephrectomy bed, 11 and 11; adrenal gland, nine and eight; paraaortic, seven and six; lung, 14 and 13; bone, 13 and 13; superficial, 12 and nine; intraperitoneal, five and three; and liver, one and one. A mean of 2.2 procedures per patient were performed, with a median clinical follow-up of 16 months. Major complication and local recurrence rates were 2% (one of 60) and 3% (two of 72), respectively. No patients were graded as having good surgical risk, but median OS was 2.69 years, with an estimated 5-year survival rate of 27%. Cryoablation remained cost-effective with or without the presence of systemic therapies according to historical cost comparisons, with an adjunctive cost-effectiveness ratio of $28,312-$59,554 per LYG. MCA was associated with very low morbidity and local tumor recurrence rates for all anatomic sites, with apparent increased OS. Even as an adjunct to systemic therapies, MCA appeared cost-effective for palliation of oligometastatic RCC. Copyright © 2012 SIR. Published by Elsevier Inc. All rights reserved.

VX680/MK-0457, a potent and selective Aurora kinase inhibitor, targets both tumor and endothelial cells in clear cell renal cell carcinoma

PubMed Central

Li, Yan; Zhang, Zhong-Fa; Chen, Jindong; Huang, Dan; Ding, Yan; Tan, Min-Han; Qian, Chao-Nan; Resau, James H; Kim, Hyung; Teh, Bin Tean

2010-01-01

Aurora kinases are key regulators of cell mitosis and have been implicated in the process of tumorigenesis. In recent years, the Aurora kinases have attracted much interest as promising targets for cancer treatment. Here we report on the roles of Aurora A and Aurora B kinases in clear cell renal cell carcinoma (ccRCC). Using genomewide expression array analysis of 174 patient samples of ccRCC, we found that expression levels of Aurora A and B were significantly elevated in ccRCC compared to normal kidney samples. High expression levels of Aurora A and Aurora B were significantly associated with advanced tumor stage and poor patient survival. Inhibition of Aurora kinase activity with the drug VX680 (also referred to as MK-0457) inhibited ccRCC cell growth in vitro and led to ccRCC cell accumulation in the G2/M phase and apoptosis. Growth of ccRCC xenograft tumors was also inhibited by VX680 treatment, accompanied by a reduction of tumor microvessel density. Analysis of endothelial cell lines demonstrated that VX680 inhibits endothelial cell growth with effects similar to that seen in ccRCC cells. Our findings suggest that VX680 inhibits the growth of ccRCC tumors by targeting the proliferation of both ccRCC tumor cells and tumor-associated endothelial cells. Aurora kinases and their downstream cell cycle proteins have an important role in ccRCC and may be potent prognostic markers and therapy targets for this disease. PMID:20589168

Intraoperative evaluation of renal blood flow during laparoscopic partial nephrectomy with a novel Doppler system.

PubMed

Mues, Adam C; Okhunov, Zhamshid; Badani, Ketan; Gupta, Mantu; Landman, Jaime

2010-12-01

Hemostasis remains a major challenge associated with laparoscopic renal surgery. We evaluated a cost-effective novel Doppler probe (DP) for assessment of vascular control during laparoscopic partial nephrectomy (LPN). We prospectively collected data during LPN procedures. We documented tumor location and size as well as subjective quality of the hilar dissection. The DP was compared with our standard intraoperative ultrasound system (SUS) for the ability to detect blood flow during hilar dissection and to determine parenchymal ischemia around the tumor after clamping of the renal vessels. Twenty patients underwent LPN by a single surgeon. The mean tumor size was 3.0 cm (range: 1.2-6.3 cm). The times to assess the kidney using the SUS and DP were 68.6 seconds (range: 20-155) and 44.5 seconds (range: 15-180), respectively. Evaluation prior to renal hilar clamping demonstrated the presence of blood flow in all 20 patients (100%) using the SUS and in 17 of 20 (85%) using the DP. Similarly, cessation of blood flow with clamping was documented in 100% of cases with SUS and 85% with DP. Persistent flow was detected by both SUS and DP in two patients requiring further dissection and reclamping. Then, both systems detected the absence of flow before tumor resection. With blood flow interruption confirmation, no patient had significant bleeding at the time of renal parenchymal transection. Intraoperative Doppler ultrasound technologies minimize the risk of significant bleeding during LPN. The DP is a small, simple, effective probe that can be used to assess blood flow interruption to the kidney during laparoscopic renal surgery.

