Sample records for delayed type iv

  1. Delayed allergic dermatitis presenting as a keloid-like reaction caused by sting from an Indo-Pacific Portuguese man-o'-war (Physalia utriculus).

    PubMed

    Guevara, B E K; Dayrit, J F; Haddad, V

    2017-03-01

    Cnidarian envenomations are common occurrences in the tropics that can affect holidaymakers. The cutaneous reactions are classified as immediate or delayed types. Delayed allergic reactions are persistently recurring dermatitis, which can occur within 1-4 weeks from the initial sting, and may last for several months. Hypertrophic scar-like or keloid-like reactions are rare, and are believed to be a type IV hypersensitivity reaction to sequestered antigens from stinging filaments. We report an unusual case of delayed allergic dermatitis with keloid-like presentation caused by Physalia utriculus. © 2017 British Association of Dermatologists.

  2. A Strain-Sonde Technique for the Measurement of Mechanical Time-Delay Fuze Function Times and Performance

    DTIC Science & Technology

    1983-09-01

    AD IV) MEMORANDUM REPORT ARBRL-MR-03309 N(Supersedes IMR No. 760) A STRAIN -SONDE TECHNIQUE FOR THE MEASUREMENT OF MECHANICAL TIME- DELAY FUZE...and BkuWel) S. TYPE OF REPORT & PERIOD COVERED A STRAIN -SONDE TECHNIQUE FOR THE MEASUREMENT OF Final MECHANICAL TIME-DELAY FUZE FUNCTION TIMES AND S...nmber) M577 Mechanical Time-Delay Fuze F"/FM Telemeter Interlock Pin Release Semiconductor Strain Gage Rotor Signal Condition Amplifier Firing Pin In

  3. Immunotherapy using regulatory T cells in cancer suggests more flavors of hypersensitivity type IV.

    PubMed

    Pakravan, Nafiseh; Hassan, Zuhair Mohammad

    2018-03-01

    Regulatory T cells (Tregs) profoundly affect tumor microenvironment and exert dominant suppression over antitumor immunity in response to self-antigen expressed by tumor. Immunotherapy targeting Tregs lead to a significant improvement in antitumor immunity. Intradermal injection of tumor antigen results in negative delayed-type hypersensitivity (DTH) type IV. However, anti-Tregs treatment/use of adjuvant along with tumor antigens turns DTH to positive. Considering Tregs as the earliest tumor sensor/responders, tumor can be regarded as Treg-mediated type IV hypersensitivity and negative DTH to tumor antigen is due to anti-inflammatory action of Tregs to tumor antigens at the injection site. Such a view would help us in basic and clinical situations to testify a candidate vaccine via dermal administration and evaluation of Treg proportion at injection site.

  4. Polarization Characteristics of Zebra Patterns in Type IV Solar Radio Bursts

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaneda, K.; Misawa, H.; Tsuchiya, F.

    The polarization characteristics of zebra patterns (ZPs) in type IV solar bursts were studied. We analyzed 21 ZP events observed by the Assembly of Metric-band Aperture Telescope and Real-time Analysis System between 2010 and 2015 and identified the following characteristics: a degree of circular polarization (DCP) in the range of 0%–70%, a temporal delay of 0–70 ms between the two circularly polarized components (i.e., the right- and left-handed components), and dominant ordinary-mode emission in about 81% of the events. For most events, the relation between the dominant and delayed components could be interpreted in the framework of fundamental plasma emissionmore » and depolarization during propagation, though the values of DCP and delay were distributed across wide ranges. Furthermore, it was found that the DCP and delay were positively correlated (rank correlation coefficient R = 0.62). As a possible interpretation of this relationship, we considered a model based on depolarization due to reflections at sharp density boundaries assuming fundamental plasma emission. The model calculations of depolarization including multiple reflections and group delay during propagation in the inhomogeneous corona showed that the DCP and delay decreased as the number of reflections increased, which is consistent with the observational results. The dispersive polarization characteristics could be explained by the different numbers of reflections causing depolarization.« less

  5. FREQUENCY DEPENDENCE OF POLARIZATION OF ZEBRA PATTERN IN TYPE-IV SOLAR RADIO BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaneda, Kazutaka; Misawa, H.; Tsuchiya, F.

    2015-08-01

    We investigated the polarization characteristics of a zebra pattern (ZP) in a type-IV solar radio burst observed with AMATERAS on 2011 June 21 for the purpose of evaluating the generation processes of ZPs. Analyzing highly resolved spectral and polarization data revealed the frequency dependence of the degree of circular polarization and the delay between two polarized components for the first time. The degree of circular polarization was 50%–70% right-handed and it varied little as a function of frequency. Cross-correlation analysis determined that the left-handed circularly polarized component was delayed by 50–70 ms relative to the right-handed component over the entiremore » frequency range of the ZP and this delay increased with the frequency. We examined the obtained polarization characteristics by using pre-existing ZP models and concluded that the ZP was generated by the double-plasma-resonance process. Our results suggest that the ZP emission was originally generated in a completely polarized state in the O-mode and was partly converted into the X-mode near the source. Subsequently, the difference between the group velocities of the O-mode and X-mode caused the temporal delay.« less

  6. Dipeptidyl-peptidase IV (DPP-IV) inhibitor delays tolerance to anxiolytic effect of ethanol and withdrawal-induced anxiety in rats.

    PubMed

    Sharma, Ajaykumar N; Pise, Ashish; Sharma, Jay N; Shukla, Praveen

    2015-06-01

    Dipeptidyl-peptidase IV (DPP-IV) is an enzyme responsible for the metabolism of endogenous gut-derived hormone, glucagon-like peptide-1 (GLP-1). DPP-IV is known for its role in energy homeostasis and pharmacological blockade of this enzyme is a recently approved clinical strategy for the management of type II diabetes. Accumulating evidences suggest that enzyme DPP-IV can affect spectrum of central nervous system (CNS) functions. However, little is known about the role of this enzyme in ethanol-mediated neurobehavioral complications. The objective of the present study was to examine the impact of DPP-IV inhibitor, sitagliptin on the development of tolerance to anxiolytic effect of ethanol and anxiety associated with ethanol withdrawal in rats. A dose-response study revealed that sitaglitpin (20 mg/kg, p.o.) per se exhibit anxiolytic effect in the elevated plus maze (EPM) test in rats. Tolerance to anxiolytic effect of ethanol (2 g/kg, i.p.; 8 % w/v) was observed from 7(th) day of ethanol-diet (6 % v/v) consumption. In contrast, tolerance to anxiolytic effect of ethanol was delayed in rats that were treated daily with sitagliptin (20 mg/kg, p.o.) as tolerance was observed from 13(th)day since commencement of ethanol-diet consumption. Discontinuation of rats from ethanol-diet after 15-days of ethanol consumption resulted in withdrawal anxiety between 8 h and 12 h post-abstinence. However, rats on 15-day ethanol-diet with concomitant sitagliptin (20 mg/kg, p.o.) treatment exhibited delay in appearance (24 h post-withdrawal) of withdrawal anxiety. In summary, DPP-IV inhibitors may prove as an attractive research strategy against ethanol tolerance and dependence.

  7. Modulation of type I immediate and type IV delayed immunoreactivity using direct suggestion and guided imagery during hypnosis.

    PubMed

    Zachariae, R; Bjerring, P; Arendt-Nielsen, L

    1989-11-01

    Cutaneous reactivity against histamine skin prick test (Type I) and purified tuberculin protein derivative (Mantoux reaction, Type IV) was studied in eight volunteers under hypnosis. Types I and IV immunoreactivity were modulated by direct suggestion (Type I) and guided imagery (Type IV). The volunteers were highly susceptible subjects, selected by means of the Harvard Group Scale of Hypnotic Susceptibility, Form A. When the volunteers underwent hypnotic suggestion to decrease the cutaneous reaction to histamine prick test, a significant (P less than 0.02) reduction of the flare reaction (area of erythema) was observed compared with control histamine skin prick tests. The wheal reaction did not respond to hypnotic suggestion. Neither wheal nor flare reaction could be increased in size by hypnotic suggestion compared with control histamine skin prick tests. A hypnotic suggestion of increasing the Type IV reaction on one arm and decreasing the reaction on the other revealed a significant difference in both erythema size (P less than 0.02) and palpable induration (P less than 0.01). In two cases the reactions were monitored by laser doppler blood flowmetry and skin thickness measurement by ultrasound. The difference between the suggested increased and decreased reaction was 19% for the laser doppler bloodflow (in favor of the augmented side), and 44% for the dermal infiltrate thickness. This study objectively supports the numerous uncontrolled case reports of modulation of immunoreactivity in allergic diseases involving both Type I and Type IV skin reactions following hypnotic suggestions.

  8. Testing for Drug Hypersensitivity Syndromes

    PubMed Central

    Rive, Craig M; Bourke, Jack; Phillips, Elizabeth J

    2013-01-01

    Adverse drug reactions are a common cause of patient morbidity and mortality. Type B drug reactions comprise only 20% of all drug reactions but they tend to be primarily immunologically mediated and less dependent on the drug’s pharmacological action and dose. Common Type B reactions seen in clinical practice are those of the immediate, IgE, Gell-Coombs Type I reactions, and the delayed, T-cell mediated, Type IV reactions. Management of these types of reactions, once they have occurred, requires careful consideration and recognition of the utility of routine diagnostic tests followed by ancillary specialised diagnostic testing. For Type I, IgE mediated reactions this includes prick/intradermal skin testing and oral provocation. For Type IV, T-cell mediated reactions this includes a variety of in vivo (patch testing) and ex vivo tests, many of which are currently mainly used in highly specialised research laboratories. The recent association of many serious delayed (Type IV) hypersensitivity reactions to specific drugs with HLA class I and II alleles has created the opportunity for HLA screening to exclude high risk populations from exposure to the implicated drug and hence prevent clinical reactions. For example, the 100% negative predictive value of HLA-B*5701 for true immunologically mediated abacavir hypersensitivity and the development of feasible, inexpensive DNA-based molecular tests has led to incorporation of HLA-B*5701 screening in routine HIV clinical practice. The mechanism by which drugs specifically interact with HLA has been recently characterised and promises to lead to strategies for pre-clinical screening to inform drug development and design. PMID:23592889

  9. Airport Network Flow Simulator

    DOT National Transportation Integrated Search

    1978-10-01

    The Airport Network Flow Simulator is a FORTRAN IV simulation of the flow of air traffic in the nation's 600 commercial airports. It calculates for any group of selected airports: (a) the landing and take-off (Type A) delays; and (b) the gate departu...

  10. IVS Pilot Project - Tropospheric Parameters

    NASA Astrophysics Data System (ADS)

    Boehm, J.; Schuh, H.; Engelhardt, G.; MacMillan, D.; Lanotte, R.; Tomasi, P.; Vereshchagina, I.; Haas, R.; Negusini, M.; Gubanov, V.

    2003-04-01

    In April 2002 the IVS (International VLBI Service for Geodesy and Astrometry) set up the IVS Pilot Project - Tropospheric Parameters and the Institute of Geodesy and Geophysics (IGG), Vienna, was asked to coordinate the project. After a call for participation six IVS Analysis Centers have joined the project and submitted their estimates of tropospheric parameters (wet and total zenith delays, horizontal gradients) for all IVS-R1 and IVS-R4 sessions since January 1st, 2002, on a regular basis. Using a two-step procedure the individual submissions are combined to stable and robust tropospheric parameters with 1h resolution and high accuracy. The zenith delays derived by VLBI are also compared with those provided by IGS (International GPS Service). At collocated sites (VLBI and GPS antennas at the same station) rather constant biases are found between the GPS and VLBI derived zenith delays, although both techniques are subject to the same tropospheric delays. Possible reasons for these biases are discussed.

  11. Novel NTRK1 mutations cause hereditary sensory and autonomic neuropathy type IV: demonstration of a founder mutation in the Turkish population.

    PubMed

    Tüysüz, Beyhan; Bayrakli, Fatih; DiLuna, Michael L; Bilguvar, Kaya; Bayri, Yasar; Yalcinkaya, Cengiz; Bursali, Aysegul; Ozdamar, Elif; Korkmaz, Baris; Mason, Christopher E; Ozturk, Ali K; Lifton, Richard P; State, Matthew W; Gunel, Murat

    2008-05-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN IV), or congenital insensitivity to pain with anhidrosis, is an autosomal recessive disorder characterized by insensitivity to noxious stimuli, anhidrosis from deinnervated sweat glands, and delayed mental and motor development. Mutations in the neurotrophic tyrosine kinase receptor type 1 (NTRK1), a receptor in the neurotrophin signaling pathway phosphorylated in response to nerve growth factor, are associated with this disorder. We identified six families from Northern Central Turkey with HSAN IV. We screened the NTRK1 gene for mutations in these families. Microsatellite and single nucleotide polymorphism (SNP) markers on the Affymetrix 250K chip platform were used to determine the haplotypes for three families harboring the same mutation. Screening for mutations in the NTRK1 gene demonstrated one novel frameshift mutation, two novel nonsense mutations, and three unrelated kindreds with the same splice-site mutation. Genotyping of the three families with the identical splice-site mutation revealed that they share the same haplotype. This report broadens the spectrum of mutations in NTRK1 that cause HSAN IV and demonstrates a founder mutation in the Turkish population.

  12. On the type Ia supernovae 2007on and 2011iv: evidence for Chandrasekhar-mass explosions at the faint end of the luminosity-width relationship

    NASA Astrophysics Data System (ADS)

    Ashall, C.; Mazzali, P. A.; Stritzinger, M. D.; Hoeflich, P.; Burns, C. R.; Gall, C.; Hsiao, E. Y.; Phillips, M. M.; Morrell, N.; Foley, Ryan J.

    2018-06-01

    Radiative transfer models of two transitional type Ia supernovae (SNe Ia) have been produced using the abundance stratification technique. These two objects - designated SN 2007on and SN 2011iv - both exploded in the same galaxy, NGC 1404, which allows for a direct comparison. SN 2007on synthesized 0.25 M_{⊙} of 56Ni and was less luminous than SN 2011iv, which produced 0.31 M_{⊙} of 56Ni. SN 2007on had a lower central density (ρc) and higher explosion energy (Ekin ˜1.3 ± 0.3 × 1051erg) than SN 2011iv, and it produced less nuclear statistical equilibrium (NSE) elements (0.06 M_{⊙}). Whereas, SN 2011iv had a larger ρc, which increased the electron capture rate in the lowest velocity regions, and produced 0.35 M_{⊙} of stable NSE elements. SN 2011iv had an explosion energy of ˜Ekin ˜0.9 ± 0.2 × 1051erg. Both objects had an ejecta mass consistent with the Chandrasekhar mass (Ch-mass), and their observational properties are well described by predictions from delayed-detonation explosion models. Within this framework, comparison to the sub-luminous SN 1986G indicates SN 2011iv and SN 1986G have different transition densities (ρtr) but similar ρc. Whereas SN 1986G and SN 2007on had a similar ρtr but different ρc. Finally, we examine the colour-stretch parameter sBV versus Lmax relation and determine that the bulk of SNe Ia (including the sub-luminous ones) are consistent with Ch-mass delayed-detonation explosions, where the main parameter driving the diversity is ρtr. We also find ρc to be driving the second-order scatter observed at the faint end of the luminosity-width relationship.

  13. A novel GBE1 gene variant in a child with glycogen storage disease type IV.

    PubMed

    Said, Samar M; Murphree, Marine I; Mounajjed, Taofic; El-Youssef, Mounif; Zhang, Lizhi

    2016-08-01

    Glycogen storage disease type IV is an autosomal recessive disorder of carbohydrates caused by deficiency of amylo-1-4-glycanoglycosyltransferase, which leads to accumulation of amylopectin-like polysaccharides in tissues including liver, heart and neuromuscular system. More than 40 different mutations in the glycogen branching enzyme gene (GBE1) have been described. In this study, we report a 2-year-old boy who presented with developmental delay and muscle weakness. He subsequently was diagnosed with glycogen storage disease type IV based on a liver biopsy histology and electron microscopy. Glycogen branching enzyme activity was in the low range. Genetic analysis demonstrated a novel heterozygous variant (c.760A>G; p.Thr254Ala) in exon 6 of the GBE1 gene, which is believed to be pathogenic. This variant was inherited from the patient's mother who was asymptomatic with normal glycogen branching enzyme activity. Whole-exome sequencing failed to reveal additional variations in the GBE1 gene. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Prolonged survival of dendritic cell-vaccinated melanoma patients correlates with tumor-specific delayed type IV hypersensitivity response and reduction of tumor growth factor beta-expressing T cells.

    PubMed

    López, Mercedes N; Pereda, Cristian; Segal, Gabriela; Muñoz, Leonel; Aguilera, Raquel; González, Fermín E; Escobar, Alejandro; Ginesta, Alexandra; Reyes, Diego; González, Rodrigo; Mendoza-Naranjo, Ariadna; Larrondo, Milton; Compán, Alvaro; Ferrada, Carlos; Salazar-Onfray, Flavio

    2009-02-20

    The aim of this work was to assess immunologic response, disease progression, and post-treatment survival of melanoma patients vaccinated with autologous dendritic cells (DCs) pulsed with a novel allogeneic cell lysate (TRIMEL) derived from three melanoma cell lines. Forty-three stage IV and seven stage III patients were vaccinated four times with TRIMEL/DC vaccine. Specific delayed type IV hypersensitivity (DTH) reaction, ex vivo cytokine production, and regulatory T-cell populations were determined. Overall survival and disease progression rates were analyzed using Kaplan-Meier curves and compared with historical records. The overall survival for stage IV patients was 15 months. More than 60% of patients showed DTH-positive reaction against the TRIMEL. Stage IV/DTH-positive patients displayed a median survival of 33 months compared with 11 months observed for DTH-negative patients (P = .0014). All stage III treated patients were DTH positive and remained alive and tumor free for a median follow-up period of 48 months (range, 33 to 64 months). DTH-positive patients showed a marked reduction in the proportion of CD4+ transforming growth factor (TGF) beta+ regulatory T cells compared to DTH-negative patients (1.54% v 5.78%; P < .0001). Our findings strongly suggest that TRIMEL-pulsed DCs provide a standardized and widely applicable source of melanoma antigens, very effective in evoking antimelanoma immune response. To our knowledge, this is the first report describing a correlation between vaccine-induced reduction of CD4+TGFbeta+ regulatory T cells and in vivo antimelanoma immune response associated to improved patient survival and disease stability.

  15. Material-specific retroactive interference effects of the Wechsler Adult Intelligence Scale-Fourth Edition on the Wechsler Memory Scale-Fourth Edition in a nonclinical sample.

    PubMed

    Ingram, Nicolette S; Diakoumakos, Jessica V; Sinclair, Erin R; Crowe, Simon F

    2016-01-01

    This study investigated proactive and retroactive interference effects between the Wechsler Memory Scale-Fourth Edition (WMS-IV) using the flexible approach, and the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). One hundred and eighty nonclinical participants were assigned to a four (visual interference, verbal interference, visual and verbal interference, vs. no interference) by two (retroactive vs. proactive) between-subjects design. The administration order of the tests was counterbalanced (i.e., administration of the WAIS-IV prior to the WMS-IV, and the WAIS-IV administered during the delay interval of the WMS-IV). The WAIS-IV produced significant retroactive interference effects on the WMS-IV; however, no proactive interference effect was observed. The retroactive interference effect was dependent on material specificity. The results indicate that material presented within the delay of the WMS-IV can have a significant effect on subsequent delayed recall. Clinicians should carefully consider the effects associated with carry-over effects of these tests when using them in combination.

  16. Delayed Enhancement of Ascites After IV Contrast Material Administration at CT: Time Course and Clinical Correlation

    PubMed Central

    Benedetti, Nancy; Aslam, Rizwan; Wang, Zhen J.; Joe, Bonnie N.; Fu, Yanjun; Yee, Judy; Yeh, Benjamin M.

    2010-01-01

    OBJECTIVE The objective of our study was to determine the prevalence and clinical predictors of delayed contrast enhancement of ascites. MATERIALS AND METHODS In this retrospective study, 132 consecutive patients with ascites who underwent repeated abdominopelvic CT examinations performed within 7 days of each other were identified. These patients included 112 patients who received and 20 who did not receive IV contrast material at the initial CT examination. For each examination, we recorded the CT attenuation of the ascites. For the follow-up scan, the presence of delayed enhancement of ascites was defined as an increase in CT attenuation > 10 HU over baseline. The Fisher’s exact test, unpaired Student’s t test, and logistic regression were used to determine predictors of delayed enhancement of ascites. RESULTS A threshold increase in the attenuation of ascites by > 10 HU or more between the initial and follow-up CT examinations occurred only when IV contrast material was given with the initial examination. The increased attenuation was due to delayed contrast enhancement of ascites and occurred in 15 of the 112 patients (13%). Of the 16 patients scanned less than 1 day apart, 10 (63%) showed delayed enhancement of ascites. Delayed enhancement was not observed 3 or more days after IV contrast material administration. For each 1 mg/dL increase in serum creatinine level, the likelihood of delayed enhancement of ascites increased (odds ratio, 2.02; 95% CI, 1.11–3.69). Multivariate logistic regression showed that a short time interval between examinations (p < 0.001), increased serum creatinine level (p < 0.001), and presence of loculated ascites (p = < 0.01) were independent predictors of the magnitude of delayed enhancement of ascites. CONCLUSION Delayed contrast enhancement of ascites occurs commonly after recent prior IV contrast material administration and should not be mistaken for hemoperitoneum or proteinaceous fluid such as pus. PMID:19696286

  17. Protein contact dermatitis: allergens, pathogenesis, and management.

    PubMed

    Levin, Cheryl; Warshaw, Erin

    2008-01-01

    Protein contact dermatitis is an allergic skin reaction induced principally by proteins of either animal or plant origin. The clinical presentation is that of a chronic dermatitis, and it is often difficult to differentiate between allergic contact dermatitis and other eczematous dermatoses. One distinguishing clinical feature is that acute flares of pruritus, urticaria, edema, or vesiculation are noted minutes after contact with the causative substances. Additionally, the patch-test result is typically negative, and the scratch- or prick-test result is positive. The pathogenesis of protein contact dermatitis is unclear but may involve a type I (immunoglobulin E [IgE], immediate) hypersensitivity reaction, type IV (cell-mediated delayed) hypersensitivity reaction, and/or a delayed reaction due to IgE-bearing Langerhans' cells. Management involves avoidance of the allergen.

  18. Tropospheric Parameters Determined by VLBI Within the IVS

    NASA Astrophysics Data System (ADS)

    Schuh, H.; Boehm, J.

    2003-12-01

    In April 2002 the IVS (International VLBI Service for Geodesy and Astrometry) set up the Pilot Project - Tropospheric Parameters, and the Institute of Geodesy and Geophysics (IGG), Vienna, was put in charge of coordinating the project. Seven IVS Analysis Centers have joined the project and regularly submitted their estimates of tropospheric parameters (wet and total zenith delays, horizontal gradients) for all IVS-R1 and IVS-R4 sessions since January 1st, 2002. The individual submissions are combined by a two-step procedure to obtain stable, robust and highly accurate tropospheric parameter time series with one hour resolution. The internal accuracy of the combined wet zenith delays is between 2 and 4 mm. The zenith delays derived by VLBI are compared with those provided by the International GPS Service (IGS). At sites with co-located VLBI and GPS antennas the short-term variabilities of the GPS and VLBI derived zenith delays generally show a good agreement but biases are found between the results of the two techniques. Possible reasons for these biases are discussed. Since July 1st, 2003, within the IVS the tropospheric parameters are determined as operational products. The presentation also includes the VLBI CONT02 campaign of 15 days of continuous observing in the second half of October 2002.

  19. Using the Vessel Health and Preservation framework to enhance vein assessment and vascular access device selection.

    PubMed

    Shaw, Sally Jane

    2017-07-12

    There is a range of risk factors that can lead to peripheral intravenous (IV) cannula failure, and several failed cannulation attempts can result in the patient experiencing increased pain, discomfort and delays in receiving IV therapy. The Vessel Health and Preservation (VHP) framework is a tool that can be used to improve clinical decision-making and the patient experience in relation to vascular access and IV therapy. Use of the VHP framework can ensure the right vein and right vascular access device (VAD) is selected at the right time for each patient. This article describes how healthcare practitioners can use the VHP framework to support and enhance vein assessment and VAD selection. It outlines the various types of VAD available, focusing on short-term peripheral IV cannulae, which are the most commonly used devices. It also explores the potential benefits of implementing the VHP framework in clinical areas.

  20. A unifying concept: pancreatic ductal anatomy both predicts and determines the major complications resulting from pancreatitis.

    PubMed

    Nealon, William H; Bhutani, Manoop; Riall, Taylor S; Raju, Gottumukkala; Ozkan, Orhan; Neilan, Ryan

    2009-05-01

    Precepts about acute pancreatitis, necrotizing pancreatitis, and pancreatic fluid collections or pseudocyst rarely include the impact of pancreatic ductal injuries on their natural course and outcomes. We previously examined and established a system to categorize ductal changes. We sought a unifying concept that may predict course and direct therapies in these complex patients. We use our system categorizing ductal changes in pseudocyst of the pancreas and severe necrotizing pancreatitis (type I, normal duct; type II, duct stricture; type III, duct occlusion or "disconnected duct"; and type IV, chronic pancreatitis). From 1985 to 2006, a policy was implemented of routine imaging (cross-sectional, endoscopic retrograde cholangiopancreatography, or magnetic resonance cholangiopancreatography). Clinical outcomes were measured. Among 563 patients with pseudocyst, 142 resolved spontaneously (87% of type I, 5% of type II, and no type III, and 3% of type IV). Percutaneous drainage was successful in 83% of type I, 49% of type II, and no type III or type IV. Among 174 patients with severe acute pancreatitis percutaneous drainage was successful in 64% of type I, 38% of type II, and no type III. Operative debridement was required in 39% of type I and 83% and 85% of types II and III, respectively. Persistent fistula after debridement occurred in 27%, 54%, and 85% of types I, II, and III ducts, respectively. Late complications correlated with duct injury. Pancreatic ductal changes predict spontaneous resolution, success of nonoperative measures, and direct therapies in pseudocyst. Ductal changes also predict patients with necrotizing pancreatitis who are most likely to have immediate and delayed complications.

  1. Acute cocaine induced deficits in cognitive performance in rhesus macaque monkeys treated with baclofen

    PubMed Central

    Porrino, Linda J.; Hampson, Robert E.; Opris, Ioan; Deadwyler, Samuel A.

    2013-01-01

    Rationale Acute and/or chronic exposure to cocaine can affect cognitive performance, which may influence rate of recovery during treatment. Objective Effects of the GABA-B receptor agonist baclofen were assessed for potency to reverse the negative influence of acute, pre-session, intravenous (IV) injection of cocaine on cognitive performance in Macaca mulatta nonhuman primates. Methods Animals were trained to perform a modified delayed match to sample (DMS) task incorporating two types of trials with varying degrees of cognitive load that had different decision requirements in order to correctly utilize information retained over the delay interval. The effects of cocaine (0.2, 0.4, and 0.6 mg/kg, IV) alone and in combination with baclofen (0.29 and 0.40 mg/kg, IV) were examined with respect to sustained performance levels. Brain metabolic activity during performance of the task was assessed using PET imaged uptake of [18F]-fluorodeoxyglucose. Results Acute cocaine injections produced a dose-dependent decline in DMS performance selective for trials of high cognitive load. The GABA-receptor agonist baclofen, co-administered with cocaine, reversed task performance back to nondrug (saline IV) control levels. Simultaneous assessment of PET-imaged brain metabolic activity in prefrontal cortex (PFC) showed alterations by cocaine compared to PFC metabolic activation in nondrug (saline, IV) control DMS sessions, but like performance, PFC activation was returned to control levels by baclofen (0.40 mg/kg, IV) injected with cocaine. Conclusions The results show that baclofen, administered at a relatively high dose, reversed the cognitive deficits produced by acute cocaine intoxication that may have implications for use in chronic drug exposure. PMID:22836369

  2. PKCδ phosphorylation is an upstream event of GSK3 inactivation-mediated ROS generation in TGF-β1-induced senescence.

    PubMed

    Byun, H-O; Jung, H-J; Kim, M-J; Yoon, G

    2014-09-01

    Transforming growth factor β1 (TGF-β1) induces Mv1Lu cell senescence through inactivating glycogen synthase kinase 3 (GSK3), thereby inactivating complex IV and increasing intracellular ROS. In the present study, we identified protein kinase C delta (PKCδ) as an upstream regulator of GSK3 inactivation in this mechanism of TGF-β1-induced senescence. When Mv1Lu cells were exposed to TGF-β1, PKCδ phosphorylation simultaneously increased with GSK3 phosphorylation, and then AKT and ERK were phosphorylated. AKT phosphorylation and Smad signaling were independent of GSK3 phosphorylation, but ERK phosphorylation was downstream of GSK3 inactivation. TGF-β1-triggered GSK3 phosphorylation was blocked by inhibition of PKCδ, using its pharmacological inhibitor, Rottlerin, or overexpression of a dominant negative PKCδ mutant, but GSK3 inhibition with SB415286 did not alter PKCδ phosphorylation. Activation of PKCδ by PMA delayed cell growth and increased intracellular ROS level, but did not induce senescent phenotypes. In addition, overexpression of wild type or a constitutively active PKCδ mutant was enough to delay cell growth and decrease the mitochondrial oxygen consumption rate and complex IV activity, but weakly induce senescence. However, PMA treatment on Mv1Lu cells, which overexpress wild type and constitutively active PKCδ mutants, effectively induced senescence. These results indicate that PKCδ plays a key role in TGF-β1-induced senescence of Mv1Lu cells through the phosphorylation of GSK3, thereby triggering mitochondrial complex IV dysfunction and intracellular ROS generation.

  3. [Comparison on Oral versus Intravenous Proton Pump Inhibitors for Prevention of Bleeding after Endoscopic Submucosal Dissection of Gastric Lesions].

    PubMed

    Jung, Yeoun Su; Kim, Kyeong Ok; Lee, Si Hyung; Jang, Byung Ik; Kim, Tae Nyeun

    2016-02-01

    Although intravenous proton pump inhibitor (PPI) has been used for the prevention of post endoscopic submucosal dissection (ESD) bleeding, the route of administration has not been confirmed. The aim of the present study was to compare the efficacy of intravenous and oral PPI administration for the prevention of delayed post ESD bleeding. Total 166 consecutive patients were randomly assigned to 30 mg lansoprazol twice a day (PO group) and 120 mg pantoprazole intravenous injection (IV group) for 48 hours. Finally, 65 patients in PO group and 87 patients in IV group were analyzed. After ESD, all patients underwent follow up endoscopy after 24 hours and were observed the symptoms of bleeding up to 60 days after ESD. Age, sex and use of anticoagulants were not different between groups. At follow up endoscopy after 24 hours, oozing and exposed vessel was noted in 4.6% of PO group and 8.0% of IV group and there was no significant difference. Delayed bleeding occurred in 4 of 65 patients (6.2%) in the PO group and 8 of 87 patients (9.2%) in the IV group (p>0.999). By multivariate analysis, oozing or exposed vessels at follow up endoscopy were risk factors for delayed bleeding (OR=17.5, p=0.022). There was no significant difference in the delayed bleeding, length of hospital stay according to the administration route. Bleeding stigmata at follow up endoscopy was risk factor of delayed bleeding. Oral PPI administration can cost-effectively replace IV PPI for prevention of post ESD bleeding.

  4. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    PubMed

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  5. Evolution of Query Optimization Methods

    NASA Astrophysics Data System (ADS)

    Hameurlain, Abdelkader; Morvan, Franck

    Query optimization is the most critical phase in query processing. In this paper, we try to describe synthetically the evolution of query optimization methods from uniprocessor relational database systems to data Grid systems through parallel, distributed and data integration systems. We point out a set of parameters to characterize and compare query optimization methods, mainly: (i) size of the search space, (ii) type of method (static or dynamic), (iii) modification types of execution plans (re-optimization or re-scheduling), (iv) level of modification (intra-operator and/or inter-operator), (v) type of event (estimation errors, delay, user preferences), and (vi) nature of decision-making (centralized or decentralized control).

  6. Which DSM-IV-TR Criteria Best Differentiate High-Functioning Autism Spectrum Disorder from ADHD and Anxiety Disorders in Older Children?

    ERIC Educational Resources Information Center

    Hartley, Sigan L.; Sikora, Darryn M.

    2009-01-01

    Diagnosis of autism spectrum disorder (ASD) is often delayed in high-functioning children with milder and more varied forms of ASD. The substantial overlap between ASD and other psychiatric disorders is thought to contribute to this delay. This study examined the endorsement of DSM-IV-TR diagnostic criteria for ASD based on semi-structured parent…

  7. Equipoise among recanalization strategies.

    PubMed

    Tomsick, T A; Khatri, P; Jovin, T; Demaerschalk, B; Malisch, T; Demchuk, A; Hill, M D; Jauch, E; Spilker, J; Broderick, J P

    2010-03-30

    Modern acute ischemic stroke therapy is based on the premise that recanalization and subsequent reperfusion are essential for the preservation of brain tissue and favorable clinical outcomes. We outline key issues that we think underlie equipoise regarding the comparative clinical efficacy of IV recombinant tissue-type plasminogen activator (rt-PA) and intra-arterial (IA) reperfusion therapies for acute ischemic stroke. On the one hand, IV rt-PA therapy has the benefit of speed with presumed lower rates of recanalization of large artery occlusions as compared to IA methods. More recent reports of major arterial occlusions treated with IV rt-PA, as measured by transcranial Doppler and magnetic resonance angiography, demonstrate higher rates of recanalization. Conversely, IA therapies report higher recanalization rates, but are hampered by procedural delays and risks, even failing to be applied at all in occasional patients where time to reperfusion remains a critical factor. Higher rates of recanalization in IA trials using clot-removal devices have not translated into improved patient functional outcome as compared to trials of IV therapy. Combined IV-IA therapy promises to offer advantages of both, but perhaps only when applied in the timeliest of fashions, compared to IV therapy alone. Where equipoise exists, randomizing subjects to either IV rt-PA therapy or IV therapy followed by IA intervention, while incorporating new interventions into the study design, is a rational and appropriate research approach.

  8. Delayed haemolysis secondary to treatment of severe malaria with intravenous artesunate: Report on the experience of a referral centre for tropical infections in Spain.

    PubMed

    Aldámiz-Echevarría Lois, Teresa; López-Polín, Ana; Norman, Francesca F; Monge-Maillo, Begoña; López-Vélez, Rogelio; Perez-Molina, Jose A

    Post-artesunate delayed haemolysis is described as hemolytic anemia presenting days after malaria treatment in hyperparasitemic patients. Physiopathological mechanisms and clinical manifestations have not been thoroughly characterised. We conducted a retrospective study of hospitalised malaria patients who received artemisinin derivatives from January 1, 2010 to December 31, 2015. 21 patients were included in the study: 11 travellers, 8 travellers visiting friends and relatives and 2 immigrants. Median age was 35.5 years (IQR: 25.7-44.8) and 11 were men. Eight patients received oral and 13 received intravenous (IV) artemisinin-based drugs. Follow-up after the malaria episode was available for 15 patients (12 with IV treatment). Four patients presented with delayed haemolysis 9-14 days after artesunate treatment; all had been admitted with severe malaria, were treated IV and had hyperparasitaemia (17%-33%). Other than hyperparasitaemia, no other factors were associated with artesunate haemolysis. Patients' outcomes were favourable and the only additional therapeutic measure needed was a blood transfusion. Delayed haemolysis is a frequent complication in hyperparasitemic malaria treated with IV artesunate. Follow-up is mandatory for at least 2 weeks after treatment initiation. This condition is potentially severe but does not appear to be life threatening. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Conctact dermatitis: some important topics.

    PubMed

    Pigatto, P D

    2015-11-01

    Allergic contact dermatitis (ACD) is a type IV delayed hypersensitivity reaction. The gold standard for diagnosis is patch testing. The prevalence of positive patch tests in referred patients with suspected ACD ranges from 27 to 95.6%. The relationship between ACD and atopic dermatitis (AD) is complicated with conflicting reports of prevalence in the literature; however, in a patient with dermatitis not responding to traditional therapies, or with new areas of involvement, ACD should be considered as part of the work-up.

  10. Glomerular pathology in Alport syndrome: a molecular perspective

    PubMed Central

    Cosgrove, Dominic

    2012-01-01

    We have known for some time that mutations in the genes encoding 3 of the 6 type IV collagen chains are the underlying defect responsible for both X-linked (where the COL4A5 gene is involved) and autosomal (where either COL4A3 or COL4A4 genes are involved) Alport syndrome. The result of these mutations is the absence of the sub-epithelial network of all three chains in the glomerular basement membrane (GBM) resulting, at maturity, in a type IV collagen GBM network comprised of only α1(IV) and α2(IV) chains. The altered GBM functions adequately in early life. Eventually there is onset of proteinuria associated with the classic and progressive irregular thickening, thinning, and splitting of the GBM, which culminates in end stage renal failure. We have learned much about the molecular events associated with disease onset and progression through the study of animal models for Alport syndrome, and have identified some potential therapeutic approaches that may serve to delay the onset or slow the progression of the disease. This review focuses on where we are in our understanding of the disease, where we need to go to understand the molecular triggers that set the process in motion, and what emergent therapeutic approaches show promise for ameliorating disease progression in the clinic. PMID:21455721

  11. Managing type II and type IV Lauge-Hansen supination external rotation ankle fractures: current orthopaedic practice.

    PubMed

    Kosuge, D D; Mahadevan, D; Chandrasenan, J; Pugh, H

    2010-11-01

    Differentiating supination external rotation (SER) type II and IV ankle injuries is challenging in the absence of a medial malleolar fracture or talar shift on radiographs. The accurate differentiation between a stable SER-II from an unstable SER-IV injury would allow implementation of the appropriate management plan from diagnosis. The aim of this study was to ascertain the practice of orthopaedic surgeons in dealing with these injuries. A postal survey was undertaken on 216 orthopaedic consultants from three regions. In the presence of medial-sided clinical signs (tenderness, swelling, ecchymosis), 22% of consultants would perform surgical fixation. 53% would choose non-operative treatment and the majority would monitor these fractures through serial radiographs. The remaining 25% of consultants would perform an examination under anaesthesia (EUA; 15%), request stress radiographs (9%) or an MRI scan (1%). Without medial-sided signs, 85% would advocate non-operative treatment and, of these, 74% would perform weekly radiographs. Interestingly, 6% would perform immediate surgical fixation. Stress radiographs (6%) and EUAs (2%) were advocated in the remaining group of consultants. Foot and ankle surgeons utilised stress radiographs more frequently and were more likely to proceed to surgical fixation should talar shift be demonstrated. Clinical practice is varied amongst the orthopaedic community. This may lead to unnecessary surgery in SER-II injuries and delay in diagnosis and operative management of SER-IV injuries. We have highlighted the various investigative modalities available that may be used in conjunction with clinical signs to make a more accurate diagnosis.

  12. Impact of long-wavelength UVA and visible light on melanocompetent skin.

    PubMed

    Mahmoud, Bassel H; Ruvolo, Eduardo; Hexsel, Camile L; Liu, Yang; Owen, Michael R; Kollias, Nikiforos; Lim, Henry W; Hamzavi, Iltefat H

    2010-08-01

    The purpose of this study was to determine the effect of visible light on the immediate pigmentation and delayed tanning of melanocompetent skin; the results were compared with those induced by long-wavelength UVA (UVA1). Two electromagnetic radiation sources were used to irradiate the lower back of 20 volunteers with skin types IV-VI: UVA1 (340-400 nm) and visible light (400-700 nm). Pigmentation was assessed by visual examination, digital photography with a cross-polarized filter, and diffused reflectance spectroscopy at 7 time points over a 2-week period. Confocal microscopy and skin biopsies for histopathological examination using different stains were carried out. Irradiation was also carried out on skin type II. Results showed that although both UVA1 and visible light can induce pigmentation in skin types IV-VI, pigmentation induced by visible light was darker and more sustained. No pigmentation was observed in skin type II. The quality and quantity of pigment induced by visible light and UVA1 were different. These findings have potential implications on the management of photoaggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  13. Process improvement to enhance existing stroke team activity toward more timely thrombolytic treatment.

    PubMed

    Cho, Han-Jin; Lee, Kyung Yul; Nam, Hyo Suk; Kim, Young Dae; Song, Tae-Jin; Jung, Yo Han; Choi, Hye-Yeon; Heo, Ji Hoe

    2014-10-01

    Process improvement (PI) is an approach for enhancing the existing quality improvement process by making changes while keeping the existing process. We have shown that implementation of a stroke code program using a computerized physician order entry system is effective in reducing the in-hospital time delay to thrombolysis in acute stroke patients. We investigated whether implementation of this PI could further reduce the time delays by continuous improvement of the existing process. After determining a key indicator [time interval from emergency department (ED) arrival to intravenous (IV) thrombolysis] and conducting data analysis, the target time from ED arrival to IV thrombolysis in acute stroke patients was set at 40 min. The key indicator was monitored continuously at a weekly stroke conference. The possible reasons for the delay were determined in cases for which IV thrombolysis was not administered within the target time and, where possible, the problems were corrected. The time intervals from ED arrival to the various evaluation steps and treatment before and after implementation of the PI were compared. The median time interval from ED arrival to IV thrombolysis in acute stroke patients was significantly reduced after implementation of the PI (from 63.5 to 45 min, p=0.001). The variation in the time interval was also reduced. A reduction in the evaluation time intervals was achieved after the PI [from 23 to 17 min for computed tomography scanning (p=0.003) and from 35 to 29 min for complete blood counts (p=0.006)]. PI is effective for continuous improvement of the existing process by reducing the time delays between ED arrival and IV thrombolysis in acute stroke patients.

  14. Non-Gaussian noise-weakened stability in a foraging colony system with time delay

    NASA Astrophysics Data System (ADS)

    Dong, Xiaohui; Zeng, Chunhua; Yang, Fengzao; Guan, Lin; Xie, Qingshuang; Duan, Weilong

    2018-02-01

    In this paper, the dynamical properties in a foraging colony system with time delay and non-Gaussian noise were investigated. Using delay Fokker-Planck approach, the stationary probability distribution (SPD), the associated relaxation time (ART) and normalization correlation function (NCF) are obtained, respectively. The results show that: (i) the time delay and non-Gaussian noise can induce transition from a single peak to double peaks in the SPD, i.e., a type of bistability occurring in a foraging colony system where time delay and non-Gaussian noise not only cause transitions between stable states, but also construct the states themselves. Numerical simulations are presented and are in good agreement with the approximate theoretical results; (ii) there exists a maximum in the ART as a function of the noise intensity, this maximum for ART is identified as the characteristic of the non-Gaussian noise-weakened stability of the foraging colonies in the steady state; (iii) the ART as a function of the noise correlation time exhibits a maximum and a minimum, where the minimum for ART is identified as the signature of the non-Gaussian noise-enhanced stability of the foraging colonies; and (iv) the time delay can enhance the stability of the foraging colonies in the steady state, while the departure from Gaussian noise can weaken it, namely, the time delay and departure from Gaussian noise play opposite roles in ART or NCF.

  15. Breath-holding spells may be associated with maturational delay in myelination of brain stem.

    PubMed

    Vurucu, Sebahattin; Karaoglu, Abdulbaki; Paksu, Sukru M; Oz, Oguzhan; Yaman, Halil; Gulgun, Mustafa; Babacan, Oguzhan; Unay, Bulent; Akin, Ridvan

    2014-02-01

    To evaluate possible contribution of maturational delay of brain stem in the etiology of breath-holding spells in children using brain stem auditory evoked potentials. The study group included children who experienced breath-holding spells. The control group consisted of healthy age- and sex-matched children. Age, gender, type and frequency of spell, hemoglobin, and ferritin levels in study group and brain stem auditory evoked potentials results in both groups were recorded. Study group was statistically compared with control group for brain stem auditory evoked potentials. The mean age of study and control groups was 26.3 ± 14.6 and 28.9 ± 13.9 months, respectively. The III-V and I-V interpeak latencies were significantly prolonged in the study group compared with the control group (2.07 ± 0.2 milliseconds; 1.92 ± 0.13 milliseconds and 4.00 ± 0.27 milliseconds; 3.83 ± 0.19 milliseconds; P = 0.009 and P = 0.03, respectively). At the same time, III-V and I-V interpeak latencies of patients without anemia in the study group compared with those of control group were significantly prolonged (2.09 ± 0.24 milliseconds; 1.92 ± 0.13 milliseconds and 4.04 ± 0.28 milliseconds; 3.83 ± 0.19 milliseconds; P = 0.007 and P = 0.01, respectively). Our results consider that maturational delay in myelination of brain stem may have a role in the etiology of breath-holding spells in children.

  16. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    PubMed

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  17. The nebular spectra of the transitional Type Ia Supernovae 2007on and 2011iv: broad, multiple components indicate aspherical explosion cores

    NASA Astrophysics Data System (ADS)

    Mazzali, P. A.; Ashall, C.; Pian, E.; Stritzinger, M. D.; Gall, C.; Phillips, M. M.; Höflich, P.; Hsiao, E.

    2018-05-01

    The nebular-epoch spectrum of the rapidly declining, `transitional' Type Ia supernova (SN) 2007on showed double emission peaks, which have been interpreted as indicating that the SN was the result of the direct collision of two white dwarfs. The spectrum can be reproduced using two distinct emission components, one redshifted and one blueshifted. These components are similar in mass but have slightly different degrees of ionization. They recede from one another at a line-of-sight speed larger than the sum of the combined expansion velocities of their emitting cores, thereby acting as two independent nebulae. While this configuration appears to be consistent with the scenario of two white dwarfs colliding, it may also indicate an off-centre delayed detonation explosion of a near-Chandrasekhar-mass white dwarf. In either case, broad emission line widths and a rapidly evolving light curve can be expected for the bolometric luminosity of the SN. This is the case for both SNe 2007on and 2011iv, also a transitional SN Ia that exploded in the same elliptical galaxy, NGC 1404. Although SN 2011iv does not show double-peaked emission line profiles, the width of its emission lines is such that a two-component model yields somewhat better results than a single-component model. Most of the mass ejected is in one component, however, which suggests that SN 2011iv was the result of the off-centre ignition of a Chandrasekhar-mass white dwarf.

  18. Stage-Specific Action of Matrix Metalloproteinases Influences Progressive Hereditary Kidney Disease

    PubMed Central

    Zeisberg, Michael; Khurana, Mona; Rao, Velidi H; Cosgrove, Dominic; Rougier, Jean-Philippe; Werner, Michelle C; Shield, Charles F; Werb, Zena; Kalluri, Raghu

    2006-01-01

    Background Glomerular basement membrane (GBM), a key component of the blood-filtration apparatus in the in the kidney, is formed through assembly of type IV collagen with laminins, nidogen, and sulfated proteoglycans. Mutations or deletions involving α3(IV), α4(IV), or α5(IV) chains of type IV collagen in the GBM have been identified as the cause for Alport syndrome in humans, a progressive hereditary kidney disease associated with deafness. The pathological mechanisms by which such mutations lead to eventual kidney failure are not completely understood. Methods and Findings We showed that increased susceptibility of defective human Alport GBM to proteolytic degradation is mediated by three different matrix metalloproteinases (MMPs)—MMP-2, MMP-3, and MMP-9—which influence the progression of renal dysfunction in α3(IV) −/− mice, a model for human Alport syndrome. Genetic ablation of either MMP-2 or MMP-9, or both MMP-2 and MMP-9, led to compensatory up-regulation of other MMPs in the kidney glomerulus. Pharmacological ablation of enzymatic activity associated with multiple GBM-degrading MMPs, before the onset of proteinuria or GBM structural defects in the α3(IV) −/− mice, led to significant attenuation in disease progression associated with delayed proteinuria and marked extension in survival. In contrast, inhibition of MMPs after induction of proteinuria led to acceleration of disease associated with extensive interstitial fibrosis and early death of α3(IV) −/− mice. Conclusions These results suggest that preserving GBM/extracellular matrix integrity before the onset of proteinuria leads to significant disease protection, but if this window of opportunity is lost, MMP-inhibition at the later stages of Alport disease leads to accelerated glomerular and interstitial fibrosis. Our findings identify a crucial dual role for MMPs in the progression of Alport disease in α3(IV) −/− mice, with an early pathogenic function and a later protective action. Hence, we propose possible use of MMP-inhibitors as disease-preventive drugs for patients with Alport syndrome with identified genetic defects, before the onset of proteinuria. PMID:16509766

  19. IVS Tropospheric Parameters: Comparison with DORIS and GPS for CONT02

    NASA Technical Reports Server (NTRS)

    Schuh, Harald; Snajdrova, Kristyna; Boehm, Johannes; Willis, Pascal; Engelhardt, Gerald; Lanotte, Roberto; Tomasi, Paolo; Negusini, Monia; MacMillan, Daniel; Vereshchagina, Iraida

    2004-01-01

    In April 2002 the IVS (International VLBI Service for Geodesy and Astrometry) set up the Pilot Project - Tropospheric Parameters, and the Institute of Geodesy and Geophysics (IGG), Vienna, was put in charge of coordinating the project. Seven IVS Analysis Centers have joined the project and regularly submitted their estimates of tropospheric parameters (wet and total zenith delays, horizontal gradients) for all IVS-R1 mid IVS-R4 sessions since January 1st, 2002. The individual submissions are combined by a two-step procedure to obtain stable, robust and highly accurate tropospheric parameter time series with one hour resolution (internal accuracy: 2-4 ram). Starting with July 2003, the combined tropospheric estimates became operational IVS products. In the second half of October 2002 the VLBI campaign CONT02 was observed with 8 stations participating around the globe. At four of them (Gilmore Creek, U.S.A.; Hartebeesthoek, South Africa; Kokee Park, U.S.A.; Ny-Alesund, Norway) also total zenith delays from DORIS (Doppler Orbitography and Radiopositioning Integrated by Satellite) are available and these estimates are compared with those from the IGS (International GPS Service) and the IVS. The distance from the DORIS beacons to the co-located GPS and VLBI stations is around 2 km or less for the four sites mentioned above.

  20. Two transitional type Ia supernovae located in the Fornax cluster member NGC 1404: SN 2007on and SN 2011iv

    NASA Astrophysics Data System (ADS)

    Gall, C.; Stritzinger, M. D.; Ashall, C.; Baron, E.; Burns, C. R.; Hoeflich, P.; Hsiao, E. Y.; Mazzali, P. A.; Phillips, M. M.; Filippenko, A. V.; Anderson, J. P.; Benetti, S.; Brown, P. J.; Campillay, A.; Challis, P.; Contreras, C.; Elias de la Rosa, N.; Folatelli, G.; Foley, R. J.; Fraser, M.; Holmbo, S.; Marion, G. H.; Morrell, N.; Pan, Y.-C.; Pignata, G.; Suntzeff, N. B.; Taddia, F.; Robledo, S. Torres; Valenti, S.

    2018-03-01

    We present an analysis of ultraviolet (UV) to near-infrared observations of the fast-declining Type Ia supernovae (SNe Ia) 2007on and 2011iv, hosted by the Fornax cluster member NGC 1404. The B-band light curves of SN 2007on and SN 2011iv are characterised by Δm15 (B) decline-rate values of 1.96 mag and 1.77 mag, respectively. Although they have similar decline rates, their peak B- and H-band magnitudes differ by 0.60 mag and 0.35 mag, respectively. After correcting for the luminosity vs. decline rate and the luminosity vs. colour relations, the peak B-band and H-band light curves provide distances that differ by 14% and 9%, respectively. These findings serve as a cautionary tale for the use of transitional SNe Ia located in early-type hosts in the quest to measure cosmological parameters. Interestingly, even though SN 2011iv is brighter and bluer at early times, by three weeks past maximum and extending over several months, its B - V colour is 0.12 mag redder than that of SN 2007on. To reconcile this unusual behaviour, we turn to guidance from a suite of spherical one-dimensional Chandrasekhar-mass delayed-detonation explosion models. In this context, 56Ni production depends on both the so-called transition density and the central density of the progenitor white dwarf. To first order, the transition density drives the luminosity-width relation, while the central density is an important second-order parameter. Within this context, the differences in the B - V colour evolution along the Lira regime suggest that the progenitor of SN 2011iv had a higher central density than SN 2007on. The photometry tables are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/611/A58

  1. VLBI Analysis with the Multi-Technique Software GEOSAT

    NASA Technical Reports Server (NTRS)

    Kierulf, Halfdan Pascal; Andersen, Per-Helge; Boeckmann, Sarah; Kristiansen, Oddgeir

    2010-01-01

    GEOSAT is a multi-technique geodetic analysis software developed at Forsvarets Forsknings Institutt (Norwegian defense research establishment). The Norwegian Mapping Authority has now installed the software and has, together with Forsvarets Forsknings Institutt, adapted the software to deliver datum-free normal equation systems in SINEX format. The goal is to be accepted as an IVS Associate Analysis Center and to provide contributions to the IVS EOP combination on a routine basis. GEOSAT is based on an upper diagonal factorized Kalman filter which allows estimation of time variable parameters like the troposphere and clocks as stochastic parameters. The tropospheric delays in various directions are mapped to tropospheric zenith delay using ray-tracing. Meteorological data from ECMWF with a resolution of six hours is used to perform the ray-tracing which depends both on elevation and azimuth. Other models are following the IERS and IVS conventions. The Norwegian Mapping Authority has submitted test SINEX files produced with GEOSAT to IVS. The results have been compared with the existing IVS combined products. In this paper the outcome of these comparisons is presented.

  2. Bone age in cerebral palsy

    PubMed Central

    Miranda, Eduardo Régis de Alencar Bona; Palmieri, Maurício D'arc; de Assumpção, Rodrigo Montezuma César; Yamada, Helder Henzo; Rancan, Daniela Regina; Fucs, Patrícia Maria de Moraes Barros

    2013-01-01

    Objective To compare the chronological age and bone age among cerebral palsy patients in the outpatient clinic and its correlation with the type of neurological involvement, gender and functional status. Methods 401 patients with spastic cerebral palsy, and ages ranging from three months to 20 years old, submitted to radiological examination for bone age and analyzed by two independent observers according Greulich & Pyle. Results In the topographic distribution, there was a significant delay (p<0.005) in tetraparetic (17.7 months), hemiparetic (10.1 months), and diparetic patients (7.9 months). In the hemiparetic group, the mean bone age in the affected side was 96.88 months and the uncompromised side was 101.13 months (p<0.005). Regarding functional status, the ambulatory group showed a delay of 18.73 months in bone age (p<0.005). Comparing bone age between genders, it was observed a greater delay in males (13.59 months) than in females (9.63 months), but not statistically significant (p = 0.54). Conclusion There is a delay in bone age compared to chronological age influenced by the topography of spasticity, functional level and gender in patients with cerebral palsy. Level of Evidence IV, Case Series. PMID:24453693

  3. In vivo comparison of delayed gadolinium-enhanced MRI of cartilage and delayed quantitative CT arthrography in imaging of articular cartilage.

    PubMed

    Hirvasniemi, J; Kulmala, K A M; Lammentausta, E; Ojala, R; Lehenkari, P; Kamel, A; Jurvelin, J S; Töyräs, J; Nieminen, M T; Saarakkala, S

    2013-03-01

    To compare delayed gadolinium-enhanced magnetic resonance imaging (MRI) of cartilage (dGEMRIC) and delayed quantitative computed tomography (CT) arthrography (dQCTA) to each other, and their association to arthroscopy. Additionally, the relationship between dGEMRIC with intravenous (dGEMRIC(IV)) and intra-articular contrast agent administration (dGEMRIC(IA)) was determined. Eleven patients with knee pain were scanned at 3 T MRI and 64-slice CT before arthroscopy. dQCTA was performed at 5 and 45 min after intra-articular injection of ioxaglate. Both dGEMRIC(IV) and dGEMRIC(IA) were performed at 90 min after gadopentetate injection. dGEMRIC indices and change in relaxation rates (ΔR(1)) were separately calculated for dGEMRIC(IV) and dGEMRIC(IA). dGEMRIC and dQCTA parameters were calculated for predetermined sites at the knee joint that were International Cartilage Repair Society (ICRS) graded in arthroscopy. dQCTA normalized with the contrast agent concentration in synovial fluid (SF) and dGEMRIC(IV) correlated significantly, whereas dGEMRIC(IA) correlated with the normalized dQCTA only when dGEMRIC(IA) was also normalized with the contrast agent concentration in SF. Correlation was strongest between normalized dQCTA at 45 min and ΔR(1,IV) (r(s) = 0.72 [95% CI 0.56-0.83], n = 49, P < 0.01) and ΔR(1,IA) normalized with ΔR(1) in SF (r(s) = 0.70 [0.53-0.82], n = 52, P < 0.01). Neither dGEMRIC nor dQCTA correlated with arthroscopic grading. dGEMRIC(IV) and non-normalized dGEMRIC(IA) were not related while ΔR(1,IV) correlated with normalized ΔR(1,IA) (r(s) = 0.52 [0.28-0.70], n = 50, P < 0.01). This study suggests that dQCTA is in best agreement with dGEMRIC(IV) at 45 min after CT contrast agent injection. dQCTA and dGEMRIC were not related to arthroscopy, probably because the remaining cartilage is analysed in dGEMRIC and dQCTA, whereas in arthroscopy the absence of cartilage defines the grading. The findings indicate the importance to take into account the contrast agent concentration in SF in dQCTA and dGEMRIC(IA). Copyright © 2012 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.

  4. Ischiorectal abscess and ischiorectal-vaginal fistula as delayed complications of posterior intravaginal slingplasty: a case report.

    PubMed

    Chen, Heidi Wen-Chu; Guess, Marsha K; Connell, Kathleen A; Bercik, Richard S

    2009-10-01

    Synthetic meshes have been used extensively to augment surgical management of pelvic organ prolapses. Posterior intravaginal sling (IVS) is a technique used for correcting vaginal vault/apical prolapse, posterior vaginal prolapse or rectocele. There are limited data on long-term safety of this procedure. In a subanalysis of the IVS tapes from the SUSPEND trial performed secondary to the large number of patients with complications of suburethral sling erosions after IVS, it was noted that the sling erosion tended to have a delayed presentation secondary to poor incorporation of the mesh. A 48-year-old woman with cystocele, uterine prolapse and rectocele had undergone total vaginal hysterectomy, mesh-augmented anterior repair, posterior colporrhaphy and posterior intravaginal slingplasty (IVS) in July 2005. Thirty months after the surgery, she presented with gradual symptoms of copious vaginal discharge for several weeks followed by constant right buttock pain and swelling. Examination was notable for intact mesh with no signs of erosion and a 3-cm induration deep within the right buttock. Computed tomography suggested a pelvic abscess. Magnetic resonance imaging confirmed a right ischiorectal fossa abscess and a vaginal fistula. The patient underwent sling excision, right ischiorectal fossa exploration and vaginal fistula repair. A fistulous tract was found to extend along the intact sling from the vaginal epithelium toward the right ischiorectal fossa. At 2 months' followup, there were no recurrences or other complications. This is the first report of a delayed complication of an ischiorectal abscess associated with an ischiorectal-vaginal fistula that presented 30 months after the placement of a posterior IVS.

  5. Three-dimensional Magnetic Resonance Imaging of the Anterolateral Ligament of the Knee: An Evaluation of Intact and Anterior Cruciate Ligament-Deficient Knees From the Scientific Anterior Cruciate Ligament Network International (SANTI) Study Group.

    PubMed

    Muramatsu, Koichi; Saithna, Adnan; Watanabe, Hiroki; Sasaki, Kana; Yokosawa, Kenta; Hachiya, Yudo; Banno, Tatsuo; Helito, Camilo Partezani; Sonnery-Cottet, Bertrand

    2018-05-02

    To determine the visualization rate of the anterolateral ligament (ALL) in uninjured and anterior cruciate ligament (ACL)-deficient knees using 3-dimensional (3D) magnetic resonance imaging (MRI) and to characterize the spectrum of ALL injury observed in ACL-deficient knees, as well as determine the interobserver and intraobserver reliability of a 3D MRI classification of ALL injury. A total of 100 knees (60 ACL deficient and 40 uninjured) underwent 3D MRI. The ALL was evaluated by 2 blinded orthopaedic surgeons. The ALL was classified as follows: type A, continuous, clearly defined low-signal band; type B, warping, thinning, or iso-signal changes; and type C, without clear continuity. The comparison between imaging performed early after ACL injury (<1 month) and delayed imaging (>1 month) was evaluated, as was intraobserver and interobserver reliability. Complete visualization of the ALL was achieved in all uninjured knees. In the ACL-deficient group, 24 knees underwent early imaging, with 87.5% showing evidence of ALL injury (3 normal, or type A, knees [12.5%], 18 type B [75.0%], and 3 type C [12.5%]). The remaining 36 knees underwent delayed imaging, with 55.6% showing evidence of injury (16 type A [44.4%], 18 type B [50.0%], and 2 type C [5.6%]). The difference in the rate of injury between the 2 groups was significant (P = .03). Multivariate analysis showed that the delay from ACL injury to MRI was the only factor (negatively) associated with the rate of injury to the ALL. Interobserver reliability and intraobserver reliability of the classification of ALL type were good (κ = 0.86 and κ = 0.93, respectively). Three-dimensional MRI allows full visualization of the ALL in all normal knees. The rate of injury to the ALL in acutely ACL-injured knees identified on 3D MRI is higher than previous reports using standard MRI techniques. This rate is significantly higher than the rate of injury to the ALL identified on delayed imaging of ACL-injured knees. Level IV, diagnostic, case-control study. Copyright © 2018 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  6. Investigation of the Acoustics of Plucked String Tones Based on the Analysis of Their Time-Varying Spectra.

    NASA Astrophysics Data System (ADS)

    Chen, Kwok-Ping John

    This research investigates two aspects of the time-varying vibration patterns of plucked string tones of classical guitar, Chinese pipa and Chinese ch'in. First, the assumption that horizontal and vertical frequencies and decay rates may be different is used as a basis for classifying the partial amplitude envelopes into four types. It is found that the partial envelopes of the tones produced by the three instruments, using the finger tip excitation method, on a single undamped string, can be described in terms of these four types. The results show that ch'in tones contain Type III, and IV, guitar tones contain Type I, II and III, and pipa tones contain all four types with a higher percentage of Type III and IV. Second, the theories of "missing modes" (Young, 1800), (Benade, 1976) and delayed generation of these modes (Fletcher, 1984), (Hall, 1987) are re-examined experimentally. The edge of a conventional guitar pick is used to excite a single undamped string on a classical guitar at nodal position N which is L/N from the bridge. As a result, it is a consistent feature that any mode whose index n is a multiple of N is attenuated during the attack phase but subsequently rises with a more gradual attack to reach a significant peak amplitude, except for the first multiple of locations L/3 to L/7. This amplitude envelope pattern, Type V, which is only applicable when the pick-edge excitation method is used, is distinct from the other four types mentioned above.

  7. Brief Report: Should the DSM V Drop Asperger Syndrome?

    ERIC Educational Resources Information Center

    Ghaziuddin, Mohammad

    2010-01-01

    The DSM IV defines Asperger syndrome (AS) as a pervasive developmental (autistic spectrum) disorder characterized by social deficits and rigid focused interests in the absence of language impairment and cognitive delay. Since its inclusion in the DSM-IV, there has been a dramatic increase in its recognition both in children and adults. However,…

  8. Randomised double-blind study comparing tropisetron alone and in combination with dexamethasone in the prevention of acute and delayed cisplatin-induced emesis.

    PubMed

    Garcia-del-Muro, X; Vadell, C; Pérez Manga, G; Bover, I; Rifá, J; Beltrán, M; Barros, M M; Germá, J R; Fabregat, X; Moreno, V; Salvador, A; Viladiu, P

    1998-01-01

    In a randomised, double-blind and parallel-design multicentre study, 282 chemotherapy-naive cancer patients received tropisetron 5 mg intravenously (i.v.) before high-dose cisplatin on day 1, and oral tropisetron 5 mg daily on days 2-6, in combination with either placebo (n = 143) or dexamethasone (n = 135), given i.v. on day 1 and orally on days 2-6. Complete protection from acute vomiting/nausea was achieved in 76.3%/79.3% of patients receiving the combination and in 55.2%/61.5% of those receiving tropisetron alone. Complete protection on days 2-6 from delayed vomiting/nausea was obtained in 60%/60% and 39.2%/40.6%, respectively. Tropisetron in combination with dexamethasone is safe and more effective than tropisetron alone in the prevention of both acute and delayed cisplatin-induced emesis.

  9. Cognitive psychopathology in Schizophrenia: Comparing memory performances with Obsessive-compulsive disorder patients and normal subjects on the Wechsler Memory Scale-IV.

    PubMed

    Cammisuli, Davide Maria; Sportiello, Marco Timpano

    2016-06-01

    Memory system turns out to be one of the cognitive domains most severely impaired in schizophrenia. Within the theoretical framework of cognitive psychopathology, we compared the performance of schizophrenia patients on the Wechsler Memory Scale-IV with that in matched patients with Obsessive-compulsive disorder and that in healthy control subjects to establish the specific nature of memory deficits in schizophrenia. 30 schizophrenia patients, 30 obsessive-compulsive disorder patients and 40 healthy controls completed the Wechsler Memory Scale-IV. Schizophrenia symptom severity was assessed by the Positive and Negative Syndrome Scale (PANSS). Performances on memory battery including Indexes and subtests scores were compared by a One-Way ANOVA (Scheffé post-hoc test). Spearman Rank correlations were performed between scores on PANSS subscales and symptoms and WMS-IV Indexes and subtests, respectively. Schizophrenia patients showed a memory profile characterized by mild difficulties in auditory memory and visual working memory and poor functioning of visual, immediate and delayed memory. As expected, schizophrenia patients scored lower than healthy controls on all WMS-IV measures. With regard to the WMS-IV Indexes, schizophrenia patients performed worse on Auditory Memory, Visual Memory, Immediate and Delayed Memory than Obsessive-compulsive disorder patients but not on Visual Working Memory. Such a pattern was made even clearer for specific tasks such as immediate and delayed recall and spatial recall and memory for visual details, as revealed by the lowest scores on Logical Memory (immediate and delayed conditions) and Designs (immediate condition) subtests, respectively. Significant negative correlations between Logical Memory I and II were found with PANSS Excitement symptom as well as between DE I and PANSS Tension symptom. Significant positive correlations between LM II and PANSS Blunted affect and Poor rapport symptoms as well as DE I and PANSS Blunted affect and Mannerism and Posturing symptoms, were found too. Memory damage observed in schizophrenia patients was more severe and wider than that of patients with obsessive-compulsive disorder, except for visual working memory. Memory dysfunction, mainly related to episodic memory damage and reduced efficiency of central executive, is intimately connected to the specific psychopathological processes characterizing schizophrenia. Implications for therapeutics and cognitive remediation techniques are discussed.

  10. 7 CFR 59.202 - Mandatory daily reporting for barrows and gilts.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... live weight basis; and (iv) The base price and premiums and discounts paid for carcass characteristics... unavailable due to pricing that is determined on a delayed basis. The packer shall report information on such... reporting day, unless such information is unavailable due to pricing that is determined on a delayed basis...

  11. Cocoon formation in patients with midgut neuroendocrine tumors: a rare and unrecognized final pathway.

    PubMed

    Wang, Yi-Zarn; King, Heather; Diebold, Anne

    2013-08-01

    Neuroendocrine tumors (NETs) are relatively rare with an indolent nature. As a result, treatment is often delayed and passive. The most commonly recognized disease progression leading to death is from the sequelae of bowel obstruction, ischemia, or liver failure secondary to liver metastasis. We recently recognized a rare cocoon-like formation in patients with metastatic gastroenteropancreatic NETs and hypothesize that this may be a distinct, final pathway for these patients. Ten patients with stage IV gastroenteropancreatic NETs, seen at our center between October 2008 and November 2011, who developed a cocoon were identified. Patient's charts, operative reports, pathology, and tumor markers were reviewed. No discernable predictors were identified as precursors to this condition. One patient survived 13 months after cocoon diagnosis, and the remaining 9 patients were all deceased within 5 months. Surgical treatment was attempted in 6 patients and was only partially successful in 1 patient who had the earliest stage of cocoon formation (type 1). Cocoon-like formations in patients with stage IV gastroenteropancreatic NETs is rare and may be a terminal disease progression that has not been previously recognized. The best treatment option remains unknown. Surgical treatment is not advisable, with the exception of type 1 abdominal cocoons.

  12. Health system delay and its effect on clinical stage of breast cancer: Multicenter study.

    PubMed

    Unger-Saldaña, Karla; Miranda, Alfonso; Zarco-Espinosa, Gelasio; Mainero-Ratchelous, Fernando; Bargalló-Rocha, Enrique; Miguel Lázaro-León, Jesús

    2015-07-01

    The objective of this study was to determine the correlation between health system delay and clinical disease stage in patients with breast cancer. This was a cross-sectional study of 886 patients who were referred to 4 of the largest public cancer hospitals in Mexico City for the evaluation of a probable breast cancer. Data on time intervals, sociodemographic factors, and clinical stage at diagnosis were retrieved. A logistic regression model was used to estimate the average marginal effects of delay on the probability of being diagnosed with advanced breast cancer (stages III and IV). The median time between problem identification and the beginning of treatment was 7 months. The subinterval with the largest delay was that between the first medical consultation and diagnosis (median, 4 months). Only 15% of the patients who had cancer were diagnosed with stage 0 and I disease, and 48% were diagnosed with stage III and IV disease. Multivariate analyses confirmed independent correlations for the means of problem identification, patient delay, health system delay, and age with a higher probability that patients would begin cancer treatment in an advanced stage. In the sample studied, the majority of patients with breast cancer began treatment after a delay. Both patient delays and provider delays were associated with advanced disease. Research aimed at identifying specific access barriers to medical services is much needed to guide the design of tailored health policies that go beyond the promotion of breast care awareness and screening participation to include improvements in health services that facilitate access to timely diagnosis and treatment. © 2015 The Authors. Cancer published by Wiley Periodicals, Inc. on behalf of American Cancer Society.

  13. Oral cryotherapy reduces mucositis and opioid use after myeloablative therapy--a randomized controlled trial.

    PubMed

    Svanberg, Anncarin; Birgegård, Gunnar; Ohrn, Kerstin

    2007-10-01

    Mucositis is a major complication in myeloablative therapy, which often necessitates advanced pharmacological pain treatment, including i.v. opioids. Attempts to prevent oral mucositis have included oral cryotherapy, which has been shown to reduce mucositis, but there is a lack of knowledge concerning the effect of oral cryotherapy on opioid use by reducing the mucositis for patients treated with myeloablative therapy before bone marrow transplantation (BMT). The aim of the present study was to evaluate if oral cryotherapy could delay or alleviate the development of mucositis and thereby reduce the number of days with i.v. opioids among patients who receive myeloablative therapy before BMT. Eighty patients 18 years and older, scheduled for BMT, were included consecutively and randomised to oral cryotherapy or standard oral care. A stratified randomisation was used with regard to type of transplantation. Intensity of pain, severity of mucositis and use of opioids were recorded using pain visual analogue scale (VAS) scores, mucositis index scores and medical and nursing charts. This study showed that patients receiving oral cryotherapy had less pronounced mucositis and significantly fewer days with i.v. opioids than the control group. In the autologous setting, cryotherapy patients also needed significantly lower total dose of opioids. Oral cryotherapy is an effective and well-tolerated therapy to alleviate mucositis and consequently reduce the number of days with i.v. opioids among patients treated with myeloablative therapy before BMT.

  14. Direct comparison of intra-articular versus intravenous delayed gadolinium-enhanced MRI of hip joint cartilage.

    PubMed

    Zilkens, Christoph; Miese, Falk; Kim, Young-Jo; Jäger, Marcus; Mamisch, Tallal C; Hosalkar, Harish; Antoch, Gerald; Krauspe, Rüdiger; Bittersohl, Bernd

    2014-01-01

    To investigate the potential of delayed gadolinium-enhanced magnetic resonance imaging in cartilage (dGEMRIC) after intra-articular (ia) contrast agent administration at 3 Tesla (T), a paired study comparing intravenous (iv) dGEMRIC (standard) with ia-dGEMRIC was performed. Thirty-five symptomatic patients with suspected cartilage damage underwent ia- and iv-dGEMRIC. MRI was performed with a 3T system wherein the interval between both measurements was 2 weeks. For iv-dGEMRIC, FDA approved Gd-DOTA(-) was injected intravenously 45 min before the MRI scan. For ia-dGEMRIC, 10-20 mL of a 2 mM solution of Gd- DOTA(-) was injected under fluoroscopic guidance 30 min before the MRI scan. Both ia- and iv-dGEMRIC demonstrated the typical T1Gd pattern in hip joint cartilage with increasing values toward the superior regions in acetabular cartilage reflecting the higher glycosaminoglycan (GAG) content in the main weight-bearing area. Correlation analysis revealed a moderate correlation between both techniques (r = 0.439, P-value < 0.001), whereas the T1Gd values for iv-dGEMRIC were significantly higher than those for ia-dGEMRIC. This corresponds with the Bland-Altman plot analysis, which revealed a systemic bias (higher T1Gd values after iv gadolinium application) of ∼70 ms. Ia-dGEMRIC was able to reveal the characteristic T1Gd pattern in hip joint cartilage confirming the sensitivity of ia-dGEMRIC for GAG. In addition, there was a significant correlation between iv-dGEMRIC and ia-dGEMRIC. However, the T1Gd values after ia contrast media application were significantly lower than those after iv application that has to be considered for future studies. Copyright © 2013 Wiley Periodicals, Inc.

  15. Cocamidopropyl betaine.

    PubMed

    Jacob, Sharon E; Amini, Sadegh

    2008-01-01

    Cocamidopropyl betaine (CAPB) is an amphoteric synthetic detergent that has been increasingly used in cosmetics and personal hygiene products (eg, shampoos, contact lens solutions, toothpaste detergents, makeup removers, bath gels, skin care products, cleansers, liquid soaps, antiseptics, and gynecologic and anal hygiene products) because it induces relatively mild skin irritation. Delayed T-cell-mediated type IV hypersensitivity reactions to CAPB have been reported, and contact sensitization prevalence is estimated at between 3.0 and 7.2%. The increasing rates of sensitization led to CAPB's being named Allergen of the Year in 2004. Related impurities rendered during the manufacturing process (such as amidoamine and dimethylaminopropylamine) are thought to play a role in sensitization.

  16. Delayed diagnosis of Alport syndrome without hematuria.

    PubMed

    Yin-Yin, Chen; You-Ming, Peng; Yu-Mei, Liang

    2014-05-01

    Alport syndrome is a progressive hereditary disease caused by mutations in the genes encoding type IV collagen. Persistent microscopic hematuria is the hallmark of Alport syndrome, occurring in almost all boys according to previous reports. We report the case of a 20-year-old man presented with proteinuria but no hematuria that was initially misdiagnosed with refractory nephrotic syndrome and was eventually diagnosed with Alport syndrome following kidney and skin biopsy. During the follow-up period, he experienced a rapid progression to end-stage renal disease. Timely diagnosis of Alport syndrome is important, because patients may benefit from early intervention and avoid suffering from unnecessary nephrotoxic drug use.

  17. Retarded ejaculation in men: an overview of psychological and neurobiological insights.

    PubMed

    Waldinger, Marcel D; Schweitzer, Dave H

    2005-06-01

    Disorders of orgasm and ejaculation are erroneously mixed up in the DSM-IV classification system. Male Orgasmic Disorder to denote "delayed ejaculation" is inadequate as orgasm and ejaculation represent clinical expressions of different neurobiological phenomena. Unfortunately, the DSM-IV criteria for delayed ejaculation were accepted regardless of any research with appropriate methodology and design. The psychological approach and associated psychotherapy to solve this problem is rather disappointing. The neurobiological approach, which started with animal studies, has demonstrated various neurotransmitters with the potency to inhibit ejaculation. Indeed, several experimental drugs have been tested in rats, showing the successful acceleration of ejaculation. We propose that human research should start with the development of an operational definition of delayed ejaculation. To achieve this goal, we propose unselected epidemiological stopwatch studies which also provide information on the prevalence and incidence of delayed ejaculation in men. Currently, no effective and safe drugs are available to accelerate ejaculation time in men. The best way to treat lifelong delayed ejaculation is, thus far, to inform the patients about biological and psychological inhibiting factors which they need to avoid, and to remain critical about unrealistic expectations from psychotherapy. Psychotherapy may be useful in subgroups, particularly in the absence of effective and safe drugs.

  18. Suppression of the motor deficit in a mucolipidosis type IV mouse model by bone marrow transplantation

    PubMed Central

    Walker, Marquis T.; Montell, Craig

    2016-01-01

    Mucolipidosis IV (MLIV) is a severe lysosomal storage disorder, which results from loss of the TRPML1 channel. MLIV causes multiple impairments in young children, including severe motor deficits. Currently, there is no effective treatment. Using a Drosophila MLIV model, we showed previously that introduction of trpml+ in phagocytic glia rescued the locomotor deficit by removing early dying neurons, thereby preventing amplification of neuronal death from cytotoxicity. Because microglia, which are phagocytic cells in the mammalian brain, are bone marrow derived, and cross the blood–brain barrier, we used a mouse MLIV model to test the efficacy of bone marrow transplantation (BMT). We found that BMT suppressed the reduced myelination and the increased caspase-3 activity due to loss of TRPML1. Using a rotarod test, we demonstrated that early BMT greatly delayed the motor impairment in the mutant mice. These data offer the possibility that BMT might provide the first therapy for MLIV. PMID:27270598

  19. Inactivated simian immunodeficiency virus vaccine failed to protect rhesus macaques from intravenous or genital mucosal infection but delayed disease in intravenously exposed animals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sutjipto, S.; Pedersen, N.C.; Miller, C.J.

    1990-05-01

    Eight rhesus macaques were immunized four times over a period of 8 months with a psoralen-UV-light-inactivated whole simian immunodeficiency virus vaccine adjuvanted with threonyl muramyl dipeptide. Eight unvaccinated control animals received adjuvant alone. Only the vaccinated animals made antibodies before challenge exposure to the viral core and envelope as determined by Western blotting (immunoblotting) and virus-neutralizing antibodies. Ten days after the final immunization, one-half of the vaccinated and nonvaccinated monkeys were challenged exposed intravenously (i.v.) and one-half were challenge exposed via the genital mucosa with virulent simian immunodeficiency virus. All of the nonvaccinated control monkeys became persistently infected. In spitemore » of preexisting neutralizing antibodies and an anamnestic antibody response, all of the immunized monkeys also became persistently infected. However, there was evidence that the clinical course in immunized i.v. infected animals was delayed. All four mock-vaccinated i.v. challenge-exposed animals died with disease from 3 to 9 months postchallenge. In contrast, only one of four vaccinated i.v. challenge-exposed monkeys had died by 11 months postchallenge.« less

  20. Immediate management of posterior urethral disruptions due to pelvic fracture: therapeutic alternatives.

    PubMed

    Podestá, M L; Medel, R; Castera, R; Ruarte, A

    1997-04-01

    We retrospectively reviewed the results of 3 types of initial management of pelvic fracture urethral disruption in children. From 1980 to 1994, 35 boys 2 to 15 years old (mean age 8.1) with prostatomembranous urethral disruption were treated, including 17 who also had associated injuries. Immediate treatment included suprapubic cystostomy and delayed urethroplasty in 19 patients (group 1), urethral catheter alignment without traction and concomitant suprapubic cystostomy in 10 (group 2), and primary retropubic anastomotic urethroplasty in 6 (group 3). In all patients in groups 1 and 2 severe urethral obliteration developed. Four group 3 patients (66%) had a stricture at the site of anastomotic repair. After delayed urethroplasty 16 group 1 (84%) and all 10 group 2 patients were continent. However, only 3 group 3 patients (50%) achieved continence. Retrospectively associated bladder neck injury occurred in 5 of the 6 incontinent boys. Erections were observed before and after treatment in all but 3 children. Unstable pelvic ring fractures (type IV) comprised 28% of all pelvic fractures with a high rate of associated injuries. As described, urethral alignment was not beneficial for avoiding urethral obliteration. Therefore we recommend suprapublic cystostomy as the only form of initial treatment in these cases. Urinary incontinence seems more likely related to associated bladder neck rupture and the severity of pelvic fracture rather than to initial treatment or delayed urethral repair. Consequently, when associated bladder neck injury is present, we advocate immediate surgical repair.

  1. AGN Space Telescope and Optical Reverberation Mapping Project. IV. Velocity-Delay Mapping of Broad Emission Lines in NGC 5548

    NASA Astrophysics Data System (ADS)

    Horne, Keith D.; Agn Storm Team

    2015-01-01

    Two-dimensional velocity-delay maps of AGN broad emission line regions can be recovered by modelling observations of reverberating emission-line profiles on the assumption that the line profile variations are driven by changes in ionising radiation from a compact source near the black hole. The observable light travel time delay resolves spatial structure on iso-delay paraboloids, while the doppler shift resolves kinematic structure along the observer's line-of-sight. Velocity-delay maps will be presented and briefly discussed for the Lyman alpha, CIV and Hbeta line profiles based on the HST and ground-based spectrophotometric monitoring of NGC 5548 during the 2014 AGN STORM campaign.

  2. Arctigenin, a phenylpropanoid dibenzylbutyrolactone lignan, inhibits type I-IV allergic inflammation and pro-inflammatory enzymes.

    PubMed

    Lee, Ji Yun; Kim, Chang Jong

    2010-06-01

    We previously reported that arctigenin, a phenylpropanoid dibenzylbutyrolactone lignan isolated from Forsythia koreana, exhibits anti-inflammatory, antioxidant, and analgesic effects in animal models. In addition, arctigenin inhibited eosinophil peroxidase and activated myeloperoxidase in inflamed tissues. In this study, we tested the effects of arctigenin on type I-IV allergic inflammation and pro-inflammatory enzymes in vitro and in vivo. Arctigenin significantly inhibited the heterologous passive cutaneous anaphylaxis induced by ovalbumin in mice at 15 mg/kg, p.o., and compound 48/80-induced histamine release from rat peritoneal mast cells at 10 microM. Arctigenin (15 mg/kg, p.o.) significantly inhibited reversed cutaneous anaphylaxis. Further, arctigenin (15 mg/kg, p.o.) significantly inhibited the Arthus reaction to sheep's red blood cells, decreasing the hemolysis titer, the hemagglutination titer, and the plaque-forming cell number for SRBCs. In addition, arctigenin significantly inhibited delayed type hypersensitivity at 15 mg/kg, p.o. and the formation of rosette-forming cells at 45 mg/kg, p.o. Contact dermatitis induced by picrylchloride and dinitrofluorobenzene was significantly (p < 0.05) inhibited by surface treatment with arctigenin (0.3 mg/ear). Furthermore, arctigenin dose-dependently inhibited pro-inflammatory enzymes, such as cyclooxygenase-1 and 2, 5-lipoxygenase, phospholipase A2, and phosphodiesterase. Our results show that arctigenin significantly inhibited B- and T-cell mediated allergic inflammation as well as pro-inflammatory enzymes.

