Sample records for deletion analysis identified

  1. Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small-eye and belly-spotting phenotypes.

    PubMed

    Favor, Jack; Bradley, Alan; Conte, Nathalie; Janik, Dirk; Pretsch, Walter; Reitmeir, Peter; Rosemann, Michael; Schmahl, Wolfgang; Wienberg, Johannes; Zaus, Irmgard

    2009-08-01

    In the mouse Pax6 function is critical in a dose-dependent manner for proper eye development. Pax6 contiguous gene deletions were shown to be homozygous lethal at an early embryonic stage. Heterozygotes express belly spotting and extreme microphthalmia. The eye phenotype is more severe than in heterozygous Pax6 intragenic null mutants, raising the possibility that deletions are functionally different from intragenic null mutations or that a region distinct from Pax6 included in the deletions affects eye phenotype. We recovered and identified the exact regions deleted in three new Pax6 deletions. All are homozygous lethal at an early embryonic stage. None express belly spotting. One expresses extreme microphthalmia and two express the milder eye phenotype similar to Pax6 intragenic null mutants. Analysis of Pax6 expression levels and the major isoforms excluded the hypothesis that the deletions expressing extreme microphthalmia are directly due to the action of Pax6 and functionally different from intragenic null mutations. A region distinct from Pax6 containing eight genes was identified for belly spotting. A second region containing one gene (Rcn1) was identified for the extreme microphthalmia phenotype. Rcn1 is a Ca(+2)-binding protein, resident in the endoplasmic reticulum, participates in the secretory pathway and expressed in the eye. Our results suggest that deletion of Rcn1 directly or indirectly contributes to the eye phenotype in Pax6 contiguous gene deletions.

  2. Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

    PubMed

    Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

    2014-11-01

    Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

  3. Isolation of anonymous DNA sequences from within a submicroscopic X chromosomal deletion in a patient with choroideremia, deafness, and mental retardation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nussbaum, R.L.; Lesko, J.G.; Lewis, R.A.

    1987-09-01

    Choroideremia, an X-chromosome linked retinal dystrophy of unknown pathogenesis, causes progressive nightblindness and eventual central blindness in affected males by the third to fourth decade of life. Choroideremia has been mapped to Xq13-21 by tight linkage to restriction fragment length polymorphism loci. The authors have recently identified two families in which choroideremia is inherited with mental retardation and deafness. In family XL-62, an interstitial deletion Xq21 is visible by cytogenetic analysis and two linked anonymous DNA markers, DXYS1 and DXS72, are deleted. In the second family, XL-45, an interstitial deletion was suspected on phenotypic grounds but could not be confirmedmore » by high-resolution cytogenetic analysis. They used phenol-enhanced reassociation of 48,XXXX DNA in competition with excess XL-45 DNA to generate a library of cloned DNA enriched for sequences that might be deleted in XL-45. Two of the first 83 sequences characterized from the library were found to be deleted in probands from family XL-45 as well as from family XL-62. Isolation of these sequences proves that XL-45 does contain a submicroscopic deletion and provides a starting point for identifying overlapping genomic sequences that span the XL-45 deletion. Each overlapping sequence will be studied to identify exons from the choroideremia locus.« less

  4. Cryptic intragenic deletion of the SHOX gene in a family with Léri-Weill dyschondrosteosis detected by Multiplex Ligation-Dependent Probe Amplification (MLPA).

    PubMed

    Funari, Mariana F A; Jorge, Alexander A L; Pinto, Emilia M; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

    2008-11-01

    LWD is associated to SHOX haploinsufficiency, in most cases, due to gene deletion. Generally FISH and microsatellite analysis are used to identify SHOX deletion. MLPA is a new method of detecting gene copy variation, allowing simultaneous analysis of several regions. Here we describe the presence of a SHOX intragenic deletion in a family with LWD, analyzed through different methodologies. Genomic DNA of 11 subjects from one family were studied by microsatellite analysis, direct sequencing and MLPA. FISH was performed in two affected individuals. Microsatellite analysis showed that all affected members shared the same haplotype suggesting the involvement of SHOX. MLPA detected an intragenic deletion involving exons IV-VIa, which was not detected by FISH and microsatellite analysis. In conclusion, the MLPA technique was proved to be the best solution on detecting this small deletion, it has the advantage of being less laborious also allowing the analysis of several regions simultaneously.

  5. The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

    PubMed

    Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

    2013-01-01

    Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

  6. Copy number variants in attention-deficit hyperactive disorder: identification of the 15q13 deletion and its functional role.

    PubMed

    Valbonesi, Stefano; Magri, Chiara; Traversa, Michele; Faraone, Stephen V; Cattaneo, Annamaria; Milanesi, Elena; Valenti, Vera; Gennarelli, Massimo; Scassellati, Catia

    2015-04-01

    Evidence has supported a role for rare copy number variants in the etiology of attention-deficit hyperactivity disorder (ADHD), in particular, the region 15q13, which is also a hot spot for several neuropsychiatric disorders. This region spans several genes, but their role and the biological implications remain unclear. We carried out, for the first time, an analysis of the 15q13 region in an Italian cohort of 117 ADHD patients and 77 controls using the MLPA method, confirmed by a genome single-nucleotide polymorphism array. In addition, we probed for downstream effects of the 15q13 deletions on gene expression by carrying out a transcriptomic analysis in blood. We found 15q13 deletions in two ADHD patients and identified 129 genes as significantly dysregulated in the blood of the two ADHD patients carrying 15q13 deletions compared with ADHD patients without 15q13 deletions. As expected, genes in the deleted region (KLF13, MTMR10) were downregulated in the two patients with deletions. Moreover, a pathway analysis identified apoptosis, oxidation reduction, and immune response as the mechanisms that were altered most significantly in the ADHD patients with 15q13 deletions. Interestingly, we showed that deletions in KLF13 and CHRNA7 influenced the expression of genes belonging to the same immune/inflammatory and oxidative stress signaling pathways. Our findings are consistent with the presence of 15q13 deletions in Italian ADHD patients. More interestingly, we show that pathways related to immune/inflammatory response and oxidative stress signaling are affected by the deletion of KFL13 and CHRNA7. Because the phenotypic effects of 15q13 are pleiotropic, our findings suggest that there are shared biologic pathways among multiple neuropsychiatric conditions.

  7. PAR1 deletions downstream of SHOX are the most frequent defect in a Spanish cohort of Léri-Weill dyschondrosteosis (LWD) probands.

    PubMed

    Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E

    2006-10-01

    Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.

  8. Analysis of repeat-mediated deletions in the mitochondrial genome of Saccharomyces cerevisiae.

    PubMed

    Phadnis, Naina; Sia, Rey A; Sia, Elaine A

    2005-12-01

    Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions.

  9. Analysis of Repeat-Mediated Deletions in the Mitochondrial Genome of Saccharomyces cerevisiae

    PubMed Central

    Phadnis, Naina; Sia, Rey A.; Sia, Elaine A.

    2005-01-01

    Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions. PMID:16157666

  10. Genomic analysis of adult B-ALL identifies potential markers of shorter survival.

    PubMed

    Patel, Shiven; Mason, Clinton C; Glenn, Martha J; Paxton, Christian N; South, Sara T; Cessna, Melissa H; Asch, Julie; Cobain, Erin F; Bixby, Dale L; Smith, Lauren B; Reshmi, Shalini; Gastier-Foster, Julie M; Schiffman, Joshua D; Miles, Rodney R

    2017-05-01

    B lymphoblastic leukemia (B-ALL) in adults has a higher risk of relapse and lower long-term survival than pediatric B-ALL, but data regarding genetic prognostic biomarkers are much more limited for adult patients. We identified 70 adult B-ALL patients from three institutions and performed genome-wide analysis via single nucleotide polymorphism (SNP) arrays on DNA isolated from their initial diagnostic sample and, when available, relapse bone marrow specimens to identify recurring copy number alterations (CNA). As B-cell developmental genes play a crucial role in this leukemia, we assessed such for recurrent deletions in diagnostic and relapse samples. We confirmed previous findings that the most prevalent deletions of these genes occur in CDKN2A, IKZF1, and PAX5, with several others at lower frequencies. Of the 16 samples having paired diagnostic and relapse samples, 5 showed new deletions in these recurrent B-cell related genes and 8 showed abolishment. Deletion of EBF1 heralded a significant negative prognostic impact on relapse free survival in univariate and multivariate analyses. The combination of both a CDKN2A/B deletion and an IKZF1 alteration (26% of cases) also showed a trend toward predicting worse overall survival compared to having only one or neither of these deletions. These findings add to the understanding of genomic influences on this comparably understudied disease cohort that upon further validation may help identify patients who would benefit from upfront treatment intensification. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Case-Deletion Diagnostics for Maximum Likelihood Multipoint Quantitative Trait Locus Linkage Analysis

    PubMed Central

    Mendoza, Maria C.B.; Burns, Trudy L.; Jones, Michael P.

    2009-01-01

    Objectives Case-deletion diagnostic methods are tools that allow identification of influential observations that may affect parameter estimates and model fitting conclusions. The goal of this paper was to develop two case-deletion diagnostics, the exact case deletion (ECD) and the empirical influence function (EIF), for detecting outliers that can affect results of sib-pair maximum likelihood quantitative trait locus (QTL) linkage analysis. Methods Subroutines to compute the ECD and EIF were incorporated into the maximum likelihood QTL variance estimation components of the linkage analysis program MAPMAKER/SIBS. Performance of the diagnostics was compared in simulation studies that evaluated the proportion of outliers correctly identified (sensitivity), and the proportion of non-outliers correctly identified (specificity). Results Simulations involving nuclear family data sets with one outlier showed EIF sensitivities approximated ECD sensitivities well for outlier-affected parameters. Sensitivities were high, indicating the outlier was identified a high proportion of the time. Simulations also showed the enormous computational time advantage of the EIF. Diagnostics applied to body mass index in nuclear families detected observations influential on the lod score and model parameter estimates. Conclusions The EIF is a practical diagnostic tool that has the advantages of high sensitivity and quick computation. PMID:19172086

  12. Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

    PubMed Central

    Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

    2014-01-01

    Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

  13. Methylation-Specific Multiplex Ligation-Dependent Probe Amplification and Identification of Deletion Genetic Subtypes in Prader-Willi Syndrome

    PubMed Central

    Henkhaus, Rebecca S.; Kim, Soo-Jeong; Kimonis, Virginia E.; Gold, June-Anne; Dykens, Elisabeth M.; Driscoll, Daniel J.

    2012-01-01

    Purpose: Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are complex neurodevelopmental disorders caused by loss of expression of imprinted genes from the 15q11-q13 region depending on the parent of origin. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) kits from MRC-Holland (Amsterdam, The Netherlands) were used to detect PWS and AS deletion subtypes. We report our experience with two versions of the MS-MLPA-PWS/AS kit (original A1 and newer B1) in determining methylation status and deletion subtypes in individuals with PWS. Methods: MS-MLPA analysis was performed on DNA isolated from a large cohort of PWS subjects with the MS-MLPA-PWS/AS-A1 and -B1 probe sets. Results: Both MS-MLPA kits will identify deletions in the 15q11-q13 region but the original MS-MLPA-A1 kit has a higher density of probes at the telomeric end of the 15q11-q13 region, which is more useful for identifying individuals with atypical deletions. The newer B1 kit contains more probes in the imprinting center (IC) and adjoining small noncoding RNAs useful in identifying small microdeletions. Conclusion: The A1 kit identified the typical deletions and smaller atypical deletions, whereas the B1 kit was more informative for identifying microdeletions including the IC and SNORD116 regions. Both kits should be made available for accurate characterization of PWS/AS deletion subtypes as well as evaluating for IC and SNORD116 microdeletions. PMID:21977908

  14. Proteomic Analysis of Albumins and Globulins from Wheat Variety Chinese Spring and Its Fine Deletion Line 3BS-8

    PubMed Central

    Ma, Chao-Ying; Gao, Li-Yan; Li, Ning; Li, Xiao-Hui; Ma, Wu-Jun; Appels, Rudi; Yan, Yue-Ming

    2012-01-01

    The relationship between chromosome deletion in wheat and protein expression were investigated using Chinese Spring and fine deletion line 3BS-8. Through 2-DE (2-D electrophoresis) analysis, no differentially expressed proteins (DEPs) were found in leaf samples; however, 47 DEPs showed at least two-fold abundance variation (p < 0.05) in matured wheat grains and 21 spots were identified by tandem MALDI-TOF/TOF-MS. Among the identified spots, four were cultivar-specific, including three (spots B15, B16, and B21) in Chinese Spring and one in 3BS-8 (spot B10). Among variety-different DEPs between Chinese Spring and 3BS-8, most spots showed a higher express profile in CS; only four spots showed up-regulated expression tendency in 3BS-8. An interesting observation was that more than half of the identified protein spots were involved in storage proteins, of which 11 spots were identified as globulins. According to these results, we can presume that the encoded genes of protein spots B15, B16, and B21 were located on the chromosome segment deleted in 3BS-8. PMID:23202959

  15. Reduced expression of APC-1B but not APC-1A by the deletion of promoter 1B is responsible for familial adenomatous polyposis.

    PubMed

    Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi

    2016-05-24

    Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.

  16. Molecular and cytogenetic investigation of Y chromosome deletions over three generations facilitated by intracytoplasmic sperm injection.

    PubMed

    Minor, Agata; Wong, Edgar Chan; Harmer, Karynn; Ma, Sai

    2007-08-01

    The azoospermic factor (AZF) region is critical for normal spermatogenesis since microdeletions and partial deletions have been associated with infertility. We investigate the diagnostic ability of karyotyping in detecting clinically relevant Y chromosome deletions. The clinical significance of heterochromatin deletions, microdeletions and partial AZFc deletions is also evaluated. A patient with a Yq deletion, affected by severe oligoasthenoteratozoospermia, underwent intracytoplasmic sperm injection (ICSI) which resulted in the birth of a healthy baby boy. The patient, his father and his son underwent Y chromosome microdeletion and partial AZFc deletion screening. We also studied the aneuploidy rate in the sperm of the patient by fluorescent in situ hybridization. AZF microdeletions were absent in the family. However, microdeletion analysis confirmed that the Yq deletion was limited to the heterochromatin. We found a partial AZFc gr/gr deletion in all three family members. We observed an increased rate of sex chromosome aneuploidy in the infertile patient. Cytogenetic analysis was misleading in identifying the Yq breakpoint. Infertility observed in the patient was associated with the gr/gr partial deletion. However, because of the incomplete penetrance of gr/gr deletions, the consequence of the vertical transmission of the deletion through ICSI remains unknown. Copyright (c) 2007 John Wiley & Sons, Ltd.

  17. Zoom‐in comparative genomic hybridisation arrays for the characterisation of variable breakpoint contiguous gene syndromes

    PubMed Central

    Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G

    2007-01-01

    Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889

  18. Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis.

    PubMed

    Nicoletti, Annalisa; Ziccardi, Lucia; Maltese, Paolo Enrico; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

    2017-02-01

    X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by "home-made" MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene.

  19. Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

    PubMed

    Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

    2016-04-01

    The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. A comprehensive analysis of replicative lifespan in 4,698 single-gene deletion strains uncovers conserved mechanisms of aging

    PubMed Central

    McCormick, Mark A.; Delaney, Joe R.; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; Shemorry, Anna; Sim, Sylvia; Chou, Annie Chia-Zong; Ahmed, Umema; Carr, Daniel; Murakami, Christopher J.; Schleit, Jennifer; Sutphin, George L.; Wasko, Brian M.; Bennett, Christopher F.; Wang, Adrienne M.; Olsen, Brady; Beyer, Richard P.; Bammler, Theodor K.; Prunkard, Donna; Johnson, Simon C.; Pennypacker, Juniper K.; An, Elroy; Anies, Arieanna; Castanza, Anthony S.; Choi, Eunice; Dang, Nick; Enerio, Shiena; Fletcher, Marissa; Fox, Lindsay; Goswami, Sarani; Higgins, Sean A.; Holmberg, Molly A.; Hu, Di; Hui, Jessica; Jelic, Monika; Jeong, Ki-Soo; Johnston, Elijah; Kerr, Emily O.; Kim, Jin; Kim, Diana; Kirkland, Katie; Klum, Shannon; Kotireddy, Soumya; Liao, Eric; Lim, Michael; Lin, Michael S.; Lo, Winston C.; Lockshon, Dan; Miller, Hillary A.; Moller, Richard M.; Muller, Brian; Oakes, Jonathan; Pak, Diana N.; Peng, Zhao Jun; Pham, Kim M.; Pollard, Tom G.; Pradeep, Prarthana; Pruett, Dillon; Rai, Dilreet; Robison, Brett; Rodriguez, Ariana A.; Ros, Bopharoth; Sage, Michael; Singh, Manpreet K.; Smith, Erica D.; Snead, Katie; Solanky, Amrita; Spector, Benjamin L.; Steffen, Kristan K.; Tchao, Bie Nga; Ting, Marc K.; Wende, Helen Vander; Wang, Dennis; Welton, K. Linnea; Westman, Eric A.; Brem, Rachel B.; Liu, Xin-guang; Suh, Yousin; Zhou, Zhongjun; Kaeberlein, Matt; Kennedy, Brian K.

    2015-01-01

    SUMMARY Many genes that affect replicative lifespan (RLS) in the budding yeast Saccharomyces cerevisiae also affect aging in other organisms such as C. elegans and M. musculus. We performed a systematic analysis of yeast RLS in a set of 4,698 viable single-gene deletion strains. Multiple functional gene clusters were identified, and full genome-to-genome comparison demonstrated a significant conservation in longevity pathways between yeast and C. elegans. Among the mechanisms of aging identified, deletion of tRNA exporter LOS1 robustly extended lifespan. Dietary restriction (DR) and inhibition of mechanistic Target of Rapamycin (mTOR) exclude Los1 from the nucleus in a Rad53-dependent manner. Moreover, lifespan extension from deletion of LOS1 is non-additive with DR or mTOR inhibition, and results in Gcn4 transcription factor activation. Thus, the DNA damage response and mTOR converge on Los1-mediated nuclear tRNA export to regulate Gcn4 activity and aging. PMID:26456335

  1. Usefulness of MLPA in the detection of SHOX deletions.

    PubMed

    Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

    2010-01-01

    SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

  2. Coexpression network analysis identifies transcriptional modules associated with genomic alterations in neuroblastoma.

    PubMed

    Yang, Liulin; Li, Yun; Wei, Zhi; Chang, Xiao

    2018-06-01

    Neuroblastoma is a highly complex and heterogeneous cancer in children. Acquired genomic alterations including MYCN amplification, 1p deletion and 11q deletion are important risk factors and biomarkers in neuroblastoma. Here, we performed a co-expression-based gene network analysis to study the intrinsic association between specific genomic changes and transcriptome organization. We identified multiple gene coexpression modules which are recurrent in two independent datasets and associated with functional pathways including nervous system development, cell cycle, immune system process and extracellular matrix/space. Our results also indicated that modules involved in nervous system development and cell cycle are highly associated with MYCN amplification and 1p deletion, while modules responding to immune system process are associated with MYCN amplification only. In summary, this integrated analysis provides novel insights into molecular heterogeneity and pathogenesis of neuroblastoma. This article is part of a Special Issue entitled: Accelerating Precision Medicine through Genetic and Genomic Big Data Analysis edited by Yudong Cai & Tao Huang. Copyright © 2017. Published by Elsevier B.V.

  3. 4p16.3 microdeletions and microduplications detected by chromosomal microarray analysis: New insights into mechanisms and critical regions.

    PubMed

    Bi, Weimin; Cheung, Sau-Wai; Breman, Amy M; Bacino, Carlos A

    2016-10-01

    Deletions in the 4p16.3 region cause Wolf-Hirschhorn syndrome, a well known contiguous microdeletion syndrome with the critical region for common phenotype mapped in WHSCR2. Recently, duplications in 4p16.3 were reported in three patients with developmental delay and dysmorphic features. Through chromosomal microarray analysis, we identified 156 patients with a deletion (n = 109) or duplication (n = 47) in 4p16.3 out of approximately 60,000 patients analyzed by Baylor Miraca Genetics Laboratories. Seventy-five of the postnatally detected deletions encompassed the entire critical region, 32 (43%) of which were associated with other chromosome rearrangements, including six patients (8%) that had a duplication adjacent to the terminal deletion. Our data indicate that Wolf-Hirschhorn syndrome deletions with an adjacent duplication occur at a higher frequency than previously appreciated. Pure deletions (n = 14) or duplications (n = 15) without other copy number changes distal to or inside the WHSCR2 were identified for mapping of critical regions. Our data suggest that deletion of the segment from 0.6 to 0.9 Mb from the terminus of 4p causes a seizure phenotype and duplications of a region distal to the previously defined smallest region of overlap for 4p16.3 microduplication syndrome are associated with neurodevelopmental problems. We detected seven Wolf-Hirschhorn syndrome deletions and one 4p16.3 duplication prenatally; all of the seven are either >8 Mb in size and/or associated with large duplications. In conclusion, our study provides deeper insight into the molecular mechanisms, the critical regions and effective prenatal diagnosis for 4p16.3 deletions/ duplications. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  4. Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis

    PubMed Central

    Nicoletti, Annalisa; Ziccardi, Lucia; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

    2017-01-01

    Aims: X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. Methods: We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by “home-made” MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Results: Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Conclusion: Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene. PMID:27997221

  5. Large mitochondrial DNA deletion in an infant with addison disease.

    PubMed

    Duran, Gloria P; Martinez-Aguayo, A; Poggi, H; Lagos, M; Gutierrez, D; Harris, P R

    2012-01-01

    Mitochondrial diseases are a group of disorders caused by mutations in nuclear DNA or mitochondrial DNA, usually involving multiple organ systems. Primary adrenal insufficiency due to mitochondrial disease is extremely infrequent and has been reported in association with mitochondrial DNA deletion syndromes such as Kearns-Sayre syndrome. To report a 3-year-old boy with Addison disease, congenital glaucoma, chronic pancreatitis, and mitochondrial myopathy due to large mitochondrial DNA deletion. Molecular analysis of mitochondrial DNA samples obtained from peripheral blood, oral mucosa, and muscle tissue. A novel large mitochondrial DNA deletion of 7,372bp was identified involving almost all genes on the big arch of mtDNA. This case reaffirms the association of adrenal insufficiency and mitochondrial DNA deletions and presents new evidence that glaucoma is another manifestation of mitochondrial diseases. Due to the genetic and clinical heterogeneity of mitochondrial disorders, molecular analysis is crucial to confirm diagnosis and to allow accurate genetic counseling.

  6. A novel class of Pseudoautosomal region 1 deletions downstream of SHOX is associated with Leri-Weill dyschondrosteosis.

    PubMed

    Benito-Sanz, Sara; Thomas, N Simon; Huber, Céline; Huber, Celine; Gorbenko del Blanco, Darya; Del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Crolla, John A; Maloney, Vivienne; Rappold, Gudrun; Argente, Jesús; Argente, Jesus; Campos-Barros, Angel; Cormier-Daire, Valérie; Cormier-Daire, Valerie; Heath, Karen E

    2005-10-01

    Leri-Weill dyschondrosteosis (LWD) is a pseudoautosomal dominant disorder characterized by disproportionate short stature and a characteristic curving of the radius, known as the "Madelung deformity." SHOX mutations resulting in SHOX haploinsufficiency have been found in LWD and in a variable proportion of patients with idiopathic short stature (ISS), whereas homozygous loss of SHOX results in the more severe Langer mesomelic dysplasia (LMD). Defects in SHOX have been identified in approximately 60% of LWD cases, whereas, in the remaining approximately 40%, the molecular basis is unknown. This suggests either genetic heterogeneity or the presence of mutations in unanalyzed regions of SHOX, such as the upstream, intragenic, or downstream regulatory sequences. Therefore, the pseudoautosomal region 1 (PAR1) of 80 patients with LWD, in whom SHOX deletions and mutations had been excluded, was screened for deletions by use of a new panel of microsatellite markers. We identified 12 patients with LWD who presented with a novel class of PAR1 deletions that did not include SHOX. The deletions were of variable size and mapped at least approximately 30-530 kb downstream of SHOX. In our cohort, this type of deletion accounted for 15% of cases. In all cases, the deletions cosegregated with the phenotype. No apparent phenotypic differences were observed between patients with SHOX deletions and those with this new class of PAR1 deletions. Thus, we present here the identification of a second PAR1 region implicated in the etiopathogenesis of LWD. Our findings suggest the presence of distal regulatory elements of SHOX transcription in PAR1 or, alternatively, the existence of an additional locus apparently involved in the control of skeletal development. Deletion analysis of this newly identified region should be included in the mutation screening of patients with LWD, LMD, and ISS.

  7. Heterozygous deletion at the SOX10 gene locus in two patients from a Chinese family with Waardenburg syndrome type II.

    PubMed

    Wenzhi, He; Ruijin, Wen; Jieliang, Li; Xiaoyan, Ma; Haibo, Liu; Xiaoman, Wang; Jiajia, Xian; Shaoying, Li; Shuanglin, Li; Qing, Li

    2015-10-01

    Waardenburg syndrome (WS) is a rare disease characterized by sensorineural deafness and pigment disturbance. To date, almost 100 mutations have been reported, but few reports on cases with SOX10 gene deletion. The inheritance pattern of SOX10 gene deletion is still unclear. Our objective was to identify the genetic causes of Waardenburg syndrome type II in a two-generation Chinese family. Clinical evaluations were conducted in both of the patients. Microarray analysis and multiplex ligation-dependent probe amplification (MLPA) were performed to identify disease-related copy number variants (CNVs). DNA sequencing of the SOX10, MITF and SNAI2 genes was performed to identify the pathogenic mutation responsible for WS2. A 280kb heterozygous deletion at the 22q13.1 chromosome region (including SOX10) was detected in both of the patients. No mutation was found in the patients, unaffected family members and 30 unrelated healthy controls. This report is the first to describe SOX10 heterozygous deletions in Chinese WS2 patients. Our result conform the thesis that heterozygous deletions at SOX10 is an important pathogenicity for WS, and present as autosomal dominant inheritance. Nevertheless, heterozygous deletion of the SOX10 gene would be worth investigating to understand their functions and contributions to neurologic phenotypes. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  8. Small Deletion Variants Have Stable Breakpoints Commonly Associated with Alu Elements

    PubMed Central

    Coin, Lachlan J. M.; Steinfeld, Israel; Yakhini, Zohar; Sladek, Rob; Froguel, Philippe; Blakemore, Alexandra I. F.

    2008-01-01

    Copy number variants (CNVs) contribute significantly to human genomic variation, with over 5000 loci reported, covering more than 18% of the euchromatic human genome. Little is known, however, about the origin and stability of variants of different size and complexity. We investigated the breakpoints of 20 small, common deletions, representing a subset of those originally identified by array CGH, using Agilent microarrays, in 50 healthy French Caucasian subjects. By sequencing PCR products amplified using primers designed to span the deleted regions, we determined the exact size and genomic position of the deletions in all affected samples. For each deletion studied, all individuals carrying the deletion share identical upstream and downstream breakpoints at the sequence level, suggesting that the deletion event occurred just once and later became common in the population. This is supported by linkage disequilibrium (LD) analysis, which has revealed that most of the deletions studied are in moderate to strong LD with surrounding SNPs, and have conserved long-range haplotypes. Analysis of the sequences flanking the deletion breakpoints revealed an enrichment of microhomology at the breakpoint junctions. More significantly, we found an enrichment of Alu repeat elements, the overwhelming majority of which intersected deletion breakpoints at their poly-A tails. We found no enrichment of LINE elements or segmental duplications, in contrast to other reports. Sequence analysis revealed enrichment of a conserved motif in the sequences surrounding the deletion breakpoints, although whether this motif has any mechanistic role in the formation of some deletions has yet to be determined. Considered together with existing information on more complex inherited variant regions, and reports of de novo variants associated with autism, these data support the presence of different subgroups of CNV in the genome which may have originated through different mechanisms. PMID:18769679

  9. Parallel analysis of tagged deletion mutants efficiently identifies genes involved in endoplasmic reticulum biogenesis.

    PubMed

    Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D

    2003-07-30

    Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.

  10. Molecular detection of a 4p deletion using PCR-based polymorphisms: a technique for the rapid detection of the Wolf-Hirschhorn syndrome.

    PubMed

    Altherr, M R; Gusella, J F; Wasmuth, J J; Kummer, M A; McKercher, S W; Johnson, V P

    1992-11-01

    Wolf-Hirschhorn syndrome (WHS) results from a deletion of part of chromosome 4p. The region of 4p consistently deleted in WHS is near the tip of 4p. Two loci in this region D4S95 and D4S125 are associated with highly informative VNTR polymorphisms and were recently converted to allow PCR-based screening. PCR analysis was used successfully to identify a small de novo deletion of 4p in a patient suspected of having WHS. This procedure allows a rapid and accurate confirmation of 4p deletions in cases where cytogenetics alone cannot provide a clear answer.

  11. Genotype-Phenotype Analysis, Neuropsychological Assessment, and Growth Hormone Response in a Patient with 18p Deletion Syndrome.

    PubMed

    Sun, Huihui; Wan, Naijun; Wang, Xinli; Chang, Liang; Cheng, Dazhi

    2018-01-01

    18p deletion syndrome is a rare chromosomal disease caused by deletion of the short arm of chromosome 18. By using cytogenetic and SNP array analysis, we identified a girl with 18p deletion syndrome exhibiting craniofacial anomalies, intellectual disability, and short stature. G-banding analysis of metaphase cells revealed an abnormal karyotype 46,XX,del(18)(p10). Further, SNP array detected a 15.3-Mb deletion at 18p11.21p11.32 (chr18:12842-15375878) including 61 OMIM genes. Genotype-phenotype correlation analysis showed that clinical manifestations of the patient were correlated with LAMA1, TWSG1, and GNAL deletions. Her neuropsychological assessment test demonstrated delay in most cognitive functions including impaired mathematics, linguistic skills, visual motor perception, respond speed, and executive function. Meanwhile, her integrated visual and auditory continuous performance test (IVA-CPT) indicated a severe comprehensive attention deficit. At age 7 and 1/12 years, her height was 110.8 cm (-2.5 SD height for age). Growth hormone (GH) treatment was initiated. After 27 months treatment, her height was increased to 129.6 cm (-1.0 SD height for age) at 9 and 4/12 years, indicating an effective response to GH treatment. © 2018 S. Karger AG, Basel.

  12. Multiplexed quantitative real-time PCR to detect 22q11.2 deletion in patients with congenital heart disease

    PubMed Central

    Mahnke, Donna K.; Larson, Joshua M.; Ghanta, Sujana; Feng, Ying; Simpson, Pippa M.; Broeckel, Ulrich; Duffy, Kelly; Tweddell, James S.; Grossman, William J.; Routes, John M.; Mitchell, Michael E.

    2010-01-01

    22q11.2 Deletion syndrome (22q11.2 DS) [DiGeorge syndrome type 1 (DGS1)] occurs in ∼1:3,000 live births; 75% of children with DGS1 have severe congenital heart disease requiring early intervention. The gold standard for detection of DGS1 is fluorescence in situ hybridization (FISH) with a probe at the TUPLE1 gene. However, FISH is costly and is typically ordered in conjunction with a karyotype analysis that takes several days. Therefore, FISH is underutilized and the diagnosis of 22q11.2 DS is frequently delayed, often resulting in profound clinical consequences. Our goal was to determine whether multiplexed, quantitative real-time PCR (MQPCR) could be used to detect the haploinsufficiency characteristic of 22q11.2 DS. A retrospective blinded study was performed on 382 subjects who had undergone congenital heart surgery. MQPCR was performed with a probe localized to the TBX1 gene on human chromosome 22, a gene typically deleted in 22q11.2 DS. Cycle threshold (Ct) was used to calculate the relative gene copy number (rGCN). Confirmation analysis was performed with the Affymetrix 6.0 Genome-Wide SNP Array. With MQPCR, 361 subjects were identified as nondeleted with an rGCN near 1.0 and 21 subjects were identified as deleted with an rGCN near 0.5, indicative of a hemizygous deletion. The sensitivity (21/21) and specificity (361/361) of MQPCR to detect 22q11.2 deletions was 100% at an rGCN value drawn at 0.7. One of 21 subjects with a prior clinical (not genetically confirmed) DGS1 diagnosis was found not to carry the deletion, while another subject, not previously identified as DGS1, was detected as deleted and subsequently confirmed via microarray. The MQPCR assay is a rapid, inexpensive, sensitive, and specific assay that can be used to screen for 22q11.2 deletion syndrome. The assay is readily adaptable to high throughput. PMID:20551144

  13. Effects of Mora Deletion, Nonword Repetition, Rapid Naming, and Visual Search Performance on Beginning Reading in Japanese

    ERIC Educational Resources Information Center

    Kobayashi, Maya Shiho; Haynes, Charles W.; Macaruso, Paul; Hook, Pamela E.; Kato, Junko

    2005-01-01

    This study examined the extent to which mora deletion (phonological analysis), nonword repetition (phonological memory), rapid automatized naming (RAN), and visual search abilities predict reading in Japanese kindergartners and first graders. Analogous abilities have been identified as important predictors of reading skills in alphabetic languages…

  14. A Comprehensive Analysis of Replicative Lifespan in 4,698 Single-Gene Deletion Strains Uncovers Conserved Mechanisms of Aging.

    PubMed

    McCormick, Mark A; Delaney, Joe R; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; Shemorry, Anna; Sim, Sylvia; Chou, Annie Chia-Zong; Ahmed, Umema; Carr, Daniel; Murakami, Christopher J; Schleit, Jennifer; Sutphin, George L; Wasko, Brian M; Bennett, Christopher F; Wang, Adrienne M; Olsen, Brady; Beyer, Richard P; Bammler, Theodor K; Prunkard, Donna; Johnson, Simon C; Pennypacker, Juniper K; An, Elroy; Anies, Arieanna; Castanza, Anthony S; Choi, Eunice; Dang, Nick; Enerio, Shiena; Fletcher, Marissa; Fox, Lindsay; Goswami, Sarani; Higgins, Sean A; Holmberg, Molly A; Hu, Di; Hui, Jessica; Jelic, Monika; Jeong, Ki-Soo; Johnston, Elijah; Kerr, Emily O; Kim, Jin; Kim, Diana; Kirkland, Katie; Klum, Shannon; Kotireddy, Soumya; Liao, Eric; Lim, Michael; Lin, Michael S; Lo, Winston C; Lockshon, Dan; Miller, Hillary A; Moller, Richard M; Muller, Brian; Oakes, Jonathan; Pak, Diana N; Peng, Zhao Jun; Pham, Kim M; Pollard, Tom G; Pradeep, Prarthana; Pruett, Dillon; Rai, Dilreet; Robison, Brett; Rodriguez, Ariana A; Ros, Bopharoth; Sage, Michael; Singh, Manpreet K; Smith, Erica D; Snead, Katie; Solanky, Amrita; Spector, Benjamin L; Steffen, Kristan K; Tchao, Bie Nga; Ting, Marc K; Vander Wende, Helen; Wang, Dennis; Welton, K Linnea; Westman, Eric A; Brem, Rachel B; Liu, Xin-Guang; Suh, Yousin; Zhou, Zhongjun; Kaeberlein, Matt; Kennedy, Brian K

    2015-11-03

    Many genes that affect replicative lifespan (RLS) in the budding yeast Saccharomyces cerevisiae also affect aging in other organisms such as C. elegans and M. musculus. We performed a systematic analysis of yeast RLS in a set of 4,698 viable single-gene deletion strains. Multiple functional gene clusters were identified, and full genome-to-genome comparison demonstrated a significant conservation in longevity pathways between yeast and C. elegans. Among the mechanisms of aging identified, deletion of tRNA exporter LOS1 robustly extended lifespan. Dietary restriction (DR) and inhibition of mechanistic Target of Rapamycin (mTOR) exclude Los1 from the nucleus in a Rad53-dependent manner. Moreover, lifespan extension from deletion of LOS1 is nonadditive with DR or mTOR inhibition, and results in Gcn4 transcription factor activation. Thus, the DNA damage response and mTOR converge on Los1-mediated nuclear tRNA export to regulate Gcn4 activity and aging. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

    PubMed Central

    Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

    2016-01-01

    Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

  16. Confirmation and refinement of the heterozygous deletion of the small leucine-rich proteoglycans associated with posterior amorphous corneal dystrophy.

    PubMed

    Cervantes, Aleck E; Gee, Katherine M; Whiting, Martha F; Frausto, Ricardo F; Aldave, Anthony J

    2018-04-19

    To present the clinical and cytogenetic features of a previously unreported family with posterior amorphous corneal dystrophy (PACD) associated with a heterozygous deletion of the small leucine-rich proteoglycan (SRLP) genes on chromosome 12. Clinical characterization was performed using slit lamp biomicroscopic and optical coherence tomography (OCT) imaging. Genomic DNA was collected from affected and unaffected family members, and a cytogenomic array was used to identify copy number variations (CNV) present in the PACD locus. Three members of a Guatemalan family presented with clinical characteristics consistent with PACD: bilateral posterior stromal lamellar opacification, decreased corneal curvature, and iridocorneal adhesions. OCT imaging demonstrated decreased corneal thickness and hyperreflectivity of the posterior third of the corneal stroma. CNV analysis confirmed the presumed clinical diagnosis of PACD by revealing a 0.304 Mb heterozygous deletion in the PACD locus on chromosome 12 that included the four SLRP genes (KERA, LUM, DCN, and EPYC) deleted in each of the PACD families in which CNV analysis has been reported. This is the first report of the OCT appearance of PACD and the second confirmation of a heterozygous deletion of chromosome 12q21.33 as the cause of PACD, highlighting the utility of array-based cytogenomics to confirm the suspected clinical diagnosis of PACD. As the smallest previously reported pathogenic deletion was 0.701 Mb, the 0.304-Mb deletion we report is the smallest identified to date and reduces the size of the PACD locus to 0.275 Mb.

  17. Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

    PubMed

    Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

    2000-12-15

    Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

  18. Targeted exome sequencing and chromosomal microarray for the molecular diagnosis of nevoid basal cell carcinoma syndrome.

    PubMed

    Matsudate, Yoshihiro; Naruto, Takuya; Hayashi, Yumiko; Minami, Mitsuyoshi; Tohyama, Mikiko; Yokota, Kenji; Yamada, Daisuke; Imoto, Issei; Kubo, Yoshiaki

    2017-06-01

    Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder mainly caused by heterozygous mutations of PTCH1. In addition to characteristic clinical features, detection of a mutation in causative genes is reliable for the diagnosis of NBCCS; however, no mutations have been identified in some patients using conventional methods. To improve the method for the molecular diagnosis of NBCCS. We performed targeted exome sequencing (TES) analysis using a multi-gene panel, including PTCH1, PTCH2, SUFU, and other sonic hedgehog signaling pathway-related genes, based on next-generation sequencing (NGS) technology in 8 cases in whom possible causative mutations were not detected by previously performed conventional analysis and 2 recent cases of NBCCS. Subsequent analysis of gross deletion within or around PTCH1 detected by TES was performed using chromosomal microarray (CMA). Through TES analysis, specific single nucleotide variants or small indels of PTCH1 causing inferred amino acid changes were identified in 2 novel cases and 2 undiagnosed cases, whereas gross deletions within or around PTCH1, which are validated by CMA, were found in 3 undiagnosed cases. However, no mutations were detected even by TES in 3 cases. Among 3 cases with gross deletions of PTCH1, deletions containing the entire PTCH1 and additional neighboring genes were detected in 2 cases, one of which exhibited atypical clinical features, such as severe mental retardation, likely associated with genes located within the 4.3Mb deleted region, especially. TES-based simultaneous evaluation of sequences and copy number status in all targeted coding exons by NGS is likely to be more useful for the molecular diagnosis of NBCCS than conventional methods. CMA is recommended as a subsequent analysis for validation and detailed mapping of deleted regions, which may explain the atypical clinical features of NBCCS cases. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  19. Impact of the Bim Deletion Polymorphism on Survival Among Patients With Completely Resected Non-Small-Cell Lung Carcinoma.

    PubMed

    Atsumi, Jun; Shimizu, Kimihiro; Ohtaki, Yoichi; Kaira, Kyoichi; Kakegawa, Seiichi; Nagashima, Toshiteru; Enokida, Yasuaki; Nakazawa, Seshiru; Obayashi, Kai; Takase, Yoshiaki; Kawashima, Osamu; Kamiyoshihara, Mitsuhiro; Sugano, Masayuki; Ibe, Takashi; Igai, Hitoshi; Takeyoshi, Izumi

    2016-02-01

    A deletion polymorphism of the Bim gene has been reported to be a prognostic factor for patients with non-small-cell lung cancer (NSCLC) treated with epidermal growth factor receptor-tyrosine kinase inhibitors in the Asian population. We investigated the impact of the Bim deletion polymorphism on survival among patients with completely resected NSCLC. The Bim polymorphism was detected by polymerase chain reaction analysis. We measured overall survival (OS) and recurrence-free survival rates in 411 patients and postrecurrence survival (PRS) in 94 patients who experienced recurrence and received additional anticancer therapy. The Bim deletion polymorphism was detected in 61 patients (14.8%). OS rates were significantly lower for patients with the Bim deletion polymorphism than for those with the wild-type sequence. On multivariable analysis, the Bim deletion polymorphism was identified as an independent prognostic factor for OS (hazard ratio, 1.98; 95% CI, 1.17 to 3.36; P = .011). Among the 94 patients who experienced recurrence and were treated with anticancer therapy, patients with the Bim deletion polymorphism showed significantly poorer PRS than those with the wild-type sequence (median, 9.8 months v 26.9 months, respectively; P < .001). Multivariable analysis revealed that the Bim deletion polymorphism was an independent predictor of PRS (hazard ratio, 3.36; 95% CI, 1.75 to 6.47; P < .001). This trend remained apparent in subgroup analyses stratified by EGFR status, histology, and therapeutic modality. The Bim deletion polymorphism is a novel indicator of shortened PRS among patients with recurrent NSCLC treated with anticancer therapy in the Asian population.

  20. Identification and characterization of cryptic SHOX intragenic deletions in three Japanese patients with Léri-Weill dyschondrosteosis.

    PubMed

    Fukami, Maki; Dateki, Sumito; Kato, Fumiko; Hasegawa, Yukihiro; Mochizuki, Hiroshi; Horikawa, Reiko; Ogata, Tsutomu

    2008-01-01

    Although short-stature homeobox-containing gene (SHOX ) haploinsufficiency is responsible for Léri-Weill dyschondrosteosis (LWD), the molecular defect has not been identified in approximately 20% of Japanese LWD patients. Furthermore, although high prevalence of microdeletions affecting SHOX is primarily ascribed to the presence of repeat sequences such as Alu elements around SHOX, it remains to be determined whether microdeletions are actually mediated by repeat sequences. We performed multiple ligation probe amplification (MLPA) assay in six Japanese LWD patients with apparently normal SHOX, followed by fluorescent in situ hybridization (FISH) analysis and sequencing for polymerase chain reaction (PCR) products encompassing the deletion junctions in patients with abnormal MLPA patterns. Consequently, heterozygous intragenic deletions were identified in three cases, i.e., a 5,906-bp deletion involving exons 4-5 in case 1, a 5,594-bp deletion involving exons 4-6a in case 2, and a 50,199-bp deletion involving exons 4-6b in case 3. The deletion breakpoints of cases 1 and 2 were present in nonrepeat sequences, whereas those of case 3 resided within Alu elements. The results suggest that cryptic SHOX intragenic deletions account for a small fraction of LWD and that microdeletions affecting SHOX can be generated by repeat-sequence-mediated aberrant recombinations and by nonhomologous end joining.

  1. Increased CNV-Region deletions in mild cognitive impairment (MCI) and Alzheimer's disease (AD) subjects in the ADNI sample

    PubMed Central

    Guffanti, Guia; Torri, Federica; Rasmussen, Jerod; Clark, Andrew P.; Lakatos, Anita; Turner, Jessica A.; Fallon, James H.; Saykin, Andrew J.; Weiner, Michael; Vawter, Marquis P.; Knowles, James A.; Potkin, Steven G.; Macciardi, Fabio

    2014-01-01

    We investigated the genome-wide distribution of CNVs in the Alzheimer's disease (AD) Neuroimaging Initiative (ADNI) sample (146 with AD, 313 with Mild Cognitive Impairment (MCI), and 181 controls). Comparison of single CNVs between cases (MCI and AD) and controls shows overrepresentation of large heterozygous deletions in cases (p-value < 0.0001). The analysis of CNV-Regions identifies 44 copy number variable loci of heterozygous deletions, with more CNV-Regions among affected than controls (p = 0.005). Seven of the 44 CNV-Regions are nominally significant for association with cognitive impairment. We validated and confirmed our main findings with genome re-sequencing of selected patients and controls. The functional pathway analysis of the genes putatively affected by deletions of CNV-Regions reveals enrichment of genes implicated in axonal guidance, cell–cell adhesion, neuronal morphogenesis and differentiation. Our findings support the role of CNVs in AD, and suggest an association between large deletions and the development of cognitive impairment PMID:23583670

  2. Gross deletions in TCOF1 are a cause of Treacher–Collins–Franceschetti syndrome

    PubMed Central

    Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy

    2012-01-01

    Treacher–Collins–Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5′ end of the gene were identified. The partial gene deletions of different sizes represent ∼5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected. PMID:22317976

  3. Gross deletions in TCOF1 are a cause of Treacher-Collins-Franceschetti syndrome.

    PubMed

    Bowman, Michael; Oldridge, Michael; Archer, Caroline; O'Rourke, Anthony; McParland, Joanna; Brekelmans, Roel; Seller, Anneke; Lester, Tracy

    2012-07-01

    Treacher-Collins-Franceschetti syndrome (TCS) is an autosomal dominant craniofacial disorder characterised by midface hypoplasia, micrognathia, downslanting palpebral fissures, eyelid colobomata, and ear deformities that often lead to conductive deafness. A total of 182 patients with signs consistent with a diagnosis of TCS were screened by DNA sequence and dosage analysis of the TCOF1 gene. In all, 92 cases were found to have a pathogenic mutation by sequencing and 5 to have a partial gene deletion. A further case had a novel in-frame deletion in the alternatively spliced exon 6A of uncertain pathogenicity. The majority of the pathogenic sequence changes were found to predict premature protein termination, however, four novel missense changes in the LIS1 homology motif at the 5' end of the gene were identified. The partial gene deletions of different sizes represent ~5.2% of all the pathogenic TCOF1 mutations identified, indicating that gene rearrangements account for a significant proportion of TCS cases. This is the first report of gene rearrangements resulting in TCS. These findings expand the TCOF1 mutation spectrum indicating that dosage analysis should be performed together with sequence analysis, a strategy that is predicted to have a sensitivity of 71% for patients in whom TCS is strongly suspected.

  4. Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

    PubMed

    Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

    2009-09-01

    We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

  5. Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area

    PubMed Central

    Li, Peipei; Xing, Hua; Zhao, Zhenjun; Yang, Zhaoqing; Cao, Yaming; Yan, Guiyun; Sattabongkot, Jetsumon; Cui, Liwang; Fan, Qi

    2016-01-01

    Deletion of the Plasmodium falciparum histidine-rich protein 2 (pfhrp2) gene may affect the performance of PfHRP2-based rapid diagnostic tests (RDTs). Here we investigated the genetic diversity of the pfhrp2 gene in clinical parasite isolates collected in recent years from the China-Myanmar border area. Deletion of pfhrp2 has been identified in 4 out of 97 parasite isolates. Sequencing of the pfhrp2 exon 2 from 67 isolates revealed a high level of genetic diversity in pfhrp2, which is reflected in the presence of many repeat types and their variants, as well as variable copy numbers and different arrangements of these repeats in parasite isolates. In addition, we observed pfhrp3 deletion in three of the four parasites harboring pfhrp2 deletion, suggesting of double deletions of both genes in these three isolates. Analysis of two cases, which were P. falciparum-positive by microscopy and PCR but failed by two PfHRP2-based RDTs, did not find pfhrp2 deletion. Further correlational studies of pfhrp2 polymorphisms with detection sensitivity are needed to identify factors influencing the performance of RDTs in malaria-endemic areas. PMID:26297799

  6. Identification of a region of homozygous deletion in cervical carcinoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aburatani, H.; Housman, D.E.; Wang, Y.

    1994-09-01

    To identify the possible location of a tumor suppressor gene (TSG) for cervical carcinoma, we have scanned the tumor DNAs for homozygous deletion by Representational Difference Analysis (RDA). Matched pairs of tumor and normal DNA were restriction digested and PCR-amplified. The tumor DNA amplicon was used as a driver for subtraction to identify DNA fragments homozygously deleted in tumor DNA. We analysed 6 cervical cancer specimens (5 cell lines, 1 fresh tumor). Four out of 6 analyses produced difference products present only in normal DNA, which were either hemizygously or homozygously deleted in tumor DNA. The two samples which failedmore » to produce any difference products were cell lines established from dysplasia patients, on which genetic changes might be minimal. One cervical carcinoma cell line CC6 produced 11 difference products deleted homozygously, all of which are clustered in 3p12-13 region. The proximal short arm of chromosome 3 is known to have a high incidence of L.O.H. in cervical carcinoma and thus may be a locus for TSG. A 4 Mb YAC contig has been established over the deletion and its characterization is under way to facilitate the identification of possible TSGs in this region.« less

  7. A Novel Class of Pseudoautosomal Region 1 Deletions Downstream of SHOX Is Associated with Léri-Weill Dyschondrosteosis

    PubMed Central

    Benito-Sanz, Sara; Thomas, N. Simon; Huber, Céline; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Crolla, John A.; Maloney, Vivienne; Argente, Jesús; Campos-Barros, Ángel; Cormier-Daire, Valérie; Heath, Karen E.

    2005-01-01

    Léri-Weill dyschondrosteosis (LWD) is a pseudoautosomal dominant disorder characterized by disproportionate short stature and a characteristic curving of the radius, known as the “Madelung deformity.” SHOX mutations resulting in SHOX haploinsufficiency have been found in LWD and in a variable proportion of patients with idiopathic short stature (ISS), whereas homozygous loss of SHOX results in the more severe Langer mesomelic dysplasia (LMD). Defects in SHOX have been identified in ∼60% of LWD cases, whereas, in the remaining ∼40%, the molecular basis is unknown. This suggests either genetic heterogeneity or the presence of mutations in unanalyzed regions of SHOX, such as the upstream, intragenic, or downstream regulatory sequences. Therefore, the pseudoautosomal region 1 (PAR1) of 80 patients with LWD, in whom SHOX deletions and mutations had been excluded, was screened for deletions by use of a new panel of microsatellite markers. We identified 12 patients with LWD who presented with a novel class of PAR1 deletions that did not include SHOX. The deletions were of variable size and mapped at least ∼30–530 kb downstream of SHOX. In our cohort, this type of deletion accounted for 15% of cases. In all cases, the deletions cosegregated with the phenotype. No apparent phenotypic differences were observed between patients with SHOX deletions and those with this new class of PAR1 deletions. Thus, we present here the identification of a second PAR1 region implicated in the etiopathogenesis of LWD. Our findings suggest the presence of distal regulatory elements of SHOX transcription in PAR1 or, alternatively, the existence of an additional locus apparently involved in the control of skeletal development. Deletion analysis of this newly identified region should be included in the mutation screening of patients with LWD, LMD, and ISS. PMID:16175500

  8. AB020. Chromosome rearrangement in patients with 46,XY disorders of sex development

    PubMed Central

    Vu, Dung Chi; Nguyen, Khanh Ngoc; Can, Ngoc Bich; Bui, Thao Phuong; Fukami, Maki

    2017-01-01

    Background Disorders of sex development (DSD) is defined by congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Causative mutations have not been identified in more than 50% 46,XY DSD cases. We aimed to identify chromosomal rearrangement in the development of 46,XY DSD in Vietnamese patients. Methods Case series report including clinical presentations and data from array-based comparative genomic hybridization analysis for six genetic males with genital abnormalities combines with mental disability and other congenital anomalies. Results Heterozygous submicroscopic deletions and/or duplications were identified in six cases. A 7.2 Mb terminal deletion at chromosome 9 including deletion of DMRT1 gene and a 2.7 Mb terminal duplication at chromosome 17 were detected in case 1 that presented with prematurity, dysmorphism and ambiguous genitalia. A terminal deletion affects DMRT1-3 at 9p22-23 was identified in case 2 with ambiguous genitalia, mental disability and dysmorphism. An 18 Mb terminal duplication at chromosome 5 was detected in case 3 with DSD, growth retardation, microcephaly and dysmorphism, ptosis, ventricular septal defect and craniosynostosis. An interstitial deletion including deletions of WT1, PAX6, and PRRG4 genes at chromosome 11 was detected in case 4 with WAGR syndrome. A terminal duplication at chromosome 7 was detected in case 5 with DSD, severe hypospadias, small phallus size (1 cm at 3 years of age), and no testis found clinically. A 5 Mb terminal deletion at chromosome 4 and a 6 Mb terminal duplication of chromosome 16 were detected in case 6 with severe motor-mental retardation, microcephaly (head circumference −3.5 SD), micrognathia, and DSD. Conclusions The results indicate that chromosomal rearrangements constitute an important part of the molecular bases of 46,XY DSD and that submicroscopic deletions and/or duplication can lead to various types of 46,XY DSD combined with other congenital anomalies and/or mental disability.

  9. Telomere healing following DNA polymerase arrest-induced breakages is likely the main mechanism generating chromosome 4p terminal deletions.

    PubMed

    Hannes, Femke; Van Houdt, Jeroen; Quarrell, Oliver W; Poot, Martin; Hochstenbach, Ron; Fryns, Jean-Pierre; Vermeesch, Joris R

    2010-12-01

    Constitutional developmental disorders are frequently caused by terminal chromosomal deletions. The mechanisms and/or architectural features that might underlie those chromosome breakages remain largely unexplored. Because telomeres are the vital DNA protein complexes stabilizing linear chromosomes against chromosome degradation, fusion, and incomplete replication, those terminal-deleted chromosomes acquired new telomeres either by telomere healing or by telomere capture. To unravel the mechanisms leading to chromosomal breakage and healing, we sequenced nine chromosome 4p terminal deletion boundaries. A computational analysis of the breakpoint flanking region, including 12 previously published pure terminal breakage sites, was performed in order to identify architectural features that might be involved in this process. All terminal 4p truncations were likely stabilized by telomerase-mediated telomere healing. In the majority of breakpoints multiple genetic elements have a potential to induce secondary structures and an enrichment in replication stalling site motifs were identified. These findings suggest DNA replication stalling-induced chromosome breakage during early development is the first mechanistic step leading toward terminal deletion syndromes. © 2010 Wiley-Liss, Inc.

  10. Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

    PubMed

    Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

    2013-06-01

    Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

  11. DMD mutation spectrum analysis in 613 Chinese patients with dystrophinopathy.

    PubMed

    Guo, Ruolan; Zhu, Guosheng; Zhu, Huimin; Ma, Ruiyu; Peng, Ying; Liang, Desheng; Wu, Lingqian

    2015-08-01

    Dystrophinopathy is a group of inherited diseases caused by mutations in the DMD gene. Within the dystrophinopathy spectrum, Duchenne and Becker muscular dystrophies are common X-linked recessive disorders that mainly feature striated muscle necrosis. We combined multiplex ligation-dependent probe amplification with Sanger sequencing to detect large deletions/duplications and point mutations in the DMD gene in 613 Chinese patients. A total of 571 (93.1%) patients were diagnosed, including 428 (69.8%) with large deletions/duplications and 143 (23.3%) with point mutations. Deletion/duplication breakpoints gathered mostly in introns 44-55. Reading frame rules could explain 88.6% of deletion mutations. We identified seventy novel point mutations that had not been previously reported. Spectrum expansion and genotype-phenotype analysis of DMD mutations on such a large sample size in Han Chinese population would provide new insights into the pathogenic mechanism underlying dystrophinopathies.

  12. 3p22.1p21.31 microdeletion identifies CCK as Asperger syndrome candidate gene and shows the way for therapeutic strategies in chromosome imbalances.

    PubMed

    Iourov, Ivan Y; Vorsanova, Svetlana G; Voinova, Victoria Y; Yurov, Yuri B

    2015-01-01

    In contrast to other autism spectrum disorders, chromosome abnormalities are rare in Asperger syndrome (AS) or high-functioning autism. Consequently, AS was occasionally subjected to classical positional cloning. Here, we report on a case of AS associated with a deletion of the short arm of chromosome 3. Further in silico analysis has identified a candidate gene for AS and has suggested a therapeutic strategy for manifestations of the chromosome rearrangement. Using array comparative genomic hybridization, an interstitial deletion of 3p22.1p21.31 (~2.5 Mb in size) in a child with Asperger's syndrome, seborrheic dermatitis and chronic pancreatitis was detected. Original bioinformatic approach to the prioritization of candidate genes/processes identified CCK (cholecystokinin) as a candidate gene for AS. In addition to processes associated with deleted genes, bioinformatic analysis of CCK gene interactome indicated that zinc deficiency might be a pathogenic mechanism in this case. This suggestion was supported by plasma zinc concentration measurements. The increase of zinc intake produced a rise in zinc plasma concentration and the improvement in the patient's condition. Our study supported previous linkage findings and had suggested a new candidate gene in AS. Moreover, bioinformatic analysis identified the pathogenic mechanism, which was used to propose a therapeutic strategy for manifestations of the deletion. The relative success of this strategy allows speculating that therapeutic or dietary normalization of metabolic processes altered by a chromosome imbalance or genomic copy number variations may be a way for treating at least a small proportion of cases of these presumably incurable genetic conditions.

  13. Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy.

    PubMed

    Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo; Xu, Ge-Zhi

    2017-01-01

    Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. We identified two novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype-phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling.

  14. Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy

    PubMed Central

    Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo

    2017-01-01

    Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931

  15. Analysis of copy number variations in Holstein-Friesian cow genomes based on whole-genome sequence data.

    PubMed

    Mielczarek, M; Frąszczak, M; Giannico, R; Minozzi, G; Williams, John L; Wojdak-Maksymiec, K; Szyda, J

    2017-07-01

    Thirty-two whole genome DNA sequences of cows were analyzed to evaluate inter-individual variability in the distribution and length of copy number variations (CNV) and to functionally annotate CNV breakpoints. The total number of deletions per individual varied between 9,731 and 15,051, whereas the number of duplications was between 1,694 and 5,187. Most of the deletions (81%) and duplications (86%) were unique to a single cow. No relation between the pattern of variant sharing and a family relationship or disease status was found. The animal-averaged length of deletions was from 5,234 to 9,145 bp and the average length of duplications was between 7,254 and 8,843 bp. Highly significant inter-individual variation in length and number of CNV was detected for both deletions and duplications. The majority of deletion and duplication breakpoints were located in intergenic regions and introns, whereas fewer were identified in noncoding transcripts and splice regions. Only 1.35 and 0.79% of the deletion and duplication breakpoints were observed within coding regions. A gene with the highest number of deletion breakpoints codes for protein kinase cGMP-dependent type I, whereas the T-cell receptor α constant gene had the most duplication breakpoints. The functional annotation of genes with the largest incidence of deletion/duplication breakpoints identified 87/112 Kyoto Encyclopedia of Genes and Genomes pathways, but none of the pathways were significantly enriched or depleted with breakpoints. The analysis of Gene Ontology (GO) terms revealed that a cluster with the highest enrichment score among genes with many deletion breakpoints was represented by GO terms related to ion transport, whereas the GO term cluster mostly enriched among the genes with many duplication breakpoints was related to binding of macromolecules. Furthermore, when considering the number of deletion breakpoints per gene functional category, no significant differences were observed between the "housekeeping" and "strong selection" categories, but genes representing the "low selection pressure" group showed a significantly higher number of breakpoints. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  16. Identification of the first de novo PAR1 deletion downstream of SHOX in an individual diagnosed with Léri-Weill dyschondrosteosis (LWD).