[Managing focal incidental renal lesions].

PubMed

Nicolau, C; Paño, B; Sebastià, C

2016-01-01

Incidental renal lesions are relatively common in daily radiological practice. It is important to know the different diagnostic possibilities for incidentally detected lesions, depending on whether they are cystic or solid. The management of cystic lesions is guided by the Bosniak classification. In solid lesions, the goal is to differentiate between renal cancer and benign tumors such as fat-poor angiomyolipoma and oncocytoma. Radiologists need to know the recommendations for the management of these lesions and the usefulness of the different imaging techniques and interventional procedures in function of the characteristics of the incidental lesion and the patient's life expectancy. Copyright © 2015 SERAM. Published by Elsevier España, S.L.U. All rights reserved.

Use of three-dimensional time-resolved phase-contrast magnetic resonance imaging with vastly undersampled isotropic projection reconstruction to assess renal blood flow in a renal cell carcinoma patient treated with sunitinib: a case report.

PubMed

Takayama, Tatsuya; Takehara, Yasuo; Sugiyama, Masataka; Sugiyama, Takayuki; Ishii, Yasuo; Johnson, Kevin E; Wieben, Oliver; Wakayama, Tetsuya; Sakahara, Harumi; Ozono, Seiichiro

2014-08-14

New imaging modalities to assess the efficacy of drugs that have molecular targets remain under development. Here, we describe for the first time the use of time-resolved three-dimensional phase-contrast magnetic resonance imaging to monitor changes in blood supply to a tumor during sunitinib treatment in a patient with localized renal cell carcinoma. A 43-year-old Japanese woman with a tumor-bearing but functional single kidney presented at our hospital in July 2012. Computed tomography and magnetic resonance imaging revealed a cT1aN0M0 renal cell carcinoma embedded in the upper central region of the left kidney. She was prescribed sunitinib as neoadjuvant therapy for 8 months, and then underwent partial nephrectomy. Tumor monitoring during this time was done using time-resolved three-dimensional phase-contrast magnetic resonance imaging, a recent technique which specifically measures blood flow in the various vessels of the kidney. This imaging allowed visualization of the redistribution of renal blood flow during treatment, and showed that flow to the tumor was decreased and flows to other areas increased. Of note, this change occurred in the absence of any change in tumor size. The ability of time-resolved three-dimensional phase-contrast magnetic resonance imaging to provide quantitative information on blood supply to tumors may be useful in monitoring the efficacy of sunitinib treatment.

The Effect of Patient and Surgical Characteristics on Renal Function After Partial Nephrectomy.

PubMed

Winer, Andrew G; Zabor, Emily C; Vacchio, Michael J; Hakimi, A Ari; Russo, Paul; Coleman, Jonathan A; Jaimes, Edgar A

2018-06-01

The purpose of the study was to identify patient and disease characteristics that have an adverse effect on renal function after partial nephrectomy. We conducted a retrospective review of 387 patients who underwent partial nephrectomy for renal tumors between 2006 and 2014. A line plot with a locally weighted scatterplot smoothing was generated to visually assess renal function over time. Univariable and multivariable longitudinal regression analyses incorporated a random intercept and slope to evaluate the association between patient and disease characteristics with renal function after surgery. Median age was 60 years and most patients were male (255 patients [65.9%]) and white (343 patients [88.6%]). In univariable analysis, advanced age at surgery, larger tumor size, male sex, longer ischemia time, history of smoking, and hypertension were significantly associated with lower preoperative estimated glomerular filtration rate (eGFR). In multivariable analysis, independent predictors of reduced renal function after surgery included advanced age, lower preoperative eGFR, and longer ischemia time. Length of time from surgery was strongly associated with improvement in renal function among all patients. Independent predictors of postoperative decline in renal function include advanced age, lower preoperative eGFR, and longer ischemia time. A substantial number of subjects had recovery in renal function over time after surgery, which continued past the 12-month mark. These findings suggest that patients who undergo partial nephrectomy can experience long-term improvement in renal function. This improvement is most pronounced among younger patients with higher preoperative eGFR. Copyright © 2017 Elsevier Inc. All rights reserved.