  3. Impact of TBI on late effects in children treated by megatherapy for Stage IV neuroblastoma. A study of the French Society of Pediatric oncology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Flandin, Isabelle; Department of Radiotherapy/Oncology, Hospital Lyon Sud, Lyon; Hartmann, Olivier

    2006-04-01

    Purpose: To determine the contribution of total body irradiation (TBI) to late sequelae in children treated with high-dose chemotherapy and autologous bone marrow transplantation for Stage IV neuroblastoma. Patients and Methods: We compared two populations that were similar with regard to age, stage, pre-autologous bone marrow transplantation chemotherapy (CT) regimen, period of treatment, and follow-up (12 years). The TBI group (n = 32) received TBI as part of the megatherapy procedure (1982-1993), whereas the CT group (n 30) received conditioning without TBI (1985-1992). Analysis 12 years later focused on growth, weight and corpulence (body mass index) delay; hormonal deficiencies; liver,more » kidney, heart, ear, eye, and dental sequelae; school performance; and the incidence of secondary tumors. Results: Impact of TBI was most marked in relation to growth and weight delay, although the mean delay was not severe, probably because of treatment with growth hormones. Other consequences of TBI were thyroid insufficiency, cataracts, and a high incidence of secondary tumors. Hearing loss and dental agenesis were more prominent in the group treated with CT alone. No differences were observed in school performance. Conclusion: The most frequent side effects of TBI were cataracts, thyroid insufficiency, and growth delay, but more worrying is the risk of secondary tumors. Because of the young mean age of patients and the toxicity of TBI regimens without any survival advantage, regimens without TBI are preferable in the management of Stage IV neuroblastoma.« less

  4. IVS Working Group 2 for Product Specification and Observing Programs

    NASA Astrophysics Data System (ADS)

    Schuh, H.; Charlot, P.; Hase, H.; Himwich, E.; Kingham, K.; Klatt, C.; Ma, C.; Malkin, Z.; Niell, A.; Nothnagel, A.; Schluter, W.; Takashima, K.; Vandenberg, N.

    2002-03-01

    After the scientific rationale is given in the introduction the Terms of Reference and the proceeding of IVS Working Group 2 are presented. Then the present status and future goals of all international activities within IVS are described. In particular the current products of IVS are described in terms of accuracy, reliability, frequency of observing sessions, temporal resolution of the parameters estimated by VLBI data analysis, time delay from observing to product, i.e. time which has passed after the end of the last session included in the VLBI solution till availability of the final products and frequency of solution (in the case of "global solutions";, when all existing or a high number of VLBI sessions are used to determine so-called global parameters). All IVS products and their potential users are covered in the report. This includes the Earth orientation parameters (EOP), the reference frames (TRF and CRF), geodynamical and geophysical parameters and physical parameters. Measures which should be taken within IVS to meet the goals defined in the first steps are presented. As most of the measures are related to the observing programs, these are the main focus for improving the current status of IVS products. The report shows that due to various requirements of the different users of IVS products the following aspects must be accomplished: - significant improvement of the accuracy of VLBI products, - shorter time delay from observation to availability of results, - almost continuous temporal coverage by VLBI sessions. A first scenario of the IVS observing program for 2002 and 2003 considers an increase of observing time by about 30%-40% and includes sessions carried out by S2 and K4 technology. The midterm observing program for the next 4-5 years seems to be rather ambitious. However, it appears feasible if all efforts are concentrated and the necessary resources are made available. From: Bidzina Kapanadze (Ilia State Iniversity) Address: bidzina_kapanadze@iliauni.edu.ge Database: ast

  5. EDN1 Lys198Asn is associated with diabetic retinopathy in type 2 diabetes

    PubMed Central

    Li, Haitao; Louey, Janice W.C.; Choy, Kwong Wai; Liu, David T.L.; Chan, Wai Man; Chan, Yiu Man; Fung, Nicholas S.K.; Fan, Bao Jian; Baum, Larry; Chan, Juliana C.N.; Lam, Dennis S.C.

    2008-01-01

    Purpose We tested the hypothesis that genetic variants in vasoactive and angiogenic factors regulating the retina vasculature contribute to the development of diabetic retinopathy (DR). Methods A case-control study was performed to study the genetic association between DR and polymorphic variants of EDN1 (Lys198Asn), LTA (IVS1–80C>A, IVS1–206G>C, IVS1–252A>G), eNOS (Glu298Asp), and ITGA2 (BgI II) in a Chinese population with type 2 diabetes mellitus. A well defined population with type 2 diabetes, consisting of 127 controls and 216 DR patients, was recruited. Results A higher frequency of the Asn/Asn genotype of EDN1 was found in individuals with at least 10 years of diabetes and no retinopathy (controls) compared with DR patients with any duration of diabetes (DR: 2.3%; control: 11.0%; p=0.0002). The Asn allele was also more frequent in controls than DR patients (DR: 16.4%; control: 29.5%; p=0.007). Multiple logistic regression analysis showed that the Asn/Asn genotype was the factor most significantly associated with reduced risk of DR (odds ratio=0.19; 95% CI: 0.07-0.53; p=0.002) and with late onset of diabetes (Asn/Asn: 59 years; Lys/Lys + Lys/Asn: 53 years; p=0.02). Moreover, the Lys/Lys genotype was more common among patients with nonproliferative (75.7%) than proliferative DR (56.9%; p=0.008). The distributions of Lys198Asn alleles in hypertension did not differ from normotensive subjects. No associations between DR and polymorphisms of LTA, eNOS, or ITGA2 were detected, and there were no detectable gene-gene or gene-environmental interactions among the polymorphisms. Conclusions The Asn/Asn genotype of EDN1 was associated with a reduced risk of DR and with delayed onset of type 2 diabetes. PMID:18806884

  6. Protein Kinase LegK2 Is a Type IV Secretion System Effector Involved in Endoplasmic Reticulum Recruitment and Intracellular Replication of Legionella pneumophila ▿

    PubMed Central

    Hervet, Eva; Charpentier, Xavier; Vianney, Anne; Lazzaroni, Jean-Claude; Gilbert, Christophe; Atlan, Danièle; Doublet, Patricia

    2011-01-01

    Legionella pneumophila is the etiological agent of Legionnaires' disease. Crucial to the pathogenesis of this intracellular pathogen is its ability to subvert host cell defenses, permitting intracellular replication in specialized vacuoles within host cells. The Dot/Icm type IV secretion system (T4SS), which translocates a large number of bacterial effectors into host cell, is absolutely required for rerouting the Legionella phagosome. Many Legionella effectors display distinctive eukaryotic domains, among which are protein kinase domains. In silico analysis and in vitro phosphorylation assays identified five functional protein kinases, LegK1 to LegK5, encoded by the epidemic L. pneumophila Lens strain. Except for LegK5, the Legionella protein kinases are all T4SS effectors. LegK2 plays a key role in bacterial virulence, as demonstrated by gene inactivation. The legK2 mutant containing vacuoles displays less-efficient recruitment of endoplasmic reticulum markers, which results in delayed intracellular replication. Considering that a kinase-dead substitution mutant of legK2 exhibits the same virulence defects, we highlight here a new molecular mechanism, namely, protein phosphorylation, developed by L. pneumophila to establish a replicative niche and evade host cell defenses. PMID:21321072

  7. [Allergic contact dermatitis to common ivy (Hedera helix L.)].

    PubMed

    Ozdemir, C; Schneider, L A; Hinrichs, R; Staib, G; Weber, L; Weiss, J M; Scharffetter-Kochanek, K

    2003-10-01

    Common ivy (Hedera helix L.) is a ubiquitous plant in Europe whose major allergen falcarinol has moderate allergic potential. It is not related to poison ivy (Toxicodendron spp.). There are no cross reactions between the allergens of common ivy (falcarinol) and poison ivy (urushiol). Contact with common ivy or falcarinol may lead to sensitization and then a delayed hypersensitivity reaction. There are only few cases described in the literature. We report on a male hobby gardener with appropriate clinical history and positive patch test. The pathogenic mechanism is a type IV reaction following a sensitization exposure. Gardeners and landscape architects with frequent exposure to common ivy and thus a high risk of sensitization should wear appropriate protective clothing.

  8. Extension of the classical classification of β-turns

    PubMed Central

    de Brevern, Alexandre G.

    2016-01-01

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3rd of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years. PMID:27627963

  9. Extension of the classical classification of β-turns.

    PubMed

    de Brevern, Alexandre G

    2016-09-15

    The functional properties of a protein primarily depend on its three-dimensional (3D) structure. These properties have classically been assigned, visualized and analysed on the basis of protein secondary structures. The β-turn is the third most important secondary structure after helices and β-strands. β-turns have been classified according to the values of the dihedral angles φ and ψ of the central residue. Conventionally, eight different types of β-turns have been defined, whereas those that cannot be defined are classified as type IV β-turns. This classification remains the most widely used. Nonetheless, the miscellaneous type IV β-turns represent 1/3(rd) of β-turn residues. An unsupervised specific clustering approach was designed to search for recurrent new turns in the type IV category. The classical rules of β-turn type assignment were central to the approach. The four most frequently occurring clusters defined the new β-turn types. Unexpectedly, these types, designated IV1, IV2, IV3 and IV4, represent half of the type IV β-turns and occur more frequently than many of the previously established types. These types show convincing particularities, in terms of both structures and sequences that allow for the classical β-turn classification to be extended for the first time in 25 years.

  10. Electroencephalographic Response to Sodium Nitrite May Predict Delayed Cerebral Ischemia After Severe Subarachnoid Hemorrhage.

    PubMed

    Garry, Payashi S; Rowland, Matthew J; Ezra, Martyn; Herigstad, Mari; Hayen, Anja; Sleigh, Jamie W; Westbrook, Jon; Warnaby, Catherine E; Pattinson, Kyle T S

    2016-11-01

    Aneurysmal subarachnoid hemorrhage often leads to death and poor clinical outcome. Injury occurring during the first 72 hours is termed "early brain injury," with disruption of the nitric oxide pathway playing an important pathophysiologic role in its development. Quantitative electroencephalographic variables, such as α/δ frequency ratio, are surrogate markers of cerebral ischemia. This study assessed the quantitative electroencephalographic response to a cerebral nitric oxide donor (intravenous sodium nitrite) to explore whether this correlates with the eventual development of delayed cerebral ischemia. Unblinded pilot study testing response to drug intervention. Neuroscience ICU, John Radcliffe Hospital, Oxford, United Kingdom. Fourteen World Federation of Neurosurgeons grades 3, 4, and 5 patients (mean age, 52.8 yr [range, 41-69 yr]; 11 women). IV sodium nitrite (10 μg/kg/min) for 1 hour. Continuous electroencephalographic recording for 2 hours. The alpha/delta frequency ratio was measured before and during IV sodium nitrite infusion. Seven of 14 patients developed delayed cerebral ischemia. There was a +30% to +118% (range) increase in the alpha/delta frequency ratio in patients who did not develop delayed cerebral ischemia (p < 0.0001) but an overall decrease in the alpha/delta frequency ratio in those patients who did develop delayed cerebral ischemia (range, +11% to -31%) (p = 0.006, multivariate analysis accounting for major confounds). Administration of sodium nitrite after severe subarachnoid hemorrhage differentially influences quantitative electroencephalographic variables depending on the patient's susceptibility to development of delayed cerebral ischemia. With further validation in a larger sample size, this response may be developed as a tool for risk stratification after aneurysmal subarachnoid hemorrhage.

  11. Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

    PubMed

    Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

    2017-01-01

    The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  12. AtlA functions as a peptidoglycan lytic transglycosylase in the Neisseria gonorrhoeae type IV secretion system.

    PubMed

    Kohler, Petra L; Hamilton, Holly L; Cloud-Hansen, Karen; Dillard, Joseph P

    2007-08-01

    Type IV secretion systems require peptidoglycan lytic transglycosylases for efficient secretion, but the function of these enzymes is not clear. The type IV secretion system gene cluster of Neisseria gonorrhoeae encodes two peptidoglycan transglycosylase homologues. One, LtgX, is similar to peptidoglycan transglycosylases from other type IV secretion systems. The other, AtlA, is similar to endolysins from bacteriophages and is not similar to any described type IV secretion component. We characterized the enzymatic function of AtlA in order to examine its role in the type IV secretion system. Purified AtlA was found to degrade macromolecular peptidoglycan and to produce 1,6-anhydro peptidoglycan monomers, characteristic of lytic transglycosylase activity. We found that AtlA can functionally replace the lambda endolysin to lyse Escherichia coli. In contrast, a sensitive measure of lysis demonstrated that AtlA does not lyse gonococci expressing it or gonococci cocultured with an AtlA-expressing strain. The gonococcal type IV secretion system secretes DNA during growth. A deletion of ltgX or a substitution in the putative active site of AtlA severely decreased DNA secretion. These results indicate that AtlA and LtgX are actively involved in type IV secretion and that AtlA is not involved in lysis of gonococci to release DNA. This is the first demonstration that a type IV secretion peptidoglycanase has lytic transglycosylase activity. These data show that AtlA plays a role in type IV secretion of DNA that requires peptidoglycan breakdown without cell lysis.

  13. [Diagnostic values of serum type III procollagen N-terminal peptide in type IV gastric cancer].

    PubMed

    Akazawa, S; Fujiki, T; Kanda, Y; Kumai, R; Yoshida, S

    1985-04-01

    Since increased synthesis of collagen has been demonstrated in tissue of type IV gastric cancer, we attempted to distinguish type IV gastric cancer from other cancers by measuring serum levels of type III procollagen N-terminal peptide (type III-N-peptide). Mean serum levels in type IV gastric cancer patients without metastasis were found to be elevated above normal values and developed a tendency to be higher than those in types I, II and III gastric cancer patients without metastasis. Highly positive ratios were found in patients with liver diseases including hepatoma and colon cancer, biliary tract cancer, and esophageal cancer patients with liver, lung or bone metastasis, but only 2 out of 14 of these cancer patients without such metastasis showed positive serum levels of type III-N-peptide. Positive cases in patients with type IV gastric cancer were obtained not only in the group with clinical stage IV but also in the groups with clinical stages II and III. In addition, high serum levels of type III-N-peptide in patients with type IV gastric cancer were seen not only in the cases with liver, lung or bone metastasis but also in cases with disseminated peritoneal metastasis alone. These results suggest that if the serum level of type III-N-peptide is elevated above normal values, type IV gastric cancer should be suspected after ruling out liver diseases, myelofibrosis and liver, lung or bone metastasis.

  14. Neurophysiological Distinction between Schizophrenia and Schizoaffective Disorder

    PubMed Central

    Mathalon, Daniel H.; Hoffman, Ralph E.; Watson, Todd D.; Miller, Ryan M.; Roach, Brian J.; Ford, Judith M.

    2009-01-01

    Schizoaffective disorder (SA) is distinguished from schizophrenia (SZ) based on the presence of prominent mood symptoms over the illness course. Despite this clinical distinction, SA and SZ patients are often combined in research studies, in part because data supporting a distinct pathophysiological boundary between the disorders are lacking. Indeed, few studies have addressed whether neurobiological abnormalities associated with SZ, such as the widely replicated reduction and delay of the P300 event-related potential (ERP), are also present in SA. Scalp EEG was acquired from patients with DSM-IV SA (n = 15) or SZ (n = 22), as well as healthy controls (HC; n = 22) to assess the P300 elicited by infrequent target (15%) and task-irrelevant distractor (15%) stimuli in separate auditory and visual ”oddball” tasks. P300 amplitude was reduced and delayed in SZ, relative to HC, consistent with prior studies. These SZ abnormalities did not interact with stimulus type (target vs. task-irrelevant distractor) or modality (auditory vs. visual). Across sensory modality and stimulus type, SA patients exhibited normal P300 amplitudes (significantly larger than SZ patients and indistinguishable from HC). However, P300 latency and reaction time were both equivalently delayed in SZ and SA patients, relative to HC. P300 differences between SA and SZ patients could not be accounted for by variation in symptom severity, socio-economic status, education, or illness duration. Although both groups show similar deficits in processing speed, SA patients do not exhibit the P300 amplitude deficits evident in SZ, consistent with an underlying pathophysiological boundary between these disorders. PMID:20140266

  15. Pseudomonas aeruginosa type IV minor pilins and PilY1 regulate virulence by modulating FimS-AlgR activity.

    PubMed

    Marko, Victoria A; Kilmury, Sara L N; MacNeil, Lesley T; Burrows, Lori L

    2018-05-18

    Type IV pili are expressed by a wide range of prokaryotes, including the opportunistic pathogen Pseudomonas aeruginosa. These flexible fibres mediate twitching motility, biofilm maturation, surface adhesion, and virulence. The pilus is composed mainly of major pilin subunits while the low abundance minor pilins FimU-PilVWXE and the putative adhesin PilY1 prime pilus assembly and are proposed to form the pilus tip. The minor pilins and PilY1 are encoded in an operon that is positively regulated by the FimS-AlgR two-component system. Independent of pilus assembly, PilY1 was proposed to be a mechanosensory component that-in conjunction with minor pilins-triggers up-regulation of acute virulence phenotypes upon surface attachment. Here, we investigated the link between the minor pilins/PilY1 and virulence. pilW, pilX, and pilY1 mutants had reduced virulence towards Caenorhabditis elegans relative to wild type or a major pilin mutant, implying a role in pathogenicity that is independent of pilus assembly. We hypothesized that loss of specific minor pilins relieves feedback inhibition on FimS-AlgR, increasing transcription of the AlgR regulon and delaying C. elegans killing. Reporter assays confirmed that FimS-AlgR were required for increased expression of the minor pilin operon upon loss of select minor pilins. Overexpression of AlgR or its hyperactivation via a phosphomimetic mutation reduced virulence, and the virulence defects of pilW, pilX, and pilY1 mutants required FimS-AlgR expression and activation. We propose that PilY1 and the minor pilins inhibit their own expression, and that loss of these proteins leads to FimS-mediated activation of AlgR that suppresses expression of acute-phase virulence factors and delays killing. This mechanism could contribute to adaptation of P. aeruginosa in chronic lung infections, as mutations in the minor pilin operon result in the loss of piliation and increased expression of AlgR-dependent virulence factors-such as alginate-that are characteristic of such infections.

  16. Cognitive and Adaptive Skills in Toddlers Who Meet Criteria for Autism in DSM-IV but not DSM-5

    PubMed Central

    Brennan, Laura A.; Barton, Marianne L.; Fein, Deborah

    2017-01-01

    The current study compared adaptive and cognitive skills, and autism severity of toddlers with an autism spectrum disorder (ASD) diagnosis under DSM-IV but not DSM-5 criteria (DSM-IV only group) to those who met autism criteria under both diagnostic systems (DSM-5 group) and to those without ASD (non-ASD group). The toddlers in the DSM-IV only group were less delayed on various domains of adaptive (Communication, Socialization) and cognitive (Expressive and Receptive language, Fine Motor, Visual Reception) skills, and had less severe symptoms of ASD than the DSM-5 group. Thus, they might have the best potential for successful intervention. The DSM-IV only group did not differ from the non-ASD group in any adaptive or cognitive skills except for socialization skills, the hallmark of ASD. PMID:27628939

  17. Cognitive and Adaptive Skills in Toddlers Who Meet Criteria for Autism in DSM-IV but not DSM-5.

    PubMed

    Jashar, Dasal Tenzin; Brennan, Laura A; Barton, Marianne L; Fein, Deborah

    2016-12-01

    The current study compared adaptive and cognitive skills, and autism severity of toddlers with an autism spectrum disorder (ASD) diagnosis under DSM-IV but not DSM-5 criteria (DSM-IV only group) to those who met autism criteria under both diagnostic systems (DSM-5 group) and to those without ASD (non-ASD group). The toddlers in the DSM-IV only group were less delayed on various domains of adaptive (Communication, Socialization) and cognitive (Expressive and Receptive language, Fine Motor, Visual Reception) skills, and had less severe symptoms of ASD than the DSM-5 group. Thus, they might have the best potential for successful intervention. The DSM-IV only group did not differ from the non-ASD group in any adaptive or cognitive skills except for socialization skills, the hallmark of ASD.

  18. The antihistamine olopatadine regulates T cell activation in palladium allergy.

    PubMed

    Iguchi, Naohiko; Takeda, Yuri; Sato, Naoki; Ukichi, Kenichirou; Katakura, Akira; Ueda, Kyosuke; Narushima, Takayuki; Higuchi, Shigehito; Ogasawara, Kouetsu

    2016-06-01

    Because of its corrosion resistance palladium (Pd) has been widely used in many consumer products ranging from fashion accessories to dental materials. Recently, however, an increase in Pd allergy cases has been reported. Metal allergy is categorized as a Type IV allergy, which is characterized as a delayed-type hypersensitivity reaction in which T cells are known to play an important role; however, the precise mechanism of their action remains unclear. Here we defined the relationship between histamine and the Pd allergic reaction specifically with respect to T cell responses. To verify the effects of histamine on T cells, we examined whether there is a change in IFN-γ production following stimulation of histamine or the antihistamine, olopatadine hydrochloride (OLP), in vitro. In addition, we assessed whether OLP administration affected the degree of footpad swelling or IFN-γ production during the Pd allergy response in mice. We found that histamine stimulation increased IFN-γ production in T cells, specifically enhancing IFN-γ production in CD8(+) T cells compared with CD4(+) T cells. Interestingly, OLP suppressed the production of IFN-γ in CD8(+) T cells, and this compound inhibited footpad swelling and IFN-γ production in mice with Pd allergy. These results suggest that histamine promotes the Type IV allergic reaction and thus, the histamine 1 receptor (H1R) might be useful therapeutic target for treatment of metal allergy. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Comparison of Children's Venipuncture Fear and Pain: Randomized Controlled Trial of EMLA® and J-Tip Needleless Injection System®.

    PubMed

    Stoltz, Petronella; Manworren, Renee C B

    Needle procedures, like venipuncture and intravenous (IV) catheter insertion, are recognized as a common cause of pain and fear for children in hospitals and emergency departments. The purpose of this study was to compare children's self-reported pain and fear related to IV insertion with administration of either the topical local anesthetic EMLA® or 1% buffered lidocaine delivered with the J-Tip Needleless Injection System® (J-Tip®). In this prospective, randomized trial, 150 consecutive pediatric patients 8 to 18years of age undergoing IV insertion were randomly assigned 1:1 to treatment group. Participants self-reported procedural pain using a Visual Analog Scale, and procedural fear using the Children's Fear Scale. Procedural pain scores were significantly lower in the EMLA® group (mean score 1.63+1.659) vs. the J-Tip® group (2.99±2.586; p<0.001). Post-procedure fear scores were significantly lower than pre-procedure fear scores in both treatment groups (p<0.002), but there was no difference in fear scores between the two treatment groups (p=0.314). EMLA® provided superior pain relief for IV insertion compared to J-Tip®. Although EMLA® use resulted in lower self-reported pain scores compared to J-Tip®, pain scores for both treatments were low and fear scores did not differ. When IV insertion can be delayed for 60-90min, EMLA® should be used. When a delay is contraindicated, J-Tip® may be a reasonable alternative to minimize procedural pain of IV insertion. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues.

    PubMed

    Foldager, Casper Bindzus; Toh, Wei Seong; Gomoll, Andreas H; Olsen, Bjørn Reino; Spector, Myron

    2014-04-01

    The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti-collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM.

  1. An 18-ps TDC using timing adjustment and bin realignment methods in a Cyclone-IV FPGA

    NASA Astrophysics Data System (ADS)

    Cao, Guiping; Xia, Haojie; Dong, Ning

    2018-05-01

    The method commonly used to produce a field-programmable gate array (FPGA)-based time-to-digital converter (TDC) creates a tapped delay line (TDL) for time interpolation to yield high time precision. We conduct timing adjustment and bin realignment to implement a TDC in the Altera Cyclone-IV FPGA. The former tunes the carry look-up table (LUT) cell delay by changing the LUT's function through low-level primitives according to timing analysis results, while the latter realigns bins according to the timing result obtained by timing adjustment so as to create a uniform TDL with bins of equivalent width. The differential nonlinearity and time resolution can be improved by realigning the bins. After calibration, the TDC has a 18 ps root-mean-square timing resolution and a 45 ps least-significant bit resolution.

  2. Incidental Learning: A Brief, Valid Measure of Memory Based on the WAIS-IV Vocabulary and Similarities Subtests.

    PubMed

    Spencer, Robert J; Reckow, Jaclyn; Drag, Lauren L; Bieliauskas, Linas A

    2016-12-01

    We assessed the validity of a brief incidental learning measure based on the Similarities and Vocabulary subtests of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV). Most neuropsychological assessments for memory require intentional learning, but incidental learning occurs without explicit instruction. Incidental memory tests such as the WAIS-III Symbol Digit Coding subtest have existed for many years, but few memory studies have used a semantically processed incidental learning model. We conducted a retrospective analysis of 37 veterans with traumatic brain injury, referred for outpatient neuropsychological testing at a Veterans Affairs hospital. As part of their evaluation, the participants completed the incidental learning tasks. We compared their incidental learning performance to their performance on traditional memory measures. Incidental learning scores correlated strongly with scores on the California Verbal Learning Test-Second Edition (CVLT-II) and Brief Visuospatial Memory Test-Revised (BVMT-R). After we conducted a partial correlation that controlled for the effects of age, incidental learning correlated significantly with the CVLT-II Immediate Free Recall, CVLT-II Short-Delay Recall, CVLT-II Long-Delay Recall, and CVLT-II Yes/No Recognition Hits, and with the BVMT-R Delayed Recall and BVMT-R Recognition Discrimination Index. Our incidental learning procedures derived from subtests of the WAIS-IV Edition are an efficient and valid way of measuring memory. These tasks add minimally to testing time and capitalize on the semantic encoding that is inherent in completing the Similarities and Vocabulary subtests.

  3. Selective TNF-α inhibitor-induced injection site reactions.

    PubMed

    Murdaca, Giuseppe; Spanò, Francesca; Puppo, Francesco

    2013-03-01

    During the last decade, many new biological immune modulators entered the market as new therapeutic principles. TNF-α is a pro-inflammatory cytokine known to a have a key role in the pathogenic mechanisms of various immune-mediated or inflammatory diseases. TNF-α blockers have demonstrated efficacy in large, randomized controlled clinical trials either as monotherapy or in combination with other anti-inflammatory or disease-modifying anti-rheumatic drugs. Although generally well tolerated and safe, potential adverse events may be associated with TNF-α inhibitor treatment. The authors will briefly review the potential adverse drug reactions and the immunological mechanisms of injection site reactions (ISRs) in patients treated with etanercept and adalimumab. Patients treated with TNF-α inhibitors can develop ISR around the sites of injections. 'Type IV delayed type reaction' or 'recall ISRs'. Eosinophilic cellulitis or 'Wells syndrome', 'type III' and 'type I' reactions are reported. Long-term studies are necessary to determine the durability of response and the real risk of ISRs with golimumab and certolizumab pegol. Further studies are also necessary to evaluate the immunogenicity of these drugs.

  4. Generalized dissociative amnesia: episodic, semantic and procedural memories lost and found.

    PubMed

    van der Hart, O; Nijenhuis, E

    2001-10-01

    This review tests Ribot's classic twofold categorization of generalized amnesia (GA) into Type I, total loss of episodic memory, and Type II, additional more or less extensive loss of semantic and/or procedural memory. It also explores his law of regression, according to which, cast in modern terms, recovery of lost procedural and semantic memories precedes recovery of episodic memory, as well as reported aetiological factors. Clinically and formally assessed cases of GA, published since 1845, were surveyed and further analysed. Over and above authentic episodic memory loss, cases differed widely in the extent of impairment of semantic and procedural memory. Recovery of semantic and procedural memory often preceded recovery of episodic memory. This particularly applied to authenticated trauma memories. To an extent, lost memories affected current functioning, and in some cases were associated with alternating dissociative personalities. Severe memory distortions upon memory recovery were not reported. Most cases were trauma or stress related, while in some cases the aetiology remained unknown. Contrary to the view expressed in DSM-IV, which states that dissociative amnesia pertains to an inability to recall personal information, GA may also involve loss and recovery of semantic and procedural memories. Since the loss of various memory types in GA is dimensional rather than categorical, Ribot's typological distinction does not hold. Some of the reviewed cases suggest a trauma-related aetiology. Generalized amnesia of varying degrees of severity can involve delayed retrieval of trauma memories, as well as the loss and delayed retrieval of the premorbid personality.

  5. Genetics Home Reference: familial porencephaly

    MedlinePlus

    ... one component of a protein called type IV collagen. Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  6. A type IV burst associated with a coronal streamer disruption event

    NASA Technical Reports Server (NTRS)

    Kundu, M. R.

    1987-01-01

    A type IV burst was observed on February 17, 1985 with the Clark Lake Radio Observatory multifrequency radioheliograph operating in the frequency range 20-125 MHz. This burst was associated with a coronal streamer disruption event. From two-dimensional images produced at 50 MHz, evidence of a type II burst and a slow moving type IV burst are shown. The observations of the moving type IV burst suggests that a plasmoid containing energetic electrons can result from the disruption of a coronal streamer.

  7. Genetics Home Reference: multicentric osteolysis, nodulosis, and arthropathy

    MedlinePlus

    ... to cut (cleave) a protein called type IV collagen. Type IV collagen is a major structural component of basement membranes, ... enzyme, preventing the normal cleavage of type IV collagen. It is unclear how a loss of enzyme ...

  8. viking: identification and characterization of a second type IV collagen in Drosophila.

    PubMed

    Yasothornsrikul, S; Davis, W J; Cramer, G; Kimbrell, D A; Dearolf, C R

    1997-10-01

    We have taken an enhancer trap approach to identify genes that are expressed in hematopoietic cells and tissues of Drosophila. We conducted a molecular analysis of two P-element insertion strains that have reporter gene expression in embryonic hemocytes, strain 197 and vikingICO. This analysis has determined that viking encodes a collagen type IV gene, alpha2(IV). The viking locus is located adjacent to the previously described DCg1, which encodes collagen alpha1(IV), and in the opposite orientation. The alpha2(IV) and alpha1(IV) collagens are structurally very similar to one another, and to vertebrate type IV collagens. In early development, viking and DCg1 are transcribed in the same tissue-specific pattern, primarily in the hemocytes and fat body cells. Our results suggest that both the alpha1 and alpha2 collagen IV chains may contribute to basement membranes in Drosophila. This work also provides the foundation for a more complete genetic dissection of collagen type IV molecules and their developmental function in Drosophila.

  9. Effects of astragaloside IV on action potentials and ionic currents in guinea-pig ventricular myocytes.

    PubMed

    Zhao, Meimi; Zhao, Jinsheng; He, Guilin; Sun, Xuefei; Huang, Xueshi; Hao, Liying

    2013-01-01

    Astragaloside IV (AS-IV) is one of the main active constituents of Astragalus membranaceus, which has various actions on the cardiovascular system. However, its electrophysiological mechanisms are not clear. In the present study, we investigated the effects of AS-IV on action potentials and membrane currents using the whole-cell patch clamp technique in isolated guinea-pig ventricular myocytes. AS-IV prolonged the action potential duration (APD) at all three tested concentrations. The peak effect was achieved with 1×10(-6) M, at which concentration AS-IV significantly prolonged the APD at 95% repolarization from 313.1±38.9 to 785.3±83.7 ms. AS-IV at 1×10(-6) M also enhanced the inward rectifier K(+) currents (I(K1)) and inhibited the delayed rectifier K(+) currents (I(K)). AS-IV (1×10(-6) M) strongly depressed the peak of voltage-dependent Ca(2+) channel current (I(CaL)) from -607.3±37.5 to -321.1±38.3 pA. However, AS-IV was not found to affect the Na(+) currents. Taken together, AS-IV prolonged APD of guinea-pig ventricular myocytes, which might be explained by its inhibition of I(K). AS-IV also influences Ca(2+) signaling through suppressing ICaL.

  10. Distribution of type IV collagen in pancreatic adenocarcinoma and chronic pancreatitis.

    PubMed Central

    Lee, C. S.; Montebello, J.; Georgiou, T.; Rode, J.

    1994-01-01

    Changes in the basement membrane are present in various neoplastic conditions such as neurofibrosarcoma, cervical carcinoma, colorectal cancers and hepatoblastoma. This study examines the expression of type IV collagen in the basement membrane, using an immunohistochemical method, in the normal pancreas (n = 10), chronic pancreatitis (n = 15) and pancreatic adenocarcinoma (n = 30). The formalin fixed, paraffin embedded tissue was sectioned and pretreated with protease prior to immunostaining for type IV collagen. There was a statistically significant difference in type IV collagen expression between pancreatic carcinoma and chronic pancreatitis (P = 0.0001; chi 2 test with continuity correction). In pancreatic adenocarcinoma, type IV collagen distribution in the basement membrane was discontinuous and irregular or absent around individual or groups of neoplastic cells (n = 30). Most cases of chronic pancreatitis showed continuous pattern of basement membrane type IV collagen around residual ducts (n = 10). In the normal pancreas, only one of the ten cases showed discontinuous basement membrane around pancreatic ducts, while in the rest of the cases, the pattern was continuous. This study suggests that there is abnormal distribution of type IV collagen in the basement membrane in pancreatic carcinoma, which may be related to either abnormal deposition or degradation of the collagen. Immunostaining for type IV collagen may be of some diagnostic use for distinguishing pancreatic adenocarcinoma from problematic cases of chronic pancreatitis. Images Figure 1 Figure 2 Figure 3 PMID:8199008

  11. Predictors and outcomes of endoleaks in the Veterans Affairs Open Versus Endovascular Repair (OVER) Trial of Abdominal Aortic Aneurysms.

    PubMed

    Lal, Brajesh K; Zhou, Wei; Li, Ziyi; Kyriakides, Tassos; Matsumura, Jon; Lederle, Frank A; Freischlag, Julie

    2015-12-01

    The Veterans Affairs Open Versus Endovascular Repair (OVER) Trial of Abdominal Aortic Aneurysms study was a randomized controlled trial comparing open vs endovascular repair (EVAR) in standard-risk patients with infrarenal aortic aneurysms. The analysis reported here identifies characteristics, risk factors, and long-term outcome of endoleaks in patients treated with EVAR in the OVER cohort. The OVER trial enrolled 881 patients, of whom 439 received successful EVAR. Logistic regression analysis was used to identify predictors for endoleaks and secondary interventions. Kaplan-Meier survival analysis, longitudinal plots, and generalized linear mixed models methods were used to describe time to endoleak detection, resolution, or death. During a mean follow-up of 6.2 ± 2.4 years, 135 patients (30.5%) developed 187 endoleaks. Four patients with EVAR went on to rupture; these four patients did not all have an endoleak. Mortality between patients who did and did not develop endoleaks was not significantly different. The 187 endoleaks included 12% type I, 76% type II, 3% type III, 3% type IV, and 6% indeterminate. Patient demographics and vascular risk factors were not associated with endoleak development. The presence of endoleaks resulted in an increase in aneurysm diameter over time (P < .0001). Fifty-three percent of endoleaks resolved spontaneously, and 31.9% received secondary interventions. The initial aneurysm size independently predicted a need for secondary interventions (P < .0003). Delayed type II endoleaks (detected >1 year after EVAR) were associated with aneurysm enlargement compared with the early counterpart. There was no difference in aneurysm size or length of survival between type II and other types of endoleak. We present one of the most comprehensive and longest follow-up analyses of patients treated with aortic endografts. Endoleaks were common and negatively affected aneurysm diameter reduction. Delayed type II endoleaks were associated with late aneurysm diameter enlargement. Endoleaks and aneurysm diameter enlargement were not associated with excess mortality compared with those without these features. Published by Elsevier Inc.

  12. Genetics Home Reference: hereditary angiopathy with nephropathy, aneurysms, and muscle cramps syndrome

    MedlinePlus

    ... one component of a protein called type IV collagen . Type IV collagen molecules attach to each other to form complex ... and support cells in many tissues. Type IV collagen networks play an important role in the basement ...

  13. Type IV collagen is a novel DEJ biomarker that is reduced by radiotherapy.

    PubMed

    McGuire, J D; Gorski, J P; Dusevich, V; Wang, Y; Walker, M P

    2014-10-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy--teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. © International & American Associations for Dental Research.

  14. Type IV Collagen is a Novel DEJ Biomarker that is Reduced by Radiotherapy

    PubMed Central

    McGuire, J.D.; Gorski, J.P.; Dusevich, V.; Wang, Y.; Walker, M.P.

    2014-01-01

    The dental basement membrane (BM) is composed of collagen types IV, VI, VII, and XVII, fibronectin, and laminin and plays an inductive role in epithelial-mesenchymal interactions during tooth development. The BM is degraded and removed during later-stage tooth morphogenesis; however, its original position defines the location of the dentin-enamel junction (DEJ) in mature teeth. We recently demonstrated that type VII collagen is a novel component of the inner enamel organic matrix layer contiguous with the DEJ. Since it is frequently co-expressed with and forms functional complexes with type VII collagen, we hypothesized that type IV collagen should also be localized to the DEJ in mature human teeth. To identify collagen IV, we first evaluated defect-free erupted teeth from various donors. To investigate a possible stabilizing role, we also evaluated extracted teeth exposed to high-dose radiotherapy – teeth that manifest post-radiotherapy DEJ instability. We now show that type IV collagen is a component within the morphological DEJ of posterior and anterior teeth from individuals aged 18 to 80 yr. Confocal microscopy revealed that immunostained type IV collagen was restricted to the 5- to 10-µm-wide optical DEJ, while collagenase treatment or previous in vivo tooth-level exposure to > 60 Gray irradiation severely reduced immunoreactivity. This assignment was confirmed by Western blotting with whole-tooth crown and enamel extracts. Without reduction, type IV collagen contained macromolecular α-chains of 225 and 250 kDa. Compositionally, our results identify type IV collagen as the first macromolecular biomarker of the morphological DEJ of mature teeth. Given its network structure and propensity to stabilize the dermal-epidermal junction, we propose that a collagen-IV-enriched DEJ may, in part, explain its well-known fracture toughness, crack propagation resistance, and stability. In contrast, loss of type IV collagen may represent a biochemical rationale for the DEJ instability observed following oral cancer radiotherapy. PMID:25146181

  15. Distribution of Basement Membrane Molecules, Laminin and Collagen Type IV, in Normal and Degenerated Cartilage Tissues

    PubMed Central

    Toh, Wei Seong; Gomoll, Andreas H.; Olsen, Bjørn Reino; Spector, Myron

    2014-01-01

    Objective: The objective of the present study was to investigate the presence and distribution of 2 basement membrane (BM) molecules, laminin and collagen type IV, in healthy and degenerative cartilage tissues. Design: Normal and degenerated tissues were obtained from goats and humans, including articular knee cartilage, the intervertebral disc, and meniscus. Normal tissue was also obtained from patella-tibial enthesis in goats. Immunohistochemical analysis was performed using anti-laminin and anti–collagen type IV antibodies. Human and goat skin were used as positive controls. The percentage of cells displaying the pericellular presence of the protein was graded semiquantitatively. Results: When present, laminin and collagen type IV were exclusively found in the pericellular matrix, and in a discrete layer on the articulating surface of normal articular cartilage. In normal articular (hyaline) cartilage in the human and goat, the proteins were found co-localized pericellularly. In contrast, in human osteoarthritic articular cartilage, collagen type IV but not laminin was found in the pericellular region. Nonpathological fibrocartilaginous tissues from the goat, including the menisci and the enthesis, were also positive for both laminin and collagen type IV pericellularly. In degenerated fibrocartilage, including intervertebral disc, as in degenerated hyaline cartilage only collagen type IV was found pericellularly around chondrocytes but with less intense staining than in non-degenerated tissue. In calcified cartilage, some cells were positive for laminin but not type IV collagen. Conclusions: We report differences in expression of the BM molecules, laminin and collagen type IV, in normal and degenerative cartilaginous tissues from adult humans and goats. In degenerative tissues laminin is depleted from the pericellular matrix before collagen type IV. The findings may inform future studies of the processes underlying cartilage degeneration and the functional roles of these 2 extracellular matrix proteins, normally associated with BM. PMID:26069692

  16. Which DSM-IV-TR criteria best differentiate high-functioning autism spectrum disorder from ADHD and anxiety disorders in older children?

    PubMed Central

    HARTLEY, SIGAN L.; SIKORA, DARRYN M.

    2010-01-01

    Diagnosis of autism spectrum disorder (ASD) is often delayed in high-functioning children with milder and more varied forms of ASD. The substantial overlap between ASD and other psychiatric disorders is thought to contribute to this delay. This study examined the endorsement of DSM-IV-TR diagnostic criteria for ASD based on semi-structured parent interviews across three groups of older children referred to an ASD clinic: 55 children diagnosed with high-functioning ASD, 27 children diagnosed with attention-deficit/hyperactivity disorder (ADHD), and 23 children diagnosed with anxiety disorder. Results indicate that the criteria within the domains of communication and social relatedness were largely able to discriminate the high-functioning ASD group from the ADHD and anxiety disorder groups, but criteria within the domain of restricted/repetitive/stereotyped patterns were not. PMID:19759063

  17. Haystack Observatory VLBI Correlator

    NASA Technical Reports Server (NTRS)

    Titus, Mike; Cappallo, Roger; Corey, Brian; Dudevoir, Kevin; Niell, Arthur; Whitney, Alan

    2013-01-01

    This report summarizes the activities of the Haystack Correlator during 2012. Highlights include finding a solution to the DiFX InfiniBand timeout problem and other DiFX software development, conducting a DBE comparison test following the First International VLBI Technology Workshop, conducting a Mark IV and DiFX correlator comparison, more broadband delay experiments, more u- VLBI Galactic Center observations, and conversion of RDV session processing to the Mark IV/HOPS path. Non-real-time e-VLBI transfers and engineering support of other correlators continued.

  18. Exploring Different Types of Academic Delayers: A Latent Profile Analysis

    ERIC Educational Resources Information Center

    Grunschel, Carola; Patrzek, Justine; Fries, Stefan

    2013-01-01

    In this study, we explored whether there are different types of academic delayers (i.e., types of students who delay academic tasks). Latent profile analysis based on 554 university students' reasons for academic delay revealed four distinct types: inconspicuous, successful pressure-seeking, worried/anxious, and discontent with studies. The types…

  19. Delayed gadolinium-enhanced MRI of the fibrocartilage disc of the temporomandibular joint – a feasibility study

    PubMed Central

    Pittschieler, Elisabeth; Szomolanyi, Pavol; Schmid-Schwap, Martina; Weber, Michael; Egerbacher, Monika; Traxler, Hannes; Trattnig, Siegfried

    2014-01-01

    Objective To 1) test the feasibility of delayed Gadolinium-Enhanced Magnetic Resonance Imaging of Cartilage (dGEMRIC) at 3 T in the temporomandibular joint (TMJ) and 2) to determine the optimal delay for measurements of the TMJ disc after i.v. contrast agent (CA) administration. Design MRI of the right and left TMJ of six asymptomatic volunteers was performed at 3 T using a dedicated coil. 2D inversion recovery (2D-IR) sequences were performed at 4 time points covering 120 minutes and 3D gradient-echo (3D GRE) dual flip-angle sequences were performed at 14 time points covering 130 minutes after the administration of 0.2 mmol/kg of Gd-diethylenetriamine pentaacetic acid ion (Gd-DTPA)2-, i.e., 0.4 mL of Magnevist™ per kg body weight. Pair-wise tests were used to assess differences between pre-and post-contrast T1 values. Results 2D-IR sequences showed a statistically significant drop (p < 0.001) in T1 values after i.v. CA administration. The T1 drop of 50% was reached 60 minutes after bolus injection in the TMJ disc. The 3D GRE dual flip-angle sequences confirmed these results and show plateau of T1 after 60 minutes. Conclusions T1(Gd) maps calculated from dGEMRIC data allow in vivo assessment of the fibrocartilage disc of the TMJ. The recommended measurement time for dGEMRIC in the TMJ after i.v. CA administration is from 60 to 120 minutes. PMID:25131629

  20. Delayed gadolinium-enhanced MRI of the fibrocartilage disc of the temporomandibular joint--a feasibility study.

    PubMed

    Pittschieler, Elisabeth; Szomolanyi, Pavol; Schmid-Schwap, Martina; Weber, Michael; Egerbacher, Monika; Traxler, Hannes; Trattnig, Siegfried

    2014-12-01

    To 1) test the feasibility of delayed Gadolinium-Enhanced Magnetic Resonance Imaging of Cartilage (dGEMRIC) at 3 T in the temporomandibular joint (TMJ) and 2) to determine the optimal delay for measurements of the TMJ disc after i.v. contrast agent (CA) administration. MRI of the right and left TMJ of six asymptomatic volunteers was performed at 3 T using a dedicated coil. 2D inversion recovery (2D-IR) sequences were performed at 4 time points covering 120 minutes and 3D gradient-echo (3D GRE) dual flip-angle sequences were performed at 14 time points covering 130 minutes after the administration of 0.2 mmol/kg of Gd-diethylenetriamine pentaacetic acid ion (Gd-DTPA)(2-), i.e., 0.4 mL of Magnevist™ per kg body weight. Pair-wise tests were used to assess differences between pre-and post-contrast T1 values. 2D-IR sequences showed a statistically significant drop (p<0.001) in T1 values after i.v. CA administration. The T1 drop of 50% was reached 60 minutes after bolus injection in the TMJ disc. The 3D GRE dual flip-angle sequences confirmed these results and show plateau of T1 after 60 minutes. T1(Gd) maps calculated from dGEMRIC data allow in vivo assessment of the fibrocartilage disc of the TMJ. The recommended measurement time for dGEMRIC in the TMJ after i.v. CA administration is from 60 to 120 minutes. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Type IV Ehlers-Danlos Syndrome: A Surgical Emergency? A Case of Massive Retroperitoneal Hemorrhage

    PubMed Central

    Chun, Stephen G; Pedro, Patrick; Yu, Mihae; Takanishi, Danny M

    2011-01-01

    Retroperitoneal hemorrhagic bleeding is a known manifestation of Type-IV Ehlers-Danlos Syndrome that is caused by loss-of-function mutations of the pro-alpha-1 chains of type III pro-collagen (COL3A1) resulting in vascular fragility. A number of previous reports describe futile surgical intervention for retroperitoneal bleeding in Type-IV Ehlers-Danlos Syndrome with high post-operative mortality, although the rarity of retroperitoneal bleeding associated with Type-IV Ehlers-Danlos Syndrome precludes an evidence-based approach to clinical management. We report a 23-year-old male with history of Type-IV Ehlers-Danlos Syndrome who presented with severe abdominal pain and tachycardia following an episode of vomiting. Further work-up of his abdominal pain revealed massive retroperitoneal bleeding by CT-scan of the abdomen. Given numerous cases of catastrophic injury caused by surgical intervention in Type-IV Ehlers-Danlos Syndrome, the patient was treated non-operatively, and the patient made a full recovery. This case suggests that even in cases of large retroperitoneal hemorrhages associated with Ehlers-Danlos Syndrome, it may not truly represent a surgical emergency. PMID:21966332

  2. Parthenium dermatitis manifesting clinically as polymorphic light eruption and prurigo nodularis- like lesions with vasculitis-like picture on histopathology

    PubMed Central

    Lakshmi, Chembolli; Srinivas, C. R.; Pillai, Suma B.; Shanthakumari, S.

    2011-01-01

    Parthenium dermatitis is a widespread and distressing dermatoses in rural and urban India caused by the air borne allergen of the Compositae weed Parthenium hysterophorus. Parthenium dermatitis has been thought to be mediated solely by type IV hypersensitivity, but recently a combined immediate (type I) and delayed (type IV) hypersensitivity mechanism has been postulated in the initiation and perpetuation of parthenium dermatitis, especially in sensitized subjects with an atopic diathesis. Initially, the exposed sites of the body are involved. Later in the course of the disease, unexposed sites may get involved. Various clinical presentations have been described in parthenium dermatitis. Typically, it presents as an air borne contact dermatitis (ABCD) involving the eyelids and nasolabial folds Other presentations include a photodermatitis (essentially a pseudo photodermatitis), atopic dermatitis, seborrheic dermatitis, exfoliative dermatitis, hand dermatitis. Photosensitive lichenoid dermatitis and prurigo nodularis are rarer presentations. Uncommon presentations have been described in parthenium dermatitis. They include prurigo nodularis-like lesions and photosensitive lichenoid eruption. Three cases are presented, two of whom presented as polymorphic-like lesions and one as prurigo nodularis. All three patch tested positive to parthenium on Day 2. Prick testing was positive in two of the three patients. Parthenium dermatitis mimicking polymorphic light eruption has not been reported. Histopathology revealed vasculitis in the lesional skin in two of the patients. Although leukocytoclastic vasculitis has been reported earlier from the prick-tested site, this is the first report demonstrating the presence of vasculitis in lesional skin of parthenium dermatitis. PMID:23130236

  3. A Right Way and a Wrong Way: Remedying Excessive Post-Trial Delay in Light of Tardiff, Moreno, and Toohey

    DTIC Science & Technology

    2007-04-01

    Guard (enlisted service), 1991-1993. Member of the bars of the Commonwealth of Virginia, the United States Court of Appeals for the Federal Circuit...the United States Court of Appeals for the Armed Forces, the Court of Federal Claims, and the United States Army Court of Criminal Appeals . This...I. Introduction 3 II. Historical Background 6 A. History of Criminal Appeals 6 B. Post-Trial Delay Cases 11 III. United States v. Tardiff. 21 IV

  4. OSO 8 observations of wave propagation in the solar chromosphere and transition region

    NASA Technical Reports Server (NTRS)

    Chipman, E. G.

    1978-01-01

    The University of Colorado instrument on OSO 8 has been used to observe relative phases of the 300-s intensity variation between the temperature-minimum region and several emission lines formed in the solar chromosphere and chromosphere-corona transition region. The lines used are due to Fe II, Si II, C II, Si IV, and C IV. The scattered light in the spectrograph, which originates almost entirely in the spectral region between 1700 and 1900 A, was used as a probe of the temperature-minimum region. The lines of Fe II, Si II, and C II show almost identical delays of approximately 30 s relative to the temperature minimum, while the intensity oscillations of the lines of Si IV and C IV appear to lead the temperature-minimum intensity oscillations by about 10 s.

  5. Reconstruction with 3D-printed pelvic endoprostheses after resection of a pelvic tumour.

    PubMed

    Liang, H; Ji, T; Zhang, Y; Wang, Y; Guo, W

    2017-02-01

    The aims of this retrospective study were to report the feasibility of using 3D-printing technology for patients with a pelvic tumour who underwent reconstruction. A total of 35 patients underwent resection of a pelvic tumour and reconstruction using 3D-printed endoprostheses between September 2013 and December 2015. According to Enneking's classification of bone defects, there were three Type I lesions, 12 Type II+III lesions, five Type I+II lesions, two Type I+II+III lesions, ten type I+II+IV lesions and three type I+II+III+IV lesions. A total of three patients underwent reconstruction using an iliac prosthesis, 12 using a standard hemipelvic prosthesis and 20 using a screw-rod connected hemipelvic prosthesis. All patients had an en bloc resection. Margins were wide in 15 patients, marginal in 14 and intralesional in six. After a mean follow-up of 20.5 months (6 to 30), 25 patients survived without evidence of disease, five were alive with disease and five had died from metastatic disease. Complications included seven patients with delayed wound healing and two with a dislocation of the hip. None had a deep infection. For the 30 surviving patients, the mean Musculoskeletal Society 93 score was 22.7 (20 to 25) for patients with an iliac prosthesis, 19.8 (15 to 26) for those with a standard prosthesis, and 17.7 (9 to 25) for those with a screw-rod connected prosthesis. The application of 3D-printing technology can facilitate the precise matching and osseointegration between implants and the host bone. We found that the use of 3D-printed pelvic prostheses for reconstruction of the bony defect after resection of a pelvic tumour was safe, without additional complications, and gave good short-term functional results. Cite this article: Bone Joint J 2017;99-B:267-75. ©2017 The British Editorial Society of Bone & Joint Surgery.

  6. Hybrid external fixation in the treatment of tibial pilon fractures: A retrospective analysis of 162 fractures.

    PubMed

    Galante, Vito N; Vicenti, Giovanni; Corina, Gianfranco; Mori, Claudio; Abate, Antonella; Picca, Girolamo; Conserva, Vito; Speciale, Domenico; Scialpi, Lorenzo; Tartaglia, Nicola; Caiaffa, Vincenzo; Moretti, Biagio

    2016-10-01

    To determine the efficacy of hybrid external fixation in the treatment of tibial pilon fractures. Retrospective, multicentre study. Adult patients with tibial pilon fractures treated with hybrid external fixation. Fracture reduction with ligamentotaxis and fixation with XCaliber hybrid external fixator. Fracture union, complications, functional outcome (Mazur Ankle Score). Union was obtained in 159 fractures at an average of 125days; there were three delayed unions and three non-unions. The most frequent complication was superficial pin-track infections (48), all of which responded to local wound care and antibiotics. There were no deep infections and no DVT. Only one fracture had loss of reduction that required frame revision. The overall functional scores were 91 (excellent) for AO/OTA type A fractures, 89 (good) for type B fractures, and 75 (satisfactory) for type C fractures. Hybrid external fixation is an effective method of stabilising tibial pilon fractures, particularly those with marked comminution. The minimally-invasive technique and stable fixation enable early mobilisation, with good functional results and minimal complications. Level IV Case series. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Berberine Attenuates Inflammation Associated with Delayed-Type Hypersensitivity via Suppressing Th1 Response and Inhibiting Apoptosis.

    PubMed

    Wang, Zhigang; Chen, Zhe; Chen, Tao; Yi, Tao; Zheng, Zhou; Fan, Hong; Chen, Zebin

    2017-02-01

    Berberine, one of the active alkaloids from Rhizoma Coptidis, has been indicated to have anti-inflammatory and immunosuppressive properties. The aim of this study was to determine the role of berberine on ovalbumin (OVA)-induced delayed-type hypersensitivity (DTH) and its potential mechanisms. Berberine treatment significantly reduced footpad swelling, inflammatory cells infiltration, anti-OVA IgG levels, IgE concentration in serum, and the tetramer + CD8 + cells. In homogenized footpad tissue, the production of Th1-mediated cytokines including IFN-γ, TNF-α, and IL-2 were suppressed following the administration of berberine. Detailed studies revealed that berberine prevented differentiation into Th1 cells in the OVA-primed lymphocytes, resulting from suppressing the expression of T-bet and secretion of IFN-γ but not IL-4. Concanavalin A stimulation assay and MTT assay also indicated inhibiting effect of berberine treatment on IFN-γ production and decreased cytotoxicity in lymphocytes proliferation, respectively. Additionally, berberine obviously decreased the cell apoptosis and enzymatic activity of caspase-3, which was further confirmed by the facts that berberine clearly lowered Bax/Bcl-2 ratio and expression of cleaved caspase-3 protein. On correlation analysis, the percentage of apoptotic cells showed a significant positive relationship with IFN-γ/IL-4 ratio of supernatant from footpad tissue in berberine-treated DTH mice. These results demonstrated that berberine attenuated Th1-mediated inflammation in OVA-induced DTH by curbing Th1 response and inhibiting cell apoptosis, suggesting a therapeutic potential for berberine for the treatment of type IV hypersensitivity.

  8. 40 CFR Table 8 to Subpart Uuuu of... - Reporting Requirements

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ...) and (3); 13. for affected sources invoking the delay of repair provisions in § 63.104(e) for heat exchanger systems, the next compliance report must contain the information in § 63.104(f)(2)(i) through (iv...

  9. 40 CFR Table 8 to Subpart Uuuu of... - Reporting Requirements

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ...) and (3); 13. for affected sources invoking the delay of repair provisions in § 63.104(e) for heat exchanger systems, the next compliance report must contain the information in § 63.104(f)(2)(i) through (iv...

  10. Consensus in controversy: The modified Delphi method applied to Gynecologic Oncology practice.

    PubMed

    Cohn, David E; Havrilesky, Laura J; Osann, Kathryn; Lipscomb, Joseph; Hsieh, Susie; Walker, Joan L; Wright, Alexi A; Alvarez, Ronald D; Karlan, Beth Y; Bristow, Robert E; DiSilvestro, Paul A; Wakabayashi, Mark T; Morgan, Robert; Mukamel, Dana B; Wenzel, Lari

    2015-09-01

    To determine the degree of consensus regarding the probabilities of outcomes associated with IP/IV and IV chemotherapy. A survey was administered to an expert panel using the Delphi method. Ten ovarian cancer experts were asked to estimate outcomes for patients receiving IP/IV or IV chemotherapy. The clinical estimates were: 1) probability of completing six cycles of chemotherapy, 2) probability of surviving five years, 3) median survival, and 4) probability of ER/hospital visits during treatment. Estimates for two patients, one with a low comorbidity index (patient 1) and the other with a moderate index (patient 2), were included. The survey was administered in three rounds, and panelists could revise their subsequent responses based on review of the anonymous opinions of their peers. The ranges were smaller for IV compared with IP/IV therapy. Ranges decreased with each round. Consensus converged around outcomes related to IP/IV chemotherapy for: 1) completion of 6 cycles of therapy (type 1 patient, 62%, type 2 patient, 43%); 2) percentage of patients surviving 5 years (type 1 patient, 66%, type 2 patient, 47%); and 3) median survival (type 1 patient, 83 months, type 2 patient, 58 months). The group required three rounds to achieve consensus on the probabilities of ER/hospital visits (type 1 patient, 24%, type 2 patient, 35%). Initial estimates of survival and adverse events associated with IP/IV chemotherapy differ among experts. The Delphi process works to build consensus and may be a pragmatic tool to inform patients of their expected outcomes. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Change in genotype of methicillin-resistant Staphylococcus aureus (MRSA) affects the antibiogram of hospital-acquired MRSA.

    PubMed

    Harada, Dai; Nakaminami, Hidemasa; Miyajima, Eri; Sugiyama, Taku; Sasai, Nao; Kitamura, Yoshinobu; Tamura, Taku; Kawakubo, Takashi; Noguchi, Norihisa

    2018-07-01

    Recently, the dissemination of community-acquired methicillin-resistant Staphylococcus aureus (CA-MRSA) into hospitals has frequently been reported worldwide. Hospital-acquired MRSA (HA-MRSA) strains exhibit high-level resistance to multiple antimicrobial agents, whereas CA-MRSA strains are usually susceptible to non-β-lactams. Thus, it is predicted that the antibiogram of the HA-MRSA population would change along with the change in genotype of MRSA. Here, we investigated the changes in the MRSA population along with the MRSA antibiogram in a hospital between 2010 and 2016. Staphylococcal cassette chromosome (SCC) mec typing showed that the predominant HA-MRSA strains in the hospital dramatically changed from SCCmec type II, which is the major type of HA-MRSA, to SCCmec type IV, which is the major type of CA-MRSA. Multilocus sequence typing revealed that the predominant SCCmec type IV strain was a clonal complex (CC) 8 clone, which is mainly found among CA-MRSA. Furthermore, the CC1-SCCmec type IV (CC1-IV) clone significantly increased. Both the CC8-IV and CC1-IV clones exhibited high antimicrobial susceptibility. The antibiogram change of the HA-MRSA population was consistent with the antimicrobial susceptibilities and increased prevalence of the CC8-IV and CC1-IV clones. Our data reveal that the change in the genotypes of MRSA strains could impact the antibiogram of HA-MRSA population. Copyright © 2018 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  12. Differential expression of basement membrane type IV collagen α2 and α6 chains as a prognostic factor in patients with extrahepatic bile duct carcinoma.

    PubMed

    Hirashima, Kotaro; Iyama, Ken-Ichi; Baba, Yoshifumi; Honda, Yumi; Sado, Yoshikazu; Ninomiya, Yoshifumi; Watanabe, Masayuki; Takamori, Hiroshi; Beppu, Toru; Baba, Hideo

    2013-03-01

    The destruction of the basement membrane (BM) is the first step in cancer invasion and metastasis. Type IV collagen is a major component of the BM, and is composed of six genetically distinct α(IV) chains; α1(IV) to α6(IV). The loss of α5(IV) and α6(IV) chains from the epithelial BM at the early stage of cancer invasion has been reported in several types of cancers. However, the expression of α5(IV) and α6(IV) chains in extrahepatic bile duct carcinoma (EBDC) remains unclear. We examined the expression of α(IV) chains by immunohistochemistry using 71 resected EBDC specimens. Prognostic significance of α(IV) chains was examined by Cox regression and Kaplan-Meier analyses. In the invasive cancer, the expression of α6(IV) chain in the BM was lost partially or completely preceded by the loss of α2(IV) chain. The loss of α6(IV) chain in the BM of the invasive cancer was related to the tumor classification, TNM stages, and the expression of α2(IV) chain. The patients with α2(IV)-negative and α6(IV)-negative chains had significantly poorer prognosis than those with α2(IV)-positive and α6(IV)-positive/negative chains (P = 0.04). The loss of α2(IV) and α6(IV) chains might be a useful prognostic factor in patients with EBDC. Copyright © 2012 Wiley Periodicals, Inc.

  13. [The early phase of vincristine-induced neuropathy. Electrophysiological evidence of a "dying-back" phenomenon (author's transl)].

    PubMed

    Sebille, A; Parlier, Y

    1981-07-04

    Electrophysiological exploration was carried out in 12 patients before and during administration of vincristine sulphate 1,4 mg/m2 body surface area. The patients had stage III or IV lymphoreticulosarcoma and received one injection of vincristine weekly for 6 weeks. Compared with pretreatment findings, (1) motor and sensory conduction velocity, as well as delay in triceps surae H reflex remained unchanged; (2) sensory nerve amplitude and density of distal muscle electromyographic recordings rapidly decreased; (3) the amplitude of distal tendinous reflexes rapidly diminished, whereas that of the H reflex remained stable. These results being similar to those observed in experimental acrylamide toxicity, where a "dying back" hemopathy has been demonstrated, it is suggested that the neuropathy induced by vincristine in man is of the same type.

  14. The Type 1 Homodimeric Reaction Center in Heliobacterium modesticaldum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Golbeck, John

    In this funding period, we (i) found that strong illumination of Heliobacterium modesticaldum cells results in saturation of the electron acceptor pool, leading to reduction of the acceptor side and the creation of a back-reacting state that gives rise to delayed fluorescence; (ii) noted that when the FX cluster is reduced in purified reaction centers, no electron transfer occurs beyond A0, even though a quinone is present; (iii) observed by photochemically induced dynamic nuclear polarization (photo-CIDNP) studies of whole cells of Heliobacterium mobilis that primary charge separation is retained even after conversion of the majority of BChl g to Chlmore » aF. ; and (iv) purified a homogeneous preparation of reaction center cores, which led to promising crystallization trials to obtain a three-dimensional structure.« less

  15. The role of Shewanella oneidensis MR-1 outer surface structures in extracellular electron transfer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bouhenni, Rachida; Vora, Gary J.; Biffinger, Justin C.

    2010-04-20

    Shewanella oneidensis is a facultative anaerobe that uses more than 14 different terminal electron acceptors for respiration. These include metal oxides and hydroxyoxides, and toxic metals such as uranium and chromium. Mutants deficient in metal reduction were isolated using the mariner transposon derivative, minihimar RB1. These included mutants with transposon insertions in the prepilin peptidase and type II secretion system genes. All mutants were deficient in Fe(III) and Mn(IV) reduction, and exhibited slow growth when DMSO was used as the electron acceptor. The genome sequence of S. oneidensis contains one prepilin peptidase gene, pilD. A similar prepilin peptidase that maymore » function in the processing of type II secretion prepilins was not found. Single and multiple chromosomal deletions of four putative type IV pilin genes did not affect Fe(III) and Mn(IV) reduction. These results indicate that PilD in S. oneidensis is responsible for processing both type IV and type II secretion prepilin proteins. Type IV pili do not appear to be required for Fe(III) and Mn(IV) reduction.« less

  16. Gravitational effects from a series of IVS R&D VLBI-sessions with observations close to the Sun

    NASA Astrophysics Data System (ADS)

    Heinkelmann, R.; Soja, B.; Schuh, H.

    2015-08-01

    In 2011 and 2012 the IVS observed twelve VLBI research and development (R&D) sessions that include successful observations as angularly close as 3.9° from the heliocenter. Among others, one purpose of these IVS-R&D sessions was to achieve an improvement in the determination of the PPN parameter γ . Besides, by analyzing this specific set of IVS sessions, it was for the first time possible to measure the dispersive effect of the Solar corona with VLBI (Soja et al., 2014). In this work we assess the formal error of the γ-parameter and the contributions of the various terms to the partial derivative of the γ-parameter. Furthermore, we investigate the size of the gravitational delays caused by: (i) Solar monopole field at rest and with approximately linear translation, (ii) rotation of the Solar monopole field, (iii) Solar gravitational field quadrupole expansion, and (iv) Solar higher order term.

  17. Blood platelet adhesion to protein studied by on-line acoustic wave sensor.

    PubMed

    Cavic, B A; Freedman, J; Morel, Z; Mody, M; Rand, M L; Stone, D C; Thompson, M

    2001-03-01

    The attachment of blood platelets to the surface of bare and protein-coated thickness-shear mode acoustic wave devices operating in a flow-through configuration has been studied. Platelets in washed from bind to the gold electrodes of such sensors, but the resulting frequency shifts are far less than predicted by the conventional mass-based model of device operation. Adherence to albumin and various types of collagen can be produced by on-line introduction of protein or by a pre-coating strategy. Differences in attachment of platelets to collagen types I and IV and the Horm variety can be detected. Platelets attached to collagen yield an interesting delayed, but reversible signal on exposure to a flowing medium of low pH. Scanning electron microscopy of sensor surfaces at various time points in this experiment reveals that originally intact platelets are eventually destroyed by the high acidity of the medium. The reversible frequency is attributed to the presence of removable platelet granular components at the sensor-liquid interface.

  18. Essential core of the Hawking–Ellis types

    NASA Astrophysics Data System (ADS)

    Martín-Moruno, Prado; Visser, Matt

    2018-06-01

    The Hawking–Ellis (Segre–Plebański) classification of possible stress–energy tensors is an essential tool in analyzing the implications of the Einstein field equations in a more-or-less model-independent manner. In the current article the basic idea is to simplify the Hawking–Ellis type I, II, III, and IV classification by isolating the ‘essential core’ of the type II, type III, and type IV stress–energy tensors; this being done by subtracting (special cases of) type I to simplify the (Lorentz invariant) eigenvalue structure as much as possible without disturbing the eigenvector structure. We will denote these ‘simplified cores’ type II0, type III0, and type IV0. These ‘simplified cores’ have very nice and simple algebraic properties. Furthermore, types I and II0 have very simple classical interpretations, while type IV0 is known to arise semi-classically (in renormalized expectation values of standard stress–energy tensors). In contrast type III0 stands out in that it has neither a simple classical interpretation, nor even a simple semi-classical interpretation. We will also consider the robustness of this classification considering the stability of the different Hawking–Ellis types under perturbations. We argue that types II and III are definitively unstable, whereas types I and IV are stable.

  19. Time course for measuring endolymphatic size in healthy volunteers following intravenous administration of gadoteridol.

    PubMed

    Naganawa, Shinji; Suzuki, Kojiro; Yamazaki, Masahiro; Sakurai, Yasuo; Ikeda, Mitsuru

    2014-01-01

    We developed semi-quantitative methods to measure endolymphatic size on images obtained 4 hours after intravenous administration of single-dose gadolinium-based contrast medium (IV-SD-GBCM) and found little variation in results between observers. We used the methods to measure the size of the endolymph in healthy volunteers at various times after IV-SD-GBCM and attempted to determine the optimal timing for the evaluation. In 8 healthy male volunteers, we obtained heavily T2-weighted 3-dimensional fluid-attenuated inversion recovery (hT2W-3D-FLAIR) images 1.5, 3, 4.5, and 6 hours after IV-SD-GBCM as positive perilymph images (PPI) as well as acquiring positive endolymph images (PEI) and magnetic resonance cisternography (MRC). To evaluate the endolymph, we generated 2 kinds of processed images (HYDROPS-Mi2 and HYDROPS2-Mi2) by subtracting PEI or MRC from PPI as previously proposed. We semi-quantitatively measured the ratio of the area of the endolymph (%EL) to that of total lymph on the 2 kinds of generated images for the cochlea and vestibule according to the previously proposed method. We analyzed statistics to evaluate the change in %EL over time and used analysis of variance (ANOVA) for a 2 × 4 repeated-measures design to assess difference in image type. We adopted 5% as a significance level. The %EL was significantly larger at 1.5 hours after IV-SD-GBCM than at 3, 4.5, and 6 hours in both the cochlea and vestibule for both kinds of generated images. Between 4.5 and 6 hours, the %EL plateaued for both the cochlea and vestibule, and the 2 kinds of generated images did not differ significantly. A delay of 1.5 hours after IV-SD-GBCM is not sufficient to evaluate endolymphatic size. The %EL plateaus between 4.5 and 6 hours. These data might be valuable for further clinical studies.

  20. Observational properties of decameter type IV bursts

    NASA Astrophysics Data System (ADS)

    Melnik, Valentin; Brazhenko, Anatoly; Rucker, Helmut; Konovalenko, Alexander; Briand, Carine; Dorovskyy, Vladimir; Zarka, Philippe; Frantzusenko, Anatoly; Panchenko, Michael; Poedts, Stefan; Zaqarashvili, Teimuraz; Shergelashvili, Bidzina

    2013-04-01

    Oscillations of decameter type IV bursts were registered during observations of solar radio emission by UTR-2, URAN-2 and NDA in 2011-2012. Large majority of these bursts were accompanied by coronal mass ejections (CMEs), which were observed by SOHO and STEREO in the visible light. Only in some cases decameter type IV bursts were not associated with CMEs. The largest periods of oscillations P were some tens of minutes. There were some modes of long periods of oscillations simultaneously. Periods of oscillations in flux and in polarization profiles were close. Detailed properties of oscillations at different frequencies were analyzed on the example of two type IV bursts. One of them was observed on April 7, 2011 when a CME happened. Another one (August 1, 2011) was registered without any CME. The 7 April type IV burst had two periods in the frames 75-85 and 35-85 minutes. Interesting feature of these oscillations is decreasing periods with time. The observed decreasing rates dP/dt equaled 0.03-0.07. Concerning type IV burst observed on August 1, 2011 the period of its oscillations increases from 17 min. at 30 MHz to 44 min. at 10 MHz. Connection of type IV burst oscillations with oscillations of magnetic arches and CMEs at corresponding altitudes are discussed. The work is fulfilled in the frame of FP7 project "SOLSPANET".

  1. Impulsive choice and pre-exposure to delays: iv. effects of delay- and immediacy-exposure training relative to maturational changes in impulsivity.

    PubMed

    Renee Renda, C; Rung, Jillian M; Hinnenkamp, Jay E; Lenzini, Stephanie N; Madden, Gregory J

    2018-04-23

    Impulsive choice describes preference for smaller, sooner rewards over larger, later rewards. Excessive delay discounting (i.e., rapid devaluation of delayed rewards) underlies some impulsive choices, and is observed in many maladaptive behaviors (e.g., substance abuse, gambling). Interventions designed to reduce delay discounting may provide therapeutic gains. One such intervention provides rats with extended training with delayed reinforcers. When compared to a group given extended training with immediate reinforcers, delay-exposed rats make significantly fewer impulsive choices. To what extent is this difference due to delay-exposure training shifting preference toward self-control or immediacy-exposure training (the putative control group) shifting preference toward impulsivity? The current study compared the effects of delay- and immediacy-exposure training to a no-training control group and evaluated within-subject changes in impulsive choice across 51 male Wistar rats. Delay-exposed rats made significantly fewer impulsive choices than immediacy-exposed and control rats. Between-group differences in impulsive choice were not observed in the latter two groups. While delay-exposed rats showed large, significant pre- to posttraining reductions in impulsive choice, immediacy-exposed and control rats showed small reductions in impulsive choice. These results suggest that extended training with delayed reinforcers reduces impulsive choice, and that extended training with immediate reinforcers does not increase impulsive choice. © 2018 Society for the Experimental Analysis of Behavior.

  2. Probability of Loss of Assured Safety in Systems with Multiple Time-Dependent Failure Modes: Incorporation of Delayed Link Failure in the Presence of Aleatory Uncertainty.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Helton, Jon C.; Brooks, Dusty Marie; Sallaberry, Cedric Jean-Marie.

    Probability of loss of assured safety (PLOAS) is modeled for weak link (WL)/strong link (SL) systems in which one or more WLs or SLs could potentially degrade into a precursor condition to link failure that will be followed by an actual failure after some amount of elapsed time. The following topics are considered: (i) Definition of precursor occurrence time cumulative distribution functions (CDFs) for individual WLs and SLs, (ii) Formal representation of PLOAS with constant delay times, (iii) Approximation and illustration of PLOAS with constant delay times, (iv) Formal representation of PLOAS with aleatory uncertainty in delay times, (v) Approximationmore » and illustration of PLOAS with aleatory uncertainty in delay times, (vi) Formal representation of PLOAS with delay times defined by functions of link properties at occurrence times for failure precursors, (vii) Approximation and illustration of PLOAS with delay times defined by functions of link properties at occurrence times for failure precursors, and (viii) Procedures for the verification of PLOAS calculations for the three indicated definitions of delayed link failure.« less

  3. Endovascular repair of an iliac artery aneurysm in a patient with Ehlers-Danlos syndrome type IV.

    PubMed

    Tonnessen, Britt H; Sternbergh, W Charles; Mannava, Krishna; Money, Samuel R

    2007-01-01

    Ehlers-Danlos type IV (EDS-IV) is an inherited condition most notable for its associated vascular complications. Patients are prone to aneurysm formation, arterial dissection, and spontaneous vessel rupture. Intervention for the vascular pathology of EDS-IV carries high morbidity and mortality. We describe a case of a 57-year-old man with EDS-IV and an expanding iliac aneurysm who underwent successful endovascular repair with a stent-graft. Endovascular aneurysm repair is feasible and should be considered for patients with EDS-IV.

  4. Wound botulism.

    PubMed

    Burningham, M D; Walter, F G; Mechem, C; Haber, J; Ekins, B R

    1994-12-01

    Wound botulism is a rare infectious and toxicologic complication of trauma and i.v. drug abuse. Only 39 cases have been reported in detail in the English literature. This case report describes a patient with wound botulism who presented to four medical facilities before receiving definitive diagnosis and treatment. Although his history and physical examination were consistent with wound botulism, diagnosis and therapy were delayed because this rare disease was not considered initially in the differential diagnosis. Wound botulism should be considered in trauma patients and i.v. drug abusers who present with cranial nerve palsies and descending paresis.

  5. Inhaled iloprost plus oral sildenafil in patients with severe pulmonary arterial hypertension delays the need for lung transplantation.

    PubMed

    Lopez-Meseguer, M; Berastegui, C; Monforte, V; Bravo, C; Domingo, E; Roman, A

    2013-01-01

    Accepted treatment for severe pulmonary arterial hypertension (PAH) includes intravenous epoprostenol and lung transplantation (LT). Inhaled iloprost plus oral sildenafil (Ilo-Sil) is an alternative strategy that may also delay the need for LT. This was a long-term descriptive study in eight patients with PAH functional class (FC) IV with right heart failure, four of them potential candidates for LT, who were treated with Ilo-Sil as an alternative to epoprostenol. At the start of the study, patients (seven women; mean age, 43.8 [range, 34-66] years) were in FC IV and unable to perform the 6-minute walk test. Mean cardiac index was 1.9 (range, 1.4-2.1) L/min/m(2). Treatment with Ilo-Sil provoked a rapid and sustained improvement; mean walking distance at 3 months was 322 ± 90 m and no patient remained in FC IV. Survival at 1 and 5 years was 100% and 75%, respectively. Of the four potential LT candidates, one underwent transplantation after 6.8 years and one died after 1.2 years. These results suggest that therapy with Ilo-Sil represents an acceptable alternative in patients with severe and unstable PAH. Copyright © 2013. Published by Elsevier Inc.

  6. The Tropospheric Products of the International VLBI Service for Geodesy and Astrometry

    NASA Technical Reports Server (NTRS)

    Heinkelmann, Robert; Schwatke, Christian

    2010-01-01

    The IVS runs two tropospheric products: The IVS tropospheric parameter rapid combination monitors the zenith wet delay (ZWD) and zenith total delay (ZTD) of the rapid turnaround sessions R1 and R4. Goal of the combination is the identification and the exclusion of outliers by comparison and the assessment of the precision of current VLBI solutions in terms of tropospheric parameters. The rapid combination is done on a weekly basis four weeks after the observation files are released on IVS Data Centers. Since tropospheric and geodetic parameters, such as vertical station components, can significantly correlate, the consistency of the ZTD can be a measure of the consistency of the corresponding TRF as well. The ZWD mainly rely on accurate atmospheric pressure data. Thus, besides estimation techniques, modeling and analyst s noise, ZWD reflects differences in the atmospheric pressure data applied to the VLBI analysis. The second product, called tropospheric parameter long-term combination, aims for an accurate determination of climatological signals, such as trends of the atmospheric water vapor observed by VLBI. Therefore, the long-term homogeneity of atmospheric pressure data plays a crucial role for this product. The paper reviews the methods applied and results achieved so far and describes the new maintenance through DGFI.

  7. Urinary type IV collagen is related to left ventricular diastolic function and brain natriuretic peptide in hypertensive patients with prediabetes.

    PubMed

    Iida, Masato; Yamamoto, Mitsuru; Ishiguro, Yuko S; Yamazaki, Masatoshi; Ueda, Norihiro; Honjo, Haruo; Kamiya, Kaichirou

    2014-01-01

    Urinary type IV collagen is an early biomarker of diabetic nephropathy. Concomitant prediabetes (the early stage of diabetes) was associated with left ventricular (LV) diastolic dysfunction and increased brain natriuretic peptide (BNP) in hypertensive patients. We hypothesized that urinary type IV collagen may be related to these cardiac dysfunctions. We studied hypertensive patients with early prediabetes (HbA1c <5.7% and fasting glucose >110, n=18), those with prediabetes (HbA1c 5.7-6.4, n=98), and those with diabetes (HbA1c>6.5 or on diabetes medications, n=92). The participants underwent echocardiography to assess left atrial volume/body surface area (BSA) and the ratio of early mitral flow velocity to mitral annular velocity (E/e'). Left ventricular diastolic dysfunction (LVDD) was defined if patients had E/e'≥15, or E/e'=9-14 accompanied by left atrial volume/BSA≥32ml/mm(2). Urinary samples were collected for type IV collagen and albumin, and blood samples were taken for BNP and HbA1c. Urinary type IV collagen and albumin increased in parallel with the deterioration of glycemic status. In hypertensive patients with prediabetes, subjects with LVDD had higher levels of BNP and urinary type IV collagen than those without LVDD. In contrast, in hypertensive patients with diabetes, subjects with LVDD had higher urinary albumin and BNP than those without LVDD. Urinary type IV collagen correlated positively with BNP in hypertensive patients with prediabetes, whereas it correlated with HbA1c in those with diabetes. In hypertensive patients with prediabetes, urinary type IV collagen was associated with LV diastolic dysfunction and BNP. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. A comparative study of percutaneous atherectomy for femoropopliteal arterial occlusive disease.

    PubMed

    Gu, Yongquan; Malas, Mahmoud B; Qi, Lixing; Guo, Lianrui; Guo, Jianming; Yu, Hengxi; Tong, Zhu; Gao, Xixiang; Zhang, Jian; Wang, Zhonggao

    2017-08-01

    SilverHawk™ directional atherectomy has been used to treat more than 300 thousand cases of lower extremity atherosclerotic occlusive disease in the world since it was approved by FDA in 2003. This study aimed to analyze the safety and effectiveness of symptomatic femoral popliteal atherosclerotic disease treated by directional atherectomy (DA). Clinical data of all consecutive patients treated with percutaneous atherectomy utilizing the SilverHawk™ plaque excision was retrospectively analyzed. The anatomic criteria of the atherosclerotic lesions were divided into four types: type I stenosis; type II occlusion; type III in-stent restenosis; type IV stent occlusion. There were 160 patients treated during the study period. Intermittent claudication in 75 patients (47%), rest pain in 55 patients (34.5%) and tissue loss in 30 patients (18.5%). The number of patients was 72, 15, 49 and 24 in type I, II, III and IV lesions, respectively. Technical success rate was 98.6%, 93.3%, 97.9% and 91.7% in type I, II, III and IV lesions, respectively. Debris of intimal plaque was captured by protection device in 92 patients (71.3%). The mean follow-up period was 23.5±10.4 months. Restenosis rate of type I to IV lesions was 21%, 36%, 36% and 40% respectively. Restenosis rate in type I lesion was significantly lower than that in type III and IV lesions (P<0.05). Patients with tissue loss responded to revascularization as follow: type I, 11/13 healed or reduced (84.6%), type II, 3/3 patients improved (100%), type III, 5/6 patients improved (83.3%) and type IV 4/4 healed (100%). In type IV group, four patients had in-stent thrombosis found by postoperative Duplex ultrasonography. They all underwent DA after catheter-directed thrombolysis with good angiographic results. Percutaneous DA is safe and effective for both de-novo atherosclerotic and in-stent stenotic or occlusive lesions. Thrombolysis before plaque excision is recommended in case of in-stenting thrombosis.

  9. Gravitational lens system SDSS J1339+1310: microlensing factory and time delay

    NASA Astrophysics Data System (ADS)

    Goicoechea, L. J.; Shalyapin, V. N.