    PubMed

    Barroso, Eva; Benito-Sanz, Sara; Belinchón, Alberta; Yuste-Checa, Patricia; Gracia, Ricardo; Aragones, Angel; Campos-Barros, Angel; Heath, Karen E

    2010-01-01

    Léri-Weill dyschondrosteosis (LWD, MIM 127300), is a dominantly inherited skeletal dysplasia with disproportionate short stature, mesomelic limb shortening, and the characteristic Madelung deformity. Two regions of the pseudoautosomal region 1 (PAR1) have been shown to be involved in LWD, SHOX (short-stature homeobox-containing gene) and the downstream enhancer region. We report our genetic findings of a young girl clinically diagnosed with LWD. We analyzed the proband and her family using MLPA and microsatellite analysis. We identified a deletion, 726-866 kb in size, of the downstream SHOX enhancer region in the proband. Neither parent carried the deletion. Microsatellite analysis showed that the deleted allele was of paternal origin. The mutation is more likely to have arisen from a de novo event but paternal gonadal mosaicism cannot be excluded. In conclusion, we report the clinical and molecular details of the first case of a de novo deletion of the downstream PAR1 region in an LWD individual. De novo deletions of SHOX and the downstream enhancer region must be therefore considered in cases of isolated LWD. Copyright 2010 Elsevier Masson SAS. All rights reserved.

  17. Pfhrp2-Deleted Plasmodium falciparum Parasites in the Democratic Republic of the Congo: A National Cross-sectional Survey.

    PubMed

    Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R

    2017-07-01

    Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

  18. Association between F508 deletion in CFTR and chronic pancreatitis risk.

    PubMed

    Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

    2017-09-01

    The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

  19. Proteomic profiling of a mouse model of acute intestinal Apc deletion leads to identification of potential novel biomarkers of human colorectal cancer (CRC).

    PubMed

    Hammoudi, Abeer; Song, Fei; Reed, Karen R; Jenkins, Rosalind E; Meniel, Valerie S; Watson, Alastair J M; Pritchard, D Mark; Clarke, Alan R; Jenkins, John R

    2013-10-25

    Colorectal cancer (CRC) is the fourth most common cause of cancer-related death worldwide. Accurate non-invasive screening for CRC would greatly enhance a population's health. Adenomatous polyposis coli (Apc) gene mutations commonly occur in human colorectal adenomas and carcinomas, leading to Wnt signalling pathway activation. Acute conditional transgenic deletion of Apc in murine intestinal epithelium (AhCre(+)Apc(fl)(/)(fl)) causes phenotypic changes similar to those found during colorectal tumourigenesis. This study comprised a proteomic analysis of murine small intestinal epithelial cells following acute Apc deletion to identify proteins that show altered expression during human colorectal carcinogenesis, thus identifying proteins that may prove clinically useful as blood/serum biomarkers of colorectal neoplasia. Eighty-one proteins showed significantly increased expression following iTRAQ analysis, and validation of nine of these by Ingenuity Pathaway Analysis showed they could be detected in blood or serum. Expression was assessed in AhCre(+)Apc(fl)(/)(fl) small intestinal epithelium by immunohistochemistry, western blot and quantitative real-time PCR; increased nucelolin concentrations were also detected in the serum of AhCre(+)Apc(fl)(/)(fl) and Apc(Min)(/)(+) mice by ELISA. Six proteins; heat shock 60kDa protein 1, Nucleolin, Prohibitin, Cytokeratin 18, Ribosomal protein L6 and DEAD (Asp-Glu-Ala-Asp) box polypeptide 5,were selected for further investigation. Increased expression of 4 of these was confirmed in human CRC by qPCR. In conclusion, several novel candidate biomarkers have been identified from analysis of transgenic mice in which the Apc gene was deleted in the intestinal epithelium that also showed increased expression in human CRC. Some of these warrant further investigation as potential serum-based biomarkers of human CRC. Copyright © 2013 Elsevier Inc. All rights reserved.

  20. Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.

    PubMed

    Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio

    2014-07-23

    SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.

  1. Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region

    PubMed Central

    2014-01-01

    Background SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients. Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. Case presentation All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Conclusions Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region. PMID:25056248

  2. Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes.

    PubMed

    Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; Ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

    2017-08-01

    Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients.

  3. Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes

    PubMed Central

    Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

    2017-01-01

    Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients. PMID:28356564

  4. Mosaic compound heterozygosity of SHOX resulting in Leri-Weill dyschondrosteosis with marked short stature: implications for disease mechanisms and recurrence risks.

    PubMed

    Reish, Orit; Huber, Céline; Altarescu, Gheona; Chapman-Shimshoni, Daphne; Levy-Lahad, Ephrat; Renbaum, Paul; Mashevich, Maya; Munnich, Arnold; Cormier-Daire, Valérie

    2010-09-01

    Mutations or deletions in the SHOX gene cause Leri-Weill dyschondrosteosis (LWD) and Langer mesomelic dysplasia (LMD) when present in heterozygous or homozygous form, respectively. A new class of enhancer deletions was identified 30-250 kb downstream of SHOX. We identified a female patient with marked short stature, mosaic for monosomy X in 31% of her lymphocytes, and findings consistent with LWD. Additional molecular studies demonstrated segregation of 17 polymorphic markers flanking and including the SHOX locus, spanning 328 kb of pseudoautosomal region 1 (PAR1) region. A deletion up to 10 kb residing 197 kb downstream of SHOX gene was detected, which was germinally transmitted from her clinically unaffected father. This was associated with post-zygotic mosaic loss of the normal maternal X-chromosome, evidenced by fluorescent fragment analysis. Since most patients with LMD with deletions downstream of SHOX gene also have SHOX mutations in trans, it may suggest these deletions are associated with a milder phenotype. Further studies are required to elucidate the role of the former region in disease etiology. Mutations should be sought in clinically non-affected family members because of the variable expressivity in hemizygous carriers, and cytogenetic evaluation should be considered to detect possible X-chromosome rearrangements underlying the haploinsufficiency for the PAR1 when deletion is detected by molecular analysis. Similarly, when LWD and marked short stature occur in a patient with mosaic Turner syndrome, the possibility of mutations in SHOX and the downstream of SHOX gene should be considered. Copyright 2010 Wiley-Liss, Inc.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schuffenhauer, S.; Daumer-Haas, C.; Murken, J.

    Karyotypes with an interstitial deletion and a marker chromosome formed from the deleted segment are rare. We identified such a rearrangement in a newborn infant, who presented with macrocephaly, asymmetric square skull, minor facial anomalies, omphalocele, inguinal hernias, hypospadias, and club feet. The karyotype 46,XY,del(5)(pter{r_arrow}p13::cen{r_arrow}qter)/47,XY,+dicr(5)(:p13{r_arrow}cen::p13{r_arrow}cen),del(5)(pter{r_arrow}p13::cen{r_arrow}qter) was identified by banding studies and FISH analysis in the peripheral lymphocytes. One breakpoint on the del(5) maps distal to GDNF, and FISH analysis using an {alpha}-satellite probe suggests that the proximal breakpoint maps within the centromere. The dicentric r(5) consists of two copies of the segment deleted in the del(5), resulting in trisomy ofmore » proximal 5p (5p13-cen). The phenotype of the propositus is compared with other trisomy 5p cases and possible mechanisms for the generation of this unique chromosomal rearrangement are discussed. 27 refs., 3 figs.« less

  6. Microarray and FISH-based genotype-phenotype analysis of 22 Japanese patients with Wolf-Hirschhorn syndrome.

    PubMed

    Shimizu, Kenji; Wakui, Keiko; Kosho, Tomoki; Okamoto, Nobuhiko; Mizuno, Seiji; Itomi, Kazuya; Hattori, Shigeto; Nishio, Kimio; Samura, Osamu; Kobayashi, Yoshiyuki; Kako, Yuko; Arai, Takashi; Tsutomu, Oh-ishi; Kawame, Hiroshi; Narumi, Yoko; Ohashi, Hirofumi; Fukushima, Yoshimitsu

    2014-03-01

    Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome of the distal 4p chromosome, characterized by craniofacial features, growth impairment, intellectual disability, and seizures. Although genotype-phenotype correlation studies have previously been published, several important issues remain to be elucidated including seizure severity. We present detailed clinical and molecular-cytogenetic findings from a microarray and fluorescence in situ hybridization (FISH)-based genotype-phenotype analysis of 22 Japanese WHS patients, the first large non-Western series. 4p deletions were terminal in 20 patients and interstitial in two, with deletion sizes ranging from 2.06 to 29.42 Mb. The new Wolf-Hirschhorn syndrome critical region (WHSCR2) was deleted in all cases, and duplication of other chromosomal regions occurred in four. Complex mosaicism was identified in two cases: two different 4p terminal deletions; a simple 4p terminal deletion and an unbalanced translocation with the same 4p breakpoint. Seizures began in infancy in 33% (2/6) of cases with small (<6 Mb) deletions and in 86% (12/14) of cases with larger deletions (>6 Mb). Status epilepticus occurred in 17% (1/6) with small deletions and in 87% (13/15) with larger deletions. Renal hypoplasia or dysplasia and structural ocular anomalies were more prevalent in those with larger deletions. A new susceptible region for seizure occurrence is suggested between 0.76 and 1.3 Mb from 4 pter, encompassing CTBP1 and CPLX1, and distal to the previously-supposed candidate gene LETM1. The usefulness of bromide therapy for seizures and additional clinical features including hypercholesterolemia are also described. © 2013 Wiley Periodicals, Inc.

  7. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

    PubMed Central

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-01-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

  8. Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

    PubMed

    Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

    2014-09-01

    Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

  9. Identification and Characterization of Major Lipid Particle Proteins of the Yeast Saccharomyces cerevisiae

    PubMed Central

    Athenstaedt, Karin; Zweytick, Dagmar; Jandrositz, Anita; Kohlwein, Sepp Dieter; Daum, Günther

    1999-01-01

    Lipid particles of the yeast Saccharomyces cerevisiae were isolated at high purity, and their proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Major lipid particle proteins were identified by mass spectrometric analysis, and the corresponding open reading frames (ORFs) were deduced. In silicio analysis revealed that all lipid particle proteins contain several hydrophobic domains but none or only few (hypothetical) transmembrane spanning regions. All lipid particle proteins identified by function so far, such as Erg1p, Erg6p, and Erg7p (ergosterol biosynthesis) and Faa1p, Faa4p, and Fat1p (fatty acid metabolism), are involved in lipid metabolism. Based on sequence homology, another group of three lipid particle proteins may be involved in lipid degradation. To examine whether lipid particle proteins of unknown function are also involved in lipid synthesis, mutants with deletions of the respective ORFs were constructed and subjected to systematic lipid analysis. Deletion of YDL193w resulted in a lethal phenotype which could not be suppressed by supplementation with ergosterol or fatty acids. Other deletion mutants were viable under standard conditions. Strains with YBR177c, YMR313c, and YKL140w deleted exhibited phospholipid and/or neutral lipid patterns that were different from the wild-type strain and thus may be further candidate ORFs involved in yeast lipid metabolism. PMID:10515935

  10. Chimerism for 20q11.2 microdeletion of GDF5 explains discordant phenotypes in monochorionic-diamniotic twins.

    PubMed

    Meredith, Matthew M; Crabb, Beau; Vargas, Marcelo; Hirsch, Betsy A

    2017-12-01

    Microdeletions of 20q11.2 are rare but have been associated with characteristic clinical findings. A 1.6 Mb minimal critical region has been identified that includes three OMIM genes: GDF5, EPB41L1, and SAMHD. Here we describe a male monozygotic, monochorionic-diamniotic twin pair with discordant phenotypes, one with multiple findings that overlap with those reported in 20q11.2 deletions, and the other unaffected. Microarray analysis revealed mosaicism for a 363 Kb deletion encompassing GDF5 in the peripheral blood of both twins, which was confirmed by FISH. Subsequent FISH on buccal cells identified the deletion only in the affected twin. The blood FISH findings were interpreted as representing chimerism resulting from anastomosis and the blood exchange between the twins in utero. The implications of this finding are discussed, as is the contribution of GDF5 to the associated clinical findings of 20q11.2 deletions. © 2017 Wiley Periodicals, Inc.

  11. Familial co-segregation of Coffin-Lowry syndrome inherited from the mother and autosomal dominant Waardenburg type IV syndrome due to deletion of EDNRB inherited from the father.

    PubMed

    Loupe, Jacob; Sampath, Srirangan; Lacassie, Yves

    2014-10-01

    We report an African-American family that was identified after the proposita was referred for diagnostic evaluation at 4½ months with a history of Hirschsprung and dysmorphic features typical of Waardenburg syndrome (WS). Family evaluation revealed that the father had heterochromidia irides and hypertelorism supporting the clinical diagnosis of WS; however, examination of the mother revealed characteristic facial and digital features of Coffin-Lowry syndrome (CLS). Molecular testing of the mother identified a novel 2 bp deletion (c.865_866delCA) in codon 289 of RPS6KA3 leading to a frame-shift and premature termination of translation 5 codons downstream (NM_004586.2:p.Gln289ValfsX5). This deletion also was identified in the proposita and her three sisters with a clinical suspicion of CLS, all of whom as carriers for this X-linked disorder had very subtle manifestations. The molecular confirmation of WS type 4 (Shah-Waardenburg; WS4) was not as straightforward. To evaluate WS types 1-4, multiple sequential molecular tests were requested, including Sanger sequencing of all exons, and deletion/duplication analysis using MLPA for PAX3, MITF, SOX10, EDN3 and EDNRB. Although sequencing did not identify any disease causing variants, MLPA identified a heterozygous deletion of the entire EDNRB in the father. This deletion was also found in the proposita and the oldest child. Since the heterozygous deletion was the only change identified in EDNRB, this family represents one of the few cases of an autosomal dominant inheritance of WS4 involving the endothelin pathway. Altogether, clinical evaluation of the family revealed one child to be positive for WS4 and two positive for CLS, while two children were positive for both diseases simultaneously (including the proposita) while another pair test negative for either disease. This kinship is an example of the coincidence of two conditions co-segregating in one family, with variable phenotypes requiring molecular testing to confirm the clinical diagnoses. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  12. A resource for functional profiling of noncoding RNA in the yeast Saccharomyces cerevisiae.

    PubMed

    Parker, Steven; Fraczek, Marcin G; Wu, Jian; Shamsah, Sara; Manousaki, Alkisti; Dungrattanalert, Kobchai; de Almeida, Rogerio Alves; Estrada-Rivadeneyra, Diego; Omara, Walid; Delneri, Daniela; O'Keefe, Raymond T

    2017-08-01

    Eukaryotic genomes are extensively transcribed, generating many different RNAs with no known function. We have constructed 1502 molecular barcoded ncRNA gene deletion strains encompassing 443 ncRNAs in the yeast Saccharomyces cerevisiae as tools for ncRNA functional analysis. This resource includes deletions of small nuclear RNAs (snRNAs), transfer RNAs (tRNAs), small nucleolar RNAs (snoRNAs), and other annotated ncRNAs as well as the more recently identified stable unannotated transcripts (SUTs) and cryptic unstable transcripts (CUTs) whose functions are largely unknown. Specifically, deletions have been constructed for ncRNAs found in the intergenic regions, not overlapping genes or their promoters (i.e., at least 200 bp minimum distance from the closest gene start codon). The deletion strains carry molecular barcodes designed to be complementary with the protein gene deletion collection enabling parallel analysis experiments. These strains will be useful for the numerous genomic and molecular techniques that utilize deletion strains, including genome-wide phenotypic screens under different growth conditions, pooled chemogenomic screens with drugs or chemicals, synthetic genetic array analysis to uncover novel genetic interactions, and synthetic dosage lethality screens to analyze gene dosage. Overall, we created a valuable resource for the RNA community and for future ncRNA research. © 2017 Parker et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  13. Identification of MICA alleles with a long Leu-repeat in the transmembrane region and no cytoplasmic tail due to a frameshift-deletion in exon 4.

    PubMed

    Obuchi, N; Takahashi, M; Nouchi, T; Satoh, M; Arimura, T; Ueda, K; Akai, J; Ota, M; Naruse, T; Inoko, H; Numano, F; Kimura, A

    2001-06-01

    MHC class I chain-related gene A (MICA) is located close to HLA-B gene and expressed in epithelial cells. The MICA gene is reported to be highly polymorphic as are the classical class I genes. To further assess the polymorphism in the MICA gene, we analyzed a total of 60 HLA-homozygous cells for the sequences spanning exons 2-6. In the analysis, four new MICA alleles were identified and six variations were recognized in exon 6. MICA*017, which was identified in three HLA-B57 homozygous cells (DBB, DEM and WIN), differed from MICA*002 in exon 3 and had a guanine deletion at the 3' end of exon 4. MICA*015 identified in an HLA-B45 homozygous cell (OMW) also had the same deletion that causes a frameshift mutation resulting in complete change of the transmembrane region and premature termination in the cytoplasmic tail; these alleles have a long hydrophobic leucine-rich region instead of the alanine repeat in the transmembrane region and terminate at the second position in the cytoplasmic domain. The frameshift deletion was found only in HLA-B45- or -B57-positive panels tested, suggesting a strong linkage disequilibrium between the deletion and B45 or B57. MICA*048, which was different in exon 5 from MICA*008, was identified in an HLA-B61 homozygous cell (TA21), while MICA*00901 identified in HLA-B51 homozygous cells (LUY and KT2) was distinguished from MICA*009 by exon 6.

  14. Comparison of Ion Personal Genome Machine Platforms for the Detection of Variants in BRCA1 and BRCA2.

    PubMed

    Hwang, Sang Mee; Lee, Ki Chan; Lee, Min Seob; Park, Kyoung Un

    2018-01-01

    Transition to next generation sequencing (NGS) for BRCA1 / BRCA2 analysis in clinical laboratories is ongoing but different platforms and/or data analysis pipelines give different results resulting in difficulties in implementation. We have evaluated the Ion Personal Genome Machine (PGM) Platforms (Ion PGM, Ion PGM Dx, Thermo Fisher Scientific) for the analysis of BRCA1 /2. The results of Ion PGM with OTG-snpcaller, a pipeline based on Torrent mapping alignment program and Genome Analysis Toolkit, from 75 clinical samples and 14 reference DNA samples were compared with Sanger sequencing for BRCA1 / BRCA2 . Ten clinical samples and 14 reference DNA samples were additionally sequenced by Ion PGM Dx with Torrent Suite. Fifty types of variants including 18 pathogenic or variants of unknown significance were identified from 75 clinical samples and known variants of the reference samples were confirmed by Sanger sequencing and/or NGS. One false-negative results were present for Ion PGM/OTG-snpcaller for an indel variant misidentified as a single nucleotide variant. However, eight discordant results were present for Ion PGM Dx/Torrent Suite with both false-positive and -negative results. A 40-bp deletion, a 4-bp deletion and a 1-bp deletion variant was not called and a false-positive deletion was identified. Four other variants were misidentified as another variant. Ion PGM/OTG-snpcaller showed acceptable performance with good concordance with Sanger sequencing. However, Ion PGM Dx/Torrent Suite showed many discrepant results not suitable for use in a clinical laboratory, requiring further optimization of the data analysis for calling variants.

  15. Small supernumerary marker chromosome derived from proximal p-arm of chromosome 2: identification by fluorescent in situ hybridization.

    PubMed

    Lasan Trcić, Ruzica; Hitrec, Vlasta; Letica, Ljiljana; Cuk, Mario; Begović, Davor

    2003-08-01

    Conventional cytogenetics detected an interstitial deletion of proximal region of p-arm of chromosome 2 in a 6-month-old boy with a phenotype slightly resembling Down's syndrome. The deletion was inherited from the father, whose karyotype revealed a small ring-shaped marker chromosome, in addition to interstitial deletion. Fluorescence in situ hybridization identified the marker, which consisted of the proximal region of the p-arm of chromosome 2, including a part of its centromere. This case shows that molecular cytogenetic analysis can reveal the mechanism of the formation of the marker chromosome.

  16. Partial USH2A deletions contribute to Usher syndrome in Denmark.

    PubMed

    Dad, Shzeena; Rendtorff, Nanna D; Kann, Erik; Albrechtsen, Anders; Mehrjouy, Mana M; Bak, Mads; Tommerup, Niels; Tranebjærg, Lisbeth; Rosenberg, Thomas; Jensen, Hanne; Møller, Lisbeth B

    2015-12-01

    Usher syndrome is an autosomal recessive disorder characterized by congenital hearing impairment, progressive visual loss owing to retinitis pigmentosa and in some cases vestibular dysfunction. Usher syndrome is divided into three subtypes, USH1, USH2 and USH3. Twelve loci and eleven genes have so far been identified. Duplications and deletions in PCDH15 and USH2A that lead to USH1 and USH2, respectively, have previously been identified in patients from United Kingdom, Spain and Italy. In this study, we investigate the proportion of exon deletions and duplications in PCDH15 and USH2A in 20 USH1 and 30 USH2 patients from Denmark using multiplex ligation-dependent probe amplification (MLPA). Two heterozygous deletions were identified in USH2A, but no deletions or duplications were identified in PCDH15. Next-generation mate-pair sequencing was used to identify the exact breakpoints of the two deletions identified in USH2A. Our results suggest that USH2 is caused by USH2A exon deletions in a small fraction of the patients, whereas deletions or duplications in PCDH15 might be rare in Danish Usher patients.

  17. Fluorescence in situ hybridization for the diagnosis of NPHP1 deletion-related nephronophthisis on renal biopsy.

    PubMed

    Larsen, Christopher P; Bonsib, Stephen M; Beggs, Marjorie L; Wilson, Jon D

    2018-06-24

    Nephronophthisis is an autosomal recessive tubulointerstitial nephropathy that is a leading genetic etiology of end stage renal disease in children and young adults. Approximately 60% of patients with a known genetic etiology of nephronophthisis are due to homozygous deletion of the NPHP1 gene. We identified a total of 45 renal biopsies from young patients with chronic kidney disease of undetermined etiology and analyzed them for the possibility of nephronophthisis due to NPHP1 deletion using interphase fluorescence in situ hybridization and/or polymerase chain reaction. Homozygous NPHP1 deletion was identified in nine patients (20%). In cases with adequate tissue, both assays were performed and showed 100% agreement. Blinded histopathologic analysis was then performed and identified six lesions that were significantly more common in biopsies from patients with NPHP1 deletion-proven nephronophthisis than chronic kidney injury of other known etiologies. Many of the classically described nephronophthisis biopsy lesions such as tubular basement membrane duplication, presence of cysts, and mononuclear interstitial inflammation were not significantly associated with this disease when compared with biopsies from patients with chronic kidney injury due to other etiologies. There were, however, morphologic lesions that were strongly associated with NPHP1 deletion including tubular abnormalities such as diverticulum, florets, and macula densa-like change as well as interstitial Tamm-Horsfall aggregates, periglomerular fibrosis, and the absence of arteriosclerosis. Awareness of the histopathologic pattern of injury in nephronophthisis combined with testing for NPHP1 deletion enables renal pathologists to provide a definitive pathologic and genetic diagnosis in a subset of patients with this disease. Copyright © 2018. Published by Elsevier Inc.

  18. Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

    PubMed

    Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

    2013-06-01

    Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

  19. mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans.

    PubMed Central

    Soodyall, H.; Vigilant, L.; Hill, A. V.; Stoneking, M.; Jenkins, T.

    1996-01-01

    The intergenic COII/tRNA(Lys) 9-bp deletion in human mtDNA, which is found at varying frequencies in Asia, Southeast Asia, Polynesia, and the New World, was also found in 81 of 919 sub-Saharan Africans. Using mtDNA control-region sequence data from a subset of 41 individuals with the deletion, we identified 22 unique mtDNA types associated with the deletion in Africa. A comparison of the unique mtDNA types from sub-Saharan Africans and Asians with the 9-bp deletion revealed that sub-Saharan Africans and Asians have sequence profiles that differ in the locations and frequencies of variant sites. Both phylogenetic and mismatch-distribution analysis suggest that 9-bp deletion arose independently in sub-Saharan Africa and Asia and that the deletion has arisen more than once in Africa. Within Africa, the deletion was not found among Khoisan peoples and was rare to absent in western and southwestern African populations, but it did occur in Pygmy and Negroid populations from central Africa and in Malawi and southern African Bantu-speakers. The distribution of the 9-bp deletion in Africa suggests that the deletion could have arisen in central Africa and was then introduced to southern Africa via the recent "Bantu expansion." PMID:8644719

  20. Homozygous diploid deletion strains of Saccharomyces cerevisiae that determine lag phase and dehydration tolerance.

    PubMed

    D'Elia, Riccardo; Allen, Patricia L; Johanson, Kelly; Nickerson, Cheryl A; Hammond, Timothy G

    2005-06-01

    This study identifies genes that determine length of lag phase, using the model eukaryotic organism, Saccharomyces cerevisiae. We report growth of a yeast deletion series following variations in the lag phase induced by variable storage times after drying-down yeast on filters. Using a homozygous diploid deletion pool, lag times ranging from 0 h to 90 h were associated with increased drop-out of mitochondrial genes and increased survival of nuclear genes. Simple linear regression (R2 analysis) shows that there are over 500 genes for which > 70% of the variation can be explained by lag alone. In the genes with a positive correlation, such that the gene abundance increases with lag and hence the deletion strain is suitable for survival during prolonged storage, there is a strong predominance of nucleonic genes. In the genes with a negative correlation, such that the gene abundance decreases with lag and hence the strain may be critical for getting yeast out of the lag phase, there is a strong predominance of glycoproteins and transmembrane proteins. This study identifies yeast deletion strains with survival advantage on prolonged storage and amplifies our understanding of the genes critical for getting out of the lag phase.

  1. Homozygous diploid deletion strains of Saccharomyces cerevisiae that determine lag phase and dehydration tolerance

    NASA Technical Reports Server (NTRS)

    D'Elia, Riccardo; Allen, Patricia L.; Johanson, Kelly; Nickerson, Cheryl A.; Hammond, Timothy G.

    2005-01-01

    This study identifies genes that determine length of lag phase, using the model eukaryotic organism, Saccharomyces cerevisiae. We report growth of a yeast deletion series following variations in the lag phase induced by variable storage times after drying-down yeast on filters. Using a homozygous diploid deletion pool, lag times ranging from 0 h to 90 h were associated with increased drop-out of mitochondrial genes and increased survival of nuclear genes. Simple linear regression (R2 analysis) shows that there are over 500 genes for which > 70% of the variation can be explained by lag alone. In the genes with a positive correlation, such that the gene abundance increases with lag and hence the deletion strain is suitable for survival during prolonged storage, there is a strong predominance of nucleonic genes. In the genes with a negative correlation, such that the gene abundance decreases with lag and hence the strain may be critical for getting yeast out of the lag phase, there is a strong predominance of glycoproteins and transmembrane proteins. This study identifies yeast deletion strains with survival advantage on prolonged storage and amplifies our understanding of the genes critical for getting out of the lag phase.

  2. A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

    PubMed

    Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

    2015-01-01

    Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

  3. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa.

    PubMed

    García-García, Gema; Aller, Elena; Jaijo, Teresa; Aparisi, Maria J; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M

    2014-01-01

    The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures.

  4. APC promoter 1B deletion in seven American families with familial adenomatous polyposis.

    PubMed

    Snow, A K; Tuohy, T M F; Sargent, N R; Smith, L J; Burt, R W; Neklason, D W

    2015-10-01

    Familial adenomatous polyposis (FAP) is a colorectal cancer predisposition syndrome caused by mutations in the adenomatous polyposis coli (APC) gene. Clinical genetic testing fails to identify disease causing mutations in up to 20% of clinically apparent FAP cases. Following the inclusion of multiplex ligation-dependent probe amplification (MLPA) probes specific for APC promoter 1B, seven probands were identified with a deletion of promoter 1B. Using haplotype analysis spanning the APC locus, the seven families appear to be identical by descent from a common founder. The clinical phenotype of 19 mutation carriers is classical FAP with colectomy at an average age of 24. The majority of cases had a large number of duodenal and gastric polyps. Measurements of allele-specific expression of APC mRNA using TaqMan assay confirmed that relative expression in the allele containing the promoter 1B deletion was reduced 42-98%, depending on tissue type. This study confirms the importance of APC promoter deletions as a cause of FAP and identifies a founder mutation in FAP patients from the United States. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. The relationship between BIM deletion polymorphism and clinical significance of epidermal growth factor receptor-mutated non-small cell lung cancer patients with epidermal growth factor receptor-tyrosine kinase inhibitor therapy: a meta-analysis.

    PubMed

    Zou, Qian; Zhan, Ping; Lv, Tangfeng; Song, Yong

    2015-12-01

    BIM deletion polymorphism is a germline that might lead to little or no BH3 expression, which affects epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) related apoptosis. Recent studies show that BIM deletion polymorphism might be a critical factor leading to the resistance of EGFR-TKIs in EGFR mutation-positive non-small cell lung cancer (NSCLC) patients. Thus, a meta-analysis was conducted by combing seven original eligible studies including 778 NSCLC patients to investigate a steady and reliable conclusion. Our study indicated that BIM deletion polymorphism was significantly associated with the poor objective response rate (ORR) of EGFR-TKIs in EGFR-mutated NSCLC patients [odds ratios (OR) =0.55, 95% confidence interval (CI), 0.33-0.92]. And disease control rate (DCR) in EGFR-mutate NSCLC patients treated with EGFR-TKIs was significantly decreased in patients with BIM deletion polymorphism (OR=0.55, 95% CI, 0.27-1.12). Moreover, the progression-free survival (PFS) of patients with BIM deletion polymorphism is shorter. These findings suggested that BIM deletion polymorphism might be a genetic cause of intrinsic resistance to TKI therapy and it could be emerged as an independent predictor to identify patients who would benefit from TKI targeted therapy in EGFR-mutated NSCLC.

  6. Strong correlation of elastin deletions, detected by FISH, with Williams syndrome: Evaluation of 235 patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lowery, M.C.; Brothman, L.J.; Leonard, C.O.

    1995-07-01

    Williams syndrome (WS) is generally characterized by mental deficiency, gregarious personality, dysmorphic facies, supravalvular aortic stenosis, and idiopathic infantile hypercalcemia. Patients with WS show allelic loss of elastin (ELN), exhibiting a submicroscopic deletion, at 7q11.23, detectable by FISH. Hemizygosity is likely the cause of vascular abnormalities in WS patients. A series of 235 patients was studied, and molecular cytogenetic deletions were seen in 96% of patients with classic WS. Patients included 195 solicited through the Williams Syndrome Association (WSA), plus 40 clinical cytogenetics cases referred by primary-care physicians. Photographs and medical records of most WSA subjects were reviewed, and patientsmore » were identified as {open_quotes}classic{open_quotes} (n = 114) or{open_quotes}uncertain{close_quotes} (n = 39). An additional 42 WSA patients were evaluated without clinical information. FISH was performed with biotinylated ELN cosmids on metaphase cells from immortalized lymphoblastoid lines from WSA patients and after high-resolution banding analysis on clinical referral patients. An alpha-satellite probe for chromosome 7 was included in hybridizations, as an internal control. Ninety-six percent of the patients with classic WS showed a deletion in one ELN allele; four of these did not show a deletion. Of the uncertain WS patients, only 3 of 39 showed a deletion. Of the 42 who were not classified phenotypically, because of lack of clinical information, 25 patients (60%) showed a deletion. Thirty-eight percent (15/40) of clinical cytogenetics cases showed an ELN deletion and no cytogenetic deletion by banded analysis. These results support the usefulness of FISH for the detection of elastin deletions as an initial diagnostic assay for WS. 14 refs., 2 figs., 4 tabs.« less

  7. Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions.

    PubMed

    Ferraris, Alessandro; Bernardini, Laura; Sabolic Avramovska, Vesna; Zanni, Ginevra; Loddo, Sara; Sukarova-Angelovska, Elena; Parisi, Valentina; Capalbo, Anna; Tumini, Stefano; Travaglini, Lorena; Mancini, Francesca; Duma, Filip; Barresi, Sabina; Novelli, Antonio; Mercuri, Eugenio; Tarani, Luigi; Bertini, Enrico; Dallapiccola, Bruno; Valente, Enza Maria

    2013-05-16

    The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS.

  8. Dandy-Walker malformation and Wisconsin syndrome: novel cases add further insight into the genotype-phenotype correlations of 3q23q25 deletions

    PubMed Central

    2013-01-01

    Background The Dandy-Walker malformation (DWM) is one of the commonest congenital cerebellar defects, and can be associated with multiple congenital anomalies and chromosomal syndromes. The occurrence of overlapping 3q deletions including the ZIC1 and ZIC4 genes in few patients, along with data from mouse models, have implicated both genes in the pathogenesis of DWM. Methods and results Using a SNP-array approach, we recently identified three novel patients carrying heterozygous 3q deletions encompassing ZIC1 and ZIC4. Magnetic resonance imaging showed that only two had a typical DWM, while the third did not present any defect of the DWM spectrum. SNP-array analysis in further eleven children diagnosed with DWM failed to identify deletions of ZIC1-ZIC4. The clinical phenotype of the three 3q deleted patients included multiple congenital anomalies and peculiar facial appearance, related to the localization and extension of each deletion. In particular, phenotypes resulted from the variable combination of three recognizable patterns: DWM (with incomplete penetrance); blepharophimosis, ptosis, and epicanthus inversus syndrome; and Wisconsin syndrome (WS), recently mapped to 3q. Conclusions Our data indicate that the 3q deletion is a rare defect associated with DWM, and suggest that the hemizygosity of ZIC1-ZIC4 genes is neither necessary nor sufficient per se to cause this condition. Furthermore, based on a detailed comparison of clinical features and molecular data from 3q deleted patients, we propose clinical diagnostic criteria and refine the critical region for WS. PMID:23679990

  9. A proteomic analysis of ferulic acid metabolism in Amycolatopsis sp. ATCC 39116.

    PubMed

    Meyer, Florian; Netzer, Julius; Meinert, Christina; Voigt, Birgit; Riedel, Katharina; Steinbüchel, Alexander

    2018-05-16

    The pseudonocardiate Amycolatopsis sp. ATCC 39116 is used for the biotechnical production of natural vanillin from ferulic acid. Our laboratory has performed genetic modifications of this strain previously, but there are still many gaps in our knowledge regarding its vanillin tolerance and the general metabolism. We performed cultivations with this bacterium and compared the proteomes of stationary phase cells before ferulic acid feeding with those during ferulic acid feeding. Thereby, we identified 143 differently expressed proteins. Deletion mutants were constructed and characterized to analyze the function of nine corresponding genes. Using these mutants, we identified an active ferulic acid β-oxidation pathway and the enzymes which constitute this pathway. A combined deletion mutant in which the β-oxidation as well as non-β-oxidation pathways of ferulic acid degradation were deleted was unable to grow on ferulic acid as the sole source of carbon and energy. This mutant differs from the single deletion mutants and was unable to grow on ferulic acid. Furthermore, we showed that the non-β-oxidation pathway is involved in caffeic acid degradation; however, its deletion is complemented even in the double deletion mutant. This shows that both pathways can complement each other. The β-oxidation deletion mutant produced significantly reduced amounts of vanillic acid (0.12 instead of 0.35 g/l). Therefore, the resulting mutant could be used as an improved production strain. The quinone oxidoreductase deletion mutant (ΔytfG) degraded ferulic acid slower at first but produced comparable amounts of vanillin and significantly less vanillyl alcohol when compared to the parent strain.

  10. Meta-analysis confirms the LCE3C_LCE3B deletion as a risk factor for psoriasis in several ethnic groups and finds interaction with HLA-Cw6

    PubMed Central

    Riveira-Munoz, Eva; He, Su-Min; Escaramís, Georgia; Stuart, Philip E; Hüffmeier, Ulrike; Lee, Catherine; Kirby, Brian; Oka, Akira; Giardina, Emiliano; Liao, Wilson; Bergboer, Judith; Kainu, Kati; de Cid, Rafael; Munkhbat, Batmunkh; Zeeuwen, Patrick L J M; Armour, John A L; Poon, Annie; Mabuchi, Tomotaka; Ozawa, Akira; Zawirska, Agnieszka; Burden, David A; Barker, Jonathan N; Capon, Francesca; Traupe, Heiko; Sun, Liang-Dan; Cui, Yong; Yin, Xian-Yong; Chen, Gang; Lim, Henry; Nair, Rajan; Voorhess, John; Tejasvi, Trilokraj; Pujol, Ramón; Munkhtuvshin, Namid; Fischer, Judith; Kere, Juha; Schalkwijk, Joost; Bowcock, Anne; Kwok, Pui-Yan; Novelli, Giuseppe; Inoko, Hidetoshi; Ryan, Anthony W; Trembath, Richard C; Reis, André; Zhang, Xue-Jun; Elder, James T; Estivill, Xavier

    2012-01-01

    A multicenter meta-analysis including data from 9389 psoriasis patients and 9477 control subjects was performed to investigate the contribution of the deletion of genes LCE3C and LCE3B, involved in skin barrier defense, to psoriasis susceptibility in different populations. The study confirms that the deletion of LCE3C and LCE3B is a common genetic factor for susceptibility to psoriasis in European populations [OROverall = 1.21 (1.15–1.27)], and for the first time directly demonstrated the deletion's association with psoriasis in [Chinese OR = 1.27 (1.16–1.34); Mongolian OR = 2.08 (1.44–2.99)] populations. The analysis of the HLA-Cw6 locus showed significant differences in the epistatic interaction with the LCE3C and LCE3B deletion in at least some European populations, indicating epistatic effects between these two major genetic contributors to psoriasis. The study highlights the value of examining genetic risk factors in multiple populations to identify genetic interactions, and indicates the need of further studies to understand the interaction of the skin barrier and the immune system in susceptibility to psoriasis. PMID:21107349

  11. The Bim deletion polymorphism clinical profile and its relation with tyrosine kinase inhibitor resistance in Chinese patients with non-small cell lung cancer.

    PubMed

    Zhao, Mingchuan; Zhang, Yishi; Cai, Weijing; Li, Jiayu; Zhou, Fei; Cheng, Ningning; Ren, Ruixin; Zhao, Chao; Li, Xuefei; Ren, Shengxiang; Zhou, Caicun; Hirsch, Fred R

    2014-08-01

    Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) are widely used for the treatment of patients with advanced non-small cell lung cancer (NSCLC) who have EGFR mutations. Recent studies have indicated that some patients with positive mutations were refractory to EGFR TKIs if they harbored a B-cell chronic lymphocytic leukemia/lymphoma (Bcl-2)-like 11 (Bim) deletion polymorphism. The objective of the current work was to retrospectively study the Bim deletion polymorphism in Chinese patients with NSCLC and its correlation with the efficacy of EGFR TKIs. Distribution of the Bim polymorphism was detected using polymerase chain reaction analysis and direct sequencing of DNA from peripheral neutrophils in samples from 352 patients with NSCLC. Of the 352 patients, 166 who received TKI therapy and had an activating mutation identified were involved in further analysis. Progression-free survival (PFS) was the primary endpoint of the subsequent analyses, and the incidence of the Bim polymorphism and its relation to clinical benefit from EGFR TKIs also were investigated. In total, 45 of 352 patient samples (12.8%) had the Bim deletion polymorphism, which was distributed randomly with regard to various clinical characteristics. In patients with EGFR mutations who received treatment with TKIs, the median PFS and the median objective response rate were 4.7 months and 25%, respectively, for those with the Bim deletion polymorphism versus 11 months (P = .003) and 66% (P = .001), respectively, for those with wild-type Bim. Cox regression analysis identified Bim status (P = .016) and sex (P = .002) as independent factors predicting clinical benefit from EGFR TKIs in patients with EGFR-mutated NSCLC. The incidence of the Bim deletion polymorphism was approximately 13% in this study, and it was associated with a poor clinical response to EGFR TKIs in patients who had NSCLC with EGFR mutations. © 2014 American Cancer Society.

  12. Alk2/ACVR1 and Alk3/BMPR1A Provide Essential Function for Bone Morphogenetic Protein-Induced Retinal Angiogenesis.

    PubMed

    Lee, Heon-Woo; Chong, Diana C; Ola, Roxana; Dunworth, William P; Meadows, Stryder; Ka, Jun; Kaartinen, Vesa M; Qyang, Yibing; Cleaver, Ondine; Bautch, Victoria L; Eichmann, Anne; Jin, Suk-Won

    2017-04-01

    Increasing evidence suggests that bone morphogenetic protein (BMP) signaling regulates angiogenesis. Here, we aimed to define the function of BMP receptors in regulating early postnatal angiogenesis by analysis of inducible, endothelial-specific deletion of the BMP receptor components Bmpr2 (BMP type 2 receptor), Alk1 (activin receptor-like kinase 1), Alk2 , and Alk3 in mouse retinal vessels. Expression analysis of several BMP ligands showed that proangiogenic BMP ligands are highly expressed in postnatal retinas. Consistently, BMP receptors are also strongly expressed in retina with a distinct pattern. To assess the function of BMP signaling in retinal angiogenesis, we first generated mice carrying an endothelial-specific inducible deletion of Bmpr2 . Postnatal deletion of Bmpr2 in endothelial cells substantially decreased the number of angiogenic sprouts at the vascular front and branch points behind the front, leading to attenuated radial expansion. To identify critical BMPR1s (BMP type 1 receptors) associated with BMPR2 in retinal angiogenesis, we generated endothelial-specific inducible deletion of 3 BMPR1s abundantly expressed in endothelial cells and analyzed the respective phenotypes. Among these, endothelial-specific deletion of either Alk2 / acvr1 or Alk3 / Bmpr1a caused a delay in radial expansion, reminiscent of vascular defects associated with postnatal endothelial-specific deletion of BMPR2, suggesting that ALK2/ACVR1 and ALK3/BMPR1A are likely to be the critical BMPR1s necessary for proangiogenic BMP signaling in retinal vessels. Our data identify BMP signaling mediated by coordination of ALK2/ACVR1, ALK3/BMPR1A, and BMPR2 as an essential proangiogenic cue for retinal vessels. © 2017 The Authors.

  13. Alk2/ACVR1 and Alk3/BMPR1A Provide Essential Function for Bone Morphogenetic Protein Induced Retinal Angiogenesis

    PubMed Central

    Lee, Heon-Woo; Chong, Diana C.; Ola, Roxana; Dunworth, William P.; Meadows, Stryder; Ka, Jun; Kaartinen, Vesa M.; Qyang, Yibing; Cleaver, Ondine; Bautch, Victoria L.; Eichmann, Anne; Jin, Suk-Won

    2017-01-01

    Objective Increasing evidence suggests that Bone Morphogenetic Protein (BMP) signaling regulates angiogenesis. Here, we aimed to define the function of BMP receptors in regulating early post-natal angiogenesis by analysis of inducible, endothelial specific deletion of the BMP receptor components Bmpr2, Alk1, Alk2 and Alk3 in mouse retinal vessels. Approach and Results Expression analysis of several BMP ligands showed that pro-angiogenic BMP ligands are highly expressed in postnatal retinas. Consistently, BMP receptors are also strongly expressed in retina with a distinct pattern. To assess the function of BMP signaling in retinal angiogenesis, we first generated mice carrying an endothelial-specific inducible deletion of BMP Type 2 receptor (Bmpr2). Postnatal deletion of Bmpr2 in endothelial cells substantially decreased the number of angiogenic sprouts at the vascular front and branchpoints behind the front, leading to attenuated radial expansion. To identify critical BMPR1s associated with BMPR2 in retinal angiogenesis, we generated endothelial-specific inducible deletion of three BMPR1s abundantly expressed in endothelial cells and analyzed the respective phenotypes. Among these, endothelial specific deletion of either Alk2/acvr1 or Alk3/Bmpr1a caused a delay in radial expansion, reminiscent of vascular defects associated with postnatal endothelial specific deletion of BMPR2, suggesting that ALK2/ACVR1 and ALK3/BMPR1A are likely to be the critical BMPR1s necessary for pro-angiogenic BMP signaling in retinal vessels. Conclusions Our data identify BMP signaling mediated by coordination of ALK2/ACVR1, ALK3/BMPR1A, and BMPR2 as an essential pro-angiogenic cue for retinal vessels. PMID:28232325

  14. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature.

    PubMed

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Angel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ~60% of Léri-Weill dyschondrosteosis (LWD) and ~5-15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ~286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS.

  15. Identification of the first PAR1 deletion encompassing upstream SHOX enhancers in a family with idiopathic short stature

    PubMed Central

    Benito-Sanz, Sara; Aza-Carmona, Miriam; Rodríguez-Estevez, Amaya; Rica-Etxebarria, Ixaso; Gracia, Ricardo; Campos-Barros, Ángel; Heath, Karen E

    2012-01-01

    Short stature homeobox-containing gene, MIM 312865 (SHOX) is located within the pseudoautosomal region 1 (PAR1) of the sex chromosomes. Mutations in SHOX or its downstream transcriptional regulatory elements represent the underlying molecular defect in ∼60% of Léri-Weill dyschondrosteosis (LWD) and ∼5–15% of idiopathic short stature (ISS) patients. Recently, three novel enhancer elements have been identified upstream of SHOX but to date, no PAR1 deletions upstream of SHOX have been observed that only encompass these enhancers in LWD or ISS patients. We set out to search for genetic alterations of the upstream SHOX regulatory elements in 63 LWD and 100 ISS patients with no known alteration in SHOX or the downstream enhancer regions using a specifically designed MLPA assay, which covers the PAR1 upstream of SHOX. An upstream SHOX deletion was identified in an ISS proband and her affected father. The deletion was confirmed and delimited by array-CGH, to extend ∼286 kb. The deletion included two of the upstream SHOX enhancers without affecting SHOX. The 13.3-year-old proband had proportionate short stature with normal GH and IGF-I levels. In conclusion, we have identified the first PAR1 deletion encompassing only the upstream SHOX transcription regulatory elements in a family with ISS. The loss of these elements may result in SHOX haploinsufficiency because of decreased SHOX transcription. Therefore, this upstream region should be included in the routine analysis of PAR1 in patients with LWD, LMD and ISS. PMID:22071895

  16. Genomic interval engineering of mice identified a novel modulator of triglyceride production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Y.; Jong, M.C.; Frazer, K.A.

    1999-10-01

    To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

  17. Novel SNP array analysis and exome sequencing detect a homozygous exon 7 deletion of MEGF10 causing early onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD)

    PubMed Central

    Pierson, Tyler Mark; Markello, Thomas; Accardi, John; Wolfe, Lynne; Adams, David; Sincan, Murat; Tarazi, Noor M.; Fajardo, Karin Fuentes; Cherukuri, Praveen F.; Bajraktari, Ilda; Meilleur, Katy G.; Donkervoort, Sandra; Jain, Mina; Hu, Ying; Lehky, Tanya J.; Cruz, Pedro; Mullikin, James C.; Bonnemann, Carsten; Gahl, William A.; Boerkoel, Cornelius F.; Tifft, Cynthia J.

    2013-01-01

    Early-onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD) is a myopathic disorder associated with mutations in MEGF10. By novel analysis of SNP array hybridization and exome sequence coverage, we diagnosed a 10-year old girl with EMARDD following identification of a novel homozygous deletion of exon 7 in MEGF10. In contrast to previously reported EMARDD patients, her weakness was more prominent proximally than distally, and involved her legs more than her arms. MRI of her pelvis and thighs showed muscle atrophy and fatty replacement. Ultrasound of several muscle groups revealed dense homogenous increases in echogenicity. Cloning and sequencing of the deletion breakpoint identified features suggesting the mutation arose by fork stalling and template switching. These findings constitute the first genomic deletion causing EMARDD, expand the clinical phenotype, and provide new insight into the pattern and histology of its muscular pathology. PMID:23453856

  18. Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis

    PubMed Central

    Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

    2008-01-01

    Background Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, ~4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. Results As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. Conclusion We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s). PMID:19055778

  19. Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis.

    PubMed

    Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

    2008-12-03

    Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, approximately 4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s).

  20. 44 CFR 5.27 - Deletion of identifying details.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Deletion of identifying details. 5.27 Section 5.27 Emergency Management and Assistance FEDERAL EMERGENCY MANAGEMENT AGENCY..., FEMA may delete identifying details when making available or publishing an opinion, statement of policy...

  1. Absence of Genomic Ikaros/IKZF1 Deletions in Pediatric B-Precursor Acute Lymphoblastic Leukemia

    PubMed Central

    Qazi, Sanjive; Ma, Hong; Uckun, Fatih M

    2013-01-01

    Here we report the results of gene expression analyses using multiple probesets aimed at determining the incidence of Ikaros/IKZF1 deletions in pediatric B-precursor acute lymphoblastic leukemia (BPL). Primary leukemia cells from 122 Philadelphia chromosome (Ph)+ BPL patients and 237 Ph− BPL patients as well as normal hematopoietic cells from 74 normal non-leukemic bone marrow specimens were organized according to expression levels of IKZF1 transcripts utilizing two-way hierarchical clustering technique to identify specimens with low IKZF1 expression for the 10 probesets interrogating Exons 1 through 4 and Exon 8. Our analysis demonstrated no changes in expression that would be expected from homozygous or heterozygous deletions of IKZF1 in primary leukemic cells. Similar results were obtained in gene expression analysis of primary leukemic cells from 20 Ph+ positive and 155 Ph− BPL patients in a validation dataset. Taken together, our gene expression analyses in 534 pediatric BPL cases, including 142 cases with Ph+ BPL, contradict previous reports that were based on SNP array data and suggested that Ph+ pediatric BPL is characterized by a high frequency of homozygous or heterozygous IKZF1 deletions. Further, exon-specific genomic PCR analysis of primary leukemia cells from 21 high-risk pediatric BPL patients and 11 standard-risk pediatric BPL patients, and 8 patients with infant BPL did not show any evidence for homozygous IKZF1 locus deletions. Nor was there any evidence for homozygous or heterozygous intragenic IKZF1 deletions. PMID:24478816

  2. A systematic review and meta-analysis of individual patient data on the impact of the BIM deletion polymorphism on treatment outcomes in epidermal growth factor receptor mutant lung cancer.

    PubMed

    Soh, Sheila X; Siddiqui, Fahad J; Allen, John C; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J; Tan, Daniel S; Tan, Eng-Huat; Ong, S Tiong; Lim, Wan-Teck

    2017-06-20

    A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06-2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251-2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603-4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063-1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised.

  3. Identification of deletions in children with congenital hypothyroidism and thyroid dysgenesis with the use of multiplex ligation-dependent probe amplification.

    PubMed

    Kumorowicz-Czoch, Malgorzata; Madetko-Talowska, Anna; Tylek-Lemanska, Dorota; Pietrzyk, Jacek J; Starzyk, Jerzy

    2015-01-01

    Thyroid dysgenesis (TD) is the most common cause of congenital hypothyroidism (CH). Important genetic factors possibly contributing to TD etiologies include mutations of thyroid transcription factors and TSHR-encoding genes. Our objective was to determine multiplex ligation-dependent probe amplification (MLPA) utility in detecting the copy number changes in patients with CH and TD. The study included 45 children from southeastern Poland selected via already established neonatal screening for CH. Genomic DNA was extracted from peripheral blood samples and used in MLPA analysis. Genetic variations were analyzed within selected fragments of the PAX8, FOXE1, NKX2-1, thyroid stimulating hormone receptor (TSHR), and TPO genes. Three heterozygous deletion types in probe hybridization regions were identified for the following genes: PAX8 (exon 7), TSHR (exon 2), and FOXE1 (exon 1). Monoallelic deletions were identified in 5/45 TD subjects. MLPA is a useful tool for copy number changes detection and might both improve and expand genetic analysis for CH and TD.

  4. A novel deletion of SNURF/SNRPN exon 1 in a patient with Prader-Willi-like phenotype.

    PubMed

    Cao, Yang; AlHumaidi, Susan S; Faqeih, Eissa A; Pitel, Beth A; Lundquist, Patrick; Aypar, Umut

    2017-08-01

    Here we report the smallest deletion involving SNURF/SNRPN that causes major symptoms of Prader-Willi syndrome (PWS), including hypotonia, dysmorphic features, intellectual disability, and obesity. A female patient with the aforementioned and additional features was referred to the Mayo Clinic Cytogenetics laboratory for genetic testing. Chromosomal microarray analysis and subsequent Sanger sequencing identified a de novo 6.4 kb deletion at 15q11.2, containing exon 1 of the SNURF gene and exon 1 of the shortest isoform of the SNRPN gene. SNURF/SNRPN exon 1, which is methylated on the silent maternal allele, is associated with acetylated histones on the expressed paternal allele. This region also overlaps with the PWS-imprinting center (IC). Subsequent molecular methylation analysis was performed using methylation-specific MLPA (MS-MLPA), which characterized that the deletion of SNURF/SNRPN exon 1 was paternal in origin, consistent with the PWS-like phenotype. Since SNURF/SNRPN gene and the PWS-IC are known to regulate snoRNAs, it is likely that the PWS-like phenotype observed in patients with paternal SNURF/SNRPN deletion is due to the disrupted expression of SNORD116 snoRNAs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. Isolation of Persicaria minor sesquiterpene synthase promoter and its deletions for transgenic Arabidopsis thaliana

    NASA Astrophysics Data System (ADS)

    Omar, Aimi Farehah; Ismail, Ismanizan

    2016-11-01

    Sesquiterpene synthase (SS) catalyzes the formation of sesquiterpenes from farnesyl diphosphate (FDP) via carbocation intermediates. In this study, the promoter region of sesquiterpene synthase was isolated from Persicaria minor to identify possible cis-acting elements in the promoter. The full-length PmSS promoter of P. minor is 1824-bp sequences. The sequence was analyzed and several putative cis-acting regulatory elements were identified. Three cis-acting regulatory elements were selected for deletion analysis which are cis-acting element involved in wound responsiveness (WUN), cis - acting element involved in defense and stress responsiveness (TC) and cis-acting element involved in ABA responsiveness (ABRE). Series of deletions were conducted to assess the promoter activity producing three truncated fragments promoter; Prom 2 1606-bp, Prom 3 1144- bp, and Prom 4 921-bp. The full-length promoter and its deletion series were cloned into the pBGWFS7 vector which contain β-glucuronidase (GUS) gene and green fluorescent protein (GFP) as the reporter gene. All constructs were successfully transformed into Arabidopsis thaliana based on PCR of positive BASTA resistance plants.

  6. Whole Wiskott‑Aldrich syndrome protein gene deletion identified by high throughput sequencing.

    PubMed

    He, Xiangling; Zou, Runying; Zhang, Bing; You, Yalan; Yang, Yang; Tian, Xin

    2017-11-01

    Wiskott‑Aldrich syndrome (WAS) is a rare X‑linked recessive immunodeficiency disorder, characterized by thrombocytopenia, small platelets, eczema and recurrent infections associated with increased risk of autoimmunity and malignancy disorders. Mutations in the WAS protein (WASP) gene are responsible for WAS. To date, WASP mutations, including missense/nonsense, splicing, small deletions, small insertions, gross deletions, and gross insertions have been identified in patients with WAS. In addition, WASP‑interacting proteins are suspected in patients with clinical features of WAS, in whom the WASP gene sequence and mRNA levels are normal. The present study aimed to investigate the application of next generation sequencing in definitive diagnosis and clinical therapy for WAS. A 5 month‑old child with WAS who displayed symptoms of thrombocytopenia was examined. Whole exome sequence analysis of genomic DNA showed that the coverage and depth of WASP were extremely low. Quantitative polymerase chain reaction indicated total WASP gene deletion in the proband. In conclusion, high throughput sequencing is useful for the verification of WAS on the genetic profile, and has implications for family planning guidance and establishment of clinical programs.

  7. Spectrum of novel mutations found in Waardenburg syndrome types 1 and 2: implications for molecular genetic diagnostics.

    PubMed

    Wildhardt, Gabriele; Zirn, Birgit; Graul-Neumann, Luitgard M; Wechtenbruch, Juliane; Suckfüll, Markus; Buske, Annegret; Bohring, Axel; Kubisch, Christian; Vogt, Stefanie; Strobl-Wildemann, Gertrud; Greally, Marie; Bartsch, Oliver; Steinberger, Daniela

    2013-03-18

    Till date, mutations in the genes PAX3 and MITF have been described in Waardenburg syndrome (WS), which is clinically characterised by congenital hearing loss and pigmentation anomalies. Our study intended to determine the frequency of mutations and deletions in these genes, to assess the clinical phenotype in detail and to identify rational priorities for molecular genetic diagnostics procedures. Prospective analysis. 19 Caucasian patients with typical features of WS underwent stepwise investigation of PAX3 and MITF. When point mutations and small insertions/deletions were excluded by direct sequencing, copy number analysis by multiplex ligation-dependent probe amplification was performed to detect larger deletions and duplications. Clinical data and photographs were collected to facilitate genotype-phenotype analyses. All analyses were performed in a large German laboratory specialised in genetic diagnostics. 15 novel and 4 previously published heterozygous mutations in PAX3 and MITF were identified. Of these, six were large deletions or duplications that were only detectable by copy number analysis. All patients with PAX3 mutations had typical phenotype of WS with dystopia canthorum (WS1), whereas patients with MITF gene mutations presented without dystopia canthorum (WS2). In addition, one patient with bilateral hearing loss and blue eyes with iris stroma dysplasia had a de novo missense mutation (p.Arg217Ile) in MITF. MITF 3-bp deletions at amino acid position 217 have previously been described in patients with Tietz syndrome (TS), a clinical entity with hearing loss and generalised hypopigmentation. On the basis of these findings, we conclude that sequencing and copy number analysis of both PAX3 and MITF have to be recommended in the routine molecular diagnostic setting for patients, WS1 and WS2. Furthermore, our genotype-phenotype analyses indicate that WS2 and TS correspond to a clinical spectrum that is influenced by MITF mutation type and position.