Diabetes and Risk of Renal Cell Carcinoma

PubMed Central

Habib, Samy L; Prihoda, Thomas J; Luna, Maria; Werner, Sherry A

2012-01-01

Background and objectives: There is evidence that the incidence of solid tumors is markedly increased in patients with diabetes mellitus. In the current study, we investigate the association between diabetes and renal cancer. Patients and Methods: A single-center retrospective analysis of 473 patients who underwent nephrectomy for renal cell carcinoma (RCC) was performed. Diabetic RCC patients were screened for age, gender, ethnicity, HgA1C, glucose levels and renal function. Results: Of the 473 cases with RCC, we identified 120 patients (25.4%) with a history of diabetes. The incidence of diabetes in RCC patients was higher in female than male subjects and in Hispanic compared to White and Other ethnic backgrounds. At diagnosis, the majority of diabetic RCC patients were 50-59 years of age. In diabetic RCC cases, clear cell type histology (92.0%), nuclear grade 2 (56.1%) and tumor size range from 1-5 cm (65.7%) were the most common in each category. Conclusion: Our findings indicate that diabetic RCC patients have a predominance of localized, small clear cell RCC. In addition, females with a history of RCC have a higher frequency of diabetes compared to males. This is the first report of clinical and histopathological features of RCC associated with diabetes. PMID:22232697

Surgical planning and manual image fusion based on 3D model facilitate laparoscopic partial nephrectomy for intrarenal tumors.

PubMed

Chen, Yuanbo; Li, Hulin; Wu, Dingtao; Bi, Keming; Liu, Chunxiao

2014-12-01

Construction of three-dimensional (3D) model of renal tumor facilitated surgical planning and imaging guidance of manual image fusion in laparoscopic partial nephrectomy (LPN) for intrarenal tumors. Fifteen patients with intrarenal tumors underwent LPN between January and December 2012. Computed tomography-based reconstruction of the 3D models of renal tumors was performed using Mimics 12.1 software. Surgical planning was performed through morphometry and multi-angle visual views of the tumor model. Two-step manual image fusion superimposed 3D model images onto 2D laparoscopic images. The image fusion was verified by intraoperative ultrasound. Imaging-guided laparoscopic hilar clamping and tumor excision was performed. Manual fusion time, patient demographics, surgical details, and postoperative treatment parameters were analyzed. The reconstructed 3D tumor models accurately represented the patient's physiological anatomical landmarks. The surgical planning markers were marked successfully. Manual image fusion was flexible and feasible with fusion time of 6 min (5-7 min). All surgeries were completed laparoscopically. The median tumor excision time was 5.4 min (3.5-10 min), whereas the median warm ischemia time was 25.5 min (16-32 min). Twelve patients (80 %) demonstrated renal cell carcinoma on final pathology, and all surgical margins were negative. No tumor recurrence was detected after a media follow-up of 1 year (3-15 months). The surgical planning and two-step manual image fusion based on 3D model of renal tumor facilitated visible-imaging-guided tumor resection with negative margin in LPN for intrarenal tumor. It is promising and moves us one step closer to imaging-guided surgery.

Growth factors and renal cancer: characterization and therapeutic implications.

PubMed

Mydlo, J H

1995-01-01

The heterogeneiety renal-cell carcinoma can lead to unpredictable behavior: the ability to achieve a large volume yet not metastasize, the ability to demonstrate late recurrence or spontaneous regression, or the capability to metastasize at a relatively small volume. One-third of all patients who undergo radical nephrectomy for presumed localized disease will eventually have metastasis. Since renal-cell carcinoma is not significantly radio- or chemosensitive, it is important to investigate new avenues for treatment of this tumor once it has spread, specifically at the molecular level. This review discusses the most recent work on growth factors and renal cancer and proposes possible modalities for treatment.

Presentation of renal cell carcinoma as cervical polyp metastasis.

PubMed

Godfrey, Gwendolyn J; Moore, Grace; Alatassi, Houda

2010-10-01

Secondary cervical adenocarcinomas are most commonly seen owing to the extension of a primary endometrial adenocarcinoma. Metastatic tumors from other sites are rather uncommon and, when seen, are most frequently from the ovaries, gastrointestinal tract, or breast. We report a case of metastatic renal cell carcinoma, clear cell variant, to the cervix, which presented as a cervical polyp in a postmenopausal female. To our knowledge, this is the fourth reported case of renal cell carcinoma metastatic to the cervix. This case is only the third in which the cervical metastasis was the presenting sign of renal cell carcinoma and the first in which the clinical presentation was as a cervical polyp.