    2016-12-01

    We spectroscopically re-observed the gravitational lens system SDSS J1339+1310 using OSIRIS on the GTC. We also monitored the r-band variability of the two quasar images (A and B) with the LT over 143 epochs in the period 2009-2016. These new data in both the wavelength and time domains have confirmed that the system is an unusual microlensing factory. The C iv emission line is remarkably microlensed, since the microlensing magnification of B relative to that for A, μBA, reaches a value of 1.4 ( 0.4 mag) for its core. Moreover, the B image shows a red wing enhancement of C iv flux (relative to A), and μBA = 2 (0.75 mag) for the C iv broad-line emission. Regarding the nuclear continuum, we find a chromatic behaviour of μBA, which roughly varies from 5 (1.75 mag) at 7000 Å to 6 (1.95 mag) at 4000 Å. We also detect significant microlensing variability in the r band, and this includes a number of microlensing events on timescales of 50-100 d. Fortunately, the presence of an intrinsic 0.7 mag dip in the light curves of A and B, permitted us to measure the time delay between both quasar images. This delay is ΔtAB = 47 d (1σ confidence interval; A is leading), in good agreement with predictions of lens models. Tables 1-3 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/596/A77

  10. Genetic ablation or pharmacological blockade of dipeptidyl peptidase IV does not impact T cell-dependent immune responses

    PubMed Central

    Vora, Kalpit A; Porter, Gene; Peng, Roche; Cui, Yan; Pryor, Kellyann; Eiermann, George; Zaller, Dennis M

    2009-01-01

    Background Current literature suggests that dipeptidyl peptidase IV (DPP-IV; CD26) plays an essential role in T-dependent immune responses, a role that could have important clinical consequences. To rigorously define the role of DPP-IV in the immune system, we evaluated genetic and pharmacological inhibition of the enzyme on T-dependent immune responses in vivo. Results The DPP-IV null animals mounted robust primary and secondary antibody responses to the T dependent antigens, 4-hydroxy-3-nitrophenylacetyl-ovalbumin (NP-Ova) and 4-hydroxy-3-nitrophenylacetyl-chicken gamma globulin (NP-CGG), which were comparable to wild type mice. Serum levels of antigen specific IgM, IgG1, IgG2a, IgG2b and IgG3 were similar between the two groups of animals. DPP-IV null animals mounted an efficient germinal center reaction by day 10 after antigen stimulation that was comparable to wild type mice. Moreover, the antibodies produced by DPP-IV null animals after repeated antigenic challenge were affinity matured. Similar observations were made using wild type animals treated with a highly selective DPP-IV inhibitor during the entire course of the experiments. T cell recall responses to ovalbumin and MOG peptide, evaluated by measuring proliferation and IL-2 release from cells isolated from draining lymph nodes, were equivalent in DPP-IV null and wild type animals. Furthermore, mice treated with DPP-IV inhibitor had intact T-cell recall responses to MOG peptide. In addition, female DPP-IV null and wild type mice treated with DPP-IV inhibitor exhibited normal and robust in vivo cytotoxic T cell responses after challenge with cells expressing the male H-Y minor histocompatibility antigen. Conclusion These data indicate Selective inhibition of DPP-IV does not impair T dependent immune responses to antigenic challenge. PMID:19358731

  11. Secretion of TcpF by the Vibrio cholerae Toxin-Coregulated Pilus Biogenesis Apparatus Requires an N-Terminal Determinant

    PubMed Central

    Megli, Christina J.

    2013-01-01

    Type IV pili are important for microcolony formation, biofilm formation, twitching motility, and attachment. We and others have shown that type IV pili are important for protein secretion across the outer membrane, similar to type II secretion systems. This study explored the relationship between protein secretion and pilus formation in Vibrio cholerae. The toxin-coregulated pilus (TCP), a type IV pilus required for V. cholerae pathogenesis, is necessary for the secretion of the colonization factor TcpF (T. J. Kirn, N. Bose, and R. K. Taylor, Mol. Microbiol. 49:81–92, 2003). This phenomenon is not unique to V. cholerae; secreted virulence factors that are dependent on the presence of components of the type IV pilus biogenesis apparatus for secretion have been reported with Dichelobacter nodosus (R. M. Kennan, O. P. Dhungyel, R. J. Whittington, J. R. Egerton, and J. I. Rood, J. Bacteriol. 183:4451–4458, 2001) and Francisella tularensis (A. J. Hager et al., Mol. Microbiol. 62:227–237, 2006). Using site-directed mutagenesis, we demonstrated that the secretion of TcpF is dependent on the presence of selected amino acid R groups at position five. We were unable to find other secretion determinants, suggesting that Y5 is the major secretion determinant within TcpF. We also report that proteins secreted in a type IV pilus biogenesis apparatus-dependent manner have a YXS motif within the first 15 amino acids following the Sec cleavage site. The YXS motif is not present in proteins secreted by type II secretion systems, indicating that this is unique to type IV pilus-mediated secretion. Moreover, we show that TcpF interacts with the pilin TcpA, suggesting that these proteins are secreted by the type IV pilus biogenesis system. These data provide a starting point for understanding how type IV pili can mediate secretion of virulence factors important for bacterial pathogenesis. PMID:23564177

  12. Aberrations in uterine contractile patterns in mares with delayed uterine clearance after administration of detomidine and oxytocin.

    PubMed

    von Reitzenstein, Marcela; Callahan, Megan A; Hansen, Peter J; LeBlanc, Michelle M

    2002-09-01

    An experiment was conducted to determine whether the uterotonic effects of oxytocin, a drug used to treat mares that have a delay in uterine clearance were affected by the sedative detomidine (an alpha2-agonist), a drug used to treat fractious mares. An additional objective was to identify propagation patterns of uterine contractions and determine whether these patterns differed between normal mares and mares with delayed uterine clearance (DUC). Intrauterine pressure was measured in five reproductively normal mares and four mares with DUC during estrus using an 8-F Milar catheter with two discrete pressure sensors. Mares received one of three treatments in random order: detomidine (0.001 mg/kg; i.v.); detomidine followed in 10 min by oxytocin (10 IU; i.v.); and saline (0.9% NaCl 0.5 ml; i.v.) followed in 10 min by oxytocin. All treatments induced waves of contractions; however, only three mares with DUC exhibited contractions after administration of detomidine. Normal mares experienced more uterine contractions (P < 0.01) that tended to last longer (P < 0.06), and were of greater intensity (P < 0.04) than mares with delayed clearance. Administration of detomidine before oxytocin increased the number of contractions (P < 0.02) and increased the maximum intrauterine pressure in the uterine horn (P < 0.05) in normal mares as compared to response after administration of saline and oxytocin. Detomidine had no effect in mares with delayed clearance. All mares had more propagating than non-propagating uterine contractions (74 +/- 8 versus 25 +/- 8%, respectively). Normal mares exhibited a normal propagation pattern more frequently (P < 0.0001) than mares with DUC. Simultaneous (P < 0.05) and inverted (P < 0.03) contractions occurred more frequently in mares with DUC. Administration of detomidine increased the number (P < 0.01), and tended to increase the percentage (P < 0.07) of normal propagating uterine contractions in normal mares, but did not affect propagation patterns in mares with DUC. In conclusion, detomidine augmented the uterotonic effect of oxytocin in normal mares but not in mares with DUC. Data suggest that mares with DUC have a defect in myoelectrical signaling and a decrease in the contractile strength of the uterine muscle.

  13. Type IV pili mechanochemically regulate virulence factors in Pseudomonas aeruginosa.

    PubMed

    Persat, Alexandre; Inclan, Yuki F; Engel, Joanne N; Stone, Howard A; Gitai, Zemer

    2015-06-16

    Bacteria have evolved a wide range of sensing systems to appropriately respond to environmental signals. Here we demonstrate that the opportunistic pathogen Pseudomonas aeruginosa detects contact with surfaces on short timescales using the mechanical activity of its type IV pili, a major surface adhesin. This signal transduction mechanism requires attachment of type IV pili to a solid surface, followed by pilus retraction and signal transduction through the Chp chemosensory system, a chemotaxis-like sensory system that regulates cAMP production and transcription of hundreds of genes, including key virulence factors. Like other chemotaxis pathways, pili-mediated surface sensing results in a transient response amplified by a positive feedback that increases type IV pili activity, thereby promoting long-term surface attachment that can stimulate additional virulence and biofilm-inducing pathways. The methyl-accepting chemotaxis protein-like chemosensor PilJ directly interacts with the major pilin subunit PilA. Our results thus support a mechanochemical model where a chemosensory system measures the mechanically induced conformational changes in stretched type IV pili. These findings demonstrate that P. aeruginosa not only uses type IV pili for surface-specific twitching motility, but also as a sensor regulating surface-induced gene expression and pathogenicity.

  14. Arcsecond positions for milliarcsecond VLBI nuclei of extragalactic radio sources. IV - Seventeen sources

    NASA Technical Reports Server (NTRS)

    Morabito, D. D.; Preston, R. A.; Linfield, R. P.; Slade, M. A.; Jauncey, D. L.

    1986-01-01

    VLBI measurements of time delay and delay rate at 2.29 and 8.42 GHz on baselines of 10,000 km have been used to determine the positions of the milliarcsecond nuclei in 17 extragalactic radio sources with estimated accuracies of 0.1 to 0.3 arcsec. The observed sources are part of an all-sky VLBI catalog of milliarcsecond radio sources. In addition, slightly improved positions are presented for 101 sources originally reported by Morabito et al. (1983). Arcsecond positions have now been determined for 836 sources.

  15. Functional classification of mitochondrion-rich cells in euryhaline Mozambique tilapia (Oreochromis mossambicus) embryos, by means of triple immunofluorescence staining for Na+/K+-ATPase, Na +/K+/2Cl- cotransporter and CFTR anion channel

    USGS Publications Warehouse

    Hiroi, J.; McCormick, S.D.; Ohtani-Kaneko, R.; Kaneko, T.

    2005-01-01

    Mozambique tilapia Oreochromis mossambicus embryos were transferred from freshwater to seawater and vice versa, and short-term changes in the localization of three major ion transport proteins, Na+/K +-ATPase, Na+/K+/2Cl- cotransporter (NKCC) and cystic fibrosis transmembrane conductance regulator (CFTR) were examined within mitochondrion-rich cells (MRCs) in the embryonic yolk-sac membrane. Triple-color immunofluorescence staining allowed us to classify MRCs into four types: type I, showing only basolateral Na+/K +-ATPase staining; type II, basolateral Na+/K +-ATPase and apical NKCC; type III, basolateral Na+/K +-ATPase and basolateral NKCC; type IV, basolateral Na +/K+-ATPase, basolateral NKCC and apical CFTR. In freshwater, type-I, type-II and type-III cells were observed. Following transfer from freshwater to seawater, type-IV cells appeared at 12 h and showed a remarkable increase in number between 24 h and 48 h, whereas type-III cells disappeared. When transferred from seawater back to freshwater, type-IV cells decreased and disappeared at 48 h, type-III cells increased, and type-II cells, which were not found in seawater, appeared at 12 h and increased in number thereafter. Type-I cells existed consistently irrespective of salinity changes. These results suggest that type I is an immature MRC, type II is a freshwater-type ion absorptive cell, type III is a dormant type-IV cell and/or an ion absorptive cell (with a different mechanism from type II), and type IV is a seawater-type ion secretory cell. The intracellular localization of the three ion transport proteins in type-IV cells is completely consistent with a widely accepted model for ion secretion by MRCs. A new model for ion absorption is proposed based on type-II cells possessing apical NKCC.

  16. Amplified QCM biosensor for type IV collagenase based on collagenase-cleavage of gold nanoparticles functionalized peptide.

    PubMed

    Dong, Zong-Mu; Jin, Xin; Zhao, Guang-Chao

    2018-05-30

    The present study develops a rapid, simple and efficient method for the determination of type IV collagenase by using a specific peptide-modified quartz crystal microbalance (QCM). A small peptide (P1), contains a specific sequence (Pro-Gly) and a terminal cysteine, was synthetized and immobilized to the surface of QCM electrode via the reaction between Au and thiol of the cysteine. The peptide bond between proline and glycine can be specific hydrolyzed cleavage by type IV collagenase, which enabled the modified electrode with a high selectivity toward type IV collagenase. The cleaving process caused a frequency change of QCM to give a signal related to the concentration of type IV collagenase. The morphologies of the modified electrodes were characterized by scanning electron microscope (SEM) and the specific hydrolyzed cleavage process was monitored by QCM. When P1 was modified with gold nanoparticles (P1-Au NPs), the signal could be amplified to further enhance the sensitivity of the designed sensor due to the high-mass of the modified Au NPs. Compared the direct unamplified assay, the values obtained for the limit of detection for type IV collagenase was 0.96 ng mL -1 , yielding about 6.5 times of magnitude improvement in sensitivity. This signal enhanced peptide based QCM biosensor for type IV collagenase also showed good selectivity and sensitivity in complex matrix. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Ultrastructural sinusoidal changes in extrahepatic cholestasis. Light and electron microscopic immunohistochemical localization of collagen type III and type IV.

    PubMed

    Gulubova, M V

    1996-07-01

    Extrahepatic cholestasis causes excessive extracellular matrix formation perisinusoidally. Ito cells, transitional and endothelial cells are considered to be a source of extracellular matrix proteins in experimental cholestasis. The localization of collagens type III and type IV in human liver in extrahepatic cholestasis was investigated immunohistochemically in the present study. Immersion fixation was used after modification to be applied to surgical biopsies with commercially available kits. Sinusoidal changes were observed that indicated excessive collagen and matrix formation. Light microscopically, increased immunostaining with the two collagen antibodies was found perisinusoidally and portally. Ultrastructurally, collagen type III positive fibres were found beneath basement membranes of vessels, in collagen bundles and as a fibrillar network in the space of Disse. Collagen type IV immunostaining was located in portal tracts and near hepatocyte microvilli. Intracellular staining with collagen type IV was detected in the rough endoplasmic reticulum of some transitional cells. Immunostaining was located around transitional cells, Ito cells or endothelial cells mainly. Our study indicates that Ito cells, transitional and endothelial cells are the main source of collagens type III and IV in the space of Disse in extrahepatic cholestasis in humans.

  18. Oxygen microprofile in the prepared sediments and its implication for the sediment oxygen consuming process in a heavily polluted river of China.

    PubMed

    Wang, Chao; Zhai, Wanying; Shan, Baoqing

    2016-05-01

    Dissolved oxygen (DO) microprofiles of prepared sediments from 24 sampling sites in the Fuyang River were measured using a gold amalgam microelectrode in this study. The measured microprofiles can be divided into four types. In type I profiles, DO kept constant in the overlying water and decreased smoothly in the pore water; in type II profile, DO showed fluctuation in the pore water; in type III profiles, DO showed peak in the SWI; in type IV profiles, DO decreased obviously in the overlying water. Type I profiles indicated the absence of benthic organisms and thus the degradation of the sediment habitat. Type II and III profiles indicated the activity of benthic animal and epipelic algae, which is common in the healthy aquatic sediment. Type IV profiles indicated that the excessive accumulation of pollutants in the sediment and thus the serious sediment pollution. There are nine sites showing type I profile, three sites showing type II profile, nine sites showing type III profile, and three sites showing type IV profile in the Fuyang River. The dominance of type I and appearance of type IV indicated that sediment oxygen consumption processes in the Fuyang River were strongly influenced by the sediment pollutants release and the vanish of benthic organisms. The pharmacy, metallurgy, and curriery industries may contribute to the sediment deterioration and thus to the occurrence of type I and type IV oxygen profiles in the Fuyang River.

  19. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome

    PubMed Central

    Kim, Jeong Gyun; Cho, Won-Sang; Kim, Jeong Eun

    2014-01-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure. PMID:24653803

  20. Spontaneous Carotid-Cavernous Fistula in the Type IV Ehlers-Danlos Syndrome.

    PubMed

    Kim, Jeong Gyun; Cho, Won-Sang; Kang, Hyun-Seung; Kim, Jeong Eun

    2014-02-01

    Ehlers-Danlos syndrome (EDS) is a rare inherited connective disease. Among several subgroups, type IV EDS is frequently associated with spontaneous catastrophic bleeding from a vascular fragility. We report on a case of carotid-cavernous fistula (CCF) in a patient with type IV EDS. A 46-year-old female presented with an ophthalmoplegia and chemosis in the right eye. Subsequently, seizure and cerebral infarction with micro-bleeds occurred. CCF was completely occluded with transvenous coil embolization without complications. Thereafter, the patient was completely recovered. Transvenous coil embolization can be a good treatment of choice for spontaneous CCF with type IV EDS. However, every caution should be kept during invasive procedure.

  1. Effect of Aegle marmelos and Murraya koenigii in treatment of delayed pubertal buffaloes heifers

    PubMed Central

    Baitule, Mohan M.; Gawande, A. P.; Kumar, Umesh; Sahatpure, S. K.; Patil, Manoj S.; Baitule, Mansi M.

    2016-01-01

    Aim: This study aims to study the estrus induction, ovulation, and conception rate of delayed puberty in buffaloes heifers by feeding a herbal plants Aegle marmelos (bael/bili/bhel leaf) and Murraya koenigii (Curry leaf). Materials and Methods: Totally, 24 buffalo heifers with delayed puberty were selected for the present study and divided randomly in four equal groups (n=6). Before experiment, all animals were dewormed with albendazole at 10 mg/kg body weight to prevent them from the stress of parasitism. In the present experiment, four group taken and Group I (n=6) treated with A. marmelos, Group II (n=6) treated with M. koenigii, Group III (n=6) treated with mixture of A. marmelos and M. koenigii and fed for 9 days. Group IV (n=6) considered as control and fed with concentrate only. The blood samples were collected from all the animals on day 0 (before treatment), 4, 9 (during treatment), on the day of estrus and day 8 after the onset of estrus. The 10 ml blood was collected from the jugular vein of all the experimental animals for estimation of serum calcium, inorganic phosphorus, and progesterone (P4). The estrus response, ovulation, conception rate along with serum calcium, inorganic phosphorus, and progesterone level were determined by the standard protocol. Results: From Group III 4 heifers, from Group II 3 heifers, and from Group I and IV (Control) 2 heifers each, exhibited the estrus. The estrus response was recorded as 33.33%, 50.00%, 75.00%, and 33.33% in Group I, Group II, Group III, and Group IV, respectively. In treatment Group III, serum calcium found significantly more (p<0.05) on day 8 post-estrus as compared to other groups at a similar interval. Inorganic phosphorus and progesterone show no significant difference between groups. The ovulation and conception rates are comparatively better in Group III (75%) buffalo heifers than other groups. Conclusion: Herbal supplementation of A. marmelos and M. koenigii in combination, as well as M. koenigii alone, were found effective in fertility improvement in delayed pubertal buffalo heifers by increasing ovulation and conception rate. PMID:28096608

  2. A new system for cultivation of human keratinocytes on acellular dermal matrix substitute with the use of human fibroblast feeder layer.

    PubMed

    Xiao, S; Zhu, S; Ma, B; Xia, Z-F; Yang, J; Wang, G

    2008-01-01

    To improve the proliferative potential of human keratinocytes (HK) cultured on acellular dermal matrix (ADM), HK and mitomycin C-treated human fibroblasts (MMC-HF) were seeded onto ADM to form four types of composite skin: type I, HK were seeded onto the epidermal side of ADM; type II, both HK and MMC-HF were seeded onto the epidermal side; type III, MMC-HF were preseeded onto the dermal side of ADM, and then HK were seeded onto the epidermal side, and type IV, where MMC-HF were preseeded onto both sides, and then HK were seeded onto the epidermal side. Compared with type I and III, the proliferative potential of HK of type II and IV was significantly higher on day 3, 5, 7 and 9 in vitro. In type I and III, HK grew into one layer on day 7-9, while in type II and IV keratinocytes grew into a confluent monolayer by day 4-6. The adherence to ADM of HK in types II and IV was stronger than that in type I and III. The take rate of type II and IV composite skin was also significantly higher. In conclusion, when MMC-HF and HK were cocultured on the epidermal side of ADM, MMC-HF could serve as excellent feeder cells. Copyright 2007 S. Karger AG, Basel.

  3. Ultraviolet properties of IRAS-selected Be stars

    NASA Technical Reports Server (NTRS)

    Bjorkman, Karen S.; Snow, Theodore P.

    1988-01-01

    New IUE observations were obtained of 35 Be stars from a list of stars which show excess infrared fluxes in IRAS data. The IRAS-selected Be stars show larger C IV and Si IV equivalent widths than other Be stars. Excess C IV and Si IV absorption seems to be independent of spectral type for IRAS-selected Be stars later than spectral type B4. This is interpreted as evidence for a possible second mechanism acting in conjunction with radiation pressure for producing the winds in Be stars. No clear correlation of IR excess of v sin i with C IV or Si IV equivalent widths is seen, although a threshold for the occurrence of excess C IV and Si IV absorption appears at a v sin i of 150 km/sec.

  4. Genetics Home Reference: congenital insensitivity to pain with anhidrosis

    MedlinePlus

    ... is also known as hereditary sensory and autonomic neuropathy type IV. The signs and symptoms of CIPA ... to pain with anhidrosis hereditary sensory and autonomic neuropathy type IV hereditary sensory and autonomic neuropathy, type ...

  5. Collagen type IV at the fetal-maternal interface.

    PubMed

    Oefner, C M; Sharkey, A; Gardner, L; Critchley, H; Oyen, M; Moffett, A

    2015-01-01

    Extracellular matrix proteins play a crucial role in influencing the invasion of trophoblast cells. However the role of collagens and collagen type IV (col-IV) in particular at the implantation site is not clear. Immunohistochemistry was used to determine the distribution of collagen types I, III, IV and VI in endometrium and decidua during the menstrual cycle and the first trimester of pregnancy. Expression of col-IV alpha chains during the reproductive cycle was determined by qPCR and protein localisation by immunohistochemistry. The structure of col-IV in placenta was examined using transmission electron microscopy. Finally, the expression of col-IV alpha chain NC1 domains and collagen receptors was localised by immunohistochemistry. Col-IV alpha chains were selectively up-regulated during the menstrual cycle and decidualisation. Primary extravillous trophoblast cells express collagen receptors and secrete col-IV in vitro and in vivo, resulting in the increased levels found in decidua basalis compared to decidua parietalis. A novel expression pattern of col-IV in the mesenchyme of placental villi, as a three-dimensional network, was found. NC1 domains of col-IV alpha chains are known to regulate tumour cell migration and the selective expression of these domains in decidua basalis compared to decidua parietalis was determined. Col-IV is expressed as novel forms in the placenta. These findings suggest that col-IV not only represents a structural protein providing tissue integrity but also influences the invasive behaviour of trophoblast cells at the implantation site. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  7. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  8. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  9. 7 CFR 1463.106 - Base quota levels for eligible tobacco producers.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ...)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm's average... (35-36)—.952381 (iv) Virginia Sun-cured (type 37) 1.0000 6 Multiply the sum from Step 5 times the farm... (35-36)—.94264 (iv) Virginia Sun-cured (type 37) 1.0000 3 Multiply the sum from Step 2 times the farm...

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Xiu-Li, E-mail: usually.158@163.com; Hubei Key Laboratory of Tumor Biological Behaviors and Hubei Cancer Clinical Study Center, No 169 Donghu Road, Wuchang District, Wuhan 430071; Peng, Chun-Wei, E-mail: pqc278@163.com

    Highlights: {yields} HER2 level is closely related to the biologic behaviors of breast cancer cells. {yields} A new method to simultaneously image HER2 and type IV collagen was established. {yields} HER2 status and type IV collagen degradation predict breast cancer invasion. {yields} The complex interactions between tumor and its environment were revealed. -- Abstract: It has been well recognized that human epidermal growth factor receptor 2 (HER2) level in breast cancer (BC) is closely related to the malignant biologic behaviors of the tumor, including invasion and metastasis. Yet, there has been a lack of directly observable evidence to support suchmore » notion. Here we report a quantum dots (QDs)-based double-color imaging technique to simultaneously show the HER2 level on BC cells and the type IV collagen in the tumor matrix. In benign breast tumor, the type IV collagen was intact. With the increasing of HER2 expression level, there has been a progressive decrease in type IV collagen around the cancer nest. At HER2 (3+) expression level, there has virtually been a total destruction of type IV collagen. Moreover, HER2 (3+) BC cells also show direct invasion into the blood vessels. This novel imaging method provides direct observable evidence to support the theory that the HER2 expression level is directly related to BC invasion.« less

  11. Slit2 promotes tumor growth and invasion in chemically induced skin carcinogenesis.

    PubMed

    Qi, Cuiling; Lan, Haimei; Ye, Jie; Li, Weidong; Wei, Ping; Yang, Yang; Guo, Simei; Lan, Tian; Li, Jiangchao; Zhang, Qianqian; He, Xiaodong; Wang, Lijing

    2014-07-01

    Slit, a neuronal guidance cue, binds to Roundabout (Robo) receptors to modulate neuronal, leukocytic, and endothelial migration. Slit has been reported to have an important effect on tumor growth and metastasis. In the current study, we evaluated the role of Slit2 in skin tumor growth and invasion in mice using a two-step chemical carcinogenesis protocol. We found that Slit2 expression correlated with the loss of basement membrane in the samples of human skin squamous cell carcinoma at different stages of disease progression. Slit2-Tg mice developed significantly more skin tumors than wild-type mice. Furthermore, the skin tumors that occurred in Slit2-Tg mice were significantly larger than those in the wild-type mice 10 weeks after 7,12-dimethylbenz[a]anthracene initiation until the end of the experiment. We also found that pathological development of the wild-type mice was delayed compared with that of Slit2-Tg mice. To further investigate the mechanism of increasing tumors in Slit2-Tg mice, we analyzed the expression of 5-bromo-2'-deoxyuridine (BrdU) in mouse skin lesions and found that the number of BrdU-positive cells and microvessel density in skin lesions were significantly higher in Slit2-Tg mice than in wild-type mice. Histological staining of PAS and type IV collagen and the colocalization of Slit2 and type IV collagen demonstrated varying degrees of loss of the basement membrane in the skin lesions from Slit2-Tg mice that were at the stage of carcinoma in situ. However, the basement membrane was well defined in the wild-type mice. In addition, MMP2, but not MMP9, was upregulated in the skin tissue of Slit2-Tg mice. Interruption of Slit2-Robo1 signaling by the antibody R5 significantly repressed the invasive capability of the squamous cell carcinoma cell line A431. Taken together, our findings reveal that Slit2 promotes DMBA/TPA-induced skin tumorigenesis by increasing cell proliferation, microvessel density, and invasive behavior of cutaneous squamous cell carcinoma, along with loss of basement membrane, by upregulation of MMP2 expression.

  12. On the Directivity of Low-Frequency Type IV Radio Bursts

    NASA Technical Reports Server (NTRS)

    Gopalswamy, N.; Akiyama, S.; Makela, P.; Yashiro, S.; Cairns, I. H.

    2016-01-01

    An intense type IV radio burst was observed by the STEREO Behind (STB) spacecraft located about 144 deg. behind Earth. The burst was associated with a large solar eruption that occurred on the backside of the Sun (N05E151) close to the disk center in the STB view. The eruption was also observed by the STEREO Ahead (STA) spacecraft (located at 149 deg. ahead of Earth) as an eruption close to the west limb (N05W60) in that view. The type IV burst was complete in STB observations in that the envelope reached the lowest frequency and then receded to higher frequencies. The burst was partial viewed from STA, revealing only the edge coming down to the lowest frequency. The type IV burst was not observed at all near Earth because the source was 61 deg. behind the east limb. The eruption was associated with a low-frequency type II burst observed in all three views, although it was not very intense. Solar energetic particles were also observed at both STEREOs and at SOHO, suggesting that the shock was much extended, consistent with the very high speed of the CME (2048 km/s). These observations suggest that the type IV emission is directed along a narrow cone above the flare site. We confirm this result statistically using the type IV bursts of solar cycle 23.

  13. Diffuse reticuloendothelial system involvement in type IV glycogen storage disease with a novel GBE1 mutation: a case report and review.

    PubMed

    Magoulas, Pilar L; El-Hattab, Ayman W; Roy, Angshumoy; Bali, Deeksha S; Finegold, Milton J; Craigen, William J

    2012-06-01

    Glycogen storage disease type IV is a rare autosomal recessive disorder of glycogen metabolism caused by mutations in the GBE1 gene that encodes the 1,4-alpha-glucan-branching enzyme 1. Its clinical presentation is variable, with the most common form presenting in early childhood with primary hepatic involvement. Histologic manifestations in glycogen storage disease type IV typically consist of intracytoplasmic non-membrane-bound inclusions containing abnormally branched glycogen (polyglucosan bodies) within hepatocytes and myocytes. We report a female infant with classic hepatic form of glycogen storage disease type IV who demonstrated diffuse reticuloendothelial system involvement with the spleen, bone marrow, and lymph nodes infiltrated by foamy histiocytes with intracytoplasmic polyglucosan deposits. Sequence analysis of the GBE1 gene revealed compound heterozygosity for a previously described frameshift mutation (c.1239delT) and a novel missense mutation (c.1279G>A) that is predicted to alter a conserved glycine residue. GBE enzyme analysis revealed no detectable activity. A review of the literature for glycogen storage disease type IV patients with characterized molecular defects and deficient enzyme activity reveals most GBE1 mutations to be missense mutations clustering in the catalytic enzyme domain. Individuals with the classic hepatic form of glycogen storage disease type IV tend to be compound heterozygotes for null and missense mutations. Although the extensive reticuloendothelial system involvement that was observed in our patient is not typical of glycogen storage disease type IV, it may be associated with severe enzymatic deficiency and a poor outcome. Copyright © 2012 Elsevier Inc. All rights reserved.

  14. A Review of Best Practices for Intravenous Push Medication Administration.

    PubMed

    Lenz, Janelle R; Degnan, Daniel D; Hertig, John B; Stevenson, James G

    In 2015, the Institute for Safe Medication Practices (ISMP) released safe practice guidelines for adult intravenous (IV) push medications. ISMP's most recent set of guidelines has added to a growing list of recommendations from professional groups on the safe use of IV medications. These recommendations and guidelines vary with regard to their audience, scope, and terminology. In some ways, these variations may contribute to confusion and delayed adoption of the standards. This report attempts to provide clarity about the rationale and background regarding the need for practice improvement, discussion of various guidelines, and practice mitigation strategies to improve patient safety.

  15. Should the DSM V drop Asperger syndrome?

    PubMed

    Ghaziuddin, Mohammad

    2010-09-01

    The DSM IV defines Asperger syndrome (AS) as a pervasive developmental (autistic spectrum) disorder characterized by social deficits and rigid focused interests in the absence of language impairment and cognitive delay. Since its inclusion in the DSM-IV, there has been a dramatic increase in its recognition both in children and adults. However, because studies have generally failed to demonstrate a clear distinction between AS and autism, some researchers have called for its elimination from the forthcoming DSM V. This report argues for a modification of its diagnostic criteria and its continued retention in the diagnostic manual.

  16. AIDS and Adolescents: The Time for Prevention Is Now.

    ERIC Educational Resources Information Center

    Haffner, Debra W.

    Due to indiscriminate experimentation with drugs and sex, teens are increasingly at risk of contracting AIDS. Goals of prevention include reducing the panic and misinformation surrounding the disease, helping teenagers delay sexual intercourse, ensuring condom use, and preventing I.V. drug use. AIDS prevention as a shared responsibility includes…

  17. Type IV carbonic anhydrase is present in the gills of spiny dogfish (Squalus acanthias).

    PubMed

    Gilmour, K M; Bayaa, M; Kenney, L; McNeill, B; Perry, S F

    2007-01-01

    Physiological and biochemical studies have provided indirect evidence for a membrane-associated carbonic anhydrase (CA) isoform, similar to mammalian type IV CA, in the gills of dogfish (Squalus acanthias). This CA isoform is linked to the plasma membrane of gill epithelial cells by a glycosylphosphatidylinositol anchor and oriented toward the plasma, such that it can catalyze the dehydration of plasma HCO(3)(-) ions. The present study directly tested the hypothesis that CA IV is present in dogfish gills in a location amenable to catalyzing plasma HCO(3)(-) dehydration. Homology cloning techniques were used to assemble a 1,127 base pair cDNA that coded for a deduced protein of 306 amino acids. Phylogenetic analysis suggested that this protein was a type IV CA. For purposes of comparison, a second cDNA (1,107 base pairs) was cloned from dogfish blood; it encoded a deduced protein of 260 amino acids that was identified as a cytosolic CA through phylogenetic analysis. Using real-time PCR and in situ hybridization, mRNA expression for the dogfish type IV CA was detected in gill tissue and specifically localized to pillar cells and branchial epithelial cells that flanked the pillar cells. Immunohistochemistry using a polyclonal antibody raised against rainbow trout type IV CA revealed a similar pattern of CA IV immunoreactivity and demonstrated a limited degree of colocalization with Na(+)-K(+)-ATPase immunoreactivity. The presence and localization of a type IV CA isoform in the gills of dogfish is consistent with the hypothesis that branchial membrane-bound CA with an extracellular orientation contributes to CO(2) excretion in dogfish by catalyzing the dehydration of plasma HCO(3)(-) ions.

  18. Clinical utility of the Wechsler Memory Scale--Fourth Edition (WMS-IV) in predicting laterality of temporal lobe epilepsy among surgical candidates.

    PubMed

    Soble, Jason R; Eichstaedt, Katie E; Waseem, Hena; Mattingly, Michelle L; Benbadis, Selim R; Bozorg, Ali M; Vale, Fernando L; Schoenberg, Mike R

    2014-12-01

    This study evaluated the accuracy of the Wechsler Memory Scale--Fourth Edition (WMS-IV) in identifying functional cognitive deficits associated with seizure laterality in localization-related temporal lobe epilepsy (TLE) relative to a previously established measure, the Rey Auditory Verbal Learning Test (RAVLT). Emerging WMS-IV studies have highlighted psychometric improvements that may enhance its ability to identify lateralized memory deficits. Data from 57 patients with video-EEG-confirmed unilateral TLE who were administered the WMS-IV and RAVLT as part of a comprehensive presurgical neuropsychological evaluation for temporal resection were retrospectively reviewed. We examined the predictive accuracy of the WMS-IV not only in terms of verbal versus visual composite scores but also using individual subtests. A series of hierarchal logistic regression models were developed, including the RAVLT, WMS-IV delayed subtests (Logical Memory, Verbal Paired Associates, Designs, Visual Reproduction), and a WMS-IV verbal-visual memory difference score. Analyses showed that the RAVLT significantly predicted laterality with overall classification rates of 69.6% to 70.2%, whereas neither the individual WMS-IV subtests nor the verbal-visual memory difference score accounted for additional significant variance. Similar to previous versions of the WMS, findings cast doubt as to whether the WMS-IV offers significant incremental validity in discriminating seizure laterality in TLE beyond what can be obtained from the RAVLT. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

    PubMed

    Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

    2015-04-02

    Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

  20. Mouse strain and injection site are crucial for detecting linked suppression in transplant recipients by trans-vivo DTH assay.

    PubMed

    Burlingham, W J; Jankowska-Gan, E

    2007-02-01

    Chemokine-driven accumulation of lymphocytes, mononuclear and polymorphonuclear proinflammatory cells in antigenic tissue sites is a key feature of several types of T-cell-dependent autoimmunity and transplant rejection pathology. It is now clear that the immune system expends considerable energy to control this process, exemplified by the sequential layers of regulatory cell input, both innate and adaptive, designed to prevent a classical Type IV or 'delayed-type' hypersensitivity (DTH) reaction from occurring in the visual field of the eye. Yet, despite an abundance of in vitro assays currently available to the human T-cell immunologist, none of them adequately models the human DTH response and its various control features. The theme of this article is that it is relatively easy to model the effector side of the human DTH response with xenogeneic adoptive transfer models. However, we show that in order to detect inhibition of a recall DTH in response to colocalized donor antigen (linked suppression)--a characteristic feature of peripheral tolerance to an organ transplant--both the challenge site and the immunocompetence of the mouse adoptive host are critical factors limiting the sensitivity of the trans-vivo DTH test.

  1. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  2. The Role of Dipeptidyl Peptidase IV in Lung Metastasis of Breast Cancer Cells

    DTIC Science & Technology

    1999-05-01

    Our studies focused on (1) cloning and sequencing of wild-type endothelial DPP IV (wtDPP IV) and preparation of truncated DPP IV ( tDPP IV); (2...that was identical to hepatic DPP IV. Acid extraction of rat lung yielded a tDPP IV, which was an effective inhibitor of breast cancer cell adhesion to

  3. Enhanced 99 Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    Technetium (99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals. Two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 – 1,000 oC. After being cooled, the solid glass specimens prepared at different temperatures were analyzed for Tc oxidation state using Tc K-edge XANES. In most samples, Tc wasmore » partially oxidized from Tc(IV) to Tc(VII) as the melt temperature increased. However, Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were moderately higher than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  4. Matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in paediatric burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors.

    PubMed

    Weremijewicz, Artur; Matuszczak, Ewa; Sankiewicz, Anna; Tylicka, Marzena; Komarowska, Marta; Tokarzewicz, Anna; Debek, Wojciech; Gorodkiewicz, Ewa; Hermanowicz, Adam

    2018-06-01

    The purpose of this study was the determination of matrix metalloproteinase-2 and its correlation with basal membrane components laminin-5 and collagen type IV in the blood plasma of burn patients measured with Surface Plasmon Resonance Imaging (SPRI) biosensors. 31 children scalded by hot water who were managed at the Department of Paediatric Surgery between 2014-2015, after primarily presenting with burns in 4-20% TBSA were included into the study (age 9 months up to 14 years, mean age 2,5+1 years). There were 10 girls and 21 boys. Venous blood samples were drawn 2-6h, and 12-16h after the thermal injury, and on the subsequent days 3, 5 and 7. The matrix metalloproteinase-2, collagen type IV and laminin-5 concentrations were assessed using Surface Plasmon Resonance Imaging by the investigators blinded to the other data. The MMP-2, laminin-5 and collagen type IV concentrations in the blood plasma of patients with burns, were highest 12-16h after thermal injury, the difference was statistically significant. The MMP-2, laminin-5 and collagen type IV concentrations measured 3 days, 5 days and 7 days after the thermal injury, slowly decreased over time, and on the 7th day reached the normal range, when compared with the concentration measured in controls. Current work is the first follow-up study regarding MMP-2 in burns. MMP-2, laminin-5 and collagen type IV levels were elevated early after burn injury in the plasma of studied patients, and were highest 12-16h after the injury. MMP-2, laminin-5 and collagen type IV levels were not proportional to the severity of the burn. We believe in the possibility that the gradual decrease of MMP-2, collagen type IV and laminin-5 concentrations could be connected with the process of healing, but to prove it, more investigation is needed in this area. The SPR imaging biosensor is a good diagnostic tool for determination of MMP-2, laminin-5 and collagen type IV in blood plasma of patients with burns. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  5. [APPLICATION OF COMPUTER-ASSISTED SURGICAL PLANNING IN SURGICAL TREATMENT OF ANKLE FRACTURES].

    PubMed

    Xia, Shengli; Wang, Xiuhui; Fu, Beigang; Lu, Yaogang; Wang, Minghui

    2015-12-01

    To explore the clinical value of computer-assisted surgical planning in the treatment of ankle fractures. Between January 2012 and January 2014, open reduction and internal fixation were performed on 42 patients with ankle fractures. There were 22 males and 20 females with an average age of 52 years (range, 19-72 years). The causes were spraining injury (20 cases), traffic accident injury (14 cases), and falling from height injury (8 cases). The time from injury to operation was 5 hours to 12 days (mean, 2.5 days). All fractures were closed trimalleolar fractures. According to Lauge-Hansen classification, 25 cases were rated as supination extorsion type IV, 13 as pronation extorsion type IV, and 4 as pronation abduction type III. The preoperative planning was made by virtual reduction and internal fixation using Superimage software. The mean operation time was 93.7 minutes (range, 76-120 minutes). Delayed wound healing occurred in 1 case, and secondary healing was obtained after treatment; primary healing of incision was achieved in the other patients. Postoperative X-ray films and CT images showed anatomic reduction of fracture and good position of internal fixation. All patients were followed up 14.6 months on average (range, 9-27 months). The range of motion of the affected ankle was close to the normal side at 6-8 weeks. The mean fracture healing time was 13.1 weeks (range, 11-17 weeks). Degenerative change of the ankle joint was observed in 3 cases (7.1%) with manifestation of mild narrowing of joint space on the X-ray films at last follow-up. According to Baird-Jackson score system, the results were excellent in 24 cases, good in 13 cases, and fair in 5 cases, with an excellent and good rate of 88%. Computer-assisted surgical planning for ankle fractures can help surgeons identify type of ankle fractures and improve surgical scheme for guiding fracture reduction and selecting and placing implants, so good effectiveness can be obtained.

  6. Endovascular Treatment of a Carotid Dissecting Pseudoaneurysm in a Patient with Ehlers-Danlos Syndrome Type IV with Fatal Outcome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lim, Siok Ping, E-mail: siokpinglim@yahoo.co.uk; Duddy, Martin J.

    2008-01-15

    We present a patient with Ehlers-Danlos syndrome type IV (EDS IV) with a carotid dissecting pseudoaneurysm causing severe carotid stenosis. This lesion was treated endovascularly. Unfortunately, the patient died of remote vascular catastrophes (intracranial hemorrhage and abdominal aortic rupture). This unique case illustrates the perils of endovascular treatment of EDS IV patients and the need for preoperative screening for concomitant lesions. It also shows that a dissecting pseudoaneurysm can feasibly be treated with a covered stent and that closure is effective using Angioseal in patients with EDS IV.

  7. Role of 17 beta-estradiol on type IV collagen fibers volumetric density in the basement membrane of bladder wall.

    PubMed

    de Fraga, Rogerio; Dambros, Miriam; Miyaoka, Ricardo; Riccetto, Cássio Luís Zanettini; Palma, Paulo César Rodrigues

    2007-10-01

    The authors quantified the type IV collagen fibers volumetric density in the basement membrane of bladder wall of ovariectomized rats with and without estradiol replacement. This study was conducted on 40 Wistar rats (3 months old) randomly divided in 4 groups: group 1, remained intact (control); group 2, submitted to bilateral oophorectomy and daily replacement 4 weeks later of 17 beta-estradiol for 12 weeks; group 3, sham operated and daily replacement 4 weeks later of sesame oil for 12 weeks; and group 4, submitted to bilateral oophorectomy and killed after 12 weeks. It was used in immunohistochemistry evaluation using type IV collagen polyclonal antibody to stain the fibers on paraffin rat bladder sections. The M-42 stereological grid system was used to analyze the fibers. Ovariectomy had an increase effect on the volumetric density of the type IV collagen fibers in the basement membrane of rat bladder wall. Estradiol replacement in castrated animals demonstrated a significative difference in the stereological parameters when compared to the castrated group without hormonal replacement. Surgical castration performed on rats induced an increasing volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall and the estradiol treatment had a significant effect in keeping a low volumetric density of type IV collagen fibers in the basement membrane of rats bladder wall.

  8. Characterization of Staphylococcus aureus faecal isolates associated with food-borne disease in Korea.

    PubMed

    Shin, E; Hong, H; Park, J; Oh, Y; Jung, J; Lee, Y

    2016-07-01

    To characterize Staphylococcus aureus faecal isolates from people suspected to be infected with food poisoning by using antimicrobial susceptibility testing and molecular techniques. A total of 340 Staph. aureus isolates from 6226 people suspected to be infected with food poisoning were identified and characterized by biochemical methods, antimicrobial susceptibility testing and PCR. Samples were obtained from January 2006 to December 2008 from the National Notifiable Diseases Surveillance System at the Research Institute of Public Health and Environment in Seoul Metropolitan, Korea. All strains carried at least one of the eight staphylococcal enterotoxin (se) genes tested and a total of 27 se profiles were produced; the most frequent se profile was seg-sei and the next was sea. Among the total isolates, 36 methicillin-resistant Staphylococcus aureus (MRSAs) isolates were further analysed by multilocus sequence typing (MLST), Staphylococcal cassette chromosome mec (SCCmec) typing, pulsed-field gel electrophoresis (PFGE) and PCR detection for pvl. ST72-SCCmec type IV was the most predominant clone (27 isolates, 75%) followed by ST1-SCCmec type IV (five isolates, 13·8%), ST20-SCCmec type IV (one isolate, 2·8%), ST493-SCCmec type IV (one isolate, 2·8%), ST903-SCCmec type IV (one isolate, 2·8%) and ST5-SCCmec type II (one isolate, 2·8%). By PFGE typing, MRSAs isolated during the same period were grouped together although they were isolated from different regions. None of MRSAs had PVL gene and nine MRSAs were multidrug resistant. Analysis of MRSAs by MLST, SCCmec typing, PFGE and pvl detection showed that the majority of strain associated with food-borne diseases belonged to a Korean community-acquired (CA) MRSA clone with ST72-SCCmec type IV-PVL negative-SEG/SEI and its variations while one strain was hospital-acquired (HA) MRSA. CA-MRSA clone which possessed ST72-SCCmec type IV-PVL negative-SEG/SEI was spread most commonly among MRSAs that were associated with food-borne diseases. This is the first report of ST903 strain in Korea. © 2016 The Society for Applied Microbiology.

  9. Adenocarcinoma of the lung with scattered consolidation: radiological-pathological correlation and prognosis.

    PubMed

    Jiang, Binghu; Takashima, Shodayu; Hakucho, Tomoaki; Hodaka, Numasaki; Yasuhiko, Tomita; Masahiko, Higashiyama

    2013-10-01

    To investigate the clinicopathological features and prognosis in patients with adenocarcinoma of the lung with scattered consolidation (ALSC). Between January 2006 and March 2010, 139 consecutive patients with lung adenocarcinoma of ≤3 cm, who underwent pulmonary resection for lung cancer, were investigated retrospectively. Radiologic classification was based on the findings of thin-section CT such as the presence of consolidation or ground-glass opacity (GGO). Type I (n=15) and Type II (n=14), showed a pure GGO and a mixed GGO with consolidation <50%, respectively. Type IV (n=38) and Type V (n=52) showed a mixed GGO with consolidation ≥50% and a pure consolidation, respectively. Type III (n=20) was the adenocarcinoma of the lung with scattered consolidation (ALSC). The clinicopathological features and prognosis of ALSC was investigated with comparative analysis and survival analysis. Because of the similar recurrence rate for Type I and Type II (P=1.000), Type IV and Type V (P=0.343), we merged Type I and Type II as Type I+II, Type IV and Type V as Type IV+V, respectively. In the 20 (14.4%) patients with ALSC, lymph node metastasis was not observed, and it was rare in lymphatic invasion and vascular invasion. On the basis of IASLC/ATS/ERS 2011 classification, 80% of the ALSC were preinvasive lesions. In Noguchi classification, there was no significant difference between Type I+II and ALSC (P=0.260). The prognosis of ALSC was similar to Type I+II (P=0.408), but better than Type IV+V (P=0.040). Adenocarcinoma of the lung with scattered consolidation (ALSC) on thin-section CT was a relatively favorable prognostic factor. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. 46 CFR 164.019-3 - Definitions.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Guard-approved PFDs. Commandant means the Chief of the Lifesaving and Fire Safety Division, Office of... code PFD type acceptable for use 1 I, II, and III. 2 II and III. 3 III. 4B IV (all Ring Buoys). 4BC IV (Buoyant Cushions). 4RB IV (Recreational Ring Buoys only). 5 Wearable Type V (intended use must be...

  11. Metachronous Bilateral Posterior Tibial Artery Aneurysms in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagspiel, Klaus D., E-mail: kdh2n@virginia.edu; Bonatti, Hugo; Sabri, Saher

    2011-04-15

    Ehlers-Danlos syndrome type IV is a life-threatening genetic connective tissue disorder. We report a 24-year-old woman with EDS-IV who presented with metachronous bilateral aneurysms/pseudoaneurysms of the posterior tibial arteries 15 months apart. Both were treated successfully with transarterial coil embolization from a distal posterior tibial approach.

  12. Utility of high-resolution anorectal manometry and wireless motility capsule in the evaluation of patients with Parkinson's disease and chronic constipation

    PubMed Central

    Su, Andrew; Gandhy, Rita; Barlow, Carrolee; Triadafilopoulos, George

    2016-01-01

    Background The aetiology of constipation in Parkinson's disease remains poorly understood. Defaecatory dyssynergia, anal sphincter spasticity and slow transit constipation may, individually or collectively, play a role. Aims In this retrospective cohort analysis of patients with Parkinson's disease and chronic constipation, we determined the utility of high-resolution anorectal manometry, balloon expulsion and wireless motility capsule testing in defining the underlying aetiology for constipation. Methods In this retrospective cohort study, consecutive patients with Parkinson's disease and chronic constipation underwent clinical assessment, manometry with balloon expulsion and wireless motility capsule testing using standard protocols. Results We studied 66 patients fulfilling Rome IV criteria for functional constipation. Most patients (89%) had abnormal manometry, exhibiting various types of defaecatory dyssynergia (mostly types II and IV), abnormal balloon expulsion, diminished rectal sensation and, in some, lacking rectoanal inhibitory reflex. 62% exhibited colonic transit delay by wireless motility capsule study, while 57% had combined manometric and transit abnormalities, suggesting of overlap constipation. Symptoms of infrequent defaecation, straining and incomplete evacuation were not discriminatory. There was a relationship between constipation scores and colonic transit times (p=0.01); Parkinson's disease scores and duration were not correlated with either the manometric or transit findings. Faecal incontinence was seen in 26% of the patients. Conclusions Chronic constipation in patients with Parkinson's disease may reflect pelvic floor dyssynergia, slow transit constipation or both, and may be associated with faecal incontinence, suggesting both motor and autonomic dysfunction. Anorectal manometry and wireless motility capsule testing are useful in the assessment of these patients. PMID:27843572

  13. Interstellar C IV and Si IV column densities toward early-type stars

    NASA Technical Reports Server (NTRS)

    Bruhweiler, F. C.; Kondo, Y.; Mccluskey, G. E.

    1980-01-01

    Equivalent widths and deduced column densities of Si IV and C IV are examined for 18 early-type close binaries, and physical processes responsible for the origin of these ions in the interstellar medium are investigated. The available C IV/Si IV column density ratios typically lie within a narrow range from 0.8 to 4.5, and there is evidence that the column density of C IV is higher than that of N V along most lines of sight, suggesting that C IV is not formed in the same hot region as O VI. In addition, the existence of regions with a narrowly defined new temperature range around 50,000 deg K is indicated. The detection of the semitorrid gas of Bruhweiler, Kondo, and McCluskey (1978, 1979) is substantiated, and the relation of this gas to the observations of coronal gas in the galactic halo is discussed.

  14. Estimation of coupling between time-delay systems from time series

    NASA Astrophysics Data System (ADS)

    Prokhorov, M. D.; Ponomarenko, V. I.

    2005-07-01

    We propose a method for estimation of coupling between the systems governed by scalar time-delay differential equations of the Mackey-Glass type from the observed time series data. The method allows one to detect the presence of certain types of linear coupling between two time-delay systems, to define the type, strength, and direction of coupling, and to recover the model equations of coupled time-delay systems from chaotic time series corrupted by noise. We verify our method using both numerical and experimental data.

  15. Serotype IV and invasive group B Streptococcus disease in neonates, Minnesota, USA, 2000-2010.

    PubMed

    Ferrieri, Patricia; Lynfield, Ruth; Creti, Roberta; Flores, Aurea E

    2013-04-01

    Group B Streptococcus (GBS) is a major cause of invasive disease in neonates in the United States. Surveillance of invasive GBS disease in Minnesota, USA, during 2000-2010 yielded 449 isolates from 449 infants; 257 had early-onset (EO) disease (by age 6 days) and 192 late-onset (LO) disease (180 at age 7-89 days, 12 at age 90-180 days). Isolates were characterized by capsular polysaccharide serotype and surface-protein profile; types III and Ia predominated. However, because previously uncommon serotype IV constitutes 5/31 EO isolates in 2010, twelve type IV isolates collected during 2000-2010 were studied further. By pulsed-field gel electrophoresis, they were classified into 3 profiles; by multilocus sequence typing, representative isolates included new sequence type 468. Resistance to clindamycin or erythromycin was detected in 4/5 serotype IV isolates. Emergence of serotype IV GBS in Minnesota highlights the need for serotype prevalence monitoring to detect trends that could affect prevention strategies.

  16. Two Boys with 47, XXY and Autism

    ERIC Educational Resources Information Center

    Merhar, S. L.; Manning-Courtney, P.

    2007-01-01

    Two children with autism and Klinefelter syndrome (KS) (47, XXY) are presented. Both qualify for the diagnosis of autism based on DSM-IV with severely delayed and disordered language, difficulties with social interaction, and a restricted range of interests and activities. Both also have abnormal EEGs, and one patient has had what appear to be…

  17. Anthrax

    DTIC Science & Technology

    2009-01-01

    antimicrobials listed below) Initial therapye (intravenous dosing) Oral dosing Initial therapy (intravenous) IV treatment initially Switch to oral...high index of suspicion for anthrax, initiation of therapy should not be delayed for results of these confirmatory tests. 1. MICROBIOLOGICAL TESTS...Sputum specimens from inhalational anthrax patients should be plated on chocolate agar, SBA, and MAC. Cultures will show isolated B. anthracis

  18. Successful grafting in poplar species (Populus spp.) breeding

    Treesearch

    A. Assibi Mahama; Brian Sparks; Ronald S., Zalesny; Richard B. Hall

    2006-01-01

    Poor rooting of Populus deltoides Bartr. ex Marsh hardwood cuttings often has contributed to delays in breeding progress as a result of failures of scion wood before and/or after pollination. Seventeen clones were used, and the study was conducted in the greenhouse to test an "intervenous feeding" (IV) method, along with three different...

  19. Brief Report: Should Asperger Syndrome Be Excluded from the Forthcoming DSM-V?

    ERIC Educational Resources Information Center

    Kaland, Nils

    2011-01-01

    Asperger syndrome (AS) is a "pervasive developmental disorder," characterized by social impairments and focused, circumscribed interests and activities in the absence of significant language impairment and cognitive delay. Since its inclusion in the DSM-IV, there has been a dramatic increase in its recognition both in children and adults. Some…

  20. Negative symptoms in first episode non-affective psychosis.

    PubMed

    Malla, Ashok K; Takhar, Jatinder J; Norman, Ross M G; Manchanda, Rahul; Cortese, Leonard; Haricharan, Raj; Verdi, Mary; Ahmed, Rashid

    2002-06-01

    To determine the prevalence of negative symptoms and to examine secondary sources of influence on negative symptoms and the role of specific negative symptoms in delay associated with seeking treatment in first episode non-affective psychosis. One hundred and ten patients who met Diagnostic Statistical Manual-IV (DSM-IV) criteria for a first episode of schizophrenia spectrum psychoses were rated for assessment of negative, positive, depressive and extrapyramidal symptoms, the premorbid adjustment scale and assessment of demographic and clinical characteristics including duration of untreated psychosis (DUP). Alogia/flat affect and avolition/anhedonia were strongly influenced by parkinsonian and depressive symptoms, respectively. A substantial proportion (26.8%) of patients showed at a least moderate level of negative symptoms not confounded by depression and Parkinsonism. DUP was related only to avolition/anhedonia while flat affect/alogia was related to male gender, diagnosis of schizophrenia, age of onset and the length of the prodrome. Negative symptoms that are independent of the influence of positive symptoms, depression and extra pyramidal symptoms (EPS) are present in a substantial proportion of first episode psychosis patients and delay in seeking treatment is associated mainly with avolition and anhedonia.

  1. The effects of wearing Passenger Protective Breathing Equipment on evacuation times through type III and type IV emergency aircraft exits in clear air and smoke.

    DOT National Transportation Integrated Search

    1989-11-01

    The effects of Passenger Protective Breathing Equipment (PPBE) on the time required for simulated emergency evacuations through Type III and Type IV overwing aircraft exits were studied in two quasi-independent experiments, one in clear air and anoth...

  2. An Analysis of Type IV Precision Measurement Equipment Laboratory Logistical Support Relative to the Implementation of F-15/F-16 Two-Level Maintenance

    DTIC Science & Technology

    1994-09-01

    wife, Margie, for her patience and understanding. Graduate school definitely affects the family . Margie allowed me to use many valuable family hours...Consolidations and reorganizations, in which the face of logistics is changing day -by- day , are taking place throughout the Department of Defense. Two...will focus on Type IV F-15 and Type IV F-16 PMELs. Imporane of Research The two-level maintenance concept significantly alters the structure of

  3. Collagen IV Diseases: A Focus on the Glomerular Basement Membrane in Alport Syndrome

    PubMed Central

    Cosgrove, Dominic; Liu, Shiguang

    2016-01-01

    Alport syndrome is the result of mutations in any of three type IV collagen genes, COL4A3, COL4A4, or COL4A5. Because the three collagen chains form heterotrimers, there is an absence of all three proteins in the basement membranes where they are expressed. In the glomerulus, the mature glomerular basement membrane type IV collagen network, normally comprised of two separate networks, α3(IV)/α4(IV)/α5(IV) and α1(IV)/α2(IV), is comprised entirely of collagen α1(IV)/α2. This review addresses the current state of our knowledge regarding the consequence of this change in basement membrane composition, including both the direct, via collagen receptor binding, and indirect, regarding influences on glomerular biomechanics. The state of our current understanding regarding mechanisms of glomerular disease initiation and progression will be examined, as will the current state of the art regarding emergent therapeutic approaches to slow or arrest glomerular disease in Alport patients. PMID:27576055

  4. Initial Misdiagnosis of Proximal Pancreatic Adenocarcinoma Is Associated with Delay in Diagnosis and Advanced Stage at Presentation.

    PubMed

    Swords, Douglas S; Mone, Mary C; Zhang, Chong; Presson, Angela P; Mulvihill, Sean J; Scaife, Courtney L

    2015-10-01

    Delay in diagnosis of pancreatic ductal adenocarcinoma (PDAC) is associated with decreased survival. The effect of an initial misdiagnosis on delay in diagnosis and stage of PDAC is unknown. This study is a retrospective review (2000-2010) from a University-based cancer center of new diagnoses of proximal PDAC. Of 313 patients, 98 (31.3 %) had an initial misdiagnosis. Misdiagnosed patients were younger, 62.8 ± 12.6 vs. 68.0 ± 10.1 (p < 0.001). The most common initial misdiagnoses were: gallbladder disease, gastroesophageal reflux disease, and peptic ulcer disease. After excluding patients with prior cholecystectomy, 14.2 % were misdiagnosed with gallbladder disease and underwent cholecystectomy before PDAC diagnosis. Misdiagnosed patients had higher rates of abdominal pain (p < 0.001), weight loss (p = 0.04), and acute pancreatitis (p < 0.001) and lower rate of jaundice (p < 0.001). Median time between symptoms to PDAC diagnosis was longer in misdiagnosed: 4.2 months vs. 1.4 (p < 0.001). Median time from contact with medical provider to axial imaging was longer in misdiagnosed (p < 0.001). Rate of stages III-IV disease at diagnosis was higher in misdiagnosed: 61.2 vs. 43.7 % (p = 0.004), with a 1.4 (95 % confidence interval (CI), 1.12-1.74) higher risk of stages III-IV disease at diagnosis; however, there was no difference in median overall survival in misdiagnosed patients (9.6 months in misdiagnosed vs. 10.3 months in correctly diagnosed, p = 0.69). Initial misdiagnosis of patients with proximal PDAC is associated with delay in diagnosis and higher risk of locally advanced or advanced disease at time of PDAC diagnosis.

  5. Glomerular basement membrane injuries in IgA nephropathy evaluated by double immunostaining for α5(IV) and α2(IV) chains of type IV collagen and low-vacuum scanning electron microscopy.

    PubMed

    Masuda, Yukinari; Yamanaka, Nobuaki; Ishikawa, Arimi; Kataoka, Mitue; Arai, Takashi; Wakamatsu, Kyoko; Kuwahara, Naomi; Nagahama, Kiyotaka; Ichikawa, Kaori; Shimizu, Akira

    2015-06-01

    The glomerulus contains well-developed capillaries, which are at risk of injury due to high hydrostatic pressure, hyperfiltration, hypertension and inflammation. However, the pathological alterations of the injured glomerular basement membrane (GBM), the main component of the glomerular filtration barrier, are still uncertain in cases of glomerulonephritis. We examined the alterations of the GBM in 50 renal biopsy cases with IgA nephropathy (31.8 ± 17.6 years old) using double immunostaining for the α2(IV) and α5(IV) chains of type IV collagen, and examining the ultrastructural alterations by transmission electron microscopy (TEM) and low-vacuum scanning electron microscopy (LV-SEM). The GBM of IgA nephropathy cases showed various morphological and qualitative alterations. In the TEM findings, thinning, gaps, rupture, thickening with a lamellar and reticular structure and double contours were detected in the GBM. Double immunostaining for α5(IV) and α2(IV) showed thickening of the GBM with reduced α5(IV) and increased α2(IV), or mosaic images of α5(IV) and α2(IV), and holes, fractures, spiny projections and rupture of α5(IV) in the GBM. In addition, LV-SEM showed an etched image and multiple holes in a widening and wavy GBM. These findings might be associated with the development of a brittle GBM in IgA nephropathy. Glomerular basement membrane alterations were frequently noted in IgA nephropathy, and were easily evaluated by double immunostaining for α2(IV) and α5(IV) of type IV collagen and LV-SEM. The application of these analyses to human renal biopsy specimens may enhance our understanding of the alterations of the GBM that occur in human glomerular diseases.

  6. Genetics Home Reference: glycogen storage disease type IV

    MedlinePlus

    ... 000 to 800,000 individuals worldwide. Type IV accounts for roughly 3 percent of all cases of glycogen storage disease. Related Information What information about a genetic condition can statistics ...

  7. From Cholera to Burns: A Role for Oral Rehydration Therapy

    PubMed Central

    Green, W.B.; Asuku, M.E.; Feldman, M.; Makam, R.; Noppenberger, D.; Price, L.A.; Prosciak, M.; van Loon, I.N.

    2011-01-01

    According to the practice guidelines of the American Burn Association on burn shock resuscitation, intravenous (IV) fluid therapy is the standard of care for the replacement of fluid and electrolyte losses in burn injury of ≥20% of the total body surface area. However, in mass burn casualties, IV fluid resuscitation may be delayed or unavailable. Oral rehydration therapy (ORT), which has been shown to be highly effective in the treatment of dehydration in epidemics of cholera, could be an alternate way to replace fluid losses in burns. A prospective case series of three patients was carried out as an initial step to establish whether oral Ceralyte®90 could replace fluid losses requiring IV fluid therapy in thermal injury. The requirement of the continuing IV fluid therapy was reduced by an average of 58% in the first 24 hours after the injury (range 37-78%). ORT may be a feasible alternative to IV fluid therapy in the resuscitation of burns. It could also potentially save many lives in mass casualty situations or in resource-poor settings where IV fluid therapy is not immediately available. Further studies are needed to assess the efficacy of this treatment and to determine whether the present formulations of ORT for cholera need modification. PMID:22283039

  8. Contact allergic gastritis: an underdiagnosed entity?

    PubMed Central

    Pföhler, Claudia; Körner, Rebecca; Vogt, Thomas; Müller, Cornelia S L

    2012-01-01

    Only a few cases of contact allergic gastritis in patients with nickel allergy have been reported. We report a case of probable contact-allergic gastritis in a 46-year-old woman. Clinical examination revealed lichenoid mucosal lesions of the gums adjacent to bridges and crowns that had been implanted several weeks back. Since implantation, the patient had suffered from gastrointestinal complaints (including stomach pain). Gastroscopy showed eosinophilic gastritis. Patch testing done under the diagnosis of contact allergic stomatitis showed positive reactions to: gold sodium thiosulphate; manganese (II) chloride; nickel (II) sulphate; palladium chloride; vanadium (III) chloride and zirconium (IV) chloride. The crowns and bridge contained gold, palladium and zirconium chloride, hence they were replaced by titan-based dentition. Shortly after replacing the artificial dentition, all gastrointestinal symptoms resolved spontaneously without further treatment. Delayed-type allergy against the components of artificial dentition seemed to be the cause of gastritis. PMID:23192576

  9. Systemic drug-related intertriginous and flexural exanthema (SDRIFE).

    PubMed

    Elmariah, Sarina B; Cheung, Wang; Wang, Nadia; Kamino, Hideko; Pomeranz, Miriam K

    2009-08-15

    A 72-year-old man with a history of metastatic melanoma presented with a two-day history of erythematous and edematous plaques, with scattered bullae on the neck, chest, axillae, and inguinal and gluteal folds, which began five days after infusion of an experimental drug. The clinical and histopathologic findings were consistent with systemic drug-related intertriginous and flexural exanthema (SDRIFE), which is an uncommon drug reaction that results in symmetric erythema that affects the buttocks, groin, and/or thighs as well other flexural folds. The clinical manifestations of SDRIFE are highly characteristic and include distinctive primary cutaneous lesions with a specific distribution and course; however, heterogeneity exists with respect to histopathologic features, skin test results, and in vitro investigations. The exact mechanism of SDRIFE remains unknown but is thought to result from a type IV delayed hypersensitivity immune response. Treatment is symptomatic and includes topical or oral glucocorticoids.

  10. Severe facial swelling in a pregnant woman after using hair dye.

    PubMed

    van Genderen, Michel E; Carels, Ginette; Lonnee, Edward R; Dees, Adriaan

    2014-03-31

    A 33-year-old Caucasian pregnant woman (26 weeks' gestation) presented to the emergency department. She had a 2-day history of severe itching of the scalp and steadily worsening swelling of the face over the previous 12 h, which had extended to the neck. She had no difficulty breathing. The itching and swelling had developed 3 days after she had used hair dye. The patient had no history of allergic responses to hair dye or black henna tattoos. A diagnosis of type IV delayed hypersensitivity reaction was made. Permanent hair dyes are the most frequently used professional hair dyes and are most commonly based on paraphenylenediamine (PPD) or related chemicals. PPD is known to be one of the most potent allergens which cause allergic contact dermatitis. After treatment with intravenous antihistamines and steroids, the facial swelling reduced and the patient had completely recovered by the following day.

  11. Type 4 pili are dispensable for biofilm development in the cyanobacterium Synechococcus elongatus.

    PubMed

    Nagar, Elad; Zilberman, Shaul; Sendersky, Eleonora; Simkovsky, Ryan; Shimoni, Eyal; Gershtein, Diana; Herzberg, Moshe; Golden, Susan S; Schwarz, Rakefet

    2017-07-01

    The hair-like cell appendages denoted as type IV pili are crucial for biofilm formation in diverse eubacteria. The protein complex responsible for type IV pilus assembly is homologous with the type II protein secretion complex. In the cyanobacterium Synechococcus elongatus PCC 7942, the gene Synpcc7942_2071 encodes an ATPase homologue of type II/type IV systems. Here, we report that inactivation of Synpcc7942_2071 strongly affected the suite of proteins present in the extracellular milieu (exo-proteome) and eliminated pili observable by electron microscopy. These results support a role for this gene product in protein secretion as well as in pili formation. As we previously reported, inactivation of Synpcc7942_2071 enables biofilm formation and suppresses the planktonic growth of S. elongatus. Thus, pili are dispensable for biofilm development in this cyanobacterium, in contrast to their biofilm-promoting function in type IV pili-producing heterotrophic bacteria. Nevertheless, pili removal is not required for biofilm formation as evident by a piliated mutant of S. elongatus that develops biofilms. We show that adhesion and timing of biofilm development differ between the piliated and non-piliated strains. The study demonstrates key differences in the process of biofilm formation between cyanobacteria and well-studied type IV pili-producing heterotrophic bacteria. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  12. The lymphoscintigraphic manifestation of (99m)Tc-dextran lymphatic imaging in primary intestinal lymphangiectasia.

    PubMed

    Wen, Zhe; Tong, Guansheng; Liu, Yong; Meeks, Jacqui K; Ma, Daqing; Yang, Jigang

    2014-05-01

    The aim of this study was to analyze the imaging characteristics of (99m)Tc-dextran ((99m)Tc-DX) lymphatic imaging in the diagnosis of primary intestinal lymphangiectasia (PIL). Forty-one PIL patients were diagnosed as having PIL with the diagnosis being subsequently confirmed by laparotomy, endoscopy, biopsy, or capsule colonoscopy. Nineteen patients were male and 22 were female. A whole-body (99m)Tc-DX scan was performed at 10 min, 1 h, 3 h, and 6 h intervals after injection. The 10 min and 1 h postinjection intervals were considered the early phase, the 3 h postinjection interval was considered the middle phase, and the 6 h postinjection interval was considered the delayed phase. The imaging characteristics of (99m)Tc-DX lymphatic imaging in PIL were of five different types: (i) presence of dynamic radioactivity in the intestine, associated with radioactivity moving from the small intestine to the ascending and transverse colon; (ii) presence of delayed dynamic radioactivity in the intestine, no radioactivity or little radioactivity distributing in the intestine in the early phase, or significant radioactivity distributing in the intestine in the delayed phase; (iii) radioactivity distributing in the intestine and abdominal cavity; (iv) radioactivity distributing only in the abdominal cavity with no radioactivity in the intestines; and (v) no radioactivity distributing in the intestine and abdominal activity. (99m)Tc-DX lymphatic imaging in PIL showed different imaging characteristics. Caution should be exercised in the diagnosis of PIL using lymphoscintigraphy. Lymphoscintigraphy is a safe and accurate examination method and is a significant diagnostic tool in the diagnosis of PIL.

  13. Poor adherence to treatment associated with a high recurrence in a bipolar disorder outpatient sample.

    PubMed

    Gutiérrez-Rojas, Luis; Jurado, Dolores; Martínez-Ortega, José María; Gurpegui, Manuel

    2010-12-01

    We analyzed the association of previous course-of-illness and other variables of clinical interest with a high frequency of both depressive or (hypo)manic episodes controlling for the effect of socio-demographic characteristics. A total of 108 outpatients with a DSM-IV diagnosis of bipolar disorder (BD) were recruited. A retrospective and naturalistic study was conducted to examine the number of affective episodes and their relationship with socio-demographic, clinical and course-of-illness variables, including adherence to medication, type of medication used and the use of addictive substances. The episode frequency was estimated as the number of "major instances" of depression, hypomania and mania during the illness. To classify the patients into two groups (higher and lower-episode frequency), we used the statistical criterion of median split. Results were analyzed with logistic regression models to control for the effects of potential confounders. A high episode frequency (nine or more episodes) was associated with age (36-55years), delay in diagnosis, poor adherence to medication and current use of antipsychotic medication. In addition, a high frequency of manic episodes (four or more) was associated with female sex, age (>36years) and a manic onset of the illness, whereas a high frequency of depressive episodes (five or more) was associated with delay in diagnosis and poor adherence to medication. Cross-sectional study design. Avoiding delay in diagnosis and enhancing treatment adherence might be important targets for reducing recurrences in BD. Copyright © 2010 Elsevier B.V. All rights reserved.

  14. 10 CFR Appendix IV to Part 960 - Types of Information for the Nomination of Sites as Suitable for Characterization

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Types of Information for the Nomination of Sites as Suitable for Characterization IV Appendix IV to Part 960 Energy DEPARTMENT OF ENERGY GENERAL GUIDELINES FOR..., diapirism, tilting, subsidence, faulting, and volcanism. • Estimate of the geothermal gradient. • Estimate...

  15. Delays in the diagnosis of oesophagogastric cancer: a consecutive case series.

    PubMed Central

    Martin, I. G.; Young, S.; Sue-Ling, H.; Johnston, D.

    1997-01-01

    OBJECTIVES: To examine the time taken to diagnose oesophageal or gastric cancer, identify the source of delay, and assess its clinical importance. DESIGN: Study of all new patients presenting to one surgical unit with carcinoma of the oesophagus or stomach. SETTING: University department of surgery in a large teaching hospital. SUBJECTS: 115 consecutive patients (70 men, mean age 66 years) with carcinoma of the oesophagus (27) or stomach (88). MAIN OUTCOME MEASURES: Interval from the onset of symptoms to histological diagnosis, final pathological stage of the tumour, and whether potentially curative resection was possible. RESULTS: The median delay from first symptoms to histological diagnosis was 17 weeks (range 1 to 168 weeks). 25% (29/115) of patients had a delay of over 28 weeks (median 39 weeks). Total delay was made up of the following components: delay in consulting a doctor (29%), delay in referral (23%), delay in being seen at hospital (16%), and delay in establishing the diagnosis at the hospital (32%). No relation was found between delay in diagnosis and tumour stage in patients with gastric cancer, but for oesophageal cancer those with stage I and II disease were diagnosed within 7 weeks compared with 21 weeks (P < 0.02) for those with stage III and IV disease. CONCLUSIONS: Long delays still occur in the diagnosis of patients with cancer of the stomach or oesophagus. Streamlined referral and investigation pathways are needed if patients with gastric and oesophageal carcinomas are to be diagnosed early in the course of the disease. PMID:9056794

  16. The DSS-14 C-band exciter

    NASA Technical Reports Server (NTRS)

    Rowan, D. R.

    1989-01-01

    The development and implementation of a C-band exciter for use with the Block IV Receiver-Exciter Subsystem at Deep Space Station 14 (DSS-14) has been completed. The exciter supplements the standard capabilities of the Block IV system by providing a drive signal for the C-band transmitter while generating coherent translation frequencies for C-band (5-GHz) to S-band (2.2- to 2.3-GHz) Doppler extraction, C-band to L-band (1.6-GHz) zero delay measurements, and a level calibrated L-band test signal. Exciter functions are described, and a general explanation and description of the C-band uplink controller is presented.

  17. APF530 versus ondansetron, each in a guideline-recommended three-drug regimen, for the prevention of chemotherapy-induced nausea and vomiting due to anthracycline plus cyclophosphamide–based highly emetogenic chemotherapy regimens: a post hoc subgroup analysis of the Phase III randomized MAGIC trial

    PubMed Central

    Schnadig, Ian D; Agajanian, Richy; Dakhil, Christopher; Gabrail, Nashat; Vacirca, Jeffrey; Taylor, Charles; Wilks, Sharon; Braun, Eduardo; Mosier, Michael C; Geller, Robert B; Schwartzberg, Lee; Vogelzang, Nicholas

    2017-01-01

    Background APF530, a novel extended-release granisetron injection, was superior to ondansetron in a guideline-recommended three-drug regimen in preventing delayed-phase chemotherapy-induced nausea and vomiting (CINV) among patients receiving highly emetogenic chemotherapy (HEC) in the double-blind Phase III Modified Absorption of Granisetron In the prevention of CINV (MAGIC) trial. Patients and methods This MAGIC post hoc analysis evaluated CINV prevention efficacy and safety of APF530 versus ondansetron, each with fosaprepitant and dexamethasone, in patient subgroup receiving an anthracycline plus cyclophosphamide (AC) regimen. Patients were randomized 1:1 to APF530 500 mg subcutaneously (granisetron 10 mg) or ondansetron 0.15 mg/kg intravenously (IV) (≤16 mg); stratification was by planned cisplatin ≥50 mg/m2 (yes/no). Patients were to receive fosaprepitant 150 mg IV and dexamethasone 12 mg IV on day 1, then dexamethasone 8 mg orally once daily on day 2 and twice daily on days 3 and 4. Patients were mostly younger females (APF530 arm, mean age 54.1 years, female, 99.3%; ondansetron arm, 53.8 years, female 98.3%). The primary end point was delayed-phase (>24–120 hours) complete response (CR). Results APF530 versus ondansetron regimens achieved numerically better CINV control in delayed and overall (0–120 hours) phases for CR, complete control, total response, rescue medication use, and proportion with no nausea. APF530 trends are consistent with the overall population, although not statistically superior given the underpowered AC subgroup analysis. The APF530 regimen in this population was generally well tolerated, with safety comparable to that of the overall population. Conclusion APF530 plus fosaprepitant and dexamethasone effectively prevented CINV among patients receiving AC-based HEC, a large subgroup in whom CINV control has traditionally been challenging. PMID:28579832

  18. Delayed replantation of rat teeth after use of reconstituted powdered milk as a storage medium.

    PubMed

    dos Santos, Cláudia Letícia Vendrame; Sonoda, Celso Koogi; Poi, Wilson Roberto; Panzarini, Sônia Regina; Sundefeld, Maria Lúcia Marçal Mazza; Negri, Márcia Regina

    2009-02-01

    Minimal extraoral dry storage period and moist storage for the avulsed tooth are identified as key steps for the treatment protocol of tooth replantation. Among the possible moist storage media, bovine milk has stood out because of its capacity of preserving the integrity of the periodontal ligament (PDL) fibers. This condition has attracted the attention to investigate the use of powdered milk, which is one of the presentation forms of bovine milk, as a feasible storage medium in cases of delayed tooth replantation. The aim of this study was to evaluate the healing process after delayed replantation of rat teeth stored in reconstituted powdered milk and long shelf-life (ultra high temperature) whole milk. Forty maxillary right rat incisors were assigned to four groups (n = 10): group I--the teeth were extracted and immediately replanted into theirs sockets; group II--the teeth were stored for 60 min in 200 ml of freshly reconstituted powdered milk; group III--the teeth were stored for 60 min in 200 ml of long shelf-life whole milk; group IV--the teeth were kept dry for the same time. All procedures were performed at room temperature. Next, the root canals of teeth in groups II, III, and IV were instrumented, filled with a calcium hydroxide-based paste, and replanted into their sockets. All animals received systemic antibiotic therapy and were killed by anesthetic overdose 60 days after replantation. The pieces containing the replanted teeth were removed, fixed, decalcified, and paraffin-embedded. Semi-serial 6-microm-thick sections were obtained and stained with hematoxylin and eosin for histomorphological analysis. There was statistically significant difference (P < 0.05) between groups I and IV regarding the presence of replacement resorption and PDL remnants on root surface. The powdered milk and long shelf-life whole milk presented similar results to each other and may be indicated as storage media for avulsed teeth.

  19. Gambling, Delay, and Probability Discounting in Adults With and Without ADHD.

    PubMed

    Dai, Zhijie; Harrow, Sarah-Eve; Song, Xianwen; Rucklidge, Julia J; Grace, Randolph C

    2016-11-01

    We investigated the relationship between impulsivity, as measured by delay and probability discounting, and gambling-related cognitions and behavior in adults with and without ADHD. Adults who met Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV) diagnostic criteria for ADHD (n = 31) and controls (n = 29) were recruited from the community. All completed an interview that included an assessment of psychiatric disorders, gambling questionnaires, and simulated gambling, delay, and probability discounting tasks. The ADHD group was more likely to meet the criteria for problem gambling and was more impulsive than controls based on a composite discounting measure. ADHD symptoms were correlated with gambling-related cognitions and behavior. Probability, but not delay discounting, explained significant variance in gambling-related measures after controlling for ADHD symptoms. Results confirm an association between adult ADHD and gambling, and suggest that the facets of impulsivity related to risk proneness may be an independent risk factor for problem gambling in this population. © The Author(s) 2013.

  20. Very low density lipoprotein triglyceride transport in type IV hyperlipoproteinemia and the effects of carbohydrate-rich diets.

    PubMed

    Quarfordt, S H; Frank, A; Shames, D M; Berman, M; Steinberg, D

    1970-12-01

    Transport of plasma-free fatty acids (FFA) and of fatty acids in triglycerides of plasma very low density lipoproteins (VLDL-TGFA) was studied in two normal subjects, five patients with type IV hyperlipoproteinemia, and two patients with type I hyperlipoproteinemia. After intravenous pulse-labeling with albumin-bound 1-palmitate-(14)C, specific radioactivity of plasma FFA and VLDL-TGFA were determined at intervals up to 24 hr. The results were analyzed using several different multicompartmental models each compatible with the experimental data. Fractional transport of VLDL-TGFA was distinctly lower (no overlap) in the type IV patients than in the control subjects, both on a usual balanced diet (40% of calories from carbohydrate) and on a high-carbohydrate diet (80% of calories). However, net or total transport of VLDL-TGFA in the type IV patients was not clearly distinguishable from that in the control subjects, there being considerable overlap on either diet. The results suggest that in this group of type IV patients the underlying defect leading to the increased pool size of VLDL-TGFA is not overproduction but a relative defect in mechanisms for removal of VLDL-TGFA. Since some of these type IV patients had only a moderate degree of hypertriglyceridemia at the time they were studied, and since it is not established that patients with the type IV phenotype constitute a biochemically homogeneous population, the present results should not be generalized. Four studies were done (in two control subjects and two type IV patients) in which the kinetic parameters in the same individual were determined on the balanced diet and on the high-carbohydrate diet. All subjects showed an increase in VLDL-TGFA pool size. Using two of the models for analysis, all showed an increase in net transport of VLDL-TGFA; using the third model, three of the four studies showed an increase in VLDL-TGFA transport. The results are compatible with the interpretation that the carbohydrate-induced increase in VLDL-TGFA, both in controls and type IV patients, is at least in part due to an increased rate of production of VLDL-TGFA. The magnitude of the increase was approximately the same in controls and patients. Thus, metabolic adjustment to a high-carbohydrate regimen in these type IV patients may not be basically different from that in normal controls; the higher levels of VLDL-TGFA reached may simply be another reflection of a defective removal mechanism. An alternative interpretation, compatible with the data, would involve both a carbohydrate-induced increase in fractional rate of release of VLDL-TGFA from liver to plasma and a decrease in fractional removal of VLDL-TGFA from plasma without increase in net production rate. The simpler hypothesis of a single primary effect on net VLDL-TGFA production from FFA seems more likely.

  1. Alport Syndrome Diagnosis

    MedlinePlus

    ... the presence or absence of the type IV collagen alpha-3, alpha-4 and alpha-5 chains ( ... linked Alport syndrome) is suspected. The type IV collagen alpha-5 chain (COL4A5) is normally present in ...

  2. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE PAGES

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui; ...

    2017-09-07

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  3. Enhanced 99Tc retention in glass waste form using Tc(IV)-incorporated Fe minerals

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Um, Wooyong; Luksic, Steven A.; Wang, Guohui

    We present that technetium ( 99Tc) immobilization by doping into iron oxide mineral phases may alleviate the problems with Tc volatility during vitrification of nuclear waste. Because reduced Tc, Tc(IV), substitutes for Fe(III) in the crystal structure by a process of Tc reduction from Tc(VII) to Tc(IV) followed by co-precipitation of Fe oxide minerals, two Tc-incorporated Fe minerals (Tc-goethite and Tc-magnetite/maghemite) were prepared and tested for Tc retention in glass melt samples at temperatures between 600 and 1000 °C. After being cooled, the solid glass specimens prepared at different temperatures at 600, 800, and 1000 °C were analyzed for Tcmore » oxidation state using Tc K-edge XANES. In most samples, Tc was partially (<60%) oxidized from Tc(IV) to Tc(VII) as the melt temperature increased up to 600 °C. However, most of Tc(IV) was completely (>95%) oxidized to Tc(VII) at temperature above 800 °C. Tc retention in glass melt samples prepared using Tc-incorporated Fe minerals were slightly higher (~10%) than in glass prepared using KTcO4 because of limited and delayed Tc volatilization.« less

  4. Importance of cell damage causing growth delay for high pressure inactivation of Saccharomyces cerevisiae

    NASA Astrophysics Data System (ADS)

    Nanba, Masaru; Nomura, Kazuki; Nasuhara, Yusuke; Hayashi, Manabu; Kido, Miyuki; Hayashi, Mayumi; Iguchi, Akinori; Shigematsu, Toru; Hirayama, Masao; Ueno, Shigeaki; Fujii, Tomoyuki

    2013-06-01

    A high pressure (HP) tolerant (barotolerant) mutant a2568D8 and a variably barotolerant mutant a1210H12 were generated from Saccharomyces cerevisiae using ultra-violet mutagenesis. The two mutants, a barosensitive mutant a924E1 and the wild-type strain, were pressurized (225 MPa), and pressure inactivation behavior was analyzed. In the wild-type strain, a proportion of the growth-delayed cells were detected after exposure to HP. In a924E1, the proportion of growth-delayed cells significantly decreased compared with the wild-type. In a2568D8, the proportion of growth-delayed cells increased and the proportion of inactivated cells decreased compared with the wild-type. In a1210H12, the growth-delayed cells could not be detected within 120 s of exposure to HP. The proportion of growth-delayed cells, which incurred the damage, would affect the survival ratio by HP. These results suggested that cellular changes in barotolerance caused by mutations are remarkably affected by the ability to recover from cellular damage, which results in a growth delay.