  8. Spectrum of novel mutations found in Waardenburg syndrome types 1 and 2: implications for molecular genetic diagnostics

    PubMed Central

    Wildhardt, Gabriele; Zirn, Birgit; Graul-Neumann, Luitgard M; Wechtenbruch, Juliane; Suckfüll, Markus; Buske, Annegret; Bohring, Axel; Kubisch, Christian; Vogt, Stefanie; Strobl-Wildemann, Gertrud; Greally, Marie; Bartsch, Oliver; Steinberger, Daniela

    2013-01-01

    Objectives Till date, mutations in the genes PAX3 and MITF have been described in Waardenburg syndrome (WS), which is clinically characterised by congenital hearing loss and pigmentation anomalies. Our study intended to determine the frequency of mutations and deletions in these genes, to assess the clinical phenotype in detail and to identify rational priorities for molecular genetic diagnostics procedures. Design Prospective analysis. Patients 19 Caucasian patients with typical features of WS underwent stepwise investigation of PAX3 and MITF. When point mutations and small insertions/deletions were excluded by direct sequencing, copy number analysis by multiplex ligation-dependent probe amplification was performed to detect larger deletions and duplications. Clinical data and photographs were collected to facilitate genotype–phenotype analyses. Setting All analyses were performed in a large German laboratory specialised in genetic diagnostics. Results 15 novel and 4 previously published heterozygous mutations in PAX3 and MITF were identified. Of these, six were large deletions or duplications that were only detectable by copy number analysis. All patients with PAX3 mutations had typical phenotype of WS with dystopia canthorum (WS1), whereas patients with MITF gene mutations presented without dystopia canthorum (WS2). In addition, one patient with bilateral hearing loss and blue eyes with iris stroma dysplasia had a de novo missense mutation (p.Arg217Ile) in MITF. MITF 3-bp deletions at amino acid position 217 have previously been described in patients with Tietz syndrome (TS), a clinical entity with hearing loss and generalised hypopigmentation. Conclusions On the basis of these findings, we conclude that sequencing and copy number analysis of both PAX3 and MITF have to be recommended in the routine molecular diagnostic setting for patients, WS1 and WS2. Furthermore, our genotype–phenotype analyses indicate that WS2 and TS correspond to a clinical spectrum that is influenced by MITF mutation type and position. PMID:23512835

  9. Potential Diagnostic and Prognostic Value of Lymphocytic Mitochondrial DNA Deletion in Relation to Folic Acid Status in HCV-Related Hepatocellular Carcinoma

    PubMed Central

    Zekri, Abdel Rahman N; Salama, Hosny; Medhat, Eman; Hamdy, Sherif; Hassan, Zeinab K; Bakr, Yasser Mabrouk; Youssef, Amira Salah El - Din; Saleh, Doaa; Saeed, Ramy; Omran, Dalia

    2017-01-01

    Objective: We assessed the possibility of using mitochondrial (mt) DNA deletion as a molecular biomarker for disease progression in HCV-related hepatocellular carcinoma (HCC) and to identify its association with folic acid status. Methods: Serum folic acid and lymphocytic mtDNA deletions were assessed in 90 patients; 50 with HCC, 20 with liver cirrhosis (LC), and 20 with chronic hepatitis C (CHC) compared to 10 healthy control subjects. The diagnostic accuracy of mtDNA deletions frequency was evaluated using receiver-operating characteristic (ROC) curve analysis Survival analysis was performed using the Kaplan-Meier method. Differences in the survival rates were compared using log-rank test. Result: Our data revealed a significant elevation of mtDNA deletions frequency in the HCC group compared to the other groups (P-value <0.01). Also, our data showed a significant correlation between folate deficiency and high frequency of mtDNA deletions in patients with HCV-related HCC when compared to the other groups (r= -0.094 and P-value <0.05). Moreover, the size of the hepatic focal lesion in the HCC patients was positively correlated with mtDNA deletions (r= 0.09 and P-value <0.01). The median survival time for the HCC patients with high frequency of mtDNA deletions (∆Ct ≥3.9; 5.7+ 0.6 months) was significantly shorter than those with low mtDNA deletions frequency (∆Ct < 3.9; 11.9+ 0.04 months, P-value <0.01). Conclusion: Our data provided an evidence that lymphocytic mtDNA deletion could be used as non-invasive biomarker for disease progression and patients’ survival in HCV-related HCC. Also, our findings implied a causal relationship between the folate deficiency and the high mtDNA deletions frequency among Egyptian patients with HCV related HCC. PMID:28952275

  10. PTEN genomic deletion predicts prostate cancer recurrence and is associated with low AR expression and transcriptional activity

    PubMed Central

    2012-01-01

    Background Prostate cancer (PCa), a leading cause of cancer death in North American men, displays a broad range of clinical outcome from relatively indolent to lethal metastatic disease. Several genomic alterations have been identified in PCa which may serve as predictors of progression. PTEN, (10q23.3), is a negative regulator of the phosphatidylinositol 3-kinase (PIK3)/AKT survival pathway and a tumor suppressor frequently deleted in PCa. The androgen receptor (AR) signalling pathway is known to play an important role in PCa and its blockade constitutes a commonly used treatment modality. In this study, we assessed the deletion status of PTEN along with AR expression levels in 43 primary PCa specimens with clinical follow-up. Methods Fluorescence In Situ Hybridization (FISH) was done on formalin fixed paraffin embedded (FFPE) PCa samples to examine the deletion status of PTEN. AR expression levels were determined using immunohistochemistry (IHC). Results Using FISH, we found 18 cases of PTEN deletion. Kaplan-Meier analysis showed an association with disease recurrence (P=0.03). Concurrently, IHC staining for AR found significantly lower levels of AR expression within those tumors deleted for PTEN (P<0.05). To validate these observations we interrogated a copy number alteration and gene expression profiling dataset of 64 PCa samples, 17 of which were PTEN deleted. We confirmed the predictive value of PTEN deletion in disease recurrence (P=0.03). PTEN deletion was also linked to diminished expression of PTEN (P<0.01) and AR (P=0.02). Furthermore, gene set enrichment analysis revealed a diminished expression of genes downstream of AR signalling in PTEN deleted tumors. Conclusions Altogether, our data suggest that PTEN deleted tumors expressing low levels of AR may represent a worse prognostic subset of PCa establishing a challenge for therapeutic management. PMID:23171135

  11. SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

    PubMed

    Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

    2007-11-01

    Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

  12. CD200/BTLA deletions in pediatric precursor B-cell acute lymphoblastic leukemia treated according to the EORTC-CLG 58951 protocol

    PubMed Central

    Ghazavi, Farzaneh; Clappier, Emmanuelle; Lammens, Tim; Suciu, Stefan; Caye, Aurélie; Zegrari, Samira; Bakkus, Marleen; Grardel, Nathalie; Benoit, Yves; Bertrand, Yves; Minckes, Odile; Costa, Vitor; Ferster, Alina; Mazingue, Françoise; Plat, Geneviève; Plouvier, Emmanuel; Poirée, Marilyne; Uyttebroeck, Anne; van der Werff-ten Bosch, Jutte; Yakouben, Karima; Helsmoortel, Hetty; Meul, Magali; Van Roy, Nadine; Philippé, Jan; Speleman, Frank; Cavé, Hélène; Van Vlierberghe, Pieter; De Moerloose, Barbara

    2015-01-01

    DNA copy number analysis has been instrumental for the identification of genetic alterations in B-cell precursor acute lymphoblastic leukemia. Notably, some of these genetic defects have been associated with poor treatment outcome and might be relevant for future risk stratification. In this study, we characterized recurrent deletions of CD200 and BTLA genes, mediated by recombination-activating genes, and used breakpoint-specific polymerase chain reaction assay to screen a cohort of 1154 cases of B-cell precursor acute lymphoblastic leukemia uniformly treated according to the EORTC-CLG 58951 protocol. CD200/BTLA deletions were identified in 56 of the patients (4.8%) and were associated with an inferior 8-year event free survival in this treatment protocol [70.2% ± 1.2% for patients with deletions versus 83.5% ± 6.4% for non-deleted cases (hazard ratio 2.02; 95% confidence interval 1.23–3.32; P=0.005)]. Genetically, CD200/BTLA deletions were strongly associated with ETV6-RUNX1-positive leukemias (P<0.0001), but were also identified in patients who did not have any genetic abnormality that is currently used for risk stratification. Within the latter population of patients, the presence of CD200/BTLA deletions was associated with inferior event-free survival and overall survival. Moreover, the multivariate Cox model indicated that these deletions had independent prognostic impact on event-free survival when adjusting for conventional risk criteria. All together, these findings further underscore the rationale for copy number profiling as an important tool for risk stratification in human B-cell precursor acute lymphoblastic leukemia. This trial was registered at www.ClinicalTrials.gov as #NCT00003728. PMID:26137961

  13. CD200/BTLA deletions in pediatric precursor B-cell acute lymphoblastic leukemia treated according to the EORTC-CLG 58951 protocol.

    PubMed

    Ghazavi, Farzaneh; Clappier, Emmanuelle; Lammens, Tim; Suciu, Stefan; Caye, Aurélie; Zegrari, Samira; Bakkus, Marleen; Grardel, Nathalie; Benoit, Yves; Bertrand, Yves; Minckes, Odile; Costa, Vitor; Ferster, Alina; Mazingue, Françoise; Plat, Geneviève; Plouvier, Emmanuel; Poirée, Marilyne; Uyttebroeck, Anne; van der Werff-Ten Bosch, Jutte; Yakouben, Karima; Helsmoortel, Hetty; Meul, Magali; Van Roy, Nadine; Philippé, Jan; Speleman, Frank; Cavé, Hélène; Van Vlierberghe, Pieter; De Moerloose, Barbara

    2015-10-01

    DNA copy number analysis has been instrumental for the identification of genetic alterations in B-cell precursor acute lymphoblastic leukemia. Notably, some of these genetic defects have been associated with poor treatment outcome and might be relevant for future risk stratification. In this study, we characterized recurrent deletions of CD200 and BTLA genes, mediated by recombination-activating genes, and used breakpoint-specific polymerase chain reaction assay to screen a cohort of 1154 cases of B-cell precursor acute lymphoblastic leukemia uniformly treated according to the EORTC-CLG 58951 protocol. CD200/BTLA deletions were identified in 56 of the patients (4.8%) and were associated with an inferior 8-year event free survival in this treatment protocol [70.2% ± 1.2% for patients with deletions versus 83.5% ± 6.4% for non-deleted cases (hazard ratio 2.02; 95% confidence interval 1.23-3.32; P=0.005)]. Genetically, CD200/BTLA deletions were strongly associated with ETV6-RUNX1-positive leukemias (P<0.0001), but were also identified in patients who did not have any genetic abnormality that is currently used for risk stratification. Within the latter population of patients, the presence of CD200/BTLA deletions was associated with inferior event-free survival and overall survival. Moreover, the multivariate Cox model indicated that these deletions had independent prognostic impact on event-free survival when adjusting for conventional risk criteria. All together, these findings further underscore the rationale for copy number profiling as an important tool for risk stratification in human B-cell precursor acute lymphoblastic leukemia. This trial was registered at www.ClinicalTrials.gov as #NCT00003728. Copyright© Ferrata Storti Foundation.

  14. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

    PubMed

    Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

    2018-01-01

    Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

  15. Chromosome 3 allelic losses and microsatellite alterations in transitional cell carcinoma of the urinary bladder.

    PubMed Central

    Li, M.; Zhang, Z. F.; Reuter, V. E.; Cordon-Cardo, C.

    1996-01-01

    A deletion analysis of chromosome 3 was conducted in 72 cases of transitional cell carcinoma of the urinary bladder using seven microsatellites spanning the 3p arm and two additional microsatellites in 3q. Results showed that 19 of 72 (26.4%) cases had deletions in one or more 3p regions. Two regions of frequent deletion were identified: 3p12-14 and 3p21-23. Less frequent deletions at 3p24.2-25 were also observed. Deletions at 3p were weakly correlated with tumor grade, but strongly with pathological stage. Among 70 cases with histological grade available, 4 of 29 (13.8%) grade 1 and 2 tumors, and 15 of 41 (36.6%) grade 3 tumors showed allelic losses in one or more of the 3p regions studied (P = 0.055). Among 69 cases with pathological stage available, none of 27 superficial carcinomas (pTa, pTis, and pT1) showed 3p deletions, whereas 18 of 42 (42.9%) muscle invasive lesions (pT2, pT3, and pT4) displayed allelic losses at 3p (P < 0.001). In addition, 12 cases showed microsatellite instability, but there was no correlation between abnormalities and tumor grade or stage. No correlation was found between deletions at 3p21-23 and microsatellite instability. In conclusion, deletions at three discrete regions of 3p were identified in bladder carcinoma, suggesting the involvement of candidate tumor suppressor genes residing in these regions. Moreover, detection of allelic losses in these regions was associated with higher tumor grade and more advanced stage, suggesting their potential involvement in bladder tumor progression. Images Figure 1 Figure 3 PMID:8686747

  16. Comparative genome analysis identifies two large deletions in the genome of highly-passaged attenuated Streptococcus agalactiae strain YM001 compared to the parental pathogenic strain HN016.

    PubMed

    Wang, Rui; Li, Liping; Huang, Yan; Luo, Fuguang; Liang, Wanwen; Gan, Xi; Huang, Ting; Lei, Aiying; Chen, Ming; Chen, Lianfu

    2015-11-04

    Streptococcus agalactiae (S. agalactiae), also known as group B Streptococcus (GBS), is an important pathogen for neonatal pneumonia, meningitis, bovine mastitis, and fish meningoencephalitis. The global outbreaks of Streptococcus disease in tilapia cause huge economic losses and threaten human food hygiene safety as well. To investigate the mechanism of S. agalactiae pathogenesis in tilapia and develop attenuated S. agalactiae vaccine, this study sequenced and comparatively analyzed the whole genomes of virulent wild-type S. agalactiae strain HN016 and its highly-passaged attenuated strain YM001 derived from tilapia. We performed Illumina sequencing of DNA prepared from strain HN016 and YM001. Sequencedreads were assembled and nucleotide comparisons, single nucleotide polymorphism (SNP) , indels were analyzed between the draft genomes of HN016 and YM001. Clustered regularly interspaced short palindromic repeats (CRISPRs) and prophage were detected and analyzed in different S. agalactiae strains. The genome of S. agalactiae YM001 was 2,047,957 bp with a GC content of 35.61 %; it contained 2044 genes and 88 RNAs. Meanwhile, the genome of S. agalactiae HN016 was 2,064,722 bp with a GC content of 35.66 %; it had 2063 genes and 101 RNAs. Comparative genome analysis indicated that compared with HN016, YM001 genome had two significant large deletions, at the sizes of 5832 and 11,116 bp respectively, resulting in the deletion of three rRNA and ten tRNA genes, as well as the deletion and functional damage of ten genes related to metabolism, transport, growth, anti-stress, etc. Besides these two large deletions, other ten deletions and 28 single nucleotide variations (SNVs) were also identified, mainly affecting the metabolism- and growth-related genes. The genome of attenuated S. agalactiae YM001 showed significant variations, resulting in the deletion of 10 functional genes, compared to the parental pathogenic strain HN016. The deleted and mutated functional genes all encode metabolism- and growth-related proteins, not the known virulence proteins, indicating that the metabolism- and growth-related genes are important for the pathogenesis of S. agalactiae.

  17. Update of the GJB2/DFNB1 mutation spectrum in Russia: a founder Ingush mutation del(GJB2-D13S175) is the most frequent among other large deletions

    PubMed Central

    Bliznetz, Elena A; Lalayants, Maria R; Markova, Tatiana G; Balanovsky, Oleg P; Balanovska, Elena V; Skhalyakho, Roza A; Pocheshkhova, Elvira A; Nikitina, Natalya V; Voronin, Sergey V; Kudryashova, Elena K; Glotov, Oleg S; Polyakov, Alexander V

    2017-01-01

    Although mutations in the GJB2 gene sequence make up the majority of variants causing autosomal-recessive non-syndromic hearing loss, few large deletions have been shown to contribute to DFNB1 deafness. Currently, genetic testing for DFNB1 hearing loss includes GJB2 sequencing and DFNB1 deletion analysis for two common large deletions, del(GJB6-D13S1830) and del(GJB6-D13S1854). Here, we report frequency in Russia, clinical significance and evolutionary origins of a 101 kb deletion, del(GJB2-D13S175), recently identified by us. In multiethnic cohort of 1104 unrelated hearing loss patients with biallelic mutations at the DFNB1 locus, the del(GJB2-D13S175) allele frequency of up to 0.5% (11/2208) was determined and this allele was shown to be predominantly associated with profound sensorineural hearing loss. Additionally, eight previously unpublished GJB2 mutations were described in this study. All patients carrying del(GJB2-D13S175) were of the Ingush ancestry. Among normal hearing individuals, del(GJB2-D13S175) was observed in Russian Republic of Ingushetia with a carrier rate of ~1% (2/241). Analysis of haplotypes associated with the deletion revealed a common founder in the Ingushes, with age of the deletion being ~3000 years old. Since del(GJB2-D13S175) was missed by standard methods of GJB2 analysis, del(GJB2-D13S175) detection has been added to our routine testing strategy for DFNB1 hearing loss. PMID:28405014

  18. Detection of a molecular deletion at the DXS732 locus in a patient with X-linked hypohidrotic ectodermal dysplasia (EDA), with the identification of a unique junctional fragment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zonana, J.; Gault, J.; Jones, M.

    1993-01-01

    X-linked hypohidrotic ectodermal dysplasia (EDA) has been localized to the Xq12-q13.1. A panel of genomic DNA samples from 80 unrelated males with EDA has been screened for deletions at seven genetic loci within the Xq12-13 region. A single individual was identified with a deletion at the DXS732 locus by hybridization with the mouse genomic probe pcos169E/4. This highly conserved DNA probe is from locus DXCrc169, which is tightly linked to the Ta locus, the putative mouse homologue of EDA. The proband had the classical phenotype of EDA, with no other phenotypic abnormalities, and a normal cytogenetic analysis. A human genomicmore » DNA clone, homologous to pcos169E/4, was isolated from a human X-chromosome cosmid library. On hybridization with the cosmid, the proband was found to be only partially deleted at the DXS732 locus, with a unique junctional fragment identified in the proband and in three of his maternal relatives. This is the first determination of carrier status for EDA in females, by direct mutation analysis. Failure to detect deletion of the other loci tested in the proband suggests that the DXS732 locus is the closest known locus to the EDA gene. Since the DXS732 locus contains a highly conserved sequence, it must be considered to be a candidate locus for the EDA gene itself. 18 refs., 3 figs., 1 tab.« less

  19. Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf–Hirschhorn syndrome

    PubMed Central

    South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

    2016-01-01

    Background Wolf–Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Methods Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. Results We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. Conclusions We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. PMID:26747863

  20. TBR1 is the candidate gene for intellectual disability in patients with a 2q24.2 interstitial deletion.

    PubMed

    Palumbo, Orazio; Fichera, Marco; Palumbo, Pietro; Rizzo, Renata; Mazzolla, Elisabetta; Cocuzza, Donatella Maria; Carella, Massimo; Mattina, Teresa

    2014-03-01

    Interstitial deletion of 2q24.2 is a rarely described cytogenetic aberration in patients with intellectual disability (ID). Previously reported genotype-phenotype correlation identified a minimum deleted region of 2.65 Mb including 15 genes. Recently, a patient with a de novo 2q24.2 microdeletion of 0.4 Mb encompassing only three genes was described. However, the precise relationship between most deleted genes and the clinical features remains unclear. Here we describe a 12-year-old male patient diagnosed with growth retardation and ID. He also showed microcephaly, right palpebral ptosis, scapular winging, and pectus excavatum. Single nucleotide polymorphisms (SNP) array analysis showed a de novo interstitial deletion of 0.122 Mb at 2q24.2 region harboring only TBR1 (T-box, brain, 1; OMIM: 604616), which encodes a T-box family transcription factor expressed in post-mitotic projection neurons and functionally significant in embryologic corticogenesis. This is the first case of a deletion at 2q24.2 involving only TBR1. This finding narrows the smallest region of overlap (SRO) for deletions in this region and strengthens the previously suggested hypothesis that this gene is a strong candidate for the ID phenotype. The identification of TBR1 as candidate for ID encourages further molecular studies to identify novel mutations to understand the pathogenic effects of its haploinsufficiency. Finally, this report provides a review on 10 2q24.2 microdeletion patients. © 2014 Wiley Periodicals, Inc.

  1. 10 CFR 9.19 - Segregation of exempt information and deletion of identifying details.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    ... 10 Energy 1 2011-01-01 2011-01-01 false Segregation of exempt information and deletion of identifying details. 9.19 Section 9.19 Energy NUCLEAR REGULATORY COMMISSION PUBLIC RECORDS Freedom of Information Act Regulations § 9.19 Segregation of exempt information and deletion of identifying details. (a...

  2. 10 CFR 9.19 - Segregation of exempt information and deletion of identifying details.

    Code of Federal Regulations, 2010 CFR

    2010-01-01

    ... 10 Energy 1 2010-01-01 2010-01-01 false Segregation of exempt information and deletion of identifying details. 9.19 Section 9.19 Energy NUCLEAR REGULATORY COMMISSION PUBLIC RECORDS Freedom of Information Act Regulations § 9.19 Segregation of exempt information and deletion of identifying details. (a...

  3. Novel deletions involving the USH2A gene in patients with Usher syndrome and retinitis pigmentosa

    PubMed Central

    García-García, Gema; Jaijo, Teresa; Aparisi, Maria J.; Larrieu, Lise; Faugère, Valérie; Blanco-Kelly, Fiona; Ayuso, Carmen; Roux, Anne-Francoise; Millán, José M.

    2014-01-01

    Purpose The aim of the present work was to identify and characterize large rearrangements involving the USH2A gene in patients with Usher syndrome and nonsyndromic retinitis pigmentosa. Methods The multiplex ligation-dependent probe amplification (MLPA) technique combined with a customized array-based comparative genomic hybridization (aCGH) analysis was applied to 40 unrelated patients previously screened for point mutations in the USH2A gene in which none or only one pathologic mutation was identified. Results We detected six large deletions involving USH2A in six out of the 40 cases studied. Three of the patients were homozygous for the deletion, and the remaining three were compound heterozygous with a previously identified USH2A point mutation. In five of these cases, the patients displayed Usher type 2, and the remaining case displayed nonsyndromic retinitis pigmentosa. The exact breakpoint junctions of the deletions found in USH2A in four of these cases were characterized. Conclusions Our study highlights the need to develop improved efficient strategies of mutation screening based upon next generation sequencing (NGS) that reduce cost, time, and complexity and allow simultaneous identification of all types of disease-causing mutations in diagnostic procedures. PMID:25352746

  4. MDS/AML del(11)(q14) Share Common Morphological Features Despite Different Chromosomal Breakpoints.

    PubMed

    Dambruoso, Irene; Invernizzi, Rosangela; Boni, Marina; Zappatore, Rita; Giardini, Ilaria; Cavigliano, Maria Paola; Rocca, Barbara; Calvello, Celeste; Bastia, Raffaella; Caresana, Marilena; Pasi, Francesca; Nano, Rosanna; Bernasconi, Paolo

    2017-02-01

    In myelodysplatic syndromes and acute myeloid leukemia (MDS/AML) deletion of the 11q14 region is a rare chromosomal defect (incidence: 0.6-1.0%), included within the intermediate risk criteria by the International Prognostic Scoring System. No fluorescence in situ hybridization (FISH) study has yet been performed to identify a common breakpoint region (CBR). In our study through FISH with bacterial artificial chromosomes and commercial probes, we analyzed seven patients with MDS/AML harboring 11q14 deletion on conventional cytogenetic analysis. FISH revealed deletions in five patients and amplifications in two. Three patients with deletion carried a CBR, two had a deletion involving a more centromeric breakpoint. These five patients exhibited multilineage dysplasia, blast cells with large round nuclei, loose chromatin, small and abundant nucleoli, and vacuolated cytoplasm with very thin Auer bodies. In conclusion, the morphological features which occur independently of the extent of the deletion are of multilineage dysplasia in MDS and leukemic blasts strongly reactive to peroxidase in AML; despite the variable size of the deleted area, some patients harbor a CBR. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  5. Molecular analysis of defects in the CFTR gene and AZF locus of the Y chromosome in male infertility.

    PubMed

    Sobczyńska-Tomaszewska, Agnieszka; Bak, Daniel; Wolski, Jan Karol; Bablok, Leszek; Nawara, Magdalena; Mazurczak, Tadeusz; Bal, Jerzy

    2006-02-01

    To investigate the frequency and potential impact of mutations and polymorphisms in the CFTR gene and deletions in AZF locus of the Y chromosome in patients with azoospermia (AZOO), cryptozoospermia (CRYPTO) or oligoasthenoteratozoospermia (OAT) who were to be included in an assisted reproductive technologies (ART) program. A total of 188 infertile men were enrolled in the study: 100 patients with AZOO, 38 with CRYPTO and 50 with OAT. The CFTR gene mutations or IVS8-5T variant in at least 1 allele was identified with similar frequencies among the AZOO (33%) and CRYPTO (21%) patients; 55% of the AZOO patients with normal spermatogenesis (NS) had mutations in 1 or 2 alleles. The novel R810G mutation in exon 13 was identified in 1 NS patient. The OAT or AZOO patients with Sertoli cell only syndrome (SCO) had mutations in the CFTR gene with similar frequencies to that in the general Polish population. The deletions in the AZF locus were detected in 20% of SCO patients, 11.5% of AZOO patients with maturation arrest and in 5% of CRYPTO patients. The other groups (NS, OAT) did not carry deletions in the region studied. Molecular diagnosis of the CFTR gene, Y chromosome deletion analysis and genetic counseling are necessary diagnostic elements for patients with male infertility, especially if the are included in an ART program.

  6. Microdeletions are a general feature of adult and adolescent acute lymphoblastic leukemia: Unexpected similarities with pediatric disease

    PubMed Central

    Paulsson, Kajsa; Cazier, Jean-Baptiste; MacDougall, Finlay; Stevens, Jane; Stasevich, Irina; Vrcelj, Nikoletta; Chaplin, Tracy; Lillington, Debra M.; Lister, T. Andrew; Young, Bryan D.

    2008-01-01

    We present here a genome-wide map of abnormalities found in diagnostic samples from 45 adults and adolescents with acute lymphoblastic leukemia (ALL). A 500K SNP array analysis uncovered frequent genetic abnormalities, with cryptic deletions constituting half of the detected changes, implying that microdeletions are a characteristic feature of this malignancy. Importantly, the pattern of deletions resembled that recently reported in pediatric ALL, suggesting that adult, adolescent, and childhood cases may be more similar on the genetic level than previously thought. Thus, 70% of the cases displayed deletion of one or more of the CDKN2A, PAX5, IKZF1, ETV6, RB1, and EBF1 genes. Furthermore, several genes not previously implicated in the pathogenesis of ALL were identified as possible recurrent targets of deletion. In total, the SNP array analysis identified 367 genetic abnormalities not corresponding to known copy number polymorphisms, with all but two cases (96%) displaying at least one cryptic change. The resolution level of this SNP array study is the highest used to date to investigate a malignant hematologic disorder. Our findings provide insights into the leukemogenic process and may be clinically important in adult and adolescent ALL. Most importantly, we report that microdeletions of key genes appear to be a common, characteristic feature of ALL that is shared among different clinical, morphological, and cytogenetic subgroups. PMID:18458336

  7. A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion

    PubMed Central

    Viñas-Jornet, Marina; Esteba-Castillo, Susanna; Gabau, Elisabeth; Ribas-Vidal, Núria; Baena, Neus; San, Joan; Ruiz, Anna; Coll, Maria Dolors; Novell, Ramon; Guitart, Miriam

    2014-01-01

    Deletions in the 2p16.3 region that includes the neurexin (NRXN1) gene are associated with intellectual disability and various psychiatric disorders, in particular, autism and schizophrenia. We present three unrelated patients, two adults and one child, in whom we identified an intragenic 2p16.3 deletion within the NRXN1 gene using an oligonucleotide comparative genomic hybridization array. The three patients presented dual diagnosis that consisted of mild intellectual disability and autism and bipolar disorder. Also, they all shared a dysmorphic phenotype characterized by a long face, deep set eyes, and prominent premaxilla. Genetic analysis of family members showed two inherited deletions. A comprehensive neuropsychological examination of the 2p16.3 deletion carriers revealed the same phenotype, characterized by anxiety disorder, borderline intelligence, and dysexecutive syndrome. The cognitive pattern of dysexecutive syndrome with poor working memory and reduced attention switching, mental flexibility, and verbal fluency was the same than those of the adult probands. We suggest that in addition to intellectual disability and psychiatric disease, NRXN1 deletion is a risk factor for a characteristic cognitive and dysmorphic profile. The new cognitive phenotype found in the 2p16.3 deletion carriers suggests that 2p16.3 deletions might have a wide variable expressivity instead of incomplete penetrance. PMID:25614873

  8. Chronic lymphocytic leukaemia with 17p deletion: a retrospective analysis of prognostic factors and therapy results.

    PubMed

    Delgado, Julio; Espinet, Blanca; Oliveira, Ana C; Abrisqueta, Pau; de la Serna, Javier; Collado, Rosa; Loscertales, Javier; Lopez, Montserrat; Hernandez-Rivas, Jose A; Ferra, Christelle; Ramirez, Angel; Roncero, Josep M; Lopez, Cristina; Aventin, Anna; Puiggros, Anna; Abella, Eugenia; Carbonell, Felix; Costa, Dolors; Carrio, Anna; Gonzalez, Marcos

    2012-04-01

    Patients with chronic lymphocytic leukaemia (CLL) whose tumour cells harbour a 17p deletion (17p-) are universally considered to have a poor prognosis. The deletion can be detected at diagnosis or during the evolution of the disease, particularly in patients who have received chemotherapy. We sought to evaluate the natural history of patients with 17p- CLL, identify predictive factors within this prognostic subgroup, and evaluate the results of different therapeutic approaches. Data from 294 patients with 17p- CLL followed up at 20 different institutions was retrospectively collected and analysed. Median age was 68 (range 27-98) years at the time of fluorescence in situ hybridization analysis. After 17p- documentation, 52% received treatment, achieving an overall response rate of 50%. Median overall survival was 41 months, and was significantly shorter in patients with elevated beta(2)-microglobulin concentration (P < 0·001), B symptoms (P = 0·016), higher percentage of cells with deletion (P < 0·001), and acquired deletions (P = 0·012). These findings suggest that patients with 17p- CLL have a variable prognosis that can be refined using simple clinical and laboratory features, including 17p- clone size, beta2-microglobulin concentration, presence of B symptoms and type of deletion (de novo versus acquired). © 2012 Blackwell Publishing Ltd.

  9. GABA metabolism pathway genes, UGA1 and GAD1, regulate replicative lifespan in Saccharomycescerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo

    2011-04-01

    Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependentmore » induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest reduced activity of the GABA-metabolizing enzymes extends lifespan by shifting carbon metabolism toward respiration, as calorie restriction does.« less

  10. Recurrent Deletions and Reciprocal Duplications of 10q11.21q11.23 Including CHAT and SLC18A3 are Likely Mediated by Complex Low-Copy Repeats

    PubMed Central

    Stankiewicz, Paweł; Kulkarni, Shashikant; Dharmadhikari, Avinash V.; Sampath, Srirangan; Bhatt, Samarth S.; Shaikh, Tamim H.; Xia, Zhilian; Pursley, Amber N.; Cooper, M. Lance; Shinawi, Marwan; Paciorkowski, Alex R.; Grange, Dorothy K.; Noetzel, Michael J.; Saunders, Scott; Simons, Paul; Summar, Marshall; Lee, Brendan; Scaglia, Fernando; Fellmann, Florence; Martinet, Danielle; Beckmann, Jacques S.; Asamoah, Alexander; Platky, Kathryn; Sparks, Susan; Martin, Ann S.; Madan-Khetarpal, Suneeta; Hoover, Jacqueline; Medne, Livija; Bonnemann, Carsten G.; Moeschler, John B.; Vallee, Stephanie E.; Parikh, Sumit; Irwin, Polly; Dalzell, Victoria P.; Smith, Wendy E.; Banks, Valerie C.; Flannery, David B.; Lovell, Carolyn M.; Bellus, Gary A.; Golden-Grant, Kathryn; Gorski, Jerome L.; Kussmann, Jennifer L.; McGregor, Tracy L.; Hamid, Rizwan; Pfotenhauer, Jean; Ballif, Blake C.; Shaw, Chad A.; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Rosenfeld, Jill A.; Cheung, Sau Wai; Shaffer, Lisa G.

    2013-01-01

    We report 24 unrelated individuals with deletions and 17 additional cases with duplications at 10q11.21q21.1 identified by chromosomal microarray analysis. The rearrangements range in size from 0.3 to 12 Mb. Nineteen of the deletions and eight duplications are flanked by large, directly oriented segmental duplications of >98% sequence identity, suggesting that nonallelic homologous recombination (NAHR) caused these genomic rearrangements. Nine individuals with deletions and five with duplications have additional copy number changes. Detailed clinical evaluation of 20 patients with deletions revealed variable clinical features, with developmental delay (DD) and/or intellectual disability (ID) as the only features common to a majority of individuals. We suggest that some of the other features present in more than one patient with deletion, including hypotonia, sleep apnea, chronic constipation, gastroesophageal and vesicoureteral refluxes, epilepsy, ataxia, dysphagia, nystagmus, and ptosis may result from deletion of the CHAT gene, encoding choline acetyltransferase, and the SLC18A3 gene, mapping in the first intron of CHAT and encoding vesicular acetylcholine transporter. The phenotypic diversity and presence of the deletion in apparently normal carrier parents suggest that subjects carrying 10q11.21q11.23 deletions may exhibit variable phenotypic expressivity and incomplete penetrance influenced by additional genetic and nongenetic modifiers. PMID:21948486

  11. A novel 5-bp deletion in Clarin 1 in a family with Usher syndrome.

    PubMed

    Akoury, Elie; El Zir, Elie; Mansour, Ahmad; Mégarbané, André; Majewski, Jacek; Slim, Rima

    2011-11-01

    To identify the genetic defect in a Lebanese family with two sibs diagnosed with Usher Syndrome. Exome capture and sequencing were performed on DNA from one affected member using Agilent in solution bead capture, followed by Illumina sequencing. This analysis revealed the presence of a novel homozygous 5-bp deletion, in Clarin 1 (CLRN1), a known gene responsible for Usher syndrome type III. The deletion is inherited from both parents and segregates with the disease phenotype in the family. The 5-bp deletion, c.301_305delGTCAT, p.Val101SerfsX27, is predicted to result in a frameshift and protein truncation after 27 amino acids. Sequencing all the coding regions of the CLRN1 gene in the proband did not reveal any other mutation or variant. Here we describe a novel deletion in CLRN1. Our data support previously reported intra familial variability in the clinical features of Usher syndrome type I and III.

  12. An extensive molecular cytogenetic characterization in high-risk chronic lymphocytic leukemia identifies karyotype aberrations and TP53 disruption as predictors of outcome and chemorefractoriness

    PubMed Central

    Cavallari, Maurizio; Quaglia, Francesca Maria; Lista, Enrico; Urso, Antonio; Guardalben, Emanuele; Martinelli, Sara; Saccenti, Elena; Bassi, Cristian; Lupini, Laura; Bardi, Maria Antonella; Volta, Eleonora; Tammiso, Elisa; Melandri, Aurora; Negrini, Massimo

    2017-01-01

    We investigated whether karyotype analysis and mutational screening by next generation sequencing could predict outcome in 101 newly diagnosed chronic lymphocytic leukemia patients with high-risk features, as defined by the presence of unmutated IGHV gene and/or 11q22/17p13 deletion by FISH and/or TP53 mutations. Cytogenetic analysis showed favorable findings (normal karyotype and isolated 13q14 deletion) in 30 patients, unfavorable (complex karyotype and/or 17p13/11q22 deletion) in 34 cases and intermediate (all other abnormalities) in 36 cases. A complex karyotype was present in 21 patients. Mutations were detected in 56 cases and were associated with unmutated IGHV status (p = 0.040) and complex karyotype (p = 0.047). TP53 disruption (i.e. TP53 mutations and/or 17p13 deletion by FISH) correlated with the presence of ≥ 2 mutations (p = 0.001) and a complex karyotype (p = 0.012). By multivariate analysis, an advanced Binet stage (p < 0.001) and an unfavorable karyotype (p = 0.001) predicted a shorter time to first treatment. TP53 disruption (p = 0.019) and the unfavorable karyotype (p = 0.028) predicted a worse overall survival. A shorter time to chemorefractoriness was associated with TP53 disruption (p = 0.001) and unfavorable karyotype (p = 0.025). Patients with both unfavorable karyotype and TP53 disruption presented a dismal outcome (median overall survival and time to chemorefractoriness of 28.7 and 15.0 months, respectively). In conclusion, karyotype analysis refines risk stratification in high-risk CLL patients and could identify a subset of patients with highly unfavorable outcome requiring alternative treatments. PMID:28427204

  13. Cold Urticaria, Immunodeficiency, and Autoimmunity Related to PLCG2 Deletions

    PubMed Central

    Ombrello, Michael J.; Remmers, Elaine F.; Sun, Guangping; Freeman, Alexandra F.; Datta, Shrimati; Torabi-Parizi, Parizad; Subramanian, Naeha; Bunney, Tom D.; Baxendale, Rhona W.; Martins, Marta S.; Romberg, Neil; Komarow, Hirsh; Aksentijevich, Ivona; Kim, Hun Sik; Ho, Jason; Cruse, Glenn; Jung, Mi-Yeon; Gilfillan, Alasdair M.; Metcalfe, Dean D.; Nelson, Celeste; O'Brien, Michelle; Wisch, Laura; Stone, Kelly; Douek, Daniel C.; Gandhi, Chhavi; Wanderer, Alan A.; Lee, Hane; Nelson, Stanley F.; Shianna, Kevin V.; Cirulli, Elizabeth T.; Goldstein, David B.; Long, Eric O.; Moir, Susan; Meffre, Eric; Holland, Steven M.; Kastner, Daniel L.; Katan, Matilda; Hoffman, Hal M.; Milner, Joshua D.

    2012-01-01

    Background Mendelian analysis of disorders of immune regulation can provide insight into molecular pathways associated with host defense and immune tolerance. Methods We identified three families with a dominantly inherited complex of cold-induced urticaria, antibody deficiency, and susceptibility to infection and autoimmunity. Immunophenotyping methods included flow cytometry, analysis of serum immunoglobulins and autoantibodies, lymphocyte stimulation, and enzymatic assays. Genetic studies included linkage analysis, targeted Sanger sequencing, and next-generation whole-genome sequencing. Results Cold urticaria occurred in all affected subjects. Other, variable manifestations included atopy, granulomatous rash, autoimmune thyroiditis, the presence of antinuclear antibodies, sinopulmonary infections, and common variable immunodeficiency. Levels of serum IgM and IgA and circulating natural killer cells and class-switched memory B cells were reduced. Linkage analysis showed a 7-Mb candidate interval on chromosome 16q in one family, overlapping by 3.5 Mb a disease-associated haplotype in a smaller family. This interval includes PLCG2, encoding phospholipase Cγ2 (PLCγ2), a signaling molecule expressed in B cells, natural killer cells, and mast cells. Sequencing of complementary DNA revealed heterozygous transcripts lacking exon 19 in two families and lacking exons 20 through 22 in a third family. Genomic sequencing identified three distinct in-frame deletions that cosegregated with disease. These deletions, located within a region encoding an autoinhibitory domain, result in protein products with constitutive phospholipase activity. PLCG2-expressing cells had diminished cellular signaling at 37°C but enhanced signaling at subphysiologic temperatures. Conclusions Genomic deletions in PLCG2 cause gain of PLCγ2 function, leading to signaling abnormalities in multiple leukocyte subsets and a phenotype encompassing both excessive and deficient immune function. (Funded by the National Institutes of Health Intramural Research Programs and others.) PMID:22236196

  14. Whole-genome resequencing identifies the molecular genetic cause for the absence of a Gy5 glycinin protein in soybean PI 603408

    USDA-ARS?s Scientific Manuscript database

    During ongoing proteomic analysis of the soybean (Glycine max (L.) Merr) germplasm collection, PI 603408 was identified as a landrace whose seeds lack accumulation of one of the major seed storage glycinin protein subunits. Whole genomic resequencing was used to identify a two-base deletion affectin...

  15. [Phenotypic and genetic analysis of a patient presented with Tietz/Waardenburg type II a syndrome].

    PubMed

    Wang, Huanhuan; Tang, Lifang; Zhang, Jingmin; Hu, Qin; Chen, Yingwei; Xiao, Bing

    2015-08-01

    To determine the genetic cause for a patient featuring decreased pigmentation of the skin and iris, hearing loss and multiple congenital anomalies. Routine chromosomal banding was performed to analyze the karyotype of the patient and his parents. Single nucleotide polymorphism array (SNP array) was employed to identify cryptic chromosome aberrations, and quantitative real-time PCR was used to confirm the results. Karyotype analysis has revealed no obvious anomaly for the patient and his parents. SNP array analysis of the patient has demonstrated a 3.9 Mb deletion encompassing 3p13p14.1, which caused loss of entire MITF gene. The deletion was confirmed by quantitative real-time PCR. Clinical features of the patient have included severe bilateral hearing loss, decreased pigmentation of the skin and iris and multiple congenital anomalies. The patient, carrying a 3p13p14.1 deletion, has features of Tietz syndrome/Waardenburg syndrome type IIa. This case may provide additional data for the study of genotype-phenotype correlation of this disease.

  16. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  17. Characterization of a human X-linked gene from the DXS732E locus in the candidate region for the anhidrotic ectodermal dysplasia (EDA) gene (Xq13.1)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gault, J.; Zonana, J.; Zeltinger, J.

    A conserved mouse genomic clone was used to identify a homologous human genomic clone (the DXS732E locus), which was subsequently employed to isolate cDNAs from a human fetal brain library. Nine unique overlapping cDNAs were isolated, and sequences analysis of 3.9 kb identified a putative 1 kb ORF. GRAIL analysis of the sequence supported the hypothesis that the putative ORF was coding sequence, and Prosite analysis of the putative ORF identified potential glycosylation and phosphorylation sites. The 5{prime} end of the gene maps within a CpG island, and comparison of cDNA sequences indicate the gene is alternatively spliced at itsmore » 3{prime} end. Northern analysis and RT-PCR indicate that two different sized messages appear to be expressed with the gene expressed in human fetal kidney, intestine, brain, and muscle. The gene is expressed in 77 day human skin, a time when hair follicle formation occurs. Anhidrotic ectodermal dysplasia (EDA) results in the abnormal morphogenesis of hair, teeth and eccrine sweat glands. A positional cloning strategy towards cloning the EDA gene had been used, and deletion and X-autosome translocation patients have been useful in further delimiting the EDA region. The present gene at the DXS732E locus is partially deleted in one EDA patient who does not have other apparent abnormalities. No rearrangements of the gene have been detected in two female X-autosome translocation EDA patients, nor in four additional male patients with submicroscopic molecular deletions.« less

  18. Congenital disorder of glycosylation Ic due to a de novo deletion and an hALG-6 mutation.

    PubMed

    Eklund, Erik A; Sun, Liangwu; Yang, Samuel P; Pasion, Romela M; Thorland, Erik C; Freeze, Hudson H

    2006-01-20

    We describe a new cause of congenital disorder of glycosylation-Ic (CDG-Ic) in a young girl with a rather mild CDG phenotype. Her cells accumulated lipid-linked oligosaccharides lacking three glucose residues, and sequencing of the ALG6 gene showed what initially appeared to be a homozygous novel point mutation (338G>A). However, haplotype analysis showed that the patient does not carry any paternal DNA markers extending 33kb in the telomeric direction from the ALG6 region, and microsatellite analysis extended the abnormal region to at least 2.5Mb. We used high-resolution karyotyping to confirm a deletion (10-12Mb) [del(1)(p31.2p32.3)] and found no structural abnormalities in the father, suggesting a de novo event. Our findings extend the causes of CDG to larger DNA deletions and identify the first Japanese CDG-Ic mutation.

  19. Compound heterozygous deletions in pseudoautosomal region 1 in an infant with mild manifestations of langer mesomelic dysplasia.

    PubMed

    Tsuchiya, Takayoshi; Shibata, Minoru; Numabe, Hironao; Jinno, Tomoko; Nakabayashi, Kazuhiko; Nishimura, Gen; Nagai, Toshiro; Ogata, Tsutomu; Fukami, Maki

    2014-02-01

    Haploinsufficiency of SHOX on the short arm pseudoautosomal region (PAR1) leads to Leri-Weill dyschondrosteosis (LWD), and nullizygosity of SHOX results in Langer mesomelic dysplasia (LMD). Molecular defects of LWD/LMD include various microdeletions in PAR1 that involve exons and/or the putative upstream or downstream enhancer regions of SHOX, as well as several intragenic mutations. Here, we report on a Japanese male infant with mild manifestations of LMD and hitherto unreported microdeletions in PAR1. Clinical analysis revealed mesomelic short stature with various radiological findings indicative of LMD. Molecular analyses identified compound heterozygous deletions, that is, a maternally inherited ∼46 kb deletion involving the upstream region and exons 1-5 of SHOX, and a paternally inherited ∼500 kb deletion started from a position ∼300 kb downstream from SHOX. In silico analysis revealed that the downstream deletion did not affect the known putative enhancer regions of SHOX, although it encompassed several non-coding elements which were well conserved among various species with SHOX orthologs. These results provide the possibility of the presence of a novel enhancer for SHOX in the genomic region ∼300 to ∼800 kb downstream of the start codon. © 2013 Wiley Periodicals, Inc.

  20. Prognostic significance of KIT exon 11 deletion mutation in intermediate-risk gastrointestinal stromal tumor.

    PubMed

    Quek, Richard; Farid, Mohamad; Kanjanapan, Yada; Lim, Cindy; Tan, Iain Beehuat; Kesavan, Sittampalam; Lim, Tony Kiat Hon; Oon, Lynette Lin-Ean; Goh, Brian Kp; Chan, Weng Hoong; Teo, Melissa; Chung, Alexander Yf; Ong, Hock Soo; Wong, Wai Keong; Tan, Patrick; Yip, Desmond

    2017-06-01

    Benefit of adjuvant imatinib therapy following curative resection in patients with intermediate-risk gastrointestinal stromal tumor (GIST) is unclear. GIST-specific exon mutations, in particular exon 11 deletions, have been shown to be prognostic. We hypothesize that specific KIT mutations may improve risk stratification in patients with intermediate-risk GIST, identifying a subgroup of patients who may benefit from adjuvant therapy. In total, 142 GIST patients with complete clinicopathologic and mutational data from two sites were included. Risk classification was based on the modified National Institute of Health (NIH) criteria. In this cohort, 74% (n = 105) of patients harbored a KIT mutation; 61% (n = 86) were found in exon 11 of which nearly 70% were KIT exon 11 deletions (n = 60). A total of 18% (n = 25) of cases were classified as having intermediate-risk disease. Univariate analysis confirmed tumor size, mitotic index, nongastric origin, presence of tumor rupture and modified NIH criteria were adversely prognostic for relapse-free survival (RFS). Among KIT/PDGFRA mutants, KIT exon 11 deletions had a significantly worse prognosis (hazard ratio 2.31; 95% confidence interval, 1.30-4.10; P = 0.003). Multivariate analysis confirmed KIT exon 11 deletion (P = 0.003) and clinical risk classification (P < 0.001) as independent adverse prognostic factors for RFS. Intermediate-risk patients harboring KIT exon 11 deletions had RFS outcomes similar to high-risk patients. The presence of KIT exon 11 deletion mutation in patients with intermediate-risk GIST is associated with an inferior clinical outcome with RFS similar to high-risk patients. © 2016 John Wiley & Sons Australia, Ltd.

  1. Lynch syndrome-associated extracolonic tumors are rare in two extended families with the same EPCAM deletion.

    PubMed

    Lynch, Henry T; Riegert-Johnson, Douglas L; Snyder, Carrie; Lynch, Jane F; Hagenkord, Jill; Boland, C Richard; Rhees, Jennifer; Thibodeau, Stephen N; Boardman, Lisa A; Davies, Janine; Kuiper, Roland P; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J L

    2011-10-01

    The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3' end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution's standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. Both families were found to harbor the same deletion at the 3' end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC.

  2. Use of deep whole-genome sequencing data to identify structure risk variants in breast cancer susceptibility genes.

    PubMed

    Guo, Xingyi; Shi, Jiajun; Cai, Qiuyin; Shu, Xiao-Ou; He, Jing; Wen, Wanqing; Allen, Jamie; Pharoah, Paul; Dunning, Alison; Hunter, David J; Kraft, Peter; Easton, Douglas F; Zheng, Wei; Long, Jirong

    2018-03-01

    Functional disruptions of susceptibility genes by large genomic structure variant (SV) deletions in germlines are known to be associated with cancer risk. However, few studies have been conducted to systematically search for SV deletions in breast cancer susceptibility genes. We analysed deep (> 30x) whole-genome sequencing (WGS) data generated in blood samples from 128 breast cancer patients of Asian and European descent with either a strong family history of breast cancer or early cancer onset disease. To identify SV deletions in known or suspected breast cancer susceptibility genes, we used multiple SV calling tools including Genome STRiP, Delly, Manta, BreakDancer and Pindel. SV deletions were detected by at least three of these bioinformatics tools in five genes. Specifically, we identified heterozygous deletions covering a fraction of the coding regions of BRCA1 (with approximately 80kb in two patients), and TP53 genes (with ∼1.6 kb in two patients), and of intronic regions (∼1 kb) of the PALB2 (one patient), PTEN (three patients) and RAD51C genes (one patient). We confirmed the presence of these deletions using real-time quantitative PCR (qPCR). Our study identified novel SV deletions in breast cancer susceptibility genes and the identification of such SV deletions may improve clinical testing.

  3. A systematic review and meta-analysis of individual patient data on the impact of the BIM deletion polymorphism on treatment outcomes in epidermal growth factor receptor mutant lung cancer

    PubMed Central

    Allen, John C.; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A.; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C.; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J.; Tan, Daniel S.; Tan, Eng-Huat; Ong, S. Tiong; Lim, Wan-Teck

    2017-01-01

    Background A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. Results In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06–2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251–2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603–4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063–1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. Materials and Methods 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. Conclusions In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised. PMID:28467813

  4. Haploinsufficiency of HDAC4 Causes Brachydactyly Mental Retardation Syndrome, with Brachydactyly Type E, Developmental Delays, and Behavioral Problems

    PubMed Central

    Williams, Stephen R.; Aldred, Micheala A.; Der Kaloustian, Vazken M.; Halal, Fahed; Gowans, Gordon; McLeod, D. Ross; Zondag, Sara; Toriello, Helga V.; Magenis, R. Ellen; Elsea, Sarah H.

    2010-01-01

    Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4−/− mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome. PMID:20691407

  5. Reviewing Large LAMA2 Deletions and Duplications in Congenital Muscular Dystrophy Patients.

    PubMed

    Oliveira, Jorge; Gonçalves, Ana; Oliveira, Márcia E; Fineza, Isabel; Pavanello, Rita C M; Vainzof, Mariz; Bronze-da-Rocha, Elsa; Santos, Rosário; Sousa, Mário

    2014-01-01

    Congenital muscular dystrophy (CMD) type 1A (MDC1A) is caused by recessive mutations in laminin-α2 (LAMA2) gene. Laminin-211, a heterotrimeric glycoprotein that contains the α2 chain, is crucial for muscle stability establishing a bond between the sarcolemma and the extracellular matrix. More than 215 mutations are listed in the locus specific database (LSDB) for LAMA2 gene (May 2014). A limited number of large deletions/duplications have been reported in LAMA2. Our main objective was the identification of additional large rearrangements in LAMA2 found in CMD patients and a systematic review of cases in the literature and LSDB. In four of the fifty-two patients studied over the last 10 years, only one heterozygous mutation was identified, after sequencing and screening for a frequent LAMA2 deletion. Initial screening of large mutations was performed by multiplex ligation-dependent probe application (MLPA). Further characterization implied several techniques: long-range PCR, cDNA and Southern-blot analysis. Three novel large deletions in LAMA2 and the first pathogenic large duplication were successfully identified, allowing a definitive molecular diagnosis, carrier screening and prenatal diagnosis. A total of fifteen deletions and two duplications previously reported were also reviewed. Two possible mutational "hotspots" for deletions may exist, the first encompassing exons 3 and 4 and second in the 3' region (exons 56 to 65) of LAMA2. Our findings show that this type of mutation is fairly frequent (18.4% of mutated alleles) and is underestimated in the literature. It is important to include the screening of large deletions/duplications as part of the genetic diagnosis strategy.

  6. Chromosomal microarray testing identifies a 4p terminal region associated with seizures in Wolf-Hirschhorn syndrome.

    PubMed

    Ho, Karen S; South, Sarah T; Lortz, Amanda; Hensel, Charles H; Sdano, Mallory R; Vanzo, Rena J; Martin, Megan M; Peiffer, Andreas; Lambert, Christophe G; Calhoun, Amy; Carey, John C; Battaglia, Agatino

    2016-04-01

    Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving variable size deletions of the 4p16.3 region. Seizures are frequently, but not always, associated with WHS. We hypothesised that the size and location of the deleted region may correlate with seizure presentation. Using chromosomal microarray analysis, we finely mapped the breakpoints of copy number variants (CNVs) in 48 individuals with WHS. Seizure phenotype data were collected through parent-reported answers to a comprehensive questionnaire and supplemented with available medical records. We observed a significant correlation between the presence of an interstitial 4p deletion and lack of a seizure phenotype (Fisher's exact test p=3.59e-6). In our cohort, there were five individuals with interstitial deletions with a distal breakpoint at least 751 kbp proximal to the 4p terminus. Four of these individuals have never had an observable seizure, and the fifth individual had a single febrile seizure at the age of 1.5 years. All other individuals in our cohort whose deletions encompass the terminal 751 kbp region report having seizures typical of WHS. Additional examples from the literature corroborate these observations and further refine the candidate seizure susceptibility region to a region 197 kbp in size, starting 368 kbp from the terminus of chromosome 4. We identify a small terminal region of chromosome 4p that represents a seizure susceptibility region. Deletion of this region in the context of WHS is sufficient for seizure occurrence. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  7. Haploinsufficiency of HDAC4 causes brachydactyly mental retardation syndrome, with brachydactyly type E, developmental delays, and behavioral problems.

    PubMed

    Williams, Stephen R; Aldred, Micheala A; Der Kaloustian, Vazken M; Halal, Fahed; Gowans, Gordon; McLeod, D Ross; Zondag, Sara; Toriello, Helga V; Magenis, R Ellen; Elsea, Sarah H

    2010-08-13

    Brachydactyly mental retardation syndrome (BDMR) is associated with a deletion involving chromosome 2q37. BDMR presents with a range of features, including intellectual disabilities, developmental delays, behavioral abnormalities, sleep disturbance, craniofacial and skeletal abnormalities (including brachydactyly type E), and autism spectrum disorder. To date, only large deletions of 2q37 have been reported, making delineation of a critical region and subsequent identification of candidate genes difficult. We present clinical and molecular analysis of six individuals with overlapping deletions involving 2q37.3 that refine the critical region, reducing the candidate genes from >20 to a single gene, histone deacetylase 4 (HDAC4). Driven by the distinct hand and foot anomalies and similar cognitive features, we identified other cases with clinical findings consistent with BDMR but without a 2q37 deletion, and sequencing of HDAC4 identified de novo mutations, including one intragenic deletion probably disrupting normal splicing and one intragenic insertion that results in a frameshift and premature stop codon. HDAC4 is a histone deacetylase that regulates genes important in bone, muscle, neurological, and cardiac development. Reportedly, Hdac4(-/-) mice have severe bone malformations resulting from premature ossification of developing bones. Data presented here show that deletion or mutation of HDAC4 results in reduced expression of RAI1, which causes Smith-Magenis syndrome when haploinsufficient, providing a link to the overlapping findings in these disorders. Considering the known molecular function of HDAC4 and the mouse knockout phenotype, taken together with deletion or mutation of HDAC4 in multiple subjects with BDMR, we conclude that haploinsufficiency of HDAC4 results in brachydactyly mental retardation syndrome.

  8. Developmental Coordination Disorder in a Patient with Mental Disability and a Mild Phenotype Carrying Terminal 6q26-qter Deletion

    PubMed Central

    De Cinque, Marianna; Palumbo, Orazio; Mazzucco, Ermelinda; Simone, Antonella; Palumbo, Pietro; Ciavatta, Renata; Maria, Giuliana; Ferese, Rosangela; Gambardella, Stefano; Angiolillo, Antonella; Carella, Massimo; Garofalo, Silvio

    2017-01-01

    Terminal deletion of chromosome 6q is a rare chromosomal abnormality associated with variable phenotype spectrum. Although intellectual disability, facial dysmorphism, seizures and brain abnormalities are typical features of this syndrome, genotype–phenotype correlation needs to be better understood. We report the case of a 6-year-old Caucasian boy with a clinical diagnosis of intellectual disability, delayed language development and dyspraxia who carries an approximately 8 Mb de novo heterozygous microdeletion in the 6q26-q27 locus identified by karyotype and defined by high-resolution SNP-array analysis. This patient has no significant structural brain or other organ malformation, and he shows a very mild phenotype compared to similar 6q26-qter deletion. The patient phenotype also suggests that a dyspraxia susceptibility gene is located among the deleted genes. PMID:29270193

  9. Carcinogens induce reversion of the mouse pink-eyed unstable mutation

    PubMed Central

    Schiestl, Robert H.; Aubrecht, Jiri; Khogali, Fathia; Carls, Nicholas

    1997-01-01

    Deletions and other genome rearrangements are associated with carcinogenesis and inheritable diseases. The pink-eyed unstable (pun) mutation in the mouse is caused by duplication of a 70-kb internal fragment of the p gene. Spontaneous reversion events in homozygous pun/pun mice occur through deletion of a duplicated sequence. Reversion events in premelanocytes in the mouse embryo detected as black spots on the gray fur of the offspring were inducible by the carcinogen x-rays, ethyl methanesulfonate, methyl methanesulfonate, ethyl nitrosourea, benzo[a]pyrene, trichloroethylene, benzene, and sodium arsenate. The latter three carcinogens are not detectable with several in vitro or in vivo mutagenesis assays. We studied the molecular mechanism of the carcinogen-induced reversion events by cDNA analysis using reverse transcriptase–PCR method and identified the induced reversion events as deletions. DNA deletion assays may be sensitive indicators for carcinogen exposure. PMID:9114032

  10. A large deletion in the succinate dehydrogenase B gene (SDHB) in a Japanese patient with abdominal paraganglioma and concomitant metastasis.

    PubMed

    Kodama, Hitomi; Iihara, Masatoshi; Nissato, Sumiko; Isobe, Kazumasa; Kawakami, Yasushi; Okamoto, Takahiro; Takekoshi, Kazuhiro

    2010-01-01

    Recently, mutations in nuclear genes encoding two mitochondrial complex II subunit proteins, Succinate dehydrogenase D (SDHD) and SDHB, have been found to be associated with the development of familial pheochromocytomas and paragangliomas (hereditary pheochromocytoma/paraganglioma syndrome: HPPS). Growing evidence suggests that the mutation of SDHB is highly associated with abdominal paraganglioma and the following distant metastasis (malignant paraganglioma). In the present study, we used multiplex ligation dependent probe amplification (MLPA) analysis to identify a large heterozygous SDHB gene deletion encompassing sequences corresponding to the promoter region, in addition to exon 1 and exon 2 malignant paraganglioma patient in whom previously characterized SDHB mutations were undetectable. This is the first Japanese case report of malignant paraganglioma, with a large SDHB deletions. Our present findings strongly support the notion that large deletions in the SDHB gene should be considered in patients lacking characterized SDHB mutations.

  11. Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis.

    PubMed

    Vishwakarma, Manish K; Kale, Sandip M; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K; Varshney, Rajeev K

    2017-01-01

    Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis , we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut ( Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis . The majority of the InDels were of single bp (43.7%) and 2-10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of "K" genome, although distinct from both the "A" and "B" genomes, but more similar to "B" genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications.

  12. Genome-Wide Discovery and Deployment of Insertions and Deletions Markers Provided Greater Insights on Species, Genomes, and Sections Relationships in the Genus Arachis

    PubMed Central

    Vishwakarma, Manish K.; Kale, Sandip M.; Sriswathi, Manda; Naresh, Talari; Shasidhar, Yaduru; Garg, Vanika; Pandey, Manish K.; Varshney, Rajeev K.

    2017-01-01

    Small insertions and deletions (InDels) are the second most prevalent and the most abundant structural variations in plant genomes. In order to deploy these genetic variations for genetic analysis in genus Arachis, we conducted comparative analysis of the draft genome assemblies of both the diploid progenitor species of cultivated tetraploid groundnut (Arachis hypogaea L.) i.e., Arachis duranensis (A subgenome) and Arachis ipaënsis (B subgenome) and identified 515,223 InDels. These InDels include 269,973 insertions identified in A. ipaënsis against A. duranensis while 245,250 deletions in A. duranensis against A. ipaënsis. The majority of the InDels were of single bp (43.7%) and 2–10 bp (39.9%) while the remaining were >10 bp (16.4%). Phylogenetic analysis using genotyping data for 86 (40.19%) polymorphic markers grouped 96 diverse Arachis accessions into eight clusters mostly by the affinity of their genome. This study also provided evidence for the existence of “K” genome, although distinct from both the “A” and “B” genomes, but more similar to “B” genome. The complete homology between A. monticola and A. hypogaea tetraploid taxa showed a very similar genome composition. The above analysis has provided greater insights into the phylogenetic relationship among accessions, genomes, sub species and sections. These InDel markers are very useful resource for groundnut research community for genetic analysis and breeding applications. PMID:29312366

  13. Epidermal growth factor receptor mutations in adenocarcinoma in situ and minimally invasive adenocarcinoma detected using mutation-specific monoclonal antibodies.