Renal oncocytoma characterized by the defective complex I of the respiratory chain boosts the synthesis of the ROS scavenger glutathione.

PubMed

Kürschner, Gerrit; Zhang, Qingzhou; Clima, Rosanna; Xiao, Yi; Busch, Jonas Felix; Kilic, Ergin; Jung, Klaus; Berndt, Nikolaus; Bulik, Sascha; Holzhütter, Hermann-Georg; Gasparre, Giuseppe; Attimonelli, Marcella; Babu, Mohan; Meierhofer, David

2017-12-01

Renal oncocytomas are rare benign tumors of the kidney and characterized by a deficient complex I (CI) enzyme activity of the oxidative phosphorylation (OXPHOS) system caused by mitochondrial DNA (mtDNA) mutations. Yet, little is known about the underlying molecular mechanisms and alterations of metabolic pathways in this tumor. We compared renal oncocytomas with adjacent matched normal kidney tissues on a global scale by multi-omics approaches, including whole exome sequencing (WES), proteomics, metabolomics, and metabolic pathway simulation. The abundance of proteins localized to mitochondria increased more than 2-fold, the only exception was a strong decrease in the abundance for CI subunits that revealed several pathogenic heteroplasmic mtDNA mutations by WES. We also observed renal oncocytomas to dysregulate main metabolic pathways, shunting away from gluconeogenesis and lipid metabolism. Nevertheless, the abundance of energy carrier molecules such as NAD + , NADH, NADP, ATP, and ADP were significantly higher in renal oncocytomas. Finally, a substantial 5000-fold increase of the reactive oxygen species scavenger glutathione can be regarded as a new hallmark of renal oncocytoma. Our findings demonstrate that renal oncocytomas undergo a metabolic switch to eliminate ATP consuming processes to ensure a sufficient energy supply for the tumor.

Genetic drivers of papillary renal cell carcinoma - TCGA

Cancer.gov

A comprehensive genomic analysis of 161 tumors from people with papillary renal cell carcinoma (PRCC) – the second most common form of kidney cancer –provided insights into the molecular basis of this cancer and may inform its classification and treatment.

Cytotoxic effect of the Her-2/Her-1 inhibitor PKI-166 on renal cancer cells expressing the connexin 32 gene.

PubMed

Fujimoto, Eriko; Yano, Tomohiro; Sato, Hiromi; Hagiwara, Kiyokazu; Yamasaki, Hiroshi; Shirai, Sumiko; Fukumoto, Keiko; Hagiwara, Hiromi; Negishi, Etsuko; Ueno, Koichi

2005-02-01

We have reported that connexin (Cx) 32 acts as a tumor suppressor gene in renal cancer cells partly due to Her-2 inactivation. Here, we determined if a Her-2/Her-1 inhibitor (PKI-166) can enhance the tumor-suppressive effect of Cx32 in Caki-2 cells from human renal cell carcinoma. The expression of Cx32 in Caki-2 cells was required for PKI-166-induced cytotoxic effect at lower doses. The cyctotoxicity was dependent on the occurrence of apoptosis and partly mediated by Cx32-driven gap junction intercellular communications. These results suggest that PKI-166 further supports the tumor-suppressive effect of the Cx32 gene in renal cancer cells through the induction of apoptosis.

Percutaneous Cryoablation of Solitary, Sporadic Renal Cell Carcinoma: Outcome Analysis Based on Clear-Cell versus Papillary Subtypes.

PubMed

Haddad, Mustafa M; Schmit, Grant D; Kurup, A Nicholas; Schmitz, John J; Boorjian, Stephen A; Geske, Jennifer; Thompson, R Houston; Callstrom, Matthew R; Atwell, Thomas D