  5. Urinary type IV collagen excretion predicts subsequent declining renal function in type 2 diabetic patients with proteinuria.

    PubMed

    Katavetin, Pisut; Katavetin, Paravee; Susantitaphong, Paweena; Townamchai, Natavudh; Tiranathanagul, Khajohn; Tungsanga, Kriang; Eiam-Ong, Somchai

    2010-08-01

    Baseline urinary type IV collagen excretion was negatively correlated with the subsequent GFR change (r(s)=-0.39, p=0.04) in our cohort of 30 type 2 diabetic patients with proteinuria. Therefore, it could be used to predict subsequent declining renal function in type 2 diabetic patients with proteinuria. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  6. Functional conversion between A-type and delayed rectifier K+ channels by membrane lipids.

    PubMed

    Oliver, Dominik; Lien, Cheng-Chang; Soom, Malle; Baukrowitz, Thomas; Jonas, Peter; Fakler, Bernd

    2004-04-09

    Voltage-gated potassium (Kv) channels control action potential repolarization, interspike membrane potential, and action potential frequency in excitable cells. It is thought that the combinatorial association between distinct alpha and beta subunits determines whether Kv channels function as non-inactivating delayed rectifiers or as rapidly inactivating A-type channels. We show that membrane lipids can convert A-type channels into delayed rectifiers and vice versa. Phosphoinositides remove N-type inactivation from A-type channels by immobilizing the inactivation domains. Conversely, arachidonic acid and its amide anandamide endow delayed rectifiers with rapid voltage-dependent inactivation. The bidirectional control of Kv channel gating by lipids may provide a mechanism for the dynamic regulation of electrical signaling in the nervous system.

  7. Two type IV pili of Vibrio parahaemolyticus play different roles in biofilm formation.

    PubMed

    Shime-Hattori, Akiko; Iida, Tetsuya; Arita, Michiko; Park, Kwon-Sam; Kodama, Toshio; Honda, Takeshi

    2006-11-01

    Vibrio parahaemolyticus RIMD2210633 has two sets of type IV-A pilus genes. One set is similar to that found in other Gram-negative bacteria, such as Pseudomonas aeruginosa, Vibrio cholerae (chitin-regulated pilus; ChiRP), and Vibrio vulnificus. The other is homologous to the genes for the mannose-sensitive hemagglutinin (MSHA) pilus. In this study, we analyzed the effects of the deletions in the pilin genes for each type IV pilus (the ChiRP and the MSHA pilus) on biofilm formation. Although the MSHA pilin mutant formed aggregates, the number of bacteria that attached directly to the coverslip was reduced, suggesting that this pilus contributes to the bacterial attachment to the surface of the coverslip. In contrast, the ChiRP mutant attached to the surface of the coverslip, but did not form aggregates, suggesting that ChiRP plays a role in bacterial agglutination during biofilm formation. These results suggest that the two type IV pili of V. parahaemolyticus contribute to biofilm formation in different ways. Both mutants showed a lower fitness for adsorption onto chitin particles than that of the wild type. Collectively, these data suggest that the use of two type IV pili is a refined strategy of V. parahaemolyticus for survival in natural environments.

  8. A Split-Luciferase-Based Trimer Formation Assay as a High-throughput Screening Platform for Therapeutics in Alport Syndrome.

    PubMed

    Omachi, Kohei; Kamura, Misato; Teramoto, Keisuke; Kojima, Haruka; Yokota, Tsubasa; Kaseda, Shota; Kuwazuru, Jun; Fukuda, Ryosuke; Koyama, Kosuke; Matsuyama, Shingo; Motomura, Keishi; Shuto, Tsuyoshi; Suico, Mary Ann; Kai, Hirofumi

    2018-05-17

    Alport syndrome is a hereditary glomerular disease caused by mutation in type IV collagen α3-α5 chains (α3-α5(IV)), which disrupts trimerization, leading to glomerular basement membrane degeneration. Correcting the trimerization of α3/α4/α5 chain is a feasible therapeutic approach, but is hindered by lack of information on the regulation of intracellular α(IV) chain and the absence of high-throughput screening (HTS) platforms to assess α345(IV) trimer formation. Here, we developed sets of split NanoLuc-fusion α345(IV) proteins to monitor α345(IV) trimerization of wild-type and clinically associated mutant α5(IV). The α345(IV) trimer assay, which satisfied the acceptance criteria for HTS, enabled the characterization of intracellular- and secretion-dependent defects of mutant α5(IV). Small interfering RNA-based and chemical screening targeting the ER identified several chemical chaperones that have potential to promote α345(IV) trimer formation. This split luciferase-based trimer formation assay is a functional HTS platform that realizes the feasibility of targeting α345(IV) trimers to treat Alport syndrome. Copyright © 2018 Elsevier Ltd. All rights reserved.

  9. Diversity, assembly and regulation of archaeal type IV pili-like and non-type-IV pili-like surface structures.

    PubMed

    Lassak, Kerstin; Ghosh, Abhrajyoti; Albers, Sonja-Verena

    2012-01-01

    Archaea have evolved fascinating surface structures allowing rapid adaptation to changing environments. The archaeal surface appendages display such diverse biological roles as motility, adhesion, biofilm formation, exchange of genetic material and species-specific interactions and, in turn, increase fitness of the cells. Intriguingly, despite sharing the same functions with their bacterial counterparts, the assembly mechanism of many archaeal surface structures is rather related to assembly of bacterial type IV pili. This review summarizes our state-of-the-art knowledge about unique structural and biochemical properties of archaeal surface appendages with a particular focus on archaeal type IV pili-like structures. The latter comprise not only widely distributed archaella (formerly known as archaeal flagella), but also different highly specialized archaeal pili, which are often restricted to certain species. Recent findings regarding assembly mechanisms, structural aspects and physiological roles of these type IV pili-like structures will be discussed in detail. Recently, first regulatory proteins involved in transition from both planktonic to sessile lifestyle and in assembly of archaella were identified. To conclude, we provide novel insights into regulatory mechanisms underlying the assembly of archaeal surface structures. Copyright © 2012. Published by Elsevier Masson SAS.

  10. Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1

    PubMed Central

    Xiao, Qian; Jiang, Yan; Liu, Qingbo; Yue, Jiao; Liu, Chunying; Zhao, Xiaotong; Qiao, Yuemei; Ji, Hongbin; Chen, Jianfeng; Ge, Gaoxiang

    2015-01-01

    Type IV collagens (Col IV), components of basement membrane, are essential in the maintenance of tissue integrity and proper function. Alteration of Col IV is related to developmental defects and diseases, including cancer. Col IV α chains form α1α1α2, α3α4α5 and α5α5α6 protomers that further form collagen networks. Despite knowledge on the functions of major Col IV (α1α1α2), little is known whether minor Col IV (α3α4α5 and α5α5α6) plays a role in cancer. It also remains to be elucidated whether major and minor Col IV are functionally redundant. We show that minor Col IV α5 chain is indispensable in cancer development by using α5(IV)-deficient mouse model. Ablation of α5(IV) significantly impeded the development of KrasG12D-driven lung cancer without affecting major Col IV expression. Epithelial α5(IV) supports cancer cell proliferation, while endothelial α5(IV) is essential for efficient tumor angiogenesis. α5(IV), but not α1(IV), ablation impaired expression of non-integrin collagen receptor discoidin domain receptor-1 (DDR1) and downstream ERK activation in lung cancer cells and endothelial cells. Knockdown of DDR1 in lung cancer cells and endothelial cells phenocopied the cells deficient of α5(IV). Constitutively active DDR1 or MEK1 rescued the defects of α5(IV)-ablated cells. Thus, minor Col IV α5(IV) chain supports lung cancer progression via DDR1-mediated cancer cell autonomous and non-autonomous mechanisms. Minor Col IV can not be functionally compensated by abundant major Col IV. PMID:25992553

  11. Root canal morphology of South Asian Indian maxillary molar teeth

    PubMed Central

    Singh, Shishir; Pawar, Mansing

    2015-01-01

    Objective: The objective was to study the root canal morphology of South Asian Indian Maxillary molars using a tooth clearing technique. Materials and Methods: Hundred teeth each comprising of first, second, and third molars collected from different dental schools and clinics in India were subjected to standard dye penetration, decalcification and clearing procedure before being studied. Results: The first molar mesiobuccal roots exhibited 69% Type I, 24% Type II, 4% Type IV, 2% Type V, and 1% exhibited a Vertuccis Type VIII canal anatomy. In the group with three separate roots the second molar mesiobuccal roots in exhibited 80.6% Type I, 15.3% Type II, 2.7% Type IV, and 1.4% Type V canal anatomy while the third molars mesiobuccal roots exhibited 57.4% Type I, 32% Type II, 2.1% Type III, 8.5% Type IV, 1% had a Type V canal anatomy in the similar group. Conclusion: A varied root canal anatomy was seen in the mesiobuccal root canal of the maxillary molars. PMID:25713497

  12. Reducing Door-to-Needle Times using Toyota’s Lean Manufacturing Principles and Value Stream Analysis

    PubMed Central

    Ford, Andria L.; Williams, Jennifer A.; Spencer, Mary; McCammon, Craig; Khoury, Naim; Sampson, Tomoko; Panagos, Peter; Lee, Jin-Moo

    2012-01-01

    Background Earlier tPA treatment for acute ischemic stroke increases efficacy, prompting national efforts to reduce door-to-needle times (DNTs). We utilized lean process improvement methodology to develop a streamlined IV tPA protocol. Methods In early 2011, a multi-disciplinary team analyzed the steps required to treat acute ischemic stroke patients with IV tPA, utilizing value stream analysis (VSA). We directly compared the tPA-treated patients in the “pre-VSA” epoch to the “post-VSA” epoch with regard to baseline characteristics, protocol metrics, and clinical outcomes. Results The VSA revealed several tPA protocol inefficiencies: routing of patients to room, then to CT, then back to room; serial processing of work flow; and delays in waiting for lab results. On 3/1/2011, a new protocol incorporated changes to minimize delays: routing patients directly to head CT prior to patient room, utilizing parallel process work-flow, and implementing point-of-care labs. In the pre-and post-VSA epochs, 132 and 87 patients were treated with IV tPA, respectively. Compared to pre-VSA, DNTs and percent of patients treated ≤60 minutes from hospital arrival were improved in the post-VSA epoch: 60 min vs. 39 min (p<0.0001) and 52% vs. 78% (p<0.0001), respectively, with no change in symptomatic hemorrhage rate. Conclusions Lean process improvement methodology can expedite time-dependent stroke care, without compromising safety. PMID:23138440

  13. Long-lived efficient delayed fluorescence organic light-emitting diodes using n-type hosts.

    PubMed

    Cui, Lin-Song; Ruan, Shi-Bin; Bencheikh, Fatima; Nagata, Ryo; Zhang, Lei; Inada, Ko; Nakanotani, Hajime; Liao, Liang-Sheng; Adachi, Chihaya

    2017-12-21

    Organic light-emitting diodes have become a mainstream display technology because of their desirable features. Third-generation electroluminescent devices that emit light through a mechanism called thermally activated delayed fluorescence are currently garnering much attention. However, unsatisfactory device stability is still an unresolved issue in this field. Here we demonstrate that electron-transporting n-type hosts, which typically include an acceptor moiety in their chemical structure, have the intrinsic ability to balance the charge fluxes and broaden the recombination zone in delayed fluorescence organic electroluminescent devices, while at the same time preventing the formation of high-energy excitons. The n-type hosts lengthen the lifetimes of green and blue delayed fluorescence devices by > 30 and 1000 times, respectively. Our results indicate that n-type hosts are suitable to realize stable delayed fluorescence organic electroluminescent devices.

  14. How and Why to Do VLBI on GPS

    NASA Technical Reports Server (NTRS)

    Dickey, J. M.

    2010-01-01

    In order to establish the position of the center of mass of the Earth in the International Celestial Reference Frame, observations of the Global Positioning Satellite (GPS) constellation using the IVS network are important. With a good frame-tie between the coordinates of the IVS telescopes and nearby GPS receivers, plus a common local oscillator reference signal, it should be possible to observe and record simultaneously signals from the astrometric calibration sources and the GPS satellites. The standard IVS solution would give the atmospheric delay and clock offsets to use in analysis of the GPS data. Correlation of the GPS signals would then give accurate orbital parameters of the satellites in the ICRF reference frame, i.e., relative to the positions of the astrometric sources. This is particularly needed to determine motion of the center of mass of the earth along the rotation axis.

  15. Alport syndrome: a unified classification of genetic disorders of collagen IV α345: a position paper of the Alport Syndrome Classification Working Group.

    PubMed

    Kashtan, Clifford E; Ding, Jie; Garosi, Guido; Heidet, Laurence; Massella, Laura; Nakanishi, Koichi; Nozu, Kandai; Renieri, Alessandra; Rheault, Michelle; Wang, Fang; Gross, Oliver

    2018-05-01

    Mutations in the genes COL4A3, COL4A4, and COL4A5 affect the synthesis, assembly, deposition, or function of the collagen IV α345 molecule, the major collagenous constituent of the mature mammalian glomerular basement membrane. These mutations are associated with a spectrum of nephropathy, from microscopic hematuria to progressive renal disease leading to ESRD, and with extrarenal manifestations such as sensorineural deafness and ocular anomalies. The existing nomenclature for these conditions is confusing and can delay institution of appropriate nephroprotective therapy. Herein we propose a new classification of genetic disorders of the collagen IV α345 molecule with the goal of improving renal outcomes through regular monitoring and early treatment. Copyright © 2018 International Society of Nephrology. Published by Elsevier Inc. All rights reserved.

  16. User Delay Cost Model and Facilities Maintenance Cost Model for a Terminal Control Area : Volume 3. User's Manual and Program Documentation for the Facilities Maintenance Cost Model

    DOT National Transportation Integrated Search

    1978-05-01

    The Facilities Maintenance Cost Model (FMCM) is an analytic model designed to calculate expected annual labor costs of maintenance within a given FAA maintenance sector. The model is programmed in FORTRAN IV and has been demonstrated on the CDC Krono...

  17. Native structure of a type IV secretion system core complex essential for Legionella pathogenesis.

    PubMed

    Kubori, Tomoko; Koike, Masafumi; Bui, Xuan Thanh; Higaki, Saori; Aizawa, Shin-Ichi; Nagai, Hiroki

    2014-08-12

    Bacterial type IV secretion systems are evolutionarily related to conjugation systems and play a pivotal role in infection by delivering numerous virulence factors into host cells. Using transmission electron microscopy, we report the native molecular structure of the core complex of the Dot/Icm type IV secretion system encoded by Legionella pneumophila, an intracellular human pathogen. The biochemically isolated core complex, composed of at least five proteins--DotC, DotD, DotF, DotG, and DotH--has a ring-shaped structure. Intriguingly, morphologically distinct premature complexes are formed in the absence of DotG or DotF. Our data suggest that DotG forms a central channel spanning inner and outer membranes. DotF, a component dispensable for type IV secretion, plays a role in efficient embedment of DotG into the functional core complex. These results highlight a common scheme for the biogenesis of transport machinery.

  18. Polyvalent type IV sensitizations to multiple fragrances and a skin protection cream in a metal worker.

    PubMed

    Tanko, Zita; Shab, Arna; Diepgen, Thomas Ludwig; Weisshaar, Elke

    2009-06-01

    Fragrances are very common in everyday products. A metalworker with chronic hand eczema and previously diagnosed type IV sensitizations to epoxy resin, balsam of Peru, fragrance mix and fragrance mix II was diagnosed with additional type IV sensitizations to geraniol, hydroxycitronellal, lilial, tree moss, oak moss absolute, citral, citronellol, farnesol, Lyral, fragrance mix II and fragrance mix (with sorbitan sesquioleate). In addition, a type IV sensitization to the skin protection cream containing geraniol and citronellol used at the workplace was detected, and deemed occupationally relevant in this case. The patient could have had contact to fragrances through private use of cosmetics and detergents. On the other hand, the fragrance-containing skin protection cream supports occupational exposure. This case report demonstrates that fragrance contact allergy has to be searched for and clarified individually, which requires a thorough history and a detailed analysis of the work place.

  19. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli*

    PubMed Central

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-01-01

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. PMID:26324721

  20. Crystal Structure of the Minor Pilin CofB, the Initiator of CFA/III Pilus Assembly in Enterotoxigenic Escherichia coli.

    PubMed

    Kolappan, Subramania; Ng, Dixon; Yang, Guixiang; Harn, Tony; Craig, Lisa

    2015-10-23

    Type IV pili are extracellular polymers of the major pilin subunit. These subunits are held together in the pilus filament by hydrophobic interactions among their N-terminal α-helices, which also anchor the pilin subunits in the inner membrane prior to pilus assembly. Type IV pilus assembly involves a conserved group of proteins that span the envelope of Gram-negative bacteria. Among these is a set of minor pilins, so named because they share their hydrophobic N-terminal polymerization/membrane anchor segment with the major pilins but are much less abundant. Minor pilins influence pilus assembly and retraction, but their precise functions are not well defined. The Type IV pilus systems of enterotoxigenic Escherichia coli and Vibrio cholerae are among the simplest of Type IV pilus systems and possess only a single minor pilin. Here we show that the enterotoxigenic E. coli minor pilins CofB and LngB are required for assembly of their respective Type IV pili, CFA/III and Longus. Low levels of the minor pilins are optimal for pilus assembly, and CofB can be detected in the pilus fraction. We solved the 2.0 Å crystal structure of N-terminally truncated CofB, revealing a pilin-like protein with an extended C-terminal region composed of two discrete domains connected by flexible linkers. The C-terminal region is required for CofB to initiate pilus assembly. We propose a model for CofB-initiated pilus assembly with implications for understanding filament growth in more complex Type IV pilus systems as well as the related Type II secretion system. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Clinical validation of three short forms of the Dutch Wechsler Memory Scale-Fourth Edition (WMS-IV-NL) in a mixed clinical sample.

    PubMed

    Bouman, Zita; Hendriks, Marc P H; Van Der Veld, William M; Aldenkamp, Albert P; Kessels, Roy P C

    2016-06-01

    The reliability and validity of three short forms of the Dutch version of the Wechsler Memory Scale-Fourth Edition (WMS-IV-NL) were evaluated in a mixed clinical sample of 235 patients. The short forms were based on the WMS-IV Flexible Approach, that is, a 3-subtest combination (Older Adult Battery for Adults) and two 2-subtest combinations (Logical Memory and Visual Reproduction and Logical Memory and Designs), which can be used to estimate the Immediate, Delayed, Auditory and Visual Memory Indices. All short forms showed good reliability coefficients. As expected, for adults (16-69 years old) the 3-subtest short form was consistently more accurate (predictive accuracy ranged from 73% to 100%) than both 2-subtest short forms (range = 61%-80%). Furthermore, for older adults (65-90 years old), the predictive accuracy of the 2-subtest short form ranged from 75% to 100%. These results suggest that caution is warranted when using the WMS-IV-NL Flexible Approach short forms to estimate all four indices. © The Author(s) 2015.

  2. Comparison of Inner Ear Contrast Enhancement among Patients with Unilateral Inner Ear Symptoms in MR Images Obtained 10 Minutes and 4 Hours after Gadolinium Injection.

    PubMed

    Kim, T Y; Park, D W; Lee, Y J; Lee, J Y; Lee, S H; Chung, J H; Lee, S

    2015-12-01

    Recently 4-hour delayed-enhanced 3D-FLAIR MR imaging has been used in pathophysiologic analysis of the inner ear in many auditory diseases, including sudden sensorineural hearing loss, but comparison among different time points is not clear in patients with unilateral inner ear symptoms. We compared the signal-intensity ratios of the inner ears in patients with unilateral inner ear symptoms on 10-minute delayed-enhanced and 4-hour delayed-enhanced 3D-FLAIR MR images after IV gadolinium injection. The 10-minute delayed-enhanced and 4-hour delayed-enhanced 3D-FLAIR MR images were retrospectively analyzed. Signal-intensity ratios between the cerebellum and inner ear structures, such as the cochleae, vestibules, and vestibulocochlear nerve were assessed. Multiple comparisons were performed. Signal-intensity ratios of the affected cochleae, vestibules, and vestibulocochlear nerve were higher than those of unaffected sides in both 10-minute delayed-enhanced and 4-hour delayed-enhanced images. At the affected side, signal-intensity ratios of the vestibulocochlear nerve were higher in patients with nonsudden sensorineural hearing loss than in those with sudden sensorineural hearing loss on both 10-minute delayed-enhanced and 4-hour delayed-enhanced images. The signal-intensity ratios of some affected inner ear structures were higher than those of the unaffected sides in a group of 30 patients with sudden sensorineural hearing loss and 20 patients with nonsudden sensorineural hearing loss on 10-minute delayed-enhanced and 4-hour delayed-enhanced images. Signal-intensity ratios of the inner ear show statistically significant increases in many diseases, especially neuritis, in 10-minute delayed-enhanced and 4-hour delayed-enhanced images. The 4-hour delayed-enhanced images may be superior in neural inflammatory-dominant conditions, while 10-minute delayed-enhanced images may be superior in neural noninflammatory-dominant conditions. © 2015 by American Journal of Neuroradiology.

  3. Individual Differences in Discount Rate Are Associated With Demand for Self-Administered Cocaine, But Not Sucrose

    PubMed Central

    Koffarnus, Mikhail N.; Woods, James H.

    2011-01-01

    Substance abusers, including cocaine abusers, discount delayed rewards to a greater extent than do matched controls. In the current experiment, individual differences in discounting of delayed rewards in rats (choice of one immediate over three delayed sucrose pellets) were assessed for associations with demand for either sucrose pellets or an i.v. dose of 0.1 mg/kg/infusion cocaine. Twenty-four male Sprague Dawley rats were split into three groups based on sensitivity to delay to reinforcement. Then, demand for sucrose pellets and cocaine was determined across a range of fixed-ratio (FR) values. Delay discounting was then reassessed to determine the stability of this measure over the course of the experiment. Individual differences in impulsive choice were positively associated with elasticity of demand for cocaine, a measure of reinforcer value, indicating that rats having higher discount rates also valued cocaine more. Impulsive choice was not associated with level of cocaine consumption as price approached 0, or any parameter associated with demand for sucrose. Individual sensitivity to delay was correlated with the initial assessment when reassessed at the end of the experiment, although impulsive choice increased for this cohort of rats as a whole. These findings suggest that impulsive choice in rats is positively associated with valuation of cocaine, but not sucrose. PMID:21812874

  4. Spatial and Functional Relationships Among Pol V-Associated loci, Pol IV-Dependent siRNAs, and Cytosine Methylation in the Arabidopsis Epigenome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wierzbicki, A. T.; Cocklin, Ross; Mayampurath, Anoop

    2012-08-15

    Multisubunit RNA polymerases IV and V (Pols IV and V) mediate RNA-directed DNA methylation and transcriptional silencing of retrotransposons and heterochromatic repeats in plants. We identified genomic sites of Pol V occupancy in parallel with siRNA deep sequencing and methylcytosine mapping, comparing wild-type plants with mutants defective for Pol IV, Pol V, or both Pols IV and V. Approximately 60% of Pol V-associated regions encompass regions of 24-nucleotide (nt) siRNA complementarity and cytosine methylation, consistent with cytosine methylation being guided by base-pairing of Pol IV-dependent siRNAs with Pol V transcripts. However, 27% of Pol V peaks do not overlap sitesmore » of 24-nt siRNA biogenesis or cytosine methylation, indicating that Pol V alone does not specify sites of cytosine methylation. Surprisingly, the number of methylated CHH motifs, a hallmark of RNA-directed de novo methylation, is similar in wild-type plants and Pol IV or Pol V mutants. In the mutants, methylation is lost at 50%-60% of the CHH sites that are methylated in the wild type but is gained at new CHH positions, primarily in pericentromeric regions. These results indicate that Pol IV and Pol V are not required for cytosine methyltransferase activity but shape the epigenome by guiding CHH methylation to specific genomic sites.« less

  5. Neurons of human nucleus accumbens.

    PubMed

    Sazdanović, Maja; Sazdanović, Predrag; Zivanović-Macuzić, Ivana; Jakovljević, Vladimir; Jeremić, Dejan; Peljto, Amir; Tosevski, Jovo

    2011-08-01

    Nucleus accumbens is a part of the ventral striatum also known as a drug active brain region, especially related with drug addiction. The aim of the study was to investigate the Golgi morphology of the nucleus accumbens neurons. The study was performed on the frontal and sagittal sections of 15 human brains by the Golgi Kopsch method. We classified neurons in the human nucleus accumbens according to their morphology and size into four types: type I--fusiform neurons; type II--fusiform neurons with lateral dendrite, arising from a part of the cell body; type III--pyramidal-like neuron; type IV--multipolar neuron. The medium spiny neurons, which are mostly noted regarding to the drug addictive conditions of the brain, correspond to the type IV--multipolar neurons. Two regions of human nucleus accumbens could be clearly recognized on Nissl and Golgi preparations each containing different predominant neuronal types. Central part of nucleus accumbens, core region, has a low density of impregnated neurons with predominant type III, pyramidal-like neurons, with spines on secondary branches and rare type IV, multipolar neurons. Contrary to the core, peripheral region, shell of nucleus, has a high density of impregnated neurons predominantly contained of type I and type IV--multipolar neurons, which all are rich in spines on secondary and tertiary dendritic branches. Our results indicate great morphological variability of human nucleus accumbens neurons. This requires further investigations and clarifying clinical significance of this important brain region.

  6. Skin phototyping in a Chinese female population: analysis of four hundred and four cases from four major cities of China.

    PubMed

    Liu, W; Lai, W; Wang, X M; Li, L; Tian, Y; Lu, Y; Wu, Y Y; Li, Y; Zhang, P; Wu, Y; Chen, L

    2006-08-01

    The sun-reactive skin types in 404 Chinese females living in different cities were investigated in this study. A questionnaire was designed according to the original concept of skin types proposed by Fitzpatrick and the investigation was conducted in two ways: self-administered reporting and then a personal interview. Minimal erythema dose (MED) and minimal persistent pigmentation dose (MPPD) were also measured in part of the volunteers with a standard solar simulator. The results show that in the way of personal interview, the predominant skin type of the investigated group is type III (71.4%), and then type II (14.7%) and type IV (14.2%), while in the self-reporting manner, the result is as follows: type III, 74.3%, type II, 25.6% and type IV, 1%. There are no skin type I, V or VI in the studied group. MED and MPPD from the same population show some relevance to the skin types, e.g. with the change of skin type from Type II to IV, the mean value of MED increases gradually and the MPPD decreases slightly. From the study we concluded that the skin types of the investigated Chinese females are principally type III (more than 70%), and then type II and type IV. The different ways of answering the questionnaire did not affect the results remarkably. The measurements of photobiology parameters confirmed that there is a certain correlation between skin types and MED or MPPD determined in this group of volunteers.

  7. Modelling the impact of causal and non-causal factors on disruption duration for Toronto's subway system: An exploratory investigation using hazard modelling.

    PubMed

    Louie, Jacob; Shalaby, Amer; Habib, Khandker Nurul

    2017-01-01

    Most investigations of incident-related delay duration in the transportation context are restricted to highway traffic, with little attention given to delays due to transit service disruptions. Studies of transit-based delay duration are also considerably less comprehensive than their highway counterparts with respect to examining the effects of non-causal variables on the delay duration. However, delays due to incidents in public transit service can have serious consequences on the overall urban transportation system due to the pivotal and vital role of public transit. The ability to predict the durations of various types of transit system incidents is indispensable for better management and mitigation of service disruptions. This paper presents a detailed investigation on incident delay durations in Toronto's subway system over the year 2013, focusing on the effects of the incidents' location and time, the train-type involved, and the non-adherence to proper recovery procedures. Accelerated Failure Time (AFT) hazard models are estimated to investigate the relationship between these factors and the resulting delay duration. The empirical investigation reveals that incident types that impact both safety and operations simultaneously generally have longer expected delays than incident types that impact either safety or operations alone. Incidents at interchange stations are cleared faster than incidents at non-interchange stations. Incidents during peak periods have nearly the same delay durations as off-peak incidents. The estimated models are believed to be useful tools in predicting the relative magnitude of incident delay duration for better management of subway operations. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. [Action of synthetic substance P (SP) on the respiration, general metabolism and systemic hemodynamics of the anesthetized dog].

    PubMed

    Pham-Huu-Chanh; Clavel, P; Sokan, I; Azum-Gélade, M C; Lehmann-Schad, W

    1976-11-08

    In the anaesthetized Dog, synthetic substance P in one dose (0.5 mug/kg i.v.) induced a quick hypotensive but short-lasting action and a respiratory analeptic activity which only appeared with some delay and lasted more than one hour. The possibility of a rapid metabolization of synthetic SP is discussed.

  9. Proposal for a histopathological consensus classification of the periprosthetic interface membrane

    PubMed Central

    Morawietz, L; Classen, R‐A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer‐Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-01-01

    Aims The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Methods Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Results Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter‐observer reproducibility sufficient (85%). Conclusion The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non‐infectious, non‐particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients. PMID:16731601

  10. Proposal for a histopathological consensus classification of the periprosthetic interface membrane.

    PubMed

    Morawietz, L; Classen, R-A; Schröder, J H; Dynybil, C; Perka, C; Skwara, A; Neidel, J; Gehrke, T; Frommelt, L; Hansen, T; Otto, M; Barden, B; Aigner, T; Stiehl, P; Schubert, T; Meyer-Scholten, C; König, A; Ströbel, P; Rader, C P; Kirschner, S; Lintner, F; Rüther, W; Bos, I; Hendrich, C; Kriegsmann, J; Krenn, V

    2006-06-01

    The introduction of clearly defined histopathological criteria for a standardised evaluation of the periprosthetic membrane, which can appear in cases of total joint arthroplasty revision surgery. Based on histomorphological criteria, four types of periprosthetic membrane were defined: wear particle induced type (detection of foreign body particles; macrophages and multinucleated giant cells occupy at least 20% of the area; type I); infectious type (granulation tissue with neutrophilic granulocytes, plasma cells and few, if any, wear particles; type II); combined type (aspects of type I and type II occur simultaneously; type III); and indeterminate type (neither criteria for type I nor type II are fulfilled; type IV). The periprosthetic membranes of 370 patients (217 women, 153 men; mean age 67.6 years, mean period until revision surgery 7.4 years) were analysed according to the defined criteria. Frequency of histopathological membrane types was: type I 54.3%, type II 19.7%, type III 5.4%, type IV 15.4%, and not assessable 5.1%. The mean period between primary arthroplasty and revision surgery was 10.1 years for type I, 3.2 years for type II, 4.5 years for type III and 5.4 years for type IV. The correlation between histopathological and microbiological diagnosis was high (89.7%), and the inter-observer reproducibility sufficient (85%). The classification proposed enables standardised typing of periprosthetic membranes and may serve as a tool for further research on the pathogenesis of the loosening of total joint replacement. The study highlights the importance of non-infectious, non-particle induced loosening of prosthetic devices in orthopaedic surgery (membrane type IV), which was observed in 15.4% of patients.

  11. Environmentally Safe and Effective Processes for Paint Removal

    DTIC Science & Technology

    1995-04-01

    Urea Formaldehyde 3.5 1.5 Type III Melamine Formaldehyde 4.0 1.5 Type IV Phenol Formaldehyde 3.5 1.5...Polyester 3.0 34 - 42 1.04 - 1.46 Type II Urea Formaldehyde 3.5 54 - 62 1.47- 1.54 Type III Melamine Formaldehyde 4.0 64- 72 1.47- 1.52 Type IV Phenol... Melamine Formaldehyde electronics industry and to remove coatings from fibreglass and composite materials. Melamine formaldehyde resin is produced

  12. Ehlers-Danlos syndrome type IV

    PubMed Central

    Germain, Dominique P

    2007-01-01

    Ehlers-Danlos syndrome type IV, the vascular type of Ehlers-Danlos syndromes (EDS), is an inherited connective tissue disorder defined by characteristic facial features (acrogeria) in most patients, translucent skin with highly visible subcutaneous vessels on the trunk and lower back, easy bruising, and severe arterial, digestive and uterine complications, which are rarely, if at all, observed in the other forms of EDS. The estimated prevalence for all EDS varies between 1/10,000 and 1/25,000, EDS type IV representing approximately 5 to 10% of cases. The vascular complications may affect all anatomical areas, with a tendency toward arteries of large and medium diameter. Dissections of the vertebral arteries and the carotids in their extra- and intra-cranial segments (carotid-cavernous fistulae) are typical. There is a high risk of recurrent colonic perforations. Pregnancy increases the likelihood of a uterine or vascular rupture. EDS type IV is inherited as an autosomal dominant trait that is caused by mutations in the COL3A1 gene coding for type III procollagen. Diagnosis is based on clinical signs, non-invasive imaging, and the identification of a mutation of the COL3A1 gene. In childhood, coagulation disorders and Silverman's syndrome are the main differential diagnoses; in adulthood, the differential diagnosis includes other Ehlers-Danlos syndromes, Marfan syndrome and Loeys-Dietz syndrome. Prenatal diagnosis can be considered in families where the mutation is known. Choriocentesis or amniocentesis, however, may entail risk for the pregnant woman. In the absence of specific treatment for EDS type IV, medical intervention should be focused on symptomatic treatment and prophylactic measures. Arterial, digestive or uterine complications require immediate hospitalisation, observation in an intensive care unit. Invasive imaging techniques are contraindicated. Conservative approach is usually recommended when caring for a vascular complication in a patient suffering from EDS type IV. Surgery may, however, be required urgently to treat potentially fatal complications. PMID:17640391

  13. Computational prediction of secretion systems and secretomes of Brucella: identification of novel type IV effectors and their interaction with the host.

    PubMed

    Sankarasubramanian, Jagadesan; Vishnu, Udayakumar S; Dinakaran, Vasudevan; Sridhar, Jayavel; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash

    2016-01-01

    Brucella spp. are facultative intracellular pathogens that cause brucellosis in various mammals including humans. Brucella survive inside the host cells by forming vacuoles and subverting host defence systems. This study was aimed to predict the secretion systems and the secretomes of Brucella spp. from 39 complete genome sequences available in the databases. Furthermore, an attempt was made to identify the type IV secretion effectors and their interactions with host proteins. We predicted the secretion systems of Brucella by the KEGG pathway and SecReT4. Brucella secretomes and type IV effectors (T4SEs) were predicted through genome-wide screening using JVirGel and S4TE, respectively. Protein-protein interactions of Brucella T4SEs with their hosts were analyzed by HPIDB 2.0. Genes coding for Sec and Tat pathways of secretion and type I (T1SS), type IV (T4SS) and type V (T5SS) secretion systems were identified and they are conserved in all the species of Brucella. In addition to the well-known VirB operon coding for the type IV secretion system (T4SS), we have identified the presence of additional genes showing homology with T4SS of other organisms. On the whole, 10.26 to 14.94% of total proteomes were found to be either secreted (secretome) or membrane associated (membrane proteome). Approximately, 1.7 to 3.0% of total proteomes were identified as type IV secretion effectors (T4SEs). Prediction of protein-protein interactions showed 29 and 36 host-pathogen specific interactions between Bos taurus (cattle)-B. abortus and Ovis aries (sheep)-B. melitensis, respectively. Functional characterization of the predicted T4SEs and their interactions with their respective hosts may reveal the secrets of host specificity of Brucella.

  14. A survey of critical care nurses' practices and perceptions surrounding early intravenous antibiotic initiation during septic shock.

    PubMed

    Roberts, Russel J; Alhammad, Abdullah M; Crossley, Lindsay; Anketell, Eric; Wood, LeeAnn; Schumaker, Greg; Garpestad, Erik; Devlin, John W

    2017-08-01

    Delays in antibiotic administration after severe sepsis recognition increases mortality. While physician and pharmacy-related barriers to early antibiotic initiation have been well evaluated, those factors that affect the speed by which critical care nurses working in either the emergency department or the intensive care unit setting initiate antibiotic therapy remains poorly characterized. To evaluate the knowledge, practices and perceptions of critical care nurses regarding antibiotic initiation in patients with newly recognised septic shock. A validated survey was distributed to 122 critical care nurses at one 320-bed academic institution with a sepsis protocol advocating intravenous(IV) antibiotic initiation within 1hour of shock recognition. Among 100 (82%) critical care nurses responding, nearly all (98%) knew of the existence of the sepsis protocol. However, many critical care nurses stated they would optimise blood pressure [with either fluid (38%) or both fluid and a vasopressor (23%)] before antibiotic initiation. Communicated barriers to rapid antibiotic initiation included: excessive patient workload (74%), lack of awareness IV antibiotic(s) ordered (57%) or delivered (69%), need for administration of multiple non-antibiotic IV medications (54%) and no IV access (51%). Multiple nurse-related factors influence IV antibiotic(s) initiation speed and should be incorporated into sepsis quality improvement efforts. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Study of the relationship between mononuclear inflammatory infiltrate and Ki-67 and basement membrane and extracellular matrix protein expression in radicular cysts.

    PubMed

    Mourão, R V C; Júnior, E C Pinheiro; Barros Silva, P G; Turatti, E; Mota, M R L; Alves, A P N N

    2016-05-01

    To evaluate the relationship between mononuclear inflammatory infiltrate and the expression of a proliferative immunomarker (Ki-67) as well as to evaluate basement membrane and extracellular matrix proteins (laminin and collagen type IV) in radicular cysts and dentigerous cysts (DC). Immunohistochemical analyses were performed in heavily inflamed radicular cysts (HIRC), slightly inflamed radicular cysts (SIRC) and DC (n = 20) using Ki-67 (Dako(®) , 1 : 50), anticollagen type IV (DBS(®) , 1 : 40) and antilaminin (DBS(®) , 1 : 20). The data were analysed using anova/Tukey's test (Ki-67) and Kruskal-Wallis/Dunn's test (collagen type IV and laminin) (P < 0.05). The immunoexpression of Ki-67 was significantly greater in the SIRC group compared with the HIRC and DC (P = 0.0040). Likewise, the immunoexpression of collagen type IV in the basement membrane of the SIRC group was significantly more continuous (P = 0.0475) than in the HIRC group. DC had significantly less collagen type IV in extracellular matrix immunoexpression than HIRC and SIRC (P = 0.0246). Laminin was absent in the basement membrane in the SIRC and DC groups, and the extracellular matrix of the HIRC was weak and punctate. The presence of inflammatory factors in the radicular cyst wall modified the expression of proliferation factors in the epithelial lining and the expression of collagen type IV and laminin in the basement membrane, but did not modify extracellular matrix behaviour in radicular cysts. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  16. [Elective reconstruction of thoracoabdominal aortic aneurysm type IV by transabdominal approach].

    PubMed

    Marjanović, Ivan; Jevtić, Miodrag; Misović, Sidor; Sarac, Momir

    2012-01-01

    Thoracoabdominal aortic aneurysm (TAAA) type IV represents an aortic dilatation from the level of the diaphragmatic hiatus to the iliac arteries branches, including visceral branches of the aorta. In the traditional procedure of TAAA type IV repair, the body is opened using thoractomy and laparotomy in order to provide adequate exposure of the descending thoracic and abdominal aorta for safe aortic reconstruction. We reported a 71-year-old man with elective reconstruction of the TAAA type IV performed by transabdominal approach. Computed tomography scans angiography revealed a TAAA type IV with diameter of 62 mm in the region of celiac trunk andsuperior mesenteric artery branching, and the largest diameter of 75 mm in the infrarenal aortic level. The patient comorbidity included a chronic obstructive pulmonary disease and hypertension, therefore he was treated for a prolonged period. In preparation for the planned aortic reconstruction asymptomatic carotid disease (occlusion of the left internal carotid artery and subtotal stenosis of the right internal carotid artery) was diagnosed. Within the same intervention percutaneous transluminal angioplasty with stent placement in right internal carotid artery was made. In general, under endotracheal anesthesia and epidural analgesia, with transabdominal approach performed aortic reconstruction with tubular dakron graft 24 mm were, and reimplantation of visceral aortic branches into the graft performed. Postoperative course was uneventful, and the patient was discharged on the postoperative day 17. Control computed tomography scan angiography performed three months after the operation showed vascular state of the patient to be in order. Complete transabdominal approach to TAAA type IV represents an appropriate substitute for thoracoabdominal approach, without compromising safety of the patient. This approach is less traumatic, especially in patients with impaired pulmonary function, because there is no thoracotomy and any complications that could follow this approach.

  17. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed Central

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation. PMID:9405282

  18. Differential routes of Ca2+ influx in Swiss 3T3 fibroblasts in response to receptor stimulation.

    PubMed

    Miyakawa, T; Kojima, M; Ui, M

    1998-01-01

    Ca2+ influx into cells in response to stimulation of various receptors was studied with Swiss 3T3 fibroblasts. The mechanisms involved were found to be so diverse that they were classified into four groups, Type I to IV. Type-I influx occurred, via pertussis toxin-susceptible G-proteins, immediately after internal Ca2+ mobilization by bradykinin, thrombin, endothelin, vasopressin or angiotensin II. Type-II influx induced by bombesin differed from Type I in its insusceptibility to pertussis toxin treatment. Ca2+ influx induced by prostaglandin E1, referred to as Type-III influx, was unique in that phospholipase C was apparently not activated without extracellular Ca2+, strongly suggesting that the Ca2+ influx preceded and was responsible for InsP3 generation and internal Ca2+ mobilization. More Ca2+ entered the cells more slowly via the Type-IV route opened by platelet-derived and other growth factors. These types of Ca2+ influx could be differentiated by their different susceptibilities to protein kinase C maximally activated by 1 h of exposure of cells to PMA, which inhibited phospholipase Cbeta coupled to receptors involved in Type-I and -II influx but did not inhibit growth-factor-receptor-coupled phospholipase Cgamma. Type-I and -II Ca2+ influxes, together with store-operated influx induced by thapsigargin, were not directly inhibited by exposure of cells to PMA, but Type-III and -IV influxes were completely inhibited. In addition, stimulation of receptors involved in Type-I and -IV Ca2+ influx, but not Type-II and -III influx, led to phospholipase A2 activation in the presence of extracellular Ca2+. Inhibition of Type-I and -IV Ca2+ influxes by their respective inhibitors, diltiazem and nifedipine, resulted in abolition of phospholipase A2 activation induced by the respective receptor agonists, in agreement with the notion that Ca2+ influx via these routes is responsible for receptor-mediated phospholipase A2 activation.

  19. Delay Discounting: I'm a "K", You're a "K"

    ERIC Educational Resources Information Center

    Odum, Amy L.

    2011-01-01

    Delay discounting is the decline in the present value of a reward with delay to its receipt. Across a variety of species, populations, and reward types, value declines hyperbolically with delay. Value declines steeply with shorter delays, but more shallowly with longer delays. Quantitative modeling provides precise measures to characterize the…

  20. Alterations of type IV collagen alpha chains in patients with chronic acquired glomerulopathies: mRNA levels, protein expression and urinary loss.

    PubMed

    Sanna-Cherchi, Simone; Carnevali, Maria Luisa; Martorana, Davide; Cravedi, Paolo; Maggiore, Umberto; Alinovi, Rossella; Bovino, Achiropita; Mattei, Silvia; Orlandini, Guido; Gatti, Rita; Savi, Mario; Sado, Yoshikazu; Neri, Tauro M; Allegri, Landino

    2007-01-01

    Type IV collagen is a major structural component of the normal kidney glomerulus. However, its role in chronic acquired glomerulopathies has been only partially elucidated. Urinary levels of col(IV)alpha1, col(IV)alpha3 and col(IV)alpha5 collagen chains were analyzed in 107 patients with chronic acquired glomerulopathies. In a subgroup of 33 patients, tissue mRNA levels, protein expression and urinary excretion were evaluated for all col(IV)alpha chains, from col(IV)alpha1 to col(IV)alpha5. The renal specimens were examined to get a semiquantitative score of the acute and chronic activity of the histological lesions. Urines obtained from 13 healthy subjects and 10 normal renal tissue samples were used as controls. Urinary levels of col(IV)alpha1, col(IV)alpha3, col(IV)alpha5 chains were significantly higher in patients than in controls [p < 0.01 for all], while only col(IV)alpha1 and col(IV)alpha3 urinary excretion correlated with the degree of chronic histological damage [col(IV)alpha1 R = 0.44, p < 0.001; col(IV)alpha3: R = 0.47, p < 0.001]. Compared with controls, patients showed a renal expression of mRNA for col(IV)alpha5 chain significantly higher [p = 0.001], while having a significantly lower protein expression of col(IV)alpha3, col(IV)alpha4 and col(IV)alpha5 chains [p < 0.01 for all]. Patients with chronic acquired glomerulopathies show important alterations in the col(IV)alpha chain network mimicking some molecular features of the X-linked Alport's syndrome. Further studies are needed to show whether urinary levels of the col(IV)alpha chains may be used as markers for monitoring renal injury. Copyright 2007 S. Karger AG, Basel.

  1. Allergies in orthopaedic and trauma surgery.

    PubMed

    Lohmann, C H; Hameister, R; Singh, G

    2017-02-01

    Hypersensitivity reactions to implants in orthopaedic and trauma surgery are a rare but devastating complication. They are considered as a delayed-type of hypersensitivity reaction (type IV), characterized by an antigen activation of sensitized T-lymphocytes releasing various cytokines and may result in osteoclast activation and bone resorption. Potential haptens are originated from metal alloys or bone-cement. A meta-analysis has confirmed a higher probability of developing a metal hypersensitivity postoperatively and noted a greater risk of failed replacements compared to stable implants. Hypersensitivity to implants may present with a variety of symptoms such as pain, joint effusion, delayed wound/bone healing, persistent secretion, allergic dermatitis (localized or systemic), clicking noises, loss of joint function, instability and failure of the implant. Various diagnostic options have been offered, including patch testing, metal alloy patch testing, histology, lymphocyte transformation test (LTT), memory lymphocyte immunostimulation assay (MELISA), leukocyte migration inhibition test (LIF) and lymphocyte activation test (LAT). No significant differences between in vivo and in vitro methods have been found. Due to unconvincing evidence for screening methods, predictive tests are not recommended for routine performance. Infectious aetiology always needs to be excluded. As there is a lack of evidence on large-scale studies with regards to the optimal treatment option, management currently relies on individual case-by-case decisions. Several options for patients with (suspected) metal-related hypersensitivity exist and may include materials based on ceramic, titanium or oxinium or modified surfaces. Promising results have been reported, but long-term experience is lacking. More large-scaled studies are needed in this context. In patients with bone-cement hypersensitivity, the component suspected for hypersensitivity should be avoided. The development of (predictive) biomarkers is considered as a major contribution for the future. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  2. Mechanisms of chiral discrimination by topoisomerase IV

    PubMed Central

    Neuman, K. C.; Charvin, G.; Bensimon, D.; Croquette, V.

    2009-01-01

    Topoisomerase IV (Topo IV), an essential ATP-dependent bacterial type II topoisomerase, transports one segment of DNA through a transient double-strand break in a second segment of DNA. In vivo, Topo IV unlinks catenated chromosomes before cell division and relaxes positive supercoils generated during DNA replication. In vitro, Topo IV relaxes positive supercoils at least 20-fold faster than negative supercoils. The mechanisms underlying this chiral discrimination by Topo IV and other type II topoisomerases remain speculative. We used magnetic tweezers to measure the relaxation rates of single and multiple DNA crossings by Topo IV. These measurements allowed us to determine unambiguously the relative importance of DNA crossing geometry and enzymatic processivity in chiral discrimination by Topo IV. Our results indicate that Topo IV binds and passes DNA strands juxtaposed in a nearly perpendicular orientation and that relaxation of negative supercoiled DNA is perfectly distributive. Together, these results suggest that chiral discrimination arises primarily from dramatic differences in the processivity of relaxing positive and negative supercoiled DNA: Topo IV is highly processive on positively supercoiled DNA, whereas it is perfectly distributive on negatively supercoiled DNA. These results provide fresh insight into topoisomerase mechanisms and lead to a model that reconciles contradictory aspects of previous findings while providing a framework to interpret future results. PMID:19359479

  3. Serotype IV Sequence Type 468 Group B Streptococcus Neonatal Invasive Disease, Minnesota, USA.

    PubMed

    Teatero, Sarah; Ferrieri, Patricia; Fittipaldi, Nahuel

    2016-11-01

    To further understand the emergence of serotype IV group B Streptococcus (GBS) invasive disease, we used whole-genome sequencing to characterize 3 sequence type 468 strains isolated from neonates in Minnesota, USA. We found that strains of tetracycline-resistant sequence type 468 GBS have acquired virulence genes from a putative clonal complex 17 GBS donor by recombination.

  4. Diagnostic Accuracy of History and Physical Examination of Superior Labrum Anterior-Posterior Lesions

    PubMed Central

    Michener, Lori A.; Doukas, William C.; Murphy, Kevin P.; Walsworth, Matthew K.

    2011-01-01

    Context: Type I superior labrum anterior-posterior (SLAP) lesions involve degenerative fraying and probably are not the cause of shoulder pain. Type II to IV SLAP lesions are tears of the labrum. Objective: To determine the diagnostic accuracy of patient history and the active compression, anterior slide, and crank tests for type I and type II to IV SLAP lesions. Design: Cohort study. Setting: Clinic. Patients or Other Participants: Fifty-five patients (47 men, 8 women; age = 40.6 ± 15.1 years) presenting with shoulder pain. Intervention(s): For each patient, an orthopaedic surgeon conducted a clinical examination of history of trauma; sudden onset of symptoms; history of popping, clicking, or catching; age; and active compression, crank, and anterior slide tests. The reference standard was the intraoperative diagnosis. The operating surgeon was blinded to the results of the clinical examination. Main Outcome Measure(s): Diagnostic utility was calculated using the receiver operating characteristic curve and area under the curve (AUC), sensitivity, specificity, positive likelihood ratio (+LR), and negative likelihood ratio (−LR). Forward stepwise binary regression was used to determine a combination of tests for diagnosis. Results: No history item or physical examination test had diagnostic accuracy for type I SLAP lesions (n = 13). The anterior slide test had utility (AUC = 0.70, +LR = 2.25, −LR = 0.44) to confirm and exclude type II to IV SLAP lesions (n = 10). The combination of a history of popping, clicking, or catching and the anterior slide test demonstrated diagnostic utility for confirming type II to IV SLAP lesions (+LR = 6.00). Conclusions: The anterior slide test had limited diagnostic utility for confirming and excluding type II to IV SLAP lesions; diagnostic values indicated only small shifts in probability. However, the combination of the anterior slide test with a history of popping, clicking, or catching had moderate diagnostic utility for confirming type II to IV SLAP lesions. No single item or combination of history items and physical examination tests had diagnostic utility for type I SLAP lesions. PMID:21944065

  5. Terminal ileum gangrene secondary to a type IV paraesophageal hernia.

    PubMed

    Hsu, Ching Tsai; Hsiao, Po Jen; Chiu, Chih Chien; Chan, Jenq Shyong; Lin, Yee Fung; Lo, Yuan Hung; Hsiao, Chia Jen

    2016-02-28

    Type IV paraesophageal hernia (PEH) is very rare, and is characterized by the intrathoracic herniation of the abdominal viscera other than the stomach into the chest. We describe a 78-year-old woman who presented at our emergency department because of epigastric pain that she had experienced over the past 24 h. On the day after admission, her pain became severe and was accompanied by right chest pain and dyspnea. Chest radiography revealed an intrathoracic intestinal gas bubble occupying the right lower lung field. Emergency explorative laparotomy identified a type IV PEH with herniation of only the terminal ileum through a hiatal defect into the right thoracic cavity. In this report, we also present a review of similar cases in the literature published between 1980 and 2015 in PubMed. There were four published cases of small bowel herniation into the thoracic cavity during this period. Our patient represents a rare case of an individual diagnosed with type IV PEH with incarceration of only the terminal ileum.

  6. Atypical hereditary sensory and autonomic neuropathy type IV with neither mental retardation nor pain insensitivity.

    PubMed

    Jung, Chae Lim; Ki, Chang-Seok; Kim, Byoung Joon; Lee, Jong-Hyuck; Sung, Ki-Sun; Kim, Jong-Won; Park, Youn-Soo

    2013-12-01

    Hereditary sensory and autonomic neuropathy type IV is an autosomal recessive disorder characterized by severe mental retardation and self-mutilation-related complications. Recently, we investigated a 16-year-old Korean boy with normal intelligence. He had preserved pain sensation but was suspected of having hereditary sensory and autonomic neuropathy type IV because of the recurrent bone fractures and painless joint destruction in the absence of any predisposing medical conditions. Genetic analysis of the NTRK1 gene revealed compound heterozygous mutations including c.851-33T>A and c.2303C>T (p.Pro768Leu) in the NTRK1 gene. The p.Pro768Leu mutation has been identified in 2 Japanese patients with a mild phenotype. Therefore, although it is rare, hereditary sensory and autonomic neuropathy type IV should be considered in patients with recurrent bone fractures and painless joint destruction who do not have any predisposing conditions even when they do not have typical clinical features such as mental retardation or pain insensitivity.

  7. Type IV Hypersensitivity to Gold Weight Upper-Eyelid Implant: Case Report and Review of the Literature.

    PubMed

    Kilduff, Caroline L S; Casswell, Edward J; Imonikhe, Richard; Marjanovic, Branka

    2017-05-04

    Complications associated with gold-weight insertion for lagophthalmos are uncommon, recent reports have provided evidence to suggest that type IV hypersensitivity to gold can cause a persistent inflammatory reaction. We present a case of a 46-year-old man who experienced persistent post-operative inflammation, and summarize previously documented cases. This patient underwent uncomplicated insertion of an upper eyelid gold weight for right-sided facial nerve palsy. He had no allergies or implanted metalwork. Post-operatively erythema was noted at seven-weeks and did not resolve. The weight was removed after six-months. The histopathological findings were in keeping with type IV hypersensitivity and similar to previous cases. Although infrequent, this complication has poor outcomes. The definitive management is removal of the weight. Information regarding implanted gold, and previous reactions should be elicited pre-operatively. Type IV hypersensitivity should be considered in patients with persistent inflammation that do not respond to antibiotic or steroid therapy.

  8. [Clinical study on vocal cords spontaneous rehabilitation after CO2 laser surgery].

    PubMed

    Zhang, Qingxiang; Hu, Huiying; Sun, Guoyan; Yu, Zhenkun

    2014-10-01

    To study the spontaneous rehabilitation and phonation quality of vocal cords after different types of CO2 laser microsurgery. Surgical procedures based on Remacle system Type I, Type II, Type III, Type IV and Type V a respectively. Three hundred and fifteen cases with hoarseness based on strobe laryngoscopy results were prospectively assigned to different group according to vocal lesions apperence,vocal vibration and imaging of larynx CT/MRI. Each group holded 63 cases. The investigation included the vocal cords morphological features,the patients' subjective feelings and objective results of vocal cords. There are no severe complications for all patients in perioperative period. Vocal scar found in Type I ,1 case; Type II, 9 cases ;Type III, 47 cases; Type IV, 61 cases and Type Va 63 cases respectively after surgery. The difference of Vocal scar formation after surgery between surgical procedures are statistical significance (χ2 = 222.24, P < 0.05). Hoarseness improved after the surgery in 59 cases of Type I , 51 cases of Type II, 43 cases of Type III, 21 cases of Type IV and 17 cases of Type Va. There are statistically significance (χ2 = 89.46, P < 0.05) between different surgical procedures. The parameters of strobe laryngoscope: there are statistical significance on jitter between procedures (F 44.51, P < 0.05), but without difference within Type I and Type II (P > 0.05). This happened in shimmer parameter and the maximum phonation time (MPT) as jitter. There are no statistical significance between Type IV and Type Va on MPT (P > 0.05). Morphological and functional rehabilitation of vocal cord will be affected obviously when the body layer is injured. The depth and range of the CO2 laser microsurgery are the key factors affecting the vocal rehabilitation.

  9. Identification of Surprisingly Diverse Type IV Pili, across a Broad Range of Gram-Positive Bacteria

    PubMed Central

    Roos, David S.; Pohlschröder, Mechthild

    2011-01-01

    Background In Gram-negative bacteria, type IV pili (TFP) have long been known to play important roles in such diverse biological phenomena as surface adhesion, motility, and DNA transfer, with significant consequences for pathogenicity. More recently it became apparent that Gram-positive bacteria also express type IV pili; however, little is known about the diversity and abundance of these structures in Gram-positives. Computational tools for automated identification of type IV pilins are not currently available. Results To assess TFP diversity in Gram-positive bacteria and facilitate pilin identification, we compiled a comprehensive list of putative Gram-positive pilins encoded by operons containing highly conserved pilus biosynthetic genes (pilB, pilC). A surprisingly large number of species were found to contain multiple TFP operons (pil, com and/or tad). The N-terminal sequences of predicted pilins were exploited to develop PilFind, a rule-based algorithm for genome-wide identification of otherwise poorly conserved type IV pilins in any species, regardless of their association with TFP biosynthetic operons (http://signalfind.org). Using PilFind to scan 53 Gram-positive genomes (encoding >187,000 proteins), we identified 286 candidate pilins, including 214 in operons containing TFP biosynthetic genes (TBG+ operons). Although trained on Gram-positive pilins, PilFind identified 55 of 58 manually curated Gram-negative pilins in TBG+ operons, as well as 53 additional pilin candidates in operons lacking biosynthetic genes in ten species (>38,000 proteins), including 27 of 29 experimentally verified pilins. False positive rates appear to be low, as PilFind predicted only four pilin candidates in eleven bacterial species (>13,000 proteins) lacking TFP biosynthetic genes. Conclusions We have shown that Gram-positive bacteria contain a highly diverse set of type IV pili. PilFind can be an invaluable tool to study bacterial cellular processes known to involve type IV pilus-like structures. Its use in combination with other currently available computational tools should improve the accuracy of predicting the subcellular localization of bacterial proteins. PMID:22216142

  10. Accentuated hyperparathyroidism in type II Bartter syndrome.

    PubMed

    Landau, Daniel; Gurevich, Evgenia; Sinai-Treiman, Levana; Shalev, Hannah

    2016-07-01

    Bartter syndrome (BS) may be associated with different degrees of hypercalciuria, but marked parathyroid hormone (PTH) abnormalities have not been described. We compared clinical and laboratory data of patients with either ROMK-deficient type II BS (n = 14) or Barttin-deficient type IV BS (n = 20). Only BS-IV patients remained mildly hypokalemic in spite of a higher need for potassium supplementation. Estimated glomerular filtration rate (eGFR) was mildly decreased in only four BS-IV patients. Average PTH values were significantly higher in BS-II (160.6 ± 85.8 vs. 92.5 ± 48 pg/ml in BS-IV, p = 0.006). In both groups, there was a positive correlation between age and log(PTH). Levels of 25(OH) vitamin D were not different. Total serum calcium was lower (within normal limits) and age-related serum phosphate (Pi)-SDS was increased in BS-II (1.19 ± 0.71 vs. 0.01 ± 1.04 in BS-IV, p < 0.001). The GFR threshold for Pi reabsorption was higher in BS-II (5.63 ± 1.25 vs. 4.36 ± 0.98, p = 0.002). Spot urine calcium/creatinine ratio and nephrocalcinosis rate (100 vs. 16 %) were higher in the BS-II group. PTH, serum Pi levels, and urinary threshold for Pi reabsorption are significantly elevated in type II vs. type IV BS, suggesting a PTH resistance state. This may be a response to more severe long-standing hypercalciuria, leading to a higher rate of nephrocalcinosis in BS-II.

  11. Properties of the highly ionized disk and halo gas toward two distant high-latitude stars

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, K. R.

    1994-01-01

    Goddard High Resolution Spectrograph (GHRS) intermediate -resolution observations of S III, Si III, Al III, Si IV, C IV, and N V absorption along the sight lines to HD 18100 (l = 217.9 deg, b = -62.7, d = 3.1 kpc, z = -2.8 kpc) and HD 100340 (l = 258.9 deg, b = +61.2 deg, d = 5.3 kpc, z = 4.6 kpc) are presented. These small science aperture spectra have resolutions ranging from 11 to 20 km/s full width at half maximum (FWHM) and S/N from 30 to 65 per diode substep. Strong absorption by moderately and highly ionized gas is seen in each direction. The absorption in the direction of the south Galactic polar region (HD 18100) is kinematically simple, while the absorption in the direction of north Galactic polar region (HD 100304) is kinematically complex. In each case the absorption by the highly ionized gas lies within the velocity range of absorption by neutral and weakly ionized gas. Along each sight line, the velocity dispersion determined from the unsaturated absorption lines increases with the energy required to create each ion. The logarithmic column densities for Al III, Si IV, C IV, and N V are log N(atoms/sq cm = 12.71, 13.10, 13.58, and 12.75 toward HD 18100 and log N = 12.88, 13.31, 13.83, and 13.04 toward HD 100340. Average ionic ratios among these species are very similar along the two sight lines. Differences in profile shape between the absorption for AL II, Si IV, C IV, and N V provide additional support for the claim of Savage, Sembach, & Cardelli (1994) that there exists two types of highly ionized gas in the interstellar medium. One type of highly ionized gas is responsible for the structured Si IV absorption and part of the C IV absorption. In this gas N(C IV)/N(Si IV) approximately 3.0 and N(C IV)/N(N V) greater than 6. The absorption by this gas seems to be associated with some type of self-regulating interface or mixing layer between the warm and hot interstellar medium. The other type of highly ionized gas is responsible for most of the N V absorption, part of the C IV absorption, and has very little associated Si IV absorption. In this gas N(C IV)/N(N V) is approximately 1 to 3. This gas is hot (T greater than 2 x 10(exp 5) K) and may be tracing the cooling gas of supernova (SN) bubbles or a Galactic fountain. The relative mixture of these two types of highly ionized gas varies from one sight line to the next. The two sight lines in this study sample halo gas in the solar neighborhood and have a smaller percentage of the more highly ionized gas than inner Galaxy sight lines.

  12. [A clinical analysis of 50 cases of medicament-like dermatitis due to trichloroethylene].

    PubMed

    Xia, Li-hua; Huang, Han-lin; Kuang, Shou-ren; Liu, Hui-fang; Kong, Ling-zhen

    2004-06-01

    To investigate the clinical manifestations, complications and treatment of medicament-like dermatitis due to trichloroethylene (TCE), so as to provide basis for studying its etiology and mechanism. Fifty patients with dermatitis due to TCE from 1997 to 2000 were analysed retrospectively. The occurrence of the dermatitis was not parallel to TCE exposure levels, without significant dose-effect relationship. This disease could be caused by both inhalation and skin exposure. The latency period of TCE dermatitis ranged from 5 to 66 days, and the average was 31.5 d (Medium). The major clinical manifestations included skin lesions, fever, superficial lymph node swelling and liver dysfunction. Infection was the major complication. Glucocorticoid was effective for treatment of this disease. The clinical manifestations due to TCE exposure were similar to dermatitis medicamentosa. The major clinical types of TCE dermatitis included exfoliative dermatitis and erythema multiforme. The dermatitis is considered to be mediated by delayed-type (IV) hypersensitivity. The key factors to treat this disease successfully included the use of glucocorticoid in time with sufficient dose and full course, professional skin care, active treatment to protect the liver and to avoid infection.

  13. Selective thoracic surgery in the Lenke type 1A: King III and King IV type curves.

    PubMed

    Parisini, P; Di Silvestre, M; Lolli, F; Bakaloudis, G

    2009-06-01

    Pedicle screw fixation enables enhanced three-dimensional correction of spinal deformities and effectively shortens the distal fusion level. However, the choice of distal fusion level is still controversial in single thoracic idiopathic scoliosis with the lumbar compensatory curve not crossing the middle line (Lenke type 1 with modifier A or King type III and IV curves).The authors retrospectively analyzed 31 patients treated by segmental pedicular instrumentation alone, affected by a single thoracic adolescent idiopathic scoliosis with a compensatory lumbar curve not crossing the midline (Lenke 1A), with an average age of 16.3 years (range 10-22 years). The patients with regard to the King classification were also assessed. A statistical analysis was performed to determine whether the two groups (King III, King IV) presented differences concerning the level of the stable vertebra (SV), end vertebra (EV), and neutral vertebra (NV) and were also analyzed the results at follow-up regarding the relationships between the SV, EV, and lowest instrumented vertebra (LIV). The statistical analysis showed a significant difference between the two curve types. In the King III type curve the SV, EV, and NV appeared to be more proximal than those of the King IV type curve and the segments between the SV, EV, and NV appeared to be reduced in King III curves compared with King IV curves. At a follow-up of 3.2 years (range 2.2-5) the thoracic curve showed a correction of 58.4% (from 62.3 degrees to 26.6 degrees ) and compensatory lumbar curve an average spontaneous correction of 52.4% (from 38.1 degrees to 18.1 degrees ).The position of the LIV was shorter than the position of the SV in 30 patients (97%) with an average "salvage" of 2.1 (from 1 to 4) distal fusion levels. Four cases (13%), all affected by a King IV type curve, presented at follow-up an unsatisfactory results due to an "adding on" phenomenon. The statistical analysis confirmed that this phenomenon was correlated with The King IV curve (P = 0.043; Chi-square test) and that the only predictive parameter for its onset was the LIV-SV difference (odds ratio = 0.093; with a confidence interval of 0.008-1): every time that in King IV curve type the LIV was three or more levels shorter than the stable vertebra at follow-up the "adding on" phenomenon was present. The authors conclude that Lenke's type 1 with modifier A includes two kinds of curves, King III and King IV and that the Lenke's type 2 curves and King V with the lumbar curve not crossing the middle line have a similar behavior. Therefore, it is of authors' opinion that "the adding on phenomenon" could be prevented by more rigidly defining K. IV versus K. III curves. In Lenke's 1/2 A-K. IV/V type with the rotation of the first vertebra just below the thoracic lower EV in the same direction as the thoracic curve, and when SV and EV show more than two levels of difference, it is necessary to extend the lower fusion down to L2 or L3 (not more than two levels shorter than the SV). Whereas in Lenke's 1/2 A-K. III/V with the rotation of the first proximal vertebra of lumbar curve in the opposite direction to the thoracic apex and when SV and EV show not more than two level gap differences, the position of the lowest instrumented vertebra can be two or three levels shorter than the stable vertebra with satisfactory postoperative spinal balance. Therefore, the stable vertebra and the rotation of lumbar curve are considered to be a reliable guide for selecting the lower level of fusion.

  14. Specific Accumulation of Tumor-Derived Adhesion Factor in Tumor Blood Vessels and in Capillary Tube-Like Structures of Cultured Vascular Endothelial Cells

    NASA Astrophysics Data System (ADS)

    Akaogi, Kotaro; Okabe, Yukie; Sato, Junji; Nagashima, Yoji; Yasumitsu, Hidetaro; Sugahara, Kazuyuki; Miyazaki, Kaoru

    1996-08-01

    Tumor-derived adhesion factor (TAF) was previously identified as a cell adhesion molecule secreted by human bladder carcinoma cell line EJ-1. To elucidate the physiological function of TAF, we examined its distribution in human normal and tumor tissues. Immunochemical staining with an anti-TAF monoclonal antibody showed that TAF was specifically accumulated in small blood vessels and capillaries within and adjacent to tumor nests, but not in those in normal tissues. Tumor blood vessel-specific staining of TAF was observed in various human cancers, such as esophagus, brain, lung, and stomach cancers. Double immunofluorescent staining showed apparent colocalization of TAF and type IV collagen in the vascular basement membrane. In vitro experiments demonstrated that TAF preferentially bound to type IV collagen among various extracellular matrix components tested. In cell culture experiments, TAF promoted adhesion of human umbilical vein endothelial cells to type IV collagen substrate and induced their morphological change. Furthermore, when the endothelial cells were induced to form capillary tube-like structures by type I collagen, TAF and type IV collagen were exclusively detected on the tubular structures. The capillary tube formation in vitro was prevented by heparin, which inhibited the binding of TAF to the endothelial cells. These results strongly suggest that TAF contributes to the organization of new capillary vessels in tumor tissues by modulating the interaction of endothelial cells with type IV collagen.

  15. An outer membrane protein (porin) as an eliciting antigen for delayed-type hypersensitivity in murine salmonellosis.

    PubMed Central

    Udhayakumar, V; Muthukkaruppan, V R

    1987-01-01

    The porin, an outer membrane protein of Salmonella typhimurium, was found to be a suitable antigen for eliciting delayed-type hypersensitivity in mouse salmonellosis. Histological examination of the reaction site revealed that the porin was superior to other antigenic preparations in eliciting a typical delayed-type hypersensitivity reaction consisting of mononuclear cell infiltration without polymorphonuclear cell contamination. This study indicates the importance of using a suitable protein antigen from S. typhi for human application. Images PMID:3028963

  16. Successful Multiresistant Community-Associated Methicillin-Resistant Staphylococcus aureus Lineage from Taipei, Taiwan, That Carries Either the Novel Staphylococcal Chromosome Cassette mec (SCCmec) Type VT or SCCmec Type IV

    PubMed Central

    Boyle-Vavra, Susan; Ereshefsky, Ben; Wang, Chih-Chien; Daum, Robert S.

    2005-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) isolates carry the methicillin resistance gene (mecA) on a horizontally transferred genetic element called the staphylococcal chromosome cassette mec (SCCmec). Community-acquired MRSA (CAMRSA) isolates usually carry SCCmec type IV. We previously reported that 76% of 17 CAMRSA isolates (multilocus sequence type 59) obtained from pediatric patients with skin and soft tissue infections (SSTI) from Taipei did not carry SCCmec types I to IV. We used DNA sequence analysis to determine that the element harbored by these nontypeable isolates is a novel subtype of SCCmec V called SCCmec VT. It contains a ccrC recombinase gene variant (ccrC2) and mec complex C2. One SSTI isolate contained molecular features of SCCmec IV but also contained ccrC2 (a feature of SCCmec VT), suggesting that it may harbor a composite SCCmec element. The genes lukS-PV and lukF-PV encoding the Panton-Valentine leukocidin (PVL) were present in all CAMRSA SSTI isolates whether they contained SCCmec type IV or VT. SCCmec VT was also present in 5 of 34 (14.7%) CAMRSA colonization isolates collected from healthy children from Taipei who lacked MRSA risk factors. Four (80%) of the these isolates contained lukS-PV and lukF-PV, as did 1 of 27 (3.7%) SCCmec IV-containing colonization isolates. A total of 63% (10 of 16) of the SSTI isolates and 61.7% (21 of 34) of the colonization isolates tested were resistant to at least four classes of non-β-lactam antimicrobials. SCCmec VT is a novel SCCmec variant that is found in multiply resistant CAMRSA strains with sequence type 59 in Taipei in association with the PVL leukotoxin genes. PMID:16145133

  17. Magnetoencephalographic Imaging of Auditory and Somatosensory Cortical Responses in Children with Autism and Sensory Processing Dysfunction

    PubMed Central

    Demopoulos, Carly; Yu, Nina; Tripp, Jennifer; Mota, Nayara; Brandes-Aitken, Anne N.; Desai, Shivani S.; Hill, Susanna S.; Antovich, Ashley D.; Harris, Julia; Honma, Susanne; Mizuiri, Danielle; Nagarajan, Srikantan S.; Marco, Elysa J.

    2017-01-01

    This study compared magnetoencephalographic (MEG) imaging-derived indices of auditory and somatosensory cortical processing in children aged 8–12 years with autism spectrum disorder (ASD; N = 18), those with sensory processing dysfunction (SPD; N = 13) who do not meet ASD criteria, and typically developing control (TDC; N = 19) participants. The magnitude of responses to both auditory and tactile stimulation was comparable across all three groups; however, the M200 latency response from the left auditory cortex was significantly delayed in the ASD group relative to both the TDC and SPD groups, whereas the somatosensory response of the ASD group was only delayed relative to TDC participants. The SPD group did not significantly differ from either group in terms of somatosensory latency, suggesting that participants with SPD may have an intermediate phenotype between ASD and TDC with regard to somatosensory processing. For the ASD group, correlation analyses indicated that the left M200 latency delay was significantly associated with performance on the WISC-IV Verbal Comprehension Index as well as the DSTP Acoustic-Linguistic index. Further, these cortical auditory response delays were not associated with somatosensory cortical response delays or cognitive processing speed in the ASD group, suggesting that auditory delays in ASD are domain specific rather than associated with generalized processing delays. The specificity of these auditory delays to the ASD group, in addition to their correlation with verbal abilities, suggests that auditory sensory dysfunction may be implicated in communication symptoms in ASD, motivating further research aimed at understanding the impact of sensory dysfunction on the developing brain. PMID:28603492

  18. Tolerable hearing-aid delays: IV. effects on subjective disturbance during speech production by hearing-impaired subjects.

    PubMed

    Stone, Michael A; Moore, Brian C J

    2005-04-01

    We assessed the effects of time delay in a hearing aid on subjective disturbance and reading rates while the user of the aid was speaking, using hearing-impaired subjects and real-time processing. The time delay was constant across frequency. A digital signal processor was programmed as a four-channel, fast-acting, wide-dynamic-range compression hearing aid. One of four delays could be selected on the aid to produce a total delay of 13, 21, 30, or 40 msec between microphone and receiver. Twenty-five subjects, mostly with near-symmetric hearing impairment of cochlear origin, were fitted bilaterally with behind-the-ear aids connected to the processor. The aids were programmed with insertion gains prescribed by the CAMEQ loudness equalization procedure for each subject and ear. Subjects were asked to read aloud from scripts: speech production rates were measured and subjective ratings of the disturbance of the delay were obtained. Subjects required some training to recognize the effects of the delay to rate it consistently. Subjective disturbance increased progressively with increasing delay and was a nonmonotonic function of low-frequency hearing loss. Subjects with mild or severe low-frequency hearing loss were generally less disturbed by the delay than those with moderate loss. Disturbance ratings tended to decrease over successive tests. Word production rates were not significantly affected by delay over the range of delays tested. The results follow a pattern similar to those presented in , obtained using a simulation of hearing loss and normally hearing subjects, except for the nonmonotonic variation of disturbance with low-frequency hearing loss. We hypothesize that disturbance is maximal when the levels in the ear canal of the low-frequency components are similar for the unaided and aided sounds. A rating of 3, which is probably just acceptable, was obtained for delays ranging from 14 to 30 msec, depending on the hearing loss. Some acclimatization to the subjective disturbance occurred over a time scale of about 1 hour.

  19. Effects of comprehensive education protocol in decreasing pre-hospital stroke delay among Chinese urban community population.

    PubMed

    Chen, Shengyun; Sun, Haixin; Zhao, Xingquan; Fu, Paul; Yan, Wang; Yilong, Wang; Hongyan, Jia; Yan, Zhang; Wenzhi, Wang

    2013-06-01

    Studies have shown that awareness of early stroke symptoms and the use of ambulances are two important factors in decreasing pre-hospital stroke delay. The purpose of this study is to evaluate a comprehensive educational stroke protocol in improving stroke response times. Two urban communities in Beijing (population ≍50 000), matched in economic status and geography, were enrolled in this study. A comprehensive educational protocol, which included public lectures and distribution of instructive material for the community and its medical staff, was implemented from August 2008 to December 2010. Surveillance of new onset stroke in both communities was carried out during the same period. Pre-hospital delay time and percentage of patients using emergency medical services (EMS) were compared between the two communities. After comprehensive educational protocol, we found that: (i) pre-hospital delay (time from stroke symptom onset to hospital arrival) decreased from 180 to 79 minutes, (ii) the proportion of patients arriving within three hours of stroke onset increased from 55·8% to 80·4%, (iii) pre-hospital delay of stroke patients with symptoms of paralysis, numbness, and speech impediments was decreased, and (iv) the proportion of stroke patients calling for EMS increased from 50·4% to 60·7%. The comprehensive educational stroke protocol was significantly effective in decreasing pre-hospital stroke delay.

  20. Stochastic resonance in a tumor-immune system subject to bounded noises and time delay

    NASA Astrophysics Data System (ADS)

    Guo, Wei; Mei, Dong-Cheng

    2014-12-01

    Immunotherapy is one of the most recent approaches in cancer therapy. A mathematical model of tumor-immune interaction, subject to a periodic immunotherapy treatment (imitated by a periodic signal), correlative and bounded stochastic fluctuations and time delays, is investigated by numerical simulations for its signal power amplification (SPA). Within the tailored parameter regime, the synchronous response of tumor growth to the immunotherapy, stochastic resonance (SR), versus both the noises and delays is obtained. The details are as follows (i) the peak values of SPA versus the noise intensity (A) in the proliferation term of tumor cells decrease as the frequency of periodic signal increases, i.e. an increase of the frequency restrains the SR; (ii) an increase of the amplitude of periodic signal restrains the SR versus A, but boosts up the SR versus the noise intensity B in the immune term; (iii) there is an optimum cross-correlated degree between the two bounded noises, at which the system exhibits the strongest SR versus the delay time τα(the reaction time of tumor cell population to their surrounding environment constraints); (iv) upon increasing the delay time τα, double SR versus the delay time τβ (the time taken by both the tumor antigen identification and tumor-stimulated proliferation of effectors) emerges. These results may be helpful for an immunotherapy treatment for the sufferer.

  1. A Diagnostic Marker to Discriminate Childhood Apraxia of Speech from Speech Delay: IV. the Pause Marker Index

    ERIC Educational Resources Information Center

    Shriberg, Lawrence D.; Strand, Edythe A.; Fourakis, Marios; Jakielski, Kathy J.; Hall, Sheryl D.; Karlsson, Heather B.; Mabie, Heather L.; McSweeny, Jane L.; Tilkens, Christie M.; Wilson, David L.

    2017-01-01

    Purpose: Three previous articles provided rationale, methods, and several forms of validity support for a diagnostic marker of childhood apraxia of speech (CAS), termed the pause marker (PM). Goals of the present article were to assess the validity and stability of the PM Index (PMI) to scale CAS severity. Method: PM scores and speech, prosody,…

  2. Part H of the Individuals with Disabilities Education Act (IDEA) for Infants, Toddlers, and Their Families Annual Performance Report, Year IV (1990-1992).

    ERIC Educational Resources Information Center

    McNulty, Brian A.; And Others

    This report on the fourth year of Colorado's participation in Part H of the Individuals with Disabilities Education Act describes major accomplishments in preparing for full implementation of Part H in Year 5. Accomplishments in the following areas are discussed: state definition of developmental delay, central directory, timetables for serving…

  3. Ensemble codes involving hippocampal neurons are at risk during delayed performance tests.

    PubMed

    Hampson, R E; Deadwyler, S A

    1996-11-26

    Multielectrode recording techniques were used to record ensemble activity from 10 to 16 simultaneously active CA1 and CA3 neurons in the rat hippocampus during performance of a spatial delayed-nonmatch-to-sample task. Extracted sources of variance were used to assess the nature of two different types of errors that accounted for 30% of total trials. The two types of errors included ensemble "miscodes" of sample phase information and errors associated with delay-dependent corruption or disappearance of sample information at the time of the nonmatch response. Statistical assessment of trial sequences and associated "strength" of hippocampal ensemble codes revealed that miscoded error trials always followed delay-dependent error trials in which encoding was "weak," indicating that the two types of errors were "linked." It was determined that the occurrence of weakly encoded, delay-dependent error trials initiated an ensemble encoding "strategy" that increased the chances of being correct on the next trial and avoided the occurrence of further delay-dependent errors. Unexpectedly, the strategy involved "strongly" encoding response position information from the prior (delay-dependent) error trial and carrying it forward to the sample phase of the next trial. This produced a miscode type error on trials in which the "carried over" information obliterated encoding of the sample phase response on the next trial. Application of this strategy, irrespective of outcome, was sufficient to reorient the animal to the proper between trial sequence of response contingencies (nonmatch-to-sample) and boost performance to 73% correct on subsequent trials. The capacity for ensemble analyses of strength of information encoding combined with statistical assessment of trial sequences therefore provided unique insight into the "dynamic" nature of the role hippocampus plays in delay type memory tasks.

  4. (2R)-4-Oxo-4[3-(Trifluoromethyl)-5,6-diihydro:1,2,4}triazolo[4,3-a}pyrazin-7(8H)-y1]-1-(2,4,5-trifluorophenyl)butan-2-amine: A Potent, Orally Active Dipeptidyl Peptidase IV Inhibitor for the Treatment of Type 2 Diabetes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, D.; Wang, L.; Beconi, M.

    2010-11-10

    A novel series of {beta}-amino amides incorporating fused heterocycles, i.e., triazolopiperazines, were synthesized and evaluated as inhibitors of dipeptidyl peptidase IV (DPP-IV) for the treatment of type 2 diabetes. (2R)-4-Oxo-4-[3-(trifluoromethyl)-5,6-dihydro[1,2,4]triazolo[4,3-a]pyrazin-7(8H)-yl]-1-(2,4,5-trifluorophenyl)butan-2-amine (1) is a potent, orally active DPP-IV inhibitor (IC{sub 50} = 18 nM) with excellent selectivity over other proline-selective peptidases, oral bioavailability in preclinical species, and in vivo efficacy in animal models. MK-0431, the phosphate salt of compound 1, was selected for development as a potential new treatment for type 2 diabetes.

  5. Genetics Home Reference: mucolipidosis type IV

    MedlinePlus

    ... PubMed Vergarajauregui S, Puertollano R. Mucolipidosis type IV: the importance of functional lysosomes for efficient autophagy. Autophagy. 2008 ... Reviewed : August 2013 Published : June 26, 2018 The resources on this site should not be used as a substitute ... Department of Health & Human Services National Institutes of Health National Library of ...