    PubMed

    Nakamura, Haruhiko; Koizumi, Hirotaka; Kimura, Hiroyuki; Marushima, Hideki; Saji, Hisashi; Takagi, Masayuki

    2016-09-01

    Epidermal growth factor receptor (EGFR) mutation rates in adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) were studied using both DNA analysis and mutation-specific immunohistochemistry. The peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp method was used to detect mutations in exons 18, 19, 20, and 21 of the EGFR gene in DNA samples extracted from paraffin-embedded tissue sections. Simultaneously, immunohistochemical analysis with two EGFR mutation-specific monoclonal antibodies was used to identify proteins resulting from an in-frame deletion in exon 19 (E746_A750del) and a point mutation replacing leucine with arginine at codon 858 of exon 21 (L858R). Forty-three tumors (22 AIS and 21 MIA) were examined. The EGFR mutation rate in AIS detected by DNA analysis was 27.3% (L858R, 5/22; exon 19 deletion,1/22), whereas that detected in MIA was 42.9% (L858R,4/21; exon 19 deletion,5/21). Mutations detected by immunohistochemical analysis included 22.7% (L858R, 4/22; exon 19 deletion, 1/22) in AIS and 42.9% (L858R, 4/21; exon 19 deletion, 5/21) in MIA. Although some results were contradictory, concordant results were obtained using both assays in 38 of 43 cases (88.4%). DNA and immunohistochemical analyses revealed similar EGFR mutation rates in both MIA and AIS, suggesting that mutation-specific monoclonal antibodies are useful to confirm DNA assay results. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  14. A recessive contiguous gene deletion causing infantile hyperinsulinism, enteropathy and deafness identifies the Usher type 1C gene.

    PubMed

    Bitner-Glindzicz, M; Lindley, K J; Rutland, P; Blaydon, D; Smith, V V; Milla, P J; Hussain, K; Furth-Lavi, J; Cosgrove, K E; Shepherd, R M; Barnes, P D; O'Brien, R E; Farndon, P A; Sowden, J; Liu, X Z; Scanlan, M J; Malcolm, S; Dunne, M J; Aynsley-Green, A; Glaser, B

    2000-09-01

    Usher syndrome type 1 describes the association of profound, congenital sensorineural deafness, vestibular hypofunction and childhood onset retinitis pigmentosa. It is an autosomal recessive condition and is subdivided on the basis of linkage analysis into types 1A through 1E. Usher type 1C maps to the region containing the genes ABCC8 and KCNJ11 (encoding components of ATP-sensitive K + (KATP) channels), which may be mutated in patients with hyperinsulinism. We identified three individuals from two consanguineous families with severe hyperinsulinism, profound congenital sensorineural deafness, enteropathy and renal tubular dysfunction. The molecular basis of the disorder is a homozygous 122-kb deletion of 11p14-15, which includes part of ABCC8 and overlaps with the locus for Usher syndrome type 1C and DFNB18. The centromeric boundary of this deletion includes part of a gene shown to be mutated in families with type 1C Usher syndrome, and is hence assigned the name USH1C. The pattern of expression of the USH1C protein is consistent with the clinical features exhibited by individuals with the contiguous gene deletion and with isolated Usher type 1C.

  15. The preS deletion of hepatitis B virus (HBV) is associated with liver fibrosis progression in patients with chronic HBV infection.

    PubMed

    Li, Fan; Li, Xiaodong; Yan, Tao; Liu, Yan; Cheng, Yongqian; Xu, Zhihui; Shao, Qing; Liao, Hao; Huang, Pengyu; Li, Jin; Chen, Guo-Feng; Xu, Dongping

    2018-03-01

    Limited data are available regarding the association of hepatitis B virus (HBV) mutations with liver fibrosis in HBV infection. The study aimed to clarify whether HBV preS deletion mutation is associated with liver fibrosis progression. A total of 469 patients were enrolled, including 324 with chronic hepatitis B (CHB), 28 with HBV-related compensated liver cirrhosis (LC), and 117 with HBV-related decompensated LC. All CHB and compensated LC patients received liver biopsy. Fibrosis grade was assessed using METAVIR score. HBV preS deletion was determined by direct sequencing and verified by clonal sequencing. Overall preS deletion was detected in 12.6% (59/469) patients, specifically, in 7.51% (13/173), 10.60% (16/151), and 20.69% (30/145) of patients with no-to-mild liver fibrosis (F0-1), moderate-to-severe liver fibrosis (F2-3), and cirrhosis (F4), respectively (p < 0.01). Patients with preS-deleted HBV had lower serum HBV DNA and albumin levels compared to patients with wild-type HBV. The median length of preS deletion was 39-base pairs (bp) (3-204 bp) and the deletion most frequently emerged in preS2 initial region. Multivariate analysis identified the preS2 deletion rather than preS1 deletion to be an independent risk factor of significant fibrosis, i.e., METAVIR F ≥ 2 (p = 0.007). In addition, preS-deleted viral sequences were detected in the pool of intrahepatic HBV covalently closed circular DNA. HBV preS deletion is positively associated with liver fibrosis progression in chronic HBV-infected patients. HBV preS2 deletion may serve as a warning indicator for liver fibrosis progression.

  16. Assessment of copy number variations in 120 patients with Poland syndrome.

    PubMed

    Vaccari, Carlotta Maria; Tassano, Elisa; Torre, Michele; Gimelli, Stefania; Divizia, Maria Teresa; Romanini, Maria Victoria; Bossi, Simone; Musante, Ilaria; Valle, Maura; Senes, Filippo; Catena, Nunzio; Bedeschi, Maria Francesca; Baban, Anwar; Calevo, Maria Grazia; Acquaviva, Massimo; Lerone, Margherita; Ravazzolo, Roberto; Puliti, Aldamaria

    2016-11-25

    Poland Syndrome (PS) is a rare congenital disorder presenting with agenesis/hypoplasia of the pectoralis major muscle variably associated with thoracic and/or upper limb anomalies. Most cases are sporadic, but familial recurrence, with different inheritance patterns, has been observed. The genetic etiology of PS remains unknown. Karyotyping and array-comparative genomic hybridization (CGH) analyses can identify genomic imbalances that can clarify the genetic etiology of congenital and neurodevelopmental disorders. We previously reported a chromosome 11 deletion in twin girls with pectoralis muscle hypoplasia and skeletal anomalies, and a chromosome six deletion in a patient presenting a complex phenotype that included pectoralis muscle hypoplasia. However, the contribution of genomic imbalances to PS remains largely unknown. To investigate the prevalence of chromosomal imbalances in PS, standard cytogenetic and array-CGH analyses were performed in 120 PS patients. Following the application of stringent filter criteria, 14 rare copy number variations (CNVs) were identified in 14 PS patients in different regions outside known common copy number variations: seven genomic duplications and seven genomic deletions, enclosing the two previously reported PS associated chromosomal deletions. These CNVs ranged from 0.04 to 4.71 Mb in size. Bioinformatic analysis of array-CGH data indicated gene enrichment in pathways involved in cell-cell adhesion, DNA binding and apoptosis processes. The analysis also provided a number of candidate genes possibly causing the developmental defects observed in PS patients, among others REV3L, a gene coding for an error-prone DNA polymerase previously associated with Möbius Syndrome with variable phenotypes including pectoralis muscle agenesis. A number of rare CNVs were identified in PS patients, and these involve genes that represent candidates for further evaluation. Rare inherited CNVs may contribute to, or represent risk factors of PS in a multifactorial mode of inheritance.

  17. Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned

    PubMed Central

    Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun

    2015-01-01

    This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217

  18. Identifying allelic loss and homozygous deletions in pancreatic cancer without matched normals using high-density single-nucleotide polymorphism arrays.

    PubMed

    Calhoun, Eric S; Hucl, Tomas; Gallmeier, Eike; West, Kristen M; Arking, Dan E; Maitra, Anirban; Iacobuzio-Donahue, Christine A; Chakravarti, Aravinda; Hruban, Ralph H; Kern, Scott E

    2006-08-15

    Recent advances in oligonucleotide arrays and whole-genome complexity reduction data analysis now permit the evaluation of tens of thousands of single-nucleotide polymorphisms simultaneously for a genome-wide analysis of allelic status. Using these arrays, we created high-resolution allelotype maps of 26 pancreatic cancer cell lines. The areas of heterozygosity implicitly served to reveal regions of allelic loss. The array-derived maps were verified by a panel of 317 microsatellite markers used in a subset of seven samples, showing a 97.1% concordance between heterozygous calls. Three matched tumor/normal pairs were used to estimate the false-negative and potential false-positive rates for identifying loss of heterozygosity: 3.6 regions (average minimal region of loss, 720,228 bp) and 2.3 regions (average heterozygous gap distance, 4,434,994 bp) per genome, respectively. Genomic fractional allelic loss calculations showed that cumulative levels of allelic loss ranged widely from 17.1% to 79.9% of the haploid genome length. Regional increases in "NoCall" frequencies combined with copy number loss estimates were used to identify 41 homozygous deletions (19 first reports), implicating an additional 13 regions disrupted in pancreatic cancer. Unexpectedly, 23 of these occurred in just two lines (BxPc3 and MiaPaCa2), suggesting the existence of at least two subclasses of chromosomal instability (CIN) patterns, distinguished here by allelic loss and copy number changes (original CIN) and those also highly enriched in the genomic "holes" of homozygous deletions (holey CIN). This study provides previously unavailable high-resolution allelotype and deletion breakpoint maps in widely shared pancreatic cancer cell lines and effectively eliminates the need for matched normal tissue to define informative loci.

  19. Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

    PubMed Central

    Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

    2012-01-01

    We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the organization of spinal locomotor networks. PMID:22869012

  20. Novel deletion of the E3A ubiquitin protein ligase gene detected by multiplex ligation-dependent probe amplification in a patient with Angelman syndrome

    PubMed Central

    Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio

    2010-01-01

    Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004

  1. Creation and genomic analysis of irradiation hybrids in Populus

    Treesearch

    Matthew S. Zinkgraf; K. Haiby; M.C. Lieberman; L. Comai; I.M. Henry; Andrew Groover

    2016-01-01

    Establishing efficient functional genomic systems for creating and characterizing genetic variation in forest trees is challenging. Here we describe protocols for creating novel gene-dosage variation in Populus through gamma-irradiation of pollen, followed by genomic analysis to identify chromosomal regions that have been deleted or inserted in...

  2. Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat

    PubMed Central

    Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying

    2018-01-01

    A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P < 0.01), and the average first-born litter size of individuals with an insertion/insertion genotype higher than that of those with the deletion/deletion genotype (P < 0.05). There was also a significant difference in genotype distributions of the 16 bp indel between mothers of single-lamb and multi-lamb litters in the studied goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081

  3. Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

    PubMed Central

    Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

    1989-01-01

    We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

  4. Influence of the LILRA3 Deletion on Multiple Sclerosis Risk: Original Data and Meta-Analysis

    PubMed Central

    Ortiz, Miguel A.; Núñez, Concepción; Ordóñez, David; Alvarez-Cermeño, José C.; Martínez-Rodriguez, José E.; Sánchez, Antonio J.; Arroyo, Rafael; Izquierdo, Guillermo; Malhotra, Sunny; Montalban, Xavier; García-Merino, Antonio; Munteis, Elvira; Alcina, Antonio; Comabella, Manuel; Matesanz, Fuencisla

    2015-01-01

    Background Multiple sclerosis (MS) is a neurodegenerative, autoimmune disease of the central nervous system. Genome-wide association studies (GWAS) have identified over hundred polymorphisms with modest individual effects in MS susceptibility and they have confirmed the main individual effect of the Major Histocompatibility Complex. Additional risk loci with immunologically relevant genes were found significantly overrepresented. Nonetheless, it is accepted that most of the genetic architecture underlying susceptibility to the disease remains to be defined. Candidate association studies of the leukocyte immunoglobulin-like receptor LILRA3 gene in MS have been repeatedly reported with inconsistent results. Objectives In an attempt to shed some light on these controversial findings, a combined analysis was performed including the previously published datasets and three newly genotyped cohorts. Both wild-type and deleted LILRA3 alleles were discriminated in a single-tube PCR amplification and the resulting products were visualized by their different electrophoretic mobilities. Results and Conclusion Overall, this meta-analysis involved 3200 MS patients and 3069 matched healthy controls and it did not evidence significant association of the LILRA3 deletion [carriers of LILRA3 deletion: p = 0.25, OR (95% CI) = 1.07 (0.95–1.19)], even after stratification by gender and the HLA-DRB1*15:01 risk allele. PMID:26274821

  5. In vivo functional analysis of L-rhamnose metabolic pathway in Aspergillus niger: a tool to identify the potential inducer of RhaR.

    PubMed

    Khosravi, Claire; Kun, Roland Sándor; Visser, Jaap; Aguilar-Pontes, María Victoria; de Vries, Ronald P; Battaglia, Evy

    2017-11-06

    The genes of the non-phosphorylative L-rhamnose catabolic pathway have been identified for several yeast species. In Schefferomyces stipitis, all L-rhamnose pathway genes are organized in a cluster, which is conserved in Aspergillus niger, except for the lra-4 ortholog (lraD). The A. niger cluster also contains the gene encoding the L-rhamnose responsive transcription factor (RhaR) that has been shown to control the expression of genes involved in L-rhamnose release and catabolism. In this paper, we confirmed the function of the first three putative L-rhamnose utilisation genes from A. niger through gene deletion. We explored the identity of the inducer of the pathway regulator (RhaR) through expression analysis of the deletion mutants grown in transfer experiments to L-rhamnose and L-rhamnonate. Reduced expression of L-rhamnose-induced genes on L-rhamnose in lraA and lraB deletion strains, but not on L-rhamnonate (the product of LraB), demonstrate that the inducer of the pathway is of L-rhamnonate or a compound downstream of it. Reduced expression of these genes in the lraC deletion strain on L-rhamnonate show that it is in fact a downstream product of L-rhamnonate. This work showed that the inducer of RhaR is beyond L-rhamnonate dehydratase (LraC) and is likely to be the 2-keto-3-L-deoxyrhamnonate.

  6. DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

    PubMed Central

    Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

    2014-01-01

    Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

  7. Analysis of BIM (BCL-2 like 11 gene) deletion polymorphism in Chinese non-small cell lung cancer patients

    PubMed Central

    Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie

    2014-01-01

    Background Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. Methods The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. Results The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. Conclusion The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival. PMID:26767045

  8. Analysis of BIM (BCL-2 like 11 gene) deletion polymorphism in Chinese non-small cell lung cancer patients.

    PubMed

    Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie

    2014-11-01

    Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival.

  9. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression

    PubMed Central

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M.; Goh, Elaine S.; Graham, Gail E.; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J.M.; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H.; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A.; Prasad, Chitra; Dick, Paul T.; Hussain, Asmaa S.; Walinga, Margreet; Reijenga, Renske G.; Gazzellone, Matthew; Lionel, Anath C.; Marshall, Christian R.; Scherer, Stephen W.; Stavropoulos, Dimitri J.; McCready, Elizabeth; Bassett, Anne S.

    2016-01-01

    Purpose The purpose of the current study was to assess the penetrance of NRXN1 deletions. Methods We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant CNVs was used as a proxy to estimate the relative penetrance of NRXN1 deletions. Results We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability, significantly greater than in controls [OR=8.14 (95% CI 2.91–22.72), p< 0.0001)]. Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3′ end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5′ NRXN1 deletion [OR=7.47 (95% CI 2.36–23.61), p=0.0006]. The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (p=0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV, a two-fold greater prevalence than for exonic NRXN1 deletion cases (p=0.0035). Conclusions The results support the importance of exons near the 5′ end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes. PMID:27195815

  10. Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

    PubMed

    Bai, Ying; Chen, Yibing; Kong, Xiangdong

    2018-02-02

    It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

  11. A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

    PubMed

    Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

    2000-01-01

    Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

  12. CCAAT/enhancer-binding protein alpha (CEBPA) polymorphisms and mutations in healthy individuals and in patients with peripheral artery disease, ischaemic heart disease and hyperlipidaemia.

    PubMed

    Fuchs, O; Kostecka, A; Provazníková, D; Krásná, B; Kotlín, R; Stanková, M; Kobylka, P; Dostálová, G; Zeman, M; Chochola, M

    2010-01-01

    The CCAAT/enhancer-binding protein alpha, encoded by the intronless CEBPA gene, is a transcription factor that induces expression of genes involved in differentiation of granulocytes, monocytes, adipocytes and hepatocytes. Both mono- and bi-allelic CEBPA mutations were detected in acute myeloid leukaemia and myelodysplastic syndrome. In this study we also identified CEBPA mutations in healthy individuals and in patients with peripheral artery disease, ischaemic heart disease and hyperlipidaemia. We found 16 various deletions with the presence of two direct repeats in CEBPA by analysis of 431 individuals. Three most frequent repeats included in these deletions in CEBPA gene are CGCGAG (493- 498_865-870), GG (486-487_885-886), and GCCAAGCAGC (508-517_907-916), all according to GenBank Accession No. NM_004364.2. In one case we identified that a father with ischaemic heart disease and his healthy son had two identical deletions (493_864del and 508_906del, both according to GenBank Accession No. NM_004364.2) in CEBPA. The occurrence of deletions between two repetitive sequences may be caused by recombination events in the repair process. A double-stranded cut in DNA may initiate these recombination events in adjacent DNA sequences. Four types of polymorphisms in the CEBPA gene were also detected in the screened individuals. Polymorphism in CEBPA gene 690 G>T according to GenBank Accession No. NM_004364.2 is the most frequent type in our analysis. Statistical analysis did not find significant differences in the frequency of polymorphisms in CEBPA in patients and in healthy individuals with the exception of P4 polymorphism (580_585dup according to GenBank Accesion No. NM_004364.2). P4 polymorphism was significantly increased in ischaemic heart disease patients.

  13. Molecular cytogenetic analysis of Xq critical regions in premature ovarian failure

    PubMed Central

    2013-01-01

    Background One of the frequent reasons for unsuccessful conception is premature ovarian failure/primary ovarian insufficiency (POF/POI) that is defined as the loss of functional follicles below the age of 40 years. Among the genetic causes the most common one involves the X chromosome, as in Turner syndrome, partial X deletion and X-autosome translocations. Here we report a case of a 27-year-old female patient referred to genetic counselling because of premature ovarian failure. The aim of this case study to perform molecular genetic and cytogenetic analyses in order to identify the exact genetic background of the pathogenic phenotype. Results For premature ovarian failure disease diagnostics we performed the Fragile mental retardation 1 gene analysis using Southern blot technique and Repeat Primed PCR in order to identify the relationship between the Fragile mental retardation 1 gene premutation status and the premature ovarion failure disease. At this early onset, the premature ovarian failure affected patient we detected one normal allele of Fragile mental retardation 1 gene and we couldn’t verify the methylated allele, therefore we performed the cytogenetic analyses using G-banding and fluorescent in situ hybridization methods and a high resolution molecular cytogenetic method, the array comparative genomic hybridization technique. For this patient applying the G-banding, we identified a large deletion on the X chromosome at the critical region (ChrX q21.31-q28) which is associated with the premature ovarian failure phenotype. In order to detect the exact breakpoints, we used a special cytogenetic array ISCA plus CGH array and we verified a 67.355 Mb size loss at the critical region which include total 795 genes. Conclusions We conclude for this case study that the karyotyping is definitely helpful in the evaluation of premature ovarian failure patients, to identify the non submicroscopic chromosomal rearrangement, and using the array CGH technique we can contribute to the most efficient detection and mapping of exact deletion breakpoints of the deleted Xq region. PMID:24359613

  14. Monosomy1p36.3 and trisomy 19p13.3 in a child with periventricular nodular heterotopia.

    PubMed

    Descartes, Maria; Mikhail, Fady M; Franklin, Judith C; McGrath, Tony M; Bebin, Martina

    2011-10-01

    Monosomy 1p36 is a clinically recognizable syndrome that is considered to be the most common terminal deletion syndrome. It has characteristic clinical features that include craniofacial dysmorphism, congenital anomalies, hearing deficits, developmental delay, mental retardation, hypotonia, seizures, and brain anomalies. Brain anomalies in patients with 1p36 deletion are frequent but inconsistent. To date, 2 cases with monosomy 1p36 associated with periventricular nodular heterotopia (PNH) have been reported. We report a 2-month-old boy with multiple congenital anomalies; brain magnetic resonance imaging revealed PNH. The first 2 described cases were pure terminal deletions, whereas our patient carried unbalanced translocation due to an adjacent 1 segregation of a balanced maternal translocation, resulting in monosomy 1p36.3 and trisomy 19p13.3 identified by whole-genome array comparative genomic hybridization analysis. Our patient, with a smaller deletion that the 2 previously reported cases, can help narrow the critical region for PNH in association with the 1p36 deletion. Several potential candidate genes are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

  15. Deletion detection for diagnosis of Duchenne muscular dystrophy in the Japanese population--comparison between the polymerase chain reaction and the Southern blot analysis.

    PubMed

    Katayama, S; Takeshita, N; Yano, T; Ubagai, T; Qiu, X J; Katagiri, Y; Kubo, H; Hirakawa, S

    1993-06-01

    We compared the efficacy of the multiplex PCR with that of the cDNA analysis for detection of deletions of the DMD gene in the Japanese patients. Thirty males with DMD from 27 Japanese families were studied by the multiplex PCR, and 24 of them were also investigated by Southern blot analysis. We used five dystrophin cDNA probes for deletion analysis. A total of 19 regions were amplified by the PCR to detect deletions, 9 regions by the method of Chamberlain et al. and another 10 regions by the method of Beggs et al. Deletions were detected in 14 (52%) out of 27 DMD families by the PCR. Southern blot analysis detected deletions in 14 (64%) out of 22 families. Thirteen (93%) of the 14 DMD families with deletions detected by Southern blotting were also confirmed by the multiplex PCR. Provided care is taken in cases where the deletion is limited to a single exon, the multiplex PCR appears to be an efficient and useful alternative to conventional Southern blot analysis for detecting deletions during the prenatal and postnatal diagnosis of DMD.

  16. Lynch Syndrome-Associated Extracolonic Tumors Are Rare in Two Extended Families With the Same EPCAM Deletion

    PubMed Central

    Lynch, Henry T.; Riegert-Johnson, Douglas L.; Snyder, Carrie; Lynch, Jane F.; Hagenkord, Jill; Boland, C. Richard; Rhees, Jennifer; Thibodeau, Stephen N.; Boardman, Lisa A.; Davies, Janine; Kuiper, Roland P.; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J.L.

    2013-01-01

    OBJECTIVES The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3′ end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. METHODS Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution’s standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. RESULTS Both families were found to harbor the same deletion at the 3′ end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. CONCLUSIONS Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC. PMID:21769135

  17. Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

    PubMed Central

    Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

    2014-01-01

    A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

  18. ∆F508 CFTR interactome remodelling promotes rescue of cystic fibrosis.

    PubMed

    Pankow, Sandra; Bamberger, Casimir; Calzolari, Diego; Martínez-Bartolomé, Salvador; Lavallée-Adam, Mathieu; Balch, William E; Yates, John R

    2015-12-24

    Deletion of phenylalanine 508 of the cystic fibrosis transmembrane conductance regulator (∆F508 CFTR) is the major cause of cystic fibrosis, one of the most common inherited childhood diseases. The mutated CFTR anion channel is not fully glycosylated and shows minimal activity in bronchial epithelial cells of patients with cystic fibrosis. Low temperature or inhibition of histone deacetylases can partly rescue ∆F508 CFTR cellular processing defects and function. A favourable change of ∆F508 CFTR protein-protein interactions was proposed as a mechanism of rescue; however, CFTR interactome dynamics during temperature shift and inhibition of histone deacetylases are unknown. Here we report the first comprehensive analysis of the CFTR and ∆F508 CFTR interactome and its dynamics during temperature shift and inhibition of histone deacetylases. By using a novel deep proteomic analysis method, we identify 638 individual high-confidence CFTR interactors and discover a ∆F508 deletion-specific interactome, which is extensively remodelled upon rescue. Detailed analysis of the interactome remodelling identifies key novel interactors, whose loss promote ∆F508 CFTR channel function in primary cystic fibrosis epithelia or which are critical for CFTR biogenesis. Our results demonstrate that global remodelling of ∆F508 CFTR interactions is crucial for rescue, and provide comprehensive insight into the molecular disease mechanisms of cystic fibrosis caused by deletion of F508.

  19. Array comparative genome hybridization in patients with developmental delay: two example cases.

    PubMed

    Hancarova, Miroslava; Drabova, Jana; Zmitkova, Zuzana; Vlckova, Marketa; Hedvicakova, Petra; Novotna, Drahuse; Vlckova, Zdenka; Vejvalkova, Sarka; Marikova, Tatana; Sedlacek, Zdenek

    2012-02-15

    Developmental delay is often a predictor of mental retardation (MR) or autism, two relatively frequent developmental disorders severely affecting intellectual and social functioning. The causes of these conditions remain unknown in most patients. They have a strong genetic component, but the specific genetic defects can only be identified in a fraction of patients. Recent developments in genomics supported the establishment of the causal link between copy number variants in the genomes of some patients and their affection. One of the techniques suitable for this analysis is array comparative genome hybridization, which can be used both for detailed mapping of chromosome rearrangements identified by classical cytogenetics and for the identification of novel submicroscopic gains or losses of genetic material. We illustrate the power of this approach in two patients. Patient 1 had a cytogenetically visible deletion of chromosome X and the molecular analysis was used to specify the gene content of the deletion and the prognosis of the child. Patient 2 had a seemingly normal karyotype and the analysis revealed a small recurrent deletion of chromosome 1 likely to be responsible for his phenotype. However, the genetic dissection of MR and autism is complicated by high heterogeneity of the genetic aberrations among patients and by broad variability of phenotypic effects of individual genetic defects. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Deletion of a Stay-Green Gene Associates with Adaptive Selection in Brassica napus.

    PubMed

    Qian, Lunwen; Voss-Fels, Kai; Cui, Yixin; Jan, Habib U; Samans, Birgit; Obermeier, Christian; Qian, Wei; Snowdon, Rod J

    2016-12-05

    Chlorophyll levels provide important information about plant growth and physiological plasticity in response to changing environments. The stay-green gene NON-YELLOWING 1 (NYE1) is believed to regulate chlorophyll degradation during senescence, concomitantly affecting the disassembly of the light-harvesting complex and hence indirectly influencing photosynthesis. We identified Brassica napus accessions carrying an NYE1 deletion associated with increased chlorophyll content, and with upregulated expression of light-harvesting complex and photosynthetic reaction center (PSI and PSII) genes. Comparative analysis of the seed oil content of accessions with related genetic backgrounds revealed that the B. napus NYE1 gene deletion (bnnye1) affected oil accumulation, and linkage disequilibrium signatures suggested that the locus has been subject to artificial selection by breeding in oilseed B. napus forms. Comparative analysis of haplotype diversity groups (haplogroups) between three different ecotypes of the allopolyploid B. napus and its A-subgenome diploid progenitor, Brassica rapa, indicated that introgression of the bnnye1 deletion from Asian B. rapa into winter-type B. napus may have simultaneously improved its adaptation to cooler environments experienced by autumn-sown rapeseed. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.

  1. Identification and characterization of novel mutations of the major Fanconi anemia gene FANCA in the Japanese population.

    PubMed

    Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki

    2004-12-01

    Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.

  2. Mutations in the Norrie disease gene.

    PubMed

    Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

    1995-01-01

    We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  4. Analysis of the complete genome of subgroup A' hepatitis B virus isolates from South Africa.

    PubMed

    Kramvis, Anna; Weitzmann, Louise; Owiredu, William K B A; Kew, Michael C

    2002-04-01

    A phylogenetic analysis is presented of six complete and seven pre-S1/S2/S gene sequences of hepatitis B virus (HBV) isolates from South Africa. Five of the full-length sequences and all of the pre-S2/S sequences have been previously reported. Four of the six complete genomes and three of the five incomplete sequences clustered with subgroup A', a unique segment of genotype A of HBV previously identified in 60% of South African isolates using analysis of the pre-S2/S region alone. This separation was also evident when the polymerase open reading frame was analysed, but not on analysis of either the X or pre-core/core genes. Amino acids were identified in the pre-S1 and polymerase regions specific to subgroup A'. In common with genotype D, 10 of 11 genotype A South African isolates had an 11 amino acid deletion in the amino end of the pre-S1 region. This deletion is also found in hepadnaviruses from non-human primates.

  5. Molecular characterization of NRXN1 deletions from 19,263 clinical microarray cases identifies exons important for neurodevelopmental disease expression.

    PubMed

    Lowther, Chelsea; Speevak, Marsha; Armour, Christine M; Goh, Elaine S; Graham, Gail E; Li, Chumei; Zeesman, Susan; Nowaczyk, Malgorzata J M; Schultz, Lee-Anne; Morra, Antonella; Nicolson, Rob; Bikangaga, Peter; Samdup, Dawa; Zaazou, Mostafa; Boyd, Kerry; Jung, Jack H; Siu, Victoria; Rajguru, Manjulata; Goobie, Sharan; Tarnopolsky, Mark A; Prasad, Chitra; Dick, Paul T; Hussain, Asmaa S; Walinga, Margreet; Reijenga, Renske G; Gazzellone, Matthew; Lionel, Anath C; Marshall, Christian R; Scherer, Stephen W; Stavropoulos, Dimitri J; McCready, Elizabeth; Bassett, Anne S

    2017-01-01

    The purpose of the current study was to assess the penetrance of NRXN1 deletions. We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant copy-number variations (CNVs) was used as a proxy to estimate the relative penetrance of NRXN1 deletions. We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability that were significantly greater than in controls (odds ratio (OR) = 8.14; 95% confidence interval (CI): 2.91-22.72; P < 0.0001). Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3' end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5' NRXN1 deletion (OR = 7.47; 95% CI: 2.36-23.61; P = 0.0006). The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (P = 0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV at a prevalence twice as high as that for exonic NRXN1 deletion cases (P = 0.0035). The results support the importance of exons near the 5' end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes.Genet Med 19 1, 53-61.

  6. NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

    PubMed Central

    Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

    2000-01-01

    Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

  7. Systematic Phenotyping of a Large-Scale Candida glabrata Deletion Collection Reveals Novel Antifungal Tolerance Genes

    PubMed Central

    Hiller, Ekkehard; Istel, Fabian; Tscherner, Michael; Brunke, Sascha; Ames, Lauren; Firon, Arnaud; Green, Brian; Cabral, Vitor; Marcet-Houben, Marina; Jacobsen, Ilse D.; Quintin, Jessica; Seider, Katja; Frohner, Ingrid; Glaser, Walter; Jungwirth, Helmut; Bachellier-Bassi, Sophie; Chauvel, Murielle; Zeidler, Ute; Ferrandon, Dominique; Gabaldón, Toni; Hube, Bernhard; d'Enfert, Christophe; Rupp, Steffen; Cormack, Brendan; Haynes, Ken; Kuchler, Karl

    2014-01-01

    The opportunistic fungal pathogen Candida glabrata is a frequent cause of candidiasis, causing infections ranging from superficial to life-threatening disseminated disease. The inherent tolerance of C. glabrata to azole drugs makes this pathogen a serious clinical threat. To identify novel genes implicated in antifungal drug tolerance, we have constructed a large-scale C. glabrata deletion library consisting of 619 unique, individually bar-coded mutant strains, each lacking one specific gene, all together representing almost 12% of the genome. Functional analysis of this library in a series of phenotypic and fitness assays identified numerous genes required for growth of C. glabrata under normal or specific stress conditions, as well as a number of novel genes involved in tolerance to clinically important antifungal drugs such as azoles and echinocandins. We identified 38 deletion strains displaying strongly increased susceptibility to caspofungin, 28 of which encoding proteins that have not previously been linked to echinocandin tolerance. Our results demonstrate the potential of the C. glabrata mutant collection as a valuable resource in functional genomics studies of this important fungal pathogen of humans, and to facilitate the identification of putative novel antifungal drug target and virulence genes. PMID:24945925

  8. 34 CFR 5.16 - Deletion of identifying details.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... PURSUANT TO PUB. L. 90-23 (Eff. until 7-14-10) What Records Are Available § 5.16 Deletion of identifying... shall be published or made available with such identifying details left blank, or shall be published or...

  9. Genomic analysis using high density SNP based oligonucleotide arrays and MLPA provides a comprehensive analysis of INI1/SMARCB1 in malignant rhabdoid tumors

    PubMed Central

    Jackson, Eric M.; Sievert, Angela J.; Gai, Xiaowu; Hakonarson, Hakon; Judkins, Alexander R; Tooke, Laura; Perin, Juan Carlos; Xie, Hongbo; Shaikh, Tamim H.; Biegel, Jaclyn A.

    2009-01-01

    Translational Relevance Previous reports suggested that abnormalities of INI1 could be detected in 70–75% of malignant rhabdoid tumors. The mechanism of inactivation in the other 25% remained unclear. The goal of this study was to perform a high-resolution genomic analysis of a large series of rhabdoid tumors with the expectation of identifying additional loci related to the initiation or progression of these malignancies. We also developed a comprehensive set of assays, including a new MLPA assay, to interrogate the INI1 locus in 22q11.2. Intragenic deletions could be detected using the Illumina 550K Beadchip, whereas single exon deletions could be detected using MLPA. The current study demonstrates that with a multi-platform approach, alterations at the INI1 locus can be detected in almost all cases. Thus, appropriate molecular genetic testing can be used as an aid in the diagnosis and for treatment planning for most patients. Purpose A high-resolution genomic profiling and comprehensive targeted analysis of INI1/SMARCB1 of a large series of pediatric rhabdoid tumors was performed. The aim was to identify regions of copy number change and loss of heterozygosity that might pinpoint additional loci involved in the development or progression of rhabdoid tumors, and define the spectrum of genomic alterations of INI1 in this malignancy. Experimental Design A multi-platform approach, utilizing Illumina single nucleotide polymorphism (SNP) based oligonucleotide arrays, multiplex ligation dependent probe amplification (MLPA), fluorescence in situ hybridization (FISH), and coding sequence analysis was used to characterize genome wide copy number changes, loss of heterozygosity, and genomic alterations of INI1/SMARCB1 in a series of pediatric rhabdoid tumors. Results The bi-allelic alterations of INI1 that led to inactivation were elucidated in 50 of 51 tumors. INI1 inactivation was demonstrated by a variety of mechanisms, including deletions, mutations, and loss of heterozygosity. The results from the array studies highlighted the complexity of rearrangements of chromosome 22, compared to the low frequency of alterations involving the other chromosomes. Conclusions The results from the genome wide SNP-array analysis suggest that INI1 is the primary tumor suppressor gene involved in the development of rhabdoid tumors with no second locus identified. In addition, we did not identify hot spots for the breakpoints in sporadic tumors with deletions of chromosome 22q11.2. By employing a multimodality approach, the wide spectrum of alterations of INI1 can be identified in the majority of patients, which increases the clinical utility of molecular diagnostic testing. PMID:19276269

  10. Analysis of copy number variation in Alzheimer's disease in a cohort of clinically characterized and neuropathologically verified individuals.

    PubMed

    Swaminathan, Shanker; Huentelman, Matthew J; Corneveaux, Jason J; Myers, Amanda J; Faber, Kelley M; Foroud, Tatiana; Mayeux, Richard; Shen, Li; Kim, Sungeun; Turk, Mari; Hardy, John; Reiman, Eric M; Saykin, Andrew J

    2012-01-01

    Copy number variations (CNVs) are genomic regions that have added (duplications) or deleted (deletions) genetic material. They may overlap genes affecting their function and have been shown to be associated with disease. We previously investigated the role of CNVs in late-onset Alzheimer's disease (AD) and mild cognitive impairment using Alzheimer's Disease Neuroimaging Initiative (ADNI) and National Institute of Aging-Late Onset AD/National Cell Repository for AD (NIA-LOAD/NCRAD) Family Study participants, and identified a number of genes overlapped by CNV calls. To confirm the findings and identify other potential candidate regions, we analyzed array data from a unique cohort of 1617 Caucasian participants (1022 AD cases and 595 controls) who were clinically characterized and whose diagnosis was neuropathologically verified. All DNA samples were extracted from brain tissue. CNV calls were generated and subjected to quality control (QC). 728 cases and 438 controls who passed all QC measures were included in case/control association analyses including candidate gene and genome-wide approaches. Rates of deletions and duplications did not significantly differ between cases and controls. Case-control association identified a number of previously reported regions (CHRFAM7A, RELN and DOPEY2) as well as a new gene (HLA-DRA). Meta-analysis of CHRFAM7A indicated a significant association of the gene with AD and/or MCI risk (P = 0.006, odds ratio = 3.986 (95% confidence interval 1.490-10.667)). A novel APP gene duplication was observed in one case sample. Further investigation of the identified genes in independent and larger samples is warranted.

  11. New syndromic form of benign hereditary chorea is associated with a deletion of TITF-1 and PAX-9 contiguous genes.

    PubMed

    Devos, David; Vuillaume, Isabelle; de Becdelievre, Alix; de Martinville, Berengère; Dhaenens, Claire-Marie; Cuvellier, Jean-Christophe; Cuisset, Jean-Marie; Vallée, Louis; Lemaitre, Marie-Pierre; Bourteel, Hélène; Hachulla, Eric; Wallaert, Benoit; Destée, Alain; Defebvre, Luc; Sablonnière, Bernard

    2006-12-01

    Benign hereditary chorea is a rare autosomal dominant disorder presenting with a childhood-onset and slowly progressive chorea. The objective of this study was to describe the clinical and genetic features of 3 patients who developed childhood-onset chorea. Three affected patients from three generations of a family with benign hereditary chorea associated with a multisystemic disorder of the basal ganglia, thyroid, lungs, salivary glands, bowels, and teeth. The TITF-1 gene was screened by microsatellite analysis, gene sequencing, and fluorescence in situ hybridization. Genetic analysis revealed a novel 0.9-Mb deletion on chromosome 14, which includes the TITF-1 and PAX9 genes. We have identified a novel deletion responsible for a new syndrome of benign hereditary chorea, including symptoms of brain-thyroid-lung syndrome associated with bowels, salivary glands, and teeth disorders. Associated signs, sometimes of slight expression, remain of high interest for the clinical and genetic diagnosis of benign hereditary chorea. Copyright 2006 Movement Disorder Society.

  12. An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3.

    PubMed

    Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

    2014-03-01

    With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders.

  13. An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3

    PubMed Central

    Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

    2014-01-01

    With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders. PMID:23860047

  14. Polynesian genetic affinities with Southeast Asian populations as identified by mtDNA analysis.

    PubMed Central

    Melton, T; Peterson, R; Redd, A J; Saha, N; Sofro, A S; Martinson, J; Stoneking, M

    1995-01-01

    Polynesian genetic affinities to populations of Asia were studied using mtDNA markers. A total of 1,037 individuals from 12 populations were screened for a 9-bp deletion in the intergenic region between the COII and tRNA(Lys) genes that approaches fixation in Polynesians. Sequence-specific oligonucleotide probes that identify specific mtDNA control region nucleotide substitutions were used to describe variation in individuals with the 9-bp deletion. The 9-bp deletion was not observed in northern Indians, Bangladeshis, or Pakistanis but was seen at low to moderate frequencies in the nine other Southeast Asian populations. Three substitutions in the control region at positions 16217, 16247, and 16261 have previously been observed at high frequency in Polynesian mtDNAs; this "Polynesian motif" was observed in 20% of east Indonesians with the 9-bp deletion but was observed in only one additional individual. mtDNA types related to the Polynesian motif are highest in frequency in the corridor from Taiwan south through the Philippines and east Indonesia, and the highest diversity for these types is in Taiwan. These results are consistent with linguistic evidence of a Taiwanese origin for the proto-Polynesian expansion, which spread throughout Oceania by way of Indonesia. PMID:7668267

  15. IKAROS Gene Deleted B-Cell Acute Lymphoblastic Leukemia in Mexican Mestizos: Observations in Seven Patients and a Short Review of the Literature.

    PubMed

    Ruiz-Delgado, Guillermo José; Cantero-Fortiz, Yahveth; León-Peña, Andrés Aurelio; León-González, Mónica; Nuñez-Cortés, Ana Karen; Ruiz-Argüelles, Guillermo José

    2016-01-01

    In B-cell acute lymphoblastic leukemia, one of the most frequent cytogenetic alterations is the presence of the Philadelphia chromosome. Recently, newly identified genetic alterations have been studied, among them the IKZF1 deletion. IKZF1 encodes IKAROS, a zinc finger protein that plays an important role in hematopoiesis involving the regulation process of adhesion, cellular migration, and as a tumor suppressor. We aimed to study the impact of IKAROS deletion in the evolution and prognosis of B-cell acute lymphoblastic leukemia. At a single center we prospectively studied patients diagnosed with B-cell acute lymphoblastic leukemia and screened for IKZF1 deletion using the multiplex ligation-dependent probe amplification method. We did a descriptive analysis of patients positive for the IKZF1 deletion to determine its impact on the evolution of the disease and survival rate. Between 2010 and 2015, 16 Mexican mestizo patients with B-cell acute lymphoblastic leukemia were prospectively screened for IKZF1 deletion; seven (43%) were positive and were included for further analysis. The age range of patients was 13-60 years; six were males and one female. All cases had type B acute lymphoblastic leukemia. Of the seven patients, two died, three were lost to follow-up, and two continue in complete remission with treatment. Results are worse than those in a group of patients with non-mutated IKAROS B-cell acute lymphoblastic leukemia previously studied in our center. Although this is a small sample, the presence of IKAROS deletion in acute lymphoblastic leukemia patients could represent a poor-prognosis marker and was probably related to therapy failure. It is also possible that this variant of leukemia may be more prevalent in Mexico. More studies are needed to define the role of IKZF1 deletion in acute lymphoblastic leukemia and the real prevalence of the disease in different populations.

  16. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    PubMed

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  17. An analysis of possible off target effects following CAS9/CRISPR targeted deletions of neuropeptide gene enhancers from the mouse genome.

    PubMed

    Hay, Elizabeth Anne; Khalaf, Abdulla Razak; Marini, Pietro; Brown, Andrew; Heath, Karyn; Sheppard, Darrin; MacKenzie, Alasdair

    2017-08-01

    We have successfully used comparative genomics to identify putative regulatory elements within the human genome that contribute to the tissue specific expression of neuropeptides such as galanin and receptors such as CB1. However, a previous inability to rapidly delete these elements from the mouse genome has prevented optimal assessment of their function in-vivo. This has been solved using CAS9/CRISPR genome editing technology which uses a bacterial endonuclease called CAS9 that, in combination with specifically designed guide RNA (gRNA) molecules, cuts specific regions of the mouse genome. However, reports of "off target" effects, whereby the CAS9 endonuclease is able to cut sites other than those targeted, limits the appeal of this technology. We used cytoplasmic microinjection of gRNA and CAS9 mRNA into 1-cell mouse embryos to rapidly generate enhancer knockout mouse lines. The current study describes our analysis of the genomes of these enhancer knockout lines to detect possible off-target effects. Bioinformatic analysis was used to identify the most likely putative off-target sites and to design PCR primers that would amplify these sequences from genomic DNA of founder enhancer deletion mouse lines. Amplified DNA was then sequenced and blasted against the mouse genome sequence to detect off-target effects. Using this approach we were unable to detect any evidence of off-target effects in the genomes of three founder lines using any of the four gRNAs used in the analysis. This study suggests that the problem of off-target effects in transgenic mice have been exaggerated and that CAS9/CRISPR represents a highly effective and accurate method of deleting putative neuropeptide gene enhancer sequences from the mouse genome. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Signaling pathways coordinating the alkaline pH response confer resistance to the hevein-type plant antimicrobial peptide Pn-AMP1 in Saccharomyces cerevisiae.

    PubMed

    Kwon, Youngho; Chiang, Jennifer; Tran, Grant; Giaever, Guri; Nislow, Corey; Hahn, Bum-Soo; Kwak, Youn-Sig; Koo, Ja-Choon

    2016-12-01

    Genome-wide screening of Saccharomyces cerevisiae revealed that signaling pathways related to the alkaline pH stress contribute to resistance to plant antimicrobial peptide, Pn-AMP1. Plant antimicrobial peptides (AMPs) are considered to be promising candidates for controlling phytopathogens. Pn-AMP1 is a hevein-type plant AMP that shows potent and broad-spectrum antifungal activity. Genome-wide chemogenomic screening was performed using heterozygous and homozygous diploid deletion pools of Saccharomyces cerevisiae as a chemogenetic model system to identify genes whose deletion conferred enhanced sensitivity to Pn-AMP1. This assay identified 44 deletion strains with fitness defects in the presence of Pn-AMP1. Strong fitness defects were observed in strains with deletions of genes encoding components of several pathways and complex known to participate in the adaptive response to alkaline pH stress, including the cell wall integrity (CWI), calcineurin/Crz1, Rim101, SNF1 pathways and endosomal sorting complex required for transport (ESCRT complex). Gene ontology (GO) enrichment analysis of these genes revealed that the most highly overrepresented GO term was "cellular response to alkaline pH". We found that 32 of the 44 deletion strains tested (72 %) showed significant growth defects compared with their wild type at alkaline pH. Furthermore, 9 deletion strains (20 %) exhibited enhanced sensitivity to Pn-AMP1 at ambient pH compared to acidic pH. Although several hundred plant AMPs have been reported, their modes of action remain largely uncharacterized. This study demonstrates that the signaling pathways that coordinate the adaptive response to alkaline pH also confer resistance to a hevein-type plant AMP in S. cerevisiae. Our findings have broad implications for the design of novel and potent antifungal agents.

  19. Small rare recurrent deletions and reciprocal duplications in 2q21.1, including brain-specific ARHGEF4 and GPR148

    PubMed Central

    Dharmadhikari, Avinash V.; Kang, Sung-Hae L.; Szafranski, Przemyslaw; Person, Richard E.; Sampath, Srirangan; Prakash, Siddharth K.; Bader, Patricia I.; Phillips, John A.; Hannig, Vickie; Williams, Misti; Vinson, Sherry S.; Wilfong, Angus A.; Reimschisel, Tyler E.; Craigen, William J.; Patel, Ankita; Bi, Weimin; Lupski, James R.; Belmont, John; Cheung, Sau Wai; Stankiewicz, Pawel

    2012-01-01

    We have identified a rare small (∼450 kb unique sequence) recurrent deletion in a previously linked attention-deficit hyperactivity disorder (ADHD) locus at 2q21.1 in five unrelated families with developmental delay (DD)/intellectual disability (ID), ADHD, epilepsy and other neurobehavioral abnormalities from 17 035 samples referred for clinical chromosomal microarray analysis. Additionally, a DECIPHER (http://decipher.sanger.ac.uk) patient 2311 was found to have the same deletion and presented with aggressive behavior. The deletion was not found in either six control groups consisting of 13 999 healthy individuals or in the DGV database. We have also identified reciprocal duplications in five unrelated families with autism, developmental delay (DD), seizures and ADHD. This genomic region is flanked by large, complex low-copy repeats (LCRs) with directly oriented subunits of ∼109 kb in size that have 97.7% DNA sequence identity. We sequenced the deletion breakpoints within the directly oriented paralogous subunits of the flanking LCR clusters, demonstrating non-allelic homologous recombination as a mechanism of formation. The rearranged segment harbors five genes: GPR148, FAM123C, ARHGEF4, FAM168B and PLEKHB2. Expression of ARHGEF4 (Rho guanine nucleotide exchange factor 4) is restricted to the brain and may regulate the actin cytoskeletal network, cell morphology and migration, and neuronal function. GPR148 encodes a G-protein-coupled receptor protein expressed in the brain and testes. We suggest that small rare recurrent deletion of 2q21.1 is pathogenic for DD/ID, ADHD, epilepsy and other neurobehavioral abnormalities and, because of its small size, low frequency and more severe phenotype might have been missed in other previous genome-wide screening studies using single-nucleotide polymorphism analyses. PMID:22543972

  20. Network-based analysis of oligodendrogliomas predicts novel cancer gene candidates within the region of the 1p/19q co-deletion.

    PubMed

    Gladitz, Josef; Klink, Barbara; Seifert, Michael

    2018-06-11

    Oligodendrogliomas are primary human brain tumors with a characteristic 1p/19q co-deletion of important prognostic relevance, but little is known about the pathology of this chromosomal mutation. We developed a network-based approach to identify novel cancer gene candidates in the region of the 1p/19q co-deletion. Gene regulatory networks were learned from gene expression and copy number data of 178 oligodendrogliomas and further used to quantify putative impacts of differentially expressed genes of the 1p/19q region on cancer-relevant pathways. We predicted 8 genes with strong impact on signaling pathways and 14 genes with strong impact on metabolic pathways widespread across the region of the 1p/19 co-deletion. Many of these candidates (e.g. ELTD1, SDHB, SEPW1, SLC17A7, SZRD1, THAP3, ZBTB17) are likely to push, whereas others (e.g. CAP1, HBXIP, KLK6, PARK7, PTAFR) might counteract oligodendroglioma development. For example, ELTD1, a functionally validated glioblastoma oncogene located on 1p, was overexpressed. Further, the known glioblastoma tumor suppressor SLC17A7 located on 19q was underexpressed. Moreover, known epigenetic alterations triggered by mutated SDHB in paragangliomas suggest that underexpressed SDHB in oligodendrogliomas may support and possibly enhance the epigenetic reprogramming induced by the IDH-mutation. We further analyzed rarely observed deletions and duplications of chromosomal arms within oligodendroglioma subcohorts identifying putative oncogenes and tumor suppressors that possibly influence the development of oligodendroglioma subgroups. Our in-depth computational study contributes to a better understanding of the pathology of the 1p/19q co-deletion and other chromosomal arm mutations. This might open opportunities for functional validations and new therapeutic strategies.

  1. A familial pericentric inversion of chromosome 11 associated with a microdeletion of 163 kb and microduplication of 288 kb at 11p13 and 11q22.3 without aniridia or eye anomalies.

    PubMed

    Balay, Lara; Totten, Ellen; Okada, Luna; Zell, Sidney; Ticho, Benjamin; Israel, Jeannette; Kogan, Jillene

    2016-01-01

    Interstitial deletions of 11p13 involving MPPED2, DCDC5, DCDC1, DNAJC24, IMMP1L, and ELP4 are previously reported to have downstream transcriptional effects on the expression of PAX6, due to a downstream regulatory region (DRR). Currently, no clear genotype-phenotype correlations have been established allowing for conclusive information regarding the exact location of the PAX6 DRR, though its location has been approximated in mouse models to be within the Elp4 gene. Of the clinical reports currently published examining patients with intact PAX6 genes but harboring deletions identified in genes downstream of PAX6, 100% indicate phenotypes which include aniridia, whereas approximately half report additional eye deformities, autism, or intellectual disability. In this clinical report, we present a 12-year-old male patient, his brother, and mother with pericentric inversions of chromosome 11 associated with submicroscopic interstitial deletions of 11p13 and duplications of 11q22.3. The inversions were identified by standard cytogenetic analysis; microarray and FISH detected the chromosomal imbalance. The patient's phenotype includes intellectual disability, speech abnormalities, and autistic behaviors, but interestingly neither the patient, his brother, nor mother have aniridia or other eye anomalies. To the best of our knowledge, these findings in three family members represent the only reported cases with 11p13 deletions downstream of PAX6 not demonstrating phenotypic characteristics of aniridia or abnormal eye development. Although none of the deleted genes are obvious candidates for the patient's phenotype, the absence of aniridia in the presence of this deletion in all three family members further delineates the location of the DRR for PAX6. © 2015 Wiley Periodicals, Inc.

  2. Ready to clone: CNV detection and breakpoint fine-mapping in breast and ovarian cancer susceptibility genes by high-resolution array CGH.

    PubMed

    Hackmann, Karl; Kuhlee, Franziska; Betcheva-Krajcir, Elitza; Kahlert, Anne-Karin; Mackenroth, Luisa; Klink, Barbara; Di Donato, Nataliya; Tzschach, Andreas; Kast, Karin; Wimberger, Pauline; Schrock, Evelin; Rump, Andreas

    2016-10-01

    Detection of predisposing copy number variants (CNV) in 330 families affected with hereditary breast and ovarian cancer (HBOC). In order to complement mutation detection with Illumina's TruSight Cancer panel, we designed a customized high-resolution 8 × 60k array for CGH (aCGH) that covers all 94 genes from the panel. Copy number variants with immediate clinical relevance were detected in 12 families (3.6%). Besides 3 known CNVs in CHEK2, RAD51C, and BRCA1, we identified 3 novel pathogenic CNVs in BRCA1 (deletion of exons 4-13, deletion of exons 12-18) and ATM (deletion exons 57-63) plus an intragenic duplication of BRCA2 (exons 3-11) and an intronic BRCA1 variant with unknown pathogenicity. The precision of high-resolution aCGH enabled straight forward breakpoint amplification of a BRCA1 deletion which subsequently allowed for fast and economic CNV verification in family members of the index patient. Furthermore, we used our aCGH data to validate an algorithm that was able to detect all identified copy number changes from next-generation sequencing (NGS) data. Copy number detection is a mandatory analysis in HBOC families at least if no predisposing mutations were found by sequencing. Currently, high-resolution array CGH is our first choice of method of analysis due to unmatched detection precision. Although it seems possible to detect CNV from sequencing data, there currently is no satisfying tool to do so in a routine diagnostic setting.

  3. Clinical comparison of overlapping deletions of 19p13.3.

    PubMed

    Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

    2013-05-01

    We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

  4. Detection, breakpoint identification and detailed characterisation of a CNV at the FRA16D site using SNP assays.

    PubMed

    Winchester, L; Newbury, D F; Monaco, A P; Ragoussis, J

    2008-01-01

    Copy Number Variants (CNV) and other submicroscopic structural changes are now recognised to be widespread across the human genome. We show that SNP data generated for association study can be utilised for the identification of deletion CNVs. During analysis of data for an SNP association study for Specific Language Impairment (SLI) a deletion was identified. SLI adversely affects the language development of children in the absence of any obvious cause. Previous studies have found linkage to a region on chromosome 16. The deletion was located in a known fragile site FRA16D in intron 5-6 of the WWOX gene (also known as FOR). Changes in the FRA16D site have been previously linked to cancer and are often characterised in cell lines. A long-range PCR assay was used to confirm the existence of the deletion. We also show the breakpoint identification and large-scale characterisation of this CNV in a normal human sample set. Copyright 2009 S. Karger AG, Basel.

  5. Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

    PubMed

    Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

    2014-06-01

    Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. A novel deletion in the thyrotropin Beta-subunit gene identified by array comparative genomic hybridization analysis causes central congenital hypothyroidism in a boy originating from Turkey.

    PubMed

    Hermanns, Pia; Couch, Robert; Leonard, Norma; Klotz, Cherise; Pohlenz, Joachim

    2014-01-01

    Isolated central congenital hypothyroidism (ICCH) is rare but important. Most ICCH patients are diagnosed later, which results in severe growth failure and intellectual disability. We describe a boy with ICCH due to a large homozygous TSHβ gene deletion. A 51-day-old male Turkish infant, whose parents were first cousins, was admitted for evaluation of prolonged jaundice. His clinical appearance was compatible with hypothyroidism. Venous thyrotropin (TSH) was undetectably low, with a subsequent low free T4 and a low free T3, suggestive of central hypothyroidism. Using different PCR protocols, we could not amplify both coding exons of the boy's TSHβ gene, which suggested a deletion. An array comparative genomic hybridization (aCGH) using specific probes around the TSHβ gene locus showed him to be homozygous for a 6-kb deletion spanning all exons and parts of the 5' untranslated region of the gene. Infants who are clinically suspected of having hypothyroidism should be evaluated thoroughly, even if their TSH-based screening result is normal. In cases with ICCH and undetectably low TSH serum concentrations, a TSHβ gene deletion should be considered; aCGH should be performed when gene deletions are suspected. In such cases, PCR-based sequencing techniques give negative results.

  7. [Multiplex Ligation - dependent Probe Amplification (MLPA) as a screening test in children with developmental defects and intellectual disability of unknown etiology].

    PubMed

    Laczmańska, Izabela; Jakubiak, Aleksandra; Slęzak, Ryszard; Pesz, Karolina; Stembalska, Agnieszka; Laczmański, Lukasz; Sąsiadek, Maria M; Smigiel, Robert

    2011-01-01

    Developmental delay and intellectual disability are significant medical and social problems which concern 1-3% of population. The etiology remains unknown in over half of the cases. To evaluate the efficiency of MLPA (Multiplex Ligation-dependent Probe Amplification) as a screening test in diagnosis of patients with developmental delay and/or intellectual disability. 313 MLPA tests were performed in 256 patients with developmental delay and/ or intellectual disability with unknown etiology. MLPA test was made after exclusion of genetic disorders possible to diagnose by dysmorphological examination or using specifi c genetic tests. Positive results were confirmed by FISH analysis with appropriate probes. Chromosomal microaberrations were identifi ed in 15 patients (4,8%): deletions of 1p36 in 4 cases, in one case deletion of 22q11.21, 22q13.33, SNRPN1, 4ptel, 6qtel, 7q11.23, 16ptel, 18qtel as well as one ca se of deletion 3ptel/duplication 15qtel; deletion 18qtel/duplication Xqtel, and also duplication 7q11.23. Detail clinical analysis was performed in patients with diagnosed microaberrations in MLPA test. The molecular MLPA test, screening for chromosomal microaberration syndromes, should be performed in each patient with developmental delay and/or intellectual disability of unknown etiology and normal cytogenetic analysis, even if congenital defects and positive familial history do not exist.

  8. Whole genome sequencing and integrative genomic analysis approach on two 22q11.2 deletion syndrome family trios for genotype to phenotype correlations

    PubMed Central

    Chung, Jonathan H.; Cai, Jinlu; Suskin, Barrie G.; Zhang, Zhengdong; Coleman, Karlene

    2015-01-01

    The 22q11.2 deletion syndrome (22q11DS) affects 1:4000 live births and presents with highly variable phenotype expressivity. In this study, we developed an analytical approach utilizing whole genome sequencing and integrative analysis to discover genetic modifiers. Our pipeline combined available tools in order to prioritize rare, predicted deleterious, coding and non-coding single nucleotide variants (SNVs) and insertion/deletions (INDELs) from whole genome sequencing (WGS). We sequenced two unrelated probands with 22q11DS, with contrasting clinical findings, and their unaffected parents. Proband P1 had cognitive impairment, psychotic episodes, anxiety, and tetralogy of Fallot (TOF); while proband P2 had juvenile rheumatoid arthritis but no other major clinical findings. In P1, we identified common variants in COMT and PRODH on 22q11.2 as well as rare potentially deleterious DNA variants in other behavioral/neurocognitive genes. We also identified a de novo SNV in ADNP2 (NM_014913.3:c.2243G>C), encoding a neuroprotective protein that may be involved in behavioral disorders. In P2, we identified a novel non-synonymous SNV in ZFPM2 (NM_012082.3:c.1576C>T), a known causative gene for TOF, which may act as a protective variant downstream of TBX1, haploinsufficiency of which is responsible for congenital heart disease in individuals with 22q11DS. PMID:25981510

  9. On the nosology and pathogenesis of Wolf-Hirschhorn syndrome: genotype-phenotype correlation analysis of 80 patients and literature review.

    PubMed

    Zollino, Marcella; Murdolo, Marina; Marangi, Giuseppe; Pecile, Vanna; Galasso, Cinzia; Mazzanti, Laura; Neri, Giovanni

    2008-11-15

    Based on genotype-phenotype correlation analysis of 80 Wolf-Hirschhorn syndrome (WHS) patients, as well as on review of relevant literature, we add further insights to the following aspects of WHS: (1) clinical delineation and phenotypic categories; (2) characterization of the basic genomic defect, mechanisms of origin and familiarity; (3) identification of prognostic factors for mental retardation; (4) chromosome mapping of the distinctive clinical signs, in an effort to identify pathogenic genes. Clinically, we consider that minimal diagnostic criteria for WHS, defining a "core" phenotype, are typical facial appearance, mental retardation, growth delay and seizures (or EEG anomalies). Three different categories of the WHS phenotype were defined, generally correlating with the extent of the 4p deletion. The first one comprises a small deletion not exceeding 3.5 Mb, that is usually associated with a mild phenotype, lacking major malformations. This category is likely under-diagnosed. The second and by far the more frequent category is identified by large deletions, averaging between 5 and 18 Mb, and causes the widely recognizable WHS phenotype. The third clinical category results from a very large deletion exceeding 22-25 Mb causing a severe phenotype, that can hardly be defined as typical WHS. Genetically, de novo chromosome abnormalities in WHS include pure deletions but also complex rearrangements, mainly unbalanced translocations. With the exception of t(4p;8p), WHS-associated chromosome abnormalities are neither mediated by segmental duplications, nor associated with a parental inversion polymorphism on 4p16.3. Factors involved in prediction of prognosis include the extent of the deletion, the occurrence of complex chromosome anomalies, and the severity of seizures. We found that the core phenotype maps within the terminal 1.9 Mb region of chromosome 4p. Therefore, WHSCR-2 should be considered the critical region for this condition. We also confirmed that the pathogenesis of WHS is multigenic. Specific and independent chromosome regions were characterized for growth delay and seizures, as well as for the additional clinical signs that characterize this condition. With the exception of parental balanced translocations, familial recurrence is uncommon.