2018-06-07

To evaluate treatment outcomes with percutaneous cryoablation (PCA) based on renal cell carcinoma (RCC) histology. Patients treated with PCA for a solitary, sporadic stage T1a RCC from 2003 to 2016 were identified from a single institution's renal ablation registry. Patients with multiple tumors, history of RCC, or genetic syndromes associated with RCC (n = 60); no specific RCC subtype determined from core biopsy (n = 66); RCC subtype other than clear-cell or papillary (n = 7); or less than 3 mo of follow-up imaging (n = 5) were excluded. In total, 173 patients met study inclusion criteria. Oncologic outcomes, clinical outcomes, and complications were evaluated based on tumor subtype. Of the 173 patients who underwent PCA for a stage T1a RCC, 130 (75%) had clear-cell RCC (ccRCC) and 43 (25%) had papillary RCC (pRCC). Median tumor size was 2.9 cm (range, 1.3-4.0 cm). Technically successful cryoablation was achieved in all 173 patients. Local tumor recurrence developed in 6 patients with ccRCC (4.6%), new renal tumors developed in 1 patient (0.8%), and metastatic RCC developed in 1 patient (0.8%) who also had local tumor recurrence. No patients with pRCC showed local tumor recurrence, new renal tumors, or metastatic disease. The 5-year disease-free survival rate in patients with ccRCC was 88%, compared with 100% in patients with pRCC (P = .48). Nine patients (5.2%), all with ccRCC, experienced major complications (P = .11). Percutaneous ablation is a viable treatment option for patients with clinical stage T1a pRCC and ccRCC. Percutaneous ablation may be a very favorable treatment strategy particularly for pRCC. Copyright © 2018 SIR. Published by Elsevier Inc. All rights reserved.

Primary Renal Sarcomas in the Intergroup Rhabdomyosarcoma Study Group (IRSG) Experience, 1972–2005: A Report from the Children’s Oncology Group

PubMed Central

Raney, Beverly; Anderson, James; Arndt, Carola; Crist, Willam; Maurer, Harold; Qualman, Stephen; Wharam, Moody; Meyer, William

2009-01-01

Purpose To describe clinical and pathologic characteristics and outcome of patients with renal sarcomas. Patients/Methods The IRSG database includes newly diagnosed patients <21 years old with rhabdomyosarcoma (RMS) or undifferentiated sarcoma (UDS). We identified patients with renal sarcoma and reviewed their charts. Results Ten of the 5,746 eligible IRSG patients enrolled from 1972–2005 had primary renal embryonal RMS (N=6) or UDS (N=4). Anaplasia was present in six (60%) of the tumors. Patients’ ages ranged from 2.6–17.8 years. Tumor diameters ranged from 7–15 cm (median, 12 cm). At diagnosis, seven patients had localized disease: four underwent complete removal of tumor (Group I), two had microscopic residual (Group II), and one had gross residual tumor (Group III). Three patients had distant metastases (Group IV) in lungs and bone. Nine patients received vincristine, actinomycin D and cyclophosphamide (VAC). Two Group I patients received no radiation therapy (XRT); others received XRT to the primary tumor and to some metastatic sites. Nine patients achieved complete disappearance of tumor, six due to the initial operation. Tumors recurred in lung (N=2) or brain (N=1) in Group IV patients; each died within 16 months. The Group III patient died of Aspergillus pneumonia. The six Group I and II patients survive, continuously disease-free, at 2.7 to 17.3 years (median, 4.7 years). Conclusions Patients with renal sarcomas often present with large tumors, many of them containing anaplastic features. Removing all gross disease at diagnosis, if feasible, is a critical component of treatment to curing patients with renal sarcoma. PMID:18523987

Improved laparoscopic nephron-sparing surgery for renal cell carcinoma based on the precise anatomy of the nephron.

PubMed

Guo, Gang; Cai, Wei; Zhang, Xu

2016-11-01

The aim of the present study was to investigate a method of laparoscopic nephron-sparing surgery (LNSS) for renal cell carcinoma (RCC) based on the precise anatomy of the nephron, and to decrease the incidence of hemorrhage and urinary leakage. Between January 2012 and December 2013, 31 patients who presented to the General Hospital of the People's Liberation Army (Beijing, China) were treated for RCC. The mean tumor size was 3.4±0.7 cm in diameter (range, 1.2-6.0 cm). During surgery, the renal artery was blocked, and subsequently, an incision in the renal capsule and renal cortex was performed, at 3-5 mm from the tumor edge. Subsequent to the incision of the renal parenchyma, scissors with blunt and sharp edge were used to separate the base of the tumor from the normal renal medulla, in the direction of the ray medullary in the renal pyramids. The basal blood vessels were incised following the hemostasis of the region using bipolar coagulation. The minor renal calyces were stripped carefully and the wound was closed with an absorbable sutures. The arterial occlusion time, duration of surgery, intraoperative bleeding volume, post-operative drainage volume, pathological results and complications were recorded. The surgery was successful for all patients. The estimated average intraoperative bleeding volume was 55.7 ml, the average surgical duration was 95.5 min, the average arterial occlusion time was 21.2 min, the average post-operative drainage volume was 92.3 ml and the average post-operative length of hospital stay was 6.1 days. No hemorrhage or urinary leakage was observed in the patients following the surgery. LNSS for RCC based on the precise anatomy of the nephron was concluded to be effective and feasible. The surgery is useful for the complete removal of tumors and guarantees a negative margin, which may also decrease the incidence of hemorrhage and urinary leakage following surgery.