  6. Mass loss in the interacting semi-detached binary delta librae

    NASA Technical Reports Server (NTRS)

    Mccluskey, George E., Jr.; Mccluskey, Carolina P. S.; Kondo, Yoji

    1995-01-01

    The interacting Algol-type binary Delta Librae (AOV + G: V) has been observed with the International Ultraviolet Explorer (IUE) satellite. More than fifty high resolution spectra in the far-ultraviolet and mid-ultraviolet spectrum have been analyzed in order to model the mass flow in the Delta Librae system. The resonance lines of Si IV and C IV are present in absorption and vary in strength both secularly and with phase. The radial velocities of the Si IV and C IV absorption lines generally follow the orbital motion of the primary star but deviate by typically a few tens of kilometers per second in the direction of the observer. The presence of Si IV and C IV features indicates the existence of a region considerably hotter than the normal AOV photosphere and, since these lines are present at all phases, this region must be fairly extensive. These results are interpreted in terms of a 'pseudo-photosphere' around the equatorial region of the AOV star, created by matter being accreted from the G-type companion. The widths of the Si IV and C IV absorption features imply that some of the matter lost by the G-star leaves the system entirely.

  7. Comparing Motor Skills in Autism Spectrum Individuals With and Without Speech Delay

    PubMed Central

    Barbeau, Elise B.; Meilleur, Andrée‐Anne S.; Zeffiro, Thomas A.

    2015-01-01

    Movement atypicalities in speed, coordination, posture, and gait have been observed across the autism spectrum (AS) and atypicalities in coordination are more commonly observed in AS individuals without delayed speech (DSM‐IV Asperger) than in those with atypical or delayed speech onset. However, few studies have provided quantitative data to support these mostly clinical observations. Here, we compared perceptual and motor performance between 30 typically developing and AS individuals (21 with speech delay and 18 without speech delay) to examine the associations between limb movement control and atypical speech development. Groups were matched for age, intelligence, and sex. The experimental design included: an inspection time task, which measures visual processing speed; the Purdue Pegboard, which measures finger dexterity, bimanual performance, and hand‐eye coordination; the Annett Peg Moving Task, which measures unimanual goal‐directed arm movement; and a simple reaction time task. We used analysis of covariance to investigate group differences in task performance and linear regression models to explore potential associations between intelligence, language skills, simple reaction time, and visually guided movement performance. AS participants without speech delay performed slower than typical participants in the Purdue Pegboard subtests. AS participants without speech delay showed poorer bimanual coordination than those with speech delay. Visual processing speed was slightly faster in both AS groups than in the typical group. Altogether, these results suggest that AS individuals with and without speech delay differ in visually guided and visually triggered behavior and show that early language skills are associated with slower movement in simple and complex motor tasks. Autism Res 2015, 8: 682–693. © 2015 The Authors Autism Research published by Wiley Periodicals, Inc. on behalf of International Society for Autism Research PMID:25820662

  8. Structural studies of a bifunctional inhibitor of neprilysin and DPP-IV.

    PubMed

    Oefner, Christian; Pierau, Sabine; Schulz, Henk; Dale, Glenn E

    2007-09-01

    Neutral endopeptidase (NEP) is the major enzyme involved in the metabolic inactivation of a number of bioactive peptides including the enkephalins, substance P, endothelin, bradykinin and atrial natriuretic factor, as well as the incretin hormone glucagon-like peptide 1 (GLP-1), which is a potent stimulator of insulin secretion. The activity of GLP-1 is also rapidly abolished by the serine protease dipeptidyl peptidase IV (DPP-IV), which led to an elevated interest in inhibitors of this enzyme for the treatment of type II diabetes. A dual NEP/DPP-IV inhibitor concept is proposed, offering an alternative strategy for the treatment of type 2 diabetes. Here, the synthesis and crystal structures of the soluble extracellular domain of human NEP (residues 52-749) complexed with the NEP, competitive and potent dual NEP/DPP-IV inhibitor MCB3937 are described.

  9. [Mucolipidoses type IV in a patient with mapuche ancestry].

    PubMed

    Hernández Ch, Marta; Méndez C, José Ignacio; Concha G, María José; Huete L, Isidro; González B, Sergio; Durán S, Gloria P

    2008-07-01

    We report a 7 year-old girl with mapuche ancestors, diagnosed as a cerebral palsy since infancy and on active rehabilitation. She acquired motor and cognitive skills at 3 years of age. At 5 years of age, a slow neurological deterioration started, associated to visual impairment. Optic atrophy was added to the typical neurological exam of ataxic cerebral palsy and the diagnosis was re-considered. Neuroimaging showed a slow and progressive atrophy of intracerebral structures and ultramicroscopy revealed intracytoplasmatic inclusions in conjunctiva and skin, compatible with mucolipidoses type IV (ML-IV). ML-IV must be included in the differential diagnosis of cerebral palsy associated with loss of acquired skills and progressive visual impairment. Electron microscopy of skin or conjunctiva is a useful diagnostic test. Suspicion of ML-IV must not be restricted to Ashkenazi Jewish population.

  10. Basement Membrane Type IV Collagen and Laminin: An Overview of Their Biology and Value as Fibrosis Biomarkers of Liver Disease.

    PubMed

    Mak, Ki M; Mei, Rena

    2017-08-01

    Basement membranes provide structural support to epithelium, endothelium, muscles, fat cells, Schwann cells, and axons. Basement membranes are multifunctional: they modulate cellular behavior, regulate organogenesis, promote tissue repair, form a barrier to filtration and tumor metastasis, bind growth factors, and mediate angiogenesis. All basement membranes contain type IV collagen (Col IV), laminin, nidogen, and perlecan. Col IV and laminin self-assemble into two independent supramolecular networks that are linked to nidogen and perlecan to form a morphological discernable basement membrane/basal lamina. The triple helical region, 7S domain and NCI domain of Col IV, laminin and laminin fragment P1 have been evaluated as noninvasive fibrosis biomarkers of alcoholic liver disease, viral hepatitis, and nonalcoholic fatty liver disease. Elevated serum Col IV and laminin are related to degrees of fibrosis and severity of hepatitis, and may reflect hepatic basement membrane metabolism. But the serum assays have not been linked to disclosing the anatomical sites and lobular distribution of perisinusoidal basement membrane formation in the liver. Hepatic sinusoids normally lack a basement membrane, although Col IV is a normal matrix component of the space of Disse. In liver disease, laminin deposits in the space of Disse and codistributes with Col IV, forming a perisinusoidal basement membrane. Concomitantly, the sinusoidal endothelium loses its fenestrae and is transformed into vascular type endothelium. These changes lead to capillarization of hepatic sinusoids, a significant pathology that impairs hepatic function. Accordingly, codistribution of Col IV and laminin serves as histochemical marker of perisinusoidal basement membrane formation in liver disease. Anat Rec, 300:1371-1390, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  11. Odorant transfer characteristics of white bread during baking.

    PubMed

    Onishi, Masanobu; Inoue, Michiko; Araki, Tetsuya; Iwabuchi, Hisakatsu; Sagara, Yasuyuki

    2011-01-01

    The potent odorants in the crust and crumb of white bread were identified and quantified by gas chromatography-mass spectrometry and gas chromatography/olfactometry. The weight loss ratio of the samples baked at 220 °C was controlled in the range of 0-28%. The odorants were classified into 5 types by the transfer characteristics: i) All amounts of odorant transferred from the crust to external space (type-I). ii) All transferred from the crust to the crumb and external space (type-II). iii) Certain amount remaining in the crust and the rest transferred to the crumb and external space (type-III). iv) All transferred from the crumb to external space (type-IV). v) Certain amount remaining in the crumb and the rest transferred to the crust and external space (type-V). The odorants of type-IV were not apparent after the crust had formed. The results indicate that the crust could be a barrier to prevent the odorants from being transferred to external space.

  12. The pharmacokinetics of intraosseous atropine in hypovolemic swine.

    PubMed

    Yost, Jonathan; Baldwin, Phillip; Bellenger, Sarah; Bradshaw, Freida; Causapin, Edna; Demotica, Richelle; Livingston, Michael; Lee, Cynthia; Gegel, Brian; Burgert, James; Claessens, Adam; Johnson, Don; Loughren, Michael

    2015-01-01

    Compare the pharmacokinetics of atropine administered via the intravenous (IV), intramuscular (IM), and intraosseous (IO) routes in a normovolemic and hypovolemic swine model. Prospective, between subjects, experimental study. Vivarium. Yorkshire-cross swine (N = 36). Atropine was administered via IV, IM, or IO routes to normovolemic and hypovolemic swine. Blood samples were drawn at regular intervals after atropine administration and analyzed for plasma atropine concentration. Pharmacokinetic parameters were obtained from modeling the plasma concentrations. Pharmacokinetic parameters, maximum concentration (Cmax) and time to maximum concentration (Tmax). The IV and IO groups in both the normovolemic and hypovolemic models reached peak plasma concentration immediately and had a very rapid distribution phase with no apparent absorption phase for the IO groups. Peak plasma concentration and time to reach peak concentration were both significantly lower for the IM groups. There was a significant increase in absorption time with IM administration in the hypovolemic model compared to the normovolemic model. The IO route is an effective method of administering atropine and is comparable to the IV route even under conditions of significant hemorrhage. Therapeutic levels of atropine may be delayed and possibly difficult to obtain via IM injection in the presence of hypovolemic shock.

  13. Modulation of substance P signaling by dipeptidyl peptidase-IV enzymatic activity in human glioma cell lines.

    PubMed

    Busek, P; Stremenová, J; Krepela, E; Sedo, A

    2008-01-01

    Dipeptidyl peptidase-IV (DPP-IV, CD26) is a serine protease almost ubiquitously expressed on cell surface and present in body fluids. DPP-IV has been suggested to proteolytically modify a number of biologically active peptides including substance P (SP) and the chemokine stromal cell derived factor-1alpha (SDF-1alpha, CXCL12). SP and SDF-1alpha have been implicated in the regulation of multiple biological processes and also induce responses that may be relevant for glioma progression. Both SP and SDF-1alpha are signaling through cell surface receptors and use intracellular calcium as a second messenger. The effect of DPP-IV on intracellular calcium mobilization mediated by SP and SDF-1alpha was monitored in suspension of wild type U373 and DPP-IV transfected U373DPPIV glioma cells using indicator FURA-2. Nanomolar concentrations of SP triggered a transient dose dependent increase in intracellular calcium rendering the cells refractory to repeated stimulation, while SDF-1 had no measurable effect. SP signaling in DPP-IV overexpressing U373DPPIV cells was not substantially different from that in wild type cells. However, preincubation of SP with the DPP-IV overexpressing cells lead to the loss of its signaling potential, which could be prevented with DPP-IV inhibitors. Taken together, DPP-IV may proteolytically inactivate local mediators involved in gliomagenesis.

  14. THE FURTHER SEPARATION OF TYPES AMONG THE PNEUMOCOCCI HITHERTO INCLUDED IN GROUP IV AND THE DEVELOPMENT OF THERAPEUTIC ANTISERA FOR THESE TYPES

    PubMed Central

    Cooper, Georgia; Rosenstein, Carolyn; Walter, Annabel; Peizer, Lenore

    1932-01-01

    The unclassified strains known as Group IV have been separated into twenty-nine types which are designated by the Roman numerals IV and XXXII. Only a small percentage of the pneumococcus strains isolated in New York City for this study were left unclassified. The majority of the types gave very slight cross-reactions, the exceptions being Types II and V, III and VIII, VII and XVIII and XV and XXX. In the series of cases studied, Types IV, V, VII and VIII were found more prevalent in the lobar pneumonia of adults and Types V, VI a and XIV in children. The majority of the types were also found in normal individuals and in persons having respiratory infections other than pneumonia. Types VI a and XIX were most prevalent in the limited number of strains studied by us. Fourteen of the types were found in pneumococcus meningitis; Type XVIII was found most often. Antisera suitable for clinical trial have been prepared for fourteen types. From the majority of the horses inoculated for more than a year, antisera having 500 to 1000 units per cc. were obtained. Antisera of lower potency were concentrated and preparations obtained equal to or stronger than high grade unconcentrated serum. Potent bivalent antisera have been prepared for types which were found to give marked cross-agglutination reactions. The results with each type as to prevalence, severity of cases, presence in normal individuals, and in spinal meningitis, potency of antisera produced for therapeutic trial and virulence of strains for mice have been considered under the different type headings. PMID:19870011

  15. Lithium hydroxide, LiOH, at elevated densities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hermann, Andreas; Ashcroft, N. W.; Hoffmann, Roald

    2014-07-14

    We discuss the high-pressure phases of crystalline lithium hydroxide, LiOH. Using first-principles calculations, and assisted by evolutionary structure searches, we reproduce the experimentally known phase transition under pressure, but we suggest that the high-pressure phase LiOH-III be assigned to a new hydrogen-bonded tetragonal structure type that is unique amongst alkali hydroxides. LiOH is at the intersection of both ionic and hydrogen bonding, and we examine the various ensuing structural features and their energetic driving mechanisms. At P = 17 GPa, we predict another phase transition to a new phase, Pbcm-LiOH-IV, which we find to be stable over a wide pressuremore » range. Eventually, at extremely high pressures of 1100 GPa, the ground state of LiOH is predicted to become a polymeric structure with an unusual graphitic oxygen-hydrogen net. However, because of its ionic character, the anticipated metallization of LiOH is much delayed; in fact, its electronic band gap increases monotonically into the TPa pressure range.« less

  16. Renal, auricular, and ocular outcomes of Alport syndrome and their current management.

    PubMed

    Zhang, Yanqin; Ding, Jie

    2017-09-01

    Alport syndrome is a hereditary glomerular basement membrane disease caused by mutations in the COL4A3/4/5 genes encoding the type IV collagen alpha 3-5 chains. Most cases of Alport syndrome are inherited as X-linked dominant, and some as autosomal recessive or autosomal dominant. The primary manifestations are hematuria, proteinuria, and progressive renal failure, whereas some patients present with sensorineural hearing loss and ocular abnormalities. Renin-angiotensin-aldosterone system blockade is proven to delay the onset of renal failure by reducing proteinuria. Renal transplantation is a curative treatment for patients who have progressed to end-stage renal disease. However, only supportive measures can be used to improve hearing loss and visual loss. Although both stem cell therapy and gene therapy aim to repair the basement membrane defects, technical difficulties require more research in Alport mice before clinical studies. Here, we review the renal, auricular, and ocular manifestations and outcomes of Alport syndrome and their current management.

  17. [Contact allergic gastritis : Rare manifestation of a metal allergy].

    PubMed

    Pföhler, C; Vogt, T; Müller, C S L

    2016-05-01

    Only a few cases of contact allergic gastritis in patients with nickel allergy have been reported in the literature. We report a case of probable contact-allergic gastritis in a 46-year-old woman. Clinical examination revealed lichenoid mucosal lesions of the gums adjacent to a bridge and crowns that had been implanted several weeks previously. Since implantation, the patient suffered from gastrointestinal complaints including stomach pain. Gastroscopy and histological investigation of stomach biopsies showed eosinophilic gastritis. Patch testing done under the diagnosis of contact allergic stomatitis showed positive reactions to gold sodium thiosulphate, manganese (II) chloride, nickel (II) sulphate, palladium chloride, vanadium (III) chloride, zirconium (IV) chloride, and fragrances. The crowns and the bridge contained gold, palladium, and zirconium, hence they were replaced by titan-based dentition. Shortly after replacing the artificial dentition, all gastrointestinal symptoms resolved spontaneously without further treatment. Delayed-type allergy to components in the artificial dentition seem to have caused the gastritis.

  18. Hfq Influences Multiple Transport Systems and Virulence in the Plant Pathogen Agrobacterium tumefaciens

    PubMed Central

    Wilms, Ina; Möller, Philip; Stock, Anna-Maria; Gurski, Rosemarie; Lai, Erh-Min

    2012-01-01

    The Hfq protein mediates gene regulation by small RNAs (sRNAs) in about 50% of all bacteria. Depending on the species, phenotypic defects of an hfq mutant range from mild to severe. Here, we document that the purified Hfq protein of the plant pathogen and natural genetic engineer Agrobacterium tumefaciens binds to the previously described sRNA AbcR1 and its target mRNA atu2422, which codes for the substrate binding protein of an ABC transporter taking up proline and γ-aminobutyric acid (GABA). Several other ABC transporter components were overproduced in an hfq mutant compared to their levels in the parental strain, suggesting that Hfq plays a major role in controlling the uptake systems and metabolic versatility of A. tumefaciens. The hfq mutant showed delayed growth, altered cell morphology, and reduced motility. Although the DNA-transferring type IV secretion system was produced, tumor formation by the mutant strain was attenuated, demonstrating an important contribution of Hfq to plant transformation by A. tumefaciens. PMID:22821981

  19. Evidence for an interaction between leptin, T cell costimulatory antigens CD28, CTLA-4 and CD26 (dipeptidyl peptidase IV) in BCG-induced immune responses of leptin- and leptin receptor-deficient mice.

    PubMed

    Rüter, Jens; Hoffmann, Torsten; Demuth, Hans-Ulrich; Moschansky, Petra; Klapp, Burghard F; Hildebrandt, Martin

    2004-06-01

    We assessed changes of the enzyme dipeptidyl peptidase IV (DPP IV, CD26) in the context of leptin or leptin receptor deficiency. C57BL/6 mice, Leptin-deficient mice (ob/ob mice, B6.V-Lep) and Leptin-receptor-deficient mice (db/db mice, B6.Cg-m+/+Lepr) were infected with B. Calmette-Guerin (BCG) and sacrificed three days later. DPP IV activity in serum was higher in ob/ob mice and in db/db mice than in wild-type mice. The expression of DPP IV/CD26 on splenocytes was higher in ob/ob mice than in wild-type animals, and lower in db/db mice, and decreased upon stimulation with BCG in ob/ob mice only. Several T cell antigens including CTLA-4 were expressed aberrantly in ob/ob and in db/db mice. Our observations provide evidence for a relationship between DPP IV and leptin.

  20. Forecast Vienna Mapping Functions 1 for real-time analysis of space geodetic observations

    NASA Astrophysics Data System (ADS)

    Boehm, J.; Kouba, J.; Schuh, H.

    2009-05-01

    The Vienna Mapping Functions 1 (VMF1) as provided by the Institute of Geodesy and Geophysics (IGG) at the Vienna University of Technology are the most accurate mapping functions for the troposphere delays that are available globally and for the entire history of space geodetic observations. So far, the VMF1 coefficients have been released with a time delay of almost two days; however, many scientific applications require their availability in near real-time, e.g. the Ultra Rapid solutions of the International GNSS Service (IGS) or the analysis of the Intensive sessions of the International VLBI Service (IVS). Here we present coefficients of the VMF1 as well as the hydrostatic and wet zenith delays that have been determined from forecasting data of the European Centre for Medium-Range Weather Forecasts (ECMWF) and provided on global grids. The comparison with parameters derived from ECMWF analysis data shows that the agreement is at the 1 mm level in terms of station height, and that the differences are larger for the wet mapping functions than for the hydrostatic mapping functions and the hydrostatic zenith delays. These new products (VMF1-FC and hydrostatic zenith delays from forecast data) can be used in real-time analysis of geodetic data without significant loss of accuracy.

  1. Deterring Online Advertising Fraud through Optimal Payment in Arrears

    NASA Astrophysics Data System (ADS)

    Edelman, Benjamin

    Online advertisers face substantial difficulty in selecting and supervising small advertising partners: Fraud can be well-hidden, and limited reputation systems reduce accountability. But partners are not paid until after their work is complete, and advertisers can extend this delay both to improve detection of improper partner practices and to punish partners who turn out to be rule-breakers. I capture these relationships in a screening model with delayed payments and probabilistic delayed observation of agents’ types. I derive conditions in which an advertising principal can set its payment delay to deter rogue agents and to attract solely or primarily good-type agents. Through the savings from excluding rogue agents, the principal can increase its profits while offering increased payments to good-type agents. I estimate that a leading affiliate network could have invoked an optimal payment delay to eliminate 71% of fraud without decreasing profit.

  2. Characterization of progesterone profiles in fall-calving Norwegian Red cows.

    PubMed

    Garmo, R T; Martin, A D; Thuen, E; Havrevoll, Ø; Steinshamn, H; Prestløkken, E; Randby, A; Eknaes, M; Waldmann, A; Reksen, O

    2009-10-01

    Progesterone profiles in Norwegian Red cows were categorized, and associations between the occurrence of irregularities in the profiles and the commencement of luteal activity were investigated. The cows were managed in 3 feeding trials from 1994 to 2001 and from 2005 to 2008 at the Norwegian University of Life Sciences. The cows were followed from calving, and the milk samples collected represented 502 lactations from 302 cows. Milk samples for progesterone analysis were taken 3 times weekly from 1994 throughout 1998 and from 2005 to 2008 and 2 times weekly from 1999 to 2001. Commencement of luteal activity was defined as the first day of 2 consecutive measurements of progesterone concentration >or=3 ng/mL not earlier than 10 d after calving. Delayed ovulation type I was defined as consistently low progesterone concentration, <3 ng/mL for >or=50 d postpartum. Delayed ovulation type II was defined as prolonged interluteal interval with milk progesterone measurements <3 ng/mL for >or=12 d between 2 luteal phases. Persistent corpus luteum (PCL) type I was defined as delayed luteolysis with milk progesterone >or=3 ng/mL for >or=19 d during the first estrous cycle postpartum. Persistent corpus luteum type II was defined as delayed luteolysis with milk progesterone >or=3 ng/mL for >or=19 d during subsequent estrous cycles before first artificial insemination. Delayed ovulation type I was present in 14.7%, delayed ovulation type II in 2.8%, PCL type I in 6.7%, and PCL type II in 3.3% of the profiles. Commencement of luteal activity was related to milk yield, parity, PCL type I, and the summated occurrence of PCL type I and II. The least squares means for the interval to commencement of luteal activity were 24.2 d when PCL type I and II were present and 29.5 d when PCL type I and II were absent. The likelihood of pregnancy to first service was not affected in cows with a history of PCL when artificial insemination was carried out at progesterone concentrations <3 ng/mL (i.e., during estrus); however, cows that had experienced PCL were more likely to be inseminated during a luteal phase. The occurrence of delayed ovulation and PCL in Norwegian Red cows was less than that reported in most other dairy populations.

  3. Estimation of delays and other parameters in nonlinear functional differential equations

    NASA Technical Reports Server (NTRS)

    Banks, H. T.; Lamm, P. K. D.

    1983-01-01

    A spline-based approximation scheme for nonlinear nonautonomous delay differential equations is discussed. Convergence results (using dissipative type estimates on the underlying nonlinear operators) are given in the context of parameter estimation problems which include estimation of multiple delays and initial data as well as the usual coefficient-type parameters. A brief summary of some of the related numerical findings is also given.

  4. Drinking status but not acute alcohol consumption influences delay discounting.

    PubMed

    Adams, Sally; Attwood, Angela S; Munafò, Marcus R

    2017-09-01

    The aim of this study was to investigate the following: (a) the effects of acute alcohol on delay discounting; (b) the effects of drinking status on delayed discounting; and (c) whether these effects differ according to reward type (alcohol vs. money). Heavy and light social alcohol users (n = 96) were randomized to receive either an acute dose of alcohol at 0.4 or 0.6 g/kg or placebo in a between-subjects, double-blind design. Delay discounting of alcohol and monetary rewards was measured using a hyperbolic model, with higher scores indicative of greater delay discounting. ANOVA of discount scores indicated a main effect of reward type, where all participants had higher discount scores for alcohol versus money rewards. A main effect of drinking status was also observed, where heavier drinkers had higher discount scores compared with lighter drinkers. We did not observe a main effect of acute alcohol use on delay discounting or the hypothesized interactions between acute alcohol use and drinking status with reward type. Our data suggest that heavier drinkers discount the value of delayed rewards more steeply than lighter drinkers. Delay discounting may therefore be a promising marker of heavy alcohol consumption in social drinkers. Copyright © 2017 John Wiley & Sons, Ltd.

  5. Vascular Ehlers-Danlos syndrome mutations in type III collagen differently stall the triple helical folding.

    PubMed

    Mizuno, Kazunori; Boudko, Sergei; Engel, Jürgen; Bächinger, Hans Peter

    2013-06-28

    Vascular Ehlers-Danlos syndrome (EDS) type IV is the most severe form of EDS. In many cases the disease is caused by a point mutation of Gly in type III collagen. A slower folding of the collagen helix is a potential cause for over-modifications. However, little is known about the rate of folding of type III collagen in patients with EDS. To understand the molecular mechanism of the effect of mutations, a system was developed for bacterial production of homotrimeric model polypeptides. The C-terminal quarter, 252 residues, of the natural human type III collagen was attached to (GPP)7 with the type XIX collagen trimerization domain (NC2). The natural collagen domain forms a triple helical structure without 4-hydroxylation of proline at a low temperature. At 33 °C, the natural collagenous part is denatured, but the C-terminal (GPP)7-NC2 remains intact. Switching to a low temperature triggers the folding of the type III collagen domain in a zipper-like fashion that resembles the natural process. We used this system for the two known EDS mutations (Gly-to-Val) in the middle at Gly-910 and at the C terminus at Gly-1018. In addition, wild-type and Gly-to-Ala mutants were made. The mutations significantly slow down the overall rate of triple helix formation. The effect of the Gly-to-Val mutation is much more severe compared with Gly-to-Ala. This is the first report on the folding of collagen with EDS mutations, which demonstrates local delays in the triple helix propagation around the mutated residue.

  6. Cardiac arrest after anesthetic management in a patient with hereditary sensory autonomic neuropathy type IV.

    PubMed

    Ergül, Yakup; Ekici, Bariş; Keskin, Sabiha

    2011-01-01

    Hereditary sensory autonomic neuropathy type IV is a rare disorder with an autosomal recessive transmission and characterized by self-mutilation due to a lack in pain and heat sensation. Recurrent hyperpyrexia and anhydrosis are seen in patients as a result of a lack of sweat gland innervation. Self-mutilation and insensitivity to pain result in orthopedic complications and patients undergone recurrent surgical interventions with anesthesia. However, these patients are prone to perioperative complications such as hyperthermia, hypothermia, and cardiac complications like bradycardia and hypotension. We report a 5-year-old boy with hereditary sensory autonomic neuropathy type IV, developing hyperpyrexia and cardiac arrest after anesthesia.

  7. Decameter Type IV Burst Associated with a Behind-the-limb CME Observed on 7 November 2013

    NASA Astrophysics Data System (ADS)

    Melnik, V. N.; Brazhenko, A. I.; Konovalenko, A. A.; Dorovskyy, V. V.; Rucker, H. O.; Panchenko, M.; Frantsuzenko, A. V.; Shevchuk, M. V.

    2018-03-01

    We report on the results of observations of a type IV burst made by the Ukrainian Radio interferometer of the Academy of Sciences (URAN-2) in the frequency range 22 - 33 MHz. The burst is associated with a coronal mass ejection (CME) initiated by a behind-the-limb active region (N05E151) and was also observed by the Nançay Decameter Array (NDA) radio telescope in the frequency band 30 - 60 MHz. The purpose of the article is the determination of the source of this type IV burst. After analysis of the observational data obtained with the URAN-2, the NDA, the Solar-Terrestrial Relations Observatory (STEREO) A and B spacecraft, and the Solar and Heliospheric Observatory (SOHO) spacecraft, we come to the conclusion that the source of the burst is the core of a behind-the-limb CME. We conclude that the radio emission can escape the center of the CME core at a frequency of 60 MHz and originates from the periphery of the core at a frequency of 30 MHz that is due to occultation by the solar corona at the corresponding frequencies. We find plasma densities in these regions assuming the plasma mechanism of radio emission. We show that the frequency drift of the start of the type IV burst is governed by an expansion of the CME core. The type III bursts that were observed against this type IV burst are shown to be generated by fast electrons propagating through the CME core plasma. A type II burst was registered at frequencies of 44 - 64 MHz and 3 - 16 MHz and was radiated by a shock with velocities of about 1000 km s^{-1} and 800 km s^{-1}, respectively.

  8. Transport Modeling for Metallic Electrode: Semiconducting Nanotube Systems

    NASA Technical Reports Server (NTRS)

    Yamada, Toshishige; Biegel, Bryan (Technical Monitor)

    2001-01-01

    Recently, current-voltage (I-V) characteristics have been reported by Collins et al. for a system with a scanning tunneling microscope (STM) tip and a carbon nanotube. The STM tip was driven forward into a film of many entangled nanotubes on a substrate, and then was retracted, so that one of nanotubes bridged the STM and the film. I-V characteristics had two different patterns for different heights. One showed large dI/ dV with V greater than 0, small dI/dV with V less than 0, and I = 0 near V = 0 (type-I), while the other showed rectification, i.e., I does not equal 0 only with V less than 0 (type-II), with the tip grounded. We propose a physical mechanism to explain the observed I-V patterns. We consider that the observed characteristics strongly reflected the nature of the tip (metal) - nanotube (semiconductor) contact. The other end of the nanotube was entangled well in the film, and simply provided a good Ohmic contact. We will argue that there are two different contact modes: vacuum gap and touching modes, depending on the presence or absence of a tiny vacuum gap d approx. 0.1 - 0.2 nm at the junction. These modes may be related to physisorption and chemisorption, respectively. Once admitting their existence, it is naturally shown that I-V characteristics are type-I in the vacuum gap mode, and type-II in the touching mode. We argue that the nanotube had to be an n-type semiconductor judging from the I-V characteristics, contrary to often observed p-type in the transistor applications, where p-type is probably due to the oxidation in air or the trapped charges in the silicon dioxide. Additional information is contained in the original extended abstract.

  9. Finite-time stability of neutral-type neural networks with random time-varying delays

    NASA Astrophysics Data System (ADS)

    Ali, M. Syed; Saravanan, S.; Zhu, Quanxin

    2017-11-01

    This paper is devoted to the finite-time stability analysis of neutral-type neural networks with random time-varying delays. The randomly time-varying delays are characterised by Bernoulli stochastic variable. This result can be extended to analysis and design for neutral-type neural networks with random time-varying delays. On the basis of this paper, we constructed suitable Lyapunov-Krasovskii functional together and established a set of sufficient linear matrix inequalities approach to guarantee the finite-time stability of the system concerned. By employing the Jensen's inequality, free-weighting matrix method and Wirtinger's double integral inequality, the proposed conditions are derived and two numerical examples are addressed for the effectiveness of the developed techniques.

  10. Ustur whole body case 0269: demonstrating effectiveness of i.v. CA-DTPA for Pu.

    PubMed

    James, A C; Sasser, L B; Stuit, D B; Glover, S E; Carbaugh, E H

    2007-01-01

    This whole body donation case (USTUR Registrant) involved a single acute inhalation of an acidic Pu(NO3)4 solution in the form of an aerosol 'mist'. Chelation treatment with intravenously (i.v.) Ca-EDTA was initiated on the day of the intake, and continued intermittently over 6 months. After 2.5 y with no further treatment, a course of i.v. Ca-DTPA was administered. A total of 400 measurements of 239+240Pu excreted in urine were recorded; starting on the first day (both before and during the initial Ca-EDTA chelation) and continuing for 37 y. This sampling included all intervals of chelation. In addition, 91 measurements of 239+240Pu-in-feces were recorded over this whole period. The Registrant died about 38 y after the intake, at age 79 y, with extensive carcinomatosis secondary to adenocarcinoma of the prostate gland. At autopsy, all major soft tissue organs were harvested for radiochemical analyses of their 238Pu, 239+240Pu and 241Am content. Also, all types of bone (comprising about half the skeleton) were harvested for radiochemical analyses, as well as samples of skin, subcutaneous fat and muscle. This comprehensive data set has been applied to derive 'chelation-enhanced' transfer rates in the ICRP Publication 67 plutonium biokinetic model, representing the behaviour of blood-borne and tissue-incorporated plutonium during intervals of therapy. The resulting model of the separate effects of i.v. Ca-EDTA and Ca-DTPA chelation shows that the therapy administered in this case succeeded in reducing substantially the long-term burden of plutonium in all body organs, except for the lungs. The calculated reductions in organ content at the time of death are approximately 40% for the liver, 60% for other soft tissues (muscle, skin, glands, etc.), 50% for the kidneys and 50% for the skeleton. Essentially, all of the substantial reduction in skeletal burden occurred in trabecular bone. This modelling exercise demonstrated that 3-y-delayed Ca-DTPA therapy was as effective as promptly administered Ca-EDTA.

  11. USTUR WHOLE BODY CASE 0269: DEMONSTRATING EFFECTIVENESS OF I.V. CA-DTPA FOR PU

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, Anthony C.; Sasser , Lyle B.; Stuit, Dorothy B.

    2008-01-28

    This whole body donation case (USTUR Registrant) involved a single acute inhalation of an acidic Pu(NO3)4 solution in the form of an aerosol ‘mist.’ Chelation treatment with i.v. Ca-EDTA was initiated on the day of the intake, and continued intermittently over 6 months. After 2½ years with no further treatment, a course of i.v. Ca-DTPA was administered. A total of 400 measurements of 239+240Pu excreted in urine were recorded; starting on the first day (both before and during the initial Ca-EDTA chelation), and continuing for 37 years. This sampling included all intervals of chelation. In addition, 91 measurements of 239+240Pu-in-fecesmore » were recorded over this whole period. The Registrant died about 38 years after the intake, at age 79 y, with extensive carcinomatosis secondary to adenocarcinoma of the prostate gland. At autopsy, all major soft tissue organs were harvested for radiochemical analyses of their 238Pu, 239+240Pu and 241Am content. Also, all types of bone (comprising about half the skeleton) were harvested for radiochemical analyses, as well as samples of skin, subcutaneous fat and muscle. This comprehensive dataset has been applied to derive ‘chelation-enhanced’ transfer rates in the ICRP Publication 67 plutonium biokinetic model, representing the behaviour of blood-borne and tissue-incorporated plutonium during intervals of therapy. The resulting model of the separate effects of i.v. Ca-EDTA and Ca-DTPA chelation shows that the therapy administered in this case succeeded in reducing substantially the long-term burden of plutonium in all body organs, except for the lungs. The calculated reductions in organ content at the time of death are approximately 40% for the liver, 60% for other soft tissues (muscle, skin, glands, etc.), 50% for the kidneys, and 50% for the skeleton. Essentially all of the substantial reduction in skeletal burden occurred in trabecular bone. This modeling exercise demonstrated that 3-y-delayed Ca-DTPA therapy was as effective as promptly administered Ca-EDTA.« less

  12. Custom-made versus off-the-shelf multibranched endografts for endovascular repair of thoracoabdominal aortic aneurysms.

    PubMed

    Bisdas, Theodosios; Donas, Konstantinos P; Bosiers, Michel J; Torsello, Giovanni; Austermann, Martin

    2014-11-01

    This study compared early outcomes between the custom-made and the new off-the-shelf multibranched endograft (mbEVAR, t-branch; Cook Medical, Bloomington, Ind) for the endovascular repair of thoracoabdominal aortic aneurysms (TAAAs). Between January 2010 and January 2013, 46 consecutive patients with TAAAs underwent endovascular aortic repair with mbEVARs. A custom-made device was used in 24 patients (group A, 52%), with Crawford classification type I, 2 (8%); type II, 4 (17%); type III, 9 (38%); and type IV/V, 9 (38%), and the a t-branch endograft was used in 22 patients (group B, 47%), with type II, 9 (41%); type III, 12 (55%); and type IV/V, 1 (4%). The main outcome measure was technical success, defined as successful target revascularization without occlusion of the bridging endografts or type I or III endoleak at the completion angiography. Secondary end points were mortality, unplanned reinterventions, branch occlusion, paraplegia, and persistent (after discharge) paraparesis. Technical success was 100% in both groups. The 30-day mortality was 8% in group A (n = 2) and 0% in group B (P = .51). Survival rates at 6 months were 71% in group A (mean follow-up, 13 ± 11 months) and 94% in group B (mean follow-up, 6 ± 3 months; (P = .04). There was only one procedure-related death caused by cerebral bleeding and herniation in group A. The freedom-from-reintervention rate at 6 months was 100% in group A (mean follow-up, 12 ± 11.5 months) and 90% in group B (mean follow-up, 6 ± 3.9 months; P = .07). No branch occlusions were observed in group A, whereas a branch occlusion occurred in three patients in group B (in all cases the bridging endograft for the renal artery). In two patients, the possible reason for branch occlusion was a thrombophilic disorder, whereas in one patient, the reason remains unknown. Paraplegia was observed in one patient in each group (group A: 4%; group B: 5%; P = .51) and persistent paraparesis in two patients in group A (8%) and in one patient (5%) in group B (P = .94). The t-branch device, with the unique advantage of direct implantation without any delay for manufacturing, showed 100% technical success and comparable clinical outcomes to the traditional custom-made mbEVARs. Further long-term evaluation remains mandatory. Copyright © 2014 Society for Vascular Surgery. Published by Elsevier Inc. All rights reserved.

  13. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors.

    PubMed

    Richter, Lubna V; Franks, Ashley E; Weis, Robert M; Sandler, Steven J

    2017-04-15

    Geobacter sulfurreducens , an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c -type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. Copyright © 2017 American Society for Microbiology.

  14. Significance of a Posttranslational Modification of the PilA Protein of Geobacter sulfurreducens for Surface Attachment, Biofilm Formation, and Growth on Insoluble Extracellular Electron Acceptors

    PubMed Central

    Franks, Ashley E.; Weis, Robert M.; Sandler, Steven J.

    2017-01-01

    ABSTRACT Geobacter sulfurreducens, an anaerobic metal-reducing bacterium, possesses type IV pili. These pili are intrinsic structural elements in biofilm formation and, together with a number of c-type cytochromes, are thought to serve as conductive nanowires enabling long-range electron transfer (ET) to metal oxides and graphite anodes. Here, we report that a posttranslational modification of a nonconserved amino acid residue within the PilA protein, the structural subunit of the type IV pili, is crucial for growth on insoluble extracellular electron acceptors. Matrix-assisted laser desorption ionization (MALDI) mass spectrometry of the secreted PilA protein revealed a posttranslational modification of tyrosine-32 with a moiety of a mass consistent with a glycerophosphate group. Mutating this tyrosine into a phenylalanine inhibited cell growth with Fe(III) oxides as the sole electron acceptor. In addition, this amino acid substitution severely diminished biofilm formation on graphite surfaces and impaired current output in microbial fuel cells. These results demonstrate that the capability to attach to insoluble electron acceptors plays a crucial role for the cells' ability to utilize them. The work suggests that glycerophosphate modification of Y32 is a key factor contributing to the surface charge of type IV pili, influencing the adhesion of Geobacter to specific surfaces. IMPORTANCE Type IV pili are bacterial appendages that function in cell adhesion, virulence, twitching motility, and long-range electron transfer (ET) from bacterial cells to insoluble extracellular electron acceptors. The mechanism and role of type IV pili for ET in Geobacter sulfurreducens is still a subject of research. In this study, we identified a posttranslational modification of the major G. sulfurreducens type IV pilin, suggested to be a glycerophosphate moiety. We show that a mutant in which the glycerophosphate-modified tyrosine-32 is replaced with a phenylalanine has reduced abilities for ET and biofilm formation compared with those of the wild type. The results show the importance of the glycerophosphate-modified tyrosine for surface attachment and electron transfer in electrode- or Fe(III)-respiring G. sulfurreducens cells. PMID:28138101

  15. Hereditary sensory and autonomic neuropathy type IV and orthopaedic complications.

    PubMed

    Kim, W; Guinot, A; Marleix, S; Chapuis, M; Fraisse, B; Violas, P

    2013-11-01

    Hereditary sensory and autonomic neuropathy type IV (HSAN-IV) is a very rare autosomal recessive disorder characterized by recurrent episodes of unexplained fever, extensive anhidrosis, total insensitivity to pain, hypotonia, and mental retardation. The most frequent complications of this disease are corneal scarring, multiple fractures, joint deformities, osteomyelitis, and disabling self-mutilations. We reported the case of a 12-year-old boy. The goal was to discuss our decision-making and compare this case with cases described in the literature. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  16. Campylobacter fetus subspecies contain conserved type IV secretion systems on multiple genomic islands and plasmids

    USDA-ARS?s Scientific Manuscript database

    The features contributing to the differences in pathogenicity of the C. fetus subspecies are unknown. Putative factors involved in pathogenesis are located in genomic islands that encode type IV secretion system (T4SS) and fic-domain (filamentation induced by cyclic AMP) proteins. In the genomes of ...

  17. A unique evolution of the kidney phenotype in a patient with autosomal recessive Alport syndrome.

    PubMed

    Vischini, Gisella; Kapp, Meghan E; Wheeler, Ferrin C; Hopp, Laszlo; Fogo, Agnes B

    2018-03-09

    Alport syndrome is due to mutations in one of the genes encoding (α3,4,5) type IV collagen resulting in defective type IV collagen, a key component of the glomerular basement membrane (GBM). The GBM is initially thin, and with ongoing remodeling, develops a thickened basket-woven appearance. We report a unique case of a 9-year-old boy who was biopsied for hematuria and proteinuria, diagnosed as IgA nephropathy, with normal GBM appearance and thickness. Due to a family history of hematuria and chronic kidney disease, he subsequently underwent genetic evaluation and a mutation of α3 type IV collagen (COL4A3) was detected. Additional studies of the initial biopsy demonstrated abnormal type IV collagen immunostaining. A repeat biopsy 4years later showed characteristic glomerular basement membrane morphology of Alport syndrome, and scarring consistent with sequelae of IgA nephropathy. This is the first description of this unusual transition from an initial normal appearance of the glomerular basement membrane to the classic Alport phenotype. Copyright © 2018. Published by Elsevier Inc.

  18. Colorectal laterally spreading tumors show characteristic expression of cell polarity factors, including atypical protein kinase C λ/ι, E-cadherin, β-catenin and basement membrane component.

    PubMed

    Ichikawa, Yasushi; Nagashima, Yoji; Morioka, Kaori; Akimoto, Kazunori; Kojima, Yasuyuki; Ishikawa, Takashi; Goto, Ayumu; Kobayashi, Noritoshi; Watanabe, Kazuteru; Ota, Mitsuyoshi; Fujii, Shoichi; Kawamata, Mayumi; Takagawa, Ryo; Kunizaki, Chikara; Takahashi, Hirokazu; Nakajima, Atsushi; Maeda, Shin; Shimada, Hiroshi; Inayama, Yoshiaki; Ohno, Shigeo; Endo, Itaru

    2014-09-01

    Colorectal flat-type tumors include laterally spreading tumors (LSTs) and flat depressed-type tumors. The former of which shows a predominant lateral spreading growth rather than an invasive growth. The present study examined the morphological characteristics of LSTs, in comparison with polypoid- or flat depressed-type tumors, along with the expression of atypical protein kinase C (aPKC) λ/ι, a pivotal cell polarity regulator, and the hallmarks of cell polarity, as well as with type IV collagen, β-catenin and E-cadherin. In total, 37 flat-type (24 LSTs and 13 flat depressed-type tumors) and 20 polypoid-type colorectal tumors were examined. The LSTs were classified as 15 LST adenoma (LST-A) and nine LST cancer in adenoma (LST-CA). An immunohistochemical examination was performed on aPKC λ/ι, type IV collagen, β-catenin and E-cadherin. The LST-A and -CA showed a superficial replacing growth pattern, with expression of β-catenin and E-cadherin in the basolateral membrane and type IV collagen along the basement membrane. In addition, 86.6% of LST-A and 55.6% of LST-CA showed aPKC λ/ι expression of 1+ (weak to normal intensity staining in the cytoplasm compared with the normal epithelium). Furthermore, ~45% of the polypoid-type adenomas showed 2+ (moderate intensity staining in the cytoplasm and/or nucleus) and 66.7% of the polypoid-type cancer in adenoma were 3+ (strong intensity staining in the cytoplasm and nucleus). A statistically significant positive correlation was observed between the expression of aPKC λ/ι and β-catenin (r=0.842; P<0.001), or type IV collagen (r=0.823; P<0.001). The LSTs showed a unique growth pattern, different from the expanding growth pattern presented by a polypoid tumor and invasive cancer. The growth characteristics of LST appear to be caused by adequate coexpression of β-catenin, type IV collagen and aPKC λ/ι.

  19. Exploring new classification criteria for the earliest type stars: the 3400 Aregion

    NASA Astrophysics Data System (ADS)

    Morrell, Nidia I.; Walborn, Nolan R.; Arias, Julia I.

    2002-02-01

    We propose spectroscopic observations of a sample of standard O2-O4 stars in the wavelength region containing the N IV 3479-83-85 Aand O IV 3381-85-3412 Alines, in order to analyze the behavior of these spectral features as a function of the spectral type. We aim to define new classification criteria for the hottest stars, evaluating these N IV and O IV lines near 3400 Aas possible temperature and luminosity discriminators. The former spectral class O3 has just been split into three different classes: O2, O3 and O3.5 (Walborn et al. 2001). The paucity of classification criteria at these types in the traditional wavelength domain (4000 - 4700 Å), makes clear the need to explore other spectral ranges in order to define additional constraints on the determination of spectral types and luminosity classes. The wavelength range around 3400 Ahas been observed in many faint, crowded early O-type stars by HST/FOS, the corresponding data being available from the HST archive. This enhances our interest in observing this spectral range in the classification standards for the early O-type stars in order to make these existing HST observations even more useful, allowing the determination of accurate spectral types for unknown objects from them, once the behavior of the new criteria in the standards has been charted.

  20. A Solar Stationary Type IV Radio Burst and Its Radiation Mechanism

    NASA Astrophysics Data System (ADS)

    Liu, Hongyu; Chen, Yao; Cho, Kyungsuk; Feng, Shiwei; Vasanth, Veluchamy; Koval, Artem; Du, Guohui; Wu, Zhao; Li, Chuanyang

    2018-04-01

    A stationary Type IV (IVs) radio burst was observed on September 24, 2011. Observations from the Nançay RadioHeliograph (NRH) show that the brightness temperature (TB) of this burst is extremely high, over 10^{11} K at 150 MHz and over 108 K in general. The degree of circular polarization (q) is between -60% ˜ -100%, which means that it is highly left-handed circularly polarized. The flux-frequency spectrum follows a power-law distribution, and the spectral index is considered to be roughly -3 ˜ -4 throughout the IVs. Radio sources of this event are located in the wake of the coronal mass ejection and are spatially dispersed. They line up to present a formation in which lower-frequency sources are higher. Based on these observations, it is suggested that the IVs was generated through electron cyclotron maser emission.

  1. Comparison of the effects of sternal and tibial intraosseous administered resuscitative drugs on return of spontaneous circulation in a swine model of cardiac arrest.

    PubMed

    O'Sullivan, Mara; Martinez, Andre; Long, Audrey; Johnson, Michelle; Blouin, Dawn; Johnson, Arthur D; Burgert, James M

    2016-01-01

    Compare vasopressin, amiodarone, and epinephrine administration by sternal intraosseous (SIO), tibial intraosseous (TIO), and intravenous (IV) routes in a swine model of cardiac arrest. Prospective, randomized, between subjects, experimental design. Laboratory. Male Yorkshire-cross swine (N = 35), seven per group. Swine were randomized to SIO, TIO, IV, cardiopulmonary resuscitation (CPR) with defibrillation, or CPR-only groups. Ventricular fibrillation (VF) was induced under general anesthesia. Mechanical CPR began 2 minutes postarrest. Vasopressin (40 U) was administered to the SIO, TIO, and IV groups 4 minutes postarrest. Defibrillation was performed and amiodarone (300 mg) was administered 6 minutes postarrest. Defibrillation was repeated, and epinephrine (1 mg) was administered 10 minutes postarrest. Defibrillation was repeated every 2 minutes and epinephrine repeated every 4 minutes until return of spontaneous circulation (ROSC) or 26 postarrest minutes elapsed. Rate of ROSC, time to ROSC, and odds of ROSC. There were no significant differences in rate of ROSC between the SIO and TIO (p = 0.22) or IV groups (p = 1.0). Time to ROSC was five times less in the SIO group than the TIO group (p = 0.003) but not compared to IV (p = 0.125). Time to ROSC in the IV group was significantly less than the TIO group (p = 0.04). Odds of ROSC for the SIO group were five times higher compared to the TIO group but same as IV. Odds of ROSC in the IV group were higher than the TIO group. There was a statistically significant delay in the time to ROSC and a clinically significant difference in odds of ROSC when resuscitative drugs, including lipophilic amiodarone, were administered by the TIO route compared to the SIO and IV routes in a swine model of sudden cardiac arrest. Further investigations are warranted to isolate the mechanism behind these findings.

  2. Practice patterns for the use of iodinated i.v. contrast media for pediatric CT studies: a survey of the Society for Pediatric Radiology.

    PubMed

    Callahan, Michael J; Servaes, Sabah; Lee, Edward Y; Towbin, Alexander J; Westra, Sjirk J; Frush, Donald P

    2014-04-01

    There are limited data available on the use of i.v. contrast media for CT studies in the pediatric population. The purpose of this study is to determine the practice patterns of i.v. contrast media usage for pediatric CT by members of the Society for Pediatric Radiology (SPR). SPR members were surveyed regarding the use of i.v. contrast media for pediatric CT studies. Questions pertained to information required before administering i.v. contrast media, types of central catheters for injecting i.v. contrast media, injection rates based on angiocatheter size and study type, and management of i.v. contrast media extravasation. The response rate of 6% (88/1545) represented practice patterns of 26% (401/1545) of the SPR membership. Most respondents thought the following clinical information was mandatory before i.v. contrast media administration: allergy to i.v. contrast media (97%), renal insufficiency (97%), current metformin use (72%), significant allergies (61%), diabetes (54%), and asthma (52%). Most administered i.v. contrast media through nonimplanted central venous catheters (78%), implanted venous ports (78%), and peripherally inserted central catheters (72%). The most common maximum i.v. contrast media injection rates were 5.0 mL/s or greater for a 16-gauge angiocatheter, 4.0 mL/s for an 18-gauge angiocatheter, 3.0 mL/s for a 20-gauge angiocatheter, and 2.0 mL/s for a 22-gauge angiocatheter. For soft-tissue extravasation of i.v. contrast media, 95% elevate the affected extremity, 76% use ice, and 45% use heat. The results of this survey illustrate the collective opinion of a subset of SPR members relating to the use of i.v. contrast media in pediatric CT, providing guidelines for clinical histories needed before i.v. contrast media, maximum i.v. contrast injection rates for standard angiocatheters, contrast media injection rates for specific CT studies, and management of i.v. contrast media soft-tissue extravasation.

  3. A study of lip print pattern in Goan dental students - A digital approach.

    PubMed

    Prabhu, Rachana V; Dinkar, Ajit; Prabhu, Vishnudas

    2012-10-01

    To find the incidence of different types of lip patterns, the dominant pattern, quadrant wise, amongst the Goan population. To assess, the quadrant wise differences in lip patterns among males and females and to report new lip print pattern in Goan population. Lip prints of 100 students studying in Goa Dental College & Hospital were taken using 14 mm wide and 50 mm long Scotch tape without any distortion. These prints were then scanned (256 gray shades at a resolution of 300 dpi.) for the digital analysis. Using various applications of Adobe Photoshop 7 software an attempt was made to trace each and every line. K. Suzuki and Y. Tsuchihashi's classification was followed to define the patterns of the grooves. The current study has found the most predominant pattern in Quadrant I to be Type V (580 lines; 52.39%) followed in order by Type I' (196 lines; 17.70%), Type I (166 lines; 14.99%), Type II (166 lines; 10.47%), Type IV (40 lines; 3.61%), Type III (9 lines; 0.81%). In Quadrant II of this study the most predominant pattern recorded was Type V (589 lines; 50.47%) followed in order by Type I' (209 lines; 17.90%), Type I (204 lines; 17.48%), Type II (130 lines; 11.13%), Type IV (34 lines; 2.91%), Type III (1 line; 0.08%). In Quadrant III of this study the most predominant pattern recorded was again Type V (484 lines; 52.09%) followed in order by Type I' (174 lines; 18.72%), Type I (155 lines; 16.68%), Type II (102 lines; 10.97%), Type IV (9 lines; 0.96%), Type III (5 lines; 0.53%). In Quadrant IV of this study the most predominant pattern recorded was Type V (543 lines; 58.19%) followed in order by Type I (151 lines; 16.18%), Type I' (138 lines; 14.79%), Type II (85 lines; 9.11%), Type III (9 lines; 0.96%), Type IV (7 line; 0.75%). In all four Quadrants the most predominant pattern found in males and females was Type V. The present study recorded the following types of type V patterns for the first time; Trifurcations, Bridge or 'H' pattern, Horizontal Lines, Cartwheel, Pineapple Skin and Multiple Branching Appearance. The digital method of analyzing the Lip Print images using Adobe Photoshop 7 software serves as a convenient method that provides better visualization and ease in identification and recording of the Lip Print pattern. Predominant pattern in all four quadrants was Type V followed by the linear pattern i.e. Type I' in quadrants I, II, and III and Type I in quadrant IV in the studied population. Distribution of pattern is not affected by the sex. Although type V is the most predominant pattern found in Goan population, the sub-classification of this type defines the more defined term and aids in accuracy of the classification. Copyright © 2012. Published by Elsevier Ltd.

  4. Insights into early extracellular matrix evolution: spongin short chain collagen-related proteins are homologous to basement membrane type IV collagens and form a novel family widely distributed in invertebrates.

    PubMed

    Aouacheria, Abdel; Geourjon, Christophe; Aghajari, Nushin; Navratil, Vincent; Deléage, Gilbert; Lethias, Claire; Exposito, Jean-Yves

    2006-12-01

    Collagens are thought to represent one of the most important molecular innovations in the metazoan line. Basement membrane type IV collagen is present in all Eumetazoa and was found in Homoscleromorpha, a sponge group with a well-organized epithelium, which may represent the first stage of tissue differentiation during animal evolution. In contrast, spongin seems to be a demosponge-specific collagenous protein, which can totally substitute an inorganic skeleton, such as in the well-known bath sponge. In the freshwater sponge Ephydatia mülleri, we previously characterized a family of short-chain collagens that are likely to be main components of spongins. Using a combination of sequence- and structure-based methods, we present evidence of remote homology between the carboxyl-terminal noncollagenous NC1 domain of spongin short-chain collagens and type IV collagen. Unexpectedly, spongin short-chain collagen-related proteins were retrieved in nonsponge animals, suggesting that a family related to spongin constitutes an evolutionary sister to the type IV collagen family. Formation of the ancestral NC1 domain and divergence of the spongin short-chain collagen-related and type IV collagen families may have occurred before the parazoan-eumetazoan split, the earliest divergence among extant animal phyla. Molecular phylogenetics based on NC1 domain sequences suggest distinct evolutionary histories for spongin short-chain collagen-related and type IV collagen families that include spongin short-chain collagen-related gene loss in the ancestors of Ecdyzosoa and of vertebrates. The fact that a majority of invertebrates encodes spongin short-chain collagen-related proteins raises the important question to the possible function of its members. Considering the importance of collagens for animal structure and substratum attachment, both families may have played crucial roles in animal diversification.

  5. Anomalous ionization seen in the spectra of B supergiants

    NASA Technical Reports Server (NTRS)

    Cassinelli, J. P.; Abbott, D. C.

    1981-01-01

    An IUE survey of B supergiants has been conducted to study the persistence with spectral type of the ultraviolet resonance lines of N V, C IV and Si IV. N V is seen as late as B2.5Ia, C IV until B6Ia and Si IV throughout the range from B1.5 to B9. This is in fairly good agreement with the Auger ionization model of Cassinelli and Olson (1979). The terminal velocities are derived for the 20 stars in the sample and it is found that the ratio v(T)/v(esc) decreases monotonically with spectral type from the value of 3.0 that it has in the O spectral range to the value 1.0 at B9Ia.

  6. Acute surgical treatment of perforated peptic ulcer in the elderly patients.

    PubMed

    Su, Yen-Hao; Yeh, Chi-Chuan; Lee, Chih-Yuan; Lin, Mong-Wei; Kuan, Chen-Hsiang; Lai, I-Rue; Chen, Chiung-Nien; Lin, Hong-Mau; Lee, Po-Huang; Lin, Ming-Tsan

    2010-01-01

    Emergency abdominal surgery is associated with high morbidity and mortality rates, especially in the elderly patients, but prompt diagnoses and treatment should not be delayed. We conducted a retrospective review (1) to identify risk factors for morbidity and mortality among elderly patients admitted for emergent surgery of perforated peptic ulcers; and (2) to determine whether there were any differences between those who are 70-79 years old and those 80 years old and older. 94 patients who were older than 70 years old and underwent emergency surgery for perforated peptic ulcer between 2000 and 2004 in our institution were reviewed retrospectively. The following variables were followed: age, sex, comorbidity, previous medications, time from onset of symptoms/signs to surgery, time from arrival in emergent room to surgery, perioperative risks, operative findings, type of operation, morbidity, mortality and length of hospital stay. The age, morbidity, mortality and the length of intensive care unit stay were increased in Group 2 (>80 yrs) than Group 1 (70 to 79 yrs), but they did not achieve significant differences statistically. Time from symptoms/signs to emergency room over 24 hours, American Society of Anesthesiologist grade over IV and limited procedure showed significant contributions to postoperative morbidity on univariate analysis. Comorbidity, time from emergency room to operation room over 12 hours, American Society of Anesthesiologists grade over IV, peri-operative blood transfusion, postoperative morbidity and duration of ICU stays over 5 days were significant factors contributed to mortality on univariate analysis. Further analysis showed comorbidity, peri-operative blood transfusion, and postoperative morbidity were independent and predictive factors of mortality on multivariate model. Although perforated peptic ulcer in the elderly patients is associated with high morbidity and mortality, we should not delay the surgical intervention for patients with advanced age. Timely diagnosis and early surgical management of perforated peptic ulcers was imperative for elderly patients. The abdominal computer tomography was recommended in elderly patients for who had vague and atypical clinical symptoms/signs of perforated peptic ulcer. In addition, more attention should be paid to patients with preoperative comorbidities, peri-operative blood transfusion and post-operative morbidity for which were associated with high post-operative mortality.

  7. Medical devices manufactured from latex: European regulatory initiatives.

    PubMed

    De Jong, W H; Geertsma, R E; Tinkler, J J B

    2002-05-01

    In Europe the marketing of medical devices manufactured from latex is regulated by directives describing the essential (safety) requirements that products have to fulfill to obtain marketing approval. This paper describes the general requirements for marketing medical devices in Europe and, more specifically, the requirements for products manufactured from natural rubber latex. The requirements for marketing medical devices can be fulfilled by using the relevant harmonized European standards. These standards are regularly under revision to incorporate the latest scientific developments. For certain devices, for example, latex medical (examination and surgical) gloves, specific standards have been published. Medical devices manufactured from latex pose a serious problem because of the risk of induction of allergy both against the latex proteins inherently present (type I or immediate type allergy) and against chemicals added during processing (type IV or delayed type hypersensitivity) present as residues in the latex products. So, besides requirements for product quality in terms of barrier properties, strength, and sterility, the main focus consists of the allergy-inducing properties of the latex products. Recent developments have reopened the discussion on the value of total protein versus allergen determination in latex medical gloves. However, as long as minimal levels needed for both sensitization and elicitation have not been established, a safe maximum level for leachable proteins/allergens in latex products cannot be determined. A European Commission guidance document on the latex allergy problem is currently being drafted by experts from Competent Authorities. Copyright 2002 Elsevier Science (USA).

  8. SOME COMMENTS ON TYPE IV BURSTS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, H.; Kakinuma, T.

    1962-01-01

    It has become clear that a large continuum burst is composed of 4 distinctive types, CM/sub 1/, CM/sub 2/, DM, and IV, which originate from different altitudes over the photosphere. The observational characters of each type are given. CM/sub 1/ is the main phase of a centimeter-wave burst originating from about 0.02-0.05 R/sub S/ in height. DM burst is polarized in the ordinary sense, which is the cause of reversal of polarization with frequency. Its center frequency lies between about 1000 and 200 Mc/s, and is often misunderstood as the original Type IV burst. The movement of magnetic field duringmore » a burst is suggested. CM/sub 2/ may be considered as an enhancement of the upper part of the source of S-component caused by this movement of the field. (auth)« less

  9. Singular cosmological evolution using canonical and ghost scalar fields

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nojiri, Shin'ichi; Odintsov, S.D.; Oikonomou, V.K.

    2015-09-01

    We demonstrate that finite time singularities of Type IV can be consistently incorporated in the Universe's cosmological evolution, either appearing in the inflationary era, or in the late-time regime. While using only one scalar field instabilities can in principle occur at the time of the phantom-divide crossing, when two fields are involved we are able to avoid such instabilities. Additionally, the two-field scalar-tensor theories prove to be able to offer a plethora of possible viable cosmological scenarios, at which various types of cosmological singularities can be realized. Amongst others, it is possible to describe inflation with the appearance of amore » Type IV singularity, and phantom late-time acceleration which ends in a Big Rip. Finally, for completeness, we also present the Type IV realization in the context of suitably reconstructed F(R) gravity.« less

  10. Towards equation of state of dark energy from quasar monitoring: Reverberation strategy

    NASA Astrophysics Data System (ADS)

    Czerny, B.; Hryniewicz, K.; Maity, I.; Schwarzenberg-Czerny, A.; Życki, P. T.; Bilicki, M.

    2013-08-01

    Context. High-redshift quasars can be used to constrain the equation of state of dark energy. They can serve as a complementary tool to supernovae Type Ia, especially at z > 1. Aims: The method is based on the determination of the size of the broad line region (BLR) from the emission line delay, the determination of the absolute monochromatic luminosity either from the observed statistical relation or from a model of the formation of the BLR, and the determination of the observed monochromatic flux from photometry. This allows the luminosity distance to a quasar to be obtained, independently from its redshift. The accuracy of the measurements is, however, a key issue. Methods: We modeled the expected accuracy of the measurements by creating artificial quasar monochromatic lightcurves and responses from the BLR under various assumptions about the variability of a quasar, BLR extension, distribution of the measurements in time, accuracy of the measurements, and the intrinsic line variability. Results: We show that the five-year monitoring of a single quasar based on the Mg II line should give an accuracy of 0.06-0.32 mag in the distance modulus which will allow new constraints to be put on the expansion rate of the Universe at high redshifts. Successful monitoring of higher redshift quasars based on C IV lines requires proper selection of the objects to avoid sources with much higher levels of the intrinsic variability of C IV compared to Mg II.

  11. Characteristics of fetal anticonvulsant syndrome associated autistic disorder.

    PubMed

    Rasalam, A D; Hailey, H; Williams, J H G; Moore, S J; Turnpenny, P D; Lloyd, D J; Dean, J C S

    2005-08-01

    The aim of this study was to evaluate the clinical features and frequency of autistic disorder or Asperger syndrome (AS; according to Diagnostic and Statistical Manual of Mental Disorders, 4th edition [DSM-IV] criteria) in children exposed to anticonvulsant medication in utero. During a 20-year study period, 626 children were born in Aberdeen to mothers taking antiepileptic drugs (AEDs). The study examined long-term effects of prenatal exposure to AEDs in 260 children (122 males, 138 females). Of these, 26 (16 males) were reported by parents to have social or behavioural difficulties. Eleven children (6 males, 5 females) fulfilled the DSM-IV criteria for autistic disorder and one (female) fulfilled the DSM-IV criteria for AS. These children comprised 4.6% of the exposed children studied, and 1.9% of all exposed children born during the study period. Mean age of these children at diagnosis was 5 years 4 months (SD 2y 11mo) and 9 years 10 months (SD 3y 10mo) at the time of this study. Other children from the group of 26 had difficulties in areas of speech and language development and social communication but did not meet the criteria for an autism spectrum disorder (ASD). Sodium valproate was the drug most commonly associated with autistic disorder, five of 56 (8.9%) of the study children exposed to sodium valproate alone had either autistic disorder or AS. It was concluded that prenatal exposure to anticonvulsant medication is a risk factor for the development of an ASD. Fetal anticonvulsant syndrome associated autistic disorder is characterized by an even sex ratio, absence of regression or skill loss, and language delay in the absence of global delay.

  12. Intestinal expression of human apolipoprotein A-IV in transgenic mice fails to influence dietary lipid absorption or feeding behavior.

    PubMed Central

    Aalto-Setälä, K; Bisgaier, C L; Ho, A; Kieft, K A; Traber, M G; Kayden, H J; Ramakrishnan, R; Walsh, A; Essenburg, A D; Breslow, J L

    1994-01-01

    Two transgenic mouse lines, expressing low or high amounts of human apo A-IV were created. In low and high expressor HuAIVTg mice on a chow diet, serum human apo A-IV levels were 6 and 25 times the normal human level and on a high fat diet, they were 12 and 77 times higher. Human apo A-IV was equally distributed between lipoprotein (mainly HDL) and lipid-free fractions. Intestinal absorption of radiolabeled cholesterol and triglycerides was unaffected in HuAIVTg mice. Vitamin A, carried exclusively in chylomicrons and their remnants, was catabolized normally. When an intragastric vitamin E bolus is given to the HuAIVTg mice, the initial absorption and appearance in triglyceride-rich lipoproteins was similar to that observed in normal mice. However, elevated amounts of vitamin E were subsequently observed in the VLDL of the HuAIVTg mice. Furthermore, in the fed state, serum VLDL triglycerides were markedly elevated in HuAIVTg mice. This effect was greater in high expressor mice. Serum total cholesterol was not elevated, but the distribution was altered in the HuAIVTg mice; VLDL-C was increased at the expense of VLDL-C. Kinetic studies suggested a delayed clearance of VLDL in HuAIVTg mice. Apo A-IV has been suggested to be a satiety factor, but no effect on feeding behavior or weight gain was observed in these HuAIVTg mice. In summary, our studies with HuAIVTg mice show that additional apo A-IV does not effect intestinal absorption of fat and fat-soluble vitamins, and at least chronic elevation of plasma apo A-IV does not effect feeding behavior in this model system. Images PMID:8163677

  13. Effects of Mineral Compositions on Matrix Diffusion and Sorption of 75Se(IV) in Granite.

    PubMed

    Yang, Xiaoyu; Ge, Xiangkun; He, Jiangang; Wang, Chunli; Qi, Liye; Wang, Xiangyun; Liu, Chunli

    2018-02-06

    Exploring the migration behaviors of selenium in granite is critical for the safe disposal of radioactive waste. The matrix diffusion and sorption of 75 Se(IV) (analogue for 79 Se) in granite were systematically studied to set reliable parameters in this work. Through-diffusion and batch sorption experiments were conduct with four types of Beishan granite. The magnitudes of the obtained apparent diffusion coefficient (D a ) values are of the following order: monzogranite > granodiorite-2 > granodiorite-1, which is opposite to the sequence of the K d values obtained from both the diffusion model and batch sorption experiments. The EPMA results of the granitic flakes showed that there was no obvious enrichment of Se(IV) on quartz, microcline and albite. Only biotite showed a weak affinity for Se(IV). Macroscopic sorption behaviors of Se(IV) on the four types of granite were identical with the sequence of the granitic biotite contents. Quantitative fitting results were also provided. XPS and XANES spectroscopy data revealed that bidentate inner-sphere complexes were formed between Se(IV) and Fe(III). Our results indicate that biotite can be representative of the Se(IV) sorption in complex mineral assemblages such as granite, and the biotite contents are critically important to evaluate Se(IV) transport in granite.

  14. The effect of caudal vs intravenous morphine on early extubation and postoperative analgesic requirements for stage 2 and 3 single-ventricle palliation: a double blind randomized trial.

    PubMed

    Stuth, Eckehard A E; Berens, Richard J; Staudt, Susan R; Robertson, Frederick A; Scott, John P; Stucke, Astrid G; Hoffman, George M; Troshynski, Todd J; Tweddell, James S T; Zuperku, Edward J

    2011-04-01

    High-dose single-shot caudal morphine has been postulated to facilitate early extubation and to lower initial analgesic requirements after staged single-ventricle (SV) palliation. With Institutional Review Board approval and written informed parental consent, 64 SV children aged 75-1667 days were randomized to pre-incisional caudal morphine-bupivacaine (100 μg·kg(-1) morphine (concentration 0.1%), mixed with 0.25% bupivacaine with 1 : 200,000 epinephrine, total 1 ml·kg(-1)) and postcardiopulmonary bypass (CPB) intravenous (IV) droperidol (75 μg·kg(-1)) ('active caudal group') or pre-incisional caudal saline (1 ml·kg(-1)) and post-CPB IV morphine (150 μg·kg(-1)) with droperidol (75 μg·kg(-1)) ('active IV group'). Assignment remained concealed from families and the care teams throughout the trial. Early extubation failure rates (primary or reintubation within 24 h), time to first postoperative rescue morphine analgesia, and 12-h postoperative morphine requirements were assessed for extubated patients. Thirty-one (12 stage 2) SV patients received caudal morphine and 32 (15 stage 2) received IV morphine. Extubation failure rates were 6/31 (19%) for caudal and 5/32 (16%) for IV morphine. For successfully extubated patients (n = 54), active caudal treatment significantly delayed the need for postoperative rescue morphine in stage 3 patients (P = 0.02) but not in stage 2 patients (P = 0.189) (Kaplan-Meier survival analysis with LogRank test). The reduction in 12-h postoperative morphine requirements with active caudal treatment did not reach significance (P = 0.085) but morphine requirements were significantly higher for stage 2 compared with stage 3 patients (P < 0.001) (two-way anova in n = 50 extubated patients). High-dose caudal morphine with bupivacaine delayed the need for rescue morphine analgesia in stage 3 patients. All stage 2 patients required early rescue morphine and had significantly higher postoperative 12-h morphine requirements than stage 3 patients. Early extubation is feasible for the majority of stage 2 and 3 SV patients regardless of analgesic regimen. The study was underpowered to assess differences in extubation failure rates. © 2011 Blackwell Publishing Ltd.

  15. Delay discounting of food by rhesus monkeys: Cocaine and food choice in isomorphic and allomorphic situations.

    PubMed

    Huskinson, Sally L; Woolverton, William L; Green, Leonard; Myerson, Joel; Freeman, Kevin B

    2015-06-01

    Research on delay discounting has focused largely on nondrug reinforcers in an isomorphic context in which choice is between alternatives that involve the same type of reinforcer. Less often, delay discounting has been studied with drug reinforcers in a more ecologically valid allomorphic context where choice is between alternatives involving different types of reinforcers. The present experiment is the first to examine discounting of drug and nondrug reinforcers in both isomorphic and allomorphic situations using a theoretical model (i.e., the hyperbolic discounting function) that allows for comparisons of discounting rates between reinforcer types and amounts. The goal of the current experiment was to examine discounting of a delayed, nondrug reinforcer (food) by male rhesus monkeys when the immediate alternative was either food (isomorphic situation) or cocaine (allomorphic situation). In addition, we sought to determine whether there was a magnitude effect with delayed food in the allomorphic situation. Choice of immediate food and immediate cocaine increased with amount and dose, respectively. Choice functions for immediate food and cocaine generally shifted leftward as delay increased. Compared to isomorphic situations in which food was the immediate alternative, delayed food was discounted more steeply in allomorphic situations where cocaine was the immediate alternative. Notably, discounting was not affected by the magnitude of the delayed reinforcer. These data indicate that how steeply a delayed nondrug reinforcer is discounted may depend more on the qualitative characteristics of the immediate reinforcer and less on the magnitude of the delayed one. (c) 2015 APA, all rights reserved).

  16. Beta-ketoacyl-acyl carrier protein synthase IV: a key enzyme for regulation of medium-chain fatty acid synthesis in Cuphea lanceolata seeds.

    PubMed

    Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich

    2002-09-01

    With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.

  17. Air pollution is associated with brainstem auditory nuclei pathology and delayed brainstem auditory evoked potentials.

    PubMed

    Calderón-Garcidueñas, Lilian; D'Angiulli, Amedeo; Kulesza, Randy J; Torres-Jardón, Ricardo; Osnaya, Norma; Romero, Lina; Keefe, Sheyla; Herritt, Lou; Brooks, Diane M; Avila-Ramirez, Jose; Delgado-Chávez, Ricardo; Medina-Cortina, Humberto; González-González, Luis Oscar

    2011-06-01

    We assessed brainstem inflammation in children exposed to air pollutants by comparing brainstem auditory evoked potentials (BAEPs) and blood inflammatory markers in children age 96.3±8.5 months from highly polluted (n=34) versus a low polluted city (n=17). The brainstems of nine children with accidental deaths were also examined. Children from the highly polluted environment had significant delays in wave III (t(50)=17.038; p<0.0001) and wave V (t(50)=19.730; p<0.0001) but no delay in wave I (p=0.548). They also had significantly longer latencies than controls for interwave intervals I-III, III-V, and I-V (all t(50)>7.501; p<0.0001), consisting with delayed central conduction time of brainstem neural transmission. Highly exposed children showed significant evidence of inflammatory markers and their auditory and vestibular nuclei accumulated α synuclein and/or β amyloid(1-42). Medial superior olive neurons, critically involved in BAEPs, displayed significant pathology. Children's exposure to urban air pollution increases their risk for auditory and vestibular impairment. Copyright © 2011 ISDN. Published by Elsevier Ltd. All rights reserved.

  18. Effect of the glucocorticoid receptor antagonist Org 34850 on fast and delayed feedback of corticosterone release.

    PubMed

    Spiga, Francesca; Harrison, Louise R; Wood, Susan A; MacSweeney, Cliona P; Thomson, Fiona J; Craighead, Mark; Grassie, Morag; Lightman, Stafford L

    2008-02-01

    We investigated the effect of the glucocorticoid receptor (GR) antagonist Org 34850 on fast and delayed inhibition of corticosterone secretion in response to the synthetic glucocorticoid methylprednisolone (MPL). Male rats were implanted with a catheter in the right jugular vein, for blood sampling and MPL administration, and with an s.c. cannula for Org 34850 administration. All experiments were conducted at the diurnal hormonal peak in the late afternoon. Rats were connected to an automated sampling system and blood samples were collected every 5 or 10 min. Org 34850 (10 mg/kg, s.c.) or vehicle (5% mulgofen in saline) was injected at 1630 h; 30 min later, rats received an injection of MPL (500 microg/rat, i.v.) or saline (0.1 ml/rat). We found that an acute administration of MPL rapidly decreased the basal corticosterone secretion and this effect was not prevented by acute pretreatment with Org 34850. However, blockade of GR with Org 34850 prevented delayed inhibition of MPL on corticosterone secretion measured between 4 and 12 h after MPL administration. Our data suggest an involvement of GR in modulating delayed, but not fast, inhibition induced by MPL on basal corticosterone secretion.

  19. Pros and Cons While Looking Through an Asian Window on the Rome IV Criteria for Irritable Bowel Syndrome: Pros.

    PubMed

    Ghoshal, Uday C

    2017-07-30

    A decade after Rome III, in 2016, Rome IV criteria were published. There are major differences between Rome IV and the earlier iteration, some of which are in line with Asian viewpoints. The clinical applicability of the Rome IV criteria of irritable bowel syndrome (IBS) in Asian perspective is reviewed here. Instead of considering functional gastrointestinal disorders (FGIDs) to be largely psychogenic, Rome IV suggested the importance of the gut over brain ("disorders of gut-brain interaction" not "brain-gut interaction"). The word "functional" is underplayed. Multi-dimensional clinical profile attempts to recognize micro-organic nature, like slow colon transit and fecal evacuation disorders in constipation and dietary intolerance including that of lactose and fructose, bile acid malabsorption, non-celiac wheat sensitivity, small intestinal bacterial overgrowth, and gastrointestinal infection in diarrhea. Overlap between different FGIDs has been recognized as Rome IV suggests these to be a spectrum rather than discrete disorders. Bloating, common in Asia, received attention, though less. Sub-typing of IBS may be more clinician-friendly now as the patient-reported stool form may be used than a diary. However, a few issues, peculiar to Asia, need consideration; Rome IV, like Rome III, suggests that Bristol type I-II stool to denote constipation though Asian experts include type III as well. Work-up for physiological factors should be given greater importance. Language issue is important. Bloating, common in IBS, should be listed in the criteria. Threshold values for symptoms in Rome IV criteria are based on Western data. Post-infectious malabsorption (tropical sprue) should be excluded to diagnose post-infectious IBS, particularly in Asia.

  20. Glycated Apolipoprotein A-IV Induces Atherogenesis in Patients With CAD in Type 2 Diabetes.

    PubMed

    Dai, Yang; Shen, Ying; Li, Qing Run; Ding, Feng Hua; Wang, Xiao Qun; Liu, Hong Juan; Yan, Xiao Xiang; Wang, Ling Jie; Yang, Ke; Wang, Hai Bo; Chen, Qiu Jing; Shen, Wei Feng; Zhang, Rui Yan; Lu, Lin

    2017-10-17

    Nonenzymatic glycation of apolipoproteins plays a role in the pathogenesis of the vascular complications of diabetes. This study investigated whether apolipoprotein (apo) A-IV was glycated in patients with type 2 diabetes mellitus (T2DM) and whether apoA-IV glycation was related to coronary artery disease (CAD). The study also determined the biological effects of glycated apoA-IV. The authors consecutively enrolled 204 patients with T2DM without CAD (Group I), 515 patients with T2DM with CAD (Group II), and 176 healthy subjects (control group) in this study. ApoA-IV was precipitated from ultracentrifugally isolated high-density lipoprotein, and its glycation level was determined based on Western blotting densitometry (relative intensity of apoA-IV glycation). ApoA-IV NƐ-(carboxylmethyl) lysine (CML) modification sites were identified by mass spectrometry in 37 control subjects, 63 patients in Group I, and 138 patients in Group II. Saline or glycated apoA-IV (g-apoA-IV) generated by glyoxal culture was injected into apoE -/- mice to evaluate atherogenesis, and was also used for the cell experiments. The relative intensity and the abundance of apoA-IV glycation were associated with the presence and severity of CAD in patients with T2DM (all p < 0.05). The experiments showed that g-apoA-IV induced proinflammatory reactions in vitro and promoted atherogenesis in apoE -/- mice through the nuclear receptor NR4A3. G-apoA-IV with mutations (K-A) at high-frequency glycation sites exhibited more weakened proinflammatory and atherogenic effects than did g-apoA-IV both in vitro and in vivo. ApoA-IV glycation is associated with CAD severity in patients with T2DM, and g-apoA-IV induces atherogenesis through NR4A3 in apoE -/- mice. Copyright © 2017 American College of Cardiology Foundation. Published by Elsevier Inc. All rights reserved.

  1. Neural Correlates of a Default Response in a Delayed Go/No-Go Task

    ERIC Educational Resources Information Center

    Kalenscher, Tobias; Gunturkun, Onur; Calabrese, Pasquale; Gehlen, Walter; Kalt, Thomas; Diekamp, Bettina

    2005-01-01

    Working memory, the ability to temporarily retain task-relevant information across a delay, is frequently investigated using delayed matching-to-sample (DMTS) or delayed Go/No-Go tasks (DGNG). In DMTS tasks, sample cues instruct the animal which type of response has to be executed at the end of a delay. Typically, performance decreases with…

  2. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Technical Reports Server (NTRS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-01-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  3. The flare origin of Forbush decreases not associated with solar flares on the visible hemisphere of the Sun

    NASA Astrophysics Data System (ADS)

    Iucci, N.; Parisi, M.; Signorini, C.; Storini, M.; Villoresi, G.

    1985-08-01

    Investigations have shown that Forbush decreases (Fds) are produced by the propagation into the interplanetary space of a strong perturbation originating from a solar flare (Sf) accompanied by Type IV radioemission. As the front of the perturbation propagates into the interplanetary space, the region in which the galactic cosmic rays are modulated (Fd-modulated region) rotates westward with the Sun and is generally included between two boundary streams; therefore the Fds not associated with observed type IV Sfs (N.Ass.Fds) are likely to be produced by type IV Sfs occurred on the Sun's backside: these vents can be observed when the Earth crosses the corotating Western boundary of the modulated region.

  4. [Determinants of patient and health system delays for women with breast cancer in Morocco, 2013].

    PubMed

    Benbakhta, B; Tazi, M; Benjaafar, N; Khattabi, A; Maaroufi, A

    2015-06-01

    In Morocco, breast cancer is the first most common cancer in women. It is diagnosed in most cases at an advanced stage. Delay in diagnosis and access to treatment for breast cancer increases morbidity and mortality. The objective of this study was to determine the consultation delay (patient delay), diagnosis delay and access to treatment delay (health system delays) of women with breast cancer admitted at the National Institute of Oncology in Rabat. Factors associated with these delays were analyzed. We conducted a cross-sectional study from December 2012 to May 2013 at the National Institute of Oncology in Rabat. Two hundred eligible and consenting women were interviewed using a structured and pre-tested questionnaire. Stages I and II were identified as "early stages" and III and IV as "advanced stages". In our population, 54% were diagnosed at an early stage of breast cancer and 46% at an advanced stage. The median total delay was 120 days (interquartile interval [IIQ]=81-202 days). The patient delay (median=65 days, IIQ=31-121) was longer than the health system delay (median=50 days, IIQ=29-77). High risk for a long total delay (more than 4 months) was observed for women who were aged over 65 years (OR=1.30, 95% CI 1.10-4.20), illiterate (OR=4.50, 95% CI 2.10-6.20), rural residents (OR=3.40, 95% CI 1.23-8.13), in a lower socioeconomic category (OR=4.75, 95% CI 1.45-15.60), without knowledge about breast self-examination (OR=5.67, 95% CI 2.65-12.15) and seen more than 2 times before diagnosis (OR=7.70, 95% CI 2.88-20.50). A long total delay increased the risk of being diagnosed at an advanced stage (OR=5.62, 95% CI 3.03-10.45). Efforts should be directed to providing good information to the population at risk, better access to screening and continuing medical training to enable diagnosis and early treatment. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  5. Immunohistochemical diagnosis of Alport's syndrome in paraffin-embedded renal sections: antigen retrieval with autoclave heating.

    PubMed

    Naito, Ichiro; Ninomiya, Yoshifumi; Nomura, Shinsuke

    2003-03-01

    Alport's syndrome (AS) is a hereditary renal disease caused by mutations in the genes encoding collagen type IV. Immunohistochemical analysis of the alpha chains of collagen type IV has been found to be useful for the diagnosis of this disease. The monoclonal antibodies (mAbs) generated by us recognize alpha 1(IV) through alpha 6(IV) chains of collagen type IV on fresh-frozen sections but not on paraffin-embedded sections. Antigen retrieval by autoclave heating has been found to restore the epitopes recognized by the mAbs; however the heating conditions had not been well established. In this study, the heating conditions were carefully examined using renal sections obtained from AS and non-AS patients. The heating was performed in an autoclave, at 105 degrees -127 degrees C for 6-8 min. During the heating, the sections were immersed in 0.2 N HCl solution (pH 0.9). Then, the mAbs were applied for 30 min, and the bound mAbs were detected using the LSAB kit. The optimal temperature for the antigen retrieval varied among specimens, and was dependent on the type of basement membrane examined. Thus, it was considered that heating at two or three different temperatures could be helpful for the precise diagnosis of AS. Adopting the antigen retrieval method could extend the possibility of immunohistochemical diagnosis of AS to cases without using fresh-frozen sections.