  10. [Analysis of genomic copy number variations in two unrelated neonates with 8p deletion and duplication associated with congenital heart disease].

    PubMed

    Mei, Mei; Yang, Lin; Zhan, Guodong; Wang, Huijun; Ma, Duan; Zhou, Wenhao; Huang, Guoying

    2014-06-01

    To screen for genomic copy number variations (CNVs) in two unrelated neonates with multiple congenital abnormalities using Affymetrix SNP chip and try to find the critical region associated with congenital heart disease. Two neonates were tested for genomic copy number variations by using Cytogenetic SNP chip.Rare CNVs with potential clinical significance were selected of which deletion segments' size was larger than 50 kb and duplication segments' size was larger than 150 kb based on the analysis of ChAs software, without false positive CNVs and segments of normal population. The identified CNVs were compared with those of the cases in DECIPHER and ISCA databases. Eleven rare CNVs with size from 546.6-27 892 kb were identified in the 2 neonates. The deletion region and size of case 1 were 8p23.3-p23.1 (387 912-11 506 771 bp) and 11.1 Mb respectively, the duplication region and size of case 1 were 8p23.1-p11.1 (11 508 387-43 321 279 bp) and 31.8 Mb respectively. The deletion region and size of case 2 were 8p23.3-p23.1 (46 385-7 809 878 bp) and 7.8 Mb respectively, the duplication region and size of case 2 were 8p23.1-p11.21 (12 260 914-40 917 092 bp) and 28.7 Mb respectively. The comparison with Decipher and ISCA databases supported previous viewpoint that 8p23.1 had been associated with congenital heart disease and the region between 7 809 878-11 506 771 bp may play a role in the severe cardiac defects associated with 8p23.1 deletions. Case 1 had serious cardiac abnormalities whose GATA4 was located in the duplication segment and the copy number increased while SOX7 was located in the deletion segment and the copy number decreased. The region between 7 809 878-11 506 771 bp in 8p23.1 is associated with heart defects and copy number variants of SOX7 and GATA4 may result in congenital heart disease.

  11. Identification and characterization of large DNA deletions affecting oil quality traits in soybean seeds through transcriptome sequencing analysis.

    PubMed

    Goettel, Wolfgang; Ramirez, Martha; Upchurch, Robert G; An, Yong-Qiang Charles

    2016-08-01

    Identification and characterization of a 254-kb genomic deletion on a duplicated chromosome segment that resulted in a low level of palmitic acid in soybean seeds using transcriptome sequencing. A large number of soybean genotypes varying in seed oil composition and content have been identified. Understanding the molecular mechanisms underlying these variations is important for breeders to effectively utilize them as a genetic resource. Through design and application of a bioinformatics approach, we identified nine co-regulated gene clusters by comparing seed transcriptomes of nine soybean genotypes varying in oil composition and content. We demonstrated that four gene clusters in the genotypes M23, Jack and N0304-303-3 coincided with large-scale genome rearrangements. The co-regulated gene clusters in M23 and Jack mapped to a previously described 164-kb deletion and a copy number amplification of the Rhg1 locus, respectively. The coordinately down-regulated gene clusters in N0304-303-3 were caused by a 254-kb deletion containing 19 genes including a fatty acyl-ACP thioesterase B gene (FATB1a). This deletion was associated with reduced palmitic acid content in seeds and was the molecular cause of a previously reported nonfunctional FATB1a allele, fap nc . The M23 and N0304-304-3 deletions were located in duplicated genome segments retained from the Glycine-specific whole genome duplication that occurred 13 million years ago. The homoeologous genes in these duplicated regions shared a strong similarity in both their encoded protein sequences and transcript accumulation levels, suggesting that they may have conserved and important functions in seeds. The functional conservation of homoeologous genes may result in genetic redundancy and gene dosage effects for their associated seed traits, explaining why the large deletion did not cause lethal effects or completely eliminate palmitic acid in N0304-303-3.

  12. Identification of novel extracellular protein for PCB/biphenyl metabolism in Rhodococcus jostii RHA1.

    PubMed

    Atago, Yuki; Shimodaira, Jun; Araki, Naoto; Bin Othman, Nor'azizi; Zakaria, Zuriati; Fukuda, Masao; Futami, Junichiro; Hara, Hirofumi

    2016-05-01

    Rhodococcus jostii RHA1 (RHA1) degrades polychlorinated biphenyl (PCB) via co-metabolism with biphenyl. To identify the novel open reading frames (ORFs) that contribute to PCB/biphenyl metabolism in RHA1, we compared chromatin immunoprecipitation chip and transcriptomic data. Six novel ORFs involved in PCB/biphenyl metabolism were identified. Gene deletion mutants of these 6 ORFs were made and were tested for their ability to grow on biphenyl. Interestingly, only the ro10225 deletion mutant showed deficient growth on biphenyl. Analysis of Ro10225 protein function showed that growth of the ro10225 deletion mutant on biphenyl was recovered when exogenous recombinant Ro10225 protein was added to the culture medium. Although Ro10225 protein has no putative secretion signal sequence, partially degraded Ro10225 protein was detected in conditioned medium from wild-type RHA1 grown on biphenyl. This Ro10225 fragment appeared to form a complex with another PCB/biphenyl oxidation enzyme. These results indicated that Ro10225 protein is essential for the formation of the PCB/biphenyl dioxygenase complex in RHA1.

  13. Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

    PubMed

    Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

    2015-11-12

    Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

  14. Gr/gr deletions on Y-chromosome correlate with male infertility: an original study, meta-analyses, and trial sequential analyses

    NASA Astrophysics Data System (ADS)

    Bansal, Sandeep Kumar; Jaiswal, Deepika; Gupta, Nishi; Singh, Kiran; Dada, Rima; Sankhwar, Satya Narayan; Gupta, Gopal; Rajender, Singh

    2016-02-01

    We analyzed the AZFc region of the Y-chromosome for complete (b2/b4) and distinct partial deletions (gr/gr, b1/b3, b2/b3) in 822 infertile and 225 proven fertile men. We observed complete AZFc deletions in 0.97% and partial deletions in 6.20% of the cases. Among partial deletions, the frequency of gr/gr deletions was the highest (5.84%). The comparison of partial deletion data between cases and controls suggested a significant association of the gr/gr deletions with infertility (P = 0.0004); however, the other partial deletions did not correlate with infertility. In cohort analysis, men with gr/gr deletions had a relatively poor sperm count (54.20 ± 57.45 million/ml) in comparison to those without deletions (72.49 ± 60.06), though the difference was not statistically significant (p = 0.071). Meta-analysis also suggested that gr/gr deletions are significantly associated with male infertility risk (OR = 1.821, 95% CI = 1.39-2.37, p = 0.000). We also performed trial sequential analyses that strengthened the evidence for an overall significant association of gr/gr deletions with the risk of male infertility. Another meta-analysis suggested a significant association of the gr/gr deletions with low sperm count. In conclusion, the gr/gr deletions show a strong correlation with male infertility risk and low sperm count, particularly in the Caucasian populations.

  15. Deletion of a Single-Copy Trna Affects Microtubule Function in Saccharomyces Cerevisiae

    PubMed Central

    Reijo, R. A.; Cho, D. S.; Huffaker, T. C.

    1993-01-01

    rts1-1 was identified as an extragenic suppressor of tub2-104, a cold-sensitive allele of the sole gene encoding β-tubulin in the yeast, Saccharomyces cerevisiae. In addition, rts1-1 cells are heat sensitive and resistant to the microtubule-destabilizing drug, benomyl. The rts1-1 mutation is a deletion of approximately 5 kb of genomic DNA on chromosome X that includes one open reading frame and three tRNA genes. Dissection of this region shows that heat sensitivity is due to deletion of the open reading frame (HIT1). Suppression and benomyl resistance are caused by deletion of the gene encoding a tRNA(AGG)(Arg) (HSX1). Northern analysis of rts1-1 cells indicates that HSX1 is the only gene encoding this tRNA. Deletion of HSX1 does not suppress the tub2-104 mutation by misreading at the AGG codons in TUB2. It also does not suppress by interfering with the protein arginylation that targets certain proteins for degradation. These results leave open the prospect that this tRNA(AGG)(Arg) plays a novel role in the cell. PMID:8307335

  16. Recurrence and variability of germline EPCAM deletions in Lynch syndrome.

    PubMed

    Kuiper, Roland P; Vissers, Lisenka E L M; Venkatachalam, Ramprasath; Bodmer, Danielle; Hoenselaar, Eveline; Goossens, Monique; Haufe, Aline; Kamping, Eveline; Niessen, Renée C; Hogervorst, Frans B L; Gille, Johan J P; Redeker, Bert; Tops, Carli M J; van Gijn, Marielle E; van den Ouweland, Ans M W; Rahner, Nils; Steinke, Verena; Kahl, Philip; Holinski-Feder, Elke; Morak, Monika; Kloor, Matthias; Stemmler, Susanne; Betz, Beate; Hutter, Pierre; Bunyan, David J; Syngal, Sapna; Culver, Julie O; Graham, Tracy; Chan, Tsun L; Nagtegaal, Iris D; van Krieken, J Han J M; Schackert, Hans K; Hoogerbrugge, Nicoline; van Kessel, Ad Geurts; Ligtenberg, Marjolijn J L

    2011-04-01

    Recently, we identified 3' end deletions in the EPCAM gene as a novel cause of Lynch syndrome. These truncating EPCAM deletions cause allele-specific epigenetic silencing of the neighboring DNA mismatch repair gene MSH2 in tissues expressing EPCAM. Here we screened a cohort of unexplained Lynch-like families for the presence of EPCAM deletions. We identified 27 novel independent MSH2-deficient families from multiple geographical origins with varying deletions all encompassing the 3' end of EPCAM, but leaving the MSH2 gene intact. Within The Netherlands and Germany, EPCAM deletions appeared to represent at least 2.8% and 1.1% of the confirmed Lynch syndrome families, respectively. MSH2 promoter methylation was observed in epithelial tissues of all deletion carriers tested, thus confirming silencing of MSH2 as the causative defect. In a total of 45 families, 19 different deletions were found, all including the last two exons and the transcription termination signal of EPCAM. All deletions appeared to originate from Alu-repeat mediated recombination events. In 17 cases regions of microhomology around the breakpoints were found, suggesting nonallelic homologous recombination as the most likely mechanism. We conclude that 3' end EPCAM deletions are a recurrent cause of Lynch syndrome, which should be implemented in routine Lynch syndrome diagnostics. © 2011 Wiley-Liss, Inc.

  17. UGT2B17 gene deletion associated with an increase in bone mineral density similar to the effect of hormone replacement in postmenopausal women.

    PubMed

    Giroux, S; Bussières, J; Bureau, A; Rousseau, F

    2012-03-01

    UGT2B17 is one of the most important enzymes for androgen metabolism. In addition, the UGT2B17 gene is one of the most commonly deleted regions of the human genome. The deletion was previously found associated with higher femoral bone density in men and women, and we replicated this association in a sample of postmenopausal who never used hormone therapy. Deletion of the UGT2B17 gene was previously shown to be associated with a higher hip bone mineral density (BMD). Using a PCR assay, we tried to replicate the association among a large group of 2,379 women. We examined the effect of the deletion on femoral neck BMD and lumbar spine BMD according to the menopausal status and hormone replacement therapy (HRT). We used a high-throughput PCR assay to identify the gene and the deletion in a population of well-characterized women. Two additional polymorphisms, UGT2B28 deletion and UGT2B15 rs1902023 G > T were also investigated. Only UGT2B17 deletion was associated with LS and FN BMD. Furthermore, the association was seen only among postmenopausal women who had never used hormone replacement as in the first reported association. We confirmed the association between UGT2B17 deletion and a higher LS and FN BMD. In addition, we show that the association is observed among postmenopausal women who never used HRT consistent with the enzymatic function of UGT2B17. The analysis shows that those having one or two UGT2B17 alleles benefit from HRT, which is not the case for null carriers.

  18. Genetic heterogeneity in patients with Bartter syndrome type 1

    PubMed Central

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-01-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888

  19. Genetic heterogeneity in patients with Bartter syndrome type 1.

    PubMed

    Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

    2017-02-01

    Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

  20. Patients with chronic lymphocytic leukemia and complex karyotype show an adverse outcome even in absence of TP53/ATM FISH deletions

    PubMed Central

    Puiggros, Anna; Collado, Rosa; Calasanz, Maria José; Ortega, Margarita; Ruiz-Xivillé, Neus; Rivas-Delgado, Alfredo; Luño, Elisa; González, Teresa; Navarro, Blanca; García-Malo, MaDolores; Valiente, Alberto; Hernández, José Ángel; Ardanaz, María Teresa; Piñan, María Ángeles; Blanco, María Laura; Hernández-Sánchez, María; Batlle-López, Ana; Salgado, Rocío; Salido, Marta; Ferrer, Ana; Abrisqueta, Pau; Gimeno, Eva; Abella, Eugènia; Ferrá, Christelle; Terol, María José; Ortuño, Francisco; Costa, Dolors; Moreno, Carol; Carbonell, Félix; Bosch, Francesc; Delgado, Julio; Espinet, Blanca

    2017-01-01

    Genomic complexity identified by chromosome banding analysis (CBA) predicts a worse clinical outcome in CLL patients treated either with standard or new treatments. Herein, we analyzed the clinical impact of complex karyotypes (CK) with or without high-risk FISH deletions (ATM and/or TP53, HR-FISH) in a cohort of 1045 untreated MBL/CLL patients. In all, 99/1045 (9.5%) patients displayed a CK. Despite ATM and TP53 deletions were more common in CK (25% vs 7%; P < 0.001; 40% vs 5%; P < 0.001, respectively), only 44% (40/90) patients with TP53 deletions showed a CK. CK group showed a significant higher two-year cumulative incidence of treatment (48% vs 20%; P < 0.001), as well as a shorter overall survival (OS) (79 mo vs not reached; P < 0.001). When patients were categorized regarding CK and HR-FISH, those with both characteristics showed the worst median OS (52 mo) being clearly distinct from those non-CK and non-HR-FISH (median not reached), but no significant differences were detected between cases with only CK or HR-FISH. Both CK and TP53 deletion remained statistically significant in the multivariate analysis for OS. In conclusion, CK group is globally associated with advanced disease and poor prognostic markers. Further investigation in larger cohorts with CK lacking HR-FISH is needed to elucidate which mechanisms underlie the poor outcome of this subgroup. PMID:28903342

  1. Copy number variants in patients with short stature

    PubMed Central

    van Duyvenvoorde, Hermine A; Lui, Julian C; Kant, Sarina G; Oostdijk, Wilma; Gijsbers, Antoinet CJ; Hoffer, Mariëtte JV; Karperien, Marcel; Walenkamp, Marie JE; Noordam, Cees; Voorhoeve, Paul G; Mericq, Verónica; Pereira, Alberto M; Claahsen-van de Grinten, Hedi L; van Gool, Sandy A; Breuning, Martijn H; Losekoot, Monique; Baron, Jeffrey; Ruivenkamp, Claudia AL; Wit, Jan M

    2014-01-01

    Height is a highly heritable and classic polygenic trait. Recent genome-wide association studies (GWAS) have revealed that at least 180 genetic variants influence adult height. However, these variants explain only about 10% of the phenotypic variation in height. Genetic analysis of short individuals can lead to the discovery of novel rare gene defects with a large effect on growth. In an effort to identify novel genes associated with short stature, genome-wide analysis for copy number variants (CNVs), using single-nucleotide polymorphism arrays, in 162 patients (149 families) with short stature was performed. Segregation analysis was performed if possible, and genes in CNVs were compared with information from GWAS, gene expression in rodents' growth plates and published information. CNVs were detected in 40 families. In six families, a known cause of short stature was found (SHOX deletion or duplication, IGF1R deletion), in two combined with a de novo potentially pathogenic CNV. Thirty-three families had one or more potentially pathogenic CNVs (n=40). In 24 of these families, segregation analysis could be performed, identifying three de novo CNVs and nine CNVs segregating with short stature. Four were located near loci associated with height in GWAS (ADAMTS17, TULP4, PRKG2/BMP3 and PAPPA). Besides six CNVs known to be causative for short stature, 40 CNVs with possible pathogenicity were identified. Segregation studies and bioinformatics analysis suggested various potential candidate genes. PMID:24065112

  2. Deletion mapping of 22q11 in CATCH22 syndrome: Identification of a second critical region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurahashi, Hiroki; Nakayama, Takahiro; Nishisho, Isamu

    1996-06-01

    The deletion at 22q11.2 implicates a variety of congenital anomaly syndromes, for which the acronym CATCH22 has been proposed . Most patients with these syndromes share the common large deletion spanning 1-2 Mb, while the phenotypic variability of the patients does not seem to correlate with the extent of the deletions. On the basis of the deletions of rare cases with unbalanced translocation, the shortest region of overlap (SRO) had been identified in the most-centromeric region of the common large deletion. One patient (ADU) has been reported to carry a balanced translocation with the breakpoint located in the SRO. Recently,more » three transcripts were identified at or very close to the ADU breakpoint (ADUBP), making them strong candidates for CATCH22 syndrome. Here, we describe one patient with a unique deletion at 22q11.2 revealed by quantitative hybridization and/or FISH with six DNA markers in the common large deletion. The patient was dizygous at loci within the SRO and hemizygous only at the most-telomeric locus in the common large deletion. This finding suggests that there must be another critical region in the common large deletion besides the breakpoint of the ADU and that haploinsufficiency of genes in this deletion may also play a major role in CATCH22 pathogenesis. 15 refs., 3 figs.« less

  3. The BIM Deletion Polymorphism and its Clinical Implication in Patients with EGFR-Mutant Non-Small-Cell Lung Cancer Treated with EGFR Tyrosine Kinase Inhibitors.

    PubMed

    Lee, Ji Yun; Ku, Bo Mi; Lim, Sung Hee; Lee, Min-Young; Kim, Haesu; Kim, Moonjin; Kim, Sungmin; Jung, Hyun Ae; Sun, Jong-Mu; Ahn, Jin Seok; Park, Keunchil; Ahn, Myung-Ju

    2015-06-01

    A germline BIM deletion polymorphism has been proposed to predict poor treatment response to certain kinase inhibitors. The purpose of this study was to explore whether the BIM deletion polymorphism predicts treatment efficacy of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) in Korean patients with EGFR-mutant non-small-cell lung cancer (NSCLC). Peripheral blood samples from a total of 205 patients with EGFR-mutant NSCLC who were treated with EGFR TKIs between July 2008 and April 2013 were included. The incidence of BIM deletions in these samples was detected by polymerase chain reaction. We compared the clinical outcomes in patients with and without the polymorphism after treatment with EGFR TKIs (gefitinib or erlotinib). The BIM deletion polymorphism was present in 15.6% (32 of 205) of patients. One patient was homozygous for the deletion, and the remaining 31 had heterozygous deletions. The majority of patients were younger than 65 years (74%), female (68%), never smokers (76%), and had stage IV NSCLC (67%). There were no associations between the BIM deletion polymorphism and clinicopathological features including gender, age, smoking status, histology, stage, and number of metastasis sites. Patients with and without the BIM deletion polymorphism had similar objective response rates (91 vs. 84%, p = 0.585). Progression-free survival and overall survival did not differ significantly between patients with and without the BIM deletion polymorphism (median progression-free survival 12 vs. 11 months, p = 0.160; median overall survival 31 vs. 30 months, p = 0.452). Multivariate analysis identified significantly predictive markers for clinical outcomes of EGFR TKIs including Eastern Cooperative Oncology Group performance status 0-1, adenocarcinoma histology, recurrent disease, and EGFR mutation type. The results were validated in an independent cohort of 69 NSCLC patients. It remains to be determined whether the BIM deletion polymorphism provides intrinsic resistance or decreased sensitivity to EGFR TKIs in EGFR-mutant NSCLC patients.

  4. A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

    PubMed Central

    Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

    2000-01-01

    Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

  5. Biosynthetic Pathway for the Epipolythiodioxopiperazine Acetylaranotin in Aspergillus terreus Revealed by Genome-based Deletion Analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, Chun-Jun; Yeh, Hsu-Hua; Chiang, Yi Ming

    2013-04-15

    Abstract Epipolythiodioxopiperazines (ETPs) are a class of fungal secondary metabolites derived from cyclic peptides. Acetylaranotin belongs to one structural subgroup of ETPs characterized by the presence of a seven-membered dihydrooxepine ring. Defining the genes involved in acetylaranotin biosynthesis should provide a means to increase production of these compounds and facilitate the engineering of second-generation molecules. The filamentous fungus Aspergillus terreus produces acetylaranotin and related natural products. Using targeted gene deletions, we have identified a cluster of 9 genes including one nonribosomal peptide synthase gene, ataP, that is required for acetylaranotin biosynthesis. Chemical analysis of the wild type and mutant strainsmore » enabled us to isolate seventeen natural products that are either intermediates in the normal biosynthetic pathway or shunt products that are produced when the pathway is interrupted through mutation. Nine of the compounds identified in this study are novel natural products. Our data allow us to propose a complete biosynthetic pathway for acetylaranotin and related natural products.« less

  6. First case of Hb Fontainebleau with sickle haemoglobin and other non-deletional α gene variants identified in neonates during newborn screening for sickle cell disorders.

    PubMed

    Upadhye, Dipti S; Jain, Dipty; Nair, Sona B; Nadkarni, Anita H; Ghosh, Kanjaksha; Colah, Roshan B

    2012-07-01

    To evaluate the significance of non-deletional α gene variants identified in neonates during newborn screening for sickle cell disorders. 1534 newborn babies were screened in the last 2 years for sickle cell disease using a targeted screening approach. Investigations included a complete blood count, high performance liquid chromatography analysis, cellulose acetate electrophoresis (pH 8.9), heat stability test, restriction digestion and Amplified Refractory Mutation System for confirmation of sickle haemoglobin (Hb S), α genotyping by multiplex PCR and DNA sequencing. Three non-deletional α gene variants, Hb Fontainebleau, Hb O Indonesia and Hb Koya Dora, were identified in heterozygous condition in newborns. This is the first report of Hb Fontainebleau in association with Hb S. The baby had anaemia at birth (Hb 11.4 g/dl) with no cyanosis, icterus or need for transfusion. She had occipital encephalocoele and was operated on day 24 to remove the mass. The baby diagnosed with Hb O Indonesia in combination with Hb S also had a low haemoglobin level of 12.7 g/dl. Newborn screening for sickle cell disorders also enabled us to identify three α globin chain variants. Two babies who inherited Hb Fontainebleau and Hb O Indonesia along with Hb S had reduced Hb levels at birth and need to be followed up.

  7. Speckle-type POZ (pox virus and zinc finger protein) protein gene deletion in ovarian cancer: Fluorescence in situ hybridization analysis of a tissue microarray.

    PubMed

    Hu, Xiaoyu; Yang, Zhu; Zeng, Manman; Liu, Y I; Yang, Xiaotao; Li, Yanan; Li, X U; Yu, Qiubo

    2016-07-01

    The aim of the present study was to investigate the status of speckle-type POZ (pox virus and zinc finger protein) protein (SPOP) gene located on chromosome 17q21 in ovarian cancer (OC). The present study evaluated a tissue microarray, which contained 90 samples of ovarian cancer and 10 samples of normal ovarian tissue, using fluorescence in situ hybridization (FISH). FISH is a method where a SPOP-specific DNA red fluorescence probe was used for the experimental group and a centromere-specific DNA green fluorescence probe for chromosome 17 was used for the control group. The present study demonstrated that a deletion of the SPOP gene was observed in 52.27% (46/88) of the ovarian cancer tissues, but was not identified in normal ovarian tissues. Simultaneously, monosomy 17 was frequently identified in the ovarian cancer tissues, but not in the normal ovarian tissues. Furthermore, the present data revealed that the ovarian cancer histological subtype and grade were significantly associated with a deletion of the SPOP gene, which was assessed by the appearance of monosomy 17 in the ovarian cancer samples; the deletion of the SPOP gene was observed in a large proportion of serous epithelial ovarian cancer (41/61; 67.21%), particularly in grade 3 (31/37; 83.78%). In conclusion, deletion of the SPOP gene on chromosome 17 in ovarian cancer samples, which results from monosomy 17, indicates that the SPOP gene may serve as a tumor suppressor gene in ovarian cancer.

  8. Copy number analysis of NIPBL in a cohort of 510 patients reveals rare copy number variants and a mosaic deletion.

    PubMed

    Cheng, Yu-Wei; Tan, Christopher A; Minor, Agata; Arndt, Kelly; Wysinger, Latrice; Grange, Dorothy K; Kozel, Beth A; Robin, Nathaniel H; Waggoner, Darrel; Fitzpatrick, Carrie; Das, Soma; Del Gaudio, Daniela

    2014-03-01

    Cornelia de Lange syndrome (CdLS) is a genetically heterogeneous disorder characterized by growth retardation, intellectual disability, upper limb abnormalities, hirsutism, and characteristic facial features. In this study we explored the occurrence of intragenic NIPBL copy number variations (CNVs) in a cohort of 510 NIPBL sequence-negative patients with suspected CdLS. Copy number analysis was performed by custom exon-targeted oligonucleotide array-comparative genomic hybridization and/or MLPA. Whole-genome SNP array was used to further characterize rearrangements extending beyond the NIPBL gene. We identified NIPBL CNVs in 13 patients (2.5%) including one intragenic duplication and a deletion in mosaic state. Breakpoint sequences in two patients provided further evidence of a microhomology-mediated replicative mechanism as a potential predominant contributor to CNVs in NIPBL. Patients for whom clinical information was available share classical CdLS features including craniofacial and limb defects. Our experience in studying the frequency of NIBPL CNVs in the largest series of patients to date widens the mutational spectrum of NIPBL and emphasizes the clinical utility of performing NIPBL deletion/duplication analysis in patients with CdLS.

  9. Clinical Application of an Innovative Multiplex-Fluorescent-Labeled STRs Assay for Prader-Willi Syndrome and Angelman Syndrome.

    PubMed

    Zhang, Kaihui; Liu, Shu; Feng, Bing; Yang, Yali; Zhang, Haiyan; Dong, Rui; Liu, Yi; Gai, Zhongtao

    2016-01-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are two clinically distinct neurodevelopmental disorders caused by absence of paternally or maternally expressed imprinted genes on chr15q11.2-q13.3. Three mechanisms are known to be involved in the pathogenesis: microdeletions, uniparental disomy (UPD) and imprinting defects. Both disorders are difficult to be definitely diagnosed at early age if no available molecular cytogenetic tests. In this study, we identified 5 AS patients with the maternal deletion and 26 PWS patients with paternal deletion on chr15q11-q13 by using an innovative multiplex-fluorescent-labeled short tandem repeats (STRs) assay based on linkage analysis, and validated by the methylation-specific PCR and array comparative genomic hybridization techniques. More interesting, one of these PWS patients was confirmed as maternal uniparental isodisomy by the STR linkage analysis. The phenotypic and genotypic characteristics of these individuals were also presented. Our results indicate that the new linkage analysis is much faster and easier for large-scale screening deletion and uniparental disomy, thus providing a valuable method for early diagnosis of PWS/AS patients, which is critical for genetic diagnosis, management and improvement of prognosis.

  10. Clinical Application of an Innovative Multiplex-Fluorescent-Labeled STRs Assay for Prader-Willi Syndrome and Angelman Syndrome

    PubMed Central

    Feng, Bing; Yang, Yali; Zhang, Haiyan; Dong, Rui; Liu, Yi; Gai, Zhongtao

    2016-01-01

    Prader-Willi syndrome (PWS) and Angelman syndrome (AS) are two clinically distinct neurodevelopmental disorders caused by absence of paternally or maternally expressed imprinted genes on chr15q11.2-q13.3. Three mechanisms are known to be involved in the pathogenesis: microdeletions, uniparental disomy (UPD) and imprinting defects. Both disorders are difficult to be definitely diagnosed at early age if no available molecular cytogenetic tests. In this study, we identified 5 AS patients with the maternal deletion and 26 PWS patients with paternal deletion on chr15q11-q13 by using an innovative multiplex-fluorescent-labeled short tandem repeats (STRs) assay based on linkage analysis, and validated by the methylation-specific PCR and array comparative genomic hybridization techniques. More interesting, one of these PWS patients was confirmed as maternal uniparental isodisomy by the STR linkage analysis. The phenotypic and genotypic characteristics of these individuals were also presented. Our results indicate that the new linkage analysis is much faster and easier for large-scale screening deletion and uniparental disomy, thus providing a valuable method for early diagnosis of PWS/AS patients, which is critical for genetic diagnosis, management and improvement of prognosis. PMID:26841067

  11. Integrative transcriptome network analysis of iPSC-derived neurons from schizophrenia and schizoaffective disorder patients with 22q11.2 deletion.

    PubMed

    Lin, Mingyan; Pedrosa, Erika; Hrabovsky, Anastasia; Chen, Jian; Puliafito, Benjamin R; Gilbert, Stephanie R; Zheng, Deyou; Lachman, Herbert M

    2016-11-15

    Individuals with 22q11.2 Deletion Syndrome (22q11.2 DS) are a specific high-risk group for developing schizophrenia (SZ), schizoaffective disorder (SAD) and autism spectrum disorders (ASD). Several genes in the deleted region have been implicated in the development of SZ, e.g., PRODH and DGCR8. However, the mechanistic connection between these genes and the neuropsychiatric phenotype remains unclear. To elucidate the molecular consequences of 22q11.2 deletion in early neural development, we carried out RNA-seq analysis to investigate gene expression in early differentiating human neurons derived from induced pluripotent stem cells (iPSCs) of 22q11.2 DS SZ and SAD patients. Eight cases (ten iPSC-neuron samples in total including duplicate clones) and seven controls (nine in total including duplicate clones) were subjected to RNA sequencing. Using a systems level analysis, differentially expressed genes/gene-modules and pathway of interests were identified. Lastly, we related our findings from in vitro neuronal cultures to brain development by mapping differentially expressed genes to BrainSpan transcriptomes. We observed ~2-fold reduction in expression of almost all genes in the 22q11.2 region in SZ (37 genes reached p-value < 0.05, 36 of which reached a false discovery rate < 0.05). Outside of the deleted region, 745 genes showed significant differences in expression between SZ and control neurons (p < 0.05). Function enrichment and network analysis of the differentially expressed genes uncovered converging evidence on abnormal expression in key functional pathways, such as apoptosis, cell cycle and survival, and MAPK signaling in the SZ and SAD samples. By leveraging transcriptome profiles of normal human brain tissues across human development into adulthood, we showed that the differentially expressed genes converge on a sub-network mediated by CDC45 and the cell cycle, which would be disrupted by the 22q11.2 deletion during embryonic brain development, and another sub-network modulated by PRODH, which could contribute to disruption of brain function during adolescence. This study has provided evidence for disruption of potential molecular events in SZ patient with 22q11.2 deletion and related our findings from in vitro neuronal cultures to functional perturbations that can occur during brain development in SZ.

  12. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family

    NASA Astrophysics Data System (ADS)

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-01

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  13. A recurrent deletion mutation in OPA1 causes autosomal dominant optic atrophy in a Chinese family.

    PubMed

    Zhang, Liping; Shi, Wei; Song, Liming; Zhang, Xiao; Cheng, Lulu; Wang, Yanfang; Ge, Xianglian; Li, Wei; Zhang, Wei; Min, Qingjie; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-11-06

    Autosomal dominant optic atrophy (ADOA) is the most frequent form of hereditary optic neuropathy and occurs due to the degeneration of the retinal ganglion cells. To identify the genetic defect in a family with putative ADOA, we performed capture next generation sequencing (CNGS) to screen known retinal disease genes. However, six exons failed to be sequenced by CNGS in optic atrophy 1 gene (OPA1). Sequencing of those exons identified a 4 bp deletion mutation (c.2983-1_2985del) in OPA1. Furthermore, we sequenced the transcripts of OPA1 from the patient skin fibroblasts and found there is six-nucleotide deletion (c.2984-c.2989, AGAAAG). Quantitative-PCR and Western blotting showed that OPA1 mRNA and its protein expression have no obvious difference between patient skin fibroblast and control. The analysis of protein structure by molecular modeling suggests that the mutation may change the structure of OPA1 by formation of an alpha helix protruding into an existing pocket. Taken together, we identified an OPA1 mutation in a family with ADOA by filling the missing CNGS data. We also showed that this mutation affects the structural intactness of OPA1. It provides molecular insights for clinical genetic diagnosis and treatment of optic atrophy.

  14. Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

    PubMed Central

    Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

    2016-01-01

    The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

  15. Analysis of APOBEC3A/3B germline deletion polymorphism in breast, cervical and oral cancers from South India and its impact on miRNA regulation.

    PubMed

    Revathidevi, Sundaramoorthy; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Rajkumar, Kottayasamy Seenivasagam; Ramani, Rajendran; Rajaraman, Ramamurthy; Ajay, Chandrasekar; Munirajan, Arasambattu Kannan

    2016-09-01

    Breast cancer and cervical cancer are the leading causes of death in women worldwide as well as in India, whilst oral cancer is the top most common cancer among Asian especially in Indian men in terms of both incidence and mortality rate. Genetic factors determining the predisposition to cancer are being explored to identify the signature genetic variations associated with these cancers. Recently, a germline deletion polymorphism in APOBEC3 gene cluster which completely deletes APOBEC3B coding region has been studied for its association with cancer risk. We screened the germline deletion polymorphism in 409 cancer patients (224 breast cancer, 88 cervical cancer and 97 oral cancer samples), 478 controls and 239 cervical cancer tissue DNAs of South Indian origin. The results suggest that the APOBEC3A/3B deletion polymorphism is not significantly associated with cancer risk in our study population (OR 0.739, 95 % CI, p value 0.91457). Considering the viral restriction property of APOBEC3s, we also screened cervical cancer tissue DNAs for the human papilloma virus infection. We observed a gradual increase in the frequency of HPV16 infection from AA/BB cases (66.86 %) to AA/-- cases (71.43) which signifies the impact of this deletion polymorphism in HPV infection. In addition, we performed in silico analysis to understand the effect of this polymorphism on miRNA regulation of the APOBEC3A/3B fusion transcript. Only 8 APOBEC3B targeting miRNAs were observed to regulate the fusion transcript of which miR-34b-3p and miR-138-5p were found to be frequently downregulated in cancers suggesting miRNA-mediated deregulation of APOBEC3A expression in cancer patients harbouring this particular deletion polymorphism.

  16. Production and characterization of alien chromosome additions in shallot (Allium cepa L. Aggregatum group) carrying extra chromosome(s) of Japanese bunching onion (A. fistulosum L.).

    PubMed

    Hang, Tran Thi Minh; Shigyo, Masayoshi; Yamauchi, Naoki; Tashiro, Yosuke

    2004-10-01

    First and second backcrosses of amphidiploid hybrids (2n = 4x = 32, genomes AAFF) between shallot (Allium cepa Aggregatum group) and A. fistulosum were conducted to produce A. cepa - A. fistulosum alien addition lines. When shallot (A. cepa Aggregatum group) was used as a pollinator, the amphidiploids and allotriploids set germinable BC(1) and BC(2) seeds, respectively. The 237 BC(1) plants mainly consisted of 170 allotriploids (2n = 3x = 24, AAF) and 42 hypo-allotriploids possessing 23 chromosomes, i.e., single-alien deletions (2n = 3x-1 = 23, AAF-nF). The single-alien deletions in the BC(1) progeny showed dwarfing characteristics and were discriminated from the allotriploids (2n = 24) and hyper-allotriploids (2n = 25) by means of flow cytometric analysis. The chromosome numbers of 46 BC(2) seedlings varied from 16 to 24. Eight monosomic additions (2n = 2x+1 = 17, AA+nF) and 20 single-alien deletions were found in these BC(2) seedlings. Consequently, six kinds of A. cepa - A. fistulosum alien chromosome additions possessing different chromosome numbers (2n = 17, 18, 20, 21, 22, 23) were recognized in the BC(1) and BC(2) populations. A total of 79 aneuploids, including 62 single-alien deletions, were analyzed by a chromosome 6F-specific isozyme marker (Got-2) in order to recognize its existence in their chromosome complements. This analysis revealed that two out of 62 single-alien deletions did not possess 6F. One (AAF-6F) out of the possible eight single-alien deletions could be identified at first. The present study is a first step toward the development of a useful tool, such as a complete set of eight different single-alien deletions, for the rapid chromosomal assignment of genes and genetic markers in A. fistulosum.

  17. Application of oligonucleotide array CGH to the simultaneous detection of a deletion in the nuclear TK2 gene and mtDNA depletion.

    PubMed

    Zhang, Shulin; Li, Fang-Yuan; Bass, Harold N; Pursley, Amber; Schmitt, Eric S; Brown, Blaire L; Brundage, Ellen K; Mardach, Rebecca; Wong, Lee-Jun

    2010-01-01

    Thymidine kinase 2 (TK2), encoded by the TK2 gene on chromosome 16q22, is one of the deoxyribonucleoside kinases responsible for the maintenance of mitochondrial deoxyribonucleotide pools. Defects in TK2 mainly cause a myopathic form of the mitochondrial DNA depletion syndrome (MDDS). Currently, only point mutations and small insertions and deletions have been reported in TK2 gene; gross rearrangements of TK2 gene and possible hepatic involvement in patients with TK2 mutations have not been described. We report a non-consanguineous Jordanian family with three deceased siblings due to mtDNA depletion. Sequence analysis of the father detected a heterozygous c.761T>A (p.I254N) mutation in his TK2 gene; however, point mutations in the mother were not detected. Subsequent gene dosage analysis using oligonucleotide array CGH identified an intragenic approximately 5.8-kb deletion encompassing the 5'UTR to intron 2 of her TK2 gene. Sequence analysis confirmed that the deletion spans c.1-495 to c.283-2899 of the TK2 gene (nucleotide 65,136,256-65,142,086 of chromosome 16). Analysis of liver and muscle specimens from one of the deceased infants in this family revealed compound heterozygosity for the paternal point mutation and maternal intragenic deletion. In addition, a significant reduction of the mtDNA content in liver and muscle was detected (10% and 20% of age- and tissue-matched controls, respectively). Prenatal diagnosis was performed in the third pregnancy. The fetus was found to carry both the point mutation and the deletion. This child died 6months after birth due to myopathy. A serum specimen demonstrated elevated liver transaminases in two of the infants from whom results were available. This report expands the mutation spectrum associated with TK2 deficiency. While the myopathic form of MDDS appears to be the main phenotype of TK2 mutations, liver dysfunction may also be a part of the mitochondrial depletion syndrome caused by TK2 gene defects.

  18. A highly penetrant form of childhood apraxia of speech due to deletion of 16p11.2

    PubMed Central

    Fedorenko, Evelina; Morgan, Angela; Murray, Elizabeth; Cardinaux, Annie; Mei, Cristina; Tager-Flusberg, Helen; Fisher, Simon E; Kanwisher, Nancy

    2016-01-01

    Individuals with heterozygous 16p11.2 deletions reportedly suffer from a variety of difficulties with speech and language. Indeed, recent copy-number variant screens of children with childhood apraxia of speech (CAS), a specific and rare motor speech disorder, have identified three unrelated individuals with 16p11.2 deletions. However, the nature and prevalence of speech and language disorders in general, and CAS in particular, is unknown for individuals with 16p11.2 deletions. Here we took a genotype-first approach, conducting detailed and systematic characterization of speech abilities in a group of 11 unrelated children ascertained on the basis of 16p11.2 deletions. To obtain the most precise and replicable phenotyping, we included tasks that are highly diagnostic for CAS, and we tested children under the age of 18 years, an age group where CAS has been best characterized. Two individuals were largely nonverbal, preventing detailed speech analysis, whereas the remaining nine met the standard accepted diagnostic criteria for CAS. These results link 16p11.2 deletions to a highly penetrant form of CAS. Our findings underline the need for further precise characterization of speech and language profiles in larger groups of affected individuals, which will also enhance our understanding of how genetic pathways contribute to human communication disorders. PMID:26173965

  19. Generation of megabase-scale deletions, inversions and duplications involving the Contactin-6 gene in mice by CRISPR/Cas9 technology.

    PubMed

    Korablev, Alexei N; Serova, Irina A; Serov, Oleg L

    2017-12-28

    Copy Number Variation (CNV) of the human CNTN6 gene (encoding the contactin-6 protein), caused by deletions or duplications, is responsible for severe neurodevelopmental impairments, often in combination with facial dysmorphias. Conversely, deleterious point mutations of this gene do not show any clinical phenotypes. The aim of this study is to generate mice carrying large deletions, duplications and inversions involving the Cntn6 gene as a new experimental model to study CNV of the human CNTN6 locus. To generate large chromosomal rearrangements on mouse chromosome 6, we applied CRISPR/Cas9 technology in zygotes. Two guide RNAs (gRNAs) (flanking a DNA fragment of 1137 Mb) together with Cas9 mRNA and single-stranded DNA oligonucleotides (ssODN) were microinjected into the cytoplasm of 599 zygotes of F1 (C57BL x CBA) mice, and 256 of them were transplanted into oviducts of CD-1 females. As a result, we observed the birth of 41 viable F0 offspring. Genotyping of these mice was performed by PCR analysis and sequencing of PCR products. Among the 41 F0 offspring, we identified seven mice with deletions, two animals carrying duplications of the gene and four carrying inversions. Interestingly, two F0 offspring had both deletions and duplications. It is important to note that while three of seven deletion carriers showed expected sequences at the new joint sites, in another three, we identified an absence of 1-10 nucleotides at the CRISPR/Cas9 cut sites, and in one animal, 103 bp were missing, presumably due to error-prone non-homologous end joining. In addition, we detected the absence of 5 and 13 nucleotides at these sites in two F0 duplication carriers. Similar sequence changes at CRISPR/Cas9 cut sites were observed at the right and left boundaries of inversions. Thus, megabase-scale deletions, duplications and inversions were identified in 11 F0 offspring among 41 analyzed, i.e., approximately 25% efficiency. All genetically modified F0 offspring were viable and able to transmit these large chromosomal rearrangements to the next generation. Using CRISPR/Cas9 technology, we created mice carrying megabase-scale deletions, duplications, and inversions involving the full-sized Cntn6 gene. These mice became founders of new mouse lines, which may be more appropriate experimental models of CNV in the human 3p26.3 region than Сntn6 knockout mice.

  20. Detection of α-thalassemia-1 Southeast Asian and Thai Type Deletions and β-thalassemia 3.5-kb Deletion by Single-tube Multiplex Real-time PCR with SYBR Green1 and High-resolution Melting Analysis

    PubMed Central

    Wiengkum, Thanatcha; Srithep, Sarinee; Chainoi, Isarapong; Singboottra, Panthong; Wongwiwatthananukit, Sanchai

    2011-01-01

    Background Prevention and control of thalassemia requires simple, rapid, and accurate screening tests for carrier couples who are at risk of conceiving fetuses with severe thalassemia. Methods Single-tube multiplex real-time PCR with SYBR Green1 and high-resolution melting (HRM) analysis were used for the identification of α-thalassemia-1 Southeast Asian (SEA) and Thai type deletions and β-thalassemia 3.5-kb gene deletion. The results were compared with those obtained using conventional gap-PCR. DNA samples were derived from 28 normal individuals, 11 individuals with α-thalassemia-1 SEA type deletion, 2 with α-thalassemia-1 Thai type deletion, and 2 with heterozygous β-thalassemia 3.5-kb gene deletion. Results HRM analysis indicated that the amplified fragments from α-thalassemia-1 SEA type deletion, α-thalassemia-1 Thai type deletion, β-thalassemia 3.5-kb gene deletion, and the wild-type β-globin gene had specific peak heights at mean melting temperature (Tm) values of 86.89℃, 85.66℃, 77.24℃, and 74.92℃, respectively. The results obtained using single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis showed 100% consistency with those obtained using conventional gap-PCR. Conclusions Single-tube multiplex real-time PCR with SYBR Green1 and HRM analysis is a potential alternative for routine clinical screening of the common types of α- and β-thalassemia large gene deletions, since it is simple, cost-effective, and highly accurate. PMID:21779184

  1. Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.

    PubMed

    Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito

    2017-04-01

    Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.

  2. Rare genomic rearrangement in a boy with Williams-Beuren syndrome associated to XYY syndrome and intriguing behavior.

    PubMed

    Dutra, Roberta L; Piazzon, Flavia B; Zanardo, Évelin A; Costa, Thais Virginia Moura Machado; Montenegro, Marília M; Novo-Filho, Gil M; Dias, Alexandre T; Nascimento, Amom M; Kim, Chong Ae; Kulikowski, Leslie D

    2015-12-01

    Williams-Beuren syndrome (WBS) is caused by a hemizygous contiguous gene microdeletion of 1.55-1.84 Mb at 7q11.23 region. Approximately, 28 genes have been shown to contribute to classical phenotype of SWB with presence of dysmorphic facial features, supravalvular aortic stenosis (SVAS), intellectual disability, and overfriendliness. With the use of Microarray-based comparative genomic hybridization and other molecular cytogenetic techniques, is possible define with more accuracy partial or atypical deletion and refine the genotype-phenotype correlation. Here, we report on a rare genomic structural rearrangement in a boy with atypical deletion in 7q11.23 and XYY syndrome with characteristic clinical signs, but not sufficient for the diagnosis of WBS. Cytogenetic analysis of G-banding showed a karyotype 47,XYY. Analysis of DNA with the technique of MLPA (Multiplex Ligation-dependent Probe Amplification) using kits a combination of kits (P064, P036, P070, and P029) identified an atypical deletion on 7q11.23. In addition, high resolution SNP Oligonucleotide Microarray Analysis (SNP-array) confirmed the alterations found by MLPA and revealed others pathogenic CNVs, in the chromosomes 7 and X. The present report demonstrates an association not yet described in literature, between Williams-Beuren syndrome and 47,XYY. The identification of atypical deletion in 7q11.23 concomitant to additional pathogenic CNVs in others genomic regions allows a better comprehension of clinical consequences of atypical genomic rearrangements. © 2015 Wiley Periodicals, Inc.

  3. Subtelomeric Deletion of Chromosome 10p15.3: Clinical Findings and Molecular Cytogenetic Characterization

    PubMed Central

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H.; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia AL; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B.A.; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-01-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11,), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM# 608668) and DIP2C (OMIM# 611380) (UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. PMID:22847950

  4. Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

    PubMed

    DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

    2012-09-01

    We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

  5. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

    PubMed

    Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

    2014-12-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain.

  6. Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

    PubMed Central

    Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

    2014-01-01

    Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence interval 2.24–31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. PMID:25281868

  7. Wide allelic heterogeneity with predominance of large IDS gene complex rearrangements in a sample of Mexican patients with Hunter syndrome.

    PubMed

    Alcántara-Ortigoza, M A; García-de Teresa, B; González-Del Angel, A; Berumen, J; Guardado-Estrada, M; Fernández-Hernández, L; Navarrete-Martínez, J I; Maza-Morales, M; Rius-Domínguez, R

    2016-05-01

    Hunter syndrome or mucopolysaccharidosis type II (MPSII) is caused by pathogenic variants in the IDS gene. This is the first study that examines the mutational spectrum in 25 unrelated Mexican MPSII families. The responsible genotype was identified in 96% of the families (24/25) with 10 novel pathogenic variants: c.133G>C, c.1003C>T, c.1025A>C, c.463_464delinsCCGTATAGCTGG, c.754_767del, c.1132_1133del, c.1463del, c.508-1G>C, c.1006+1G>T and c.(-217_103del). Extensive IDS gene deletions were identified in four patients; using DNA microarray analysis two patients showed the loss of the entire AFF2 gene, and epilepsy developed in only one of them. Wide allelic heterogeneity was noted, with large gene alterations (e.g. IDS/IDSP1 gene inversions, partial to extensive IDS deletions, and one chimeric IDS-IDSP1 allele) that occurred at higher frequencies than previously reported (36% vs 18.9-29%). The frequency of carrier mothers (80%) is consistent with previous descriptions (>70%). Carrier assignment allowed molecular prenatal diagnoses. Notably, somatic and germline mosaicism was identified in one family, and two patients presented thrombocytopenic purpura and pancytopenia after idursulfase enzyme replacement treatment. Our findings suggest a wide allelic heterogeneity in Mexican MPSII patients; DNA microarray analysis contributes to further delineation of the resulting phenotype for IDS and neighboring loci deletions. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  8. Identification of three critical regions within mouse interleukin 2 by fine structural deletion analysis.

    PubMed Central

    Zurawski, S M; Zurawski, G

    1988-01-01

    We have analyzed structure--function relationships of the protein hormone murine interleukin 2 by fine structural deletion mapping. A total of 130 deletion mutant proteins, together with some substitution and insertion mutant proteins, was expressed in Escherichia coli and analyzed for their ability to sustain the proliferation of a cloned murine T cell line. This analysis has permitted a functional map of the protein to be drawn and classifies five segments of the protein, which together contain 48% of the sequence, as unessential to the biological activity of the protein. A further 26% of the protein is classified as important, but not crucial, for the activity. Three regions, consisting of amino acids 32-35, 66-77 and 119-141 contain the remaining 26% of the protein and are critical to the biological activity of the protein. The functional map is discussed in the context of the possible role of the identified critical regions in the structure of the hormone and its binding to the interleukin 2 receptor complex. Images PMID:3261239

  9. Detection of three-base deletion by exciplex formation with perylene derivatives.

    PubMed

    Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki

    2011-06-14

    Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011

  10. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain

    PubMed Central

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-01-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ∼3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ∼2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5′ CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ∼750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain. PMID:25482058

  11. Influence of the Prader-Willi syndrome imprinting center on the DNA methylation landscape in the mouse brain.

    PubMed

    Brant, Jason O; Riva, Alberto; Resnick, James L; Yang, Thomas P

    2014-11-01

    Reduced representation bisulfite sequencing (RRBS) was used to analyze DNA methylation patterns across the mouse brain genome in mice carrying a deletion of the Prader-Willi syndrome imprinting center (PWS-IC) on either the maternally- or paternally-inherited chromosome. Within the ~3.7 Mb imprinted Angelman/Prader-Willi syndrome (AS/PWS) domain, 254 CpG sites were interrogated for changes in methylation due to PWS-IC deletion. Paternally-inherited deletion of the PWS-IC increased methylation levels ~2-fold at each CpG site (compared to wild-type controls) at differentially methylated regions (DMRs) associated with 5' CpG island promoters of paternally-expressed genes; these methylation changes extended, to a variable degree, into the adjacent CpG island shores. Maternal PWS-IC deletion yielded little or no changes in methylation at these DMRs, and methylation of CpG sites outside of promoter DMRs also was unchanged upon maternal or paternal PWS-IC deletion. Using stringent ascertainment criteria, ~750,000 additional CpG sites were also interrogated across the entire mouse genome. This analysis identified 26 loci outside of the imprinted AS/PWS domain showing altered DNA methylation levels of ≥25% upon PWS-IC deletion. Curiously, altered methylation at 9 of these loci was a consequence of maternal PWS-IC deletion (maternal PWS-IC deletion by itself is not known to be associated with a phenotype in either humans or mice), and 10 of these loci exhibited the same changes in methylation irrespective of the parental origin of the PWS-IC deletion. These results suggest that the PWS-IC may affect DNA methylation at these loci by directly interacting with them, or may affect methylation at these loci through indirect downstream effects due to PWS-IC deletion. They further suggest the PWS-IC may have a previously uncharacterized function outside of the imprinted AS/PWS domain.

  12. Multigene signature for predicting prognosis of patients with 1p19q co-deletion diffuse glioma.

    PubMed

    Hu, Xin; Martinez-Ledesma, Emmanuel; Zheng, Siyuan; Kim, Hoon; Barthel, Floris; Jiang, Tao; Hess, Kenneth R; Verhaak, Roel G W

    2017-06-01

    Co-deletion of 1p and 19q marks a diffuse glioma subtype associated with relatively favorable overall survival; however, heterogeneous clinical outcomes are observed within this category. We assembled gene expression profiles and sample annotation of 374 glioma patients carrying the 1p/19q co-deletion. We predicted 1p/19q status using gene expression when annotation was missing. A first cohort was randomly split into training (n = 170) and a validation dataset (n = 163). A second validation set consisted of 41 expression profiles. An elastic-net penalized Cox proportional hazards model was applied to build a classifier model through cross-validation within the training dataset. The selected 35-gene signature was used to identify high-risk and low-risk groups in the validation set, which showed significantly different overall survival (P = .00058, log-rank test). For time-to-death events, the high-risk group predicted by the gene signature yielded a hazard ratio of 1.78 (95% confidence interval, 1.02-3.11). The signature was also significantly associated with clinical outcome in the The Cancer Genome Atlas (CGA) IDH-mutant 1p/19q wild-type and IDH-wild-type glioma cohorts. Pathway analysis suggested that high risk was associated with increased acetylation activity and inflammatory response. Tumor purity was found to be significantly decreased in high-risk IDH-mutant with 1p/19q co-deletion gliomas and IDH-wild-type glioblastomas but not in IDH-wild-type lower grade or IDH-mutant, non-co-deleted gliomas. We identified a 35-gene signature that identifies high-risk and low-risk categories of 1p/19q positive glioma patients. We have demonstrated heterogeneity amongst a relatively new glioma subtype and provided a stepping stone towards risk stratification. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. Coinfection by multiple strains of Epstein-Barr virus in infectious mononucleosis in immunocompetent patients.

    PubMed

    Plaza, Guillermo; Santón, Almundena; Bellas, Carment

    2003-05-01

    A molecular study of Epstein-Barr virus (EBV)-induced infectious mononucleosis (IM) was performed. The presence of a 30-bp deletion on the latent membrane protein-1 (LMP-1) oncogene from EBV in Caucasian IM patients was evaluated. Peripheral blood mononuclear cells were obtained from 27 IM patients and 18 adenoids, 28 tonsils and 16 EBV-related reactive lymphadenitis specimens were used as controls. DNA isolation, EBV polymerase chain reaction (PCR) and LMP-1 oncogene PCR analysis were performed. The 30-bp deletion on LMP-1 was identified in 29.6% of IM patients, but was always seen in conjunction with full-length LMP-1. Although the LMP-1-deleted strain seemed to be more prevalent in IM (29.6%) and EBV-related reactive lymphadenitis (37.5%,) than in adenoid (0%) or tonsil specimens (21.4%), these differences were not significant (p > 0.05; chi2). Thus, a 30-bp deletion on LMP-1 was present in almost a third of Caucasian IM patients. The finding of coinfections in IM patients confirms that primary infection by more than one EBV strain is possible.

  14. Haploid deletion strains of Saccharomyces cerevisiae that determine survival during space flight

    NASA Astrophysics Data System (ADS)

    Johanson, Kelly; Allen, Patricia L.; Gonzalez-Villalobos, Romer A.; Nesbit, Jacqueline; Nickerson, Cheryl A.; Höner zu Bentrup, Kerstin; Wilson, James W.; Ramamurthy, Rajee; D'Elia, Riccardo; Muse, Kenneth E.; Hammond, Jeffrey; Freeman, Jake; Stodieck, Louis S.; Hammond, Timothy G.

    2007-02-01

    This study identifies genes that determine survival during a space flight, using the model eukaryotic organism, Saccharomyces cerevisiae. Select strains of a haploid yeast deletion series grew during storage in distilled water in space, but not in ground based static or clinorotation controls. The survival advantages in space in distilled water include a 133-fold advantage for the deletion of PEX19, a chaperone and import receptor for newly- synthesized class I peroxisomal membrane proteins, to 77-40 fold for deletion strains lacking elements of aerobic respiration, isocitrate metabolism, and mitochondrial electron transport. Following automated addition of rich growth media, the space flight was associated with a marked survival advantage of strains with deletions in catalytically active genes including hydrolases, oxidoreductases and transferases. When compared to static controls, space flight was associated with a marked survival disadvantage of deletion strains lacking transporter, antioxidant and catalytic activity. This study identifies yeast deletion strains with a survival advantage during storage in distilled water and space flight, and amplifies our understanding of the genes critical for survival in space.

  15. Isolated chromosome 8p23.2‑pter deletion: Novel evidence for developmental delay, intellectual disability, microcephaly and neurobehavioral disorders.

    PubMed

    Shi, Shanshan; Lin, Shaobin; Chen, Baojiang; Zhou, Yi

    2017-11-01

    The current study presents a patient carrying a de novo ~6 Mb deletion of the isolated chromosome 8p23.2‑pter that was identified with a single‑nucleotide polymorphism array. The patient was characterized by developmental delay (DD)/intellectual disability (ID), microcephaly, autism spectrum disorder, attention‑deficit/hyperactivity disorders and mildly dysmorphic features. The location, size and gene content of the deletion observed in this patient were compared with those in 7 patients with isolated 8p23.2 to 8pter deletions reported in previous studies (4 patients) or recorded in the Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources (DECIPHER) database (3 patients). The deletions reported in previous studies were assessed using a chromosomal microarray analysis. The 8p23.2‑pter deletion was a distinct microdeletion syndrome, as similar phenotypes were observed in patients with this deletion. Furthermore, following a detailed review of the potential associations between the genes located from 8p23.2 to 8pter and their clinical significance, it was hypothesized that DLG associated protein 2, ceroid‑lipofuscinosis neuronal 8, Rho guanine nucleotide exchange factor 10 and CUB and sushi multiple domains 1 may be candidate genes for DD/ID, microcephaly and neurobehavioral disorders. However, firm evidence should be accumulated from high‑resolution studies of patients with small, isolated, overlapping and interstitial deletions involving the region from 8p23.2 to 8pter. These studies will allow determination of genotype‑phenotype associations for the specific genes crucial to 8p23.2‑pter.

  16. Deletion at the SLC1A1 glutamate transporter gene co-segregates with schizophrenia and bipolar schizoaffective disorder in a 5-generation family.

    PubMed

    Myles-Worsley, Marina; Tiobech, Josepha; Browning, Sharon R; Korn, Jeremy; Goodman, Sarah; Gentile, Karen; Melhem, Nadine; Byerley, William; Faraone, Stephen V; Middleton, Frank A

    2013-03-01

    Growing evidence for genetic overlap between schizophrenia (SCZ) and bipolar disorder (BPD) suggests that causal variants of large effect on disease risk may cross traditional diagnostic boundaries. Extended multigenerational families with both SCZ and BPD cases can be a valuable resource for discovery of shared biological pathways because they can reveal the natural evolution of the underlying genetic disruptions and their phenotypic expression. We investigated a deletion at the SLC1A1 glutamate transporter gene originally identified as a copy number variant exclusively carried by members of a 5-generation Palauan family. Using an expanded sample of 21 family members, quantitative PCR confirmed the deletion in all seven individuals with psychosis, three "obligate-carrier" parents and one unaffected sibling, while four marry-in parents were non-carriers. Linkage analysis under an autosomal dominant model generated a LOD-score of 3.64, confirming co-segregation of the deletion with psychosis. For more precise localization, we determined the approximate deletion end points using alignment of next-generation sequencing data for one affected deletion-carrier and then designed PCR amplicons to span the entire deletion locus. These probes established that the deletion spans 84,298 bp, thus eliminating the entire promoter, the transcription start site, and the first 59 amino acids of the protein, including the first transmembrane Na(2+)/dicarboxylate symporter domain, one of the domains that perform the glutamate transport action. Discovery of this functionally relevant SLC1A1 mutation and its co-segregation with psychosis in an extended multigenerational pedigree provides further support for the important role played by glutamatergic transmission in the pathophysiology of psychotic disorders. Copyright © 2013 Wiley Periodicals, Inc.