[Clinical study on patients with renal-cell carcinoma accompanied with Von Hippel-Lindau disease treated with radiofrequency ablation].

PubMed

Nao, Tomoya; Shimamoto, Tsutomu; Karashima, Takashi; Kamei, Maiko; Fukuhara, Hideo; Fukata, Satoshi; Satake, Hirofumi; Ashida, Shingo; Yamasaki, Ichiro; Kamata, Masayuki; Inoue, Keiji; Yamanishi, Tomoaki; Ogawa, Yasuhiro; Ito, Satoshi; Shuin, Taro

2014-09-01

We report 12 renal cell carcinomas in 6 patients with Von Hippel-Lindau (VHL) disease treated with radiofrequency ablation (RFA). The mean age of the patients was 46 (range 38-53) years (male : 4, female : 2). Computed tomography (CT)-guided transcutaneous RFA was performed under conscious sedation with local anesthetics. The mean size of the tumors was 2.4 (range 0.7-8.1) cm. Nine of the 12 tumors (75%) were locally well controlled. However, 3 tumors in 2 patients developed visceral metastases after RFA. While minimal flank pain, nausea, perinephritic hematoma and lumbago were observed, there was no major complication during or after the procedure. The therapy with CT-guided transcutaneous RFA is efficient and minimal invasive for renal cell carcinoma in patients with VHL, leading to preservation of renal function.

MRI to assess renal structure and function.

PubMed

Artunc, Ferruh; Rossi, Cristina; Boss, Andreas

2011-11-01

In addition to excellent anatomical depiction, MRI techniques have expanded to study functional aspects of renal physiology, such as renal perfusion, glomerular filtration rate (GFR) or tissue oxygenation. This review will focus on current developments with an emphasis on clinical applicability. The method of GFR determination is largely heterogeneous and still has weaknesses. However, the technique of employing liver disappearance curves has been shown to be accurate in healthy persons and patients with chronic kidney disease. In potential kidney donors, complete evaluation of kidney anatomy and function can be accomplished in a single-stop investigation. Techniques without contrast media can be utilized to measure renal tissue oxygenation (blood oxygen level-dependent MRI) or perfusion (arterial spin labeling) and could aid in the diagnosis and treatment of ischemic renal diseases, such as renal artery stenosis. Diffusion imaging techniques may provide information on spatially restricted water diffusion and tumor cellularity. Functional MRI opens new horizons in studying renal physiology and pathophysiology in vivo. Although extensively utilized in research, labor-intensive postprocessing and lack of standardization currently limit the clinical applicability of functional MRI. Further studies are necessary to evaluate the clinical value of functional magnetic resonance techniques for early discovery and characterization of kidney disease.

Radiologic, pathologic and molecular attributes of two types of papillary renal adenocarcinomas.