  6. Lean diesel technology and human health: a case study in six Brazilian metropolitan regions.

    PubMed

    André, Paulo Afonso de; Veras, Mariana Matera; Miraglia, Simone Georges El Khouri; Saldiva, Paulo Hilário Nascimento

    2012-01-01

    Due to their toxicity, diesel emissions have been submitted to progressively more restrictive regulations in developed countries. However, in Brazil, the implementation of the Cleaner Diesel Technologies policy (Euro IV standards for vehicles produced in 2009 and low-sulfur diesel with 50 ppm of sulfur) was postponed until 2012 without a comprehensive analysis of the effect of this delay on public health parameters. We aimed to evaluate the impact of the delay in implementing the Cleaner Diesel Technologies policy on health indicators and monetary health costs in Brazil. The primary estimator of exposure to air pollution was the concentration of ambient fine particulate matter (particles with aerodynamic diameters <2.5 μm, [PM2.5]). This parameter was measured daily in six Brazilian metropolitan areas during 2007-2008. We calculated 1) the projected reduction in the PM2.5 that would have been achieved if the Euro IV standards had been implemented in 2009 and 2) the expected reduction after implementation in 2012. The difference between these two time curves was transformed into health outcomes using previous dose-response curves. The economic valuation was performed based on the DALY (disability-adjusted life years) method. The delay in implementing the Cleaner Diesel Technologies policy will result in an estimated excess of 13,984 deaths up to 2040. Health expenditures are projected to be increased by nearly US$ 11.5 billion for the same period. The present results indicate that a significant health burden will occur because of the postponement in implementing the Cleaner Diesel Technologies policy. These results also reinforce the concept that health effects must be considered when revising fuel and emission policies.

  7. The dopamine antagonist cis-flupenthixol blocks the expression of the conditioned positive but not the negative effects of cocaine in rats

    PubMed Central

    Wenzel, Jennifer M.; Su, Zu-In; Shelton, Kerisa; Dominguez, Hiram M.; von Furstenberg, Victoria A.; Ettenberg, Aaron

    2013-01-01

    Human cocaine users report that the initial “high” produced by cocaine administration is followed by an anxiogenic “crash”. Given that cocaine has such robust and opposing properties, it is likely that both the positive and negative effects of cocaine contribute to an individual’s motivation to administer the drug. Despite this likelihood, the neurobiology underlying cocaine’s dual processes remains unclear. While much literature supports a role for dopamine (DA) in cocaine reward, it is uncertain if DA also contributes to the drug’s negative effects. Our laboratory has extensively utilized a modified conditioned place test to explore cocaine’s opponent processes. In this paradigm rats develop conditioned place preferences (CPPs) for an environment paired with the immediate/positive effects of cocaine, and conditioned place aversions (CPAs) for an environment paired with the delayed/negative effects present 15-min after i.v. injection. In the current study rats were conditioned to associate an environment with either the immediate or delayed effects of i.v. cocaine (1 mg/kg/0.1 ml) three hours after i.p. pre-treatment with either the DA D1/D2 receptor antagonist cis-flupenthixol (0.5 mg/kg/ml) or saline vehicle. As expected, vehicle-treated control animals developed the normal pattern of CPPs for cocaine’s immediate effects or CPAs for the delayed effects of cocaine. However, while DA receptor antagonism prevented the expression of cocaine CPPs it did not alter the expression of cocaine-induced CPAs. These data confirm a role for DA transmission in cocaine reward but suggest that different neural pathways mediate the drug’s negative/anxiogenic properties. PMID:24012795

  8. In vitro biorelevant models for evaluating modified release mesalamine products to forecast the effect of formulation and meal intake on drug release.

    PubMed

    Andreas, Cord J; Chen, Ying-Chen; Markopoulos, Constantinos; Reppas, Christos; Dressman, Jennifer

    2015-11-01

    Postprandial administration of solid oral dosage forms greatly changes the dissolution environment compared to fasted state administration. The aims of this study were to investigate and forecast the effect of co-administration of a meal on drug release for delayed and/or extended release mesalamine formulations as well as design of in vitro tests to distinguish among formulations in a biorelevant way. Five different mesalamine formulations (Asacol® 400 mg, Mezavant® 1200 mg, Pentasa® 500 mg and Salofalk® in the 250 mg and 500 mg strengths) were investigated with biorelevant dissolution methods using the USP apparatus III and USP apparatus IV (open loop mode) under both fasted and fed state conditions, as well as with the dissolution methods described in pharmacopeia for delayed and extended release mesalamine products. Using the biorelevant experimental conditions proposed in this study, changes in release in the proximal gut due to meal intake are forecast to be minimal for Asacol®, Mezavant®, Pentasa® and Salofalk® 500 mg, while for Salofalk® 250 mg release was predicted to occur much earlier under fed state conditions. The USP apparatus III generally tended to result in faster dissolution rates and forecast more pronounced food effects for Salofalk® 250 mg than the USP apparatus IV. The biorelevant dissolution gradients were also able to reflect the in vivo behavior of the formulations. In vitro biorelevant models can be useful in the comparison of the release behavior from different delayed and extended release mesalamine formulations as well as forecasting effects of concomitant meal intake on drug release. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Primary Angioplasty in Patients Older Than 75 Years. Profile of Patients and Procedures, Outcomes, and Predictors of Prognosis in the ESTROFA IM+75 Registry.

    PubMed

    de la Torre Hernández, José M; Brugaletta, Salvatore; Gómez Hospital, Joan A; Baz, José A; Pérez de Prado, Armando; López Palop, Ramón; Cid, Belén; García Camarero, Tamara; Diego, Alejandro; Gimeno de Carlos, Federico; Fernández Díaz, José A; Sanchis, Juan; Alfonso, Fernando; Blanco, Roberto; Botas, Javier; Navarro Cuartero, Javier; Moreu, José; Bosa, Francisco; Vegas Valle, José M; Elízaga, Jaime; Arrebola, Antonio L; Ruiz Arroyo, José R; Hernández-Hernández, Felipe; Salvatella, Neus; Monteagudo, Marta; Gómez Jaume, Alfredo; Carrillo, Xavier; Martín Reyes, Roberto; Lozano, Fernando; Rumoroso, José R; Andraka, Leire; Domínguez, Antonio J

    2017-02-01

    The proportion of elderly patients undergoing primary angioplasty is growing. The present study describes the clinical profile, procedural characteristics, outcomes, and predictors of outcome. A 31-center registry of consecutive patients older than 75 years treated with primary angioplasty. Clinical and procedural data were collected, and the patients underwent clinical follow-up. The study included 3576 patients (39.3% women, 48.5% with renal failure, 11.5% in Killip III or IV, and 29.8% with>6hours of chest pain). Multivessel disease was present in 55.4% and nonculprit lesions were additionally treated in 24.8%. Radial access was used in 56.4%, bivalirudin in 11.8%, thromboaspiration in 55.9%, and drug-eluting stents in 26.6%. The 1-month and 2-year incidences of cardiovascular death were 10.1% and 14.7%, respectively. The 2-year rates of definite or probable thrombosis, repeat revascularization, and BARC bleeding>2 were 3.1%, 2.3%, and 4.2%, respectively. Predictive factors were diabetes mellitus, renal failure, atrial fibrillation, delay to reperfusion>6hours, ejection fraction<45%, Killip class III-IV, radial access, bivalirudin, drug-eluting stents, final TIMI flow of III, and incomplete revascularization at discharge. Notable registry findings include frequently delayed presentation and a high prevalence of adverse factors such as renal failure and multivessel disease. Positive procedure-related predictors include shorter delay, use of radial access, bivalirudin, drug-eluting stents, and complete revascularization before discharge. Copyright © 2016 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.

  10. Impact on mortality of prompt admission to critical care for deteriorating ward patients: an instrumental variable analysis using critical care bed strain.

    PubMed

    Harris, Steve; Singer, Mervyn; Sanderson, Colin; Grieve, Richard; Harrison, David; Rowan, Kathryn

    2018-05-07

    To estimate the effect of prompt admission to critical care on mortality for deteriorating ward patients. We performed a prospective cohort study of consecutive ward patients assessed for critical care. Prompt admissions (within 4 h of assessment) were compared to a 'watchful waiting' cohort. We used critical care strain (bed occupancy) as a natural randomisation event that would predict prompt transfer to critical care. Strain was classified as low, medium or high (2+, 1 or 0 empty beds). This instrumental variable (IV) analysis was repeated for the subgroup of referrals with a recommendation for critical care once assessed. Risk-adjusted 90-day survival models were also constructed. A total of 12,380 patients from 48 hospitals were available for analysis. There were 2411 (19%) prompt admissions (median delay 1 h, IQR 1-2) and 9969 (81%) controls; 1990 (20%) controls were admitted later (median delay 11 h, IQR 6-26). Prompt admissions were less frequent (p < 0.0001) as strain increased from low (22%), to medium (15%) to high (9%); the median delay to admission was 3, 4 and 5 h respectively. In the IV analysis, prompt admission reduced 90-day mortality by 7.4% (95% CI 1.7-18.5%, p = 0.117) overall, and 16.2% (95% CI 1.1-31.3%, p = 0.036) for those recommended for critical care. In the risk-adjust survival model, 90-day mortality was similar. After allowing for unobserved prognostic differences between the groups, we find that prompt admission to critical care leads to lower 90-day mortality for patients assessed and recommended to critical care.

  11. Type a niemann-pick disease. Description of three cases with delayed myelination.

    PubMed

    D'Amico, A; Sibilio, M; Caranci, F; Bartiromo, F; Taurisano, R; Balivo, F; Melis, D; Parenti, G; Cirillo, S; Elefante, R; Brunetti, A

    2008-06-03

    We describe three patients with type A Niemann-Pick disease (NPD-A). NPD-A is an autosomal recessive neuronal storage disease classified among the sphingolipidoses, characterized by accumulation of sphingomyelin in various tissues and in the brain. Magnetic Resonance imaging (MRI) of our three patients showed a marked delay of myelination with frontal atrophy. Few descriptions of this MRI pattern of delayed myelination have been published to date.

  12. Altered neural reward representations in pathological gamblers revealed by delay and probability discounting.

    PubMed

    Miedl, Stephan F; Peters, Jan; Büchel, Christian

    2012-02-01

    The neural basis of excessive delay discounting and reduced risk sensitivity of pathological gamblers with a particular focus on subjective neural reward representations has not been previously examined. To examine how pathological gamblers represent subjective reward value at a neural level and how this is affected by gambling severity. Model-based functional magnetic resonance imaging study with patients and control subjects. Department of Systems Neuroscience, University Medical Center Hamburg-Eppendorf. Participants were recruited from the local community by advertisement and through self-help groups. A sample of 16 pathological gamblers (according to the DSM-IV definition) was matched by age, sex, smoking status, income, educational level, and handedness to 16 healthy controls. Pathological gamblers showed increased discounting of delayed rewards and a trend toward decreased discounting of probabilistic rewards compared with matched controls. At the neural level, a significant group × condition interaction indicated that reward representations in the gamblers were modulated in a condition-specific manner, such that they exhibited increased (delay discounting) and decreased (probability discounting) neural value correlations in the reward system. In addition, throughout the reward system, neuronal value signals for delayed rewards were negatively correlated with gambling severity. The results extend previous reports of a generally hypoactive reward system in pathological gamblers by showing that, even when subjective reward valuation is accounted for, gamblers still show altered reward representations. Furthermore, results point toward a gradual degradation of mesolimbic reward representations for delayed rewards during the course of pathological gambling.

  13. Variation in arterial supply to the floor of the mouth and assessment of relative hemorrhage risk in implant surgery.

    PubMed

    Katsumi, Yuji; Tanaka, Ray; Hayashi, Takafumi; Koga, Taketo; Takagi, Ritsuo; Ohshima, Hayato

    2013-04-01

    Bleeding in the floor of the mouth during implant surgery is attributed to arterial injuries in the sublingual space: clinicians may injure the submental and sublingual arteries, which originate from the facial and lingual arteries, respectively. This study aimed to clarify the three-dimensional courses of submental and sublingual arteries and their topographic relation to the mandible. During the gross anatomy course at the Faculty of Dentistry and Graduate School, Niigata University (2009-2011), we investigated the relationship between the courses of submental and sublingual arteries and their dividing patterns of the mylohyoid muscle, sublingual gland, and mandible using 27 human cadavers. The courses of submental and sublingual arteries were divided into four patterns: (1) the sublingual space was supplied by the sublingual artery (type I: 63%), (2) it was supplied by both the sublingual and submental arteries (type II: 5.6%), (3) it was supplied by the submental artery without the sublingual artery (type III: 29.6%), and (4) type III without the deep lingual artery originated from the lingual artery (type IV: 1.8%). In type II, III, and IV, the submental artery perforates the mylohyoid muscle or takes a roundabout route to travel near the surface of the mandible. The percentage occurrence of arteries traveling between the sublingual gland and mandible in type II, III, and IV (55%) is higher than that in type I (8.8%). Susceptibility of the submental artery in type II, III, and IV to injury during implant surgery is suggested. © 2011 John Wiley & Sons A/S.

  14. Global attractivity of positive periodic solution to periodic Lotka-Volterra competition systems with pure delay

    NASA Astrophysics Data System (ADS)

    Tang, Xianhua; Cao, Daomin; Zou, Xingfu

    We consider a periodic Lotka-Volterra competition system without instantaneous negative feedbacks (i.e., pure-delay systems) x(t)=x(t)[r(t)-∑j=1na(t)x(t-τ(t))], i=1,2,…,n. We establish some 3/2-type criteria for global attractivity of a positive periodic solution of the system, which generalize the well-known Wright's 3/2 criteria for the autonomous delay logistic equation, and thereby, address the open problem proposed by both Kuang [Y. Kuang, Global stability in delayed nonautonomous Lotka-Volterra type systems without saturated equilibria, Differential Integral Equations 9 (1996) 557-567] and Teng [Z. Teng, Nonautonomous Lotka-Volterra systems with delays, J. Differential Equations 179 (2002) 538-561].

  15. A systematic review of the management and outcome of ERCP related duodenal perforations using a standardized classification system.

    PubMed

    Cirocchi, Roberto; Kelly, Michael Denis; Griffiths, Ewen A; Tabola, Renata; Sartelli, Massimo; Carlini, Luigi; Ghersi, Stefania; Di Saverio, Salomone

    2017-12-01

    The incidence of duodenal perforation after ERCP ranges from 0.09% to 1.67% and mortality up to 8%. This systematic review was registered in Prospective Register of Systematic Reviews, PROSPERO. Stapfer classification of ERCP-related duodenal perforations was used. The systematic search yielded 259 articles. Most frequent post-ERCP perforation was Stapfer type II (58.4%), type I second most frequent perforation (17.8%) followed by Stapfer type III in 13.2% and type IV in 10.6%. Rate of NOM was lowest in Stapfer type I perforations (13%), moderate in type III lesions (58.1%) and high in other types of perforations (84.2% in type II and 84.6% in IV). In patients underwent early surgical treatment (<24 h from ERCP) the most frequent operation was simple duodenal suture with or without omentopexy (93.7%). In patients undergoing late surgical treatment (>24 h from ERCP) interventions performed were more complex. In type I lesions post-operative mortality rate was higher in patients underwent late operation (>24 h). In type I lesions, failure of NOM occurred in 42.8% of patients. In type II failure of NOM occurred in 28.9% of patients and in type III there was failure of NOM in only 11.1%, none in type IV. Postoperative mortality after NOM failure was 75% in type I, 22.5% in type II and none died after surgical treatment for failure of NOM in type III perforations. This systematic review showed that in patients with Stapfer type I lesions, early surgical treatment gives better results, however the opposite seems true in Stapfer III and IV lesions. Copyright © 2017 Royal College of Surgeons of Edinburgh (Scottish charity number SC005317) and Royal College of Surgeons in Ireland. Published by Elsevier Ltd. All rights reserved.

  16. Criteria for choosing an intravenous infusion line intended for multidrug infusion in anaesthesia and intensive care units.

    PubMed

    Maiguy-Foinard, Aurélie; Genay, Stéphanie; Lannoy, Damien; Barthélémy, Christine; Lebuffe, Gilles; Debaene, Bertrand; Odou, Pascal; Décaudin, Bertrand

    2017-02-01

    The aims are to identify critical parameters influencing the drug mass flow rate of infusion delivery to patients during multidrug infusion and to discuss their clinical relevance. A review of literature was conducted in January 2016 using Medline, Google Scholar, ScienceDirect, Web of Science and Scopus online databases. References relating to the accuracy of fluid delivery via gravity-flow intravenous (IV) infusion systems and positive displacement pumps, components of IV administration sets, causes of flow rate variability, potential complications due to flow rate variability, IV therapies especially at low flow rates and drug compatibilities were considered relevant. Several parameters impact the delivery of drugs and fluids by IV infusion. Among them are the components of infusion systems that particularly influence the flow rate of medications and fluids being delivered. By their conception, they may generate significant start-up delays and flow rate variability. Performing multidrug infusion requires taking into account two main points: the common dead volume of drugs delivered simultaneously with potential consequences on the accuracy and amount of drug delivery and the prevention of drug incompatibilities and their clinical effects. To prevent the potentially serious effects of flow rate variability on patients, clinicians should receive instruction on the fluid dynamics of an IV administration set and so be able to take steps to minimise flow rate changes during IV therapy. Copyright © 2016 Société française d’anesthésie et de réanimation (Sfar). Published by Elsevier Masson SAS. All rights reserved.

  17. Continued expansion of USA300-like methicillin-resistant Staphylococcus aureus (MRSA) among hospitalized patients in the United States.

    PubMed

    Tickler, Isabella A; Goering, Richard V; Mediavilla, Jose R; Kreiswirth, Barry N; Tenover, Fred C

    2017-08-01

    We characterized spa types, SCCmec types, and antimicrobial resistance patterns of 516 methicillin-resistant Staphylococcus aureus (MRSA) isolates, collected between 2011 and 2014 from nares and blood cultures of United States patients. Among nares isolates, 45 spa types were observed; 29.9% were t002/SCCmec II and 30.9% were t008/SCCmec IV. Among blood isolates, 40 spa types were identified; 24.4% were t002/SCCmec II and 39.9% were type t008/SCCmec IV. Compared to data from our 2009-2010 survey, the percentage of t008/SCCmec IV isolates from nares increased significantly (20.4%-30.9%; P=0.004) while the percentage from positive blood cultures remained similar (39.2% versus 39.9%; P=0.921). There were also significant changes in the overall antimicrobial resistance patterns observed, including the decrease of the clindamycin, erythromycin, levofloxacin and moxifloxacin multidrug resistance pattern, likely the result of t002/SCCmec II strains being displaced by t008/SCCmec IV strains. Rates of high-level mupirocin resistance did not change significantly from our past study (4.1% compared to 4.7%; P=0.758) but an increase in low-level resistance, particularly among t002/SCCmec II isolates, was observed. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Detection and modeling of leakage current in AlGaN-based deep ultraviolet light-emitting diodes

    DOE PAGES

    Moseley, Michael William; Allerman, Andrew A.; Crawford, Mary H.; ...

    2015-03-01

    Current-voltage (IV) characteristics of two AlGaN-based deep ultraviolet (DUV) light-emitting diodes (LEDs) with differing densities of open-core threading dislocations (nanopipes) are analyzed. A three-diode circuit is simulated to emulate the IV characteristics of the DUV-LEDs, but is only able to accurately model the lower leakage current, lower nanopipe density DUV-LED. It was found that current leakage through the nanopipes in these structures is rectifying, despite nanopipes being previously established as inherently n-type. Using defect-sensitive etching, the nanopipes are revealed to terminate within the p-type GaN capping layer of the DUV-LEDs. The circuit model is modified to account for another p-nmore » junction between the n-type nanopipes and the p-type GaN, and an excellent fit to the IV characteristics of the leaky DUV-LED is achieved.« less

  19. Chemical Basis for Qualitative and Quantitative Differences Between ABO Blood Groups and Subgroups: Implications for Organ Transplantation.

    PubMed

    Jeyakanthan, M; Tao, K; Zou, L; Meloncelli, P J; Lowary, T L; Suzuki, K; Boland, D; Larsen, I; Burch, M; Shaw, N; Beddows, K; Addonizio, L; Zuckerman, W; Afzali, B; Kim, D H; Mengel, M; Shapiro, A M J; West, L J

    2015-10-01

    Blood group ABH(O) carbohydrate antigens are carried by precursor structures denoted type I-IV chains, creating unique antigen epitopes that may differ in expression between circulating erythrocytes and vascular endothelial cells. Characterization of such differences is invaluable in many clinical settings including transplantation. Monoclonal antibodies were generated and epitope specificities were characterized against chemically synthesized type I-IV ABH and related glycans. Antigen expression was detected on endomyocardial biopsies (n = 50) and spleen (n = 11) by immunohistochemical staining and on erythrocytes by flow cytometry. On vascular endothelial cells of heart and spleen, only type II-based ABH antigens were expressed; type III/IV structures were not detected. Type II-based ABH were expressed on erythrocytes of all blood groups. Group A1 and A2 erythrocytes additionally expressed type III/IV precursors, whereas group B and O erythrocytes did not. Intensity of A/B antigen expression differed among group A1 , A2 , A1 B, A2 B and B erythrocytes. On group A2 erythrocytes, type III H structures were largely un-glycosylated with the terminal "A" sugar α-GalNAc. Together, these studies define qualitative and quantitative differences in ABH antigen expression between erythrocytes and vascular tissues. These expression profiles have important implications that must be considered in clinical settings of ABO-incompatible transplantation when interpreting anti-ABO antibodies measured by hemagglutination assays with reagent erythrocytes. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  20. Bevacizumab and Cediranib Maleate in Treating Patients With Metastatic or Unresectable Solid Tumor, Lymphoma, Intracranial Glioblastoma, Gliosarcoma or Anaplastic Astrocytoma

    ClinicalTrials.gov

    2014-02-14

    Adult Grade III Lymphomatoid Granulomatosis; Adult Nasal Type Extranodal NK/T-cell Lymphoma; Anaplastic Large Cell Lymphoma; Angioimmunoblastic T-cell Lymphoma; Childhood Burkitt Lymphoma; Childhood Diffuse Large Cell Lymphoma; Childhood Grade III Lymphomatoid Granulomatosis; Childhood Immunoblastic Large Cell Lymphoma; Childhood Nasal Type Extranodal NK/T-cell Lymphoma; Cutaneous B-cell Non-Hodgkin Lymphoma; Extranodal Marginal Zone B-cell Lymphoma of Mucosa-associated Lymphoid Tissue; Hepatosplenic T-cell Lymphoma; Intraocular Lymphoma; Nodal Marginal Zone B-cell Lymphoma; Noncutaneous Extranodal Lymphoma; Peripheral T-cell Lymphoma; Progressive Hairy Cell Leukemia, Initial Treatment; Recurrent Adult Burkitt Lymphoma; Recurrent Adult Diffuse Large Cell Lymphoma; Recurrent Adult Diffuse Mixed Cell Lymphoma; Recurrent Adult Diffuse Small Cleaved Cell Lymphoma; Recurrent Adult Hodgkin Lymphoma; Recurrent Adult Immunoblastic Large Cell Lymphoma; Recurrent Adult Lymphoblastic Lymphoma; Recurrent Adult T-cell Leukemia/Lymphoma; Recurrent Childhood Anaplastic Large Cell Lymphoma; Recurrent Childhood Large Cell Lymphoma; Recurrent Childhood Lymphoblastic Lymphoma; Recurrent Childhood Small Noncleaved Cell Lymphoma; Recurrent Grade 1 Follicular Lymphoma; Recurrent Grade 2 Follicular Lymphoma; Recurrent Grade 3 Follicular Lymphoma; Recurrent Mantle Cell Lymphoma; Recurrent Mycosis Fungoides/Sezary Syndrome; Recurrent/Refractory Childhood Hodgkin Lymphoma; Refractory Hairy Cell Leukemia; Small Intestine Lymphoma; Splenic Marginal Zone Lymphoma; Stage IV Adult Burkitt Lymphoma; Stage IV Adult Diffuse Large Cell Lymphoma; Stage IV Adult Diffuse Mixed Cell Lymphoma; Stage IV Adult Diffuse Small Cleaved Cell Lymphoma; Stage IV Adult Hodgkin Lymphoma; Stage IV Adult Immunoblastic Large Cell Lymphoma; Stage IV Adult Lymphoblastic Lymphoma; Stage IV Adult T-cell Leukemia/Lymphoma; Stage IV Childhood Anaplastic Large Cell Lymphoma; Stage IV Childhood Hodgkin Lymphoma; Stage IV Childhood Large Cell Lymphoma; Stage IV Childhood Lymphoblastic Lymphoma; Stage IV Childhood Small Noncleaved Cell Lymphoma; Stage IV Grade 1 Follicular Lymphoma; Stage IV Grade 2 Follicular Lymphoma; Stage IV Grade 3 Follicular Lymphoma; Stage IV Mantle Cell Lymphoma; Stage IVA Mycosis Fungoides/Sezary Syndrome; Stage IVB Mycosis Fungoides/Sezary Syndrome; T-cell Large Granular Lymphocyte Leukemia; Testicular Lymphoma; Unspecified Adult Solid Tumor, Protocol Specific; Unspecified Childhood Solid Tumor, Protocol Specific; Waldenström Macroglobulinemia

  1. Specific Phobia among U.S. Adolescents: Phenomenology and Typology

    PubMed Central

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2014-01-01

    Background Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. Methods The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13–18 years in the continental United States. Results Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Conclusions Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. PMID:23108894

  2. Protease nexin 1 is a potent urinary plasminogen activator inhibitor in the presence of collagen type IV.

    PubMed

    Crisp, Robert J; Knauer, Mary F; Knauer, Daniel J

    2002-12-06

    Protease nexin 1 (PN1) in solution forms inhibitory complexes with thrombin or urokinase, which have opposing effects on the blood coagulation cascade. An initial report provided data supporting the idea that PN1 target protease specificity is under the influence of collagen type IV (1). Although collagen type IV demonstrated no effect on the association rate between PN1 and thrombin, the study reported that the association rate between PN1 and urokinase was allosterically reduced 10-fold. This has led to the generally accepted idea that the primary role of PN1 in the brain is to act as a rapid thrombin inhibition and clearance mechanism during trauma and loss of vascular integrity. In studies to identify the structural determinants of PN1 that mediate the allosteric interaction with collagen type IV, we found that protease specificity was only affected after transient exposure of PN1 to acidic conditions that mimic the elution protocol from a monoclonal antibody column. Because PN1 used in previous studies was purified over a monoclonal antibody column, we propose that the allosteric regulation of PN1 target protease specificity by collagen type IV is a result of the purification protocol. We provide both biochemical and kinetic data to support this conclusion. This finding is significant because it implies that PN1 may play a much larger role in the modeling and remodeling of brain tissues during development and is not simply an extravasated thrombin clearance mechanism as previously suggested.

  3. The Association of Increased Total Glycosylated Hemoglobin Levels with Delayed Age at Menarche in Young Women with Type 1 Diabetes

    PubMed Central

    Danielson, Kirstie K.; Palta, Mari; Allen, Catherine; D’Alessio, Donn J.

    2005-01-01

    Context: Delayed menarche is associated with subsequent reproductive and skeletal complications. Previous research has found delayed growth and pubertal maturation with type 1 diabetes and with poor glycemic control. The effect of diabetes management on menarche is important to clarify because tighter control might prevent these complications. Objective: To investigate age at menarche in young women with type 1 diabetes, and examine the effect of diabetes management (e.g. total glycosylated hemoglobin (GHb) level, number of blood glucose checks, insulin therapy intensity, insulin dose) on age at menarche in those diagnosed before menarche. Design: The Wisconsin Diabetes Registry Project is a follow-up study of a type 1 diabetes population-based incident cohort initially enrolled 1987 – 1992. Setting: Twenty-eight counties in south-central Wisconsin. Patients or Other Participants: Recruited through referrals, self-report, and hospital/clinic ascertainment. Individuals with newly diagnosed type 1 diabetes, <30 years old, were invited to participate. Of 288 young women enrolled, 188 reported menarche by 2002; 105 were diagnosed before menarche. Interventions: Not applicable. Main Outcome Measure: Age at menarche. Results: Mean age at menarche was 12.78 years, compared to 12.54 years in the United States (p = 0.01). Ages at menarche and diagnosis were not associated. For those diagnosed before menarche, age at menarche was delayed 1.3 months with each one percent increase in mean total GHb level in the three years prior to menarche. Conclusions: Age at menarche was moderately delayed in young women with type 1 diabetes. Delayed menarche could potentially be minimized with improved GHb levels. PMID:16204372

  4. The characterization of a full-thickness excision open foot wound model in n5-streptozotocin (STZ)-induced type 2 diabetic rats that mimics diabetic foot ulcer in terms of reduced blood circulation, higher C-reactive protein, elevated inflammation, and reduced cell proliferation.

    PubMed

    Yu, Caroline Oi-Ling; Leung, Kwok-Sui; Fung, Kwok-Pui; Lam, Francis Fu-Yuen; Ng, Ethel Sau-Kuen; Lau, Kit-Man; Chow, Simon Kwoon-Ho; Cheung, Wing-Hoi

    2017-08-05

    Delayed foot wound healing is a major complication attributed to hyperglycemia in type 2 diabetes mellitus (DM) patients, and these wounds may develop into foot ulcers. There are at least two types of DM wound models used in rodents to study delayed wound healing. However, clinically relevant animal models are not common. Most models use type 1 DM rodents or wounds created on the back rather than on the foot. An open full-thickness excision wound on the footpad of type 2 DM rats is more clinically relevant, but such a model has not yet been characterized systematically. The objective of this study was to investigate and characterize how DM affected a full-thickness excision open foot wound in n5-streptozotocin (n5-STZ)-induced type 2 DM rats. We hypothesized that elevated inflammation, reduced blood circulation, and cell proliferation due to hyperglycemia could delay the wound healing of DM rats. The wounds of DM rats were compared with those of non-DM rats (Ctrl) at Days 1 and 8 post wounding. The wound healing process of the DM rats was significantly delayed compared with that of the Ctrl rats. The DM rats also had higher C-reactive protein (CRP) and lower blood circulation and proliferating cell nuclear antigen (PCNA) in DM wounds. This confirmed that elevated inflammation and reduced blood flow and cell proliferation delayed foot wound healing in the n5-STZ rats. Hence, this open foot wound animal model provides a good approach to study the process of delayed wound healing.

  5. The characterization of a full-thickness excision open foot wound model in n5-streptozotocin (STZ)-induced type 2 diabetic rats that mimics diabetic foot ulcer in terms of reduced blood circulation, higher C-reactive protein, elevated inflammation, and reduced cell proliferation

    PubMed Central

    Yu, Caroline Oi-Ling; Leung, Kwok-Sui; Fung, Kwok-Pui; Lam, Francis Fu-Yuen; Ng, Ethel Sau-Kuen; Lau, Kit-Man; Chow, Simon Kwoon-Ho; Cheung, Wing-Hoi

    2017-01-01

    Delayed foot wound healing is a major complication attributed to hyperglycemia in type 2 diabetes mellitus (DM) patients, and these wounds may develop into foot ulcers. There are at least two types of DM wound models used in rodents to study delayed wound healing. However, clinically relevant animal models are not common. Most models use type 1 DM rodents or wounds created on the back rather than on the foot. An open full-thickness excision wound on the footpad of type 2 DM rats is more clinically relevant, but such a model has not yet been characterized systematically. The objective of this study was to investigate and characterize how DM affected a full-thickness excision open foot wound in n5-streptozotocin (n5-STZ)-induced type 2 DM rats. We hypothesized that elevated inflammation, reduced blood circulation, and cell proliferation due to hyperglycemia could delay the wound healing of DM rats. The wounds of DM rats were compared with those of non-DM rats (Ctrl) at Days 1 and 8 post wounding. The wound healing process of the DM rats was significantly delayed compared with that of the Ctrl rats. The DM rats also had higher C-reactive protein (CRP) and lower blood circulation and proliferating cell nuclear antigen (PCNA) in DM wounds. This confirmed that elevated inflammation and reduced blood flow and cell proliferation delayed foot wound healing in the n5-STZ rats. Hence, this open foot wound animal model provides a good approach to study the process of delayed wound healing. PMID:28413186

  6. Highly ionized gas absorption in the disk and halo toward HD 167756 at 3.5 kilometers per second resolution

    NASA Technical Reports Server (NTRS)

    Savage, Blair D.; Sembach, Kenneth R.; Cardelli, Jason A.

    1994-01-01

    High-resolution spectra of interstellar Si IV, C IV, and N V absorption lines along the 4 kpc path to the inner Galaxy star HD 167756 at z = -0.85 kpc are presented. The spectra were obtained with the echelle mode of Goddard High Resolution Spectrograph (GHRS) aboard the Hubble Space Telescope (HST) and have signal-to-noise ratios ranging from 23 to 38. The high resolution of the measurements full width at half maximum (FWHM = 3.5 km/s) results in fully resolved line profiles for the highly ionized gas absorption. The measurements provide information on the column density per unit velocity, N(v), as a function of velocity for Si IV, C IV, and N V. The C IV and N V profiles extend from -70 to +70 km/s, while the Si IV profiles extend from -40 to +70 km/s. The integrated logarithmic column densities are long N(Si IV) = 13.09 +/- 0.02, log N(C IV) = 13.83 +/- 0.02, and log N(N V) = 13.56 +/- 0.03. The N V profile is broad, asymmetric, and featureless, while the Si IV profile contains narrow absorption components near V(sub LSR) = -19, 0, +20, and +52 km/s with Doppler spread parameters, b about = 10-12 km/s. The C IV profile contains both broad and narrow structure. The high ion feature near +52 km/s is also detected in the low-ionization lines of Ca II, O I, Si II, and Fe II. The other narrow Si IV and C IV components occur within several km/s of components seen in low-ionization species. The sight line contains at least two types of highly ionized gas. One type gives rise to a broad N V profile, and the other results in the more structured Si IV profile. The C IV profile contains contributions from both types of highly ionized gas. The broad but asymmetric N V profile is well represented by a large Galactic scale height gas which is participating in Galactic rotation and has a combination of thermal and turbulent broadening with b(sub tot) about = 42 km/s. The C IV to N V abundance ratio of 1.0 +/- 0.3 for the gas implies T about 1.6 x 10(exp 5) K or about 8 x 10(exp 5) K if the gas is in collisional ionization equilibrium and has a solar carbon to nitrogen abundance ratio. This absorption may be associated with cooling hot gas situated in Galactic shells and supershells along the sight line. The gas producing the narrow Si IV and C IV absorption components has line widths that are compatible with origins in conductive interfaces between the warm and hot interstellar medium. Kinematic flows associated with the photoionized edges of clouds might also produce Si IV and C IV lines with Doppler spread parameters similar to those observed, but the C IV to Si IV ratio in this gas is 3.5, which leads us to favor the conductive interface interpretation.

  7. Community-associated methicillin-resistant Staphylococcus aureus causing chronic pneumonia.

    PubMed

    Enayet, Iram; Nazeri, Ali; Johnson, Leonard B; Riederer, Kathleen; Pawlak, Joan; Saravolatz, Louis D

    2006-04-01

    A young woman presented with pneumonia of a 3-month duration with predominantly nodular pulmonary infiltrates. Methicillin-resistant Staphylococcus aureus was identified in multiple cultures of sputum specimens. According to findings of pulsed-field gel electrophoresis, the isolate was identical to USA 300 and carried a type IV Staphylococcus cassette chromosome mec type IV gene and the genes for Panton-Valentine leukocidin.

  8. Treatment with 17-allylamino-17-demethoxygeldanamycin ameliorated symptoms of Bartter syndrome type IV caused by mutated Bsnd in mice.

    PubMed

    Nomura, Naohiro; Kamiya, Kazusaku; Ikeda, Katsuhisa; Yui, Naofumi; Chiga, Motoko; Sohara, Eisei; Rai, Tatemitu; Sakaki, Sei; Uchida, Shinich

    2013-11-22

    Mutations of BSND, which encodes barttin, cause Bartter syndrome type IV. This disease is characterized by salt and fluid loss, hypokalemia, metabolic alkalosis, and sensorineural hearing impairment. Barttin is the β-subunit of the ClC-K chloride channel, which recruits it to the plasma membranes, and the ClC-K/barttin complex contributes to transepithelial chloride transport in the kidney and inner ear. The retention of mutant forms of barttin in the endoplasmic reticulum (ER) is etiologically linked to Bartter syndrome type IV. Here, we report that treatment with 17-allylamino-17-demethoxygeldanamycin (17-AAG), an Hsp90 inhibitor, enhanced the plasma membrane expression of mutant barttins (R8L and G47R) in Madin-Darby canine kidney cells. Administration of 17-AAG to Bsnd(R8L/R8L) knock-in mice elevated the plasma membrane expression of R8L in the kidney and inner ear, thereby mitigating hypokalemia, metabolic alkalosis, and hearing loss. These results suggest that drugs that rescue ER-retained mutant barttin may be useful for treating patients with Bartter syndrome type IV. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Multicast Parametric Synchronous Sampling

    DTIC Science & Technology

    2011-09-01

    enhancement in a parametric mixer device. Fig. 4 shows the principle of generating uniform, high quality replicas extending over previously un-attainable...critical part of the MPASS architecture and is responsible for the direct and continuous acquisition of data across all of the multicast signal copies...ii) ability to copy THz signals with impunity to tens of replicas ; (iii) all-optical delays > 1.9 us; (iv) 10’s of THz-fast all-optical sampling of

  10. A High-Grade Chondrosarcoma of Calcaneum Mimicking as a Benign Pathology: Delayed Diagnosis and Management.

    PubMed

    Baba, Muzamil Ahmad; Nazir, Naila; Shabeer, Maajid; Mir, Bashir Ahmed; Kawoosa, Altaf Ahmad

    2016-10-01

    This case is presented to highlight a rare case of chondrosarcoma of calcaneum in a young adult mimicking as a benign pathology and to highlight the diagnosis and early management of such cases to prevent complications and even death. Chondrosarcoma constitutes less than 10% of all primary malignancies of bone and occurs mostly in proximal locations such as pelvis, proximal femur, and proximal humerus. We present a case of high-grade chondrosarcoma at a very rare site, calcaneum of a 40-year-old male that was mimicking as a benign pathology. This case report highlights the importance of proper clinical examination, evaluation, and suspicion for benign occurring lesions to prevent complications related to a delay in diagnosis. Therapeutic, Level IV: Case study. © 2016 The Author(s).

  11. Comparison Campaign of VLBI Data Analysis Software - First Results

    NASA Technical Reports Server (NTRS)

    Plank, Lucia; Bohm, Johannes; Schuh, Harald

    2010-01-01

    During the development of the Vienna VLBI Software VieVS at the Institute of Geodesy and Geophysics at Vienna University of Technology, a special comparison setup was developed with the goal of easily finding links between deviations of results achieved with different software packages and certain parameters of the observation. The object of comparison is the computed time delay, a value calculated for each observation including all relevant models and corrections that need to be applied in geodetic VLBI analysis. Besides investigating the effects of the various models on the total delay, results of comparisons between VieVS and Occam 6.1 are shown. Using the same methods, a Comparison Campaign of VLBI data analysis software called DeDeCC is about to be launched within the IVS soon.

  12. Intestinal electrical stimulation improves delayed gastric emptying and vomiting induced by duodenal distension in dogs.

    PubMed

    Xu, J; Chen, J D Z

    2008-03-01

    The aim of this study was to investigate the effects of short-pulse intestinal electrical stimulation (IES) on duodenal distention-induced delayed gastric emptying and vomiting in dogs and its possible mechanisms. The study was performed in 12 dogs with jejunal electrodes and a duodenal cannula in three separate experiments to investigate the effects of IES on duodenal distension (DD)-induced delayed gastric emptying and discomfort signs, vagal efferent activity, and jejunal tone. We found that: (i) IES significantly accelerated gastric emptying of liquid delayed by distension (18.05 +/- 4.06%vs. 7.18 +/- 1.99%, P = 0.036 at 60 min). (ii) IES significantly reduced vomiting and discomfort/pain induced by distension. The average signs score was 15.33 +/- 1.37 during distension which decreased to 6.50 +/- 0.91 (P = 0.0002) with IES. (iii) IES did not change vagal afferent activity, which was assessed by the spectral analysis of the heart rate variability. (iv) IES decreased jejunal tone. In conclusion, IES with parameters commonly used in gastric electrical stimulation for nausea and vomiting associated with gastroparesis improves DD-induced delayed gastric emptying and prevents DD-induced vomiting and discomfort signs. Further studies are warranted to investigate the therapeutic potential of IES for gastrointestinal symptoms associated with disturbances in motility and sensory function in small intestine.

  13. A novel technique for the treatment of stages III to IV hemorrhoids: Homemade anal cushion suspension clamp combined with harmonic scalpel.

    PubMed

    Lin, Guoqiang; Ge, Qiongxiang; He, Xiaokang; Qi, Haixin; Xu, Li

    2017-06-01

    To compare the efficacy of homemade anal cushion suspension clamp combined with harmonic scalpel (ACS) and Milligan-Morgan hemorrhoidectomy combined with electric knife (MMH) in the treatment of stages III to IV hemorrhoids. We conducted a retrospective study of 99 patients with stages III to IV hemorrhoids hospitalized from January to December in 2013. Among them, 51 patients were treated with ACS, while 48 patients received MMH. Data from clinical recording and follow-up included operative time, intraoperative blood loss, hospitalization information, postoperative pain, and postoperative complications. Operative time, intraoperative blood loss and hospitalization time in ACS group were significantly less than those in MMH group (P < .05). Compared with MMH group, ACS group had a lower postoperative static pain score from days 1 to 14 (P < .01). The patients in ACS group exhibited less postoperative defecation pain scores from days 3 to 20 than those of MMH group (P < .05). The incidence of postoperative anal edema and delayed wound healing in ACS group was lower than that in MMH group (P < .05). Compared with MMH, our novel technique ACS was more effective and had fewer postoperative complications in the treatment of stages III to IV hemorrhoids.

  14. A novel technique for the treatment of stages III to IV hemorrhoids

    PubMed Central

    Lin, Guoqiang; Ge, Qiongxiang; He, Xiaokang; Qi, Haixin; Xu, Li

    2017-01-01

    Abstract To compare the efficacy of homemade anal cushion suspension clamp combined with harmonic scalpel (ACS) and Milligan–Morgan hemorrhoidectomy combined with electric knife (MMH) in the treatment of stages III to IV hemorrhoids. We conducted a retrospective study of 99 patients with stages III to IV hemorrhoids hospitalized from January to December in 2013. Among them, 51 patients were treated with ACS, while 48 patients received MMH. Data from clinical recording and follow-up included operative time, intraoperative blood loss, hospitalization information, postoperative pain, and postoperative complications. Operative time, intraoperative blood loss and hospitalization time in ACS group were significantly less than those in MMH group (P < .05). Compared with MMH group, ACS group had a lower postoperative static pain score from days 1 to 14 (P < .01). The patients in ACS group exhibited less postoperative defecation pain scores from days 3 to 20 than those of MMH group (P < .05). The incidence of postoperative anal edema and delayed wound healing in ACS group was lower than that in MMH group (P < .05). Compared with MMH, our novel technique ACS was more effective and had fewer postoperative complications in the treatment of stages III to IV hemorrhoids. PMID:28658138

  15. Adrenal hormones and liver cAMP in exercising rats--different modes of anesthesia.

    PubMed

    Winder, W W; Fuller, E O; Conlee, R K

    1983-11-01

    We have compared five different modes of anesthesia (iv and ip pentobarbital sodium, ether, CO2, and cervical dislocation) with respect to their effects on liver glycogen, liver adenosine 3',5'-cyclic monophosphate (cAMP), blood glucose and lactate, plasma corticosterone, norepinephrine, and epinephrine in resting rats and in rats run on a treadmill at 26 m/min for 30 min. Ether, CO2, and cervical dislocation were found to be unsuitable due to the marked elevation in plasma catecholamines seen in both resting and exercising rats. Injection of pentobarbital sodium ip required an average of 8 min before onset of surgical anesthesia as opposed to less than 5 s for iv pentobarbital. Exercising rats anesthetized with ip pentobarbital showed markedly lower plasma catecholamines compared with rats given iv pentobarbital. Hepatic cAMP increased in response to exercise in all groups except the ip pentobarbital group. This is most likely due to the long delay between the end of the exercise and freezing of the liver in the ip pentobarbital-anesthetized animals. We conclude that iv injection of pentobarbital is the most suitable method of anesthesia for obtaining accurate measurements of plasma stress hormones, substrates, and metabolites and of hepatic cAMP and glycogen in resting and exercising rats.

  16. Influence of Ganoderma lucidum (Curt.: Fr.) P. Karst. on T-cell-mediated immunity in normal and immunosuppressed mice line CBA/Ca.

    PubMed

    Nizhenkovska, Iryna V; Pidchenko, Vitalii T; Bychkova, Nina G; Bisko, Nina A; Rodnichenko, Angela Y; Kozyko, Natalya O

    2015-09-01

    The article presents the results of the investigation of the effect of biomass powder of the fungus Ganoderma lucidum on T-cell-mediated immunity in normal and immunosuppressed mice CBA/Ca. Delayed-type hypersensitivity assay was used. Experimental immunodeficiency was established with intraperitoneal injection of the immunosuppressant cyclophosphamide at a single dose of 150 mg/kg on the first day of the experiment. Results of the study show that the administration of biomass powder of Ganoderma lucidum in a dose of 0.5 mg/kg orally for 10 days increases the delayed-type hypersensitivity response in normal mice CBA/Ca. Administration of 0.5 mg/kg of biomass powder of the fungus Ganoderma lucidum for 10 days blocked the development of the T-cell-mediated immunosuppression, induced by administration of cyclophosphamide and restored the delayed-type hypersensitivity response in immunosuppressed mice. Key words: fungus Ganoderma lucidum cyclophosphamide immunodeficiency T-cell-mediated immunity delayed-type hypersensitivity.

  17. Comorbid Anxiety and Depression and Their Impact on Cardiovascular Disease in Type 2 Diabetes: The Fremantle Diabetes Study Phase II.

    PubMed

    Bruce, David G; Davis, Wendy A; Dragovic, Milan; Davis, Timothy M E; Starkstein, Sergio E

    2016-10-01

    The aims were to determine whether anxious depression, defined by latent class analysis (LCA), predicts cardiovascular outcomes in type 2 diabetes and to compare the predictive power of anxious depression with Diagnostic & Statistical Manual Versions IV and 5 (DSM-IV/5) categories of depression and generalized anxiety disorder (GAD). Prospective observational study of 1,337 type 2 participants. Baseline assessment with the 9-item Patient Health Questionnaire and the GAD Scale; LCA-defined groups with minor or major anxious depression based on anxiety and depression symptoms. Cox modeling used to compare the independent impact of: (1) LCA anxious depression, (2) DSM-IV/5 depression, (3) GAD on incident cardiovascular events and deaths after 4 years. LCA minor and major anxious depression was present in 21.9 and 7.8% of participants, respectively, DSM-IV/5 minor and major depression in 6.2 and 6.1%, respectively, and GAD in 4.8%. There were 110 deaths, 31 cardiovascular deaths, and 199 participants had incident cardiovascular events. In adjusted models, minor anxious depression (Hazard ratio (95% confidence intervals): 1.70 (1.15-2.50)) and major anxious depression (1.90 (1.11-3.25)) predicted incident cardiovascular events and major anxious depression also predicted cardiovascular mortality (4.32 (1.35-13.86)). By comparison, incident cardiovascular events were predicted by DSM-IV/5 major depression (2.10 (1.22-3.62)) only and cardiovascular mortality was predicted by both DSM-IV/5 major depression (3.56 (1.03-12.35)) and GAD (5.92 (1.84-19.08)). LCA-defined anxious depression is more common than DSM-IV/5 categories and is a strong predictor of cardiovascular outcomes in type 2 diabetes. These data suggest that this diagnostic scheme has predictive validity and clinical relevance. © 2016 Wiley Periodicals, Inc.

  18. The willingness of patients to pay for intravenous patient-controlled analgesia in Korea.

    PubMed

    Lim, Hyungsun; Lee, Duck-Hyoung; Lee, Jeongwoo; Han, Young Jin; Choe, Huhn; Son, Ji-Seon

    2012-06-01

    The use of intravenous patient-controlled analgesia (IV-PCA) has been increasing because it has advantages such as improved pain relief, greater patient satisfaction, and fewer postoperative complications. However, current research has not considered the patients' thoughts about IV-PCA's cost-effectiveness. The purpose of this study was to investigate the willingness to pay (WTP) for IV-PCA and the relationship between patients' characteristics and WTP in Korea. We enrolled 400 adult patients who were scheduled for elective surgery. The patient was requested to indicate a series of predefined amounts of money (Korean won; 30,000/50,000/100,000/150,000/200,000/300,000/500,000). We also recorded patient characteristics, such as age, sex, type of surgery, IV-PCA history, education level, the person responsible for medical expenses, type of insurance, net annual income, and residential area. Three days after surgery, we asked about the degree of satisfaction and the WTP for IV-PCA. For IV-PCA, the median WTP was 100,000 won (25-75%; 50,000-200,000 won: US$1 = W1078.04; July 19, 2011) before surgery. All patients' characteristics were not related to preoperative WTP for IV-PCA, whereas the increase in WTP after surgery showed a tendency correlated to higher IV-PCA satisfaction. The median WTP was 100,000 won. The satisfaction of IV-PCA increased patients' WTP after surgery, but the WTP may be independent of patient characteristics in Korea.

  19. Delay-dependent working memory impairment in young-adult and aged 5-HT1BKO mice as assessed in a radial-arm water maze.

    PubMed

    Wolff, Mathieu; Benhassine, Narimane; Costet, Pierre; Hen, Rene; Segu, Louis; Buhot, Marie-Christine

    2003-01-01

    Serotonin (5-HT) plays a modulatory role in mnemonic functions, especially by interacting with the cholinergic system. The 5-HT1B receptor is a key target of this interaction. The 5-HT1B receptor knockout mice were found previously to exhibit a facilitation in hippocampal-dependent spatial reference memory learning. In the present study, we submitted mice to a delayed spatial working memory task, allowing the introduction of various delays between an exposure trial and a test trial. The 5-HT1BKO and wild-type mice learned the task in a radial-arm water maze (returning to the most recent presented arm containing the escape platform), and exhibited a high level of performance at delays of 0 and 5 min. However, at the delay of 60 min, only 5-HT1BKO mice exhibited an impairment. At a delay of 90 min, all mice were impaired. Treatment by scopolamine (0.8 mg/kg) induced the same pattern of performance in wild type as did the mutation for short (5 min, no impairment) and long (60 min, impairment) delays. The 22-month-old wild-type and knockout mice exhibited an impairment at short delays (5 and 15 min). The effect of the mutation affected both young-adult and aged mice at delays of 15, 30, and 60 min. Neurobiological data show that stimulation of the 5-HT1B receptor inhibits the release of acetylcholine in the hippocampus, but stimulates this in the frontal cortex. This dual function might, at least in part, explain the opposite effect of the mutation on reference memory (facilitation) and delay-dependent working memory (impairment). These results support the idea that cholinergic-serotonergic interactions play an important role in memory processes.

  20. Bond Strength of Gold Alloys Laser Welded to Cobalt-Chromium Alloy

    PubMed Central

    Watanabe, Ikuya; Wallace, Cameron

    2008-01-01

    The objective of this study was to investigate the joint properties between cast gold alloys and Co-Cr alloy laser-welded by Nd:YAG laser. Cast plates were fabricated from three types of gold alloys (Type IV, Type II and low-gold) and a Co-Cr alloy. Each gold alloy was laser-welded to Co-Cr using a dental laser-welding machine. Homogeneously-welded and non-welded control specimens were also prepared. Tensile testing was conducted and data were statistically analyzed using ANOVA. The homogeneously-welded groups showed inferior fracture load compared to corresponding control groups, except for Co-Cr. In the specimens welded heterogeneously to Co-Cr, Type IV was the greatest, followed by low-gold and Type II. There was no statistical difference (P<0.05) in fracture load between Type II control and that welded to Co-Cr. Higher elongations were obtained for Type II in all conditions, whereas the lowest elongation occurred for low-gold welded to Co-Cr. This study indicated that, of the three gold alloys tested, the Type IV gold alloy was the most suitable alloy for laser-welding to Co-Cr. PMID:19088892

  1. Regulation of COX-2–mediated signaling by α3 type IV noncollagenous domain in tumor angiogenesis

    PubMed Central

    Boosani, Chandra Shekhar; Mannam, Arjuna P.; Cosgrove, Dominic; Silva, Rita; Hodivala-Dilke, Kairbaan M.; Keshamouni, Venkateshwar G.

    2007-01-01

    Human α3 chain, a noncollagenous domain of type IV collagen [α3(IV)NC1], inhibits angiogenesis and tumor growth. These biologic functions are partly attributed to the binding of α3(IV)NC1 to αVβ3 and α3β1 integrins. α3(IV)NC1 binds αVβ3 integrin, leading to translation inhibition by inhibiting focal adhesion kinase/phosphatidylinositol 3-kinase/Akt/mTOR/4E-BP1 pathways. In the present study, we evaluated the role of α3β1 and αVβ3 integrins in tube formation and regulation of cyclooxygenase-2 (COX-2) on α3(IV)NC1 stimulation. We found that although both integrins were required for the inhibition of tube formation by α3(IV)NC1 in endothelial cells, only α3β1 integrin was sufficient to regulate COX-2 in hypoxic endothelial cells. We show that binding of α3(IV)NC1 to α3β1 integrin leads to inhibition of COX-2–mediated pro-angiogenic factors, vascular endothelial growth factor, and basic fibroblast growth factor by regulating IκBα/NFκB axis, and is independent of αVβ3 integrin. Furthermore, β3 integrin–null endothelial cells, when treated with α3(IV)NC1, inhibited hypoxia-mediated COX-2 expression, whereas COX-2 inhibition was not observed in α3 integrin–null endothelial cells, indicating that regulation of COX-2 by α3(IV)NC1 is mediated by integrin α3β1. Our in vitro and in vivo findings demonstrate that α3β1 integrin is critical for α3(IV)NC1-mediated inhibition of COX-2–dependent angiogenic signaling and inhibition of tumor progression. PMID:17426256

  2. Loss of Intralipid®- but Not Sevoflurane-Mediated Cardioprotection in Early Type-2 Diabetic Hearts of Fructose-Fed Rats: Importance of ROS Signaling

    PubMed Central

    Zhang, Liyan; Affolter, Andreas; Gandhi, Manoj; Hersberger, Martin; Warren, Blair E.; Lemieux, Hélène; Sobhi, Hany F.; Clanachan, Alexander S.; Zaugg, Michael

    2014-01-01

    Background Insulin resistance and early type-2 diabetes are highly prevalent. However, it is unknown whether Intralipid® and sevoflurane protect the early diabetic heart against ischemia-reperfusion injury. Methods Early type-2 diabetic hearts from Sprague-Dawley rats fed for 6 weeks with fructose were exposed to 15 min of ischemia and 30 min of reperfusion. Intralipid® (1%) was administered at the onset of reperfusion. Peri-ischemic sevoflurane (2 vol.-%) served as alternative protection strategy. Recovery of left ventricular function was recorded and the activation of Akt and ERK 1/2 was monitored. Mitochondrial function was assessed by high-resolution respirometry and mitochondrial ROS production was measured by Amplex Red and aconitase activity assays. Acylcarnitine tissue content was measured and concentration-response curves of complex IV inhibition by palmitoylcarnitine were obtained. Results Intralipid® did not exert protection in early diabetic hearts, while sevoflurane improved functional recovery. Sevoflurane protection was abolished by concomitant administration of the ROS scavenger N-2-mercaptopropionyl glycine. Sevoflurane, but not Intralipid® produced protective ROS during reperfusion, which activated Akt. Intralipid® failed to inhibit respiratory complex IV, while sevoflurane inhibited complex I. Early diabetic hearts exhibited reduced carnitine-palmitoyl-transferase-1 activity, but palmitoylcarnitine could not rescue protection and enhance postischemic functional recovery. Cardiac mitochondria from early diabetic rats exhibited an increased content of subunit IV-2 of respiratory complex IV and of uncoupling protein-3. Conclusions Early type-2 diabetic hearts lose complex IV-mediated protection by Intralipid® potentially due to a switch in complex IV subunit expression and increased mitochondrial uncoupling, but are amenable to complex I-mediated sevoflurane protection. PMID:25127027

  3. Effects of buspirone on the immediate positive and delayed negative properties of intravenous cocaine as measured in the conditioned place preference test

    PubMed Central

    Ettenberg, Aaron; Bernardi, Rick E.

    2007-01-01

    In prior work, we have demonstrated that the behavioral effects of cocaine adhere to the predictions of the opponent-process theory of drug action. Animals develop conditioned place preferences for distinct locations paired with the immediate effects of IV cocaine, but learn to avoid places paired with the effects present 15-min post injection. It was of interest to assess the putative role of 5-HT in producing the negative properties of cocaine since cocaine acts to inhibit the reuptake of serotonin (5-HT) and since such actions have been associated with anxiogenic consequences. Male rats were administered a reinforcing dose of cocaine (1.0 mg/kg IV) and then placed – either immediately or after a 15-min delay -- into one side of a two-compartment (black-white) Conditioned Place Preference (CPP) box for 5-min. On alternate days, the animals received IV saline injections and were placed in the opposite side of the CPP box. This continued for eight days after which animals had experienced 4 pairings of cocaine with one side (black or white) of the CPP apparatus, and 4 saline pairings with the opposite side. Other groups of rats were treated identically except that 30-min prior to placement into the apparatus, these animals received an IP injection of saline or buspirone (a partial 5-HT1A agonist) at a dose that we have shown to be anxiolytic (2.5 mg/kg IP). Control animals experienced either buspirone or saline pretreatments without cocaine. Our results confirm that animals increase the time spent on the side paired with the immediate effects of cocaine (compared to baseline), but tend to avoid the side paired with effects present 15-min post-injection. Buspirone had no effect on the immediate rewarding properties of cocaine, but completely reversed the negative properties present 15-min post-cocaine. These results are consistent with the view that attenuation of 5-HT neurotransmission (via the autoreceptor agonist properties of buspirone) can reverse the negative impact of IV cocaine. PMID:17524462

  4. Comparison of adverse events of laser and light-assisted hair removal systems in skin types IV-VI.

    PubMed

    Breadon, Jonith Y; Barnes, Chad A

    2007-01-01

    Photoepilation, utilizing lasers and noncoherent light sources, is designed to irradiate as much of the follicular unit as possible, with melanin as the target chromophore. Wavelength absorption should generate energy sufficient to heat and destroy the hair follicle, while preserving the surrounding tissue. When performing photoepilation on African-American skin (Fitzpatrick skin types IV-VI) a greater risk of potential epidermal adverse events, such as dyspigmentation, blistering, crusting, edema, and subsequent scarring, is possible. To reduce epidermal melanin absorption of energy longer wavelengths are considered safer for use on Fitzpatrick skin types IV to VI. This article reviews and compares the reported incidences of adverse events in African-American skin, utilizing lasers and noncoherent light sources for assisted hair removal.

  5. Identification of dipeptidyl peptidase-IV inhibitory peptides from mare whey protein hydrolysates.

    PubMed

    Song, J J; Wang, Q; Du, M; Ji, X M; Mao, X Y

    2017-09-01

    Inhibition of dipeptidyl peptidase-IV (DPP-IV) activity is a promising strategy for treatment of type 2 diabetes. In the current study, DPP-IV inhibitory peptides were identified from mare whey protein hydrolysates obtained by papain. The results showed that all the mare whey protein hydrolysates obtained at various hydrolysis durations possessed more potent DPP-IV inhibitory activity compared with intact whey protein. The 4-h hydrolysates showed the greatest DPP-IV inhibitory activity with half-maximal inhibitory concentration of 0.18 mg/mL. The 2 novel peptides from 4-h hydrolysate fractions separated by successive chromatographic steps were characterized by liquid chromatography-electrospray ionization tandem mass spectrometry. The novel peptides Asn-Leu-Glu-Ile-Ile-Leu-Arg and Thr-Gln-Met-Val-Asp-Glu-Glu-Ile-Met-Glu-Lys-Phe-Arg, which corresponded to β-lactoglobulin 1 f(71-77) and β-lactoglobulin 1 f(143-155), demonstrated DPP-IV inhibitory activity with half-maximal inhibitory concentrations of 86.34 and 69.84 μM, respectively. The DPP-IV inhibitory activity of the 2 peptides was retained or even improved after simulated gastrointestinal digestion in vitro. Our findings indicate that mare whey protein-derived peptides may possess potential as functional food ingredients in the management of type 2 diabetes. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  6. Equilibrium between Different Coordination Geometries in Oxidovanadium(IV) Complexes

    ERIC Educational Resources Information Center

    Ugone, Valeria; Garribba, Eugenio; Micera, Giovanni; Sanna, Daniele

    2015-01-01

    In this laboratory activity, the equilibrium between square pyramidal and octahedral V(IV)O[superscript 2+] complexes is described. We propose a set of experiments to synthesize and characterize two types of V(IV)O[superscript 2+] complexes. The experiment allows great flexibility and may be effectively used at a variety of levels and the activity…

  7. Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

    PubMed

    Lees, George E

    2013-01-01

    To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

  8. Chronic constipation recognized as a sign of a SOX10 mutation in a patient with Waardenburg syndrome.

    PubMed

    Arimoto, Yukiko; Namba, Kazunori; Nakano, Atsuko; Matsunaga, Tatsuo

    2014-05-01

    Waardenburg syndrome is characterized by hearing loss, pigmentation abnormalities, dysmorphologic features, and neurological phenotypes. Waardenburg syndrome consists of four distinct subtypes, and SOX10 mutations have been identified in type II and type IV. Type IV differs from type II owing to the presence of Hirschsprung disease. We identified a de novo nonsense mutation in SOX10 (p.G39X) in a female pediatric patient with Waardenburg syndrome with heterochromia iridis, profound bilateral sensorineural hearing loss, inner ear malformations, and overall hypopigmentation of the hair without dystopia canthorum. This patient has experienced chronic constipation since she was a neonate, but anorectal manometry showed a normal anorectal reflex. Chronic constipation in this patient was likely to be a consequence of a mild intestinal disorder owing to the SOX10 mutation, and this patient was considered to have a clinical phenotype intermediate between type II and type IV of the syndrome. Chronic constipation may be recognized as indicative of a SOX10 mutation in patients with Waardenburg syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Tolerance and immunity in mice infected with herpes simplex virus: simultaneous induction of protective immunity and tolerance to delayed-type hypersensitivity.

    PubMed

    Nash, A A; Gell, P G; Wildy, P

    1981-05-01

    Unresponsiveness to delayed type hypersensitivity was induced in mice following an intravenous injection of herpes simplex virus. The principal tolerogens used were thymidine kinase-deficient virus mutants which grow poorly in vivo; u.v.-inactivated and to a lesser extent formalin-inactivated virus were also tolerogenic. The tolerance induced was specific for the virus type. Despite the tolerance to delayed hypersensitivity, anti-viral immunity is present as determined by the rapid inactivation of infectious virus. The mechanism of tolerance to herpes virus and the importance of these observations for the pathogenesis of viral disease is discussed.

  10. Tolerance and immunity in mice infected with herpes simplex virus: simultaneous induction of protective immunity and tolerance to delayed-type hypersensitivity.

    PubMed Central

    Nash, A A; Gell, P G; Wildy, P

    1981-01-01

    Unresponsiveness to delayed type hypersensitivity was induced in mice following an intravenous injection of herpes simplex virus. The principal tolerogens used were thymidine kinase-deficient virus mutants which grow poorly in vivo; u.v.-inactivated and to a lesser extent formalin-inactivated virus were also tolerogenic. The tolerance induced was specific for the virus type. Despite the tolerance to delayed hypersensitivity, anti-viral immunity is present as determined by the rapid inactivation of infectious virus. The mechanism of tolerance to herpes virus and the importance of these observations for the pathogenesis of viral disease is discussed. PMID:7251047

  11. Not All Types of Delay Are Equal: Postsecondary Delay in the U.S. and Taking a Gap Year

    ERIC Educational Resources Information Center

    Hoe, Nina DePena

    2014-01-01

    Postsecondary delay in the U.S. is a topic that has generated interest in the field of higher education in recent decades. Seventeen percent of U.S. students under the age of 24 who began their postsecondary education in 2004 delayed their entrance for some period of time. At the national level, studies have indicated that students who delay are…

  12. Classification of corkscrew collaterals in thromboangiitis obliterans (Buerger's disease): relationship between corkscrew type and prevalence of ischemic ulcers.

    PubMed

    Fujii, Yuichi; Soga, Junko; Nakamura, Shuji; Hidaka, Takayuki; Hata, Takaki; Idei, Naomi; Fujimura, Noritaka; Nishioka, Kenji; Chayama, Kazuaki; Kihara, Yasuki; Higashi, Yukihito

    2010-08-01

    A corkscrew collateral appearance on angiography is one of the diagnostic criteria for Buerger's disease. The purpose of the present study was to classify the angiographic findings of corkscrew collaterals and to evaluate the relationship between corkscrew collateral type and the severity of Buerger's disease. Corkscrew collaterals were assessed on digital subtraction angiography in lower extremities of 28 patients with Buerger's disease (55 limbs). The corkscrew sign was classified into 4 types by size and pattern as follows: type I, artery diameter >2 mm, large helical sign; type II, diameter >1.5 mm and or=1 mm and

  13. Level III and IV Ecoregions by State

    EPA Pesticide Factsheets

    Information and links to downloadable maps and datasets for Level III and IV ecoregions, listed by state. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  14. Level III and IV Ecoregions by EPA Region

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions, listed by EPA region. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  15. Distribution of Porphyromonas gingivalis fimA genotypes in chronic apical periodontitis associated with symptoms.

    PubMed

    Wang, Qian; Zhou, Xue-dong; Zheng, Qing-hua; Wang, Yao; Tang, Lu; Huang, Ding-ming

    2010-11-01

    Porphyromonas gingivalis (P. gingivalis) is an anaerobic bacterium involved in root canal infections whose fimbriae are classified into six genotypes (types I-V and Ib) based on nucleotide sequence. Accumulated evidence suggests there is significant association between P. gingivalis and some clinical symptoms of periodontal diseases. The present study aims to determine the prevalence of P. gingivalis fimA genotypes in apical periodontitis and to investigate the correlation between P. gingivalis fimA genotypes and clinical symptoms. Samples were obtained from 158 infected root canals with apical periodontitis. DNA was extracted and analyzed with a polymerase chain reaction-based identification assay. Odds ratios, 95% confidence intervals, and contingency coefficient were calculated for associating the fimA-specific genes with clinical symptoms. P. gingivalis was detected in 39.9% of the inflected root canal samples and was found in 44.5% of P. gingivalis-positive specimens with symptoms. Types II (69.4%) were the most frequent in the symptomatic cases followed by type IV (32.7%). The occurrence of type I (64.3%) was significantly higher than any other genotypes in the asymptomatic apical periodontitis, whereas type II and type Ib were not identified. Statistical analysis revealed that the occurrences of types II, IV, and Ib fimA were associated with greater risk of clinical signs (swelling, sinus tract, or intracanal exudates) than type I. Results from this study reinforce the association between P. gingivalis-specific fimA genotypic clones and apical periodontitis, indicating that fimA genotypes (types II, IV, and Ib) were related to the etiology of symptomatic periradicular diseases. Copyright © 2010 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  16. Hereditary angioedema with C1 inhibitor deficiency: delay in diagnosis in Europe

    PubMed Central

    2013-01-01

    Background Hereditary angioedema (HAE) is a rare, debilitating, and potentially life-threatening disease characterized by recurrent edema attacks. Important advances in HAE treatment have been made, including the development of new therapies for treating or preventing attacks. Nevertheless, the disease is still frequently misdiagnosed and inappropriately treated, potentially exposing patients with laryngeal attacks to the risk of asphyxiation. Methods The Icatibant Outcome Survey (IOS) is an international, observational study that documents the clinical outcome of HAE patients eligible for treatment with icatibant. Patient ages at first symptoms and at diagnosis were recorded at enrolment, and the delay between first symptoms and diagnosis was calculated. Results The median [range] diagnostic delay in HAE type I and II patients across eight countries was 8.5 years [0–62.0]. The median delay in diagnosis was longer for HAE type II versus type I (21 versus 8 years, respectively), although this did not quite reach statistical significance. Conclusions Although it can be difficult to differentiate HAE symptoms from those of more common angioedema sub-types (e.g. idiopathic or acquired angioedema), our results show that HAE type I and II patients have an unacceptable delay in diagnosis, even those with a family history of the disease. Raising physician awareness of this disabling and potentially fatal disease may lead to a more accurate diagnosis and timely treatment. PMID:23937903

  17. Comparison of DNA decatenation by Escherichia coli topoisomerase IV and topoisomerase III: implications for non-equilibrium topology simplification

    PubMed Central

    Seol, Yeonee; Hardin, Ashley H.; Strub, Marie-Paule; Charvin, Gilles; Neuman, Keir C.

    2013-01-01

    Type II topoisomerases are essential enzymes that regulate DNA topology through a strand-passage mechanism. Some type II topoisomerases relax supercoils, unknot and decatenate DNA to below thermodynamic equilibrium. Several models of this non-equilibrium topology simplification phenomenon have been proposed. The kinetic proofreading (KPR) model postulates that strand passage requires a DNA-bound topoisomerase to collide twice in rapid succession with a second DNA segment, implying a quadratic relationship between DNA collision frequency and relaxation rate. To test this model, we used a single-molecule assay to measure the unlinking rate as a function of DNA collision frequency for Escherichia coli topoisomerase IV (topo IV) that displays efficient non-equilibrium topology simplification activity, and for E. coli topoisomerase III (topo III), a type IA topoisomerase that unlinks and unknots DNA to equilibrium levels. Contrary to the predictions of the KPR model, topo IV and topo III unlinking rates were linearly related to the DNA collision frequency. Furthermore, topo III exhibited decatenation activity comparable with that of topo IV, supporting proposed roles for topo III in DNA segregation. This study enables us to rule out the KPR model for non-equilibrium topology simplification. More generally, we establish an experimental approach to systematically control DNA collision frequency. PMID:23460205

  18. Does the transition into daylight saving time really cause partial sleep deprivation?

    PubMed

    Toth Quintilham, Manoel Carlos; Adamowicz, Taísa; Pereira, Erico Felden; Pedrazzoli, Mario; Louzada, Fernando Mazzilli

    2014-01-01

    To identify possible changes in the sleep patterns according to chronotype in undergraduate students during the daylight saving time (DST) transition. A total of 378 students answered the Morningness-Eveningness Questionnaire (MEQ) to determine their chronotype and kept a diary about sleep-wake schedules 1 week before and after the DST transition. Oral mucosal cell samples were collected for genetic analysis. After the DST transition, intermediate types (I-types) delayed bedtime and increased their time in bed and all groups delayed their wake-up time. All groups presented a shorter phase angle between sunset and the bedtime after the DST transition. On the other hand, only E-types showed a tendency to reduce the phase angle between sunrise and wake-up time, while I-types and M-types kept the same phase angles between sunrise and wake-up time after the DST transition. The polymorphisms in the human genes CLOCK and PER3 were not associated with individual differences in sleep patterns, nor were they associated with an adjustment to the DST transition. Under the new set of social times determined by DST, the adjustment was only partial. I-types delayed bedtime and all groups delayed their wake-up times after the beginning of DST. Consequently, the time in bed after the DST transition was not reduced; Morning (M-types) and Evening-types (E-types) kept the same time in bed and I-types showed an increase on it.

  19. Estimates of delays in diagnosis of cervical cancer in Nepal

    PubMed Central

    2014-01-01

    Background Cervical cancer is the leading cause of cancer related deaths among women in Nepal. The long symptom to diagnosis interval means that women have advanced disease at presentation. The aim of this study was to identify, estimate and describe the extent of different delays in diagnosis of cervical cancer in Nepal. Methods A cross-sectional descriptive study was conducted in two tertiary cancer hospitals of Nepal. Face to face interview and medical records review were carried out among 110 cervical cancer patients. Total diagnostic delay was categorized into component delays: patient delay, health care providers delay, referral delay and diagnostic waiting time. Results Total 110 patients recruited in the study represented 40 districts from all three ecological regions of the country. Median total diagnostic delay was 157 days with more than three fourth (77.3%) of the patients having longer total diagnostic delay of >90 days. Out of the total diagnostic delay, median patient delay, median health care provider delay, median referral delay and median diagnostic waiting time were 68.5 days, 40 days, 5 days and 9 days respectively. Majority of the patients had experienced longer delay of each type except referral delay. Fifty seven percent of the patients had experienced longer patient delay of >60 days, 90% had suffered longer health care provider delay of >1 week, 31.8% had longer referral delay of >1 week and 66.2% had waited >1 week at diagnostic center for final diagnosis. Variation in each type of delay was observed among women with different attributes and in context of health care service delivery. Conclusions Longer delays were observed in all the diagnostic pathways except for referral delay and diagnostic waiting time. Among the delays, patient delay is of crucial importance because of its longer span, although health care provider delay is equally important. In the context of limited screening services in Nepal, the efforts should be to reduce the diagnostic delay especially patient and health care provider delay for early detection and reduction of mortality rate of cervical cancer. PMID:24533670

  20. A clinicopathological study of the expression of extracellular matrix components in urothelial carcinoma.

    PubMed

    Ioachim, Elli; Michael, Michalis; Stavropoulos, Nicolaos E; Kitsiou, Evangelia; Salmas, Marios; Malamou-Mitsi, Vasiliki

    2005-03-01

    To measure the immunohistochemical expression of the extracellular matrix (ECM) components tenascin, fibronectin, collagen type IV and laminin in urothelial carcinomas, and to correlate their expression with clinicopathological features to clarify the prognostic value of these molecules and their role in tumour progression. Tumour specimens obtained during transurethral resection of bladder tumour (TURBT) from 103 patients (82 men and 2 1 women, mean age 66.7 years, range 27-89) were studied retrospectively. The expression of tenascin, fibronectin, collagen type IV and laminin was correlated with clinicopathological features (tumour grade and stage, multiplicity, simultaneous in situ component, the proliferative activity as estimated by the two proliferation associated indices, Ki-67 and proliferating cell nuclear antigen, the recurrence rate, and the progression of invading tumour). Specimens investigated for tenascin expression from patients with superficial bladder cancers were categorized into 28 treated by TURBT only and 53 who had TURBT followed by intravesical instillations of interferon. Cytoplasmic tenascin expression was detected in tumour cells in 20% of specimens. Tenascin was expressed in the tumour stroma in 76% of specimens, and was positively correlated with tumour grade and stage. Stromal tenascin expression was positively correlated with proliferative activity, and with the expression of fibronectin and collagen type IV. Fibronectin was expressed in the tumour stroma in 89% of specimens and was positively correlated with tumour stage, proliferative activity, and expression of collagen type IV and laminin. Collagen type IV was expressed in 93% of specimens, and was positively correlated with tumour grade and stage. Laminin was expressed in 78% of specimens and had no significant correlation with the clinicopathological features. Patients treated with TURBT alone and who had low levels of tenascin had a longer tumour-free interval than those with high levels of tenascin. Levels of tenascin might be valuable for predicting the risk of early recurrence. The expression of tenascin, fibronectin and collagen type IV seems to be correlated with more aggressive tumour behaviour. Furthermore, their interrelationships could indicate that they are involved in the remodelling of bladder cancer tissue, probably influencing tumour progression.

  1. A novel arctigenin-containing latex glove prevents latex allergy by inhibiting type I/IV allergic reactions.

    PubMed

    Wang, Yong-Xin; Xue, Dan-Ting; Liu, Meng; Zhou, Zheng-Min; Shang, Jing

    2016-03-01

    The present study aimed at developing a natural compound with anti-allergic effect and stability under latex glove manufacturing conditions and investigating whether its anti-allergic effect is maintained after its addition into the latex. The effects of nine natural compounds on growth of the RBL-2H3 cells and mouse primary spleen lymphocytes were determined using MTT assay. The compounds included glycyrrhizin, osthole, tetrandrine, tea polyphenol, catechin, arctigenin, oleanolic acid, baicalin and oxymatrine. An ELISA assay was used for the in vitro anti-type I/IV allergy screening; in this process β-hexosaminidase, histamine, and IL-4 released from RBL-2H3 cell lines and IFN-γ and IL-2 released from mouse primary spleen lymphocytes were taken as screening indices. The physical stability of eight natural compounds and the dissolubility of arctigenin, selected based on the in vitro pharnacodynamaic screening and the stability evaluation, were detected by HPLC. The in vivo pharmacodynamic confirmation of arctigenin and final latex product was evaluated with a passive cutaneous anaphylaxis (PCA) model and an allergen-specific skin response model. Nine natural compounds showed minor growth inhibition on RBL-2H3 cells and mouse primary spleen lymphocytes. Baicalin and arctigenin had the best anti-type I and IV allergic effects among the natural compounds based on the in vitro pharmacodynamic screening. Arctigenin and catechin had the best physical stability under different manufacturing conditions. Arctigenin was the selected for further evaluation and proven to have anti-type I and IV allergic effects in vivo in a dose-dependent manner. The final product of the arctigenin-containing latex glove had anti-type I and IV allergic effects in vivo which were mainly attributed to arctigenin as proved from the dissolubility results. Arctigenin showed anti-type I and IV allergic effects in vitro and in vivo, with a good stability under latex glove manufacturing conditions, and a persistent anti-allergic effect after being added into the latex to prevent latex allergy. Copyright © 2016 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

  2. Period variations of Algol-type eclipsing binaries AD And, TWCas and IV Cas

    NASA Astrophysics Data System (ADS)

    Parimucha, Štefan; Gajdoš, Pavol; Kudak, Viktor; Fedurco, Miroslav; Vaňko, Martin

    2018-04-01

    We present new analyses of variations in O – C diagrams of three Algol-type eclipsing binary stars: AD And, TW Cas and IV Cas. We have used all published minima times (including visual and photographic) as well as newly determined ones from our and SuperWasp observations. We determined orbital parameters of 3rd bodies in the systems with statistically significant errors, using our code based on genetic algorithms and Markov chain Monte Carlo simulations. We confirmed the multiple nature of AD And and the triple-star model of TW Cas, and we proposed a quadruple-star model of IV Cas.

  3. Preventive effect of Qianggan-Rongxian Decoction on rat liver fibrosis

    PubMed Central

    Li, Chun-Hui; Pan, Li-Hui; Yang, Zong-Wei; Li, Chun-Yu; Xu, Wen-Xie

    2008-01-01

    AIM: To study the preventive effects of Qianggan-Rongxian Decoction on liver fibrosis induced by dimethylnitrosamine (DMN) in rats. METHODS: Male Wistar rats were randomly divided into hepatic fibrosis model group, control group and 3 treatment groups (12 rats in each group). Except for the normal control group, all the rats received 1% DMN (10 μL/kg body weight, i.p), 3 times a week for 4 wk. The rats in the 3 treatment groups including a high-dose DMN group (10 mL/kg), a medium-dose DMN group (7 mL/kg), and a low-dose DMN group (4 mL/kg) were daily gavaged with Qianggan-Rongxian Decoction, and the rats in the model and normal control groups were given saline vehicle. Enzyme-linked immunosorbent assay (ELISA) was used to determine the changes in serum hyaluronic acid (HA), laminin (LN), and type IV collagen levels. Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were measured using routine laboratory methods. Pathologic changes, particularly fibrosis, were examined by hematoxylin and eosin (HE) and Sirius red staining. Hepatic stellate cells (HSC) were examined by transmission electron microscopy. RESULTS: Compared with the model control group, the serum levels of HA, LN, type IV collagen, ALT and AST were decreased markedly in the other groups after treatment with Qianggan-Rongxian Decoction, especially in the medium-dose DMN group (P < 0.05). Moreover, the area-density percentage of collagen fibrosis was lower in the Qianggan-Rongxian Decoction treatment groups than in the model group, and a more significant drop was observed in the medium-dose DMN group (P < 0.05). CONCLUSION: Qianggan-Rongxian Decoction can inhibit hepatic fibrosis due to chronic liver injury, delay the development of cirrhosis, and notably ameliorate liver function. It may be used as a safe and effective thera-peutic drug for patients with fibrosis. PMID:18567088

  4. Acute pancreatitis complicating choledochal cysts in children.

    PubMed

    Muthucumaru, Mathievathaniy; Ljuhar, Damir; Panabokke, Gayathri; Paul, Eldho; Nataraja, Ramesh; Ferguson, Peter; Dagia, Charuta; Clarnette, Tom; King, Sebastian

    2017-03-01

    To analyse the characteristics of patients with choledochal cysts presenting with acute pancreatitis. Multicenter retrospective review of all paediatric patients (<18 years) with choledochal cysts managed over a 14-year period (2001-2014) at two tertiary paediatric surgical centres. Patient data were analysed for demographics, presentation, radiological classification of cyst type (Todani), operative interventions, complications and long-term follow-up. A total of 49 patients with choledochal cysts were identified with 15 (31%) being Type I fusiform, 18 (37%) Type I cystic and 16 (32%) Type IV-A. Seventeen (35%) patients presented with acute pancreatitis, one having had an ante-natally diagnosed choledochal cyst. Patients presenting with pancreatitis were older when compared to the non-pancreatitis group (5.1 vs. 1.2 years, P = 0.005). Nine out of 16 (53%) patients with Type IV-A cysts presented with pancreatitis compared to five (33%) of Type I fusiform and three (17%) of Type I cystic. There was however no statistically significant association between Todani types and the development of pancreatitis (Type I fusiform, P = 1.0; Type I cystic, P = 0.063; Type IV-A, P = 0.053). The rate of complications was similar in both groups. Pancreatitis was a common presentation in children with a choledochal cyst, however, there was no clear statistically significant association with Todani types and pancreatitis. © 2016 Paediatrics and Child Health Division (The Royal Australasian College of Physicians).