  17. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    PubMed Central

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  18. Intronic deletions in the SLC34A3 gene: a cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria.

    PubMed

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R; Gray, Amie K; Baluarte, H Jorge; Econs, Michael J

    2014-02-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6-1/2-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24-hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH), and elevated 1,25(OH)2D. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440-1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. © 2013.

  19. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  20. Proteogenomics connects somatic mutations to signalling in breast cancer.

    PubMed

    Mertins, Philipp; Mani, D R; Ruggles, Kelly V; Gillette, Michael A; Clauser, Karl R; Wang, Pei; Wang, Xianlong; Qiao, Jana W; Cao, Song; Petralia, Francesca; Kawaler, Emily; Mundt, Filip; Krug, Karsten; Tu, Zhidong; Lei, Jonathan T; Gatza, Michael L; Wilkerson, Matthew; Perou, Charles M; Yellapantula, Venkata; Huang, Kuan-lin; Lin, Chenwei; McLellan, Michael D; Yan, Ping; Davies, Sherri R; Townsend, R Reid; Skates, Steven J; Wang, Jing; Zhang, Bing; Kinsinger, Christopher R; Mesri, Mehdi; Rodriguez, Henry; Ding, Li; Paulovich, Amanda G; Fenyö, David; Ellis, Matthew J; Carr, Steven A

    2016-06-02

    Somatic mutations have been extensively characterized in breast cancer, but the effects of these genetic alterations on the proteomic landscape remain poorly understood. Here we describe quantitative mass-spectrometry-based proteomic and phosphoproteomic analyses of 105 genomically annotated breast cancers, of which 77 provided high-quality data. Integrated analyses provided insights into the somatic cancer genome including the consequences of chromosomal loss, such as the 5q deletion characteristic of basal-like breast cancer. Interrogation of the 5q trans-effects against the Library of Integrated Network-based Cellular Signatures, connected loss of CETN3 and SKP1 to elevated expression of epidermal growth factor receptor (EGFR), and SKP1 loss also to increased SRC tyrosine kinase. Global proteomic data confirmed a stromal-enriched group of proteins in addition to basal and luminal clusters, and pathway analysis of the phosphoproteome identified a G-protein-coupled receptor cluster that was not readily identified at the mRNA level. In addition to ERBB2, other amplicon-associated highly phosphorylated kinases were identified, including CDK12, PAK1, PTK2, RIPK2 and TLK2. We demonstrate that proteogenomic analysis of breast cancer elucidates the functional consequences of somatic mutations, narrows candidate nominations for driver genes within large deletions and amplified regions, and identifies therapeutic targets.

  1. Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report.

    PubMed

    de la Houssaye, Guillaume; Bieche, Ivan; Roche, Olivier; Vieira, Véronique; Laurendeau, Ingrid; Arbogast, Laurence; Zeghidi, Hatem; Rapp, Philippe; Halimi, Philippe; Vidaud, Michel; Dufier, Jean-Louis; Menasche, Maurice; Abitbol, Marc

    2006-11-29

    Axenfeld-Rieger syndrome (ARS) is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Two members of this family (father and daughter) presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI) detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments.

  2. Breed relationships facilitate fine-mapping studies: A 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds

    PubMed Central

    Parker, Heidi G.; Kukekova, Anna V.; Akey, Dayna T.; Goldstein, Orly; Kirkness, Ewen F.; Baysac, Kathleen C.; Mosher, Dana S.; Aguirre, Gustavo D.; Acland, Gregory M.; Ostrander, Elaine A.

    2007-01-01

    The features of modern dog breeds that increase the ease of mapping common diseases, such as reduced heterogeneity and extensive linkage disequilibrium, may also increase the difficulty associated with fine mapping and identifying causative mutations. One way to address this problem is by combining data from multiple breeds segregating the same trait after initial linkage has been determined. The multibreed approach increases the number of potentially informative recombination events and reduces the size of the critical haplotype by taking advantage of shortened linkage disequilibrium distances found across breeds. In order to identify breeds that likely share a trait inherited from the same ancestral source, we have used cluster analysis to divide 132 breeds of dog into five primary breed groups. We then use the multibreed approach to fine-map Collie eye anomaly (cea), a complex disorder of ocular development that was initially mapped to a 3.9-cM region on canine chromosome 37. Combined genotypes from affected individuals from four breeds of a single breed group significantly narrowed the candidate gene region to a 103-kb interval spanning only four genes. Sequence analysis revealed that all affected dogs share a homozygous deletion of 7.8 kb in the NHEJ1 gene. This intronic deletion spans a highly conserved binding domain to which several developmentally important proteins bind. This work both establishes that the primary cea mutation arose as a single disease allele in a common ancestor of herding breeds as well as highlights the value of comparative population analysis for refining regions of linkage. PMID:17916641

  3. Human Calmodulin Methyltransferase: Expression, Activity on Calmodulin, and Hsp90 Dependence

    PubMed Central

    Magen, Sophia; Magnani, Roberta; Haziza, Sitvanit; Hershkovitz, Eli; Houtz, Robert; Cambi, Franca; Parvari, Ruti

    2012-01-01

    Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34) has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2nd known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes. PMID:23285036

  4. Human calmodulin methyltransferase: expression, activity on calmodulin, and Hsp90 dependence.

    PubMed

    Magen, Sophia; Magnani, Roberta; Haziza, Sitvanit; Hershkovitz, Eli; Houtz, Robert; Cambi, Franca; Parvari, Ruti

    2012-01-01

    Deletion of the first exon of calmodulin-lysine N-methyltransferase (CaM KMT, previously C2orf34) has been reported in two multigene deletion syndromes, but additional studies on the gene have not been reported. Here we show that in the cells from 2p21 deletion patients the loss of CaM KMT expression results in accumulation of hypomethylated calmodulin compared to normal controls, suggesting that CaM KMT is essential for calmodulin methylation and there are no compensatory mechanisms for CaM methylation in humans. We have further studied the expression of this gene at the transcript and protein levels. We have identified 2 additional transcripts in cells of the 2p21 deletion syndrome patients that start from alternative exons positioned outside the deletion region. One of them starts in the 2(nd) known exon, the other in a novel exon. The transcript starting from the novel exon was also identified in a variety of tissues from normal individuals. These new transcripts are not expected to produce proteins. Immunofluorescent localization of tagged CaM KMT in HeLa cells indicates that it is present in both the cytoplasm and nucleus of cells whereas the short isoform is localized to the Golgi apparatus. Using Western blot analysis we show that the CaM KMT protein is broadly expressed in mouse tissues. Finally we demonstrate that the CaM KMT interacts with the middle portion of the Hsp90 molecular chaperon and is probably a client protein since it is degraded upon treatment of cells with the Hsp90 inhibitor geldanamycin. These findings suggest that the CaM KMT is the major, possibly the single, methyltransferase of calmodulin in human cells with a wide tissue distribution and is a novel Hsp90 client protein. Thus our data provides basic information for a gene potentially contributing to the patient phenotype of two contiguous gene deletion syndromes.

  5. Demonstration of a novel Xp22.2 microdeletion as the cause of familial extreme skewing of X-inactivation utilizing case-parent trio SNP microarray analysis.

    PubMed

    Mason, Jane A; Aung, Hnin T; Nandini, Adayapalam; Woods, Rickie G; Fairbairn, David J; Rowell, John A; Young, David; Susman, Rachel D; Brown, Simon A; Hyland, Valentine J; Robertson, Jeremy D

    2018-05-01

    We report a kindred referred for molecular investigation of severe hemophilia A in a young female in which extremely skewed X-inactivation was observed in both the proband and her clinically normal mother. Bidirectional Sanger sequencing of all F8 gene coding regions and exon/intron boundaries was undertaken. Methylation-sensitive restriction enzymes were utilized to investigate skewed X-inactivation using both a classical human androgen receptor (HUMARA) assay, and a novel method targeting differential methylation patterns in multiple informative X-chromosome SNPs. Illumina Whole-Genome Infinium microarray analysis was performed in the case-parent trio (proband and both parents), and the proband's maternal grandmother. The proband was a cytogenetically normal female with severe hemophilia A resulting from a heterozygous F8 pathogenic variant inherited from her similarly affected father. No F8 mutation was identified in the proband's mother, however, both the proband and her mother both demonstrated completely skewed X-chromosome inactivation (100%) in association with a previously unreported 2.3 Mb deletion at Xp22.2. At least three disease-associated genes (FANCB, AP1S2, and PIGA) were contained within the deleted region. We hypothesize that true "extreme" skewing of X-inactivation (≥95%) is a rare occurrence, but when defined correctly there is a high probability of finding an X-chromosome disease-causing variant or larger deletion resulting in X-inactivation through a survival disadvantage or cell lethal mechanism. We postulate that the 2.3 Mb Xp22.2 deletion identified in our kindred arose de novo in the proband's mother (on the grandfather's homolog), and produced extreme skewing of X-inactivation via a "cell lethal" mechanism. We introduce a novel multitarget approach for X-inactivation analysis using multiple informative differentially methylated SNPs, as an alternative to the classical single locus (HUMARA) method. We propose that for females with unexplained severe phenotypic expression of an X-linked recessive disorder trio-SNP microarray should be undertaken in combination with X-inactivation analysis. © 2018 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  6. Prevalence and Spectrum of Large Deletions or Duplications in the Major Long QT Syndrome-Susceptibility Genes and Implications for Long QT Syndrome Genetic Testing

    PubMed Central

    Tester, David J.; Benton, Amber J.; Train, Laura; Deal, Barbara; Baudhuin, Linnea M.; Ackerman, Michael J.

    2010-01-01

    Long QT Syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for three cardiac ion channel alpha-subunits (LQT1-3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. Here, we set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes among unrelated patients who were mutation-negative following point mutation analysis of LQT1-12-susceptibility genes. Forty-two unrelated clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification (MLPA), a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA-MLPA LQTS Kit from MRC-Holland was used to analyze the three major LQTS-associated genes: KCNQ1, KCNH2, and SCN5A and the two minor genes: KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2/42 (4.8%, CI, 1.7–11%) unrelated patients. A deletion of KCNQ1 exon 3 was identified in a 10 year-old Caucasian boy with a QTc of 660 milliseconds (ms), a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17 year-old Caucasian girl with a QTc of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, since nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. PMID:20920651

  7. TBX6 Null Variants and a Common Hypomorphic Allele in Congenital Scoliosis

    PubMed Central

    Wu, N.; Ming, X.; Xiao, J.; Wu, Z.; Chen, X.; Shinawi, M.; Shen, Y.; Yu, G.; Liu, J.; Xie, H.; Gucev, Z.S.; Liu, S.; Yang, N.; Al-Kateb, H.; Chen, J.; Zhang, Jian; Hauser, N.; Zhang, T.; Tasic, V.; Liu, P.; Su, X.; Pan, X.; Liu, C.; Wang, L.; Shen, Joseph; Shen, Jianxiong; Chen, Y.; Zhang, T.; Zhang, Jianguo; Choy, K.W.; Wang, Jun; Wang, Q.; Li, S.; Zhou, W.; Guo, J.; Wang, Y.; Zhang, C.; Zhao, H.; An, Y.; Zhao, Y.; Wang, Jiucun; Liu, Z.; Zuo, Y.; Tian, Y.; Weng, X.; Sutton, V.R.; Wang, H.; Ming, Y.; Kulkarni, S.; Zhong, T.P.; Giampietro, P.F.; Dunwoodie, S.L.; Cheung, S.W.; Zhang, X.; Jin, L.; Lupski, J.R.; Qiu, G.; Zhang, F.

    2015-01-01

    BACKGROUND Congenital scoliosis is a common type of vertebral malformation. Genetic susceptibility has been implicated in congenital scoliosis. METHODS We evaluated 161 Han Chinese persons with sporadic congenital scoliosis, 166 Han Chinese controls, and 2 pedigrees, family members of which had a 16p11.2 deletion, using comparative genomic hybridization, quantitative polymerase-chain-reaction analysis, and DNA sequencing. We carried out tests of replication using an additional series of 76 Han Chinese persons with congenital scoliosis and a multi-center series of 42 persons with 16p11.2 deletions. RESULTS We identified a total of 17 heterozygous TBX6 null mutations in the 161 persons with sporadic congenital scoliosis (11%); we did not observe any null mutations in TBX6 in 166 controls (P<3.8×10−6). These null alleles include copy-number variants (12 instances of a 16p11.2 deletion affecting TBX6) and single-nucleotide variants (1 nonsense and 4 frame-shift mutations). However, the discordant intrafamilial phenotypes of 16p11.2 deletion carriers suggest that heterozygous TBX6 null mutation is insufficient to cause congenital scoliosis. We went on to identify a common TBX6 haplotype as the second risk allele in all 17 carriers of TBX6 null mutations (P<1.1×10−6). Replication studies involving additional persons with congenital scoliosis who carried a deletion affecting TBX6 confirmed this compound inheritance model. In vitro functional assays suggested that the risk haplotype is a hypomorphic allele. Hemivertebrae are characteristic of TBX6-associated congenital scoliosis. CONCLUSIONS Compound inheritance of a rare null mutation and a hypomorphic allele of TBX6 accounted for up to 11% of congenital scoliosis cases in the series that we analyzed. PMID:25564734

  8. Angelman syndrome assessed by neurological and molecular cytogenetic investigations.

    PubMed

    Hou, J W; Wang, P J; Wang, T R

    1997-01-01

    Angelman syndrome (AS) is characterized by severe psychomotor retardation, speech impairment, happy disposition with bursts of laughter, ataxia, convulsions, and some distinct physical anomalies. Correct diagnosis of AS is important because of its clinical implications, and once the disease is confirmed, familial genetic counseling becomes crucial. We evaluated 22 patients with a putative diagnosis of AS by both clinical and molecular cytogenetic analysis. A deletion of the region 15q11-13 could be identified cytogenetically in 11 cases by high-resolution technique (group I). Four additional cases were confirmed by fluorescence in situ hybridization (FISH) study with D15S11, SNRPN, D15S10, and GABRB 3 [Prader-Willi syndrome (PWS)/AS region probes] (group II). The common deletion of GABRB 3 was documented in those AS cases (n = 15) by FISH. The other 7 cases exhibited no deletion over 15q11-13 at either the cytogenetic or molecular level (group III). We compared the following associated neurological disorders: convulsions and abnormal EEG, microcephaly, sleep and behavior problems, brain anomalies proved by image studies, sexual precocity with pineal tumor among the three groups, as well as other clinical conditions including congenital heart disease, obesity, scoliosis, and hypopigmentation. In the present study, the differences in neurological and facial characteristics were not distinct among these groups. However, the associated conditions were more frequently observed in the patients with deletion than in those without deletion. The EEG features of AS appear to be less sufficient in helping identify patients at an early age before the clinical features become obvious. Therefore, a region involved in the major As phenotypes may contain only one or more tightly contiguous genes around the GABRB 3 locus, which may explain the clinical heterogeneity in AS.

  9. A novel whole exon deletion in WWOX gene causes early epilepsy, intellectual disability and optic atrophy.

    PubMed

    Ben-Salem, Salma; Al-Shamsi, Aisha M; John, Anne; Ali, Bassam R; Al-Gazali, Lihadh

    2015-05-01

    Recent studies have implicated the WW domain-containing oxidoreductase encoding gene (WWOX) in a severe form of autosomal recessive neurological disorder. This condition showed an overlapping spectrum of clinical features including spinocerebellar ataxia associated with generalized seizures and delayed psychomotor development to growth retardation, spasticity, and microcephaly. We evaluated a child from a consanguineous Emirati family that presented at birth with growth retardation, microcephaly, epileptic seizures, and later developed spasticity and delayed psychomotor development. Screening for deletions and duplications using whole-chromosomal microarray analysis identified a novel homozygous microdeletion encompassing exon 5 of the WWOX gene. Analysis of parental DNA indicated that this deletion was inherited from both parents and lies within a large region of homozygosity. Sanger sequencing of the cDNA showed that the deletion resulted in exon 5 skipping leading to a frame-shift and creating a premature stop codon at amino acid position 212. Quantification of mRNA revealed striking low level of WWOX expression in the child and moderate level of expression in the mother compared to a healthy control. To the best of our knowledge, this is the first homozygous germline structural variation in WWOX gene resulting in truncated transcripts that were presumably subject to NMD pathway. Our findings extend the clinical and genetic spectrum of WWOX mutations and support a crucial role of this gene in neurological development.

  10. Short stature in a mother and daughter with terminal deletion of Xp22.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schwinger, E.; Kirschstein, M.; Konermann, T.

    1996-05-03

    Short stature in females is often caused by homozygosity for the terminal portion of Xp due to monosomy X or a deletion. We report on a mother and daughter with short stature as sole phenotypic abnormality and deletion of bands Xp22.32-p22.33 demonstrated by classic and molecular cytogenetic analysis. In both individuals, the deleted X chromosome was late replicating. Molecular analysis suggested that the deletion is terminal and the breakpoint was localized between the STS and DXS7470 loci in Xp22.32. Chromosome analysis is often done on females with short stature to exclude Ullrich-Turner syndrome. Small deletions, terminal or interstitial, are easilymore » missed by conventional cytogenetic investigation; thus molecular analyses are useful to detect those cases. 8 refs., 3 figs.« less

  11. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    PubMed

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  12. Chromosomal DNA Deletions Explain Phenotypic Characteristics of Two Antigenic Variants, Phase II and RSA 514 (Crazy), of the Coxiella burnetii Nine Mile Strain†

    PubMed Central

    Hoover, T. A.; Culp, D. W.; Vodkin, M. H.; Williams, J. C.; Thompson, H. A.

    2002-01-01

    After repeated passages through embyronated eggs, the Nine Mile strain of Coxiella burnetii exhibits antigenic variation, a loss of virulence characteristics, and transition to a truncated lipopolysaccharide (LPS) structure. In two independently derived strains, Nine Mile phase II and RSA 514, these phenotypic changes were accompanied by a large chromosomal deletion (M. H. Vodkin and J. C. Williams, J. Gen. Microbiol. 132:2587-2594, 1986). In the work reported here, additional screening of a cosmid bank prepared from the wild-type strain was used to map the deletion termini of both mutant strains and to accumulate all the segments of DNA that comprise the two deletions. The corresponding DNAs were then sequenced and annotated. The Nine Mile phase II deletion was completely nested within the deletion of the RSA 514 strain. Basic alignment and homology studies indicated that a large group of LPS biosynthetic genes, arranged in an apparent O-antigen cluster, was deleted in both variants. Database homologies identified, in particular, mannose pathway genes and genes encoding sugar methylases and nucleotide sugar epimerase-dehydratase proteins. Candidate genes for addition of sugar units to the core oligosaccharide for synthesis of the rare sugar 6-deoxy-3-C-methylgulose (virenose) were identified in the deleted region. Repeats, redundancies, paralogous genes, and two regions with reduced G+C contents were found within the deletions. PMID:12438347

  13. A Functional Element Necessary for Fetal Hemoglobin Silencing

    PubMed Central

    Sankaran, Vijay G.; Xu, Jian; Byron, Rachel; Greisman, Harvey A.; Fisher, Chris; Weatherall, David J.; Sabath, Daniel E.; Groudine, Mark; Orkin, Stuart H.; Premawardhena, Anuja; Bender, M.A.

    2011-01-01

    BACKGROUND An improved understanding of the regulation of the fetal hemoglobin genes holds promise for the development of targeted therapeutic approaches for fetal hemoglobin induction in the β-hemoglobinopathies. Although recent studies have uncovered trans-acting factors necessary for this regulation, limited insight has been gained into the cis-regulatory elements involved. METHODS We identified three families with unusual patterns of hemoglobin expression, suggestive of deletions in the locus of the β-globin gene (β-globin locus). We performed array comparative genomic hybridization to map these deletions and confirmed breakpoints by means of polymerase-chain-reaction assays and DNA sequencing. We compared these deletions, along with previously mapped deletions, and studied the trans-acting factors binding to these sites in the β-globin locus by using chromatin immunoprecipitation. RESULTS We found a new (δβ)0-thalassemia deletion and a rare hereditary persistence of fetal hemoglobin deletion with identical downstream breakpoints. Comparison of the two deletions resulted in the identification of a small intergenic region required for γ-globin (fetal hemoglobin) gene silencing. We mapped a Kurdish β0-thalassemia deletion, which retains the required intergenic region, deletes other surrounding sequences, and maintains fetal hemoglobin silencing. By comparing these deletions and other previously mapped deletions, we elucidated a 3.5-kb intergenic region near the 5′ end of the δ-globin gene that is necessary for γ-globin silencing. We found that a critical fetal hemoglobin silencing factor, BCL11A, and its partners bind within this region in the chromatin of adult erythroid cells. CONCLUSIONS By studying three families with unusual deletions in the β-globin locus, we identified an intergenic region near the δ-globin gene that is necessary for fetal hemoglobin silencing. (Funded by the National Institutes of Health and others.) PMID:21879898

  14. Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.

    PubMed

    Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S

    2010-05-01

    Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.

  15. Frequency of heterozygous TET2 deletions in myeloproliferative neoplasms

    PubMed Central

    Tripodi, Joseph; Hoffman, Ronald; Najfeld, Vesna; Weinberg, Rona

    2010-01-01

    The Philadelphia chromosome (Ph)-negative myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a group of clonal hematopoietic stem cell disorders with overlapping clinical and cytogenetic features and a variable tendency to evolve into acute leukemia. These diseases not only share overlapping chromosomal abnormalities but also a number of acquired somatic mutations. Recently, mutations in a putative tumor suppressor gene, ten-eleven translocation 2 (TET2) on chromosome 4q24 have been identified in 12% of patients with MPN. Additionally 4q24 chromosomal rearrangements in MPN, including TET2 deletions, have also been observed using conventional cytogenetics. The goal of this study was to investigate the frequency of genomic TET2 rearrangements in MPN using fluorescence in situ hybridization as a more sensitive method for screening and identifying genomic deletions. Among 146 MPN patients, we identified two patients (1.4%) who showed a common 4q24 deletion, including TET2. Our observations also indicated that the frequency of TET2 deletion is increased in patients with an abnormal karyotype (5%). PMID:21188113

  16. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    PubMed

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  17. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  18. Novel Two-Step Hierarchical Screening of Mutant Pools Reveals Mutants under Selection in Chicks

    PubMed Central

    Yang, Hee-Jeong; Bogomolnaya, Lydia M.; Elfenbein, Johanna R.; Endicott-Yazdani, Tiana; Reynolds, M. Megan; Porwollik, Steffen; Cheng, Pui; Xia, Xiao-Qin

    2016-01-01

    Contaminated chicken/egg products are major sources of human salmonellosis, yet the strategies used by Salmonella to colonize chickens are poorly understood. We applied a novel two-step hierarchical procedure to identify new genes important for colonization and persistence of Salmonella enterica serotype Typhimurium in chickens. A library of 182 S. Typhimurium mutants each containing a targeted deletion of a group of contiguous genes (for a total of 2,069 genes deleted) was used to identify regions under selection at 1, 3, and 9 days postinfection in chicks. Mutants in 11 regions were under selection at all assayed times (colonization mutants), and mutants in 15 regions were under selection only at day 9 (persistence mutants). We assembled a pool of 92 mutants, each deleted for a single gene, representing nearly all genes in nine regions under selection. Twelve single gene deletion mutants were under selection in this assay, and we confirmed 6 of 9 of these candidate mutants via competitive infections and complementation analysis in chicks. STM0580, STM1295, STM1297, STM3612, STM3615, and STM3734 are needed for Salmonella to colonize and persist in chicks and were not previously associated with this ability. One of these key genes, STM1297 (selD), is required for anaerobic growth and supports the ability to utilize formate under these conditions, suggesting that metabolism of formate is important during infection. We report a hierarchical screening strategy to interrogate large portions of the genome during infection of animals using pools of mutants of low complexity. Using this strategy, we identified six genes not previously known to be needed during infection in chicks, and one of these (STM1297) suggests an important role for formate metabolism during infection. PMID:26857572

  19. An evolutionary analysis identifies a conserved pentapeptide stretch containing the two essential lysine residues for rice L-myo-inositol 1-phosphate synthase catalytic activity

    PubMed Central

    Basak, Papri; Maitra-Majee, Susmita; Das, Jayanta Kumar; Mukherjee, Abhishek; Ghosh Dastidar, Shubhra; Pal Choudhury, Pabitra

    2017-01-01

    A molecular evolutionary analysis of a well conserved protein helps to determine the essential amino acids in the core catalytic region. Based on the chemical properties of amino acid residues, phylogenetic analysis of a total of 172 homologous sequences of a highly conserved enzyme, L-myo-inositol 1-phosphate synthase or MIPS from evolutionarily diverse organisms was performed. This study revealed the presence of six phylogenetically conserved blocks, out of which four embrace the catalytic core of the functional protein. Further, specific amino acid modifications targeting the lysine residues, known to be important for MIPS catalysis, were performed at the catalytic site of a MIPS from monocotyledonous model plant, Oryza sativa (OsMIPS1). Following this study, OsMIPS mutants with deletion or replacement of lysine residues in the conserved blocks were made. Based on the enzyme kinetics performed on the deletion/replacement mutants, phylogenetic and structural comparison with the already established crystal structures from non-plant sources, an evolutionarily conserved peptide stretch was identified at the active pocket which contains the two most important lysine residues essential for catalytic activity. PMID:28950028

  20. Dosage analysis of cancer predisposition genes by multiplex ligation-dependent probe amplification

    PubMed Central

    Bunyan, D J; Eccles, D M; Sillibourne, J; Wilkins, E; Thomas, N Simon; Shea-Simonds, J; Duncan, P J; Curtis, C E; Robinson, D O; Harvey, J F; Cross, N C P

    2004-01-01

    Multiplex ligation-dependent probe amplification (MLPA) is a recently described method for detecting gross deletions or duplications of DNA sequences, aberrations which are commonly overlooked by standard diagnostic analysis. To determine the incidence of copy number variants in cancer predisposition genes from families in the Wessex region, we have analysed the hMLH1 and hMSH2 genes in patients with hereditary nonpolyposis colorectal cancer (HNPCC), BRCA1 and BRCA2 in families with hereditary breast/ovarian cancer (BRCA) and APC in patients with familial adenomatous polyposis coli (FAP). Hereditary nonpolyposis colorectal cancer (n=162) and FAP (n=74) probands were fully screened for small mutations, and cases for which no causative abnormality were found (HNPCC, n=122; FAP, n=24) were screened by MLPA. Complete or partial gene deletions were identified in seven cases for hMSH2 (5.7% of mutation-negative HNPCC; 4.3% of all HNPCC), no cases for hMLH1 and six cases for APC (25% of mutation negative FAP; 8% of all FAP). For BRCA1 and BRCA2, a partial mutation screen was performed and 136 mutation-negative cases were selected for MLPA. Five deletions and one duplication were found for BRCA1 (4.4% of mutation-negative BRCA cases) and one deletion for BRCA2 (0.7% of mutation-negative BRCA cases). Cost analysis indicates it is marginally more cost effective to perform MLPA prior to point mutation screening, but the main advantage gained by prescreening is a greatly reduced reporting time for the patients who are positive. These data demonstrate that dosage analysis is an essential component of genetic screening for cancer predisposition genes. PMID:15475941

  1. Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

    PubMed

    Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

    2015-01-20

    In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. A CRISPR Cas9-based gene drive platform for genetic interaction analysis in Candida albicans

    PubMed Central

    Shapiro, Rebecca S.; Chavez, Alejandro; Porter, Caroline B. M.; Hamblin, Meagan; Kaas, Christian S.; DiCarlo, James E.; Zeng, Guisheng; Xu, Xiaoli; Revtovich, Alexey V.; Kirienko, Natalia V.; Wang, Yue; Church, George M.; Collins, James J.

    2018-01-01

    Candida albicans is the leading cause of fungal infections; yet, complex genetic interaction analysis remains cumbersome in this diploid pathogen. Here, we developed a CRISPR-Cas9-based ‘gene drive array’ (GDA) platform to facilitate efficient genetic analysis in C. albicans. In our system, a modified DNA donor molecule acts as a selfish genetic element, replaces the targeted site, and propagates to replace additional wild-type loci. Using mating-competent C. albicans haploids, each carrying a different gene drive disabling a gene of interest, we are able to create diploid strains that are homozygous double-deletion mutants. We generate double-gene deletion libraries to demonstrate this technology, targeting antifungal efflux and biofilm adhesion factors. We screen these libraries to identify virulence regulators and determine how genetic networks shift under diverse conditions. This platform transforms our ability to perform genetic interaction analysis in C. albicans and is readily extended to other fungal pathogens. PMID:29062088

  3. 11q deletion in neuroblastoma: a review of biological and clinical implications.

    PubMed

    Mlakar, Vid; Jurkovic Mlakar, Simona; Lopez, Gonzalo; Maris, John M; Ansari, Marc; Gumy-Pause, Fabienne

    2017-06-29

    Deletion of the long arm of chromosome 11 (11q deletion) is one of the most frequent events that occur during the development of aggressive neuroblastoma. Clinically, 11q deletion is associated with higher disease stage and decreased survival probability. During the last 25 years, extensive efforts have been invested to identify the precise frequency of 11q aberrations in neuroblastoma, the recurrently involved genes, and to understand the molecular mechanisms of 11q deletion, but definitive answers are still unclear. In this review, it is our intent to compile and review the evidence acquired to date on 11q deletion in neuroblastoma.

  4. The TREAT-NMD DMD Global Database: Analysis of More than 7,000 Duchenne Muscular Dystrophy Mutations

    PubMed Central

    Bladen, Catherine L; Salgado, David; Monges, Soledad; Foncuberta, Maria E; Kekou, Kyriaki; Kosma, Konstantina; Dawkins, Hugh; Lamont, Leanne; Roy, Anna J; Chamova, Teodora; Guergueltcheva, Velina; Chan, Sophelia; Korngut, Lawrence; Campbell, Craig; Dai, Yi; Wang, Jen; Barišić, Nina; Brabec, Petr; Lahdetie, Jaana; Walter, Maggie C; Schreiber-Katz, Olivia; Karcagi, Veronika; Garami, Marta; Viswanathan, Venkatarman; Bayat, Farhad; Buccella, Filippo; Kimura, En; Koeks, Zaïda; van den Bergen, Janneke C; Rodrigues, Miriam; Roxburgh, Richard; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Zimowski, Janusz; Santos, Rosário; Neagu, Elena; Artemieva, Svetlana; Rasic, Vedrana Milic; Vojinovic, Dina; Posada, Manuel; Bloetzer, Clemens; Jeannet, Pierre-Yves; Joncourt, Franziska; Díaz-Manera, Jordi; Gallardo, Eduard; Karaduman, A Ayşe; Topaloğlu, Haluk; El Sherif, Rasha; Stringer, Angela; Shatillo, Andriy V; Martin, Ann S; Peay, Holly L; Bellgard, Matthew I; Kirschner, Jan; Flanigan, Kevin M; Straub, Volker; Bushby, Kate; Verschuuren, Jan; Aartsma-Rus, Annemieke; Béroud, Christophe; Lochmüller, Hanns

    2015-01-01

    Analyzing the type and frequency of patient-specific mutations that give rise to Duchenne muscular dystrophy (DMD) is an invaluable tool for diagnostics, basic scientific research, trial planning, and improved clinical care. Locus-specific databases allow for the collection, organization, storage, and analysis of genetic variants of disease. Here, we describe the development and analysis of the TREAT-NMD DMD Global database (http://umd.be/TREAT_DMD/). We analyzed genetic data for 7,149 DMD mutations held within the database. A total of 5,682 large mutations were observed (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions and 199 (14%) affected the splice sites. Point mutations totalled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations). PMID:25604253

  5. Distinctive genotypes in infants with T-cell acute lymphoblastic leukaemia.

    PubMed

    Mansur, Marcela B; van Delft, Frederik W; Colman, Susan M; Furness, Caroline L; Gibson, Jane; Emerenciano, Mariana; Kempski, Helena; Clappier, Emmanuelle; Cave, Hélène; Soulier, Jean; Pombo-de-Oliveira, Maria S; Greaves, Mel; Ford, Anthony M

    2015-11-01

    Infant T-cell acute lymphoblastic leukaemia (iT-ALL) is a very rare and poorly defined entity with a poor prognosis. We assembled a unique series of 13 infants with T-ALL, which allowed us to identify genotypic abnormalities and to investigate prenatal origins. Matched samples (diagnosis/remission) were analysed by single nucleotide polymorphism-array to identify genomic losses and gains. In three cases, we identified a recurrent somatic deletion on chromosome 3. These losses result in the complete deletion of MLF1 and have not previously been described in T-ALL. We observed two cases with an 11p13 deletion (LMO2-related), one of which also harboured a deletion of RB1. Another case presented a large 11q14·1-11q23·2 deletion that included ATM and only five patients (38%) showed deletions of CDKN2A/B. Four cases showed NOTCH1 mutations; in one case FBXW7 was the sole mutation and three cases showed alterations in PTEN. KMT2A rearrangements (KMT2A-r) were detected in three out of 13 cases. For three patients, mutations and copy number alterations (including deletion of PTEN) could be backtracked to birth using neonatal blood spot DNA, demonstrating an in utero origin. Overall, our data indicates that iT-ALL has a diverse but distinctive profile of genotypic abnormalities when compared to T-ALL in older children and adults. © 2015 The Authors. British Journal of Haematology published by John Wiley & Sons Ltd.

  6. A Comparison of Techniques for Handling and Assessing the Influence of Mobility on Student Achievement

    ERIC Educational Resources Information Center

    Smith, Lindsey J. Wolff; Beretvas, S. Natasha

    2017-01-01

    Conventional multilevel modeling works well with purely hierarchical data; however, pure hierarchies rarely exist in real datasets. Applied researchers employ ad hoc procedures to create purely hierarchical data. For example, applied educational researchers either delete mobile participants' data from the analysis or identify the student only with…

  7. Copy Number Variation in Patients with Disorders of Sex Development Due to 46,XY Gonadal Dysgenesis

    PubMed Central

    White, Stefan; Ohnesorg, Thomas; Notini, Amanda; Roeszler, Kelly; Hewitt, Jacqueline; Daggag, Hinda; Smith, Craig; Turbitt, Erin; Gustin, Sonja; van den Bergen, Jocelyn; Miles, Denise; Western, Patrick; Arboleda, Valerie; Schumacher, Valerie; Gordon, Lavinia; Bell, Katrina; Bengtsson, Henrik; Speed, Terry; Hutson, John; Warne, Garry; Harley, Vincent; Koopman, Peter; Vilain, Eric; Sinclair, Andrew

    2011-01-01

    Disorders of sex development (DSD), ranging in severity from mild genital abnormalities to complete sex reversal, represent a major concern for patients and their families. DSD are often due to disruption of the genetic programs that regulate gonad development. Although some genes have been identified in these developmental pathways, the causative mutations have not been identified in more than 50% 46,XY DSD cases. We used the Affymetrix Genome-Wide Human SNP Array 6.0 to analyse copy number variation in 23 individuals with unexplained 46,XY DSD due to gonadal dysgenesis (GD). Here we describe three discrete changes in copy number that are the likely cause of the GD. Firstly, we identified a large duplication on the X chromosome that included DAX1 (NR0B1). Secondly, we identified a rearrangement that appears to affect a novel gonad-specific regulatory region in a known testis gene, SOX9. Surprisingly this patient lacked any signs of campomelic dysplasia, suggesting that the deletion affected expression of SOX9 only in the gonad. Functional analysis of potential SRY binding sites within this deleted region identified five putative enhancers, suggesting that sequences additional to the known SRY-binding TES enhancer influence human testis-specific SOX9 expression. Thirdly, we identified a small deletion immediately downstream of GATA4, supporting a role for GATA4 in gonad development in humans. These CNV analyses give new insights into the pathways involved in human gonad development and dysfunction, and suggest that rearrangements of non-coding sequences disturbing gene regulation may account for significant proportion of DSD cases. PMID:21408189

  8. Germline mosaicism at the fragile X locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prior, T.W.; Papp, A.C.; Snyder, P.J.

    We have identified a fragile X syndrome pedigree where the disorder is associated with a molecular deletion. The deletion was present in the DNA of 2 sons but was absent in the mother`s somatic cell (lymphocyte) DNA. The results are consistent with the deletion arising as a postzygotic event in the mother, who therefore is germinally mosaic. This finding has important implications for counseling fragile X families with deletion mutations. 13 refs., 2 figs.

  9. Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion

    PubMed Central

    Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

    2017-01-01

    We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early. PMID:28720553

  10. Response to Growth Hormone Treatment in a Patient with Insulin-Like Growth Factor 1 Receptor Deletion.

    PubMed

    Mahmoud, Ranim; Naidu, Ajanta; Risheg, Hiba; Kimonis, Virginia

    2017-12-15

    We report a six-year-old boy who presented with short stature, microcephaly, dysmorphic features, and developmental delay and who was identified with a terminal deletion of 15q26.2q26.3 containing the insulin-like growth factor receptor (IGF1R) gene in addition to a terminal duplication of the 4q35.1q35.2 region. We compare our case with other reports of deletions and mutations affecting the IGF1R gene associated with pre-and postnatal growth restriction. We report the dramatic response to growth hormone therapy in this patient which highlights the importance of identifying patients with IGF1R deletion and treating them early.

  11. Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis

    PubMed Central

    D’Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; He, Hong; Li, Shibo; Hejtmancik, James F.; Sieving, Paul A.; Wang, Xinjing

    2013-01-01

    Purpose X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4–5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Methods Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Results Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5′ region of the RS1 gene (including the promoter) through intron 1 (c.(−35)-1723_c.51+2664del4472). The exon 4–5 deletion spans introns 3 to intron 5 (c.185–1020_c.522+1844del5764). Conclusions Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes. PMID:24227916

  12. Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.

    PubMed

    D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing

    2013-01-01

    X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.

  13. Identification of two 14q32 deletions involving DICER1 associated with the development of DICER1-related tumors.

    PubMed

    Herriges, John C; Brown, Sara; Longhurst, Maria; Ozmore, Jillian; Moeschler, John B; Janze, Aura; Meck, Jeanne; South, Sarah T; Andersen, Erica F

    2018-04-24

    DICER1 encodes an RNase III endonuclease protein that regulates the production of small non-coding RNAs. Germline mutations in DICER1 are associated with an autosomal dominant hereditary cancer predisposition syndrome that confers an increased risk for the development of several rare childhood and adult-onset tumors, the most frequent of which include pleuropulmonary blastoma, ovarian sex cord-stromal tumors, cystic nephroma, and thyroid gland neoplasia. The majority of reported germline DICER1 mutations are truncating sequence-level alterations, suggesting that a loss-of-function type mechanism drives tumor formation in DICER1 syndrome. However, reports of patients with germline DICER1 whole gene deletions are limited, and thus far, only two have reported an association with tumor development. Here we report the clinical findings of three patients from two unrelated families with 14q32 deletions that encompass the DICER1 locus. The deletion identified in Family I is 1.4 Mb and was initially identified in a 6-year-old male referred for developmental delay, hypotonia, macrocephaly, obesity, and behavioral problems. Subsequent testing revealed that this deletion was inherited from his mother, who had a clinical history that included bilateral multinodular goiter and papillary thyroid carcinoma. The second deletion is 5.0 Mb and was identified in a 15-year-old female who presented with autism, coarse facial features, Sertoli-Leydig cell tumor, and Wilms' tumor. These findings provide additional supportive evidence that germline deletion of DICER1 confers an increased risk for DICER1-related tumor development, and provide new insight into the clinical significance of deletions involving the 14q32 region. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  14. Proteomic analysis of protein phosphatase Z1 from Candida albicans

    PubMed Central

    Pfliegler, Walter P.; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a “novel type” fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for CaPpz1 in biofilm formation, was confirmed experimentally. Thus our unbiased proteomic approach lead to the discovery of a novel function for this phosphatase in C. albicans. PMID:28837603

  15. Comparative genomic analysis identified a mutation related to enhanced heterologous protein production in the filamentous fungus Aspergillus oryzae.

    PubMed

    Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko

    2016-11-01

    Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.

  16. Secretome analysis of Aspergillus fumigatus reveals Asp-hemolysin as a major secreted protein.

    PubMed

    Wartenberg, Dirk; Lapp, Katrin; Jacobsen, Ilse D; Dahse, Hans-Martin; Kniemeyer, Olaf; Heinekamp, Thorsten; Brakhage, Axel A

    2011-11-01

    Surface-associated and secreted proteins represent primarily exposed components of Aspergillus fumigatus during host infection. Several secreted proteins are known to be involved in defense mechanisms or immune evasion, thus, probably contributing to pathogenicity. Furthermore, several secreted antigens were identified as possible biomarkers for the verification of diseases caused by Aspergillus species. Nevertheless, there is only limited knowledge about the composition of the secretome and about molecular functions of particular proteins. To identify secreted proteins potentially essential for virulence, the core secretome of A. fumigatus grown in minimal medium was determined. Two-dimensional gel electrophoretic separation and subsequent MALDI-TOF-MS/MS analyses resulted in the identification of 64 different proteins. Additionally, secretome analyses of A. fumigatus utilizing elastin, collagen or keratin as main carbon and nitrogen source were performed. Thereby, the alkaline serine protease Alp1 was identified as the most abundant protein and hence presumably represents an important protease during host infection. Interestingly, the Asp-hemolysin (Asp-HS), which belongs to the protein family of aegerolysins and which was often suggested to be involved in fungal virulence, was present in the secretome under all growth conditions tested. In addition, a second, non-secreted protein with an aegerolysin domain annotated as Asp-hemolysin-like (HS-like) protein can be found to be encoded in the genome of A. fumigatus. Generation and analysis of Asp-HS and HS-like deletion strains revealed no differences in phenotype compared to the corresponding wild-type strain. Furthermore, hemolysis and cytotoxicity was not altered in both single-deletion and double-deletion mutants lacking both aegerolysin genes. All mutant strains showed no attenuation in virulence in a mouse infection model for invasive pulmonary aspergillosis. Overall, this study provides a comprehensive analysis of secreted proteins of A. fumigatus and a detailed characterization of hemolysin mutants. Copyright © 2011 Elsevier GmbH. All rights reserved.

  17. Multiplex screening for RB1 germline mutations in 106 patients with hereditary retinoblastoma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lohmann, D.R.; Brandt, B.; Passarge, E.

    1994-09-01

    The identification of germline mutations in the retinoblastoma susceptibility gene (RB1) is important for genetic counseling in hereditary retinoblastoma. Due to the complex genomic organization of this gene and the heterogeneity of mutations, efficient screening procedures are important for rapid mutation detection. We have developed methods based on simultaneous analysis of multiple regions of this gene in an ABI automated DNA fragment analyzer to examine 106 patients with hereditary retinoblastoma in which no alteration was identified by Southern blot hybridization. Primers for the amplification of all 27 exons of the RB1 gene as well as the promoter and poly(A) signalmore » sequences were labelled with distinct fluorescent dyes (FAM, HEX, TAMRA) to enable simultaneous electrophoretic analysis of PCR products with similar mobility. PCR fragments distinguishable by size or color were co-amplified by multiplex PCR and analyzed for length by GENESCAN analysis. Using this approach, small deletions ranging from 1 bp to 22 bp were identified in 24 patients (23%). Short sequence repeats or polypyrimidine runs were present in the vicinity of most of these deletions. In 4 patients (4%), insertions from 1 bp to 4 bp were found. The majority of length mutations resulted in a truncated gene product due to frameshift and premature termination. No mutation was identified in exons 25 to 27 possibly indicating that the encoded protein domains have minor functional importance. In order to screen for base substitutions that are not detectable by fragment length analysis, we adapted heteroduplex analysis for the use in the DNA fragment analyzer. During the optimization of this method we detected 10 single base substitutions most of which generated stop codons. Intriguingly, two identical missense mutations were identified in two unrelated families with a low-penetrance phenotype.« less

  18. Genome-wide copy number variation analysis identified deletions in SFMBT1 associated with fasting plasma glucose in a Han Chinese population.

    PubMed

    Chung, Ren-Hua; Chiu, Yen-Feng; Hung, Yi-Jen; Lee, Wen-Jane; Wu, Kwan-Dun; Chen, Hui-Ling; Lin, Ming-Wei; Chen, Yii-Der I; Quertermous, Thomas; Hsiung, Chao A

    2017-08-08

    Fasting glucose and fasting insulin are glycemic traits closely related to diabetes, and understanding the role of genetic factors in these traits can help reveal the etiology of type 2 diabetes. Although single nucleotide polymorphisms (SNPs) in several candidate genes have been found to be associated with fasting glucose and fasting insulin, copy number variations (CNVs), which have been reported to be associated with several complex traits, have not been reported for association with these two traits. We aimed to identify CNVs associated with fasting glucose and fasting insulin. We conducted a genome-wide CNV association analysis for fasting plasma glucose (FPG) and fasting plasma insulin (FPI) using a family-based genome-wide association study sample from a Han Chinese population in Taiwan. A family-based CNV association test was developed in this study to identify common CNVs (i.e., CNVs with frequencies ≥ 5%), and a generalized estimating equation approach was used to test the associations between the traits and counts of global rare CNVs (i.e., CNVs with frequencies <5%). We found a significant genome-wide association for common deletions with a frequency of 5.2% in the Scm-like with four mbt domains 1 (SFMBT1) gene with FPG (association p-value = 2×10 -4 and an adjusted p-value = 0.0478 for multiple testing). No significant association was observed between global rare CNVs and FPG or FPI. The deletions in 20 individuals with DNA samples available were successfully validated using PCR-based amplification. The association of the deletions in SFMBT1 with FPG was further evaluated using an independent population-based replication sample obtained from the Taiwan Biobank. An association p-value of 0.065, which was close to the significance level of 0.05, for FPG was obtained by testing 9 individuals with CNVs in the SFMBT1 gene region and 11,692 individuals with normal copies in the replication cohort. Previous studies have found that SNPs in SFMBT1 are associated with blood pressure and serum urate concentration, suggesting that SFMBT1 may have functional implications in some metabolic-related traits.

  19. Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

    PubMed Central

    Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

    2016-01-01

    Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

  20. The impact of trisomy 12, retinoblastoma gene and P53 in prognosis of B-cell chronic lymphocytic leukemia.

    PubMed

    AbdelSalam, M; El Sissy, A; Samra, M A; Ibrahim, S; El Markaby, D; Gadallah, F

    2008-06-01

    Routine cytogenetic analysis frequently fails to identify an abnormal clone in B-cell lymphocytic leukaemia (B-CLL) due to poor response to mitogen stimulation. Fluorescence in situ hybridization (FISH) suggest that chromosomal abnormalities occur more frequently, most commonly trisomy 12, retinoblastoma gene deletion (Rb1 gene) and P53 gene deletion. 30 patients with B-CLL were enrolled in the trial from two centers in Cairo, Egypt during the period May 2000 to January 2002. Karyotyping and FISH assessment for possible chromosomal abnormalities (trisomy 12, Rb1 gene and P53 gene) were done at initial diagnosis. Results of cytogenetic abnormalities were correlated with clinical picture and survival. The median age was 57.4 years (range 40-75). Karyotyping technique showed that no metaphase could be detected in 30%, metaphase with normal karyotyping was observed in 63% and cytogenetic abnormalities were detected in two cases (one trisomy 12 and one deletion in chromosome 13). FISH examination of interphase and metaphase nuclei revealed cytogenetic abnormalities in 15 cases (50%), trisomy 12 in 9 (30%), Rb1 gene deletion in 5 (17%) and P53 gene deletion in 3. At diagnosis, patients with trisomy 12 were significantly associated with advanced stage and absolute lymphocyte count of >or=30,000/mm(3). Univariate analysis showed that absolute lymphocyte count >or=30,000/mm(3) (p=0.004) and trisomy 12 (p=0.024) were associated with poor progression free survival. Interphase and metaphase FISH studies improve the cytogenetic diagnosis of chromosomal abnormalities in B-CLL. Lymphocytosis and trisomy 12 may be a good indicator of poor prognosis.

  1. A Complex 6p25 Rearrangement in a Child With Multiple Epiphyseal Dysplasia

    PubMed Central

    Bedoyan, Jirair K.; Lesperance, Marci M.; Ackley, Todd; Iyer, Ramaswamy K.; Innis, Jeffrey W.; Misra, Vinod K.

    2015-01-01

    Genomic rearrangements are increasingly recognized as important contributors to human disease. Here we report on an 11½-year-old child with myopia, Duane retraction syndrome, bilateral mixed hearing loss, skeletal anomalies including multiple epiphyseal dysplasia, and global developmental delay, and a complex 6p25 genomic rearrangement. We have employed oligonucleotide-based comparative genomic hybridization arrays (aCGH) of different resolutions (44 and 244K) as well as a 1 M single nucleotide polymorphism (SNP) array to analyze this complex rearrangement. Our analyses reveal a complex rearrangement involving a ~2.21 Mb interstitial deletion, a ~240 kb terminal deletion, and a 70–80 kb region in between these two deletions that shows maintenance of genomic copy number. The interstitial deletion contains eight known genes, including three Forkhead box containing (FOX) transcription factors (FOXQ1, FOXF2, and FOXC1). The region maintaining genomic copy number partly overlaps the dual specificity protein phosphatase 22 (DUSP22) gene. Array analyses suggest a homozygous loss of genomic material at the 5′ end of DUSP22, which was corroborated using TaqMan® copy number analysis. It is possible that this homozygous genomic loss may render both copies of DUSP22 or its products non-functional. Our analysis suggests a rearrangement mechanism distinct from a previously reported replication-based error-prone mechanism without template switching for a specific 6p25 rearrangement with a 1.22 Mb interstitial deletion. Our study demonstrates the utility and limitations of using oligonucleotide-based aCGH and SNP array technologies of increasing resolutions in order to identify complex DNA rearrangements and gene disruptions. PMID:21204225

  2. Clinicopathologic and molecular spectrum of RNASEH1-related mitochondrial disease

    PubMed Central

    Bugiardini, Enrico; Poole, Olivia V.; Manole, Andreea; Pittman, Alan M.; Horga, Alejandro; Hargreaves, Iain; Woodward, Cathy E.; Sweeney, Mary G.; Holton, Janice L.; Taanman, Jan-Willem; Plant, Gordon T.; Poulton, Joanna; Zeviani, Massimo; Ghezzi, Daniele; Taylor, John; Smith, Conrad; Fratter, Carl; Kanikannan, Meena A.; Paramasivam, Arumugam; Thangaraj, Kumarasamy; Spinazzola, Antonella; Holt, Ian J.; Houlden, Henry; Hanna, Michael G.

    2017-01-01

    Objective: Pathologic ribonuclease H1 (RNase H1) causes aberrant mitochondrial DNA (mtDNA) segregation and is associated with multiple mtDNA deletions. We aimed to determine the prevalence of RNase H1 gene (RNASEH1) mutations among patients with mitochondrial disease and establish clinically meaningful genotype-phenotype correlations. Methods: RNASEH1 was analyzed in patients with (1) multiple deletions/depletion of muscle mtDNA and (2) mendelian progressive external ophthalmoplegia (PEO) with neuropathologic evidence of mitochondrial dysfunction, but no detectable multiple deletions/depletion of muscle mtDNA. Clinicopathologic and molecular evaluation of the newly identified and previously reported patients harboring RNASEH1 mutations was subsequently undertaken. Results: Pathogenic c.424G>A p.Val142Ile RNASEH1 mutations were detected in 3 pedigrees among the 74 probands screened. Given that all 3 families had Indian ancestry, RNASEH1 genetic analysis was undertaken in 50 additional Indian probands with variable clinical presentations associated with multiple mtDNA deletions, but no further RNASEH1 mutations were confirmed. RNASEH1-related mitochondrial disease was characterized by PEO (100%), cerebellar ataxia (57%), and dysphagia (50%). The ataxia neuropathy spectrum phenotype was observed in 1 patient. Although the c.424G>A p.Val142Ile mutation underpins all reported RNASEH1-related mitochondrial disease, haplotype analysis suggested an independent origin, rather than a founder event, for the variant in our families. Conclusions: In our cohort, RNASEH1 mutations represent the fourth most common cause of adult mendelian PEO associated with multiple mtDNA deletions, following mutations in POLG, RRM2B, and TWNK. RNASEH1 genetic analysis should also be considered in all patients with POLG-negative ataxia neuropathy spectrum. The pathophysiologic mechanisms by which the c.424G>A p.Val142Ile mutation impairs human RNase H1 warrant further investigation. PMID:28508084

  3. Epidemiological investigation of the UGT2B17 polymorphism in doping control urine samples and its correlation to T/E ratios.

    PubMed

    Anielski, Patricia; Simmchen, Juliane; Wassill, Lars; Ganghofner, Dirk; Thieme, Detlef

    2011-10-01

    The deletion polymorphism of the enzyme UGT2B17 is known to correlate with the level of the testosterone to epitestosterone (T/E) ratio in urine specimen. Due to the importance of the T/E ratio to detect testosterone abuse in doping analysis, a PCR-ELISA system (Genotype® UGT test, AmplexDiagnostics) was established to identify the UGT2B17 phenotype in urine samples. Epidemiological investigations in a set of 674 routine doping controls (in- and out-of-competition) resulted in 22.8% homozygote gene-deleted and 74.5% UGT2B17-positive athletes. The validated test system has shown to be robust and sensitive: in only 18 cases (2.7%) isolation of cell material from urine failed. Following hydrolysis of glucuronidated conjugates, steroids were analyzed as bis-TMS derivatives by gas chromatography-mass spectrometry (GC-MS), for example, testosterone (T) and epitestosterone (E). Additionally, isotope ration mass spectrometry (IRMS) analysis and luteinizing hormone (LH) measurement were applied. Mean T/E ratios significantly correlated with the UGT2B17 phenotype (del: T/E 0.9; pos: 1.7), however the values did not differ as distinctive as reported in previous studies. Additionally, the T/E ratios in the gene-deleted group did not show a normal curve of distribution (median of T/E 0.5). Obviously, beside the UGT2B17 deletion further influences have to be taken into account, for example, polymorphisms or induction of other metabolizing enzymes. Our results indicate that the UGT2B17 polymorphism might be insufficient when utilized solely as a crucial parameter for individual interpretation of T/E in urine. Nevertheless, the detection of the UGT2B17-gene deletion in urine samples would provide additional information important for gathering evidence in analysis of steroids in doping control. Copyright © 2011 John Wiley & Sons, Ltd.

  4. Identification of a novel large deletion in a patient with severe factor V deficiency using an in-house F5 MLPA assay.

    PubMed

    Nuzzo, F; Paraboschi, E M; Straniero, L; Pavlova, A; Duga, S; Castoldi, E

    2015-01-01

    Factor V (FV) deficiency is a rare autosomal recessive bleeding disorder caused by mutations in the F5 gene. FV-deficient patients in whom no mutation or only one mutation is found may harbour large gene rearrangements, which are not detected by conventional mutation screening strategies. The aim of this study was to develop and validate a multiplex ligation-dependent probe amplification (MLPA) assay for the detection of large deletions and duplications in the F5 gene. Twenty-two MLPA probes targeting 19 of the 25 exons and the upstream and downstream regions of the F5 gene were designed and tested in 10 normal controls, a patient with a known heterozygous deletion of F5 exons 1-7 (positive control) and 14 genetically unexplained FV-deficient patients. MLPA results were confirmed by digital PCR on a QuantStudio(™) 3D Digital PCR System. The F5-specific probes yielded a reproducible peak profile in normal controls, correctly detected the known deletion in the positive control and suggested the presence of a novel deletion of exons 9-10 in a patient with undetectable FV levels and only one identified mutation. Follow-up by chip-based digital PCR, long-range PCR and direct sequencing confirmed that this patient carried a heterozygous F5 deletion of 1823 bp extending from intron 8 to intron 10. Bioinformatics sequence analysis pinpointed repetitive elements that might have originated the deletion. In conclusion, we have developed and validated an MLPA assay for the detection of gross F5 gene rearrangements. This assay may represent a valuable tool for the molecular diagnosis of FV deficiency. © 2014 John Wiley & Sons Ltd.

  5. TPH2 polymorphisms and expression in Prader-Willi syndrome subjects with differing genetic subtypes.

    PubMed

    Henkhaus, Rebecca S; Bittel, Douglas C; Butler, Merlin G

    2010-09-01

    Prader-Willi syndrome (PWS) is a genetic imprinting disease that causes developmental and behavioral disturbances resulting from loss of expression of genes from the paternal chromosome 15q11-q13 region. In about 70% of subjects, this portion of the paternal chromosome is deleted, while 25% have two copies of the maternal chromosome 15, or uniparental maternal disomy (UPD; the remaining subjects have imprinting center defects. There are several documented physical and behavioral differences between the two major PWS genetic subtypes (deletion and UPD) indicating the genetic subtype plays a role in clinical presentation. Serotonin is known to be disturbed in PWS and affects both eating behavior and compulsion, which are reported to be abnormal in PWS. We investigated the tryptophan hydroxylase gene (TPH2), the rate-limiting enzyme in the production of brain serotonin, by analyzing three different TPH2 gene polymorphisms, transcript expression, and correlation with PWS genetic subtype. DNA and RNA from lymphoblastoid cell lines derived from 12 PWS and 12 comparison subjects were used for the determination of genetic subtype, TPH2 polymorphisms and quantitative RT-PCR analysis. A similar frequency of TPH2 polymorphisms was seen in the PWS and comparison subjects with PWS deletion subjects showing increased expression with one or more TPH2 polymorphism. Both PWS deletion and PWS UPD subjects had significantly lower TPH2 expression than control subjects and PWS deletion subjects had significantly lower TPH2 expression compared with PWS UPD subjects. PWS subjects with 15q11-q13 deletions had lower TPH2 expression compared with PWS UPD or control subjects, requiring replication and further studies to identify the cause including identification of disturbed gene interactions resulting from the deletion process.

  6. Partial trisomy 2p and partial monosomy 2q arising from a paternal intrachromosomal 2q-into-2p between-arm insertion and paracentric inversion: molecular cytogenetic characterization of a four-break rearrangement.

    PubMed

    Manolakos, E; Vetro, A; Papadopoulou, E; Kefalas, K; Lagou, M; Thomaidis, L; Peitsidis, P; Sifakis, S; Divane, A; Ziegler, M; Liehr, T; Zuffardi, O; Papoulidis, I

    2013-01-01

    We report on a 26-month-old boy with an interstitial duplication of 2p22.3p22.2 and an interstitial deletion of 2q14.1q21.2. The abnormality was derived from his father having a balanced paracentric inversion and pericentric insertion. The deletion in the child was identified by cytogenetic analysis and characterized in more detail by molecular cytogenetics and array comparative genomic hybridization. The latter revealed a 20-Mb deletion in the long arm and a 5.6-Mb duplication in the short arm of chromosome 2. Fluorescence in situ hybridization in paternal chromosomes characterized an intrachromosomal insertion of 2q14.1q21.2 into 2p23; additionally a paracentric inversion of 2p13p23 was observed. The boy with the unbalanced karyotype suffered from severe psychomotor retardation, thrombophilia due to protein C deficiency, and hypertrophic cardiomyopathy and also had phenotypic abnormalities. Most of these features have previously been described in individuals with interstitial deletion of 2q14.1. Copyright © 2013 S. Karger AG, Basel.

  7. Effects of mora deletion, nonword repetition, rapid naming, and visual search performance on beginning reading in Japanese.