PubMed

Mydlo, J H; Weinstein, R; Misseri, R; Axiotis, C; Thelmo, W

2001-09-01

Most papillary renal tumors are not as aggressive as clear cell carcinomas and thus carry a better prognosis. However, several reports in the literature have demonstrated a subset of patients with papillary tumors that have a more aggressive biology and advanced stage at presentation. We compared several parameters of these subsets of renal tumors in an effort to characterize these lesions. We reviewed 391 cases of nephrectomies that were performed for cancer over a 20-year period from four institutions. Of these, 41 were documented as papillary adenocarcinomas. We reviewed these cases with respect to stage at presentation, size, vascularity on (computerized tomography) CT scan, histology, and cytokeratin immunohistology. Thirty-two of the lesions presented in the fifth, sixth, seventh and eighth decades of life (Type I), while most of the remaining 9 tumors (Type II) presented in the fourth decade of life, and in more advanced stages. Tumor volumes ranged from 84 cm3 to 1660 cm3. Type I tumors had an average size of 515 cm3 and an enhancement on CT of 36 +/- 4 Hounsfield units, compared with Type II tumors which had an average size of 164 cm3 and an enhancement on CT of 92 +/- 8 Hounsfield units. Type II tumors also had a higher mean Fuhrman score of nuclear pleomorphism than Type I, and a greater expression of cytokeratin. We found that the more common Type I variant of papillary renal adenocarcinoma was less vascular on CT scan, larger in size, and had a lower amount of nuclear pleomorphism as well as decreased expression of cytokeratin 7. The more aggressive biological variant, Type II, presented in the earlier decades of life, with a smaller, but more vascular, cancer and had a greater nuclear pleomorphism. Nuclear pleomorphism still appears to have the best prognostic assessment. However, other molecular and genetic parameters of these tumors, as well as long-term survival data will be necessary to determine the significance of these findings.

Gamma-Secretase/Notch Signalling Pathway Inhibitor RO4929097 and Temsirolimus in Treating Patients With Advanced Solid Tumors

ClinicalTrials.gov

2014-05-29

Endometrial Papillary Serous Carcinoma; Recurrent Endometrial Carcinoma; Recurrent Renal Cell Cancer; Stage III Endometrial Carcinoma; Stage III Renal Cell Cancer; Stage IV Endometrial Carcinoma; Stage IV Renal Cell Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Obesity as defined by waist circumference but not body mass index is associated with higher renal mass complexity.

PubMed

Bertrand, Laura A; Thomas, Lewis J; Li, Peng; Buchta, Claire M; Boi, Shannon K; Orlandella, Rachael M; Brown, James A; Nepple, Kenneth G; Norian, Lyse A

2017-11-01

Obesity, typically defined as a body mass index (BMI)≥30kg/m 2 , is an established risk factor for renal cell carcinoma (RCC) but is paradoxically linked to less advanced disease at diagnosis and improved outcomes. However, BMI has inherent flaws, and alternate obesity-defining metrics that emphasize abdominal fat are available. We investigated 3 obesity-defining metrics, to better examine the associations of abdominal fat vs. generalized obesity with renal tumor stage, grade, or R.E.N.A.L. nephrometry score. In a prospective cohort of 99 subjects with renal masses undergoing resection and no evidence of metastatic disease, obesity was assessed using 3 metrics: body mass index (BMI), radiographic waist circumference (WC), and retrorenal fat (RRF) pad distance. R.E.N.A.L. nephrometry scores were calculated based on preoperative CT or MRI. Univariate and multivariate analyses were performed to identify associations between obesity metrics and nephrometry score, tumor grade, and tumor stage. In the 99 subjects, surgery was partial nephrectomy in 51 and radical nephrectomy in 48. Pathology showed benign masses in 11 and RCC in 88 (of which 20 had stage T3 disease). WC was positively correlated with nephrometry score, even after controlling for age, sex, race, and diabetes status (P = 0.02), whereas BMI and RRF were not (P = 0.13, and P = 0.57, respectively). WC in stage T2/T3 subjects was higher than in subjects with benign masses (P = 0.03). In contrast, subjects with Fuhrman grade 1 and 2 tumors had higher BMI (P<0.01) and WC (P = 0.04) than subjects with grade 3 and 4 tumors. Our data suggest that obesity measured by WC, but not BMI or RRF, is associated with increased renal mass complexity. Tumor Fuhrman grade exhibited a different trend, with both high WC and BMI associated with lower-grade tumors. Our findings indicate that WC and BMI are not interchangeable obesity metrics. Further evaluation of RCC-specific outcomes using WC vs. BMI is warranted to better

Targeted inactivation of fh1 causes proliferative renal cyst development and activation of the hypoxia pathway.