  5. Identification of the DotL coupling protein subcomplex of the Legionella Dot/Icm type IV secretion system.

    PubMed

    Vincent, Carr D; Friedman, Jonathan R; Jeong, Kwang Cheol; Sutherland, Molly C; Vogel, Joseph P

    2012-07-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, survives in macrophages by altering the endocytic pathway of its host cell. To accomplish this, the bacterium utilizes a type IVB secretion system to deliver effector molecules into the host cell cytoplasm. In a previous report, we performed an extensive characterization of the L. pneumophila type IVB secretion system that resulted in the identification of a critical five-protein subcomplex that forms the core of the secretion apparatus. Here we describe a second Dot/Icm protein subassembly composed of the type IV coupling protein DotL, the apparatus proteins DotM and DotN, and the secretion adaptor proteins IcmS and IcmW. In the absence of IcmS or IcmW, DotL becomes destabilized at the transition from the exponential to stationary phases of growth, concurrent with the expression of many secreted substrates. Loss of DotL is dependent on ClpA, a regulator of the cytoplasmic protease ClpP. The resulting decreased levels of DotL in the icmS and icmW mutants exacerbates the intracellular defects of these strains and can be partially suppressed by overproduction of DotL. Thus, in addition to their role as chaperones for Legionella type IV secretion system substrates, IcmS and IcmW perform a second function as part of the Dot/Icm type IV coupling protein subcomplex. © 2012 Blackwell Publishing Ltd.

  6. The Evaluation and Treatment of Delayed Ejaculation.

    PubMed

    Shin, Daniel H; Spitz, Aaron

    2014-10-01

    Delayed ejaculation is a small but important subsection of ejaculatory dysfunction, with prevalence estimated at 1-4%. It is most commonly defined by DSM-IV-TR criteria, as "a persistent delay in, or absence of, orgasm in a male following a normal sexual excitement phase during sexual activity that the clinician, taking into account the person's age, judges to be adequate in focus, intensity, and duration." The pathophysiology of delayed ejaculation is related to disruptions in ejaculatory apparatus, nervous transmission, hormonal or neurochemical ejaculatory control, or psychosocial factors. To update the clinician on the evaluation and treatment of delayed ejaculation. The keywords "delayed ejaculation" and "retarded ejaculation" were utilized to search Pubmed for relevant publications. 319 results were generated from the search, and those publications judged relevant to the pathophysiology, epidemiology, evaluation, and treatment of delayed ejaculation were included in the review. 110 articles were ultimately selected for inclusion in this review. The evaluation of this condition requires a focused history and physical, which includes a detailed sexual history, examination of the genitalia, and inquiry into the status of the partner. Laboratory tests are aimed at the detection of abnormalities in the blood count, glucose level, hormone levels, or kidney function. If a correctable etiology is discovered, treatment is directed towards the reversal of this condition. In some cases, the delayed ejaculation may be a lifelong problem. Also, in some cases the etiology of the delayed ejaculation may be irreversible, such as in the case of age-related sensation loss or diabetes-related neuropathy. In these instances treatment may require a combination of behavioral modification, sexual therapy, or perhaps pharmaceutical drugs. Participation of the partner in therapy may sometimes be necessary. Future investigations will continue to elucidate the complex biological and psychosocial factors which contribute to delayed ejaculation, leading to more effective treatments. Shin DH and Spitz A. The evaluation and treatment of delayed ejaculation. Sex Med Rev 2014;2:121-133. Copyright © 2014 International Society for Sexual Medicine. Published by Elsevier Inc. All rights reserved.

  7. The diagnostic accuracy of multiparametric MRI to determine pediatric brain tumor grades and types.

    PubMed

    Koob, Mériam; Girard, Nadine; Ghattas, Badih; Fellah, Slim; Confort-Gouny, Sylviane; Figarella-Branger, Dominique; Scavarda, Didier

    2016-04-01

    Childhood brain tumors show great histological variability. The goal of this retrospective study was to assess the diagnostic accuracy of multimodal MR imaging (diffusion, perfusion, MR spectroscopy) in the distinction of pediatric brain tumor grades and types. Seventy-six patients (range 1 month to 18 years) with brain tumors underwent multimodal MR imaging. Tumors were categorized by grade (I-IV) and by histological type (A-H). Multivariate statistical analysis was performed to evaluate the diagnostic accuracy of single and combined MR modalities, and of single imaging parameters to distinguish the different groups. The highest diagnostic accuracy for tumor grading was obtained with diffusion-perfusion (73.24%) and for tumor typing with diffusion-perfusion-MR spectroscopy (55.76%). The best diagnostic accuracy was obtained for tumor grading in I and IV and for tumor typing in embryonal tumor and pilocytic astrocytoma. Poor accuracy was seen in other grades and types. ADC and rADC were the best parameters for tumor grading and typing followed by choline level with an intermediate echo time, CBV for grading and Tmax for typing. Multiparametric MR imaging can be accurate in determining tumor grades (primarily grades I and IV) and types (mainly pilocytic astrocytomas and embryonal tumors) in children.

  8. [Purging behaviors and nutritional status in anorexia nervosa and bulimia nervosa].

    PubMed

    Vaz, F J; García-Herráiz, A; López-Vinuesa, B; Monge, M; Fernández-Gil, M A; Guisado, J A

    2003-01-01

    The aim of the study was to investigate whether the use of purgative methods in patients with eating disorders (anorexia nervosa [AN] and bulimia nervosa [BN]) could be capable of producing changes in the nutritional status of the patients. The group under study was composed of 184 female eating disordered outpatients. One hundred and sixteen patients (63.0%) fulfilled the DSM-IV diagnostic criteria for BN (90 purging type, 26 nonpurging type). Sixty eight patients (37.0%) fulfilled the DSM-IV criteria for the diagnosis of AN (48 restricting type, 20 binging-purging type). The assessment process included anthropometry (body circumferences and skinfold thickness) and body impedance analysis. The two subgroups of AN patients significantly differed from each of the BN subgroups. From a nutritional point of view, some significant differences between the two DSM-IV subtypes of AN existed, but not between the purging type and the nonpurging type of BN. The paper discusses the clinical significance of these findings. An alternative subtypification of AN patients is proposed: 1) restricting type [patients who control their food intake and do not purge]; 2) purging type [patient with true episodes of binging which are followed by purgative behaviors]; and 3) pseudopurging type [patients with subjective binging episodes who use purging methods].

  9. Free testosterone concentration is inversely associated with markers of liver fibrosis in men with type 2 diabetes mellitus.

    PubMed

    Miyauchi, Shozo; Miyake, Teruki; Miyazaki, Masumi; Eguchi, Toru; Niiya, Tetsuji; Yamamoto, Shin; Senba, Hidenori; Furukawa, Shinya; Matsuura, Bunzo; Hiasa, Yoichi

    2017-12-28

    The association between serum testosterone level and liver fibrosis in patients with non-alcoholic fatty liver disease is unclear. To clarify this association, we investigated the relationship between serum free testosterone concentration and markers of liver fibrosis in men with type 2 diabetes mellitus but no obvious features of alcohol consumption. This retrospective observational cross-sectional study enrolled 248 men with type 2 diabetes mellitus. The FIB-4 index was measured as a marker of liver fibrosis, and multiple linear regression analysis was performed to examine its association with serum free testosterone concentration. In addition, the 7S domain of type IV collagen (IV-7S) was examined in 140 of the 248 patients. The mean free testosterone concentration was 10.6 ± 6.8 pg/mL and the means of the FIB-4 index and IV-7S were 1.64 ± 1.19 and 4.02 ± 1.11 ng/mL, respectively. After adjusting for all relevant variables, serum free testosterone concentrations were inversely associated with both the FIB-4 index and IV-7S (β; -0.28, P < 0.0001, and β; -0.28, P = 0.002, respectively). Measuring serum free testosterone concentrations in men with type 2 diabetes mellitus may help to predict progression to advanced liver disease. Identifying patients at risk may help to prevent the development of cirrhosis and hepatocellular carcinoma.

  10. Autism Spectrum Disorder in the DSM-5: Diagnostic Sensitivity and Specificity in Early Childhood.

    PubMed

    Christiansz, Jessica A; Gray, Kylie M; Taffe, John; Tonge, Bruce J

    2016-06-01

    Changes to the DSM-5 Autism Spectrum Disorder (ASD) criteria raised concerns among parents and practitioners that the criteria may exclude some children with Pervasive Developmental Disorder (PDD). Few studies have examined DSM-5 sensitivity and specificity in children less than 5 years of age. This study evaluated 185 children aged 20-55 months with DSM-IV PDD or developmental delay. Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) data was assigned to DSM-5 subdomains. Children displaying the required symptomatology were classified with DSM-5 ASD. DSM-IV clinical diagnoses were compared to DSM-5 classifications. Using combined ADI-R/ADOS information, sensitivity was .84 and specificity was .54. Comorbid behaviour and emotional problems were significantly lower in children with PDD that did not meet DSM-5 criteria.

  11. Specific phobia among U.S. adolescents: phenomenology and typology.

    PubMed

    Burstein, Marcy; Georgiades, Katholiki; He, Jian-Ping; Schmitz, Anja; Feig, Emily; Khazanov, Gabriela Kattan; Merikangas, Kathleen

    2012-12-01

    Investigators have proposed the diagnostic value of a generalized subtype of specific phobia, with classification based upon the number of phobic fears. However, current and future typologies of specific phobia classify the condition by the nature of phobic fears. This study investigated the clinical relevance of these alternative typologies by: (1) presenting the prevalence and correlates of specific phobia separately by the number and nature of phobia types; and (2) examining the clinical and psychiatric correlates of specific phobia according to these alternative typologies. The National Comorbidity Survey Replication-Adolescent Supplement (NCS-A) is a nationally representative face-to-face survey of 10,123 adolescents aged 13-18 years in the continental United States. Most adolescents with specific phobia met criteria for more than one type of phobia in their lifetime, however rates were fairly similar across DSM-IV/5 subtypes. Sex differences were consistent across DSM-IV/5 subtypes, but varied by the number of phobic types, with a female predominance observed among those with multiple types of phobias. Adolescents with multiple types of phobias exhibited an early age of onset, elevated severity and impairment, and among the highest rates of other psychiatric disorders. However, certain DSM-IV/5 subtypes (i.e. blood-injection-injury and situational) were also uniquely associated with severity and psychiatric comorbidity. Results indicate that both quantitative and DSM-IV/5 typologies of specific phobia demonstrate diagnostic value. Moreover, in addition to certain DSM-IV/5 subtypes, a generalized subtype based on the number of phobias may also characterize youth who are at greatest risk for future difficulties. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

  12. Irradiation Alters MMP-2/TIMP-2 System and Collagen Type IV Degradation in Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Won Hee; Warrington, Junie P.; Sonntag, William E.

    Purpose: Blood-brain barrier (BBB) disruption is one of the major consequences of radiation-induced normal tissue injury in the central nervous system. We examined the effects of whole-brain irradiation on matrix metalloproteinases (MMPs)/tissue inhibitors of metalloproteinases (TIMPs) and extracellular matrix (ECM) degradation in the brain. Methods and Materials: Animals received either whole-brain irradiation (a single dose of 10 Gy {gamma}-rays or a fractionated dose of 40 Gy {gamma}-rays, total) or sham-irradiation and were maintained for 4, 8, and 24 h following irradiation. mRNA expression levels of MMPs and TIMPs in the brain were analyzed by real-time reverse transcriptase-polymerase chain reaction (PCR).more » The functional activity of MMPs was measured by in situ zymography, and degradation of ECM was visualized by collagen type IV immunofluorescent staining. Results: A significant increase in mRNA expression levels of MMP-2, MMP-9, and TIMP-1 was observed in irradiated brains compared to that in sham-irradiated controls. In situ zymography revealed a strong gelatinolytic activity in the brain 24 h postirradiation, and the enhanced gelatinolytic activity mediated by irradiation was significantly attenuated in the presence of anti-MMP-2 antibody. A significant reduction in collagen type IV immunoreactivity was also detected in the brain at 24 h after irradiation. In contrast, the levels of collagen type IV were not significantly changed at 4 and 8 h after irradiation compared with the sham-irradiated controls. Conclusions: The present study demonstrates for the first time that radiation induces an imbalance between MMP-2 and TIMP-2 levels and suggests that degradation of collagen type IV, a major ECM component of BBB basement membrane, may have a role in the pathogenesis of brain injury.« less

  13. Multiparametric in situ mRNA hybridization analysis to predict disease recurrence in patients with colon carcinoma.

    PubMed Central

    Kitadai, Y.; Ellis, L. M.; Tucker, S. L.; Greene, G. F.; Bucana, C. D.; Cleary, K. R.; Takahashi, Y.; Tahara, E.; Fidler, I. J.

    1996-01-01

    We examined the expression level of several genes that regulate different steps of metastasis in formalin-fixed, paraffin-embedded archival specimens of primary human colon carcinomas from patients with at least 5 years of follow-up. The expression of epidermal growth factor receptor, basic fibroblast growth factor, type IV collagenase, E-cadherin, and multidrug resistance (mdr-1) was examined by a colorimetric in situ mRNA hybridization technique concentrating on reactivity at the periphery of the neoplasms. The in situ hybridization technique revealed inter- and intratumor heterogeneity for expression of the metastasis-related genes. The expression of basic fibroblast growth factor, collagenase type IV, epidermal growth factor receptor, and mdr-1 mRNA was higher in Dukes's stage D than in Dukes' stage B tumors. Among the 22 Dukes' stage B neoplasms, 5 specimens exhibited a high expression level of epidermal growth factor receptor, basic fibroblast growth factor, and collagenase type IV. Clinical outcome data (5-year follow-up) revealed that all 5 patients with Dukes' stage B tumors developed distant metastasis (recurrent disease), whereas the other 17 patients with Dukes' stage B tumors expressing low levels of the metastasis-related genes were disease-free. Multivariate analysis identified high levels of expression of collagenase type IV and low levels of expression of E-cadherin as independent factors significantly associated with metastasis or recurrent disease. More specifically, metastatic or recurrent disease was associated with a high ratio (> 1.35) of expression of collagenase type IV to E-cadherin (specificity of 95%). Collectively, the data show that multiparametric in situ hybridization analysis for several metastasis-related genes may predict the metastatic potential, and hence the clinical outcome, of individual lymph-node-negative human colon cancers. Images Figure 1 Figure 2 PMID:8909244

  14. Identification and tissue distribution of mRNAs encoding salmon-type calcitonins-IV and -V in the rainbow trout.

    PubMed

    Hidaka, Yoshie; Suzuki, Masakazu

    2004-06-01

    Four types of calcitonin are produced in salmonid fish, although their functional diversity is almost unknown. To explore the significance of these isoforms, we have characterized salmon-type calcitonin (sCT) mRNAs in the rainbow trout (Oncorhynchus mykiss), and examined their tissue distribution. In addition to the previously isolated sCT-I cDNAs, two new forms of sCT cDNA were cloned from the ultimobranchial gland, and one of them (sCT-IV cDNA) was predicted to encode an N-terminal peptide of 80 amino acid residues, a putative cleavage site Lys-Arg, sCT-IV, a cleavage and amidation sequence Gly-Lys-Lys-Arg, and a C-terminal peptide of 18 amino acids. The sCT-IV precursor was 78% identical with the rainbow trout sCT-I precursors. The other cloned cDNA encoded a precursor for a novel CT, sCT-V. The sCT-V peptide was different from sCT-IV by only one amino acid residue: Val at position 8 in the latter was replaced by Met. The sCT-V precursor had 80 and 90% identity with the sCT-I and -IV precursors respectively. No cDNA clones were obtained for sCTs-II or -III.Tissue distribution of sCT-I, -IV and -V mRNAs was examined by RT-PCR and specific cleavage with restriction enzymes. An amplified fragment from sCT-I mRNA was detected not only in the ultimobranchial gland, but also in the gills, testis and ovary. RT-PCR analysis coupled to restriction digestion further revealed that sCT-IV mRNA was expressed in both the testis and the ultimobranchial gland. The expression sites of sCT-IV mRNA were localized to the Leydig cells of the testis and to the parenchymal cells of the ultimobranchial gland, by in situ hybridization histochemistry. Although the amino acid sequence of sCT-V peptide was nearly the same as that of sCT-IV, the sCT-V gene showed a much wider pattern of expression: the band amplified by RT-PCR was detected in all the tissues examined except the kidney, gills and blood cells. The sCT-V mRNA was shown to be localized in the parenchymal cells of the ultimobranchial gland, but not in other tissues at the cellular level, suggesting very low expression of sCT-V mRNA in those tissues. Our results show different patterns of tissue expression of three types of sCT genes in the rainbow trout, suggesting that sCTs-I, -IV and -V might differ in their local actions.

  15. Assessing the costs attributed to project delay during project pre-construction stages

    DOT National Transportation Integrated Search

    2016-03-01

    This project for the Texas Department of Transportation (TxDOT) developed a simple but sound : methodology for estimating the cost of delaying most types of highway projects. Researchers considered the : cost of delays during the pre-construction pha...

  16. Assessing the costs attributed to project delay during project pre-construction stages.

    DOT National Transportation Integrated Search

    2016-03-01

    This project for the Texas Department of Transportation (TxDOT) developed a simple but sound : methodology for estimating the cost of delaying most types of highway projects. Researchers considered the : cost of delays during the pre-construction pha...

  17. Level III and IV Ecoregions of the Continental United States

    EPA Pesticide Factsheets

    Information and downloadable maps and datasets for Level III and IV ecoregions of the continental United States. Ecoregions are areas of general similarity in the type, quality, and quantity of environmental resources.

  18. Razumikhin-Type Stability Criteria for Differential Equations with Delayed Impulses.

    PubMed

    Wang, Qing; Zhu, Quanxin

    2013-01-01

    This paper studies stability problems of general impulsive differential equations where time delays occur in both differential and difference equations. Based on the method of Lyapunov functions, Razumikhin technique and mathematical induction, several stability criteria are obtained for differential equations with delayed impulses. Our results show that some systems with delayed impulses may be exponentially stabilized by impulses even if the system matrices are unstable. Some less restrictive sufficient conditions are also given to keep the good stability property of systems subject to certain type of impulsive perturbations. Examples with numerical simulations are discussed to illustrate the theorems. Our results may be applied to complex problems where impulses depend on both current and past states.

  19. Electric organ discharge diversity in the genus Gymnotus: anatomo-functional groups and electrogenic mechanisms.

    PubMed

    Rodríguez-Cattáneo, A; Aguilera, P; Cilleruelo, E; Crampton, W G R; Caputi, A A

    2013-04-15

    Previous studies describe six factors accounting for interspecific diversity of electric organ discharge (EOD) waveforms in Gymnotus. At the cellular level, three factors determine the locally generated waveforms: (1) electrocyte geometry and channel repertoire; (2) the localization of synaptic contacts on electrocyte surfaces; and (3) electric activity of electromotor axons preceding the discharge of electrocytes. At the organismic level, three factors determine the integration of the EOD as a behavioral unit: (4) the distribution of different types of electrocytes and specialized passive tissue forming the electric organ (EO); (5) the neural mechanisms of electrocyte discharge coordination; and (6) post-effector mechanisms. Here, we reconfirm the importance of the first five of these factors based on comparative studies of a wider diversity of Gymnotus than previously investigated. Additionally, we report a hitherto unseen aspect of EOD diversity in Gymnotus. The central region of the EO (which has the largest weight on the conspecific-received field) usually exhibits a negative-positive-negative pattern where the delay between the early negative and positive peaks (determined by neural coordination mechanisms) matches the delay between the positive and late negative peaks (determined by electrocyte responsiveness). Because delays between peaks typically determine the peak power frequency, this matching implies a co-evolution of neural and myogenic coordination mechanisms in determining the spectral specificity of the intraspecific communication channel. Finally, we define four functional species groups based on EO/EOD structure. The first three exhibit a heterogeneous EO in which doubly innervated electrocytes are responsible for a main triphasic complex. Group I species exhibit a characteristic cephalic extension of the EO. Group II species exhibit an early positive component of putative neural origin, and strong EO auto-excitability. Group III species exhibit an early, slow, negative wave of abdominal origin, and variation in EO auto-excitability. Representatives of Group IV generate a unique waveform comprising a main positive peak followed by a small, load-dependent negative component.

  20. OBSERVATION AND ANALYSIS OF BALLISTIC DOWNFLOWS IN AN M-CLASS FLARE WITH THE INTERFACE REGION IMAGING SPECTROGRAPH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brannon, Sean R.

    Despite significant advances in instrumentation, there remain no studies that analyze observations of on-disk flare loop plasma flows covering the entire evolution from chromospheric evaporation, through plasma cooling, to draining downflows. We present results from an imaging and spectroscopic observation from the Interface Region Imaging Spectrograph ( IRIS ) of the SOL2015–03–12T11:50:00 M-class flare, at high spatial resolution and time cadence. Our analysis of this event reveals initial plasma evaporation at flare temperatures indicated by 100–200 km s{sup −1} blueshifts in the Fe xxi line. We subsequently observe plasma cooling into chromospheric lines (Si iv and O iv) with ∼11more » minute delay, followed by loop draining at ∼40 km s{sup −1} as indicated by a “C”-shaped redshift structure and significant (∼60 km s{sup −1}) non-thermal broadening. We use density-sensitive lines to calculate a plasma density for the flare loops, and estimate a theoretical cooling time approximately equal to the observed delay. Finally, we use a simple elliptical free-fall draining model to construct synthetic spectra, and perform what we believe to be the first direct comparison of such synthetic spectra to observations of draining downflows in flare loops.« less

  1. Is delayed surgery related to worse outcomes in native left-sided endocarditis?

    PubMed

    Tepsuwan, Thitipong; Rimsukcharoenchai, Chartaroon; Tantraworasin, Apichat; Woragidpoonpol, Surin; Schuarattanapong, Suphachai; Nawarawong, Weerachai

    2016-05-01

    Timing of surgery in the management of infective endocarditis is controversial, and there is still no definite conclusion on how early the surgery should be performed. This study focuses on the outcomes of surgery during the active period of infective endocarditis in consideration of the duration after diagnosis. One hundred and thirty-four patients with active native valve infective endocarditis who underwent surgery from January 2006 to December 2013 were reviewed retrospectively. They were divided in 2 groups based on timing of surgery: early group (first week after diagnosis, n = 37) and delayed group (2 to 6 weeks after diagnosis, n = 97). Compared to the delayed group, the early group had significantly more patients in New York Heart Association class IV (81% vs. 43.3%), more mechanically ventilated (54.1% vs. 18.6%), more on inotropic support (62.2% vs. 38.1%), and hence a worse EuroSCORE II (14.8% vs. 8.8%). Operative mortality was comparable (5.4% vs. 10.3%) and 7-year survival was similar (77.4% vs. 74.6%). On multivariable regression analysis, delayed surgery did not impact on short- and long-term outcomes. Preoperative cardiac arrest and infection with Haemophilus, Actinobacillus, Cardiobacterium, Eikenella, or Kingella were risk factors for higher operative mortality. Predictors of poor 7-year survival were diabetes mellitus and acute renal failure. Delayed surgery is not associated with worse outcomes. Both early and delayed approaches are safe and provide acceptable results. Timing of surgery should be tailored to each patient's clinical status, not based on duration of endocarditis alone. © The Author(s) 2016.

  2. Enteral Contrast in the Computed Tomography Diagnosis of Appendicitis

    PubMed Central

    Drake, Frederick Thurston; Alfonso, Rafael; Bhargava, Puneet; Cuevas, Carlos; Dighe, Manjiri K.; Florence, Michael G.; Johnson, Morris G.; Jurkovich, Gregory J.; Steele, Scott R.; Symons, Rebecca Gaston; Thirlby, Richard C.; Flum, David R.

    2014-01-01

    Objective Our goal was to perform a comparative effectiveness study of intravenous (IV)-only versus IV + enteral contrast in computed tomographic (CT) scans performed for patients undergoing appendectomy across a diverse group of hospitals. Background Small randomized trials from tertiary centers suggest that enteral contrast does not improve diagnostic performance of CT for suspected appendicitis, but generalizability has not been demonstrated. Eliminating enteral contrast may improve efficiency, patient comfort, and safety. Methods We analyzed data for adult patients who underwent nonelective appendectomy at 56 hospitals over a 2-year period. Data were obtained directly from patient charts by trained abstractors. Multivariate logistic regression was utilized to adjust for potential confounding. The main outcome measure was concordance between final radiology interpretation and final pathology report. Results A total of 9047 adults underwent appendectomy and 8089 (89.4%) underwent CT, 54.1% of these with IV contrast only and 28.5% with IV + enteral contrast. Pathology findings correlated with radiographic findings in 90.0% of patients who received IV + enteral contrast and 90.4% of patients scanned with IV contrast alone. Hospitals were categorized as rural or urban and by their teaching status. Regardless of hospital type, there was no difference in concordance between IV-only and IV + enteral contrast. After adjusting for age, sex, comorbid conditions, weight, hospital type, and perforation, odds ratio of concordance for IV + enteral contrast versus IV contrast alone was 0.95 (95% CI: 0.72–1.25). Conclusions Enteral contrast does not improve CT evaluation of appendicitis in patients undergoing appendectomy. These broadly generalizable results from a diverse group of hospitals suggest that enteral contrast can be eliminated in CT scans for suspected appendicitis. PMID:24598250

  3. The type IV pilin of Burkholderia mallei is highly immunogenic but fails to protect against lethal aerosol challenge in a murine model.

    PubMed

    Fernandes, Paula J; Guo, Qin; Waag, David M; Donnenberg, Michael S

    2007-06-01

    Burkholderia mallei is the cause of glanders and a proven biological weapon. We identified and purified the type IV pilin protein of this organism to study its potential as a subunit vaccine. We found that purified pilin was highly immunogenic. Furthermore, mice infected via sublethal aerosol challenge developed significant increases in titers of antibody against the pilin, suggesting that it is expressed in vivo. Nevertheless, we found no evidence that high-titer antipilin antisera provided passive protection against a sublethal or lethal aerosol challenge and no evidence of protection afforded by active immunization with purified pilin. These results contrast with the utility of type IV pilin subunit vaccines against other infectious diseases and highlight the need for further efforts to identify protective responses against this pathogen.

  4. Resolution of Large Azygos Vein Aneurysm Following Stent-Graft Shunt Placement in a Patient with Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Souza, Estelle S.; Williams, David M.; Deeb, G.M.

    2006-10-15

    Ehlers-Danlos syndrome (EDS) type IV is a rare connective tissue disorder associated with thin-walled, friable arteries and veins predisposing patients to aneurysm formation, dissection, fistula formation, and vessel rupture. Azygos vein aneurysm is an extremely rare condition which has not been reported in association with EDS in the literature. We present a patient with EDS type IV and interrupted inferior vena cava (IVC) with azygos continuation who developed an azygos vein aneurysm. In order to decrease flow through the azygos vein and reduce the risk of aneurysm rupture, a stent-graft shunt was created from the right hepatic vein to themore » azygos vein via a transhepatic, retroperitoneal route. At 6 month follow-up the shunt was open and the azygos vein aneurysm had resolved.« less

  5. Differential recognition of geometric isomers by the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae): Evidence for only three essential components in aggregation pheromone.

    PubMed

    Dickens, J C; Prestwich, G D

    1989-02-01

    For two decades, the aggregation pheromone of the boll weevil,Anthonomus grandis Boh. (Coleoptera: Curculionidae), was thought to consist of four compounds: I [(+)-(Z)-2-isopropenyl-1-methylcyclobutane ethanol]; II [(Z)-3,3-dimethyl-Δ(I,β)-cyclohexane ethanol]; III [(Z)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde); and IV [(E)-3,3-dimethyl-Δ(1,α)-cyclohexane acetaldehyde). Evidence is presented from behavioral and electrophysiological studies to show that only three of these components, I, II, and IV, are essential for attraction. Competitive field tests, in which each possible three-component blend was tested against the four-component mixture, demonstrated that omission of I, II. or IV resulted in decreased trap captures (P < 0.01). Trap captures by these blends lacking I, II, or IV resembled those by the hexane solvent alone in a similar experiment. However, omission of III did not significantly alter field attractiveness of the blend. Dosage-response curves constructed from electroantennogram responses of both males and females to serial dilutions of III, IV, and a 50∶50 mixture of the geometric isomers III and IV showed both sexes to be 10- to 100-fold more sensitive to IV than III. Data from the electrophysiological studies were consistent with a single acceptor type for the (E)-cyclohexylidene aldehyde, IV, for males, and possibly one or two acceptor types for III and IV for females. Possible roles for the (Z)-cyclohexylidene aldehyde, III, and implications for the pheromonal attractant currently used in boll weevil eradication/suppression programs are discussed.

  6. Measuring functional developmental delay in infants and young children: prevalence rates from the NHIS-D.

    PubMed

    Simpson, Gloria A; Colpe, Lisa; Greenspan, Stanley

    2003-01-01

    In order to measure the prevalence of developmental delay among US infants and children, two types of questions were asked of parents in the 1994-95 National Health Interview Survey on Disability (NHIS-D). To measure functional delay (FD), questions from the Functional Developmental Growth Chart (FDQ), which measures specific age-appropriate tasks, were used. General delay (GD) was defined using the general type of questions about developmental delay that had been used in previous surveys. Using a nationally representative sample of 15 291 infants and children aged 4-59 months from the NHIS-D, analyses revealed that, according to these questions, approximately 3.3% had FD and 3.4% of the children had GD. However, only one-third of the children were identified by both sets of questions. Thus, two-thirds of the children identified as having FD were not recognised by their parents as having a delay. Conversely, many parents responded to the GD questions indicating that their child had a delay, but failed to indicate that their child had a functional problem. In addition, only 17% of the children with FD and 31% of those with GD were receiving special services. Multivariable logistic regression analyses found that children with both FD and GD were more likely to be male and to be living in families with incomes below 200% of the poverty level. The findings suggest that the general types of developmental delay questions used in national surveys may not identify children with functional delays. As parents failed to identify these children, it is possible that many of these children may be slipping through paediatric surveillance. Further research to evaluate the use of these measures in population surveys is recommended.

  7. Predominance of Three Closely Related Methicillin-Resistant Staphylococcus aureus Clones Carrying a Unique ccrC-Positive SCCmec type III and the Emergence of spa t304 and t690 SCCmec type IV pvl+ MRSA Isolates in Kinta Valley, Malaysia.

    PubMed

    Ho, Wai-Yew; Choo, Quok-Cheong; Chew, Choy-Hoong

    2017-03-01

    We investigated the epidemiology and clonality of 175 nonrepetitive methicillin-resistant Staphylococcus aureus (MRSA) isolates from clinical specimens collected between 2011 and 2012 in Kinta Valley in Malaysia. Molecular tools such as polymerase chain reaction, pulsed-field gel electrophoresis, and staphylococcal protein A (spa) typing were used. Our study revealed the predominance of three closely related ermA + SCCmec type III pulsotypes belonging to spa type t037 (Brazilian-Hungarian clone), which were deficient in the locus F, but positive for the ccrC gene in majority (65.7%) of the MRSA infections in this region. The first evidence of SCCmec type II MRSA in the country, belonging to spa type t2460, was also noted. Although the carriage of pvl gene was uncommon (8.6%) and mostly confined to either SCCmec type IV or SCCmec type V isolates, most of these isolates belonged to spa types t345 or t657, which are associated with the Bengal-Bay CA-MRSA clone. Interestingly, spa t304 and t690 SCCmec type IV pvl + were also detected among the MRSA isolates. Data from this study show the rise of uncommon clones among MRSA isolates in Malaysia.

  8. Multidisciplinary Treatment of Severe Osteogenesis Imperfecta: Functional Outcomes at Skeletal Maturity.

    PubMed

    Montpetit, Kathleen; Palomo, Telma; Glorieux, Francis H; Fassier, François; Rauch, Frank

    2015-10-01

    To determine the functional outcomes associated with long-term multidisciplinary treatment, intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation in children with severe osteogenesis imperfecta (OI) (diagnosed clinically as OI types III or IV). Retrospective study where outcomes were measured prospectively. Pediatric orthopedic hospital. Adolescents (N=41; age range, 15-21y) with severe OI (OI type III: n=17; OI type IV: n=24) who had started therapy before the age of 6 years, had received treatment for at least 10 years, and had achieved final height. Intravenous bisphosphonate treatment, orthopedic surgery, and rehabilitation. Pediatric Evaluation of Disability Inventory. At the time of the last available follow-up examination, none of the individuals diagnosed with OI type III (most severely affected group) was able to ambulate without ambulation aids, whereas 20 (83%) patients with OI type IV were able to ambulate without ambulation aids. Regarding self-care, we specifically assessed 8 skills that we deemed essential for living independently (grooming; dressing; toileting; bed, chair, toilet, tub, and car transfers). Only 6 (35%) of the youths with OI type III were able to complete all 8 items, whereas 23 (96%) individuals with OI type IV managed to perform all tasks. Teens with OI type III often needed assistance for the transfer to toilet, tub, and car and for personal hygiene and clothing management associated with toileting, usually because of limitations in upper-extremity function. These observations suggest that further improvements in the functional status of the most severely affected children with OI are contingent on advances in the clinical management of upper-extremity issues. Copyright © 2015 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

  9. Maturation delay for the predators can enhance stable coexistence for a class of prey-predator models.

    PubMed

    Banerjee, Malay; Takeuchi, Yasuhiro

    2017-01-07

    Maturation time delay for the predators is introduced in prey-predator models to implicitly model the stage-structure of predators. Most of the prey-predator models with maturation delay are known to exhibit destabilization of coexistence steady-state. Discrete time delay induced destabilization is a common finding, however, this is due to the introduction of time delay with lack of ecological justification. The main objective of the present work is to show the stabilizing role of maturation delay for a class of delayed prey-predator model. To be specific, we consider prey-predator models with strong and weak Allee effects in prey growth and Michaelis-Menten type functional response. We provide ecological justification for the introduction of maturation delay parameter in predator's growth equation. We obtain the conditions for stable and oscillatory coexistence of prey and their specialist predator in case of strong as well as weak Allee effect for non-delayed and delayed models. Apart from the analytical results for the models under consideration, we perform extensive numerical simulations to construct the relevant bifurcation diagrams. Our analytical and supportive numerical findings reveal that delay is not always a destabilizing factor rather the stable coexistence in the presence of time delay depends upon the formulation of the delayed model. The biological implications of the current investigation are provided in the conclusion section. We also explain the validity of obtained results for other types of prey-predator models with a specialist predator. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Diagnostic delay in narcolepsy type 1: combining the patients' and the doctors' perspectives.

    PubMed

    Taddei, Raquel N; Werth, Esther; Poryazova, Rositsa; Baumann, Christian R; Valko, Philipp O

    2016-12-01

    Narcolepsy type 1 is a neurological disorder characterized by a unique syndrome, including the pathognomonic symptom of cataplexy. The diagnosis can be confirmed by objective measures, such as typical findings in the multiple sleep latency test, reduced or undetectable levels of orexin (hypocretin) in the cerebrospinal fluid, and linkage to a specific HLA haplotype. Nevertheless, the mean time that elapses from symptom onset to the correct diagnosis ranges between 10 and 20 years, and the causes and correlates of this delay are poorly understood. Diagnostic delay was assessed on 52 well-defined patients with narcolepsy type 1, evaluating clinical, electrophysiological and neurochemical parameters and the results of a 41-item questionnaire developed to obtain the patients' perspective on various aspects of the diagnostic process. The mean time gap between disease onset and first medical consultation was 3.2 ± 5.1 years; the mean diagnostic delay was 8.9 ± 11.0 years. Prior to correct diagnosis, patients received a wide variety of misdiagnoses. The self-ratings of the patients revealed that the undiagnosed symptoms caused high levels of anxiety and unjustified criticism by family, friends and employers. Multiple regression analysis identified higher cerebrospinal fluid orexin levels (β = 0.311, P = 0.01), and a longer interval between the onset of excessive daytime sleepiness and cataplexy (β = 0.368, P = 0.002) as independent associates of longer diagnostic delay. The diagnostic delay decreased over the last decades (β = -0.672, P < 0.001). In conclusion, delayed diagnosis of narcolepsy type 1 is very common, associated with many adverse consequences, and requires educational efforts to improve awareness on narcolepsy among healthcare providers and the general population. © 2016 European Sleep Research Society.

  11. Tolerance and immunity in mice infected with herpes simplex virus: studies on the mechanism of tolerance to delayed-type hypersensitivity.

    PubMed

    Nash, A A; Phelan, J; Gell, P G; Wildy, P

    1981-06-01

    Tolerance to delayed-type hypersensitivity is produced in mice following an intravenous injection of herpes simplex virus. This form of tolerance is produced early on, following simultaneous injections of virus subcutaneously and intravenously, and is long lasting (greater than 100 days). The early tolerance mechanism is resistant to high doses of cyclophosphamide and is not transferable by serum or spleen cells taken after 7 days. However, spleen cells taken at 14 days onwards inhibit the induction of delayed hypersensitivity when transferred to normal syngeneic recipients. These cells are T lymphocytes and are specific for the herpes type used in the induction.

  12. Tolerance and immunity in mice infected with herpes simplex virus: studies on the mechanism of tolerance to delayed-type hypersensitivity.

    PubMed Central

    Nash, A A; Phelan, J; Gell, P G; Wildy, P

    1981-01-01

    Tolerance to delayed-type hypersensitivity is produced in mice following an intravenous injection of herpes simplex virus. This form of tolerance is produced early on, following simultaneous injections of virus subcutaneously and intravenously, and is long lasting (greater than 100 days). The early tolerance mechanism is resistant to high doses of cyclophosphamide and is not transferable by serum or spleen cells taken after 7 days. However, spleen cells taken at 14 days onwards inhibit the induction of delayed hypersensitivity when transferred to normal syngeneic recipients. These cells are T lymphocytes and are specific for the herpes type used in the induction. PMID:6265348

  13. Fatal Peritoneal Bleeding Following Embolization of a Carotid-Cavernous Fistula in Ehlers-Danlos Syndrome Type IV

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Usinskiene, Jurgita; Mazighi, Mikael; Bisdorff, Annouk

    2006-12-15

    We report the case of a 25-year-old woman treated for a spontaneous carotid-cavernous fistula in a context of Ehlers-Danlos syndrome type IV. Embolization with a transvenous approach was achieved without complications; however, the patient died 72 hr later of massive intraperitoneal bleeding. At autopsy, no lesion of the digestive arteries was identified. Possible causes of this bleeding are discussed.

  14. Structure and function of the adhesive type IV pilus of Sulfolobus acidocaldarius

    PubMed Central

    Henche, Anna-Lena; Ghosh, Abhrajyoti; Yu, Xiong; Jeske, Torsten; Egelman, Edward; Albers, Sonja-Verena

    2014-01-01

    Archaea display a variety of type IV pili on their surface and employ them in different physiological functions. In the crenarchaeon Sulfolobus acidocaldarius the most abundant surface structure is the aap pilus (archaeal adhesive pilus). The construction of in frame deletions of the aap genes revealed that all the five genes (aapA, aapX, aapE, aapF, aapB) are indispensible for assembly of the pilus and an impact on surface motility and biofilm formation was observed. Our analyses revealed that there exists a regulatory cross-talk between the expression of aap genes and archaella (formerly archaeal flagella) genes during different growth phases. The structure of the aap pilus is entirely different from the known bacterial type IV pili as well as other archaeal type IV pili. An aap pilus displayed 3 stranded helices where there is a rotation per subunit of ~ 138° and a rise per subunit of ~ 5.7 Å. The filaments have a diameter of ~ 110 Å and the resolution was judged to be ~ 9 Å. We concluded that small changes in sequence might be amplified by large changes in higher-order packing. Our finding of an extraordinary stability of aap-pili possibly represents an adaptation to harsh environments that S. acidocaldarius encounters. PMID:23078543

  15. Alteration of Escherichia coli topoisomerase IV to novobiocin resistance.

    PubMed

    Hardy, Christine D; Cozzarelli, Nicholas R

    2003-03-01

    DNA gyrase and topoisomerase IV (topo IV) are the two essential type II topoisomerases of Escherichia coli. Gyrase is responsible for maintaining negative supercoiling of the bacterial chromosome, whereas topo IV's primary role is in disentangling daughter chromosomes following DNA replication. Coumarins, such as novobiocin, are wide-spectrum antimicrobial agents that primarily interfere with DNA gyrase. In this work we designed an alteration in the ParE subunit of topo IV at a site homologous to that which confers coumarin resistance in gyrase. This parE mutation renders the encoded topo IV approximately 40-fold resistant to inhibition by novobiocin in vitro and imparts a similar resistance to inhibition of topo IV-mediated relaxation of supercoiled DNA in vivo. We conclude that topo IV is a secondary target of novobiocin and that it is very likely to be inhibited by the same mechanism as DNA gyrase.

  16. Local Bifurcations and Optimal Theory in a Delayed Predator-Prey Model with Threshold Prey Harvesting

    NASA Astrophysics Data System (ADS)

    Tankam, Israel; Tchinda Mouofo, Plaire; Mendy, Abdoulaye; Lam, Mountaga; Tewa, Jean Jules; Bowong, Samuel

    2015-06-01

    We investigate the effects of time delay and piecewise-linear threshold policy harvesting for a delayed predator-prey model. It is the first time that Holling response function of type III and the present threshold policy harvesting are associated with time delay. The trajectories of our delayed system are bounded; the stability of each equilibrium is analyzed with and without delay; there are local bifurcations as saddle-node bifurcation and Hopf bifurcation; optimal harvesting is also investigated. Numerical simulations are provided in order to illustrate each result.

  17. Type Ia Supernova Rates Near and Far

    NASA Astrophysics Data System (ADS)

    Panagia, Nino; Della Valle, Massimo; Mannucci, Filippo

    2007-08-01

    Recently, three important observational results were established: (a) The evolution of the SNIa rate with redshift is now measured up to z~1.6 and the results at the highest redshifts, derived by the GOODS collaboration show that the SN rate rises up to z~0.8, when the Universe was 6.5 Gyr old, and decreases afterward. (b) The rate of supernova explosions of the different types as a function of the galaxy (B-K) and the galaxy mass have been determined. It is found that the rates of all SN types, including Ia, Ib/c and II, show a marked increase with the star formation activity. (c) An analysis of SNIa events in early-type galaxies has provided conclusive evidence that the rate of SNIa in radio-loud galaxies is much higher than the rate measured in radio-quiet galaxies. This result suggests that repeated episodes of interaction and/or mergers of early-type galaxies with dwarf companions are responsible for supplying an adequate number of SNIa progenitors to the stellar population of elliptical galaxies. On this basis we have discussed the distribution of the delay time (DTD) between the formation of a SNIa progenitor star and its explosion as a SNIa. Our analysis finds: i) models with long delay times, say 3-4 Gyr, cannot reproduce the dependence of the SNIa rate on the colors and on the radio-luminosity of the parent galaxies; ii) the dependence of the SNIa rate on the parent galaxy colors requires models with a wide DTD, spanning the interval 100 Myr to 10 Gyr; iii) the dependence on the parent galaxy radio-luminosity requires substantial production of SNIa at epochs earlier than 100 Myr after the birth of a given stellar generation; iv) the comparison between observed SN rates and a grid of theoretical ``single-population'' DTDs shows that only a few of them are marginally consistent with all observations; v) the present data are best matched by a bimodal DTD, in which about 50% of type Ia SNe (``prompt'' SNIa) explode soon after their stellar birth, in a time of the order of 100 Myrs, while the remaining 50% (``tardy'' SNIa) have a much wider distribution, well described by an exponential function with a decay time of about 3 Gyr. This fact, coupled with the well established bimodal distribution of the decay rate, suggests the existence of two classes of progenitors and/or explosive channels. We discuss the cosmological implications of this result and make simple predictions.

  18. First Report of cfr-Carrying Plasmids in the Pandemic Sequence Type 22 Methicillin-Resistant Staphylococcus aureus Staphylococcal Cassette Chromosome mec Type IV Clone

    PubMed Central

    Shore, Anna C.; Lazaris, Alexandros; Kinnevey, Peter M.; Brennan, Orla M.; Brennan, Gráinne I.; O'Connell, Brian; Feßler, Andrea T.; Schwarz, Stefan

    2016-01-01

    Linezolid is often the drug of last resort for serious methicillin-resistant Staphylococcus aureus (MRSA) infections. Linezolid resistance is mediated by mutations in 23S rRNA and genes for ribosomal proteins; cfr, encoding phenicol, lincosamide, oxazolidinone, pleuromutilin, and streptogramin A (PhLOPSA) resistance; its homologue cfr(B); or optrA, conferring oxazolidinone and phenicol resistance. Linezolid resistance is rare in S. aureus, and cfr is even rarer. This study investigated the clonality and linezolid resistance mechanisms of two MRSA isolates from patients in separate Irish hospitals. Isolates were subjected to cfr PCR, PhLOPSA susceptibility testing, 23S rRNA PCR and sequencing, DNA microarray profiling, spa typing, pulsed-field gel electrophoresis (PFGE), plasmid curing, and conjugative transfer. Whole-genome sequencing was used for single-nucleotide variant (SNV) analysis, multilocus sequence typing, L protein mutation identification, cfr plasmid sequence analysis, and optrA and cfr(B) detection. Isolates M12/0145 and M13/0401 exhibited linezolid MICs of 64 and 16 mg/liter, respectively, and harbored identical 23S rRNA and L22 mutations, but M12/0145 exhibited the mutation in 2/6 23S rRNA alleles, compared to 1/5 in M13/0401. Both isolates were sequence type 22 MRSA staphylococcal cassette chromosome mec type IV (ST22-MRSA-IV)/spa type t032 isolates, harbored cfr, exhibited the PhLOPSA phenotype, and lacked optrA and cfr(B). They differed by five PFGE bands and 603 SNVs. Isolate M12/0145 harbored cfr and fexA on a 41-kb conjugative pSCFS3-type plasmid, whereas M13/0401 harbored cfr and lsa(B) on a novel 27-kb plasmid. This is the first report of cfr in the pandemic ST22-MRSA-IV clone. Different cfr plasmids and mutations associated with linezolid resistance in genotypically distinct ST22-MRSA-IV isolates highlight that prudent management of linezolid use is essential. PMID:26953212

  19. Performance of Young Adult Cannabis Users on Neurocognitive Measures of Impulsive Behavior and their Relationship to Symptoms of Cannabis Use Disorders

    PubMed Central

    Gonzalez, Raul; Schuster, Randi Melissa; Mermelstein, Robin J.; Vassileva, Jasmin; Martin, Eileen M.; Diviak, Kathleen R.

    2012-01-01

    Recent studies suggest that abstinent cannabis users show deficits on neurocognitive laboratory tasks of impulsive behavior. But results are mixed and less is known on the performance of non-treatment seeking, young adult cannabis users. Importantly, relationships between performance on measures of impulsive behavior and symptoms of cannabis addiction remain relatively unexplored. We compared young adult current cannabis users (CU, n = 65) and non-using controls (NU, n = 65) on several laboratory measures of impulsive behavior, as well as on a measure of episodic memory commonly impacted by cannabis use. The CU group performed more poorly than the NU group on the Hopkins Verbal Learning Test-Revised Total Immediate Recall and Delayed Recall. No significant differences were observed on the measures of impulsive behavior (i.e., Iowa Gambling Task [IGT], Go-Stop Task, Monetary Choice Questionnaire, Balloon Analogue Risk Task). We examined relationships between neurocognitive performance and symptoms of cannabis use disorder symptoms (DSM-IV CUD) among the CU group, which revealed that poorer IGT performance was associated with more symptoms of DSM-IV CUD. Our results show poorer memory performance among young adult cannabis users relative to healthy controls, but no differences on measures of impulsive behavior. However, performance on a specific type of impulsive behavior (i.e., poorer decision-making) was associated with more cannabis use disorder symptoms. These results provide preliminary evidence to suggest that decision-making deficits may be more strongly associated with problems experienced from cannabis use, rather than solely being a consequence of cannabis use, per se. PMID:22882144

  20. Approach to inguinal hernia in high-risk geriatric patients: Should it be elective or emergent?

    PubMed

    Işıl, Rıza Gürhan; Yazıcı, Pınar; Demir, Uygar; Kaya, Cemal; Bostancı, Özgür; İdiz, Ufuk Oğuz; Işıl, Canan Tülay; Demircioğlu, Mahmut Kaan; Mihmanlı, Mehmet

    2017-03-01

    Elderly patients are more prone to have inguinal hernia due to weakened abdominal musculature. However, surgical repair of inguinal hernia (SRIH) may not be performed or may be delayed due to greater risk in presence of comorbidities. Present study is investigation of outcome of elective and emergency SRIH in geriatric patients. Records of total of 384 high-risk (American Society of Anesthesiology classification III-IV) patients aged >65 years who underwent SRIH between January 2010 and December 2014 were reviewed. Patients were divided into 2 groups according to procedure type: elective (Group EL) or emergency (Group EM). Demographic features and surgical and postoperative period data of 2 groups were recorded and compared. Demographic data were similar, but number of ASA IV patients was greater in Group EM. Frequency of intestinal resection was significantly greater in emergency surgery group (1% vs 21%; p<0.01). Length of hospital stay (1.3 days vs 7.9 days; p<0.01) and intensive care unit stay (0.17 days vs 4.04 days; p<0.01) were also greater in Group EM. Morbidity (1% vs 24%; p<0.01) and mortality (0.3% vs 11%; p<0.01) were also significantly higher in Group EM compared to elective SRIH group. Emergency inguinal hernia surgery is associated with significantly higher morbidity and mortality compared with elective SRIH in high-risk geriatric patients. Elective hernia repair in these patients should be considered to reduce risk of need for intestinal resection as well as length of hospital stay.

  1. The efficacy of adjuvant immunochemotherapy with OK-432 after curative resection of gastric cancer: an individual patient data meta-analysis of randomized controlled trials.

    PubMed

    Oba, Mari S; Teramukai, Satoshi; Ohashi, Yasuo; Ogawa, Kenji; Maehara, Yoshihiko; Sakamoto, Junichi

    2016-04-01

    OK-432 has been used as a cancer treatment for 40 years, and the immunostimulatory effects of OK-432 therapy have been intensely investigated in Japan. Recently, it has received attention as a possible booster for cancer vaccine treatments. Our previous meta-analysis based on summary measures revealed a significant improvement in the survival of patients with curatively resected gastric cancer. However, it is impossible to exclude the possibility of bias due to several prognostic factors. We collected individual data for patients with stage III or stage IV gastric cancer after curative resection from 14 trials that were identified in a previous meta-analysis. Immunochemotherapy with OK-432 was compared with treatment with standard chemotherapy on an intention-to-treat basis. The primary end point was overall survival. Stratified survival analyses were performed with the trial as the stratification factor. Subgroup analyses were also performed according to the potential prognostic factors, which included pathological factors, splenectomy, and delayed-type hypersensitivity. There were 796 and 726 patients in the OK-432 and control groups, respectively. The median overall survival was 42.6 months for the OK-432 group and 32.3 months for the control group. The overall hazard ratio was 0.88 (95 % confidence interval 0.77-1.00, p = 0.050). No factor showed a statistically significant interaction in the subgroup analyses. The results suggest that immunochemotherapy treatment with OK-432 could have a borderline significant effect for patients with stage III or stage IV gastric cancer after curative resection.

  2. Analysis of Outcomes for High Tibial Osteotomies Performed With Cartilage Restoration Techniques.

    PubMed

    Kahlenberg, Cynthia A; Nwachukwu, Benedict U; Hamid, Kamran S; Steinhaus, Michael E; Williams, Riley J

    2017-02-01

    To evaluate reported medium- to long-term outcomes after high tibial osteotomy (HTO) with associated cartilage restoration procedures. A review of the MEDLINE database was performed. The inclusion criteria were English language, clinical outcome study with HTO as the primary procedure, use of a form of cartilage repair included, and the mean follow-up period of at least 2 years. Each identified study was reviewed for study design, patient demographics, type of procedures performed, clinical outcomes, progression to total knee arthroplasty, and complications. Eight hundred and twenty-seven patients (839 knees) were included. The most common cartilage preservation technique used in conjunction with HTO was microfracture (4 studies; 22.2%). The mean Lyscholm scores, reported in 50% of the studies, ranged from 40 to 65.7 preoperatively and improved to a range of 67 to 94.6 postoperatively. Four studies (22.2%) used a visual analog scale for evaluation of pain and all had a mean visual analog scale of less than 3 postoperatively. Among studies evaluating conversion to arthroplasty, the rate of conversion was 6.8% and the range of mean number of years from HTO to conversion was 4.9 to 13.0. The overall reported complication rate was 10.3%. HTO with cartilage restoration procedures provides reliable improvement in functional status in the medium- to long-term period after surgery and has potential to delay or avoid the need for knee arthroplasty surgery. Level IV, systematic review of Level I to IV studies. Copyright © 2016 Arthroscopy Association of North America. Published by Elsevier Inc. All rights reserved.

  3. Lesch typology and temperament in opioid dependence: a cross-sectional study.

    PubMed

    Salem, B A; Vyssoki, B; Lesch, O M; Erfurth, A

    2014-08-01

    The first aim of this study is to investigate the impact of different temperaments in opiate dependency patients. The second aim of this study is to define therapy relevant subgroups in opiate addiction for further basic clinical research and therapy. In the time period from September to November 2010, 101 patients (72 males and 29 females) which fulfilled the diagnosis of opiate dependency according to DSM-IV-TR were recruited consecutively. All patients were in treatment at the Oum El Nour rehabilitation center/Lebanon (Inpatient and Outpatient groups). Lesch Alcoholism Typology modified for assessment of opiate addicts, and the briefTEMPS-M, Arabic version were used. The organic Type IV group was the most prevalent (48.5%) among the sample followed by the Affective Type III group (41.6%) and the minority represented the two other types (I & II). The organic Type IV group represented the major type in the cyclothymic and anxious temperament. In the contrary the other two groups (I & II) were the minority among the cyclothymics. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis.

    PubMed

    Luvan, M; Kanthan, S R; Roshan, G; Saw, A

    2015-11-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy.

  5. Global attractivity of non-autonomous Lotka-Volterra competition system without instantaneous negative feedback

    NASA Astrophysics Data System (ADS)

    Tang, X. H.; Zou, Xingfu

    We consider a non-autonomous Lotka-Volterra competition system with distributed delays but without instantaneous negative feedbacks (i.e., pure delay systems). We establish some 3/2-type and M-matrix-type criteria for global attractivity of the positive equilibrium of the system, which generalise and improve the existing ones.

  6. Contact urticaria, allergic contact dermatitis, and photoallergic contact dermatitis from oxybenzone.

    PubMed

    Landers, Maeran; Law, Sandra; Storrs, Frances J

    2003-03-01

    There is little literature regarding conventional patch tests and photopatch tests to oxybenzone resulting in both immediate- and delayed-type hypersensitivity reactions. A patient was patch-tested and photopatch-tested to various sunscreen chemicals. Both immediate- and delayed-type hypersensitivity reactions were observed with oxybenzone. The positive patch tests were also photoaccentuated. Oxybenzone, a common sunscreen allergen, can result in both contact urticaria and delayed-type hypersensitivity on both conventional patch testing and photopatch testing. Allergic contact dermatitis to sunscreen chemicals has traditionally included contact urticaria, allergic contact dermatitis, and photoallergic contact dermatitis. Due to the recognition of p-aminobenzoic acid (PABA) and its esters as sensitizers, the presence of benzophenones in "PABA-free" sunscreens has become more prevalent, especially in sunscreens with a sun protection factor (SPF) greater than 8. In our patient, immediate- and delayed-type hypersensitivity reactions were seen to oxybenzone (2-hydroxy-4-methoxybenzophenone, 2-benzoyl-5-methoxyphenol, benzophenone-3, Eusolex 4360, Escalol 567, EUSORB 228, Spectra-Sorb UV-9, Uvinul M-40) upon conventional patch testing and photopatch testing.

  7. Minimally invasive locked plating of distal tibia fractures is safe and effective.

    PubMed

    Ronga, Mario; Longo, Umile Giuseppe; Maffulli, Nicola

    2010-04-01

    Distal tibial fractures are difficult to manage. Limited soft tissue and poor vascularity impose limitations for traditional plating techniques that require large exposures. The nature of the limitations for traditional plating techniques is intrinsic to the large exposure required to approach distal tibia, a bone characterized by limited soft tissue coverage and poor vascularity. The locking plate (LP) is a new device for treatment of fractures. We assessed the bone union rate, deformity, leg-length discrepancy, ankle range of motion, return to preinjury activities, infection, and complication rate in 21 selected patients who underwent minimally invasive osteosynthesis of closed distal tibia fractures with an LP. According to the AO classification, there were 12 Type A, 5 Type B, and 4 Type C fractures. The minimum followup was 2 years (average, 2.8 years; range, 2-4 years). Two patients were lost to followup. Union was achieved in all but one patient by the 24th postoperative week. Four patients had angular deformity less than 7 degrees . No patient had a leg-length discrepancy more than 1.1 cm. Five patients had ankle range of motion less than 20 degrees compared with the contralateral side. Sixteen patients had not returned to their preinjury sporting or leisure activities. Three patients developed a delayed infection. We judge the LP a reasonable device for treating distal tibia fractures. The level of physical activities appears permanently reduced in most patients. Level IV, therapeutic study. See Guidelines for Authors for a complete description of levels of evidence.

  8. Symmetrical drug-related intertriginous and flexural exanthema.

    PubMed

    Tan, Sze-Chin; Tan, Justina W-L

    2011-08-01

    Symmetrical drug-related intertriginous and flexural exanthema (SDRIFE), previously termed drug-related baboon syndrome, is a benign and self-limiting type IV hypersensitivity reaction characterized by symmetrical erythema involving the gluteal and intertriginous areas in the absence of systemic involvement. It may also occur in the absence of previous drug exposure. Antibiotics, in particular beta-lactams, comprise the majority of causes of SDRIFE. Other drugs which have been implicated include antihypertensives, radiocontrast media, chemotherapeutic agents, and biologics. Histology of lesional skin is variable with predominance of superficial perivascular inflammatory cell infiltrates. Outcomes of allergy tests are variable with positive delayed intradermal tests reported for penicillin V, allopurinol; positive patch tests for erythromycin, mitomycin, nystatin, pseudoephdrine; positive lymphocyte transformation tests for erythromycin; and positive drug provocation tests for clindamycin, cimetidine, corticosteroids, terbinafine, and valacyclovir. Diagnosis of SDRIFE is dependent upon recognition of the clinical morphology and distribution of the rash, and its temporal relationship to the use of the suspected drug. Outcomes of in-vivo and in-vitro tests have been inconsistent, and thus may not be useful in the identification of the putative drug.

  9. [Outcome of operative treatment for supination-external rotation Lauge-Hansen stage IV ankle fractures].

    PubMed

    Kołodziej, Łukasz; Boczar, Tomasz; Bohatyrewicz, Andrzej; Zietek, Paweł

    2010-01-01

    Ankle fractures are among the most common musculoskeletal injures. These fractures occur with an overall age- and sex-adjusted incidence rate around 180 per 100 000 person-years. The most frequent mechanism is considered to be supination-external rotation (60 to 80% of all ankle fractures) consisting of pathologic external rotation of the foot initially placed in some degree of supination. According to Lauge-Hansen classification, ankle joint structures are damaged in a sequence where the final, stage IV injuries, represents transverse fracture of the medial malleolus or its equivalent-rupture of the deltoid ligament. The aim of this study is to compare the results of two subtypes of supination-external rotation stage IV fractures. 43 patients treated surgically in 2006 to 2007 at Authors institution because of stage IV supination-external rotation ankle fracture were submitted to retrospective analysis. There were 25 patients with bimalleolar fracture (type 1) and in 18 patients with lateral malleolar fracture with accompanying rupture of the deltoid ligament (type 2). The mean age was 46 years (from 20 to 82 years). Average follow up period was 37 months (from 24 to 46 months). For the evaluation of treatment AOFAS hind-foot score (American Orthopedic Foot and Ankle Society) was used. The mean AOFAS score scale for Type 1 fractures was 85 points and for type 2 was significantly higher and amounted to 91 points (p < 0.05). Supination-external rotation stage IV ankle fractures with medial malleolar fracture, requires the implementation of additional diagnostic and therapeutic strategies and procedures in order to improve the outcome of results.

  10. Adult presentation of Bartter syndrome type IV with erythrocytosis.

    PubMed

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis.

  11. Audiological findings in children with mucopolysaccharidoses type i-iv.

    PubMed

    Vargas-Gamarra, María F; de Paula-Vernetta, Carlos; Vitoria Miñana, Isidro; Ibañez-Alcañiz, Isabel; Cavallé-Garrido, Laura; Alamar-Velazquez, Agustín

    The aim of our study is to reflect hearing impairment of 23children diagnosed with mucopolysaccharidosis (MPS) typeI, II, III and IV. Retrospective study of the clinical, audiological and treatment (medical vs surgical) findings of 23children diagnosed with MPS typeI, II, III or IV followed at a Tertiary Referral Hospital between 1997 and 2015. Six cases of MPSI, 8 of MPSII, 4 of MPSIII and 5 of MPSIV were reviewed. 71.2% of patients had secretory otitis media (SOM) and 54% of patients had some type of hearing loss (HL). The behaviour of hearing loss was variable in each of the subgroups of MPS, finding greater involvement and variability in typesI and II. Children with MPS have a high risk of hearing loss. A significant percentage of transmissive HL progressing to mixed or sensorineural HL was observed. This was more common in typesI and II. Periodic follow up of these patients is mandatory because of hearing impairment and consequences for their development and quality of life. Copyright © 2016 Elsevier España, S.L.U. and Sociedad Española de Otorrinolaringología y Cirugía de Cabeza y Cuello. All rights reserved.

  12. Effect of time between x-irradiation and chemotherapy on the growth of three solid mouse tumors. IV. Actinomycin-d

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Twentyman, P.R.; Kallman, R.F.; Brown, J.M.

    1979-09-01

    Experiments have been carried out to determine the effect of different intervals between the administration of x-radiation (1200 rad) and actinomycin-D (200 ..mu..g/kg) on the growth delay produced in three mouse tumors. The tumors used were the EMT6 tumor in BALB/c mice and the KHT and RIF-1 sarcomas in C3H mice. All tumors were grown intramuscularly in the gastrocnemius muscle, and treatment was carried out at a mean tumor weight of 450 mg. Time to reach 2 x (for KHT) or 4 x (for EMT6 and RIF-1) treatment volume was used as the endpoint of response. The drug was administeredmore » intraperitoneally either 24, 6, or 2 hr before radiation, immediately before the start of radiation, or 3, 6, or 24 hr after radiation. All irradiations were carried out in unanesthetized mice. For a single administration at this dose level (close to the maximum tolerated dose) actinomycin-D did not produce a significant delay in the growth of any of the tumors. For the RIF-1 and KHT tumors, the growth delays produced by drug/radiation combinations generally were not significantly greater than that produced by irradiation alone. For the EMT6 tumor, great variability in the growth delays of combined modality groups seen, with mean growth delays significantly longer than predicted by the radiation alone data. No consistent dependence on timing between irradiation and drug administration was seen.« less

  13. [Prognostic factors of advanced stage non-small-cell lung cancer].

    PubMed

    Kwas, H; Guermazi, E; Khattab, A; Hrizi, C; Zendah, I; Ghédira, H

    2017-09-01

    Primary lung cancer is the leading cause of cancer death in men in the world. Although the introduction of new drugs, new therapeutic strategies and despite therapeutic advances, the prognosis is relatively improved during the last years. To evaluate the prognosis of patients with locally advanced or metastatic non-small-cell lung cancer (NSCLC) and to identify prognostic factors at these stages. A retrospective study, including 140 cases of locally advanced or metastatic NSCLC diagnosed in our department between 2003 and 2013. The average age was 61±10 years (35 to 90 years). Sex ratio was 18. The delays management were 80±25 days for presentation, 45±20 days for the diagnostic, while the treatment delay was 8±2.33 days. The cancer was at stage IIIA in 14%, IIIB in 27% and IV in 59%. Six months and one-year survival was between 50 and 74% and between 9 and 25%, respectively. Better survival was observed in patients with NSCLC on stage III, having better performance status, having comorbid conditions, with prolonged delays management, a short therapeutic delay and patients who received specific antitumor treatment. The prognostic factors in locally advanced and metastatic NSCLC in our patients were: stage of cancer, performance status, comorbid conditions, delay of management and specific antitumoral treatment. These factors should be considered in the management of patients with advanced NSCLC. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. The Caenorhabditis elegans mucolipin-like gene cup-5 is essential for viability and regulates lysosomes in multiple cell types.

    PubMed

    Hersh, Bradley M; Hartwieg, Erika; Horvitz, H Robert

    2002-04-02

    The misregulation of programmed cell death, or apoptosis, contributes to the pathogenesis of many diseases. We used Nomarski microscopy to screen for mutants containing refractile cell corpses in a C. elegans strain in which all programmed cell death is blocked and such corpses are absent. We isolated a mutant strain that accumulates refractile bodies resembling irregular cell corpses. We rescued this mutant phenotype with the C. elegans mucolipidosis type IV (ML-IV) homolog, the recently identified cup-5 (coelomocyte-uptake defective) gene. ML-IV is a human autosomal recessive lysosomal storage disease characterized by psychomotor retardation and ophthalmological abnormalities. Our null mutations in cup-5 cause maternal-effect lethality. In addition, cup-5 mutants contain excess lysosomes in many and possibly all cell types and contain lamellar structures similar to those observed in ML-IV cell lines. The human ML-IV gene is capable of rescuing both the maternal-effect lethality and the lysosome-accumulation abnormality of cup-5 mutants. cup-5 mutants seem to contain excess apoptotic cells as detected by staining with terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling. We suggest that the increased apoptosis seen in cup-5 mutants is a secondary consequence of the lysosomal defect, and that abnormalities in apoptosis may be associated with human lysosomal storage disorders.

  15. Risk evaluation for in-vehicle sign information.

    DOT National Transportation Integrated Search

    2016-05-01

    The goal of the study was to examine the influence of in-vehicle signing (IVS) pertaining to four types of changing : driving conditions and determine the utility and potential safety costs associated with the IVS information. Signage : displayed on ...

  16. Nonstatic radiating spheres in general relativity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krori, K.D.; Borgohain, P.; Sarma, R.

    1985-02-15

    The method of Herrera, Jimenez, and Ruggeri of obtaining nonstatic solutions of Einstein's field equations to study the evolution of stellar bodies is applied to obtain two models of nonstatic radiating spheres from two well-known static solutions of field equations, viz., Tolman's solutions IV and V. Whereas Tolman's type-IV model is found to be contracting for the period under investigation, Tolman's type-V model shows a bounce after attaining a minimum radius.

  17. Retrobulbar Hematoma from Warfarin Toxicity and the Limitations of Bedside Ocular Sonography

    DTIC Science & Technology

    2010-05-01

    Nontraumatic RBH occurs rarely and has been associated with arteriovenous malformations,1 following thrombolysis,2 Type IV Ehlers - Danlos Syndrome ,3...infarction. N Engl J Med. 2007; 357:1448-9. 3. Shaikh S, Braun M, Eliason J. Spontaneous retrobulbar hemorrhage in type IV Ehlers - Danlos syndrome . Am J...compartment syndrome . DISCUSSION We believe this is the first case report of a nontraumatic RBH associated with warfarin toxicity. Our patient also had

  18. Electro-mechanical coupling of semiconductor film grown on stainless steel by oxidation

    NASA Astrophysics Data System (ADS)

    Lin, M. C.; Wang, G.; Guo, L. Q.; Qiao, L. J.; Volinsky, Alex A.

    2013-09-01

    Electro-mechanical coupling phenomenon in oxidation film on stainless steel has been discovered by using current-sensing atomic force microscopy, along with the I-V curves measurements. The oxidation films exhibit either ohmic, n-type, or p-type semiconductor properties, according to the obtained I-V curves. This technique allows characterizing oxidation films with high spatial resolution. Semiconductor properties of oxidation films must be considered as additional stress corrosion cracking mechanisms.

  19. Type IV-a choledochal cyst--a rare adolescent presentation as acute abdomen.

    PubMed

    Satya, Ramadass; Vijayakumar, Vani

    2006-10-01

    A 17-year-old adolescent girl from El Salvador presented to the emergency room (ER) with severe abdominal pain associated with one episode of nausea and vomiting. The pain that started 5 days earlier was sharp in nature and epigastric in location with radiation to back and was relieved by half a tablet of Vicodin. The patient has a history of intermittent epigastric pain for the past 2 years and was treated for Helicobacter pylori for 1 year. In the ER, the serum chemistry demonstrated elevated amylase. Further workup with abdominal ultrasonography (US), computed tomography (CT), magnetic resonance cholangiopancreatography (MRCP), and hepatobiliary scintigraphy confirmed a type IV-a choledochal cyst with intra- and extrahepatic dilation of bile ducts. We report an unusual acute abdomen presentation of type IV-a choledochal cyst in a 17-year-old young adult from El Salvador.

  20. Evaluation of Different Disinfactants on Dimensional Accuracy and Surface Quality of Type IV Gypsum Casts Retrieved from Elastomeric Impression Materials.

    PubMed

    Pal, P K; Kamble, Suresh S; Chaurasia, Ranjitkumar Rampratap; Chaurasia, Vishwajit Rampratap; Tiwari, Samarth; Bansal, Deepak

    2014-06-01

    The present study was done to evaluate the dimensional stability and surface quality of Type IV gypsum casts retrieved from disinfected elastomeric impression materials. In an in vitro study contaminated impression material with known bacterial species was disinfected with disinfectants followed by culturing the swab sample to assess reduction in level of bacterial colony. Changes in surface detail reproduction of impression were assessed fallowing disinfection. All the three disinfectants used in the study produced a 100% reduction in colony forming units of the test organisms. All the three disinfectants produced complete disinfection, and didn't cause any deterioration in surface detail reproduction. How to cite the article: Pal PK, Kamble SS, Chaurasia RR, Chaurasia VR, Tiwari S, Bansal D. Evaluation of dimensional stability and surface quality of type IV gypsum casts retrieved from disinfected elastomeric impression materials. J Int Oral Health 2014;6(3):77-81.

  1. Biomarker for Glycogen Storage Diseases

    ClinicalTrials.gov

    2017-07-03

    Fructose Metabolism, Inborn Errors; Glycogen Storage Disease; Glycogen Storage Disease Type I; Glycogen Storage Disease Type II; Glycogen Storage Disease Type III; Glycogen Storage Disease Type IV; Glycogen Storage Disease Type V; Glycogen Storage Disease Type VI; Glycogen Storage Disease Type VII; Glycogen Storage Disease Type VIII

  2. Spectrophotometric Measurement of Minimal Erythema Dose Sites after Narrowband Ultraviolet B Phototesting: Clinical Implication of Spetrophotometric Values in Phototherapy

    PubMed Central

    Jeon, Su-Young; Lee, Chae-Young; Song, Ki-Hoon

    2014-01-01

    Background The spectrophotometer is well known to be a useful tool for estimating the objective minimal erythema dose (MED) during planning of phototherapy protocol. However, only a few spectrophotometric values are used to evaluate the erythema and pigmentation of the MED site during phototesting. Objective To determinea new meaning of the relationships among spectrophotometric values during phototesting. Methods Twenty-five patients with psoriasis and 23 patients with vitiligo were selected before undergoing narrowband ultraviolet B phototherapy. We interpreted the gross findings of erythema and measured the L*a*b* values using a spectrophotometer at each phototest spot. We compared MEDs, basic spectrophotometric values (L*a*b*), and b*/L* values separately according to skin type, and determined the correlation of each spectrophotometric value and the correlation between a* and b*/L* values. Results Among L*a*b* values, only b* values showed a statistically significant difference between the type III and IV groups (p=0.003). There was a positive correlation only between MEDs and b* values (p<0.05). The average b*/L*value in the type IV group was significantly higher than the type III group (p<0.05). Conclusion The higher b* values in type IV skin indicates that skin tanning develops more prominently than type III. The correlation between MEDs and b* values may signify that the skin pigmentation status is deepened with the higher MEDs. The difference in b*/L*values between type III and IV skin reflects that the b*/L*value is thought to be an index of tanning. The a* value, known as an index of erythema, does not influence the degree of tanning. PMID:24648682

  3. A Comparison of the Effects of Intraosseous and Intravenous 5% Albumin on Infusion Time and Hemodynamic Measures in a Swine Model of Hemorrhagic Shock.

    PubMed

    Muir, Stacy L; Sheppard, Lance B; Maika-Wilson, Anne; Burgert, James M; Garcia-Blanco, Jose; Johnson, Arthur D; Coyner, Jennifer L

    2016-08-01

    Introduction Obtaining intravenous (IV) access in patients in hemorrhagic shock is often difficult and prolonged. Failed IV attempts delay life-saving treatment. Intraosseous (IO) access may often be obtained faster than IV access. Albumin (5%) is an option for prehospital volume expansion because of the absence of interference with coagulation and platelet function. Hypothesis/Problem There are limited data comparing the performance of IO and IV administered 5% albumin. The aims of this study were to compare the effects of tibial IO (TIO) and IV administration of 500 mL of 5% albumin on infusion time and hemodynamic measurements of heart rate (HR), mean arterial pressure (MAP), cardiac output (CO), and stroke volume (SV) in a swine model of hemorrhagic shock. Sixteen male swine were divided into two groups: TIO and IV. All subjects were anesthetized and a Class III hemorrhage was achieved by exsanguination of 31% of estimated blood volume (EBV) from a femoral artery catheter. Following exsanguination, 500 mL of 5% albumin was administered under pressurized infusion (300 mmHg) by the TIO or IV route and infusion time was recorded. Hemodynamic measurements of HR, MAP, CO, and SV were collected before and after exsanguination and every 20 seconds for 180 seconds during 5% albumin infusion. An independent t-test determined that IV 5% albumin infusion was significantly faster compared to IO (P=.01). Mean infusion time for TIO was seven minutes 35 seconds (SD=two minutes 44 seconds) compared to four minutes 32 seconds (SD=one minute 08 seconds) in the IV group. Multivariate Analysis of Variance was performed on hemodynamic data collected during the 5% albumin infusion. Analyses indicated there were no significant differences between the TIO and IV groups relative to MAP, CO, HR, or SV (P>.05). While significantly longer to infuse 5% albumin by the TIO route, the longer TIO infusion time may be negated as IO devices can be placed more quickly compared to repeated IV attempts. The lack of significant difference between the TIO and IV routes relative to hemodynamic measures indicate the TIO route is a viable route for the infusion of 5% albumin in a swine model of Class III hemorrhage. Muir SL , Sheppard LB , Maika-Wilson A , Burgert JM , Garcia-Blanco J , Johnson AD , Coyner JL . A comparison of the effects of intraosseous and intravenous 5% albumin on infusion time and hemodynamic measures in a swine model of hemorrhagic shock. Prehosp Disaster Med. 2016;31(4):436-442.

  4. Self aligned hysteresis free carbon nanotube field-effect transistors

    NASA Astrophysics Data System (ADS)

    Shlafman, M.; Tabachnik, T.; Shtempluk, O.; Razin, A.; Kochetkov, V.; Yaish, Y. E.

    2016-04-01

    Hysteresis phenomenon in the transfer characteristics of carbon nanotube field effect transistor (CNT FET) is being considered as the main obstacle for successful realization of electronic devices based on CNTs. In this study, we prepare four kinds of CNTFETs and explore their hysteretic behavior. Two kinds of devices comprise on-surface CNTs (type I) and suspended CNTs (type II) with thin insulating layer underneath and a single global gate which modulates the CNT conductance. The third and fourth types (types III and IV) consist of suspended CNT over a metallic local gate underneath, where for type IV the local gate was patterned self aligned with the source and drain electrodes. The first two types of devices, i.e., type I and II, exhibit substantial hysteresis which increases with scanning range and sweeping time. Under high vacuum conditions and moderate electric fields ( |E |>4 ×106 V /cm ), the hysteresis for on-surface devices cannot be eliminated, as opposed to suspended devices. Interestingly, type IV devices exhibit no hysteresis at all at ambient conditions, and from the different roles which the global and local gates play for the four types of devices, we could learn about the hysteresis mechanism of this system. We believe that these self aligned hysteresis free FETs will enable the realization of different electronic devices and sensors based on CNTs.

  5. RACIAL DISPARITIES IN TPA TREATMENT RATE FOR STROKE: A POPULATION-BASED STUDY

    PubMed Central

    Hsia, Amie W.; Edwards, Dorothy F.; Morgenstern, Lewis B.; Wing, Jeffrey J.; Brown, Nina C.; Coles, Regina; Loftin, Sarah; Wein, Andrea; Koslosky, Sara S.; Fatima, Sabiha; Fokar, Ali; Gibbons, M. Chris; Jayam-Trouth, Annapurni; Kidwell, Chelsea S.

    2011-01-01

    Background Some prior studies have shown that racial disparities exist in intravenous tissue plasminogen activator (IV tPA) utilization for acute ischemic stroke. We sought to determine whether race was associated with tPA treatment for stroke in a predominantly black urban population. Methods Systematic chart abstraction was performed on consecutive hospitalized ischemic stroke patients from all seven acute care hospitals in the District of Columbia from Feb 1, 2008 to Jan 31, 2009. Results Of 1044 ischemic stroke patients, 74%% were black, 19% non-Hispanic white, 5% received IV tPA. Blacks were one third less likely than whites to receive IV tPA (3% vs. 10%, p<0.001). However, blacks were also less likely than whites to present within 3 hours of symptom onset (13% vs. 21%, p=0.004) and also less likely to be tPA-eligible (5% vs. 13%, p<0.001). Of those who presented within 3 hours, blacks were almost half as likely to be treated with IV tPA than whites (27% vs. 46%, p=0.023). The treatment rate for tPA-eligible patients was similar for blacks and whites (70% vs. 76%, p=0.62). Conclusions In this predominantly black urban population hospitalized for acute ischemic stroke, blacks were significantly less likely to be treated with IV tPA due to contraindications to treatment, delayed presentation, and stroke severity. Effective interventions designed to increase treatment in this population need to focus on culturally relevant education programs designed to address barriers specific to this population. PMID:21719765

  6. A Scoring System to Determine Risk of Delayed Bleeding After Endoscopic Mucosal Resection of Large Colorectal Lesions.

    PubMed

    Albéniz, Eduardo; Fraile, María; Ibáñez, Berta; Alonso-Aguirre, Pedro; Martínez-Ares, David; Soto, Santiago; Gargallo, Carla Jerusalén; Ramos Zabala, Felipe; Álvarez, Marco Antonio; Rodríguez-Sánchez, Joaquín; Múgica, Fernando; Nogales, Óscar; Herreros de Tejada, Alberto; Redondo, Eduardo; Guarner-Argente, Carlos; Pin, Noel; León-Brito, Helena; Pardeiro, Remedios; López-Roses, Leopoldo; Rodríguez-Téllez, Manuel; Jiménez, Alejandra; Martínez-Alcalá, Felipe; García, Orlando; de la Peña, Joaquín; Ono, Akiko; Alberca de Las Parras, Fernando; Pellisé, María; Rivero, Liseth; Saperas, Esteban; Pérez-Roldán, Francisco; Pueyo Royo, Antonio; Eguaras Ros, Javier; Zúñiga Ripa, Alba; Concepción-Martín, Mar; Huelin-Álvarez, Patricia; Colán-Hernández, Juan; Cubiella, Joaquín; Remedios, David; Bessa I Caserras, Xavier; López-Viedma, Bartolomé; Cobian, Julyssa; González-Haba, Mariano; Santiago, José; Martínez-Cara, Juan Gabriel; Valdivielso, Eduardo

    2016-08-01

    After endoscopic mucosal resection (EMR) of colorectal lesions, delayed bleeding is the most common serious complication, but there are no guidelines for its prevention. We aimed to identify risk factors associated with delayed bleeding that required medical attention after discharge until day 15 and develop a scoring system to identify patients at risk. We performed a prospective study of 1214 consecutive patients with nonpedunculated colorectal lesions 20 mm or larger treated by EMR (n = 1255) at 23 hospitals in Spain, from February 2013 through February 2015. Patients were examined 15 days after the procedure, and medical data were collected. We used the data to create a delayed bleeding scoring system, and assigned a weight to each risk factor based on the β parameter from multivariate logistic regression analysis. Patients were classified as being at low, average, or high risk for delayed bleeding. Delayed bleeding occurred in 46 cases (3.7%, 95% confidence interval, 2.7%-4.9%). In multivariate analysis, factors associated with delayed bleeding included age ≥75 years (odds ratio [OR], 2.36; P < .01), American Society of Anesthesiologist classification scores of III or IV (OR, 1.90; P ≤ .05), aspirin use during EMR (OR, 3.16; P < .05), right-sided lesions (OR, 4.86; P < .01), lesion size ≥40 mm (OR, 1.91; P ≤ .05), and a mucosal gap not closed by hemoclips (OR, 3.63; P ≤ .01). We developed a risk scoring system based on these 6 variables that assigned patients to the low-risk (score, 0-3), average-risk (score, 4-7), or high-risk (score, 8-10) categories with a receiver operating characteristic curve of 0.77 (95% confidence interval, 0.70-0.83). In these groups, the probabilities of delayed bleeding were 0.6%, 5.5%, and 40%, respectively. The risk of delayed bleeding after EMR of large colorectal lesions is 3.7%. We developed a risk scoring system based on 6 factors that determined the risk for delayed bleeding (receiver operating characteristic curve, 0.77). The factors most strongly associated with delayed bleeding were right-sided lesions, aspirin use, and mucosal defects not closed by hemoclips. Patients considered to be high risk (score, 8-10) had a 40% probability of delayed bleeding. Copyright © 2016 AGA Institute. Published by Elsevier Inc. All rights reserved.

  7. The comparison of humeral intraosseous and intravenous administration of vasopressin on return of spontaneous circulation and pharmacokinetics in a hypovolemic cardiac arrest swine model.