    PubMed

    Kobayashi, Maya Shiho; Haynes, Charles W; Macaruso, Paul; Hook, Pamela E; Kato, Junko

    2005-06-01

    This study examined the extent to which mora deletion (phonological analysis), nonword repetition (phonological memory), rapid automatized naming (RAN), and visual search abilities predict reading in Japanese kindergartners and first graders. Analogous abilities have been identified as important predictors of reading skills in alphabetic languages like English. In contrast to English, which is based on grapheme-phoneme relationships, the primary components of Japanese orthography are two syllabaries-hiragana and katakana (collectively termed "kana")-and a system of morphosyllabic symbols (kanji). Three RAN tasks (numbers, objects, syllabary symbols [hiragana]) were used with kindergartners, with an additional kanji RAN task included for first graders. Reading measures included accuracy and speed of passage reading for kindergartners and first graders, and reading comprehension for first graders. In kindergartners, hiragana RAN and number RAN were the only significant predictors of reading accuracy and speed. In first graders, kanji RAN and hiragana RAN predicted reading speed, whereas accuracy was predicted by mora deletion. Reading comprehension was predicted by kanji RAN, mora deletion, and nonword repetition. Although number RAN did not contribute unique variance to any reading measure, it correlated highly with kanji RAN. Implications of these findings for research and practice are discussed.

  8. Interstitial deletion of chromosome 1q [del(1)(q24q25.3)] identified by fluorescence in situ hybridization and gene dosage analysis of apolipoprotein A-II, coagulation factor V, and antithrombin III

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Takano, Takako; Yamanouchi, Yasuko; Mori, Yosuke

    We report on a 12-month-old Japanese boy with an interstitial deletion of the long-arm of chromosome 1 and meningomyelocele, hydrocephalus, anal atresia, atrial septal defect, left renal agenesis, bilateral cryptorchidism, talipes equinovarus, low birth weight, growth/developmental retardation, and many minor anomalies. By conventional GTG-banding, his karyotype was first interpreted as 46,XY,de1(1)(q23q24), but it was corrected as 46,XY.ish del(1)(q24q25.3) by fluorescence in situ hybridization using 11 known cosmid clones as probes. His serum levels of apolipoprotein A-II (gene symbol: APOA2, previously assigned to 1q21-q23) and coagulation factor V (F5, 1q21-q25) were normal, while serum concentration and activity of antithrombin III (AT3,more » 1q23-q25.1) was low. The results indicated that localization of APOA2 and F5 are proximal to the deleted region and AT3 is located within the deletion extent in the patient. 16 refs., 4 figs.« less

  9. Identification of the first intragenic deletion of the PITX2 gene causing an Axenfeld-Rieger Syndrome: case report

    PubMed Central

    de la Houssaye, Guillaume; Bieche, Ivan; Roche, Olivier; Vieira, Véronique; Laurendeau, Ingrid; Arbogast, Laurence; Zeghidi, Hatem; Rapp, Philippe; Halimi, Philippe; Vidaud, Michel; Dufier, Jean-Louis; Menasche, Maurice; Abitbol, Marc

    2006-01-01

    Background Axenfeld-Rieger syndrome (ARS) is characterized by bilateral congenital abnormalities of the anterior segment of the eye associated with abnormalities of the teeth, midface, and umbilicus. Most cases of ARS are caused by mutations in the genes encoding PITX2 or FOXC1. Here we describe a family affected by a severe form of ARS. Case presentation Two members of this family (father and daughter) presented with typical ARS and developed severe glaucoma. The ocular phenotype was much more severe in the daughter than in the father. Magnetic resonance imaging (MRI) detected an aggressive form of meningioma in the father. There was no mutation in the PITX2 gene, determined by exon screening. We identified an intragenic deletion by quantitative genomic PCR analysis and characterized this deletion in detail. Conclusion Our findings implicate the first intragenic deletion of the PITX2 gene in the pathogenesis of a severe form of ARS in an affected family. This study stresses the importance of a systematic search for intragenic deletions in families affected by ARS and in sporadic cases for which no mutations in the exons or introns of PITX2 have been found. The molecular genetics of some ARS pedigrees should be re-examined with enzymes that can amplify medium and large genomic fragments. PMID:17134502

  10. Giant Subependymoma Developed in a Patient with Aniridia: Analyses of PAX6 and Tumor-relevant Genes

    PubMed Central

    Maekawa, Motoko; Fujisawa, Hironori; Iwayama, Yoshimi; Tamase, Akira; Toyota, Tomoko; Osumi, Noriko; Yoshikawa, Takeo

    2010-01-01

    We observed an unusually large subependymoma in a female patient with congenital aniridia. To analyze the genetic mechanisms of tumorigenesis, we first examined the paired box 6 (PAX6) gene using both tumor tissue and peripheral lymphocytes. Tumor suppressor activity has been proposed for PAX6 in gliomas, in addition to its well-known role in the eye development. Using genomic quantitative PCR and loss of heterozygosity analysis, we identified hemizygous deletions in the 5′-region of PAX6. In lymphocytes, the deletion within PAX6 spanned from between exons 6 and 7 to the 5′-upstream region of the gene, but did not reach the upstream gene, RNC1, which is reported to be associated with tumors. The subependymoma had an additional de novo deletion spanning from the intron 4 to intron 6 of PAX6, although we could not completely determine whether these two deletions are on the same chromosome or not. We also examined other potentially relevant tumor suppressor genes: PTEN, TP53 and SOX2. However, we detected no exonic mutations or deletions in these genes. Collectively, we speculate that the defect in PAX6 may have contributed to the extremely large size of the subependymoma, due to a loss of tumor suppressor activity in glial cell lineage. PMID:20500513

  11. Deletion mutagenesis identifies a haploinsufficient role for gamma-zein in opaque-2 endosperm modification

    USDA-ARS?s Scientific Manuscript database

    Quality Protein Maize (QPM) is a hard kernel variant of the high-lysine mutant, opaque-2. Using gamma irradiation, we created opaque QPM variants to identify opaque-2 modifier genes and to investigate deletion mutagenesis combined with Illumina sequencing as a maize functional genomics tool. A K0326...

  12. Neurological presentation of three patients with 22q11 deletion (CATCH 22 syndrome).

    PubMed

    Roubertie, A; Semprino, M; Chaze, A M; Rivier, F; Humbertclaude, V; Cheminal, R; Lefort, G; Echenne, B

    2001-12-01

    Chromosome 22q11 deletion (CATCH 22 syndrome or velocardiofacial syndrome) is one of the most frequent chromosomal syndromes. Neurological features other than cognitive disorders are probably the least-described part of the expanding phenotype of the 22q11 deletion. We report the neurological features of three unrelated children with a de novo deletion: one patient with an autistic disorder, a second patient with hypocalcaemic neonatal seizures and unusual persistent epileptic focus at electroencephalographic follow-up, and a third patient with atypical absence epilepsy. These observations enlarge the clinical and neurological spectrum of the 22q11 deletion. Awareness of such cases is necessary, and a diagnosis of the 22q11 deletion should be suspected in children with common neurological features associated with severe or mild dysmorphism. Diagnosis of the 22q11 deletion should be confirmed by fluorescence in situ hybridization analysis associated with standard chromosomal analysis.

  13. First Report of a Single Exon Deletion in TCOF1 Causing Treacher Collins Syndrome

    PubMed Central

    Beygo, J.; Buiting, K.; Seland, S.; Lüdecke, H.-J.; Hehr, U.; Lich, C.; Prager, B.; Lohmann, D.R.; Wieczorek, D.

    2012-01-01

    Treacher Collins syndrome (TCS) is a rare craniofacial disorder characterized by facial anomalies and ear defects. TCS is caused by mutations in the TCOF1 gene and follows autosomal dominant inheritance. Recently, mutations in the POLR1D and POLR1C genes have also been identified to cause TCS. However, in a subset of patients no causative mutation could be found yet. Inter- and intrafamilial phenotypic variability is high as is the variety of mainly family-specific mutations identified throughout TCOF1. No obvious correlation between pheno- and genotype could be observed. The majority of described point mutations, small insertions and deletions comprising only a few nucleotides within TCOF1 lead to a premature termination codon. We investigated a cohort of 112 patients with a tentative clinical diagnosis of TCS by multiplex ligation-dependent probe amplification (MLPA) to search for larger deletions not detectable with other methods used. All patients were selected after negative screening for mutations in TCOF1, POLR1D and POLR1C. In 1 patient with an unequivocal clinical diagnosis of TCS, we identified a 3.367 kb deletion. This deletion abolishes exon 3 and is the first described single exon deletion within TCOF1. On RNA level we observed loss of this exon which supposedly leads to haploinsufficiency of TREACLE, the nucleolar phosphoprotein encoded by TCOF1. PMID:22712005

  14. First Report of a Single Exon Deletion in TCOF1 Causing Treacher Collins Syndrome.

    PubMed

    Beygo, J; Buiting, K; Seland, S; Lüdecke, H-J; Hehr, U; Lich, C; Prager, B; Lohmann, D R; Wieczorek, D

    2012-01-01

    Treacher Collins syndrome (TCS) is a rare craniofacial disorder characterized by facial anomalies and ear defects. TCS is caused by mutations in the TCOF1 gene and follows autosomal dominant inheritance. Recently, mutations in the POLR1D and POLR1C genes have also been identified to cause TCS. However, in a subset of patients no causative mutation could be found yet. Inter- and intrafamilial phenotypic variability is high as is the variety of mainly family-specific mutations identified throughout TCOF1. No obvious correlation between pheno- and genotype could be observed. The majority of described point mutations, small insertions and deletions comprising only a few nucleotides within TCOF1 lead to a premature termination codon. We investigated a cohort of 112 patients with a tentative clinical diagnosis of TCS by multiplex ligation-dependent probe amplification (MLPA) to search for larger deletions not detectable with other methods used. All patients were selected after negative screening for mutations in TCOF1, POLR1D and POLR1C. In 1 patient with an unequivocal clinical diagnosis of TCS, we identified a 3.367 kb deletion. This deletion abolishes exon 3 and is the first described single exon deletion within TCOF1. On RNA level we observed loss of this exon which supposedly leads to haploinsufficiency of TREACLE, the nucleolar phosphoprotein encoded by TCOF1.

  15. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    PubMed

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  16. DeF-GPU: Efficient and effective deletions finding in hepatitis B viral genomic DNA using a GPU architecture.

    PubMed

    Cheng, Chun-Pei; Lan, Kuo-Lun; Liu, Wen-Chun; Chang, Ting-Tsung; Tseng, Vincent S

    2016-12-01

    Hepatitis B viral (HBV) infection is strongly associated with an increased risk of liver diseases like cirrhosis or hepatocellular carcinoma (HCC). Many lines of evidence suggest that deletions occurring in HBV genomic DNA are highly associated with the activity of HBV via the interplay between aberrant viral proteins release and human immune system. Deletions finding on the HBV whole genome sequences is thus a very important issue though there exist underlying the challenges in mining such big and complex biological data. Although some next generation sequencing (NGS) tools are recently designed for identifying structural variations such as insertions or deletions, their validity is generally committed to human sequences study. This design may not be suitable for viruses due to different species. We propose a graphics processing unit (GPU)-based data mining method called DeF-GPU to efficiently and precisely identify HBV deletions from large NGS data, which generally contain millions of reads. To fit the single instruction multiple data instructions, sequencing reads are referred to as multiple data and the deletion finding procedure is referred to as a single instruction. We use Compute Unified Device Architecture (CUDA) to parallelize the procedures, and further validate DeF-GPU on 5 synthetic and 1 real datasets. Our results suggest that DeF-GPU outperforms the existing commonly-used method Pindel and is able to exactly identify the deletions of our ground truth in few seconds. The source code and other related materials are available at https://sourceforge.net/projects/defgpu/. Copyright © 2016 Elsevier Inc. All rights reserved.

  17. A novel growth hormone receptor gene deletion mutation in a patient with primary growth hormone insensitivity syndrome (Laron syndrome).

    PubMed

    Yamamoto, Hiroyasu; Kouhara, Haruhiko; Iida, Keiji; Chihara, Kazuo; Kasayama, Soji

    2008-04-01

    Growth hormone (GH) insensitivity syndrome (Laron syndrome) is known to be caused by genetic disorders of the GH-IGF-1 axis. Although many mutations in the GH receptor have been identified, there have been only a few reports of deletions of the GH receptor gene. A Japanese adult female patient with Laron syndrome was subjected to chromosome analysis with basic G-banding and also with a high accuracy technique. Each exon of the GH receptor gene was amplified by means of PCR. Since this patient was diagnosed with osteoporosis, the effects of alendronate on bone mineral density (BMD) were also examined. The chromosome analysis with the high accuracy technique demonstrated a large deletion of the short arm in one allele of chromosome 5 from p11 to p13.1 [46, XX, del (5) (p11-p13.1)]. PCR amplification of exons of the GH receptor gene showed that only exons 2 and 3 were amplified. Low-dose IGF-1 administration (30microg/kg body weight) failed to increase her BMD, whereas alendronate administration resulted in an increase associated with a decrease in urinary deoxypyridinoline (DPD) and serum osteocalcin concentrations. The GH receptor gene of the patient was shown to lack exons 4-10. To the best of our knowledge, this is the third case report of Laron syndrome with large GH receptor deletion. Alendronate was effective for the enhancement of BMD.

  18. Detection of BRCA1 gross rearrangements by droplet digital PCR.

    PubMed

    Preobrazhenskaya, Elena V; Bizin, Ilya V; Kuligina, Ekatherina Sh; Shleykina, Alla Yu; Suspitsin, Evgeny N; Zaytseva, Olga A; Anisimova, Elena I; Laptiev, Sergey A; Gorodnova, Tatiana V; Belyaev, Alexey M; Imyanitov, Evgeny N; Sokolenko, Anna P

    2017-10-01

    Large genomic rearrangements (LGRs) constitute a significant share of pathogenic BRCA1 mutations. Multiplex ligation-dependent probe amplification (MLPA) is a leading method for LGR detection; however, it is entirely based on the use of commercial kits, includes relatively time-consuming hybridization step, and is not convenient for large-scale screening of recurrent LGRs. We developed and validated the droplet digital PCR (ddPCR) assay, which covers the entire coding region of BRCA1 gene and is capable to precisely quantitate the copy number for each exon. 141 breast cancer (BC) patients, who demonstrated evident clinical features of hereditary BC but turned out to be negative for founder BRCA1/2 mutations, were subjected to the LGR analysis. Four patients with LGR were identified, with three cases of exon 8 deletion and one women carrying the deletion of exons 5-7. Excellent concordance with MLPA test was observed. Exon 8 copy number was tested in additional 720 BC and 184 ovarian cancer (OC) high-risk patients, and another four cases with the deletion were revealed; MLPA re-analysis demonstrated that exon 8 loss was a part of a larger genetic alteration in two cases, while the remaining two patients had isolated defect of exon 8. Long-range PCR and next generation sequencing of DNA samples carrying exon 8 deletion revealed two types of recurrent LGRs. Droplet digital PCR is a reliable tool for the detection of large genomic rearrangements.

  19. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia.

    PubMed

    Kamran, Shawana; Raca, Gordana; Nazir, Kamran

    2015-01-01

    The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL). The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9)(q23;q34). Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH) studies, and Chromosomal Microarray Analysis (CMA). The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9)(q24;q34) and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL.

  20. RCSD1-ABL1 Translocation Associated with IKZF1 Gene Deletion in B-Cell Acute Lymphoblastic Leukemia

    PubMed Central

    Kamran, Shawana; Nazir, Kamran

    2015-01-01

    The RCSD1 gene has recently been identified as a novel gene fusion partner of the ABL1 gene in cases of B-cell Acute Lymphoblastic Leukemia (B-ALL). The RCSD1 gene is located at 1q23 and ABL1 is located at 9q34, so that the RCSD1-ABL1 fusion typically arises through a rare reciprocal translocation t(1;9)(q23;q34). Only a small number of RCSD1-ABL1 positive cases of B-ALL have been described in the literature, and the full spectrum of clinical, morphological, immunophenotypic, and molecular features associated with this genetic abnormality has not been defined. We describe extensive genetic characterization of a case of B-ALL with RCSD1-ABL1 fusion, by using conventional cytogenetic analysis, Fluorescence In Situ Hybridization (FISH) studies, and Chromosomal Microarray Analysis (CMA). The use of CMA resulted in detection of an approximately 70 kb deletion at 7p12.2, which caused a disruption of the IKZF1 gene. Deletions and mutations of IKZF1 are recurring abnormalities in B-ALL and are associated with a poor prognosis. Our findings highlight the association of the deletion of IKZF1 gene with the t(1;9)(q24;q34) and illustrate the importance of comprehensive cytogenetic and molecular evaluation for accurate prediction of prognosis in patients with B-cell ALL. PMID:26600955

  1. State of the art and new developments in molecular diagnostics for hemoglobinopathies in multiethnic societies.

    PubMed

    Harteveld, C L

    2014-02-01

    For detecting carriers of thalassemia traits, the basic part of diagnostics consists of measurement of the hematological indices followed by mostly automatic separation and measurement of the Hb fractions, while direct Hb separation either on high pressure liquid chromatography or capillary electrophoresis is sufficient to putatively identify carriers of the common Hb variants like HbS, C, E, D, and O-Arab. A putative positive result is reported together with an advice for parents, partner, or family analysis. For couples, presumed at-risk confirmation at the DNA level is essential. In general, this part of diagnostics is done in specialized centers provided with sufficient experience and the technical tools needed to combine hematological and biochemical interpretation with identification of the mutations at the molecular level. State-of-the-art tools are usually available in centers that also provide prenatal diagnosis and should consist of gap-PCR for the common deletions, direct DNA sequencing for all kind of point-mutations and the capacity to uncover novel or rare mutations or disease mechanisms. New developments are MLPA for large and eventually unknown deletion defects and microarray technology for fine mapping and primer design for breakpoint analysis. Gap-PCR primers designed in the region flanking the deletion breakpoints can subsequently be used to facilitate carrier detection of uncommon deletions in family members or isolated populations in laboratories where no microarray technology or MLPA is available. © 2013 John Wiley & Sons Ltd.

  2. Identification of Genes Related to Fungicide Resistance in Fusarium fujikuroi

    PubMed Central

    Choi, Younghae; Jung, Boknam; Li, Taiying

    2017-01-01

    We identified two genes related to fungicide resistance in Fusarium fujikuroi through random mutagenesis. Targeted gene deletions showed that survival factor 1 deletion resulted in higher sensitivity to fungicides, while deletion of the gene encoding F-box/WD-repeat protein increased resistance, suggesting that the genes affect fungicide resistance in different ways. PMID:28781543

  3. Molecular and clinical characterization of a patient with a chromosome 4p deletion, Wolf-Hirschhorn syndrome, and congenital glaucoma.

    PubMed

    Finzi, S; Pinto, C F; Wiggs, J L

    2001-03-01

    Wolf-Hirschhorn syndrome is a developmental disorder associated with hemizygous deletion of the distal short arm of chromosome 4. We have identified a patient affected with Wolf-Hirschhorn syndrome and early onset glaucoma. Five other patients with Wolf-Hirschhorn syndrome and early onset glaucoma or ocular anomalies associated with early onset glaucoma have been previously described, suggesting that the association with Wolf-Hirschhorn syndrome is not coincidental. The infrequent association of early onset glaucoma suggests that the chromosomal region commonly deleted in Wolf-Hirschhorn patients does not contain genes responsible for early onset glaucoma. In this study, we performed a molecular characterization of the deleted chromosome 4 to determine the extent of the deletion in an attempt to begin to identify the chromosomal region responsible for the associated glaucoma. Using microsatellite repeat markers located on 4p, we determined that the deletion spanned a 60-cM region including the minimal Wolf-Hirschhorn region. The proximal breakpoint occurred between markers D4S3045 and D4S2974. These results support the hypothesis that patients with Wolf-Hirschhorn syndrome and early onset glaucoma may have large deletions of 4p that include a gene(s) that may be responsible for a dominant form of congenital glaucoma.

  4. A genome-wide resource of cell cycle and cell shape genes of fission yeast

    PubMed Central

    Hayles, Jacqueline; Wood, Valerie; Jeffery, Linda; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Salas-Pino, Silvia; Heichinger, Christian; Nurse, Paul

    2013-01-01

    To identify near complete sets of genes required for the cell cycle and cell shape, we have visually screened a genome-wide gene deletion library of 4843 fission yeast deletion mutants (95.7% of total protein encoding genes) for their effects on these processes. A total of 513 genes have been identified as being required for cell cycle progression, 276 of which have not been previously described as cell cycle genes. Deletions of a further 333 genes lead to specific alterations in cell shape and another 524 genes result in generally misshapen cells. Here, we provide the first eukaryotic resource of gene deletions, which describes a near genome-wide set of genes required for the cell cycle and cell shape. PMID:23697806

  5. Behavioral differences among subjects with Prader-Willi syndrome and type I or type II deletion and maternal disomy.

    PubMed

    Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Talebizadeh, Zohreh; Thompson, Travis

    2004-03-01

    To determine whether phenotypic differences exist among individuals with Prader-Willi syndrome with either type I or type II deletions of chromosome 15 or maternal disomy 15 leading to a better understanding of cause and pathophysiology of this classical genetic syndrome. We analyzed clinical, anthropometric, and behavioral data in 12 individuals (5 men, 7 women; mean age: 25.9 +/- 8.8 years) with PWS and a type I (TI) deletion, 14 individuals (6 men, 8 women; mean age: 19.6 +/- 6.5 years) with PWS and a type II (TII) deletion, and 21 individuals (10 men, 11 women; mean age: 23.6 +/- 9.2 years) with PWS and maternal disomy 15 (UPD). The deletion type was determined by genotyping of DNA markers between proximal chromosome 15 breakpoints BP1 and BP2. TI deletions are approximately 500 kb larger than TII deletions. Several validated psychological and behavioral tests were used to assess phenotypic characteristics of individuals with PWS representing the 3 genetic subtypes. Significant differences were found between the 2 deletion groups and those with UPD in multiple psychological and behavioral tests, but no differences were observed in other clinical or anthropometric data studied. Adaptive behavior scores were generally worse in individuals with PWS and the TI deletion, and specific obsessive-compulsive behaviors were more evident in the TI individuals compared with those with UPD. Individuals with PWS with TI deletions also had poorer reading and math skills as well as visual-motor integration. Our study indicates that individuals with TI deletion generally have more behavioral and psychological problems than individuals with the TII deletion or UPD. Four recently identified genes have been identified in the chromosome region between BP1 and BP2 with 1 of the genes (NIPA-1) expressed in mouse brain tissue but not thought to be imprinted. It may be important for brain development or function. These genes are deleted in individuals with TI deletion and are implicated in compulsive behavior and lower intellectual ability in individuals with TI versus TII.

  6. Novel mutations in the STK11 gene in Thai patients with Peutz-Jeghers syndrome

    PubMed Central

    Ausavarat, Surasawadee; Leoyklang, Petcharat; Vejchapipat, Paisarn; Chongsrisawat, Voranush; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

    2009-01-01

    Peutz-Jeghers syndrome (PJS), a rare autosomal dominant inherited disorder, is characterized by hamartomatous gastrointestinal polyps and mucocutaneous pigmentation. Patients with this syndrome have a predisposition to a variety of cancers in multiple organs. Mutations in the serine/threonine kinase 11 (STK11) gene have been identified as a major cause of PJS. Here we present the clinical and molecular findings of two unrelated Thai individuals with PJS. Mutation analysis by Polymerase Chain Reaction-sequencing of the entire coding region of STK11 revealed two potentially pathogenic mutations. One harbored a single nucleotide deletion (c.182delG) in exon 1 resulting in a frameshift leading to premature termination at codon 63 (p.Gly61AlafsX63). The other carried an in-frame 9-base-pair (bp) deletion in exon 7, c.907_915del9 (p.Ile303_Gln305del). Both deletions were de novo and have never been previously described. This study has expanded the genotypic spectrum of the STK11 gene. PMID:19908348

  7. 2q37 Deletion syndrome confirmed by high-resolution cytogenetic analysis

    PubMed Central

    Cho, Eun-Kyung; Kim, Jinsup; Yang, Aram; Jin, Dong-Kyu

    2017-01-01

    Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. PMID:28690993

  8. Loss of function mutations in RPL27 and RPS27 identified by whole-exome sequencing in Diamond-Blackfan anaemia.

    PubMed

    Wang, RuNan; Yoshida, Kenichi; Toki, Tsutomu; Sawada, Takafumi; Uechi, Tamayo; Okuno, Yusuke; Sato-Otsubo, Aiko; Kudo, Kazuko; Kamimaki, Isamu; Kanezaki, Rika; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Terui, Kiminori; Sato, Tomohiko; Iribe, Yuji; Ohga, Shouichi; Kuramitsu, Madoka; Hamaguchi, Isao; Ohara, Akira; Hara, Junichi; Goi, Kumiko; Matsubara, Kousaku; Koike, Kenichi; Ishiguro, Akira; Okamoto, Yasuhiro; Watanabe, Kenichiro; Kanno, Hitoshi; Kojima, Seiji; Miyano, Satoru; Kenmochi, Naoya; Ogawa, Seishi; Ito, Etsuro

    2015-03-01

    Diamond-Blackfan anaemia is a congenital bone marrow failure syndrome that is characterized by red blood cell aplasia. The disease has been associated with mutations or large deletions in 11 ribosomal protein genes including RPS7, RPS10, RPS17, RPS19, RPS24, RPS26, RPS29, RPL5, RPL11, RPL26 and RPL35A as well as GATA1 in more than 50% of patients. However, the molecular aetiology of many Diamond-Blackfan anaemia cases remains to be uncovered. To identify new mutations responsible for Diamond-Blackfan anaemia, we performed whole-exome sequencing analysis of 48 patients with no documented mutations/deletions involving known Diamond-Blackfan anaemia genes except for RPS7, RPL26, RPS29 and GATA1. Here, we identified a de novo splicing error mutation in RPL27 and frameshift deletion in RPS27 in sporadic patients with Diamond-Blackfan anaemia. In vitro knockdown of gene expression disturbed pre-ribosomal RNA processing. Zebrafish models of rpl27 and rps27 mutations showed impairments of erythrocyte production and tail and/or brain development. Additional novel mutations were found in eight patients, including RPL3L, RPL6, RPL7L1T, RPL8, RPL13, RPL14, RPL18A and RPL31. In conclusion, we identified novel germline mutations of two ribosomal protein genes responsible for Diamond-Blackfan anaemia, further confirming the concept that mutations in ribosomal protein genes lead to Diamond-Blackfan anaemia. © 2014 John Wiley & Sons Ltd.

  9. Whole-exome sequencing for mutation detection in pediatric disorders of insulin secretion: Maturity onset diabetes of the young and congenital hyperinsulinism.

    PubMed

    Johnson, S R; Leo, P J; McInerney-Leo, A M; Anderson, L K; Marshall, M; McGown, I; Newell, F; Brown, M A; Conwell, L S; Harris, M; Duncan, E L

    2018-06-01

    To assess the utility of whole-exome sequencing (WES) for mutation detection in maturity-onset diabetes of the young (MODY) and congenital hyperinsulinism (CHI). MODY and CHI are the two commonest monogenic disorders of glucose-regulated insulin secretion in childhood, with 13 causative genes known for MODY and 10 causative genes identified for CHI. The large number of potential genes makes comprehensive screening using traditional methods expensive and time-consuming. Ten subjects with MODY and five with CHI with known mutations underwent WES using two different exome capture kits (Nimblegen SeqCap EZ Human v3.0 Exome Enrichment Kit, Nextera Rapid Capture Exome Kit). Analysis was blinded to previously identified mutations, and included assessment for large deletions. The target capture of five exome capture technologies was also analyzed using sequencing data from >2800 unrelated samples. Four of five MODY mutations were identified using Nimblegen (including a large deletion in HNF1B). Although targeted, one mutation (in INS) had insufficient coverage for detection. Eleven of eleven mutations (six MODY, five CHI) were identified using Nextera Rapid (including the previously missed mutation). On reconciliation, all mutations concorded with previous data and no additional variants in MODY genes were detected. There were marked differences in the performance of the capture technologies. WES can be useful for screening for MODY/CHI mutations, detecting both point mutations and large deletions. However, capture technologies require careful selection. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Molecular markers and Schistosoma-associated bladder carcinoma: A systematic review and meta-analysis.

    PubMed

    Koonrungsesomboon, Nut; Wadagni, Anita Carolle; Mbanefo, Evaristus Chibunna

    2015-08-01

    Molecular mechanisms and pathogenesis of schistosomal-associated bladder cancer (SABC), one of the most common malignancies in Africa and parts of the Middle East, is still unclear. Identification of host molecular markers involved in schistosomal related bladder carcinogenesis is of value in prediction of high-risk group, early detection and timely intervention. PubMed, Scopus, Google Scholar, Cochrane Library and African Journals Online databases were systematically searched and reviewed. A total of 63 articles reporting 41 host molecular factors were included in the meta-analysis. Pooled odds ratio demonstrated associations of p53 expression, telomerase activity and sFas with SABC as compared to other schistosomal patients (p53 expression: OR=9.46, 95%CI=1.14-78.55, p=0.04; telomerase by TERT: OR=37.38, 95%CI=4.17-334.85, p=0.001; telomerase by TRAP: OR=10.36, 95%CI=6.08-17.64, p<0.00001; sFas: OR=34.37, 95%CI=3.32-355.51, p=0.003). In comparison to bladder cancers of other etiology, positive associations were found between SABC and p15 deletion, p16 deletion, telomerase activity and sFas (p15 deletion: OR=4.20, 95%CI=2.58-6.82, p<0.00001; p16 deletion: OR=4.93, 95%CI=2.52-9.65, p<0.00001; telomerase by TERT: OR=3.01, 95%CI=1.51-5.97, p=0.002; telomerase by TRAP: OR=2.66, 95%CI=1.18-6.01, p=0.02; sFas: OR=4.50, 95%CI=1.78-11.40, p=0.001). Other identified associations were reported by few numbers of studies to enable reliable interpretation. Variations in gene expression or genomic alterations of some molecular markers in SABC as compared to non-SABC or other schistosomal patients were identified. These suggest minute differences in the pathogenesis and physiological profile of SABC, in relation to non-SABC. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Large Deletions at the SHOX Locus in the Pseudoautosomal Region Are Associated with Skeletal Atavism in Shetland Ponies

    PubMed Central

    Rafati, Nima; Andersson, Lisa S.; Mikko, Sofia; Feng, Chungang; Raudsepp, Terje; Pettersson, Jessica; Janecka, Jan; Wattle, Ove; Ameur, Adam; Thyreen, Gunilla; Eberth, John; Huddleston, John; Malig, Maika; Bailey, Ernest; Eichler, Evan E.; Dalin, Göran; Chowdary, Bhanu; Andersson, Leif; Lindgren, Gabriella; Rubin, Carl-Johan

    2016-01-01

    Skeletal atavism in Shetland ponies is a heritable disorder characterized by abnormal growth of the ulna and fibula that extend the carpal and tarsal joints, respectively. This causes abnormal skeletal structure and impaired movements, and affected foals are usually killed. In order to identify the causal mutation we subjected six confirmed Swedish cases and a DNA pool consisting of 21 control individuals to whole genome resequencing. We screened for polymorphisms where the cases and the control pool were fixed for opposite alleles and observed this signature for only 25 SNPs, most of which were scattered on genome assembly unassigned scaffolds. Read depth analysis at these loci revealed homozygosity or compound heterozygosity for two partially overlapping large deletions in the pseudoautosomal region (PAR) of chromosome X/Y in cases but not in the control pool. One of these deletions removes the entire coding region of the SHOX gene and both deletions remove parts of the CRLF2 gene located downstream of SHOX. The horse reference assembly of the PAR is highly fragmented, and in order to characterize this region we sequenced bacterial artificial chromosome (BAC) clones by single-molecule real-time (SMRT) sequencing technology. This considerably improved the assembly and enabled size estimations of the two deletions to 160−180 kb and 60−80 kb, respectively. Complete association between the presence of these deletions and disease status was verified in eight other affected horses. The result of the present study is consistent with previous studies in humans showing crucial importance of SHOX for normal skeletal development. PMID:27207956

  12. Glutathione S-transferase M1 and glutathione S-transferase T1 genotype in chronic pancreatitis: a meta-analysis.

    PubMed

    Zhong, Yanjun; Zou, Runmei; Cao, Jie; Peng, Mou

    2015-02-01

    A meta-analysis to determine the association between chronic pancreatitis and glutathione-S transferase (GST) mu 1 (GSTM1) and theta 1 (GSTT1) deletions. Case-control studies concerning the relationship between chronic pancreatitis and GSTM1 or GSTT1 deletions were identified (up to October 2013). Meta-analyses of the association between GSTM1 and GSTT1 genotype and chronic pancreatitis or alcoholic chronic pancreatitis (ACP) were performed. Seven studies were included in the meta-analysis (650 patients/1382 controls for GSTM1 and 536 patients/1304 controls for GSTT1). There were no significant relationships between GSTM1/GSTT1 and chronic pancreatitis or GSTT1 and ACP. There was a significant association between GSTM1 null genotype and ACP (odds ratio 1.16, 95% confidence intervals 1.03, 1.30). The GSTM1 null genotype was significantly associated with ACP risk. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  13. A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat

    PubMed Central

    2010-01-01

    Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819

  14. De novo 14q24.2q24.3 microdeletion including IFT43 is associated with intellectual disability, skeletal anomalies, cardiac anomalies, and myopia.

    PubMed

    Stokman, Marijn F; Oud, Machteld M; van Binsbergen, Ellen; Slaats, Gisela G; Nicolaou, Nayia; Renkema, Kirsten Y; Nijman, Isaac J; Roepman, Ronald; Giles, Rachel H; Arts, Heleen H; Knoers, Nine V A M; van Haelst, Mieke M

    2016-06-01

    We report an 11-year-old girl with mild intellectual disability, skeletal anomalies, congenital heart defect, myopia, and facial dysmorphisms including an extra incisor, cup-shaped ears, and a preauricular skin tag. Array comparative genomic hybridization analysis identified a de novo 4.5-Mb microdeletion on chromosome 14q24.2q24.3. The deleted region and phenotype partially overlap with previously reported patients. Here, we provide an overview of the literature on 14q24 microdeletions and further delineate the associated phenotype. We performed exome sequencing to examine other causes for the phenotype and queried genes present in the 14q24.2q24.3 microdeletion that are associated with recessive disease for variants in the non-deleted allele. The deleted region contains 65 protein-coding genes, including the ciliary gene IFT43. Although Sanger and exome sequencing did not identify variants in the second IFT43 allele or in other IFT complex A-protein-encoding genes, immunocytochemistry showed increased accumulation of IFT-B proteins at the ciliary tip in patient-derived fibroblasts compared to control cells, demonstrating defective retrograde ciliary transport. This could suggest a ciliary defect in the pathogenesis of this disorder. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  15. Characterization of a Spontaneous Nonmagnetic Mutant of Magnetospirillum gryphiswaldense Reveals a Large Deletion Comprising a Putative Magnetosome Island

    PubMed Central

    Schübbe, Sabrina; Kube, Michael; Scheffel, André; Wawer, Cathrin; Heyen, Udo; Meyerdierks, Anke; Madkour, Mohamed H.; Mayer, Frank; Reinhardt, Richard; Schüler, Dirk

    2003-01-01

    Frequent spontaneous loss of the magnetic phenotype was observed in stationary-phase cultures of the magnetotactic bacterium Magnetospirillum gryphiswaldense MSR-1. A nonmagnetic mutant, designated strain MSR-1B, was isolated and characterized. The mutant lacked any structures resembling magnetosome crystals as well as internal membrane vesicles. The growth of strain MSR-1B was impaired under all growth conditions tested, and the uptake and accumulation of iron were drastically reduced under iron-replete conditions. A large chromosomal deletion of approximately 80 kb was identified in strain MSR-1B, which comprised both the entire mamAB and mamDC clusters as well as further putative operons encoding a number of magnetosome-associated proteins. A bacterial artificial chromosome clone partially covering the deleted region was isolated from the genomic library of wild-type M. gryphiswaldense. Sequence analysis of this fragment revealed that all previously identified mam genes were closely linked with genes encoding other magnetosome-associated proteins within less than 35 kb. In addition, this region was remarkably rich in insertion elements and harbored a considerable number of unknown gene families which appeared to be specific for magnetotactic bacteria. Overall, these findings suggest the existence of a putative large magnetosome island in M. gryphiswaldense and other magnetotactic bacteria. PMID:13129949

  16. Large FVIII gene deletion confers very high risk of inhibitor development in three related severe haemophiliacs.

    PubMed

    Salviato, R; Belvini, D; Are, A; Radossi, P; Tagariello, G

    2002-01-01

    Haemophilia A displays a broad heterogeneity of genetic defects and of clinical severity. Inhibitor development is the main complication of replacement therapy in severe cases and most patients with inhibitors have gross gene rearrangement or point mutations, which hamper the production of normal circulating factor VIII (FVIII). We have investigated three related severe haemophilia A patients, all of whom have high titre inhibitors. By using long-range polymerase chain reaction (PCR) for FVIII gene inversion, we observed an unusual pattern in these patients. We therefore decided to screen the whole FVIII gene by conformation-sensitive gel electrophoresis. A large FVIII gene deletion spanning exon 2 to exon 25 was identified and we were able to obtain a 18.5 kb PCR product, which is specific for this mutation and useful for determining the carrier state in this family. All three haemophiliacs carrying this very large gene deletion show similar clinical history and very high-titre inhibitors, supporting the observation that inhibitor development seems to be an inherited characteristic. On the basis of our observations we think that this subgroup of patients at very high risk of inhibitor development should be identified by mutation analysis whenever possible, before the beginning of replacement therapy.

  17. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

    PubMed Central

    Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

    2017-01-01

    Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

  18. Evaluation of copy-number variants as modifiers of breast and ovarian cancer risk for BRCA1 pathogenic variant carriers

    PubMed Central

    Walker, Logan C; Marquart, Louise; Pearson, John F; Wiggins, George A R; O'Mara, Tracy A; Parsons, Michael T; Barrowdale, Daniel; McGuffog, Lesley; Dennis, Joe; Benitez, Javier; Slavin, Thomas P; Radice, Paolo; Frost, Debra; Godwin, Andrew K; Meindl, Alfons; Schmutzler, Rita Katharina; Isaacs, Claudine; Peshkin, Beth N; Caldes, Trinidad; Hogervorst, Frans BL; Lazaro, Conxi; Jakubowska, Anna; Montagna, Marco; Chen, Xiaoqing; Offit, Kenneth; Hulick, Peter J; Andrulis, Irene L; Lindblom, Annika; Nussbaum, Robert L; Nathanson, Katherine L; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J; Spurdle, Amanda B

    2017-01-01

    Genome-wide studies of patients carrying pathogenic variants (mutations) in BRCA1 or BRCA2 have reported strong associations between single-nucleotide polymorphisms (SNPs) and cancer risk. To conduct the first genome-wide association analysis of copy-number variants (CNVs) with breast or ovarian cancer risk in a cohort of 2500 BRCA1 pathogenic variant carriers, CNV discovery was performed using multiple calling algorithms and Illumina 610k SNP array data from a previously published genome-wide association study. Our analysis, which focused on functionally disruptive genomic deletions overlapping gene regions, identified a number of loci associated with risk of breast or ovarian cancer for BRCA1 pathogenic variant carriers. Despite only including putative deletions called by at least two or more algorithms, detection of selected CNVs by ancillary molecular technologies only confirmed 40% of predicted common (>1% allele frequency) variants. These include four loci that were associated (unadjusted P<0.05) with breast cancer (GTF2H2, ZNF385B, NAALADL2 and PSG5), and two loci associated with ovarian cancer (CYP2A7 and OR2A1). An interesting finding from this study was an association of a validated CNV deletion at the CYP2A7 locus (19q13.2) with decreased ovarian cancer risk (relative risk=0.50, P=0.007). Genomic analysis found this deletion coincides with a region displaying strong regulatory potential in ovarian tissue, but not in breast epithelial cells. This study highlighted the need to verify CNVs in vitro, but also provides evidence that experimentally validated CNVs (with plausible biological consequences) can modify risk of breast or ovarian cancer in BRCA1 pathogenic variant carriers. PMID:28145423

  19. Contribution of BRCA1 large genomic rearrangements to early-onset and familial breast/ovarian cancer in Pakistan.

    PubMed

    Rashid, Muhammad U; Muhammad, Noor; Amin, Asim; Loya, Asif; Hamann, Ute

    2017-01-01

    Germline mutations in BRCA1 and BRCA2 (BRCA1/2) account for the majority of hereditary breast and/or ovarian cancers. Pakistan has one of the highest rates of breast cancer incidence in Asia, where BRCA1/2 small-range mutations account for 17% of early-onset and familial breast/ovarian cancer patients. We report the first study from Pakistan evaluating the prevalence of BRCA1/2 large genomic rearrangements (LGRs) in breast and/or ovarian cancer patients who do not harbor small-range BRCA1/2 mutations. Both BRCA1/2 genes were comprehensively screened for LGRs using multiplex ligation-dependent probe amplification in 120 BRCA1/2 small-range mutations negative early-onset or familial breast/ovarian cancer patients from Pakistan (Group 1). The breakpoints were characterized by long-range PCR- and DNA-sequencing analyses. An additional cohort of 445 BRCA1/2 negative high-risk patients (Group 2) was analyzed for the presence of LGRs identified in Group 1. Three different BRCA1 LGRs were identified in Group 1 (4/120; 3.3%), two of these were novel. Exon 1-2 deletion was observed in two unrelated patients: an early-onset breast cancer patient and another bilateral breast cancer patient from a hereditary breast cancer (HBC) family. Novel exon 20-21 deletion was detected in a 29-year-old breast cancer patient from a HBC family. Another novel exon 21-24 deletion was identified in a breast-ovarian cancer patient from a hereditary breast and ovarian cancer family. The breakpoints of all deletions were characterized. Screening of the 445 patients in Group 2 for the three LGRs revealed ten additional patients harboring exon 1-2 deletion or exon 21-24 deletion (10/445; 2.2%). No BRCA2 LGRs were identified. LGRs in BRCA1 are found with a considerable frequency in Pakistani breast/ovarian cancer cases. Our findings suggest that BRCA1 exons 1-2 deletion and exons 21-24 deletion should be included in the recurrent BRCA1/2 mutations panel for genetic testing of high-risk Pakistani breast/ovarian cancer patients.

  20. Prenatal Diagnosis and Molecular Analysis of a Large Novel Deletion (- -JS) Causing α0-Thalassemia.

    PubMed

    Cao, Jinru; He, Shuzhen; Pu, Yudong; Liu, Jingjing; Liu, Fuping; Feng, Jun

    α-Thalassemia (α-thal) is a very common single gene hereditary disease caused by large deletions or point mutations of the α-globin gene cluster in tropical and subtropical regions of the world. Here, we report for the first time, a novel large α-thal deletion in a Chinese family from Jiangsu Province, People's Republic of China (PRC), which removes almost the entire α2 and α1 genes from the α-globin gene cluster. Thus, it was named the Jiangsu deletion (- - JS ) on the α-globin gene cluster causing α 0 -thal. Heterozygotes for this deletion showed an α-thal trait phenotype with reduced mean corpuscular volume (MCV) and mean corpuscular hemoglobin (Hb) (MCH) levels. The sequencing results showed that a 2538 bp deletion (NG_000006.1: g.35801_38338) existed in this novel genotype on the basis of -α 4.2 (leftward), indicating a deletion of about 6.8 kb from the α-globin cluster. In addition, a 29 bp sequence was inserted into the deletion during the recombination events that led to this deletion. Through pedigree analysis, we knew that the proband inherited the novel allele from his mother.

  1. Genetic alteration profiling of patients with resected squamous cell lung carcinomas

    PubMed Central

    Zhang, Ningning; Lin, Dongmei; Wu, Di; Zhu, Xinxin; Song, Wenya; Shi, Yuankai

    2016-01-01

    In this study, we analyzed the genetic profiles of squamous cell lung carcinoma (SqCLC) to identify potential therapeutic targets. Approximately 2,800 COSMIC mutations from 50 genes were determined by next-generation sequencing. Amplification/deletion of SOX2, CDKN2A, PTEN, FGFR1, EGFR, CCND1, HER2 and PDGFRA were detected by FISH and expression of VEGFR2, PD-L1 and PTEN were examined by IHC. One hundred and fifty-seven samples of SqCLC were collected. Somatic mutations was identified in 73.9% of cases, with TP53 (56.1%), CDKN2A (8.9%), PIK3CA (8.9%), KRAS (4.5%) and EGFR (3.2%). Gene copy number alterations were identified in 75.8% of cases, including SOX2 amplification (31.2%), CDKN2A deletion (21.7%), PTEN deletion (16.6%), FGFR1 amplification (15.9%), EGFR amplification (14.0%), CCND1 amplification (14.0%), HER2 amplification (9.6%) and PDGFRA amplification (7.6%). Positive expression of VEGFR2 and PD-L1 and loss of PTEN expression were observed in 80.5%, 47.2%, and 42.7% of cases, respectively. Multivariate analysis showed that positive expression of PD-L1 was an independent favorable prognostic factor for DFS (HR = 0.610; P = 0.044). In conclusion, nearly all (93.6%) SqCLC cases harbored at least one potential druggable target. The findings of this study could facilitate the identification of therapeutic target candidates for precision medicine of SqCLC. PMID:27145277

  2. Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

    PubMed

    Todd, Antonette R; Donofrio, Nicole; Sripathi, Venkateswara R; McClean, Phillip E; Lee, Rian K; Pastor-Corrales, Marcial; Kalavacharla, Venu Kal

    2017-05-23

    Common bean ( Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg , (Complements resistance gene), which is required for Ur-3 -mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant "Sierra" and susceptible crg) with rust race 53 of U. appendiculatus , isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of "Sierra" leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations.

  3. [Molecular genetic analysis for a pedigree with severe hereditary coagulation factor VII deficiency].

    PubMed

    Ding, Qiu-lan; Wang, Hong-li; Wang, Xue-feng; Wang, Ming-shan; Fu, Qi-hua; Wu, Wen-man; Hu, Yi-qun; Wang, Zhen-yi

    2003-10-01

    To identify the genetic mutations of a severe inherited coagulation factor VII (FVII) deficiency pedigree. The diagnosis was validated by coagulant and haemostatic parameters. FVII gene mutations were screened in the propositus and his family members by DNA direct sequencing and confirmed by digestions of the restriction enzymes of the PCR production. Two heterozygous missense mutations were found in the propositus of the pedigree: a G to T transversion at position 9482 in exon 6 and a C to T mutation at position 11348 in exon 8 resulting in the amino acid substitution of Arg152 with Leu and Arg304 with Trp, respectively. A heterozygous single nucleotide deletion (C) at position 11487-11489(CCC) within exon 8 was identified, which predicted the frameshift mutation at position His351 followed by the changes of six corresponding amino acids and appearance of a premature protein caused by stop codon. The heterozygous mutations identified in the proband were derived from his father (Arg152 to Leu) and his mother (Arg304 to Trp mutation) and a heterozygous deletion (C) at position 11487-9(CCC). By tracing the other pedigree members, it was found that his grandmother had a heterozygous mutation of Arg304Trp and a heterozygous polymorphism of Arg353Gln and his grandfather had a heterozygous Arg152Leu mutation. Three heterozygous mutations were found in a pedigree with hereditary coagulation factor VII deficiency. Arg152Leu and deletion C at position 11487-9(CCC) were novel mutations.

  4. Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

    PubMed Central

    Todd, Antonette R.; Donofrio, Nicole; Sripathi, Venkateswara R.; McClean, Phillip E.; Lee, Rian K.; Pastor-Corrales, Marcial; Kalavacharla, Venu (Kal)

    2017-01-01

    Common bean (Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg, (Complements resistance gene), which is required for Ur-3-mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant “Sierra” and susceptible crg) with rust race 53 of U. appendiculatus, isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of “Sierra” leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations. PMID:28545258

  5. Improved multiplex ligation-dependent probe amplification analysis identifies a deleterious PMS2 allele generated by recombination with crossover between PMS2 and PMS2CL.

    PubMed

    Wernstedt, Annekatrin; Valtorta, Emanuele; Armelao, Franco; Togni, Roberto; Girlando, Salvatore; Baudis, Michael; Heinimann, Karl; Messiaen, Ludwine; Staehli, Noemie; Zschocke, Johannes; Marra, Giancarlo; Wimmer, Katharina

    2012-09-01

    Heterozygous PMS2 germline mutations are associated with Lynch syndrome. Up to one third of these mutations are genomic deletions. Their detection is complicated by a pseudogene (PMS2CL), which--owing to extensive interparalog sequence exchange--closely resembles PMS2 downstream of exon 12. A recently redesigned multiplex ligation-dependent probe amplification (MLPA) assay identifies PMS2 copy number alterations with improved reliability when used with reference DNAs containing equal numbers of PMS2- and PMS2CL-specific sequences. We selected eight such reference samples--all publicly available--and used them with this assay to study 13 patients with PMS2-defective colorectal tumors. Three presented deleterious alterations: an Alu-mediated exon deletion; a 125-kb deletion encompassing PMS2 and four additional genes (two with tumor-suppressing functions); and a novel deleterious hybrid PMS2 allele produced by recombination with crossover between PMS2 and PMS2CL, with the breakpoint in intron 10 (the most 5' breakpoint of its kind reported thus far). We discuss mechanisms that might generate this allele in different chromosomal configurations (and their diagnostic implications) and describe an allele-specific PCR assay that facilitates its detection. Our data indicate that the redesigned PMS2 MLPA assay is a valid first-line option. In our series, it identified roughly a quarter of all PMS2 mutations. Copyright © 2012 Wiley Periodicals, Inc.

  6. Improved Multiplex Ligation-Dependent Probe Amplification Analysis Identifies a Deleterious PMS2 Allele Generated by Recombination with Crossover Between PMS2 and PMS2CL

    PubMed Central

    Wernstedt, Annekatrin; Valtorta, Emanuele; Armelao, Franco; Togni, Roberto; Girlando, Salvatore; Baudis, Michael; Heinimann, Karl; Messiaen, Ludwine; Staehli, Noemie; Zschocke, Johannes; Marra, Giancarlo; Wimmer, Katharina

    2012-01-01

    Heterozygous PMS2 germline mutations are associated with Lynch syndrome. Up to one third of these mutations are genomic deletions. Their detection is complicated by a pseudogene (PMS2CL), which – owing to extensive interparalog sequence exchange – closely resembles PMS2 downstream of exon 12. A recently redesigned multiplex ligation-dependent probe amplification (MLPA) assay identifies PMS2 copy number alterations with improved reliability when used with reference DNAs containing equal numbers of PMS2- and PMS2CL-specific sequences. We selected eight such reference samples – all publicly available – and used them with this assay to study 13 patients with PMS2-defective colorectal tumors. Three presented deleterious alterations: an Alu-mediated exon deletion; a 125-kb deletion encompassing PMS2 and four additional genes (two with tumor-suppressing functions); and a novel deleterious hybrid PMS2 allele produced by recombination with crossover between PMS2 and PMS2CL, with the breakpoint in intron 10 (the most 5′ breakpoint of its kind reported thus far). We discuss mechanisms that might generate this allele in different chromosomal configurations (and their diagnostic implications) and describe an allele-specific PCR assay that facilitates its detection. Our data indicate that the redesigned PMS2 MLPA assay is a valid first-line option. In our series, it identified roughly a quarter of all PMS2 mutations. © 2012 Wiley Periodicals, Inc. PMID:22585707

  7. A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

    PubMed

    Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

    2015-11-01

    Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

  8. Assessing copy number from exome sequencing and exome array CGH based on CNV spectrum in a large clinical cohort.

    PubMed

    Retterer, Kyle; Scuffins, Julie; Schmidt, Daniel; Lewis, Rachel; Pineda-Alvarez, Daniel; Stafford, Amanda; Schmidt, Lindsay; Warren, Stephanie; Gibellini, Federica; Kondakova, Anastasia; Blair, Amanda; Bale, Sherri; Matyakhina, Ludmila; Meck, Jeanne; Aradhya, Swaroop; Haverfield, Eden

    2015-08-01

    Detection of copy-number variation (CNV) is important for investigating many genetic disorders. Testing a large clinical cohort by array comparative genomic hybridization provides a deep perspective on the spectrum of pathogenic CNV. In this context, we describe a bioinformatics approach to extract CNV information from whole-exome sequencing and demonstrate its utility in clinical testing. Exon-focused arrays and whole-genome chromosomal microarray analysis were used to test 14,228 and 14,000 individuals, respectively. Based on these results, we developed an algorithm to detect deletions/duplications in whole-exome sequencing data and a novel whole-exome array. In the exon array cohort, we observed a positive detection rate of 2.4% (25 duplications, 318 deletions), of which 39% involved one or two exons. Chromosomal microarray analysis identified 3,345 CNVs affecting single genes (18%). We demonstrate that our whole-exome sequencing algorithm resolves CNVs of three or more exons. These results demonstrate the clinical utility of single-exon resolution in CNV assays. Our whole-exome sequencing algorithm approaches this resolution but is complemented by a whole-exome array to unambiguously identify intragenic CNVs and single-exon changes. These data illustrate the next advancements in CNV analysis through whole-exome sequencing and whole-exome array.Genet Med 17 8, 623-629.

  9. Copy number abnormality of acute lymphoblastic leukemia cell lines based on their genetic subtypes.

    PubMed

    Tomoyasu, Chihiro; Imamura, Toshihiko; Tomii, Toshihiro; Yano, Mio; Asai, Daisuke; Goto, Hiroaki; Shimada, Akira; Sanada, Masashi; Iwamoto, Shotaro; Takita, Junko; Minegishi, Masayoshi; Inukai, Takeshi; Sugita, Kanji; Hosoi, Hajime

    2018-05-21

    In this study, we performed genetic analysis of 83 B cell precursor acute lymphoblastic leukemia (B-ALL) cell lines. First, we performed multiplex ligation-dependent probe amplification analysis to identify copy number abnormalities (CNAs) in eight genes associated with B-ALL according to genetic subtype. In Ph + B-ALL cell lines, the frequencies of IKZF1, CDKN2A/2B, BTG1, and PAX5 deletion were significantly higher than those in Ph - B-ALL cell lines. The frequency of CDKN2A/2B deletion in KMT2A rearranged cell lines was significantly lower than that in non-KMT2A rearranged cell lines. These findings suggest that CNAs are correlated with genetic subtype in B-ALL cell lines. In addition, we determined that three B-other ALL cell lines had IKZF1 deletions (YCUB-5, KOPN49, and KOPN75); we therefore performed comprehensive genetic analysis of these cell lines. YCUB-5, KOPN49, and KOPN75 had P2RY8-CRLF2, IgH-CRLF2, and PAX5-ETV6 fusions, respectively. Moreover, targeted capture sequencing revealed that YCUB-5 had JAK2 R683I and KRAS G12D, and KOPN49 had JAK2 R683G and KRAS G13D mutations. These data may contribute to progress in the field of leukemia research.

  10. Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

    PubMed

    Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

    1996-11-01

    Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and efficient means for determining frequency and progression of oncogenetic events in prostate cancer.

  11. Identification of genes associated with the long-gut-persistence phenotype of the probiotic Lactobacillus johnsonii strain NCC533 using a combination of genomics and transcriptome analysis.

    PubMed

    Denou, Emmanuel; Pridmore, Raymond David; Berger, Bernard; Panoff, Jean-Michel; Arigoni, Fabrizio; Brüssow, Harald

    2008-05-01

    Lactobacillus johnsonii strains NCC533 and ATCC 33200 (the type strain of this species) differed significantly in gut residence time (12 versus 5 days) after oral feeding to mice. Genes affecting the long gut residence time of the probiotic strain NCC533 were targeted for analysis. We hypothesized that genes specific for this strain, which are expressed during passage of the bacterium through the gut, affect the phenotype. When the DNA of the type strain was hybridized against a microarray of the sequenced NCC533 strain, we identified 233 genes that were specific for the long-gut-persistence isolate. Whole-genome transcription analysis of the NCC533 strain using the microarray format identified 174 genes that were strongly and consistently expressed in the jejunum of mice monocolonized with this strain. Fusion of the two microarray data sets identified three gene loci that were both expressed in vivo and specific to the long-gut-persistence isolate. The identified genes included LJ1027 and LJ1028, two glycosyltransferase genes in the exopolysaccharide synthesis operon; LJ1654 to LJ1656, encoding a sugar phosphotransferase system (PTS) transporter annotated as mannose PTS; and LJ1680, whose product shares 30% amino acid identity with immunoglobulin A proteases from pathogenic bacteria. Knockout mutants were tested in vivo. The experiments revealed that deletion of LJ1654 to LJ1656 and LJ1680 decreased the gut residence time, while a mutant with a deleted exopolysaccharide biosynthesis cluster had a slightly increased residence time.

  12. Clinical detection of deletion structural variants in whole-genome sequences

    PubMed Central

    Noll, Aaron C; Miller, Neil A; Smith, Laurie D; Yoo, Byunggil; Fiedler, Stephanie; Cooley, Linda D; Willig, Laurel K; Petrikin, Josh E; Cakici, Julie; Lesko, John; Newton, Angela; Detherage, Kali; Thiffault, Isabelle; Saunders, Carol J; Farrow, Emily G; Kingsmore, Stephen F

    2016-01-01

    Optimal management of acutely ill infants with monogenetic diseases requires rapid identification of causative haplotypes. Whole-genome sequencing (WGS) has been shown to identify pathogenic nucleotide variants in such infants. Deletion structural variants (DSVs, >50 nt) are implicated in many genetic diseases, and tools have been designed to identify DSVs using short-read WGS. Optimisation and integration of these tools into a WGS pipeline could improve diagnostic sensitivity and specificity of WGS. In addition, it may improve turnaround time when compared with current CNV assays, enhancing utility in acute settings. Here we describe DSV detection methods for use in WGS for rapid diagnosis in acutely ill infants: SKALD (Screening Konsensus and Annotation of Large Deletions) combines calls from two tools (Breakdancer and GenomeStrip) with calibrated filters and clinical interpretation rules. In four WGS runs, the average analytic precision (positive predictive value) of SKALD was 78%, and recall (sensitivity) was 27%, when compared with validated reference DSV calls. When retrospectively applied to a cohort of 36 families with acutely ill infants SKALD identified causative DSVs in two. The first was heterozygous deletion of exons 1–3 of MMP21 in trans with a heterozygous frame-shift deletion in two siblings with transposition of the great arteries and heterotaxy. In a newborn female with dysmorphic features, ventricular septal defect and persistent pulmonary hypertension, SKALD identified the breakpoints of a heterozygous, de novo 1p36.32p36.13 deletion. In summary, consensus DSV calling, implemented in an 8-h computational pipeline with parameterised filtering, has the potential to increase the diagnostic yield of WGS in acutely ill neonates and discover novel disease genes. PMID:29263817

  13. Cloning and characterization of an alternatively spliced gene in proximal Xq28 deleted in two patients with intersexual genitalia and myotubular myopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Laporte, J.; Hu, Ling-Jia; Kretz, C.