PubMed

Pollard, Patrick J; Spencer-Dene, Bradley; Shukla, Deepa; Howarth, Kimberley; Nye, Emma; El-Bahrawy, Mona; Deheragoda, Maesha; Joannou, Maria; McDonald, Stuart; Martin, Alison; Igarashi, Peter; Varsani-Brown, Sunita; Rosewell, Ian; Poulsom, Richard; Maxwell, Patrick; Stamp, Gordon W; Tomlinson, Ian P M

2007-04-01

Germline mutations in the fumarate hydratase (FH) tumor suppressor gene predispose to leiomyomatosis, renal cysts, and renal cell cancer (HLRCC). HLRCC tumors overexpress HIF1alpha and hypoxia pathway genes. We conditionally inactivated mouse Fh1 in the kidney. Fh1 mutants developed multiple clonal renal cysts that overexpressed Hif1alpha and Hif2alpha. Hif targets, such as Glut1 and Vegf, were upregulated. We found that Fh1-deficient murine embryonic stem cells and renal carcinomas from HLRCC showed similar overexpression of HIF and hypoxia pathway components to the mouse cysts. Our data have shown in vivo that pseudohypoxic drive, resulting from HIF1alpha (and HIF2alpha) overexpression, is a direct consequence of Fh1 inactivation. Our mouse may be useful for testing therapeutic interventions that target angiogenesis and HIF-prolyl hydroxylation.

Likelihood of Incomplete Kidney Tumor Ablation with Radio Frequency Energy: Degree of Enhancement Matters.

PubMed

Lay, Aaron H; Stewart, Jeremy; Canvasser, Noah E; Cadeddu, Jeffrey A; Gahan, Jeffrey C

2016-07-01

Larger size and clear cell histopathology are associated with worse outcomes for malignant renal tumors treated with radio frequency ablation. We hypothesize that greater tumor enhancement may be a risk factor for radio frequency ablation failure due to increased vascularity. A retrospective review of patients who underwent radio frequency ablation for renal tumors with contrast enhanced imaging available was performed. The change in Hounsfield units (HU) of the tumor from the noncontrast phase to the contrast enhanced arterial phase was calculated. Radio frequency ablation failure rates for biopsy confirmed malignant tumors were compared using the chi-squared test. Multivariate logistic analysis was performed to assess predictive variables for radio frequency ablation failure. Disease-free survival was calculated using Kaplan-Meier analysis. A total of 99 patients with biopsy confirmed malignant renal tumors and contrast enhanced imaging were identified. The incomplete ablation rate was significantly lower for tumors with enhancement less than 60 vs 60 HU or greater (0.0% vs 14.6%, p=0.005). On multivariate logistic regression analysis tumor enhancement 60 HU or greater (OR 1.14, p=0.008) remained a significant predictor of incomplete initial ablation. The 5-year disease-free survival for size less than 3 cm was 100% vs 69.2% for size 3 cm or greater (p <0.01), while 5-year disease-free survival for HU change less than 60 was 100% vs 92.4% for HU change 60 or greater (p=0.24). Biopsy confirmed malignant renal tumors, which exhibit a change in enhancement of 60 HU or greater, experience a higher rate of incomplete initial tumor ablation than tumors with enhancement less than 60 HU. Size 3 cm or greater portends worse 5-year disease-free survival after radio frequency ablation. The degree of enhancement should be considered when counseling patients before radio frequency ablation. Copyright © 2016 American Urological Association Education and Research, Inc

The Role of Interventional Radiology Techniques in the Management of Renal Angiomyolipomas.

PubMed

Kiefer, Ryan M; Stavropoulos, S William

2017-05-01

Although benign, renal angiomyolipoma (AML) may lead to serious complications without appropriate management. The purpose of this review is to describe the role of and evidence for interventional radiology techniques in the management of patients with AML. For patients with renal masses and non-diagnostic imaging studies, image-guided percutaneous biopsy is found to be highly accurate and useful in directing patient management. Once the diagnosis of AML has been made based on either imaging or biopsy, arterial embolization of tumors that are symptomatic or >4 cm has been demonstrated to reduce the risk of hemorrhage as well as tumor size. Percutaneous ablation devices have been proposed as alternative strategies but remain investigational. The utility of interventional radiology techniques including percutaneous core needle biopsy and prophylactic super-selective arterial embolization is safe and effective management strategies for patients presenting with AML tumors.

Understanding Papillary Renal Cell Carcinoma | Center for Cancer Research

Cancer.gov

Renal cell carcinoma (RCC), the most common form of kidney cancer in adults, is not a single disease but rather a collection of different tumor types driven by distinct genetic changes that arise within the same tissue.

Renal Carcinogenesis, Tumor Heterogeneity, and Reactive Oxygen Species: Tactics Evolved