    PubMed

    Wimmer, Mark H; Heffner, Kenneth; Smithers, Michael; Culley, Richard; Coyner, Jennifer; Loughren, Michael; Johnson, Don

    2016-01-01

    The American Heart Association (AHA) recommends intravenous (IV) or intraosseous (IO) vasopressin in Advanced Cardiac Life Support (ACLS). Obtaining IV access in hypovolemic cardiac arrest patients can be difficult, and IO access is often obtained in these life threatening situations. No studies have been conducted to determine the effects of humeral IO (HIO) access with vasopressin in the return of spontaneous circulation (ROSC). Our study compared the kinetics of vasopressin and ROSC with HIO with IV access in the hypovolemic swine model. Twenty-two Yorkshire swine were divided into three groups: HIO (n = 7), IV (n = 8), and a control group (n = 7). The IV and HIO group received vasopressin and cardiopulmonary resuscitation (CPR), while the control group received only CPR. All subjects were exsanguinated 31 percent of their blood volume, placed in cardiac arrest, and resuscitated per ACLS. Subjects that achieved ROSC were then monitored for 20 minutes. Blood samples (10 mL) collected at 0.5, 1, 1.5, 2, 2.5, 3, and 4 minutes after vasopressin injection and analyzed for maximum concentration (Cmax) and time to maximum concentration (Tmax). Data were analyzed using a multivariate analysis of variance (MANOVA) and a Fisher's Exact Test. ROSC was achieved in every subject that received vasopressin via the HIO route. Data analysis using a MANOVA pairwise comparison revealed no difference between mean Cmax (p = 0.601) and Tmax (p = 0.771) of vasopressin administered IV versus HIO routes. Analysis of the mean serum concentrations at time intervals using a repeated measures analysis of variance found no difference (p > 0.05). A Fisher's Exact Test revealed no difference in rate of ROSC between HIO and IV groups (p > 0.05). Odds ratio determined that there was a 33 times higher chance of survival among HIO subjects versus control (CPR and Defibrillation; p = 0.03) and no difference in the survivability of the HIO or IV groups (p = 0.52). The data from this study strongly suggest that there is no significant difference in ROSC, time to ROSC, hemodynamics, or pharmacokinetics between HIO vasopressin and IV vasopressin. This research reinforces current AHA guidelines recommending the use of HIO route early over delaying care awaiting IV access.

  8. Circulatory kinetics of intravenously injected {sup 238}Pu(IV) citrate and {sup 14}C-CaNa{sub 3}-DTPA in mice: Comparison with rat, dog, and Reference Man

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Durbin, P.W.; Kullgren, B.; Schmidt, C.T.

    1997-02-01

    New ligands for in vivo chelation of Pu(IV) are being synthesized and evaluated in mice for efficacy and toxicity. Biokinetic studies of the new ligands, CaNa{sub 3}-DTPA, and Pu(IV) are major components of those investigations. Young adult female mice were injected intravenously (iv) with {sup 3}H-inulin, {sup 14}C-CaNa{sub 3}-DTPA, or {sup 238}Pu(IV) citrate to provide base- line data for plasma clearance, tissue uptake, and excretion rates and to determine the dilution volume (VOD) and renal clearance rate (RC) of filterable substances. Published plasma clearance data in Reference Man, dog, and rat were collected. Based on combined data for {sup 3}H-inulinmore » and {sup 14}C-CaNa{sub 3}-DTPA, VOD = 17% of body weight and RC = 18 mL kg{sup -1} min{sup -1} for mice. Retention of {sup 14}C-CaNa{sub 3}-DTPA in the four species is proportional to body weight and inversely proportional to RC: Integrals of the retention of {sup 14}C-CaNa{sub 3}-DTPA from R(t) = 1.0 to R(t) = 0.05 are 108, 43, 28, and 10 DF min, respectively, for Reference Man, dog, rat, and mouse. Clearances of iv-injected Pu(IV) citrate from plasma are in the same order: The plasma curve integrals from injection to 1440 min are 840, 640, 280, and 67 DF min, respectively, for Reference Man, dog, rat, and mouse. In mice, a large fraction of newly injected Pu(IV) is rapidly transferred to the interstitial water of bulk soft tissue (excluding liver and kidneys), from which it is cleared at the same rate as from the plasma. Rapid plasma clearance, escape into interstitial water (22%ID at 20 min), significant early urinary excretion (8%ID in 12 h), and prompt deposition in liver and skeleton (complete in 12 h) are evidence of inefficient binding to plasma protein of newly injected Pu(IV) in mice. Slow plasma clearance, little early urinary excretion, and delayed deposition in liver and skeleton reflect more efficient binding of newly injected Pu(IV) in Reference Man and dog. 39 refs., 6 figs., 3 tabs.« less

  9. The human clone ST22 SCCmec IV methicillin-resistant Staphylococcus aureus isolated from swine herds and wild primates in Nepal: is man the common source?

    PubMed

    Roberts, Marilyn C; Joshi, Prabhu Raj; Greninger, Alexander L; Melendez, Daira; Paudel, Saroj; Acharya, Mahesh; Bimali, Nabin Kishor; Koju, Narayan P; No, David; Chalise, Mukesh; Kyes, Randall C

    2018-05-01

    Swine nasal samples [n = 282] were collected from 12 randomly selected farms around Kathmandu, Nepal, from healthy animals. In addition, wild monkey (Macaca mulatta) saliva samples [n = 59] were collected near temples areas in Kathmandu using a non-invasive sampling technique. All samples were processed for MRSA using standardized selective media and conventional biochemical tests. MRSA verification was done and isolates characterized by SCCmec, multilocus sequence typing, whole genome sequencing [WGS] and antibiotic susceptibilities. Six (2.1%) swine MRSA were isolated from five of the different swine herds tested, five were ST22 type IV and one ST88 type V. Four (6.8%) macaques MRSA were isolated, with three ST22 SCCmec type IV and one ST239 type III. WGS sequencing showed that the eight ciprofloxacin resistant ST22 isolates carried gyrA mutation [S84L]. Six isolates carried the erm(C) genes, five isolates carried aacC-aphD genes and four isolates carried blaZ genes. The swine linezolid resistant ST22 did not carry any known acquired linezolid resistance genes but had a mutation in ribosomal protein L22 [A29V] and an insertion in L4 [68KG69], both previously associated with linezolid resistance. Multiple virulence factors were also identified. This is the first time MRSA ST22 SCCmec IV has been isolated from livestock or primates.

  10. Immunohistochemical assessment of collagen types I, III, IV and VI in biopsy samples of the bovine uterine wall collected during the oestrous cycle.

    PubMed

    Boos, A

    2000-01-01

    Uterine biopsies were collected at cycle days 1 (oestrous), 8, 15 and 19 in six cows. Unfixed cryostat sections were used to immunolocalise collagen types I, III, IV and VI by an indirect FITC method. Collagen I was sparsely found in the endometrium where it formed a fine meshwork of thin fibres directly below the surface epithelium, clearly visible only at cycle days 8 and 15. Collagen III formed the bulk of connective tissue fibres and was arranged in fine aggregates within the superficial endometrial stroma, while in the deeper areas it consisted of many thick fibre bundles. Collagen IV was found in basement membranes underlying all endometrial epithelia. Furthermore, it surrounded smooth muscle cells of blood vessels. A few single fibrils also stained positively within the endometrial stroma, more numerous at cycle days 1 and 19 as compared to days 8 and 15. Collagen VI formed a mesh of fine and pericellularly situated fibrils within the endometrial stroma. The contribution of the collagen types studied to the connective tissue of caruncles, blood vessels, lymph follicles, and myometrium is also reported. The results of the present study indicate that the connective tissue of the bovine uterine wall is composed of different collagen types, which exhibit a characteristic distribution pattern each. The day of cycle may influence amounts and organisation of collagen types I and IV as demonstrated here at the light-microscopical level. Copyright 2000 S. Karger AG, Basel

  11. Mutational Analysis of the QRRQ Motif in the Yeast Hig1 Type 2 Protein Rcf1 Reveals a Regulatory Role for the Cytochrome c Oxidase Complex*

    PubMed Central

    Garlich, Joshua; Strecker, Valentina; Wittig, Ilka; Stuart, Rosemary A.

    2017-01-01

    The yeast Rcf1 protein is a member of the conserved family of proteins termed the hypoxia-induced gene (domain) 1 (Hig1 or HIGD1) family. Rcf1 interacts with components of the mitochondrial oxidative phosphorylation system, in particular the cytochrome bc1 (complex III)-cytochrome c oxidase (complex IV) supercomplex (termed III-IV) and the ADP/ATP carrier proteins. Rcf1 plays a role in the assembly and modulation of the activity of complex IV; however, the molecular basis for how Rcf1 influences the activity of complex IV is currently unknown. Hig1 type 2 isoforms, which include the Rcf1 protein, are characterized in part by the presence of a conserved motif, (Q/I)X3(R/H)XRX3Q, termed here the QRRQ motif. We show that mutation of conserved residues within the Rcf1 QRRQ motif alters the interactions between Rcf1 and partner proteins and results in the destabilization of complex IV and alteration of its enzymatic properties. Our findings indicate that Rcf1 does not serve as a stoichiometric component, i.e. as a subunit of complex IV, to support its activity. Rather, we propose that Rcf1 serves to dynamically interact with complex IV during its assembly process and, in doing so, regulates a late maturation step of complex IV. We speculate that the Rcf1/Hig1 proteins play a role in the incorporation and/or remodeling of lipids, in particular cardiolipin, into complex IV and. possibly, other mitochondrial proteins such as ADP/ATP carrier proteins. PMID:28167530

  12. Impact of Type of Needle on Incidence of Intravascular Injection During Diagnostic Lumbar Medial Branch Block.

    PubMed

    Joo, Young; Kim, Yong Chul; Lee, Sang Chul; Kim, Hye Young; Park, Keun Suk; Choi, Eun Joo; Moon, Jee Youn

    2016-01-01

    Intravascular (IV) injection of local anesthetics is a potential cause of false-negative results after lumbar medial branch nerve blockade (L-MBB) performed to diagnose facetogenic back pain. The aim of the present study was to identify the relationship between the needle type and the incidence of IV injection in patients undergoing L-MBB using fluoroscopy with digital subtraction imaging (DSI). In this prospective randomized study, we compared the incidence of IV uptake of contrast medium using the Quincke needle and Whitacre needle under real-time DSI during L-MBB. Clinical and demographic factors associated with the occurrence of IV uptake were also investigated. In total, 126 patients were randomized into the Quincke needle group (n = 62) and Whitacre needle group (n = 64). Intravascular uptake of contrast medium was observed in 66 (9.8%) of 671 L-MBB procedures under DSI. The incidence of IV uptake was 13.9% (47/338) using the Quincke needle and 5.7% (19/333) using the Whitacre needle. In the multivariate generalized estimating equations analysis, use of a Quincke needle was related to positive IV injection at a 1.898-fold higher rate than was use of a Whitacre needle (95% confidence interval, 1.025-3.516) and a positive aspiration test predicted IV injection at a 21.735-fold higher rate (95% confidence interval, 11.996-52.258). Lumbar medial branch nerve blockade using the Quincke needle was associated with a 1.9-fold higher rate of IV injection than was L-MBB using the Whitacre needle under DSI. Although further study is needed to confirm the clinical efficacy, Whitacre needles can be considered to reduce the risk of IV injection during L-MBB.

  13. Adaptation and adaptation transfer characteristics of five different saccade types in the monkey

    PubMed Central

    Fuchs, Albert F.; Soetedjo, Robijanto

    2015-01-01

    Shifts in the direction of gaze are accomplished by different kinds of saccades, which are elicited under different circumstances. Saccade types include targeting saccades to simple jumping targets, delayed saccades to visible targets after a waiting period, memory-guided (MG) saccades to remembered target locations, scanning saccades to stationary target arrays, and express saccades after very short latencies. Studies of human cases and neurophysiological experiments in monkeys suggest that separate pathways, which converge on a common locus that provides the motor command, generate these different types of saccade. When behavioral manipulations in humans cause targeting saccades to have persistent dysmetrias as might occur naturally from growth, aging, and injury, they gradually adapt to reduce the dysmetria. Although results differ slightly between laboratories, this adaptation generalizes or transfers to all the other saccade types mentioned above. Also, when one of the other types of saccade undergoes adaptation, it often transfers to another saccade type. Similar adaptation and transfer experiments, which allow inferences to be drawn about the site(s) of adaptation for different saccade types, have yet to be done in monkeys. Here we show that simian targeting and MG saccades adapt more than express, scanning, and delayed saccades. Adaptation of targeting saccades transfers to all the other saccade types. However, the adaptation of MG saccades transfers only to delayed saccades. These data suggest that adaptation of simian targeting saccades occurs on the pathway common to all saccade types. In contrast, only the delayed saccade command passes through the adaptation site of the MG saccade. PMID:25855693

  14. Shifts in the Clonal Distribution of Methicillin-Resistant Staphylococcus aureus in Kuwait Hospitals: 1992-2010

    PubMed Central

    Boswihi, Samar S.; Udo, Edet E.; Al-Sweih, Noura

    2016-01-01

    Background As the epidemiology of methicillin-resistant Staphylococcus aureus (MRSA) is constantly changing globally, determining the prevailing MRSA clones in a local healthcare facility is important for better management of infections. This study investigated clonal composition and distribution of MRSA isolates in Kuwait’s hospitals using a combination of molecular typing methods. Materials and Methods In total, 400 non-repeat MRSA isolates were obtained between 1992 and 2010 in 13 public hospitals and were characterized using antibiogram, SCCmec typing, spa typing, and multilocus-sequence typing. Clonal assignment and detection of virulence factors and antibiotic resistance genes were performed by DNA microarray. Results The isolates were resistant to kanamycin (74.2%), erythromycin (69.5%), tetracycline (66.7%), gentamicin (61%), ciprofloxacin, (61%), fusidic acid (53.5%), clindamycin (41.5%), high-level mupirocin resistance (5.2%) and carried aphA3, aacA-aphD, ermA, ermC, mupA, tetK, tetM, fusC and far1. Molecular typing revealed 31 different MRSA clones consisting of ST239-MRSA-III (52.2%), ST22-MRSA-IV (9.2%), ST80-MRSA-IV (7.5%), ST5-MRSA-II/IV/V/VI (6.5%), ST30-MRSA-IV (3.5%), ST241-MRSA-III (2.7%), ST6-MRSA-IV (2.2%), ST36-MRSA-II (2%) and ST772-MRSA-V (1.75%). The isolates differed in the carriage of genes for enterotoxins, Panton–Valentine leukocidin (PVL), toxic shock syndrome toxin (tst-1), arginine catabolic mobile element (ACME) and exfoliative toxins. The number of clones increased from one (ST239-III-t037) in 1992 to 30 in 2010 including ST8-IV-t008 [PVL+] [ACME+] (USA300), ST772-V (Bengal Bay clone) and ST2816 identified for the first time in Kuwait. Conclusion The study revealed that the MRSA isolates belonged to diverse clones that changed in numbers and diversity overtime. Although ST239-MRSA-III, a healthcare-associated clone remained the dominant MRSA clone overtime, the newly emerged clones consisted mostly of community-associated. PMID:27631623

  15. Community-Associated Methicillin-Resistant Staphylococcus aureus Clonal Complex 80 Type IV (CC80-MRSA-IV) Isolated from the Middle East: A Heterogeneous Expanding Clonal Lineage

    PubMed Central

    Harastani, Houda H.; Tokajian, Sima T.

    2014-01-01

    Background The emergence of community-associated methicillin resistant Staphylococcus aureus (CA-MRSA) has caused a change in MRSA epidemiology worldwide. In the Middle East, the persistent spread of CA-MRSA isolates that were associated with multilocus sequence type (MLST) clonal complex 80 and with staphylococcal cassette chromosome mec (SCCmec) type IV (CC80-MRSA-IV), calls for novel approaches for infection control that would limit its spread. Methodology/Principal Findings In this study, the epidemiology of CC80-MRSA-IV was investigated in Jordan and Lebanon retrospectively covering the period from 2000 to 2011. Ninety-four S. aureus isolates, 63 (67%) collected from Lebanon and 31 (33%) collected from Jordan were included in this study. More than half of the isolates (56%) were associated with skin and soft tissue infections (SSTIs), and 73 (78%) were Panton-Valentine Leukocidin (PVL) positive. Majority of the isolates (84%) carried the gene for exofoliative toxin d (etd), 19% had the Toxic Shock Syndrome Toxin-1 gene (tst), and seven isolates from Jordan had a rare combination being positive for both tst and PVL genes. spa typing showed the prevalence of type t044 (85%) and pulsed-field gel electrophoresis (PFGE) recognized 21 different patterns. Antimicrobial susceptibility testing showed the prevalence (36%) of a unique resistant profile, which included resistance to streptomycin, kanamycin, and fusidic acid (SKF profile). Conclusions The genetic diversity among the CC80 isolates observed in this study poses an additional challenge to infection control of CA-MRSA epidemics. CA-MRSA related to ST80 in the Middle East was distinguished in this study from the ones described in other countries. Genetic diversity observed, which may be due to mutations and differences in the antibiotic regimens between countries may have led to the development of heterogeneous strains. Hence, it is difficult to maintain “the European CA-MRSA clone” as a uniform clone and it is better to designate as CC80-MRSA-IV isolates. PMID:25078407

  16. Navy Family Advocacy Program. Appendix. Analysis of Central Registry Reports.

    DTIC Science & Technology

    1983-12-01

    2/76) 2 Suspected Abuzso/Malect/Sexua1 Assault an ae2404 65.) "Suspected Abuso /Neglect/ Sexual Assault and Rape Report" 2226 60.5 NAVMED 6320/15A...ANALYSIS OF SEXUAL ASSAULT REPORTS ........... 50 HAPTER V: SUMAY ANALYSIS Or rAMILY ADVOCACY PROGRAM REPORTS . 56 APPENDIX...cont’d)I PAGE CHAPTER IV: SEXUAL ASSAULT TV-1 Fore . . . . . . . . . . . . . . . . . . . . . 51 IV-2 Type of Maltreatment ............... 53 IV-3

  17. Involvement of DPP IV/CD26 in cutaneous wound healing process in mice.

    PubMed

    Baticic Pucar, Lara; Pernjak Pugel, Ester; Detel, Dijana; Varljen, Jadranka

    2017-01-01

    Dipeptidyl peptidase IV (DPP IV/CD26) is a widely distributed multifunctional protein that plays a significant role in different physiological as well as pathological processes having a broad spectrum of bioactive substrates and immunomodulative properties. It has potential influence on different processes crucial for wound healing, including cell adhesion, migration, apoptosis, and extracellular matrix degradation. However, despite its known enzymatic and immunomodulative functions, limited data characterize the role of DPP IV/CD26 in cutaneous wound healing mechanisms. The aim of this study was to investigate the process of wound healing in conditions of CD26 deficiency in order to obtain better insights on the role of DPP IV/CD26 in cutaneous regeneration. Experimental wounds were made on the dorsal part of CD26 deficient (CD26 -/- ) and wild-type mice (C57BL/6). The process of cutaneous wound healing was monitored on defined time schedule postwounding by macroscopic, microscopic, and biochemical analyses. Obtained results revealed a better rate of wound closure, revascularization and cell proliferation in CD26 -/- mice, with enhanced local expression of hypoxia-inducible factor 1α and vascular endothelial growth factor. CD26 deficiency induced prompt macrophage recruitment at the site of skin damage but did not influence mobilization of T-cells in comparison with wild-type mice. CD26 -/- mice have significantly higher values of IP-10 in serum and control skins compared with wild-type mice but values in wounds did not differ significantly on days 2, 4, and 7 of wound healing. DPP IV/CD26 activity was found to be decreased 4 days postwounding in serum and 2, 4, and 7 days postwounding in wounds of wild-type animals compared with control skins. These findings contribute to better understanding of wound healing mechanisms and could give a support in finding new therapeutic approaches for wound healing and tissue regeneration. © 2016 by the Wound Healing Society.

  18. AN ERUPTIVE HOT-CHANNEL STRUCTURE OBSERVED AT METRIC WAVELENGTH AS A MOVING TYPE-IV SOLAR RADIO BURST

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vasanth, V.; Chen, Yao; Feng, Shiwei

    2016-10-10

    Hot-channel (HC) structure, observed in the high-temperature passbands of the Atmospheric Imaging Assembly/ Solar Dynamic Observatory , is regarded as one candidate of coronal flux rope that is an essential element of solar eruptions. Here, we present the first radio imaging study of an HC structure in the metric wavelength. The associated radio emission manifests as a moving type-IV (t-IVm) burst. We show that the radio sources co-move outward with the HC, indicating that the t-IV emitting energetic electrons are efficiently trapped within the structure. The t-IV sources at different frequencies present no considerable spatial dispersion during the early stagemore » of the event, while the sources spread gradually along the eruptive HC structure at later stage with significant spatial dispersion. The t-IV bursts are characterized by a relatively high brightness temperature (∼10{sup 7}–10{sup 9} K), a moderate polarization, and a spectral shape that evolves considerably with time. This study demonstrates the possibility of imaging the eruptive HC structure at the metric wavelength and provides strong constraints on the t-IV emission mechanism, which, if understood, can be used to diagnose the essential parameters of the eruptive structure.« less

  19. Clinical and radiographic outcomes of femoral head fractures: excision vs. fixation of fragment in Pipkin type I: what is the optimal choice for femoral head fracture?

    PubMed

    Park, Kyung-Soon; Lee, Keun-Bae; Na, Bo-Ram; Yoon, Taek-Rim

    2015-07-01

    In this work, we present relatively long-term results of femoral head fractures with a specific focus on Pipkin type I fractures. Fifty-nine femoral head fractures were treated according to modified Pipkin's classification as follows: type I, small fragment distal to the fovea centralis (FC); type II, large fragment distal to the FC; type III, large fragment proximal to the FC; type IV, comminuted fracture. There were 15 cases of type I, 28 of type II, 9 of type III, and 7 of type IV fractures. Conservative treatment with skeletal traction was performed in 4 type II cases, excision of the fragment in 15 type I and 10 type II cases, fixation of the fragment in 14 type II and all 9 type III cases, and total hip replacement in all 7 type IV cases. The overall clinical and radiographic outcomes were evaluated using previously published criteria, focusing on the results in Pipkin type I fractures with relatively large fragments. Based on Epstein criteria, in type II fractures, excellent or good clinical results were seen in 6 of 10 patients (60.0 %) treated by excision of the fragment and 12 of 14 patients (85.7 %) treated by internal fixation (p = 0.05). Also, excellent or good radiologic results were seen in 4 of 10 (40.0 %) patients treated by excision of the fragment and 12 of 14 (85.7 %) patients treated by internal fixation (p = 0.03). Even in Pipkin type I fractures, if the fragment is large (modified Pipkin type II), early reduction and internal fixation can produce good results.

  20. Neural correlates of sample-coding and reward-coding in the delay activity of neurons in the entopallium and nidopallium caudolaterale of pigeons (Columba livia).

    PubMed

    Johnston, Melissa; Anderson, Catrona; Colombo, Michael

    2017-01-15

    We recorded neuronal activity from the nidopallium caudolaterale, the avian equivalent of mammalian prefrontal cortex, and the entopallium, the avian equivalent of the mammalian visual cortex, in four birds trained on a differential outcomes delayed matching-to-sample procedure in which one sample stimulus was followed by reward and the other was not. Despite similar incidence of reward-specific and reward-unspecific delay cell types across the two areas, overall entopallium delay activity occurred following both rewarded and non-rewarded stimuli, whereas nidopallium caudolaterale delay activity tended to occur following the rewarded stimulus but not the non-rewarded stimulus. These findings are consistent with the view that delay activity in entopallium represents a code of the sample stimulus whereas delay activity in nidopallium caudolaterale represents a code of the possibility of an upcoming reward. However, based on the types of delay cells encountered, cells in NCL also code the sample stimulus and cells in ENTO are influenced by reward. We conclude that both areas support the retention of information, but that the activity in each area is differentially modulated by factors such as reward and attentional mechanisms. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Factors associated with long diagnostic delay in celiac disease.

    PubMed

    Fuchs, Valma; Kurppa, Kalle; Huhtala, Heini; Collin, Pekka; Mäki, Markku; Kaukinen, Katri

    2014-11-01

    Here, we investigated the factors associated with long diagnostic delay in celiac disease and the impact of the national Current Care Guidelines in reducing the delay. This population-based study involved 825 adult celiac disease patients. The diagnosis was considered delayed when the interval between first symptoms and diagnosis was >10 years. The patients were asked about the duration and type of symptoms before diagnosis, time and site (tertiary, secondary, or primary care) of the diagnosis, family history of the disease, and presence of significant comorbidities. Analysis was performed by binary logistic regression. Altogether, 261 (32%) out of 825 participants reported a diagnostic delay of >10 years. Female gender, neurological or musculoskeletal disorders and presence of diarrhea, abdominal pain, and malabsorption were associated with prolonged delay. Male gender, diagnosis after the introduction of the first Current Care Guidelines in 1997, and being detected by serological screening, and family history of celiac disease were associated with a lower risk of delayed diagnosis. Factors not associated with the delay were site of diagnosis, age, and presence of dermatitis herpetiformis, type 1 diabetes, or thyroidal disease. The number of long diagnostic delays in celiac disease has decreased over the past decades. The shift of diagnostics from secondary and tertiary care to primary care has not been detrimental. National guidelines together with increased awareness and active screening in at-risk groups of celiac disease are important in these circumstances.

  2. Comparison of Helicopter Emergency Medical Services Transport Types and Delays on Patient Outcomes at Two Level I Trauma Centers.

    PubMed

    Nolan, Brodie; Tien, Homer; Sawadsky, Bruce; Rizoli, Sandro; McFarlan, Amanda; Phillips, Andrea; Ackery, Alun

    2017-01-01

    Helicopter emergency medical services (HEMS) have become an engrained component of trauma systems. In Ontario, transportation for trauma patients is through one of three ways: scene call, modified scene call, or interfacility transfer. We hypothesize that differences exist between these types of transports in both patient demographics and patient outcomes. This study compares the characteristics of patients transported by each of these methods to two level 1 trauma centers and assesses for any impact on morbidity or mortality. As a secondary outcome reasons for delay were identified. A local trauma registry was used to identify and abstract data for all patients transported to two trauma centers by HEMS over a 36-month period. Further chart abstraction using the HEMS patient care reports was done to identify causes of delay during HEMS transport. During the study period HEMS transferred a total of 911 patients of which 139 were scene calls, 333 were modified scene calls and 439 were interfacility transfers. Scene calls had more patients with an ISS of less than 15 and had more patients discharged home from the ED. Modified scene calls had more patients with an ISS greater than 25. The most common delays that were considered modifiable included the sending physician doing a procedure, waiting to meet a land EMS crew, delays for diagnostic imaging and confirming disposition or destination. Differences exist between the types of transports done by HEMS for trauma patients. Many identified reasons for delay to HEMS transport are modifiable and have practical solutions. Future research should focus on solutions to identified delays to HEMS transport. Key words: helicopter emergency medical services; trauma; prehospital care; delays.

  3. [Alcohol-related cognitive impairment and the DSM-5].

    PubMed

    Walvoort, S J W; Wester, A J; Doorakkers, M C; Kessels, R P C; Egger, J I M

    2016-01-01

    It is evident from the dsm-iv-tr that alcohol-related impairment is extremely difficult to classify accurately. As a result, cognitive deficits can easily be overlooked. The dsm-5, however, incorporates a new category, namely 'neurocognitive disorders', which may lead to significant improvements in clinical practice. To compare the classification of alcohol-related cognitive dysfunction in dsm-iv-tr and dsm-5 and to discuss the clinical relevance of the revised classification in the dsm-5. We compare the chapters of the dsm-iv-tr and the dsm-5 concerning alcohol-related cognitive impairment and describe the changes that have been made. The dsm-5 puts greater emphasis on alcohol-related neurocognitive impairment. Not only does dsm-5 distinguish between the degree of severity (major or minor neurocognitive disorder), it also distinguishes between the type of impairment (non-amnestic-type versus confabulating-amnestic type). It also makes a distinction between the durations of impairment (behavioural and/or persistent disorders). The dsm-5 gives a clearer description of alcohol-related neurocognitive dysfunction than does dsm-iv-tr and it stresses the essential role of neuropsychological assessment in the classification, diagnosis, and treatment of neurocognitive disorders.

  4. Comment on “Based on interval type-2 adaptive fuzzy H∞ tracking controller for SISO time-delay nonlinear systems”

    NASA Astrophysics Data System (ADS)

    Pan, Yongping; Huang, Daoping

    2011-03-01

    In this comment, we point out the inappropriateness of Theorem 1 in the article [Tsung-Chih Lin, Mehdi Roopaei. Based on interval type-2 adaptive fuzzy H∞ tracking controller for SISO time-delay nonlinear systems. Commun Nonlinear Sci Numer Simulat 2010;15:4065-75]. For solving this problem, some formular mistakes are corrected and novel parameter adaptive laws of interval type-2 fuzzy neural network system are given.

  5. Evaluation of Memory Impairment in Aging Adult Survivors of Childhood Acute Lymphoblastic Leukemia Treated With Cranial Radiotherapy

    PubMed Central

    2013-01-01

    Background Cranial radiotherapy (CRT) is a known risk factor for neurocognitive impairment in survivors of childhood cancer and may increase risk for mild cognitive impairment and dementia in adulthood. Methods We performed a cross-sectional evaluation of survivors of childhood acute lymphoblastic leukemia (ALL) treated with 18 Gy (n = 127) or 24 Gy (n = 138) CRT. Impairment (age-adjusted score >1 standard deviation below expected mean, two-sided exact binomial test) on the Wechsler Memory Scale IV (WMS-IV) was measured. A subset of survivors (n = 85) completed structural and functional neuroimaging. Results Survivors who received 24 Gy, but not 18 Gy, CRT had impairment in immediate (impairment rate = 33.8%, 95% confidence interval [CI] = 25.9% to 42.4%; P < .001) and delayed memory (impairment rate = 30.2%, 95% CI = 22.6% to 38.6%; P < .001). The mean score for long-term narrative memory among survivors who received 24 Gy CRT was equivalent to that for individuals older than 69 years. Impaired immediate memory was associated with smaller right (P = .02) and left (P = .008) temporal lobe volumes, and impaired delayed memory was associated with thinner parietal and frontal cortices. Lower hippocampal volumes and increased functional magnetic resonance imaging activation were observed with memory impairment. Reduced cognitive status (Brief Cognitive Status Exam from the WMS-IV) was identified after 24 Gy (18.5%, 95% CI = 12.4% to 26.1%; P < .001), but not 18 Gy (8.7%, 95% CI = 4.4% to 15.0%; P = .11), CRT, suggesting a dose–response effect. Employment rates were equivalent (63.8% for 24 Gy CRT and 63.0% for 18 Gy CRT). Conclusions Adult survivors who received 24 Gy CRT had reduced cognitive status and memory, with reduced integrity in neuroanatomical regions essential in memory formation, consistent with early onset mild cognitive impairment. PMID:23584394

  6. Complex dynamics in the Leslie-Gower type of the food chain system with multiple delays

    NASA Astrophysics Data System (ADS)

    Guo, Lei; Song, Zi-Gen; Xu, Jian

    2014-08-01

    In this paper, we present a Leslie-Gower type of food chain system composed of three species, which are resource, consumer, and predator, respectively. The digestion time delays corresponding to consumer-eat-resource and predator-eat-consumer are introduced for more realistic consideration. It is called the resource digestion delay (RDD) and consumer digestion delay (CDD) for simplicity. Analyzing the corresponding characteristic equation, the stabilities of the boundary and interior equilibrium points are studied. The food chain system exhibits the species coexistence for the small values of digestion delays. Large RDD/CDD may destabilize the species coexistence and induce the system dynamic into recurrent bloom or system collapse. Further, the present of multiple delays can control species population into the stable coexistence. To investigate the effect of time delays on the recurrent bloom of species population, the Hopf bifurcation and periodic solution are investigated in detail in terms of the central manifold reduction and normal form method. Finally, numerical simulations are performed to display some complex dynamics, which include multiple periodic solution and chaos motion for the different values of system parameters. The system dynamic behavior evolves into the chaos motion by employing the period-doubling bifurcation.

  7. Pattern of Cortical Fracture following Corticotomy for Distraction Osteogenesis

    PubMed Central

    Luvan, M; Roshan, G; Saw, A

    2015-01-01

    Corticotomy is an essential procedure for deformity correction and there are many techniques described. However there is no proper classification of the fracture pattern resulting from corticotomies to enable any studies to be conducted. We performed a retrospective study of corticotomy fracture patterns in 44 patients (34 tibias and 10 femurs) performed for various indications. We identified four distinct fracture patterns, Type I through IV classification based on the fracture propagation following percutaneous corticotomy. Type I transverse fracture, Type II transverse fracture with a winglet, Type III presence of butterfly fragment and Type IV fracture propagation to a fixation point. No significant correlation was noted between the fracture pattern and the underlying pathology or region of corticotomy. PMID:28611907

  8. The Molecular Epidemiology of the Highly Virulent ST93 Australian Community Staphylococcus aureus Strain

    PubMed Central

    Coombs, Geoffrey W.; Goering, Richard V.; Chua, Kyra Y. L.; Monecke, Stefan; Howden, Benjamin P.; Stinear, Timothy P.; Ehricht, Ralf; O’Brien, Frances G.; Christiansen, Keryn J.

    2012-01-01

    In Australia the PVL - positive ST93-IV [2B], colloquially known as “Queensland CA-MRSA” has become the dominant CA-MRSA clone. First described in the early 2000s, ST93-IV [2B] is associated with skin and severe invasive infections including necrotizing pneumonia. A singleton by multilocus sequence typing (MLST) eBURST analysis ST93 is distinct from other S aureus clones. To determine if the increased prevalence of ST93-IV [2B] is due to the widespread transmission of a single strain of ST93-IV [2B] the genetic relatedness of 58 S. aureus ST93 isolated throughout Australia over an extended period were studied in detail using a variety of molecular methods including pulsed-field gel electrophoresis, spa typing, MLST, microarray DNA, SCCmec typing and dru typing. Identification of the phage harbouring the lukS-PV/lukF-PV Panton Valentine leucocidin genes, detection of allelic variations in lukS-PV/lukF-PV, and quantification of LukF-PV expression was also performed. Although ST93-IV [2B] is known to have an apparent enhanced clinical virulence, the isolates harboured few known virulence determinants. All PVL-positive isolates carried the PVL-encoding phage ΦSa2USA and the lukS-PV/lukF-PV genes had the same R variant SNP profile. The isolates produced similar expression levels of LukF-PV. Although multiple rearrangements of the spa sequence have occurred, the core genome in ST93 is very stable. The emergence of ST93-MRSA is due to independent acquisitions of different dru-defined type IV and type V SCCmec elements in several spa-defined ST93-MSSA backgrounds. Rearrangement of the spa sequence in ST93-MRSA has subsequently occurred in some of these strains. Although multiple ST93-MRSA strains were characterised, little genetic diversity was identified for most isolates, with PVL-positive ST93-IVa [2B]-t202-dt10 predominant across Australia. Whether ST93-IVa [2B] t202-dt10 arose from one PVL-positive ST93-MSSA-t202, or by independent acquisitions of SCCmec-IVa [2B]-dt10 into multiple PVL-positive ST93-MSSA-t202 strains is not known. PMID:22900085

  9. Actin homolog MreB affects chromosome segregation by regulating topoisomerase IV in Escherichia coli.

    PubMed

    Madabhushi, Ram; Marians, Kenneth J

    2009-01-30

    In Escherichia coli, topoisomerase IV, a type II topoisomerase, mediates the resolution of topological linkages between replicated daughter chromosomes and is essential for chromosome segregation. Topo IV activity is restricted to only a short interval late in the cell cycle. However, the mechanism that confers this temporal regulation is unknown. Here we report that the bacterial actin homolog MreB participates in the temporal oscillation of Topo IV activity. We show that mreB mutant strains are deficient in Topo IV activity. In addition, we demonstrate that, depending upon whether it is in a monomeric or polymerized state, MreB affects Topo IV activity differentially. In addition, MreB physically interacts with the ParC subunit of Topo IV. Together, these results may explain how dynamics of the bacterial cytoskeleton are coordinated with the timing of chromosome segregation.

  10. Serum Levels of Soluble CD26/Dipeptidyl Peptidase-IV in Type 2 Diabetes Mellitus and Its Association with Metabolic Syndrome and Therapy with Antidiabetic Agents in Malaysian Subjects.

    PubMed

    Ahmed, Radwan H; Huri, Hasniza Zaman; Al-Hamodi, Zaid; Salem, Sameer D; Muniandy, Sekaran

    2015-01-01

    A soluble form of CD26/dipeptidyl peptidase-IV (sCD26/DPP-IV) induces DPP-IV enzymatic activity that degrades incretin. We investigated fasting serum levels of sCD26/DPP-IV and active glucagon-like peptide-1 (GLP-1) in Malaysian patients with type 2 diabetes mellitus (T2DM) with and without metabolic syndrome (MetS), as well as the associations between sCD26/DPP-IV levels, MetS, and antidiabetic therapy. We assessed sCD26/DPP-IV levels, active GLP-1 levels, body mass index (BMI), glucose, insulin, A1c, glucose homeostasis indices, and lipid profiles in 549 Malaysian subjects (including 257 T2DM patients with MetS, 57 T2DM patients without MetS, 71 non-diabetics with MetS, and 164 control subjects without diabetes or metabolic syndrome). Fasting serum levels of sCD26/DPP-IV were significantly higher in T2DM patients with and without MetS than in normal subjects. Likewise, sCD26/DPP-IV levels were significantly higher in patients with T2DM and MetS than in non-diabetic patients with MetS. However, active GLP-1 levels were significantly lower in T2DM patients both with and without MetS than in normal subjects. In T2DM subjects, sCD26/DPP-IV levels were associated with significantly higher A1c levels, but were significantly lower in patients using monotherapy with metformin. In addition, no significant differences in sCD26/DPP-IV levels were found between diabetic subjects with and without MetS. Furthermore, sCD26/DPP-IV levels were negatively correlated with active GLP-1 levels in T2DM patients both with and without MetS. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-cholesterol (LDL-c) levels. Serum sCD26/DPP-IV levels increased in T2DM subjects with and without MetS. Active GLP-1 levels decreased in T2DM patients both with and without MetS. In addition, sCD26/DPP-IV levels were associated with Alc levels and negatively correlated with active GLP-1 levels. Moreover, metformin monotherapy was associated with reduced sCD26/DPP-IV levels. In normal subjects, sCD26/DPP-IV levels were associated with increased BMI, cholesterol, and LDL-c.

  11. Incidence of intravenous contrast extravasation: increased risk for patients with deep brachial catheter placement from the emergency department.

    PubMed

    Hardie, Andrew D; Kereshi, Borko

    2014-06-01

    Deep brachial intravenous catheter (IV) placement can be performed in emergency department patients with difficult vascular access, but the safety of deep brachial IV for iodinated contrast administration has not been assessed. This study compares the relative risk for extravasation of deep brachial IV compared with antecubital IV during power injected computed tomography (CT) examinations. A departmental practice quality improvement was performed to assess the rate of IV extravasation for all CT examinations during a 1 year period. De-identified data was analyzed with a waiver of informed consent to identify the rate and relative risk of iodinated contrast extravasation by catheter type. A total of 10,750 injections were performed, with 82 extravasation events (0.8 %). There were 51 extravasations of antecubital IV from approximately 8,599 placed (0.6 %). For 123 deep brachial IV placed, there were eight extravasations (6.5 %). The relative risk of a deep brachial IV extravasation was 9.4 compared to 0.4 for antecubital placement. Deep brachial IV demonstrated a markedly higher rate of contrast extravasation than antecubital IV. For power injected iodinated contrast administration, it is recommended to avoid the use of deep brachial IV whenever possible.

  12. Interstitial fluid glucose dynamics during insulin-induced hypoglycaemia.

    PubMed

    Steil, G M; Rebrin, K; Hariri, F; Jinagonda, S; Tadros, S; Darwin, C; Saad, M F

    2005-09-01

    Glucose sensors often measure s.c. interstitial fluid (ISF) glucose rather than blood or plasma glucose. Putative differences between plasma and ISF glucose include a protracted delay during the recovery from hypoglycaemia and an increased gradient during hyperinsulinaemia. These have often been investigated using sensor systems that have delays due to signal smoothing, or require long equilibration times. The aim of the present study was to define these relationships during hypoglycaemia in a well-equilibrated system with no smoothing. Hypoglycaemia was induced by i.v. insulin infusion (360 pmol.m(-2).min(-1)) in ten non-diabetic subjects. Glucose was sequentially clamped at approximately 5, 4.2 and 3.1 mmol/l and allowed to return to normoglycaemia. Subjects wore two s.c. glucose sensors (Medtronic MiniMed, Northridge, CA, USA) that had been inserted for more than 12 h. A two-compartment model was used to quantify the delay and gradient. The delay during the fall in plasma glucose was not different from the delay during recovery (8.3+/-0.67 vs 6.3+/-1.1 min; p=0.27) and no differences were observed in the ratio of sensor current to plasma glucose at basal insulin (2.7+/-0.25 nA.mmol(-1).l) compared with any of the hyperinsulinaemic clamp phases (2.8+/-0.18, 2.7+/-0.021, 2.9+/-0.21; p=NS). The ratio was significantly elevated following recovery to normoglycaemia (3.1+/-0.2 nA.mmol(-1).l; p<0.001). The elevated ratio suggests that the plasma to ISF glucose gradient was decreased following hypoglycaemia, possibly due to increased skin blood flow. Recovery from hypoglycaemia is not accompanied by a protracted delay and insulin does not increase the plasma to s.c. ISF glucose gradient.

  13. Initial Screening of Environmentally Sustainable Surface Pretreatments for Adhesive Bonding Applications

    DTIC Science & Technology

    2017-05-17

    490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as bonding...sustainable TT-C-490F pretreatments resulted in little to no loss of adhesive bond strength during H/W conditioning and their potential use as...pretreatment was applied. Environmentally sustainable TT-C-490F Type IV inorganic pretreatments resulted in little to no loss of adhesive bond strength during

  14. Nanos-mediated repression of hid protects larval sensory neurons after a global switch in sensitivity to apoptotic signals

    PubMed Central

    Bhogal, Balpreet; Plaza-Jennings, Amara

    2016-01-01

    Dendritic arbor morphology is a key determinant of neuronal function. Once established, dendrite branching patterns must be maintained as the animal develops to ensure receptive field coverage. The translational repressors Nanos (Nos) and Pumilio (Pum) are required to maintain dendrite growth and branching of Drosophila larval class IV dendritic arborization (da) neurons, but their specific regulatory role remains unknown. We show that Nos-Pum-mediated repression of the pro-apoptotic gene head involution defective (hid) is required to maintain a balance of dendritic growth and retraction in class IV da neurons and that upregulation of hid results in decreased branching because of an increase in caspase activity. The temporal requirement for nos correlates with an ecdysone-triggered switch in sensitivity to apoptotic stimuli that occurs during the mid-L3 transition. We find that hid is required during pupariation for caspase-dependent pruning of class IV da neurons and that Nos and Pum delay pruning. Together, these results suggest that Nos and Pum provide a crucial neuroprotective regulatory layer to ensure that neurons behave appropriately in response to developmental cues. PMID:27256879

  15. Nanos-mediated repression of hid protects larval sensory neurons after a global switch in sensitivity to apoptotic signals.

    PubMed

    Bhogal, Balpreet; Plaza-Jennings, Amara; Gavis, Elizabeth R

    2016-06-15

    Dendritic arbor morphology is a key determinant of neuronal function. Once established, dendrite branching patterns must be maintained as the animal develops to ensure receptive field coverage. The translational repressors Nanos (Nos) and Pumilio (Pum) are required to maintain dendrite growth and branching of Drosophila larval class IV dendritic arborization (da) neurons, but their specific regulatory role remains unknown. We show that Nos-Pum-mediated repression of the pro-apoptotic gene head involution defective (hid) is required to maintain a balance of dendritic growth and retraction in class IV da neurons and that upregulation of hid results in decreased branching because of an increase in caspase activity. The temporal requirement for nos correlates with an ecdysone-triggered switch in sensitivity to apoptotic stimuli that occurs during the mid-L3 transition. We find that hid is required during pupariation for caspase-dependent pruning of class IV da neurons and that Nos and Pum delay pruning. Together, these results suggest that Nos and Pum provide a crucial neuroprotective regulatory layer to ensure that neurons behave appropriately in response to developmental cues. © 2016. Published by The Company of Biologists Ltd.

  16. Palliative treatment with radiation-emitting metallic stents in unresectable Bismuth type III or IV hilar cholangiocarcinoma.

    PubMed

    Lu, Jian; Guo, Jin-He; Zhu, Hai-Dong; Zhu, Guang-Yu; Wang, Yong; Zhang, Qi; Chen, Li; Wang, Chao; Pan, Tian-Fan; Teng, Gao-Jun

    2017-01-01

    The emerging data for stenting in combination with brachytherapy in unresectable hilar cholangiocarcinoma are encouraging. The aim of this study was to evaluate the efficacy and safety of radiation-emitting metallic stents (REMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma. Consecutive patients who underwent percutaneous placement with REMS or uncovered self-expandable metallic stent (SEMS) for unresectable Bismuth type III or IV hilar cholangiocarcinoma between September 2011 and April 2016 were identified into this retrospective study. Data on patient demographics and overall survival, functional success, stent patency and complications were collected at the authors' hospital. A total of 59 patients were included: 33 (55.9%) in the REMS group and 26 (44.1%) in the SEMS group. The median overall survival was 338 days in the REMS group and 141 days in the SEMS group (p<0.001). The median stent patency time was 385 days for REMS and 142 days for SEMS (p<0.001). The functional success rate (87.9% vs 84.6%, p=0.722) and incidence of overall complications (27.3% vs 26.9%, p=0.999) did not differ in the two groups. Placement with REMS is safe and effective in palliation for unresectable Bismuth type III or IV hilar cholangiocarcinoma, and seems to prolong survival as well as patency of stent in these patients.

  17. Syringe Pump Performance Maintained with IV Filter Use During Low Flow Rate Delivery for Pediatric Patients.

    PubMed

    Chau, Destiny F; Vasilopoulos, Terrie; Schoepf, Miriam; Zhang, Christina; Fahy, Brenda G

    2016-09-01

    Complex surgical and critically ill pediatric patients rely on syringe infusion pumps for precise delivery of IV medications. Low flow rates and in-line IV filter use may affect drug delivery. To determine the effects of an in-line filter to remove air and/or contaminants on syringe pump performance at low flow rates, we compared the measured rates with the programmed flow rates with and without in-line IV filters. Standardized IV infusion assemblies with and without IV filters (filter and control groups) attached to a 10-mL syringe were primed and then loaded onto a syringe pump and connected to a 16-gauge, 16-cm single-lumen catheter. The catheter was suspended in a normal saline fluid column to simulate the back pressure from central venous circulation. The delivered infusate was measured by gravimetric methods at predetermined time intervals, and flow rate was calculated. Experimental trials for initial programmed rates of 1.0, 0.8, 0.6, and 0.4 mL/h were performed in control and filter groups. For each trial, the flow rate was changed to double the initial flow rate and was then returned to the initial flow rate to analyze pump performance for titration of rates often required during medication administration. These conditions (initial rate, doubling of initial rate, and return to initial rate) were analyzed separately for steady-state flow rate and time to steady state, whereas their average was used for percent deviation analysis. Differences between control and filter groups were assessed using Student t tests with adjustment for multiplicity (using n = 3 replications per group). Mean time from 0 to initial flow (startup delay) was <1 minute in both groups with no statistical difference between groups (P = 1.0). The average time to reach steady-state flow after infusion startup or rate changes was not statistically different between the groups (range, 0.8-5.5 minutes), for any flow rate or part of the trial (initial rate, doubling of initial rate, and return to initial rate), although the study was underpowered to detect small time differences. Overall, the mean steady-state flow rate for each trial was below the programmed flow rate with negative mean percent deviations for each trial. In the 1.0-mL/h initial rate trial, the steady-state flow rate attained was lower in the filter than the control group for the initial rate (P = 0.04) and doubling of initial rate (P = 0.04) with a trend during the return to initial rate (P = 0.06), although this same effect was not observed when doubling the initial rate trials of 0.8 or 0.6 mL/h or any other rate trials compared with the control group. With low flow rates used in complex surgical and pediatric critically ill patients, the addition of IV filters did not confer statistically significant changes in startup delay, flow variability, or time to reach steady-state flow of medications administered by syringe infusion pumps. The overall flow rate was lower than programmed flow rate with or without a filter.

  18. Adult presentation of Bartter syndrome type IV with erythrocytosis

    PubMed Central

    Heilberg, Ita Pfeferman; Tótoli, Cláudia; Calado, Joaquim Tomaz

    2015-01-01

    Abstract Bartter syndrome comprises a group of rare autosomal-recessive salt-losing disorders with distinct phenotypes, but one unifying pathophysiology consisting of severe reductions of sodium reabsorption caused by mutations in five genes expressed in the thick ascending limb of Henle, coupled with increased urinary excretion of potassium and hydrogen, which leads to hypokalemic alkalosis. Bartter syndrome type IV, caused by loss-of-function mutations in barttin, a subunit of chloride channel CLC-Kb expressed in the kidney and inner ear, usually occurs in the antenatal-neonatal period. We report an unusual case of late onset presentation of Bartter syndrome IV and mild phenotype in a 20 years-old man who had hypokalemia, deafness, secondary hyperparathyroidism and erythrocytosis. PMID:26537508

  19. An outbreak of post-partum breast abscesses in Mumbai, India caused by ST22-MRSA-IV: genetic characteristics and epidemiological implications

    PubMed Central

    MANOHARAN, A.; ZHANG, L.; POOJARY, A.; BHANDARKAR, L.; KOPPIKAR, G.; ROBINSON, D. A.

    2012-01-01

    SUMMARY A cluster of methicillin-resistant Staphylococcus aureus (MRSA) breast abscesses in women who had given birth at a hospital in Mumbai, India was investigated retrospectively. Nineteen of twenty cases were caused by a single clone: pvl-positive, spa type 648 (Ridom t852), ccrB:dru subtype 3:0, ST22-MRSA-IV. Despite the presence of pvl and SCCmec type IV, which are common genetic markers among community-associated MRSA, this outbreak was caused by a healthcare-associated, community-onset MRSA that was common in the hospital environment. Thus, infection control practices may have an important role in limiting the spread of this virulent clone. PMID:22475374

  20. The role of executive functioning in memory performance in pediatric focal epilepsy

    PubMed Central

    Sepeta, Leigh N.; Casaletto, Kaitlin Blackstone; Terwilliger, Virginia; Facella-Ervolini, Joy; Sady, Maegan; Mayo, Jessica; Gaillard, William D.; Berl, Madison M.

    2016-01-01

    Objective Learning and memory are essential for academic success and everyday functioning, but the pattern of memory skills and its relationship to executive functioning in children with focal epilepsy is not fully delineated. We address a gap in the literature by examining the relationship between memory and executive functioning in a pediatric focal epilepsy population. Methods Seventy children with focal epilepsy and 70 typically developing children matched on age, intellectual functioning, and gender underwent neuropsychological assessment, including measures of intelligence (WASI/DAS), as well as visual (CMS Dot Locations) and verbal episodic memory (WRAML Story Memory and CVLT-C). Executive functioning was measured directly (WISC-IV Digit Span Backward; CELF-IV Recalling Sentences) and by parent report (Behavior Rating Inventory of Executive Function (BRIEF)). Results Children with focal epilepsy had lower delayed free recall scores than controls across visual and verbal memory tasks (p = 0.02; partial η2 = .12). In contrast, recognition memory performance was similar for patients and controls (p = 0.36; partial η2 = .03). Children with focal epilepsy demonstrated difficulties in working memory (p = 0.02; partial η2 = .08) and planning/organization (p = 0.02) compared to controls. Working memory predicted 9–19% of the variance in delayed free recall for verbal and visual memory; organization predicted 9–10% of the variance in verbal memory. Patients with both left and right focal epilepsy demonstrated more difficulty on verbal versus visual tasks (p = 0.002). Memory performance did not differ by location of seizure foci (temporal vs. extra-temporal, frontal vs. extra-frontal). Significance Children with focal epilepsy demonstrated memory ability within age-level expectations, but delayed free recall was inefficient compared to typically developing controls. Memory difficulties were not related to general cognitive impairment or seizure localization. Executive functioning accounted for significant variance in memory performance, suggesting that poor executive control negatively influences memory retrieval. PMID:28111742

  1. Programming Cardiac Resynchronization Therapy for Electrical Synchrony: Reaching Beyond Left Bundle Branch Block and Left Ventricular Activation Delay.

    PubMed

    Varma, Niraj; O'Donnell, David; Bassiouny, Mohammed; Ritter, Philippe; Pappone, Carlo; Mangual, Jan; Cantillon, Daniel; Badie, Nima; Thibault, Bernard; Wisnoskey, Brian

    2018-02-06

    QRS narrowing following cardiac resynchronization therapy with biventricular (BiV) or left ventricular (LV) pacing is likely affected by patient-specific conduction characteristics (PR, qLV, LV-paced propagation interval), making a universal programming strategy likely ineffective. We tested these factors using a novel, device-based algorithm (SyncAV) that automatically adjusts paced atrioventricular delay (default or programmable offset) according to intrinsic atrioventricular conduction. Seventy-five patients undergoing cardiac resynchronization therapy (age 66±11 years; 65% male; 32% with ischemic cardiomyopathy; LV ejection fraction 28±8%; QRS duration 162±16 ms) with intact atrioventricular conduction (PR interval 194±34, range 128-300 ms), left bundle branch block, and optimized LV lead position were studied at implant. QRS duration (QRSd) reduction was compared for the following pacing configurations: nominal simultaneous BiV (Mode I: paced/sensed atrioventricular delay=140/110 ms), BiV+SyncAV with 50 ms offset (Mode II), BiV+SyncAV with offset that minimized QRSd (Mode III), or LV-only pacing+SyncAV with 50 ms offset (Mode IV). The intrinsic QRSd (162±16 ms) was reduced to 142±17 ms (-11.8%) by Mode I, 136±14 ms (-15.6%) by Mode IV, and 132±13 ms (-17.8%) by Mode II. Mode III yielded the shortest overall QRSd (123±12 ms, -23.9% [ P <0.001 versus all modes]) and was the only configuration without QRSd prolongation in any patient. QRS narrowing occurred regardless of QRSd, PR, or LV-paced intervals, or underlying ischemic disease. Post-implant electrical optimization in already well-selected patients with left bundle branch block and optimized LV lead position is facilitated by patient-tailored BiV pacing adjusted to intrinsic atrioventricular timing using an automatic device-based algorithm. © 2018 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley.

  2. Acute soman poisoning in primates neither pretreated nor receiving immediate therapy: value of gacyclidine (GK-11) in delayed medical support.

    PubMed

    Lallement, G; Clarençon, D; Galonnier, M; Baubichon, D; Burckhart, M F; Peoc'h, M

    1999-03-01

    Organophosphorus (OP) nerve agents are still used as warfare and terrorism compounds. Classical delayed treatment of victims of organophosphate poisoning includes combined i.v. administration of a cholinesterase reactivator (an oxime), a muscarinic cholinergic receptor antagonist (atropine) and a benzodiazepine anticonvulsant (diazepam). The objective of this study was to evaluate, in a realistic setting, the therapeutic benefit of administration of GK-11 (gacyclidine), an antiglutamatergic compound, as a complement to the above therapy against organophosphate poisoning. Gacyclidine was injected (i.v.) in combination with atropine/diazepam/pralidoxime at man-equivalent doses after a 45- or 30-min latency period to intoxicated primates (2 LD50). The effects of gacyclidine on the animals' survival, electroencephalographic (EEG) activity, signs of toxicity, recovery after challenge and central nervous system histology were examined. The present data demonstrated that atropine/diazepam/pralidoxime alone or combined with gacyclidine did not prevent signs of soman toxicity when treatment was delayed 45 min after poisoning. Atropine/diazepam/pralidoxime also did not control seizures or prevent neuropathology in primates exhibiting severe signs of poisoning when treatment was commenced 30 min after intoxication. However, in this latter case, EEG recordings revealed that additional treatment with gacyclidine was able to stop soman-induced seizures and restore normal EEG activity. This drug also totally prevented the neuropathology observed 5 weeks after soman exposure in animals treated with atropine/diazepam/pralidoxime alone. Overall, in the case of severe OP-poisoning, gacyclidine represents a promising adjuvant therapy to the currently available polymedication to ensure optimal management of organophosphate poisoning in man. This drug is presently being evaluated in a human clinical trial for a different neuroprotective indication. However, it should always be kept in mind that, in the case of severe OP-poisoning, medical intervention must be conducted as early as possible.

  3. Diagnostic accuracy of level IV portable sleep monitors versus polysomnography for obstructive sleep apnea: a systematic review and meta-analysis.

    PubMed

    Abrahamyan, Lusine; Sahakyan, Yeva; Chung, Suzanne; Pechlivanoglou, Petros; Bielecki, Joanna; Carcone, Steven M; Rac, Valeria E; Fitzpatrick, Michael; Krahn, Murray

    2018-01-09

    Obstructive sleep apnea (OSA) is the most common sleep-related breathing disorder. In-laboratory, overnight type I polysomnography (PSG) is the current "gold standard" for diagnosing OSA. Home sleep apnea testing (HSAT) using portable monitors (PMs) is an alternative testing method offering better comfort and lower costs. We aimed to systematically review the evidence on diagnostic ability of type IV PMs compared to PSG in diagnosing OSA. Participants: patients ≥16 years old with symptoms suggestive of OSA;intervention: type IV PMs (devices with < 2 respiratory channels); comparator: in-laboratory PSG; outcomes: diagnostic accuracy measures;studies: cross-sectional, prospective observational/experimental/quasi-experimental studies; information sources: MEDLINE and Cochrane Library from January 1, 2010 to May 10, 2016. All stages of review were conducted independently by two investigators. We screened 6054 abstracts and 117 full-text articles to select 24 full-text articles for final review. These 24 studies enrolled a total of 2068 patients with suspected OSA and evaluated 10 different PMs with one to six channels. Only seven (29%) studies tested PMs in the home setting. The mean difference (bias) between PSG-measured and PM-measured apnea-hypopnea index (AHI) ranged from - 14.8 to 10.6 events/h. At AHI ≥ 5 events/h, the sensitivity of type IV PMs ranged from 67.5-100% and specificity ranged from 25 to 100%. While current evidence is not very strong for the stand-alone use of level IV PMs in clinical practice, they can potentially widen access to diagnosis and treatment of OSA. Policy recommendations regarding HSAT use should also consider the health and broader social implications of false positive and false negative diagnoses.

  4. The Effect of Online Gaming, Cognition and Feedback Type in Facilitating Delayed Achievement of Different Learning Objectives

    ERIC Educational Resources Information Center

    Cameron, Brian; Dwyer, Francis

    2005-01-01

    Online and computer-based instructional gaming is becoming a viable instructional strategy at all levels of education. The purpose of this study was to examine the effect of (a) gaming, (b) gaming plus embedded questions, and (c) gaming plus questions plus feedback on delayed retention of different types of educational objectives for students…

  5. The effect of dipeptidyl peptidase-IV inhibition on bone in a mouse model of type 2 diabetes

    PubMed Central

    Gallagher, Emily Jane; Sun, Hui; Kornhauser, Caroline; Tobin-Hess, Aviva; Epstein, Sol; Yakar, Shoshana; LeRoith, Derek

    2017-01-01

    Background Individuals with type 2 diabetes (T2D) are at greater risk of bone fractures than those without diabetes. Certain oral diabetic medications may further increase the risk of fracture. Dipeptidyl peptidase-IV (DPP-IV) inhibitors are incretin-based therapies that are being increasingly used for the management of T2D. It has been hypothesized that these agents may reduce fracture risk in those with T2D. In this study, we used a mouse model of T2D to examine the effects of the DPP-IV inhibitor, MK-0626, on bone. Methods Male wild type (WT) and diabetic muscle-lysine-arginine (MKR) mice were treated with MK-0626, pioglitazone, alendronate or vehicle. The effects of treatment with MK-0626 on bone microarchitecture and turnover were compared with treatment with pioglitazone, alendronate and vehicle. Osteoblast differentiation was determined by alkaline phosphatase staining of bone marrow cells from WT and MKR mice after treatment with pioglitazone, MK-0626 or phosphate buffered saline. Results We found that MK-0626 had neutral effects on cortical and trabecular bone in diabetic mice. Pioglitazone had detrimental effects on the trabecular bone of WT but not of diabetic mice. Alendronate caused improvements in cortical and trabecular bone architecture in diabetic and WT mice. MK-0626 did not alter osteoblast differentiation, but pioglitazone impaired osteoblast differentiation in vitro. Conclusions Overall, the DPP-IV inhibitor, MK-0626, had no adverse effects on bone in an animal model of T2D or directly on osteoblasts in culture. These findings are reassuring as DPP-IV inhibitors are being widely used to treat patients with T2D who are already at an increased risk of fractures. PMID:24023014

  6. Proline residues in transmembrane segment IV are critical for activity, expression and targeting of the Na+/H+ exchanger isoform 1.

    PubMed Central

    Slepkov, Emily R; Chow, Signy; Lemieux, M Joanne; Fliegel, Larry

    2004-01-01

    NHE1 (Na+/H+ exchanger isoform 1) is a ubiquitously expressed integral membrane protein that regulates intracellular pH in mammalian cells. Proline residues within transmembrane segments have unusual properties, acting as helix breakers and increasing flexibility of membrane segments, since they lack an amide hydrogen. We examined the importance of three conserved proline residues in TM IV (transmembrane segment IV) of NHE1. Pro167 and Pro168 were mutated to Gly, Ala or Cys, and Pro178 was mutated to Ala. Pro168 and Pro178 mutant proteins were expressed at levels similar to wild-type NHE1 and were targeted to the plasma membrane. However, the mutants P167G (Pro167-->Gly), P167A and P167C were expressed at lower levels compared with wild-type NHE1, and a significant portion of P167G and P167C were retained intracellularly, possibly indicating induced changes in the structure of TM IV. P167G, P167C, P168A and P168C mutations abolished NHE activity, and P167A and P168G mutations caused markedly decreased activity. In contrast, the activity of the P178A mutant was not significantly different from that of wild-type NHE1. The results indicate that both Pro167 and Pro168 in TM IV of NHE1 are required for normal NHE activity. In addition, mutation of Pro167 affects the expression and membrane targeting of the exchanger. Thus both Pro167 and Pro168 are strictly required for NHE function and may play critical roles in the structure of TM IV of the NHE. PMID:14680478

  7. Molecular epidemiology of Methicillin-resistant Staphylococcus aureus in Africa: a systematic review

    PubMed Central

    Abdulgader, Shima M.; Shittu, Adebayo O.; Nicol, Mark P.; Kaba, Mamadou

    2015-01-01

    Methicillin-resistant Staphylococcus aureus (MRSA) infections are a serious global problem, with considerable impact on patients and substantial health care costs. This systematic review provides an overview on the clonal diversity of MRSA, as well as the prevalence of Panton-Valentine leukocidin (PVL)-positive MRSA in Africa. A search on the molecular characterization of MRSA in Africa was conducted by two authors using predefined terms. We screened for articles published in English and French through to October 2014 from five electronic databases. A total of 57 eligible studies were identified. Thirty-four reports from 15 countries provided adequate genotyping data. CC5 is the predominant clonal complex in the healthcare setting in Africa. The hospital-associated MRSA ST239/ST241-III [3A] was identified in nine African countries. This clone was also described with SCCmec type IV [2B] in Algeria and Nigeria, and type V [5C] in Niger. In Africa, the European ST80-IV [2B] clone was limited to Algeria, Egypt and Tunisia. The clonal types ST22-IV [2B], ST36-II [2A], and ST612-IV [2B] were only reported in South Africa. No clear distinctions were observed between MRSA responsible for hospital and community infections. The community clones ST8-IV [2B] and ST88-IV [2B] were reported both in the hospital and community settings in Angola, Cameroon, Gabon, Ghana, Madagascar, Nigeria, and São Tomé and Príncipe. The proportion of PVL-positive MRSA carriage and/or infections ranged from 0.3 to 100% in humans. A number of pandemic clones were identified in Africa. Moreover, some MRSA clones are limited to specific countries or regions. We strongly advocate for more surveillance studies on MRSA in Africa. PMID:25983721

  8. Validity of DSM-IV attention–deficit/hyperactivity disorder symptom dimensions and subtypes

    PubMed Central

    Willcutt, Erik G.; Nigg, Joel T.; Pennington, Bruce F.; Solanto, Mary V.; Rohde, Luis A.; Tannock, Rosemary; Loo, Sandra K.; Carlson, Caryn L.; McBurnett, Keith; Lahey, Benjamin B.

    2013-01-01

    DSM-IV criteria for ADHD specify two dimensions of inattention and hyperactivity-impulsivity symptoms that are used to define three nominal subtypes: predominantly hyperactive-impulsive type (ADHD-H), predominantly inattentive type (ADHD-I), and combined type (ADHD-C). To aid decision-making for DSM-5 and other future diagnostic systems, a comprehensive literature review and meta-analysis of 546 studies was completed to evaluate the validity of the DSM-IV model of ADHD. Results indicated that DSM-IV criteria identify individuals with significant and persistent impairment in social, academic, occupational, and adaptive functioning when intelligence, demographic factors, and concurrent psychopathology are controlled. Available data overwhelmingly support the concurrent, predictive, and discriminant validity of the distinction between inattention and hyperactivity-impulsivity symptoms, and indicate that nearly all differences among the nominal subtypes are consistent with the relative levels of inattention and hyperactivity-impulsivity symptoms that define the subtypes. In contrast, the validity of the DSM-IV subtype model is compromised by weak evidence for the validity of ADHD-H after first grade, minimal support for the distinction between ADHD-I and ADHD-C in studies of etiological influences, academic and cognitive functioning, and treatment response, and the marked longitudinal instability of all three subtypes. Overall, it is concluded that the DSM-IV ADHD subtypes provide a convenient clinical shorthand to describe the functional and behavioral correlates of current levels of inattention and hyperactivity-impulsivity symptoms, but do not identify discrete subgroups with sufficient long-term stability to justify the classification of distinct forms of the disorder. Empirical support is stronger for an alternative model that would replace the subtypes with dimensional modifiers that reflect the number of inattention and hyperactivity-impulsivity symptoms at the time of assessment. PMID:22612200

  9. Choice of intravenous antibiotic prophylaxis for colorectal surgery does matter.

    PubMed

    Deierhoi, Rhiannon J; Dawes, Lillian G; Vick, Catherine; Itani, Kamal M F; Hawn, Mary T

    2013-11-01

    The Surgical Care Improvement Program endorses mandatory compliance with approved intravenous prophylactic antibiotics; however, oral antibiotics are optional. We hypothesized that surgical site infection (SSI) rates may vary depending on the choice of antibiotic prophylaxis. A retrospective cohort study of elective colorectal procedures using Veterans Affairs Surgical Quality Improvement Program (VASQIP) and SSI outcomes data was linked to the Office of Informatics and Analytics (OIA) and Pharmacy Benefits Management (PBM) antibiotic data from 2005 to 2009. Surgical site infection rates by type of IV antibiotic agent alone (IV) or in combination with oral antibiotic (IV + OA) were determined. Generalized estimating equations were used to examine the association between type of antibiotic prophylaxis and SSI for the entire cohort and stratified by use of oral antibiotics. After 5,750 elective colorectal procedures, 709 SSIs (12.3%) developed within 30 days. Oral antibiotic + IV (n = 2,426) had a lower SSI rate than IV alone (n = 3,324) (6.3% vs 16.7%, p < 0.0001). There was a significant difference in the SSI rate based on type of preoperative IV antibiotic given (p ≤ 0.0001). Generalized estimating equations adjusting for significant covariates of age, body mass index, procedure work relative value units, and operation duration demonstrated an independent protective effect of oral antibiotics (odds ratio [OR] 0.37, 95% CI 0.29 to 0.46), as well as increased rates of SSI associated with ampicillin/sulbactam (OR 2.21, 95% CI 1.37 to 3.56) and second generation cephalosporins (cefoxitin, OR 2.50, 95% CI 1.83 to 3.42; cefotetan, OR 2.70, 95% CI 1.72 to 4.22) when compared with first generation cephalosporin/metronidazole. The choice of IV antibiotic was related to the SSI rate; however, oral antibiotics were associated with reduced SSI rate for every antibiotic class. Published by Elsevier Inc.

  10. Influence of hospital type on survival in stage IV colorectal cancer.

    PubMed

    Hoshino, Nobuaki; Hasegawa, Suguru; Hida, Koya; Kawada, Kenji; Okamura, Ryosuke; Hamada, Madoka; Munemoto, Yoshinori; Sakai, Yoshiharu; Watanabe, Masahiko

    2016-08-01

    Hospital factors along with various patient and surgeon factors are considered to affect the prognosis of colorectal cancer. Hospital volume is well known, but little is known regarding other hospital factors. We reviewed data on 853 patients with stage IV colorectal cancer who underwent elective palliative primary tumor resection between January 2006 and December 2007. To detect the hospital factors that could influence the prognosis of incurable colorectal cancer, the relationships between patient/hospital factors and overall survival were analyzed. Among hospital factors, hospital type (Group A: university hospital or cancer center; Group B: community hospital), hospital volume, and number of colorectal surgeons were examined. In univariate analysis, Group A hospitals showed significantly better prognosis than Group B hospitals (p = 0.034), while hospital volume and number of colorectal surgeons were not associated with overall survival. After adjustment for patient factors in multivariate analysis, hospital type was significantly associated with overall survival (hazard ratio: 1.31; 95 % confidence interval: 1.05-1.63; p = 0.016). However, there was no significant difference in short-term outcomes between hospital types. Hospital type was identified as a hospital factor that possibly affects the prognosis of stage IV colorectal cancer patients.

  11. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.

    PubMed

    Rizo-de-la-Torre, L C; Ibarra, B; Sánchez-López, J Y; Magaña-Torres, M T; Rentería-López, V M; Perea-Díaz, F J

    2017-10-01

    Beta-thalassemia (β-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. One hundred and forty-nine β-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δβ-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δβ-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of β-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans. © 2017 John Wiley & Sons Ltd.

  12. Identification of type IV collagen exposure as a molecular imaging target for early detection of thoracic aortic dissection

    PubMed Central

    Xu, Ke; Xu, Chen; Zhang, Yanzhenzi; Qi, Feiran; Yu, Bingran; Li, Ping; Jia, Lixin; Li, Yulin; Xu, Fu-jian; Du, Jie

    2018-01-01

    Thoracic aortic dissection (TAD) is an aggressive and life-threatening vascular disease and there is no effective means of early diagnosis of dissection. Type IV collagen (Col-IV) is a major component of the sub-endothelial basement membrane, which is initially exposed followed by endothelial injury as early-stage event of TAD. So, we want to build a noninvasive diagnostic method to detect early dissection by identifying the exposed Col-IV via MRI. Methods: Col-IV-targeted magnetic resonance/ fluorescence dual probe (Col-IV-DOTA-Gd-rhodamine B; CDR) was synthesized by amide reaction and coordination reaction. Flow cytometry analysis was used to evaluate the cell viability of SMC treated with CDR and fluorescence assays were used to assess the Col-IV targeting ability of CDR in vitro. We then examined the sensitivity and specificity of CDR at different stages of TAD via MRI and bioluminescence imaging in vivo. Results: The localization of Col-IV (under the intima) was observed by histology images. CDR bound specifically to Col-IV-expressing vascular smooth muscle cells and BAPN-induced dissected aorta. The CDR signal was co-detected by magnetic resonance imaging (MRI) and bioluminescence imaging as early as 2 weeks after BAPN administration (pre-dissection stage). The ability to detect rupture of dissected aorta was indicated by a strong normalized signal enhancement (NSE) in vivo. Moreover, NSE was negatively correlated with the time of dissection rupture after BAPN administration (r2 = 0.8482). Conclusion: As confirmed by in vivo studies, the CDR can identify the exposed Col-IV in degenerated aorta to monitor the progress of aortic dissection from the early stage to the rupture via MRI. Thus, CDR-enhanced MRI proposes a potential method for dissection screening, and for monitoring disease progression and therapeutic response. PMID:29290819

  13. Enterprise Information System Integration Technology

    NASA Astrophysics Data System (ADS)

    Tanaka, Tetsuo; Yumoto, Masaki; Itsuki, Rei

    In the current rapidly changing business environment, companies need to be efficient and agile to survive and thrive. That is why flexible systems integration is urgent and crucial concern for any enterprise. For the meanwhile, systems integration technology is getting more complicated, and middleware types are beginning blur for decades. We sort system integration into four different types, “Delayed Federation", “Real-time Federation", “Delayed Integration", and “Real-time Integration". We also outline appropriate technology and architecture for each type.

  14. Novel mutations of the AGXT gene causing primary hyperoxaluria type 1.

    PubMed

    Yuen, Yuet-Ping; Lai, Chi-Kong; Tong, Gensy Mei-Wah; Wong, Ping-Nam; Wong, Francis Kim-Ming; Mak, Siu-Ka; Lo, Kin-Yee; Wong, Andrew Kui-Man; Tong, Sui-Fan; Chan, Yan-Wo; Lam, Ching-Wan

    2004-01-01

    Primary hyperoxaluria type 1 (PH1), an inherited cause of nephrolithiasis, is due to a functional defect of the liver-specific peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). A definitive PH1 diagnosis can be established by analyzing AGT activity in liver tissue or mutation analysis of the AGXT gene. The molecular basis of PH1 in three Chinese patients, two with adult-onset and one with childhood-onset recurrent nephrolithiasis, was established by analyzing the entire AGXT gene. Three novel mutations (c2T>C, c817insAG and c844C>T) and two previously reported mutations (c33insC and 679-IVS6+2delAAgt) were identified. c2T>C converts the initiation codon from ATG to ACG, which predicts significant reduction, if not complete abolition, of protein translation. c817insAG leads to a frameshift and changes the amino acid sequence after codon 274. c844C>T changes glutamine at codon 282 to a termination codon, resulting in protein truncation. This is the first report describing AGXT gene mutations in Chinese patients with PH1. AGXT genotypes cannot fully explain the clinical heterogeneity of PH1, and other factors involved in disease pathogenesis remain to be identified. Our experience emphasizes the importance of excluding PH1 in patients with recurrent nephrolithiasis to avoid delay or inappropriate management.

  15. Expression of heat shock protein 47 is increased in remnant kidney and correlates with disease progression

    PubMed Central

    SUNAMOTO, MASAAKI; KUZE, KOGO; IEHARA, NORIYUKI; TAKEOKA, HIROYA; NAGATA, KAZUHIRO; KITA, TORU; DOI, TOSHIO

    1998-01-01

    Glomerulosclerosis is characterized by accumulation of the mesangial extracellular matrix, including type I and IV collagen. The processing for the collagens in the glomeruli may play a critical role for development of glomerulosclerosis. We examined the expression of heat shock protein 47 (HSP47), a collagen-binding molecular chaperone in the progresive glomerulosclerosis model. Subtotally nephrectomized rats, unlike sham-operated rats, developed focal and segmental glomerulosclerosis. Immunological staining demonstrated an increased expression of HSP47 which paralleled the expression of type I and IV collagen in the glomeruli of the nephrectomized rats as the glomerulosclerosis developed. The mRNA levels encoding type I and type IV collagen and HSP47 were increased 3.4 fold, 3.6 fold and 2.8 fold, respectively, at week 7 after nephrectomy. By in situ hybridization, the expression of HSP47 mRNA was determined to be localized to the glomeruli with segmental sclerosis. These results suggest that HSP47 may play a central role in the process of extracellular matrix accumulation during the development of glomerulosclerosis. PMID:9741355

  16. A review on high-resolution CMOS delay lines: towards sub-picosecond jitter performance.

    PubMed

    Abdulrazzaq, Bilal I; Abdul Halin, Izhal; Kawahito, Shoji; Sidek, Roslina M; Shafie, Suhaidi; Yunus, Nurul Amziah Md

    2016-01-01

    A review on CMOS delay lines with a focus on the most frequently used techniques for high-resolution delay step is presented. The primary types, specifications, delay circuits, and operating principles are presented. The delay circuits reported in this paper are used for delaying digital inputs and clock signals. The most common analog and digitally-controlled delay elements topologies are presented, focusing on the main delay-tuning strategies. IC variables, namely, process, supply voltage, temperature, and noise sources that affect delay resolution through timing jitter are discussed. The design specifications of these delay elements are also discussed and compared for the common delay line circuits. As a result, the main findings of this paper are highlighting and discussing the followings: the most efficient high-resolution delay line techniques, the trade-off challenge found between CMOS delay lines designed using either analog or digitally-controlled delay elements, the trade-off challenge between delay resolution and delay range and the proposed solutions for this challenge, and how CMOS technology scaling can affect the performance of CMOS delay lines. Moreover, the current trends and efforts used in order to generate output delayed signal with low jitter in the sub-picosecond range are presented.

  17. Estrogen receptor ERα plays a major role in ethanol-evoked myocardial oxidative stress and dysfunction in conscious female rats.

    PubMed

    Yao, Fanrong; Abdel-Rahman, Abdel A

    2016-02-01

    Our previous studies showed that ethanol elicited estrogen (E2)-dependent myocardial oxidative stress and dysfunction. In the present study we tested the hypothesis that E2 signaling via the estrogen receptor (ER), ERα, mediates this myocardial detrimental effect of alcohol. To achieve this goal, conscious female rats in proestrus phase (highest endogenous E2 level) received a selective ER antagonist (200 μg/kg; intra-venous [i.v.]) for ERα (MPP), ERβ (PHTPP) or GPER (G15) or saline 30 min before ethanol (1 g/kg; i.v.) or saline infusion. ERα blockade virtually abrogated ethanol-evoked myocardial dysfunction and hypotension, while ERβ blockade had little effect on the hypotensive response, but caused delayed attenuation of the ethanol-evoked reductions in left ventricular developed pressure and the rate of left ventricle pressure rise. GPER blockade caused delayed attenuation of all cardiovascular effects of ethanol. All three antagonists attenuated the ethanol-evoked increases in myocardial catalase and ALDH2 activities, Akt, ERK1/2, p38, eNOS, and nNOS phosphorylation, except for a lack of effect of PHTPP on p38. Finally, all three ER antagonists attenuated ethanol-evoked elevation in myocardial ROS, but this effect was most notable with ERα blockade. In conclusion, ERα plays a greater role in, and might serve as a molecular target for ameliorating, the E2-dependent myocardial oxidative stress and dysfunction caused by ethanol. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Work stressors, perseverative cognition and objective sleep quality: a longitudinal study among Dutch Helicopter Emergency Medical Service (HEMS) Pilots.

    PubMed

    Radstaak, Mirjam; Geurts, Sabine A E; Beckers, Debby G J; Brosschot, Jos F; Kompier, Michiel A J

    2014-01-01

    This longitudinal study examined the associations between work stressors, perseverative cognition and subjective and objective sleep quality. We hypothesized work stressors to be associated with (i) poor nocturnal sleep quality and (ii) higher levels of perseverative cognition during a free evening. We further hypothesized (iii) perseverative cognition to be associated with poor nocturnal sleep quality and (iv) the association between work stressors and sleep quality to be mediated by perseverative cognition. The participants were 24 pilots working for the Dutch Helicopter Emergency Medical Service (HEMS). They completed six questionnaires: at the end of three consecutive day shifts and each morning following the shifts. The questionnaires addressed work stressors (workload, distressing shifts and work-related conflicts), subjective sleep quality and perseverative cognition. Participants wore actigraphs to assess sleep onset latency, total sleep time and number of awakenings. Correlation analysis revealed that (i) distressing shifts were related to delayed sleep onset (r=0.50, p=0.026) and that workload was related to impaired sleep quality (e.g., subjective sleep quality: r=-0.42, p=0.044). Moreover, (ii) distressing shifts were positively related to perseverative cognition (r=0.62, p=0.002), (iii) perseverative cognition delayed sleep onset (r=0.74, p<0.001) and (iv) mediated the association between distressing shifts and sleep onset latency. Perseverative cognition may be an explanatory mechanism in the association between work stressors and poor sleep.

  19. Chondroitin sulphates A, B and C, collagen types I-IV and fibronectin in venous sinus of the red pulp in human spleen.

    PubMed

    Rovenská, E; Michalka, P; Papincák, J; Durdík, S; Jakubovský, J

    2005-01-01

    The morphological relationship of chondroitin sulphates A, B, and C, collagen types I-IV and fibronectin in the wall of venous sinuses of the red pulp in human spleen has not been a focus of interest among morphologists. Regarding the hypothesis that the structure of the spleen lends it the function of a blood filter the substances described in our study might play a significant role in the functional morphology. Of 146 human spleen surgical specimens, groups of 12 specimens each were examined under a light microscope using the method of antibodies against fibronectin, against collagen types I-IV and against chondroitin sulphates A, B, and C. The sections of the red pulp of human spleen stained with hematoxylin and eosin provided limited information about the wall of the sinuses. Chondroitin sulphates A and B were observed on the surface of sinus-lining cells (SLC), and fibronectin was detected on the surface of the annular fibers. Collagen type 11 was observed almost in the same places as chondroitin sulphates A and B. Collagen type IV was present in annular fibers of the wall of the sinus and in the basement membrane, like fibronectin. Chondroitin sulphate was not present in the walls of sinuses. Binding of antibodies against chondroitin sulphate A and against chondroitin sulphate B indicates the presence of chondroitin sulfates on the surface of SLC, where they probably play a role in helping the human organism to recognize alien and self substances. The presence of chondroitin,sulphates A and B probably affects inhibition of binding of cells with collagen type I, but not with fibronectin.

  20. Association of history of allergies and influenza-like infections with laryngeal cancer in a case-control study.

    PubMed

    Filippidis, Filippos T; Schwartz, Stephen M; Becker, Nikolaus; Dyckhoff, Gerhard; Kirschfink, Michael; Dietz, Andreas; Becher, Heiko; Ramroth, Heribert

    2015-08-01

    Prior studies suggest that history of allergy and infections early in life might be inversely associated with cancer. We explored the association between allergies, recent influenza infections and laryngeal cancer risk. We used data from a case-control study which included 229 cases of laryngeal cancer and 769 population controls matched for age and sex. History of a physician-diagnosed allergy, influenza-like infections in the past 5 years, smoking, alcohol consumption and occupational exposure to carcinogens were self-reported. Allergies were classified into two groups (Type I and Type IV), according to the underlying immunologic mechanism. Conditional logistic regression models were fitted using laryngeal cancer as the outcome, adjusting for smoking, alcohol consumption and occupational exposure and stratified for age and sex. Having any allergy was not associated significantly with laryngeal cancer. Although Type I and Type IV allergies were non-significantly associated with laryngeal cancer, Type IV allergies showed a strong inverse association after adjusting for smoking and alcohol (OR 0.50, 95 % CI 0.22-1.2). Participants who reported at least one influenza-like infection during the past 5 years were significantly less likely to have laryngeal cancer (OR 0.57, 95 % CI 0.39-0.81). After considering fever (≥38.5 °C) as a criterion for influenza infection, the association between influenza infection and laryngeal cancer was even stronger (OR 0.29, 95 % CI 0.13-0.63). We found no significant association between any allergy and laryngeal cancer, some indication of an inverse association between Type IV allergy and laryngeal cancer, whereas recent influenza infections were inversely associated with laryngeal cancer risk.

Top