    1997-05-01

    We have identified a novel human gene that is entirely deleted in two boys with abnormal genital development and myotubular myopathy (MTM1). The gene, F18, is located in proximal Xq28, approximately 80 kb centromeric to the recently isolated MTM1 gene. Northern analysis of mRNA showed a ubiquitous pattern and suggested high levels of expression in skeletal muscle, brain, and heart. A transcript of 4.6 kb was detected in a range of tissues, and additional alternate forms of 3.8 and 2.6 kb were present in placenta and pancreas, respectively. The gene extends over 100 kb and is composed of at leastmore » seven exons, of which two are non-coding. Sequence analysis of a 4.6-kb cDNA contig revealed two overlapping open reading frames (ORFs) that encode putative proteins of 701 and 424 amino acids, respectively. Two alternative spliced transcripts affecting the large open reading frame were identified that, together with the Northern blot results, suggest that distinct proteins are derived from the gene. No significant homology to other known proteins was detected, but segments of the first ORF encode polyglutamine tracts and proline-rich domains, which are frequently observed in DNA-binding proteins. The F18 gene is a strong candidate for being implicated in the intersexual genitalia present in the two MTM1-deleted patients. The gene also serves as a candidate for other disorders that map to proximal Xq28. 15 refs., 3 figs., 1 tab.« less

  14. Extreme Outlier Analysis Identifies Occult Mitogen-Activated Protein Kinase Pathway Mutations in Patients With Low-Grade Serous Ovarian Cancer

    PubMed Central

    Grisham, Rachel N.; Sylvester, Brooke E.; Won, Helen; McDermott, Gregory; DeLair, Deborah; Ramirez, Ricardo; Yao, Zhan; Shen, Ronglai; Dao, Fanny; Bogomolniy, Faina; Makker, Vicky; Sala, Evis; Soumerai, Tara E.; Hyman, David M.; Socci, Nicholas D.; Viale, Agnes; Gershenson, David M.; Farley, John; Levine, Douglas A.; Rosen, Neal; Berger, Michael F.; Spriggs, David R.; Aghajanian, Carol A.; Solit, David B.; Iyer, Gopa

    2015-01-01

    Purpose No effective systemic therapy exists for patients with metastatic low-grade serous (LGS) ovarian cancers. BRAF and KRAS mutations are common in serous borderline (SB) and LGS ovarian cancers, and MEK inhibition has been shown to induce tumor regression in a minority of patients; however, no correlation has been observed between mutation status and clinical response. With the goal of identifying biomarkers of sensitivity to MEK inhibitor treatment, we performed an outlier analysis of a patient who experienced a complete, durable, and ongoing (> 5 years) response to selumetinib, a non-ATP competitive MEK inhibitor. Patients and Methods Next-generation sequencing was used to analyze this patient's tumor as well as an additional 28 SB/LGS tumors. Functional characterization of an identified novel alteration of interest was performed. Results Analysis of the extraordinary responder's tumor identified a 15-nucleotide deletion in the negative regulatory helix of the MAP2K1 gene encoding for MEK1. Functional characterization demonstrated that this mutant induced extracellular signal-regulated kinase pathway activation, promoted anchorage-independent growth and tumor formation in mice, and retained sensitivity to selumetinib. Analysis of additional LGS/SB tumors identified mutations predicted to induce extracellular signal-regulated kinase pathway activation in 82% (23 of 28), including two patients with BRAF fusions, one of whom achieved an ongoing complete response to MEK inhibitor–based combination therapy. Conclusion Alterations affecting the mitogen-activated protein kinase pathway are present in the majority of patients with LGS ovarian cancer. Next-generation sequencing analysis revealed deletions and fusions that are not detected by older sequencing approaches. These findings, coupled with the observation that a subset of patients with recurrent LGS ovarian cancer experienced dramatic and durable responses to MEK inhibitor therapy, support additional clinical studies of MEK inhibitors in this disease. PMID:26324360

  15. Exonal deletion of SLC24A4 causes hypomaturation amelogenesis imperfecta.

    PubMed

    Seymen, F; Lee, K-E; Tran Le, C G; Yildirim, M; Gencay, K; Lee, Z H; Kim, J-W

    2014-04-01

    Amelogenesis imperfecta is a heterogeneous group of genetic conditions affecting enamel formation. Recently, mutations in solute carrier family 24 member 4 (SLC24A4) have been identified to cause autosomal recessive hypomaturation amelogenesis imperfecta. We recruited a consanguineous family with hypomaturation amelogenesis imperfecta with generalized brown discoloration. Sequencing of the candidate genes identified a 10-kb deletion, including exons 15, 16, and most of the last exon of the SLC24A4 gene. Interestingly, this deletion was caused by homologous recombination between two 354-bp-long homologous sequences located in intron 14 and the 3' UTR. This is the first report of exonal deletion in SLC24A4 providing confirmatory evidence that the function of SLC24A4 in calcium transport has a crucial role in the maturation stage of amelogenesis.

  16. Detection of large scale 3' deletions in the PMS2 gene amongst Colon-CFR participants: have we been missing anything?

    PubMed

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N; Lindor, Noralane; Potter, John D; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L; Jenkins, Mark A; Rosty, Christophe; Young, Joanne P; Buchanan, Daniel D

    2013-09-01

    Current screening practices have been able to identify PMS2 mutations in 78 % of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3' end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22 % (n = 16) of CRC-affected probands for mutations in the 3' end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3' deletions in PMS2 are not a frequent occurrence in such families.

  17. Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant

    PubMed Central

    Hannes, F D; Sharp, A J; Mefford, H C; de Ravel, T; Ruivenkamp, C A; Breuning, M H; Fryns, J-P; Devriendt, K; Van Buggenhout, G; Vogels, A; Stewart, H; Hennekam, R C; Cooper, G M; Regan, R; Knight, S J L; Eichler, E E; Vermeesch, J R

    2009-01-01

    Background: Genomic disorders are often caused by non-allelic homologous recombination between segmental duplications. Chromosome 16 is especially rich in a chromosome-specific low copy repeat, termed LCR16. Methods and Results: A bacterial artificial chromosome (BAC) array comparative genome hybridisation (CGH) screen of 1027 patients with mental retardation and/or multiple congenital anomalies (MR/MCA) was performed. The BAC array CGH screen identified five patients with deletions and five with apparently reciprocal duplications of 16p13 covering 1.65 Mb, including 15 RefSeq genes. In addition, three atypical rearrangements overlapping or flanking this region were found. Fine mapping by high-resolution oligonucleotide arrays suggests that these deletions and duplications result from non-allelic homologous recombination (NAHR) between distinct LCR16 subunits with >99% sequence identity. Deletions and duplications were either de novo or inherited from unaffected parents. To determine whether these imbalances are associated with the MR/MCA phenotype or whether they might be benign variants, a population of 2014 normal controls was screened. The absence of deletions in the control population showed that 16p13.11 deletions are significantly associated with MR/MCA (p = 0.0048). Despite phenotypic variability, common features were identified: three patients with deletions presented with MR, microcephaly and epilepsy (two of these had also short stature), and two other deletion carriers ascertained prenatally presented with cleft lip and midline defects. In contrast to its previous association with autism, the duplication seems to be a common variant in the population (5/1682, 0.29%). Conclusion: These findings indicate that deletions inherited from clinically normal parents are likely to be causal for the patients’ phenotype whereas the role of duplications (de novo or inherited) in the phenotype remains uncertain. This difference in knowledge regarding the clinical relevance of the deletion and the duplication causes a paradigm shift in (cyto)genetic counselling. PMID:18550696

  18. Identification of novel alleles of the rice blast resistance gene Pi54

    NASA Astrophysics Data System (ADS)

    Vasudevan, Kumar; Gruissem, Wilhelm; Bhullar, Navreet K.

    2015-10-01

    Rice blast is one of the most devastating rice diseases and continuous resistance breeding is required to control the disease. The rice blast resistance gene Pi54 initially identified in an Indian cultivar confers broad-spectrum resistance in India. We explored the allelic diversity of the Pi54 gene among 885 Indian rice genotypes that were found resistant in our screening against field mixture of naturally existing M. oryzae strains as well as against five unique strains. These genotypes are also annotated as rice blast resistant in the International Rice Genebank database. Sequence-based allele mining was used to amplify and clone the Pi54 allelic variants. Nine new alleles of Pi54 were identified based on the nucleotide sequence comparison to the Pi54 reference sequence as well as to already known Pi54 alleles. DNA sequence analysis of the newly identified Pi54 alleles revealed several single polymorphic sites, three double deletions and an eight base pair deletion. A SNP-rich region was found between a tyrosine kinase phosphorylation site and the nucleotide binding site (NBS) domain. Together, the newly identified Pi54 alleles expand the allelic series and are candidates for rice blast resistance breeding programs.

  19. Deletion 22q13.3 syndrome.

    PubMed

    Phelan, Mary C

    2008-05-27

    The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH) or array comparative genomic hybridization (CGH) is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy). Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements. Individuals with deletion 22q13 should have routine examinations by the primary care physician as well as genetic evaluations with referral to specialists if neurological, gastrointestinal, renal, or other systemic problems are suspected. Affected individuals benefit from early intervention programs, intense occupational and communication therapies, adaptive exercise and sport programs, and other therapies to strengthen their muscles and increase their communication skills. No apparent life-threatening organic abnormalities accompany the diagnosis of deletion 22q13.

  20. A de novo whole gene deletion of XIAP detected by exome sequencing analysis in very early onset inflammatory bowel disease: a case report.

    PubMed

    Kelsen, Judith R; Dawany, Noor; Martinez, Alejandro; Martinez, Alejuandro; Grochowski, Christopher M; Maurer, Kelly; Rappaport, Eric; Piccoli, David A; Baldassano, Robert N; Mamula, Petar; Sullivan, Kathleen E; Devoto, Marcella

    2015-11-18

    Children with very early-onset inflammatory bowel disease (VEO-IBD), those diagnosed at less than 5 years of age, are a unique population. A subset of these patients present with a distinct phenotype and more severe disease than older children and adults. Host genetics is thought to play a more prominent role in this young population, and monogenic defects in genes related to primary immunodeficiencies are responsible for the disease in a small subset of patients with VEO-IBD. We report a child who presented at 3 weeks of life with very early-onset inflammatory bowel disease (VEO-IBD). He had a complicated disease course and remained unresponsive to medical and surgical therapy. The refractory nature of his disease, together with his young age of presentation, prompted utilization of whole exome sequencing (WES) to detect an underlying monogenic primary immunodeficiency and potentially target therapy to the identified defect. Copy number variation analysis (CNV) was performed using the eXome-Hidden Markov Model. Whole exome sequencing revealed 1,380 nonsense and missense variants in the patient. Plausible candidate variants were not detected following analysis of filtered variants, therefore, we performed CNV analysis of the WES data, which led us to identify a de novo whole gene deletion in XIAP. This is the first reported whole gene deletion in XIAP, the causal gene responsible for XLP2 (X-linked lymphoproliferative Disease 2). XLP2 is a syndrome resulting in VEO-IBD and can increase susceptibility to hemophagocytic lymphohistocytosis (HLH). This identification allowed the patient to be referred for bone marrow transplantation, potentially curative for his disease and critical to prevent the catastrophic sequela of HLH. This illustrates the unique etiology of VEO-IBD, and the subsequent effects on therapeutic options. This cohort requires careful and thorough evaluation for monogenic defects and primary immunodeficiencies.

  1. HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

    PubMed

    George, E; Teh, Lai Kuan; Tan, Jama; Lai, Mei I; Wong, Lily

    2013-01-01

    Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser. The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations. The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia. The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

  2. MinGenome: An In Silico Top-Down Approach for the Synthesis of Minimized Genomes.

    PubMed

    Wang, Lin; Maranas, Costas D

    2018-02-16

    Genome minimized strains offer advantages as production chassis by reducing transcriptional cost, eliminating competing functions and limiting unwanted regulatory interactions. Existing approaches for identifying stretches of DNA to remove are largely ad hoc based on information on presumably dispensable regions through experimentally determined nonessential genes and comparative genomics. Here we introduce a versatile genome reduction algorithm MinGenome that implements a mixed-integer linear programming (MILP) algorithm to identify in size descending order all dispensable contiguous sequences without affecting the organism's growth or other desirable traits. Known essential genes or genes that cause significant fitness or performance loss can be flagged and their deletion can be prohibited. MinGenome also preserves needed transcription factors and promoter regions ensuring that retained genes will be properly transcribed while also avoiding the simultaneous deletion of synthetic lethal pairs. The potential benefit of removing even larger contiguous stretches of DNA if only one or two essential genes (to be reinserted elsewhere) are within the deleted sequence is explored. We applied the algorithm to design a minimized E. coli strain and found that we were able to recapitulate the long deletions identified in previous experimental studies and discover alternative combinations of deletions that have not yet been explored in vivo.

  3. Memory in Intellectually Matched Groups of Young Participants with 22q11.2 Deletion Syndrome and Those with Schizophrenia

    ERIC Educational Resources Information Center

    Kravariti, Eugenia; Jacobson, Clare; Morris, Robin; Frangou, Sophia; Murray, Robin M.; Tsakanikos, Elias; Habel, Alex; Shearer, Jo

    2010-01-01

    The 22q11.2 deletion syndrome (22qDS) and schizophrenia have genetic and neuropsychological similarities, but are likely to differ in memory profile. Confirming differences in memory function between the two disorders, and identifying their genetic determinants, can help to define genetic subtypes in both syndromes, identify genetic risk factors…

  4. A rapid NGS strategy for comprehensive molecular diagnosis of Birt-Hogg-Dubé syndrome in patients with primary spontaneous pneumothorax.

    PubMed

    Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long

    2016-05-27

    Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.

  5. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing.

    PubMed

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J

    2010-10-15

    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. GtfA and GtfB Are Both Required for Protein O-Glycosylation in Lactobacillus plantarum

    PubMed Central

    Lee, I-Chiao; van Swam, Iris I.; Tomita, Satoru; Morsomme, Pierre; Rolain, Thomas; Hols, Pascal; Bron, Peter A.

    2014-01-01

    Acm2, the major autolysin of Lactobacillus plantarum WCFS1, was recently found to be O-glycosylated with N-acetylhexosamine, likely N-acetylglucosamine (GlcNAc). In this study, we set out to identify the glycosylation machinery by employing a comparative genomics approach to identify Gtf1 homologues, which are involved in fimbria-associated protein 1 (Fap1) glycosylation in Streptococcus parasanguinis. This in silico approach resulted in the identification of 6 candidate L. plantarum WCFS1 genes with significant homology to Gtf1, namely, tagE1 to tagE6. These candidate genes were targeted by systematic gene deletion, followed by assessment of the consequences on glycosylation of Acm2. We observed a changed mobility of Acm2 on SDS-PAGE in the tagE5E6 deletion strain, while deletion of other tagE genes resulted in Acm2 mobility comparable to that of the wild type. Subsequent mass spectrometry analysis of excised and in-gel-digested Acm2 confirmed the loss of glycosylation on Acm2 in the tagE5E6 deletion mutant, whereas a lectin blot using GlcNAc-specific succinylated wheat germ agglutinin (sWGA) revealed that besides Acm2, tagE5E6 deletion also abolished all but one other sWGA-reactive, protease-sensitive signal. Only complementation of both tagE5 and tagE6 restored those sWGA lectin signals, establishing that TagE5 and TagE6 are both required for the glycosylation of Acm2 as well as the vast majority of other sWGA-reactive proteins. Finally, sWGA lectin blotting experiments using a panel of 8 other L. plantarum strains revealed that protein glycosylation is a common feature in L. plantarum strains. With the establishment of these enzymes as protein glycosyltransferases, we propose to rename TagE5 and TagE6 as GtfA and GtfB, respectively. PMID:24532775

  7. Differential DNA methylation at birth associated with mental disorder in individuals with 22q11.2 deletion syndrome

    PubMed Central

    Starnawska, A; Hansen, C S; Sparsø, T; Mazin, W; Olsen, L; Bertalan, M; Buil, A; Bybjerg-Grauholm, J; Bækvad-Hansen, M; Hougaard, D M; Mortensen, P B; Pedersen, C B; Nyegaard, M; Werge, T; Weinsheimer, S

    2017-01-01

    Individuals with 22q11.2 deletion syndrome (DS) have an increased risk of comorbid mental disorders including schizophrenia, attention deficit hyperactivity disorder, depression, as well as intellectual disability. Although most 22q11.2 deletion carriers have the long 3-Mb form of the hemizygous deletion, there remains a large variation in the development and progression of psychiatric disorders, which suggests that alternative factors contribute to the pathogenesis. In this study we investigated whether neonatal DNA methylation signatures in individuals with the 22q11.2 deletion associate with mental disorder later in life. DNA methylation was measured genome-wide from neonatal dried blood spots in a cohort of 164 individuals with 22q11.2DS, including 48 individuals diagnosed with a psychiatric disorder. Among several CpG sites with P-value<10−6, we identified cg23546855 (P-value=2.15 × 10−7) mapping to STK32C to be associated with a later psychiatric diagnosis. Pathway analysis of the top findings resulted in the identification of several Gene Ontology pathways to be significantly enriched (P-value<0.05 after Benjamini–Hochberg correction); among them are the following: neurogenesis, neuron development, neuron projection development, astrocyte development, axonogenesis and axon guidance. In addition, we identified differentially methylated CpG sites in LRP2BP (P-value=5.37 × 10−8) to be associated with intellectual disability (F70–79), in TOP1 (P-value=1.86 × 10−7) with behavioral disorders (F90–98), in NOSIP (P-value=5.12 × 10−8) with disorders of psychological development (F80–89) and in SEMA4B (P-value=4.02 × 10−7) with schizophrenia spectrum disorders (F20–29). In conclusion, our study suggests an association of DNA methylation differences at birth with development of mental disorder later in life in 22q11.2DS individuals. PMID:28850114

  8. Methods for Determining Likelihood of Tweet Deletion

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Few works exist that attempt to build predictive models for tweet deletion. Zhou et al. (2015) focus on a subset of deleted tweets – regrettable tweets. These are tweets that the authors believe to contain inappropriate content. Inappropriate can range from vulgar language to sharing private content such as a personal email address. The presence of inappropriate content doesn’t guarantee that a tweet will be deleted, however intuition dictates it can be in an important factor in the tweet being deleted. In their work, the authors create a predictive model for identifying regrettable tweets. It is important to note themore » authors focus on predicting regrettable tweets that are distinctly not spam and only written in English. Through manual investigation, the authors identify ten major topics including negative sentiment, cursing, and relationships that are prevalent in regrettable tweets. The authors then exploit WordNet and UrbanDictionary to create keyword lists related to the ten topics. Finally, using a combination of existing lexica and the topic keywords as features, the authors build classifiers to test the accuracy of their model. The authors complement 700 manually labeled regrettable tweets with 700 normal tweets to create their evaluation dataset. The authors’ best performance from 10-fold cross-validation was an f1 score of 0.85 using a J48 classifier on a balanced dataset of deleted and non-deleted tweets.« less

  9. In Southern Africa, Brown Oculocutaneous Albinism (BOCA) Maps to the OCA2 Locus on Chromosome 15q: P-Gene Mutations Identified

    PubMed Central

    Manga, Prashiela; Kromberg, Jennifer G. R.; Turner, Angela; Jenkins, Trefor; Ramsay, Michele

    2001-01-01

    In southern Africa, brown oculocutaneous albinism (BOCA) is a distinct pigmentation phenotype. In at least two cases, it has occurred in the same families as tyrosinase-positive oculocutaneous albinism (OCA2), suggesting that it may be allelic, despite the fact that this phenotype was attributed to mutations in the TYRP1 gene in an American individual of mixed ancestry. Linkage analysis in five families mapped the BOCA locus to the same region as the OCA2 locus (maximum LOD 3.07; θ=0 using a six-marker haplotype). Mutation analysis of the human homologue of the mouse pink-eyed dilution gene (P), in 10 unrelated individuals with BOCA revealed that 9 had one copy of the 2.7-kb deletion. No other mutations were identified. Additional haplotype studies, based on closely linked markers (telomere to centromere: D15S1048, D15S1019, D15S1533, P-gene 2.7-kb deletion, D15S219, and D15S156) revealed several BOCA-associated P haplotypes. These could be divided into two core haplotypes, suggesting that a limited number of P-gene mutations give rise to this phenotype. PMID:11179026

  10. P06.19 TERT promoter mutation is an independent prognostic factor in 1p/19q co-deleted oligodendrogliomas: a POLA network study

    PubMed Central

    Alentorn, A.; Carpentier, C.; Labreche, K.; Ducray, F.; Dehais, C.; Mokhtari, K.; Uro-Coste, E.; Figarella-Branger, D.; Delattre, J.; Idbaih, A.

    2016-01-01

    Abstract Background: Overall, gliomas harboring 1p19q co-deletion (oligodendrogliomas in the future WHO classification) have better prognosis and better response to treatments compared to their non 1p/19q co-deleted counterparts. However, some of these tumors have disconcerting poor outcome. We have recently shown that chromosome arm 9p loss of heterozygosity (9pLOH) participates to identify some but not all oligodendrogliomas with an aggressive clinical behavior. In parallel, TERT promoter (TERTp) mutations have been recently described as the most frequent mutations in oligodendrogliomas. Objectives: We sought to study the potential clinical significance of TERTp mutational status in oligodendrogliomas. Material and methods: 224 anaplastic oligodendrogliomas (AO) from the POLA network, were included in the present study. TERT mutational status was obtained using Sanger sequencing and SNP-array. 121 lower grade gliomas exhibiting 1p/19q co-deletion, from the TCGA dataset, were used as the validation cohort. In this latter series, level of TERT expression, obtained by RNA-sequencing, was used as a surrogate marker of TERTp mutation. 1p/19q co-deletion was defined as loss of whole-chromosome arms 1p and 19q using allelic-specific copy number analysis. Overall survivals (OS) were compared using log-rank test in univariate analysis. All covariates with p-value < 0.2 were included in a Cox’s proportional hazard ratio model for multivariate analysis. Statistical tests were two-sided and p-values < 0.05 were interpreted as statistically significant. Results: TERTp was wild-type (wt) in 14/224 AO (6.25%) in POLA cohort and in 8/121 (6.6%) in TCGA dataset. TERTp wt is associated with poor OS in univariate analysis in POLA and TCGA cohorts (p=0.032 and p=0.035, respectively). Interestingly, after adjusting for allelic 9p LOH, age (<50 vs. ≥ 50 years), treatment (chemotherapy and radiotherapy versus other treatments) and WHO grade (II vs III), TERTp mutation was an independent favorable prognostic factor in the POLA cohort (p=0.037, HR=3.7 (1.1–13)) and in the TCGA dataset (p=0.01, HR=9.8 (1.6–60)). Conclusion: This study identifies TERTp mutation as a novel independent prognostic biomarker in oligodendrogliomas toward a better stratification of this tumor type. Acknowledgements: The results shown here are in whole or part based upon data generated by the TCGA Research Network: http://cancergenome.nih.gov/. La Ligue Nationale Contre La Cancer. The Institut Universitaire de Cancérologie (IUC). The program Investissements d’avenir” ANR-10-IAIHU-06. POLA network is supported by Institut National du Cancer.

  11. Pattern of deletions of the dystrophin gene in Mexican Duchenne/Becker muscular dystrophy patients: the use of new designed primers for the analysis of the major deletion "hot spot" region.

    PubMed

    Coral-Vazquez, R; Arenas, D; Cisneros, B; Peñaloza, L; Salamanca, F; Kofman, S; Mercado, R; Montañez, C

    1997-06-13

    We have analyzed 59 unrelated Mexican Duchenne/Becker muscular dystrophy patients (DMD/BMD) using PCR analysis of the 2 prone deletion regions in the DMD gene. Thirty one (52%) of the patients had a deletion of one or several of the exons. Most of the alterations (87%) were clustered in exons 44-52, this being the highest percentage reported until now. In order to improve the molecular diagnosis in the Mexican population, we designed a new multiplex assay to PCR amplify exons 44-52. This assay allowed for the identification of a greater number of deletions in this region compared with the 9 and 5-plex assays previously described and to determine most of the deletion end boundaries. This is a reliable alternative for the initial screening of the DMD patients in the Mexican population.

  12. Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

    PubMed

    Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

    1999-06-01

    Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

  13. Functional mechanism of C-terminal tail in the enzymatic role of porcine testicular carbonyl reductase: a combined experiment and molecular dynamics simulation study of the C-terminal tail in the enzymatic role of PTCR.

    PubMed

    Son, Minky; Bang, Woo Young; Park, Chanin; Lee, Yuno; Kwon, Seul Gi; Kim, Sam Woong; Kim, Chul Wook; Lee, Keun Woo

    2014-01-01

    Porcine testicular carbonyl reductase, PTCR which is one of the short chain dehydrogenases/reductases (SDR) superfamily catalyzes the NADPH-dependent reduction of carbonyl compounds including steroids and prostaglandins. Previously we reported C-terminal tail of PTCR was deleted due to a nonsynonymous single nucleotide variation (nsSNV). Here we identified from kinetic studies that the enzymatic properties for 5α-dihydrotestosterone (5α-DHT) were different between wild-type and C-terminal-deleted PTCRs. Compared to wild-type PTCR, C-terminal-deleted PTCR has much higher reduction rate. To investigate structural difference between wild-type and C-terminal-deleted PTCRs upon 5α-DHT binding, we performed molecular dynamics simulations for two complexes. Using trajectories, molecular interactions including hydrogen bonding patterns, distance between 5α-DHT and catalytic Tyr193, and interaction energies are analyzed and compared. During the MD simulation time, the dynamic behavior of C-terminal tail in wild-type PTCR is also examined using essential dynamics analysis. The results of our simulations reveal that the binding conformation of 5α-DHT in C-terminal-deleted PTCR is more favorable for reduction reaction in PTCR, which shows strong agreement with kinetic data. These structural findings provide valuable information to understand substrate specificity of PTCR and further kinetic properties of enzymes belonging to the SDR superfamily.

  14. Functional Mechanism of C-Terminal Tail in the Enzymatic Role of Porcine Testicular Carbonyl Reductase: A Combined Experiment and Molecular Dynamics Simulation Study of the C-Terminal Tail in the Enzymatic Role of PTCR

    PubMed Central

    Park, Chanin; Lee, Yuno; Kwon, Seul Gi; Kim, Sam Woong; Kim, Chul Wook; Lee, Keun Woo

    2014-01-01

    Porcine testicular carbonyl reductase, PTCR which is one of the short chain dehydrogenases/reductases (SDR) superfamily catalyzes the NADPH-dependent reduction of carbonyl compounds including steroids and prostaglandins. Previously we reported C- terminal tail of PTCR was deleted due to a nonsynonymous single nucleotide variation (nsSNV). Here we identified from kinetic studies that the enzymatic properties for 5α-dihydrotestosterone (5α-DHT) were different between wild-type and C-terminal-deleted PTCRs. Compared to wild-type PTCR, C-terminal-deleted PTCR has much higher reduction rate. To investigate structural difference between wild-type and C-terminal-deleted PTCRs upon 5α-DHT binding, we performed molecular dynamics simulations for two complexes. Using trajectories, molecular interactions including hydrogen bonding patterns, distance between 5α-DHT and catalytic Tyr193, and interaction energies are analyzed and compared. During the MD simulation time, the dynamic behavior of C-terminal tail in wild-type PTCR is also examined using essential dynamics analysis. The results of our simulations reveal that the binding conformation of 5α-DHT in C-terminal-deleted PTCR is more favorable for reduction reaction in PTCR, which shows strong agreement with kinetic data. These structural findings provide valuable information to understand substrate specificity of PTCR and further kinetic properties of enzymes belonging to the SDR superfamily. PMID:24646606

  15. 12p13.33 microdeletion including ELKS/ERC1, a new locus associated with childhood apraxia of speech

    PubMed Central

    Thevenon, Julien; Callier, Patrick; Andrieux, Joris; Delobel, Bruno; David, Albert; Sukno, Sylvie; Minot, Delphine; Mosca Anne, Laure; Marle, Nathalie; Sanlaville, Damien; Bonnet, Marlène; Masurel-Paulet, Alice; Levy, Fabienne; Gaunt, Lorraine; Farrell, Sandra; Le Caignec, Cédric; Toutain, Annick; Carmignac, Virginie; Mugneret, Francine; Clayton-Smith, Jill; Thauvin-Robinet, Christel; Faivre, Laurence

    2013-01-01

    Speech sound disorders are heterogeneous conditions, and sporadic and familial cases have been described. However, monogenic inheritance explains only a small proportion of such disorders, in particular in cases with childhood apraxia of speech (CAS). Deletions of <5 Mb involving the 12p13.33 locus is one of the least commonly deleted subtelomeric regions. Only four patients have been reported with such a deletion diagnosed with fluorescence in situ hybridisation telomere analysis or array CGH. To further delineate this rare microdeletional syndrome, a French collaboration together with a search in the Decipher database allowed us to gather nine new patients with a 12p13.33 subtelomeric or interstitial rearrangement identified by array CGH. Speech delay was found in all patients, which could be defined as CAS when patients had been evaluated by a speech therapist (5/9 patients). Intellectual deficiency was found in 5/9 patients only, and often associated with psychiatric manifestations of various severity. Two such deletions were inherited from an apparently healthy parent, but reevaluation revealed abnormal speech production at least in childhood, suggesting variable expressivity. The ELKS/ERC1 gene, which encodes for a synaptic factor, is found in the smallest region of overlap. These results reinforce the hypothesis that deletions of the 12p13.33 locus may be responsible for variable phenotypes including CAS associated with neurobehavioural troubles and that the presence of CAS justifies a genetic work-up. PMID:22713806

  16. [Gene deletion and functional analysis of the heptyl glycosyltransferase (waaF) gene in Vibrio parahemolyticus O-antigen cluster].

    PubMed

    Zhao, Feng; Meng, Songsong; Zhou, Deqing

    2016-02-04

    To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.

  17. New developments in Smith-Magenis syndrome (del 17p11.2).

    PubMed

    Gropman, Andrea L; Elsea, Sarah; Duncan, Wallace C; Smith, Ann C M

    2007-04-01

    Recent clinical, neuroimaging, sleep, and molecular cytogenetic studies have provided new insights into the mechanisms leading to the Smith-Magenis phenotype and are summarized in this review. Cross sectional studies of patients with Smith-Magenis syndrome have found evidence for central and peripheral nervous system abnormalities, neurobehavioral disturbances, and an inverted pattern of melatonin secretion leading to circadian rhythm disturbance. A common chromosome 17p11.2 deletion interval spanning approximately 3.5 Mb is identified in about 70% of individuals with chromosome deletion. Recently heterozygous point mutations in the RAI1 gene within the Smith-Magenis syndrome critical region have been reported in Smith-Magenis syndrome patients without detectable deletion by fluorescent in-situ hybridization. Patients with intragenic mutations in RAI1 as well as those with deletions share most but not all aspects of the phenotype. Findings from molecular cytogenetic analysis suggest that other genes or genetic background may play a role in altering the functional availability of RAI1 for downstream effects. Further research into additional genes in the Smith-Magenis syndrome critical region will help define the role they play in modifying features or severity of the Smith-Magenis syndrome phenotype. More research is needed to translate advances in clinical research into new treatment options to address the sleep and neurobehavioral problems in this disorder.

  18. Deletion of amelotin exons 3-6 is associated with amelogenesis imperfecta.

    PubMed

    Smith, Claire E L; Murillo, Gina; Brookes, Steven J; Poulter, James A; Silva, Sandra; Kirkham, Jennifer; Inglehearn, Chris F; Mighell, Alan J

    2016-08-15

    Amelogenesis imperfecta (AI) is a heterogeneous group of genetic conditions that result in defective dental enamel formation. Amelotin (AMTN) is a secreted protein thought to act as a promoter of matrix mineralization in the final stage of enamel development, and is strongly expressed, almost exclusively, in maturation stage ameloblasts. Amtn overexpression and Amtn knockout mouse models have defective enamel with no other associated phenotypes, highlighting AMTN as an excellent candidate gene for human AI. However, no AMTN mutations have yet been associated with human AI. Using whole exome sequencing, we identified an 8,678 bp heterozygous genomic deletion encompassing exons 3-6 of AMTN in a Costa Rican family segregating dominant hypomineralised AI. The deletion corresponds to an in-frame deletion of 92 amino acids, shortening the protein from 209 to 117 residues. Exfoliated primary teeth from an affected family member had enamel that was of a lower mineral density compared to control enamel and exhibited structural defects at least some of which appeared to be associated with organic material as evidenced using elemental analysis. This study demonstrates for the first time that AMTN mutations cause non-syndromic human AI and explores the human phenotype, comparing it with that of mice with disrupted Amtn function. © The Author 2016. Published by Oxford University Press.

  19. Novel large-range mitochondrial DNA deletions and fatal multisystemic disorder with prominent hepatopathy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bianchi, Marzia; Rizza, Teresa; Verrigni, Daniela

    2011-11-18

    Highlights: Black-Right-Pointing-Pointer Expanded array of mtDNA deletions. Black-Right-Pointing-Pointer Pearson syndrome with prominent hepatopathy associated with single mtDNA deletions. Black-Right-Pointing-Pointer Detection of deletions in fibroblasts and blood avoids muscle and liver biopsy. Black-Right-Pointing-Pointer Look for mtDNA deletions before to study nuclear genes related to mtDNA depletion. -- Abstract: Hepatic involvement in mitochondrial cytopathies rarely manifests in adulthood, but is a common feature in children. Multiple OXPHOS enzyme defects in children with liver involvement are often associated with dramatically reduced amounts of mtDNA. We investigated two novel large scale deletions in two infants with a multisystem disorder and prominent hepatopathy. Amount ofmore » mtDNA deletions and protein content were measured in different post-mortem tissues. The highest levels of deleted mtDNA were in liver, kidney, pancreas of both patients. Moreover, mtDNA deletions were detected in cultured skin fibroblasts in both patients and in blood of one during life. Biochemical analysis showed impairment of mainly complex I enzyme activity. Patients manifesting multisystem disorders in childhood may harbour rare mtDNA deletions in multiple tissues. For these patients, less invasive blood specimens or cultured fibroblasts can be used for molecular diagnosis. Our data further expand the array of deletions in the mitochondrial genomes in association with liver failure. Thus analysis of mtDNA should be considered in the diagnosis of childhood-onset hepatopathies.« less

  20. Assessing pathogenicity for novel mutation/sequence variants: the value of healthy older individuals.

    PubMed

    Zatz, Mayana; Pavanello, Rita de Cassia M; Lourenço, Naila Cristina V; Cerqueira, Antonia; Lazar, Monize; Vainzof, Mariz

    2012-12-01

    Improvement in DNA technology is increasingly revealing unexpected/unknown mutations in healthy persons and generating anxiety due to their still unknown health consequences. We report a 44-year-old healthy father of a 10-year-old daughter with bilateral coloboma and hearing loss, but without muscle weakness, in whom a whole-genome CGH revealed a deletion of exons 38-44 in the dystrophin gene. This mutation was inherited from her asymptomatic father, who was further clinically and molecularly evaluated for prognosis and genetic counseling (GC). This deletion was never identified by us in 982 Duchenne/Becker patients. To assess whether the present case represents a rare case of non-penetrance, and aiming to obtain more information for prognosis and GC, we suggested that healthy older relatives submit their DNA for analysis, to which several complied. Mutation analysis revealed that his mother, brother, and 56-year-old maternal uncle also carry the 38-44 deletion, suggesting it an unlikely cause of muscle weakness. Genome sequencing will disclose mutations and variants whose health impact are still unknown, raising important problems in interpreting results, defining prognosis, and discussing GC. We suggest that, in addition to family history, keeping the DNA of older relatives could be very informative, in particular for those interested in having their genome sequenced.

  1. A meta-analysis of prognostic value of KIT mutation status in gastrointestinal stromal tumors

    PubMed Central

    Jiang, Zhiqiang; Zhang, Jian; Li, Zhi; Liu, Yingjun; Wang, Daohai; Han, Guangsen

    2016-01-01

    Numerous types of KIT mutations have been reported in gastrointestinal stromal tumors (GISTs); however, controversy still exists regarding their clinicopathological significance. In this study, we reviewed the publicly available literature to assess the data by a meta-analysis to characterize KIT mutations and different types of KIT mutations in prognostic prediction in patients with GISTs. Twenty-eight studies that included 4,449 patients were identified and analyzed. We found that KIT mutation status was closely correlated with size of tumors and different mitosis indexes, but not with tumor location. KIT mutation was also observed to be significantly correlated with tumor recurrence, metastasis, as well as the overall survival of patients. Interestingly, there was higher risk of progression in KIT exon 9-mutated patients than in exon 11-mutated patients. Five-year relapse-free survival (RFS) rate was significantly higher in KIT exon 11-deleted patients than in those with other types of KIT exon 11 mutations. In addition, RFS for 5 years was significantly worse in patients bearing KIT codon 557–558 deletions than in those bearing other KIT exon 11 deletions. Our results strongly support the hypothesis that KIT mutation status is another evaluable factor for prognosis prediction in GISTs. PMID:27350754

  2. An unusual case of hereditary nephrogenic diabetes insipidus (HNDI) affecting mother and daughter.

    PubMed

    Giri, Dinesh; Hart, Rachel; Jones, Caroline; Ellis, Ian; Ramakrishnan, Renuka

    2016-01-01

    Hereditary nephrogenic diabetes iInsipidus (HNDI) is an uncommon disorder due to a resistance to anti-diuretic hormone leading to a reduced urinary concentrating ability. The X-linked form is fully expressed in hemizygous male patients, but diabetes insipidus may also present in heterozygous females where it must be distinguished from autosomal and other secondary causes. We report a mother and daughter in the same family with HNDI due to a heterozygous deletion in exon 1 of the AVPR2 gene, not previously described in the literature. A 5-year-old girl was referred for investigation of polyuria and polydipsia. The patient had a water deprivation test elsewhere at the age of 3 that was inconclusive. A degree of water restriction was imposed leading to headaches. The thyroid, cortisol, renal, and calcium profiles were normal. Her mother showed similar symptoms that had not been previously investigated. AQP2 (Aquaporin) and initial AVPR2 gene sequencing had not identified a mutation, but subsequent quantitative polymerase chain reaction analysis revealed a heterozygous large exon 1 deletion of the AVPR2 gene. The same deletion was also found in the child's mother. The patient's symptoms have significantly improved on appropriate treatment. Further analysis revealed skewed X inactivation in mother and daughter.

  3. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups.

    PubMed

    Curtis, Christina; Shah, Sohrab P; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M; Dunning, Mark J; Speed, Doug; Lynch, Andy G; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

    2012-04-18

    The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome.

  4. Mutation and deletion analysis of GFRα-1, encoding the co-receptor for the GDNF/RET complex, in human brain tumours

    PubMed Central

    Gimm, O; Gössling, A; Marsh, D J; Dahia, P L M; Mulligan, L M; Deimling, A von; Eng, C

    1999-01-01

    Glial cell line-derived neurotrophic factor (GDNF) plays a key role in the control of vertebrate neuron survival and differentiation in both the central and peripheral nervous systems. GDNF preferentially binds to GFRα-1 which then interacts with the receptor tyrosine kinase RET. We investigated a panel of 36 independent cases of mainly advanced sporadic brain tumours for the presence of mutations in GDNF and GFRα-1. No mutations were found in the coding region of GDNF. We identified six previously described GFRα-1 polymorphisms, two of which lead to an amino acid change. In 15 of 36 brain tumours, all polymorphic variants appeared to be homozygous. Of these 15 tumours, one also had a rare, apparently homozygous, sequence variant at codon 361. Because of the rarity of the combination of homozygous sequence variants, analysis for hemizygous deletion was pursued in the 15 samples and loss of heterozygosity was found in 11 tumours. Our data suggest that intragenic point mutations of GDNF or GFRα-1 are not a common aetiologic event in brain tumours. However, either deletion of GFRα-1 and/or nearby genes may contribute to the pathogenesis of these tumours. © 1999 Cancer Research Campaign PMID:10408842

  5. AluY-mediated germline deletion, duplication and somatic stem cell reversion in UBE2T defines a new subtype of Fanconi anemia.

    PubMed

    Virts, Elizabeth L; Jankowska, Anna; Mackay, Craig; Glaas, Marcel F; Wiek, Constanze; Kelich, Stephanie L; Lottmann, Nadine; Kennedy, Felicia M; Marchal, Christophe; Lehnert, Erik; Scharf, Rüdiger E; Dufour, Carlo; Lanciotti, Marina; Farruggia, Piero; Santoro, Alessandra; Savasan, Süreyya; Scheckenbach, Kathrin; Schipper, Jörg; Wagenmann, Martin; Lewis, Todd; Leffak, Michael; Farlow, Janice L; Foroud, Tatiana M; Honisch, Ellen; Niederacher, Dieter; Chakraborty, Sujata C; Vance, Gail H; Pruss, Dmitry; Timms, Kirsten M; Lanchbury, Jerry S; Alpi, Arno F; Hanenberg, Helmut

    2015-09-15

    Fanconi anemia (FA) is a rare inherited disorder clinically characterized by congenital malformations, progressive bone marrow failure and cancer susceptibility. At the cellular level, FA is associated with hypersensitivity to DNA-crosslinking genotoxins. Eight of 17 known FA genes assemble the FA E3 ligase complex, which catalyzes monoubiquitination of FANCD2 and is essential for replicative DNA crosslink repair. Here, we identify the first FA patient with biallelic germline mutations in the ubiquitin E2 conjugase UBE2T. Both mutations were aluY-mediated: a paternal deletion and maternal duplication of exons 2-6. These loss-of-function mutations in UBE2T induced a cellular phenotype similar to biallelic defects in early FA genes with the absence of FANCD2 monoubiquitination. The maternal duplication produced a mutant mRNA that could encode a functional protein but was degraded by nonsense-mediated mRNA decay. In the patient's hematopoietic stem cells, the maternal allele with the duplication of exons 2-6 spontaneously reverted to a wild-type allele by monoallelic recombination at the duplicated aluY repeat, thereby preventing bone marrow failure. Analysis of germline DNA of 814 normal individuals and 850 breast cancer patients for deletion or duplication of UBE2T exons 2-6 identified the deletion in only two controls, suggesting aluY-mediated recombinations within the UBE2T locus are rare and not associated with an increased breast cancer risk. Finally, a loss-of-function germline mutation in UBE2T was detected in a high-risk breast cancer patient with wild-type BRCA1/2. Cumulatively, we identified UBE2T as a bona fide FA gene (FANCT) that also may be a rare cancer susceptibility gene. © The Author 2015. Published by Oxford University Press.

  6. Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

    PubMed Central

    2010-01-01

    Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

  7. Predominance of Ancestral Lineages of Mycobacterium tuberculosis in India

    PubMed Central

    Gutierrez, M. Cristina; Ahmed, Niyaz; Willery, Eve; Narayanan, Sujatha; Hasnain, Seyed E.; Chauhan, Devendra S.; Katoch, Vishwa M.; Vincent, Véronique; Locht, Camille

    2006-01-01

    Although India has the highest prevalence of tuberculosis (TB) worldwide, the genetic diversity of Mycobacterium tuberculosis in India is largely unknown. A collection of 91 isolates originating from 12 different regions spread across the country were analyzed by genotyping using 21 loci with variable-number tandem repeats (VNTRs), by spoligotyping, by principal genetic grouping (PGG), and by deletion analysis of M. tuberculosis–specific deletion region 1. The isolates showed highly diverse VNTR genotypes. Nevertheless, highly congruent groupings identified by using the 4 independent sets of markers permitted a clear definition of 3 prevalent PGG1 lineages, which corresponded to the "ancestral" East African–Indian, the Delhi, and the Beijing/W genogroups. A few isolates from PGG2 lineages and a single representative of the presumably most recent PGG3 were identified. These observations suggest a predominance of ancestral M. tuberculosis genotypes in the Indian subcontinent, which supports the hypothesis that India is an ancient endemic focus of TB. PMID:17073085

  8. A deletion mutation in bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle

    PubMed Central

    2010-01-01

    Background Osteopetrosis is a skeletal disorder of humans and animals characterized by the formation of overly dense bones, resulting from a deficiency in the number and/or function of bone-resorbing osteoclast cells. In cattle, osteopetrosis can either be induced during gestation by viral infection of the dam, or inherited as a recessive defect. Genetically affected calves are typically aborted late in gestation, display skull deformities and exhibit a marked reduction of osteoclasts. Although mutations in several genes are associated with osteopetrosis in humans and mice, the genetic basis of the cattle disorder was previously unknown. Results We have conducted a whole-genome association analysis to identify the mutation responsible for inherited osteopetrosis in Red Angus cattle. Analysis of >54,000 SNP genotypes for each of seven affected calves and nine control animals localized the defective gene to the telomeric end of bovine chromosome 4 (BTA4). Homozygosity analysis refined the interval to a 3.4-Mb region containing the SLC4A2 gene, encoding an anion exchanger protein necessary for proper osteoclast function. Examination of SLC4A2 from normal and affected animals revealed a ~2.8-kb deletion mutation in affected calves that encompasses exon 2 and nearly half of exon 3, predicted to prevent normal protein function. Analysis of RNA from a proven heterozygous individual confirmed the presence of transcripts lacking exons 2 and 3, in addition to normal transcripts. Genotyping of additional animals demonstrated complete concordance of the homozygous deletion genotype with the osteopetrosis phenotype. Histological examination of affected tissues revealed scarce, morphologically abnormal osteoclasts displaying evidence of apoptosis. Conclusions These results indicate that a deletion mutation within bovine SLC4A2 is associated with osteopetrosis in Red Angus cattle. Loss of SLC4A2 function appears to induce premature cell death, and likely results in cytoplasmic alkalinization of osteoclasts which, in turn, may disrupt acidification of resorption lacunae. PMID:20507629

  9. Rare Genome-Wide Copy Number Variation and Expression of Schizophrenia in 22q11.2 Deletion Syndrome.

    PubMed

    Bassett, Anne S; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; van Amelsvoort, Therese; McDonald-McGinn, Donna; Gur, Raquel E; Swillen, Ann; Van den Bree, Marianne; Murphy, Kieran; Gothelf, Doron; Bearden, Carrie E; Eliez, Stephan; Kates, Wendy; Philip, Nicole; Sashi, Vandana; Campbell, Linda; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M; Simon, Tony; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R; Owen, Michael; Murphy, Clodagh; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J; Scherer, Stephen W; Emanuel, Beverly S; Guo, Tingwei; Morrow, Bernice E; Marshall, Christian R

    2017-11-01

    Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this study was to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Through an international consortium, the authors obtained DNA samples from 329 psychiatrically phenotyped subjects with 22q11.2DS. Using a high-resolution microarray platform and established methods to assess copy number variation (CNV), the authors compared the genome-wide burden of rare autosomal CNV, outside of the 22q11.2 deletion region, between two groups: a schizophrenia group and those with no psychotic disorder at age ≥25 years. The authors assessed whether genes overlapped by rare CNVs were overrepresented in functional pathways relevant to schizophrenia. Rare CNVs overlapping one or more protein-coding genes revealed significant between-group differences. For rare exonic duplications, six of 19 gene sets tested were enriched in the schizophrenia group; genes associated with abnormal nervous system phenotypes remained significant in a stepwise logistic regression model and showed significant interactions with 22q11.2 deletion region genes in a connectivity analysis. For rare exonic deletions, the schizophrenia group had, on average, more genes overlapped. The additional rare CNVs implicated known (e.g., GRM7, 15q13.3, 16p12.2) and novel schizophrenia risk genes and loci. The results suggest that additional rare CNVs overlapping genes outside of the 22q11.2 deletion region contribute to schizophrenia risk in 22q11.2DS, supporting a multigenic hypothesis for schizophrenia. The findings have implications for understanding expression of psychotic illness and herald the importance of whole-genome sequencing to appreciate the overall genomic architecture of schizophrenia.

  10. Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

    PubMed

    Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

    2011-11-01

    Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

  11. Progressive sutural cataract associated with a BFSP2 mutation in a Chinese family.

    PubMed

    Zhang, Lu; Gao, Linghan; Li, Zhijian; Qin, Wei; Gao, Weiqi; Cui, Xiaobo; Feng, Guoyin; Fu, Songbin; He, Lin; Liu, Ping

    2006-12-20

    To identify the mutation underlying the segregation of progressive sutural congenital cataracts in a four-generation Chinese pedigree. Genomic DNA was extracted from the peripheral blood samples of members of the pedigree. A genome-wide scan was performed using microsatellite markers spaced at about 10 cM intervals. Linkage analysis was carried out using a Linkage software package. Ten additional microsatellite markers for the positive region were selected for precise targeting, and haplotype data were processed using Cyrillic software to define the region of the disease gene. Mutation detection was carried out by sequencing candidate genes. Significant evidence of linkage was obtained at marker D3S1279 (LOD score [Z] =2.32, recombination fraction [theta]=0.0). Precise targeting and haplotype analysis traced the disease gene to a 38.6 cM region bounded by D3S1267 and D3S1614 at 3q21.1- q26.2 near BFSP2, which encodes a lens-specific beaded filament protein. Sequencing results revealed a 3-bp deletion of nucleotides 696-698 (GAA) in exon 3 of BFSP2, which is predicted to cause an in-frame deletion of glutamic acid residue 233 from the polypeptide encoded by the mutant gene. This deletion was seen neither in any unaffected member of the family nor in 50 unrelated control individuals. We observed progressive isolated sutural cataract associated with a deletion mutation of the BFSP2 gene in a Chinese pedigree. It highlights the physiological importance of the beaded filament protein and supports the role of BFSP2 in human cataract formation.

  12. Novel types of COMP mutations and genotype-phenotype association in pseudoachondroplasia and multiple epiphyseal dysplasia.

    PubMed

    Mabuchi, Akihiko; Manabe, Noriyo; Haga, Nobuhiko; Kitoh, Hiroshi; Ikeda, Toshiyuki; Kawaji, Hiroyuki; Tamai, Kazuya; Hamada, Junichiro; Nakamura, Shigeru; Brunetti-Pierri, Nicola; Kimizuka, Mamori; Takatori, Yoshio; Nakamura, Kozo; Nishimura, Gen; Ohashi, Hirofumi; Ikegawa, Shiro

    2003-01-01

    Mutations in the gene encoding cartilage oligomeric matrix protein ( COMP) cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). More than 40 mutations have been identified; however, genotype-phenotype relationships are not well delineated. Further, mutations other than in-frame insertion/deletions and substitutions have not been found, and currently known mutations are clustered within relatively small regions. Here we report the identification of nine novel and three recurrent COMP mutations in PSACH and MED patients. These include two novel types of mutations; the first, a gross deletion spanning an exon-intron junction, causes an exon deletion. The second, a frameshift mutation that results in a truncation of the C-terminal domain, is the first known truncating mutation in the COMP gene. The remaining mutations, other than a novel exon 18 mutation, affected highly conserved aspartate or cysteine residues in the calmodulin-like repeat (CLR) region. Genotype-phenotype analysis revealed a correlation between the position and type of mutations and the severity of short stature. Mutations in the seventh CLR produced more severe short stature compared with mutations elsewhere in the CLRs ( P=0.0003) and elsewhere in the COMP gene ( P=0.0007). Patients carrying mutations within the five-aspartates repeat (aa 469-473) in the seventh CLR were extremely short (below -6 SD). Patients with deletion mutations were significantly shorter than those with substitution mutations ( P=0.0024). These findings expand the mutation spectrum of the COMP gene and highlight genotype-phenotype relationships, facilitating improved genetic diagnosis and analysis of COMP function in humans.

  13. A Novel Deletion Mutation in the MEN1 Gene in a Patient with Prolactinoma and a Family History of Pancreatic Tumors.

    PubMed

    Kageyama, Kazunori; Usui, Takeshi; Yoshizawa, Kaori; Daimon, Makoto

    2014-09-01

    Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant tumor syndrome caused by mutations in the MEN1 gene. Mutations in this tumor suppressor gene are often associated with neuroendocrine tumors. Here we describe a novel deletion mutation at codon 304 in the MEN1 gene of a patient with a prolactinoma and strong family history of pancreatic tumors. We describe the patient's clinical course and mutational analysis and review the relevant literature. A 30-year-old pregnant female was referred to our institution's psychological department for treatment of depression. She had developed a prolactinoma at age 17 and was being treated with 1 mg/week of cabergoline. A medical interview revealed a family history of pancreatic islet cell and other tumors; her mother died of pancreatic cancer, her brother is living with gastrinoma, and her sister died of leiomyosarcoma. Extensive examinations performed after delivery, including laboratory tests and computed tomography (CT) scans, did not reveal any other tumors. Mutational analysis of the MEN1 gene identified a heterozygous deletion mutation (c911_914delAGGT) at codon 304. This mutation produces a frameshift at p.304Lys and might disturb the splicing of intron 6 due to the lack of a donor site. The predicted menin protein from the mutated allele is truncated at amino acid 328. We report a novel deletion mutation (c911_914delAGGT) in the MEN1 gene that was likely associated with the patient's prolactinoma and her strong family history of pancreatic tumors.

  14. Mutation spectrum of Chinese patients with Bartter syndrome.

    PubMed

    Han, Yue; Lin, Yi; Sun, Qing; Wang, Shujuan; Gao, Yanxia; Shao, Leping

    2017-11-24

    Bartter syndrome (BS) has been rarely reported in Chinese population except for a few case reports. This investigation was aimed to analyze the mutations of the causal genes in sixteen Chinese patients with BS, and review their followup and treatment. Identify mutations by the next generation sequencing and the multiplex ligation-dependent probe amplification (MLPA). Clinical characteristics and biochemical findings at the first presentation as well as follow-up were reviewed. 15 different CLCNKB gene mutations were identified in fourteen patients with BS, including 11 novel ones. A novel missense mutation and a novel small deletion were found from SLC12A1 gene. A novel gross deletion was found in CLCNKA gene. A recurrent missense mutation was identified from BSND gene. We found that the whole gene deletion mutation of CLCNKB gene was the most frequent mutation (32%), and the rate of gross deletion was up to 50 percent in this group of Chinese patients. The present study has found 19 mutations, including 14 novel ones, which would enrich the human gene mutation database (HGMD) and provide valuable references to the genetic counseling and diagnosis of the Chinese population.

  15. A large germline deletion in the Chek2 kinase gene is associated with an increased risk of prostate cancer

    PubMed Central

    Cybulski, C; Wokołorczyk, D; Huzarski, T; Byrski, T; Gronwald, J; Górski, B; Dębniak, T; Masojć, B; Jakubowska, A; Gliniewicz, B; Sikorski, A; Stawicka, M; Godlewski, D; Kwias, Z; Antczak, A; Krajka, K; Lauer, W; Sosnowski, M; Sikorska‐Radek, P; Bar, K; Klijer, R; Zdrojowy, R; Małkiewicz, B; Borkowski, A; Borkowski, T; Szwiec, M; Narod, S A; Lubiński, J

    2006-01-01

    Background Germline mutations in the Chek2 kinase gene (CHEK2) have been associated with a range of cancer types. Recently, a large deletion of exons 9 and 10 of CHEK2 was identified in several unrelated patients with breast cancer of Czech or Slovak origin. The geographical and ethnic extent of this founder allele has not yet been determined. Participants and methods We assayed for the presence of this deletion, and of three other CHEK2 founder mutations, in 1864 patients with prostate cancer and 5496 controls from Poland. Results The deletion was detected in 24 of 5496 (0.4%) controls from the general population, and is the most common CHEK2 truncating founder allele in Polish patients. The deletion was identified in 15 of 1864 (0.8%) men with unselected prostate cancer (OR 1.9; 95% CI 0.97 to 3.5; p = 0.09) and in 4 of 249 men with familial prostate cancer (OR 3.7; 95% CI 1.3 to 10.8; p = 0.03). These ORs were similar to those associated with the other truncating mutations (IVS2+1G→A, 1100delC). Conclusion A large deletion of exons 9 and 10 of CHEK2 confers an increased risk of prostate cancer in Polish men. The del5395 founder deletion might be present in other Slavic populations, including Ukraine, Belarus, Russia, Baltic and Balkan countries. It will be of interest to see to what extent this deletion is responsible for the burden of prostate cancer in other populations. PMID:17085682

  16. Subtelomeric deletions of chromosome 6p: molecular and cytogenetic characterization of three new cases with phenotypic overlap with Ritscher-Schinzel (3C) syndrome.

    PubMed

    Descipio, Cheryl; Schneider, Lori; Young, Terri L; Wasserman, Nora; Yaeger, Dinah; Lu, Fengmin; Wheeler, Patricia G; Williams, Marc S; Bason, Lynn; Jukofsky, Lori; Menon, Ammini; Geschwindt, Ryan; Chudley, Albert E; Saraiva, Jorge; Schinzel, Albert A G L; Guichet, Agnes; Dobyns, William E; Toutain, Annick; Spinner, Nancy B; Krantz, Ian D

    2005-04-01

    We have identified six children in three families with subtelomeric deletions of 6p25 and a recognizable phenotype consisting of ptosis, posterior embryotoxon, optic nerve abnormalities, mild glaucoma, Dandy-Walker malformation, hydrocephalus, atrial septal defect, patent ductus arteriosus, and mild mental retardation. There is considerable clinical overlap between these children and individuals with the Ritscher-Schinzel (or cranio-cerebello-cardiac (3C)) syndrome (OMIM #220210). Clinical features of 3C syndrome include craniofacial anomalies (macrocephaly, prominent forehead and occiput, foramina parietalia, hypertelorism, down-slanting palpebral fissures, ocular colobomas, depressed nasal bridge, narrow or cleft palate, and low-set ears), cerebellar malformations (variable manifestations of a Dandy-Walker malformation with moderate mental retardation), and cardiac defects (primarily septal defects). Since the original report, over 25 patients with 3C syndrome have been reported. Recessive inheritance has been postulated based on recurrence in siblings born to unaffected parents and parental consanguinity in two familial cases. Molecular and cytogenetic mapping of the 6p deletions in these three families with subtelomeric deletions of chromosome 6p have defined a 1.3 Mb minimally deleted critical region. To determine if 6p deletions are common in 3C syndrome, we analyzed seven unrelated individuals with 3C syndrome for deletions of this region. Three forkhead genes (FOXF1 and FOXQ1 from within the critical region, and FOXC1 proximal to this region) were evaluated as potential candidate disease genes for this disorder. No deletions or disease-causing mutations were identified.

  17. Detection of large scale 3′ deletions in the PMS2 gene amongst Colon-CFR participants – have we been missing anything?

    PubMed Central

    Clendenning, Mark; Walsh, Michael D; Gelpi, Judith Balmana; Thibodeau, Stephen N.; Lindor, Noralane; Potter, John D.; Newcomb, Polly; LeMarchand, Loic; Haile, Robert; Gallinger, Steve; Hopper, John L.; Jenkins, Mark A.; Rosty, Christophe; Young, Joanne P.; Buchanan, Daniel D.

    2013-01-01

    Current screening practices have been able to identify PMS2 mutations in 78% of cases of colorectal cancer from the Colorectal Cancer Family Registry (Colon CFR) which showed solitary loss of the PMS2 protein. However the detection of large-scale deletions in the 3′ end of the PMS2 gene has not been possible due to technical difficulties associated with pseudogene sequences. Here, we utilised a recently described MLPA/long-range PCR-based approach to screen the remaining 22% (n = 16) of CRC-affected probands for mutations in the 3′ end of the PMS2 gene. No deletions encompassing any or all of exons 12 through 15 were identified; therefore, our results suggest that 3′ deletions in PMS2 are not a frequent occurrence in such families. PMID:23288611

  18. Chronic lymphocytic leukemia cells with allelic deletions at 13q14 commonly have one intact RB1 gene: Evidence for a role of an adjacent locus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leu, Y.; Grander, D.; Linder, S.

    The authors have previously shown that 30% of patients with B-cell chronic lymphocytic leukemia (B-CLL) have hemizygous deletions of the retinoblastoma (RB1) gene at 13q14. RB1 gene deletions may thus participate in malignant transformation of B-CLL, but is it also possible that a neighboring gene on 13q is the relevant one. To answer this question the remaining RB1 allele of eight clones with hemizygous deletions was studied by reverse transcription-polymerase chain reaction (RT-PCR), single-strand conformation polymorphism (SSCP) analysis, and immunofluorescense techniques. Cells from 10 patients without RB1 gene deletions were also studied by these methods. Lack of RB1 mRNA andmore » RB protein expression was seen in leukemia cells from one of the patients. All other cases were found to be normal with regard to immunofluorescense, RT-PCR, and SSCP analysis, indicating at least one functional RB1 allele and supporting the importance of another gene in the 13q14 deletions. The authors then performed extended Southern blot analysis of the 13q region, using probes for 10 different loci. In 14 of 31 CLL clones (45%), deletions of a region telomeric to the RB1 gene (D13S25) were observed. In 4 of the cases the deletions were homozygous. Hemizygous deletions of the RB1 gene were observed in 11 of these patients and in one of the patients without D13S25 deletions. These data thus indicate that a gene(s) telomeric to RB1 is involved in the malignant transformation of CLL clones and that deletions of this region are a common event in this disease. 20 refs., 3 figs., 3 tabs.« less

  19. The Dean and Betty Gallo Prostate Cancer Center

    DTIC Science & Technology

    2004-07-01

    8217 Deleted: Completed 1998), / . Deleted: Clin Cancer Res, 1997 ,phase II study of 13 cis retinoic Completed: Serum TGF- beta and IGF- 30 DiPaola...t , sensitive to activation of both ER alpha and beta . Further laboratory studies by DiPaola and collaborators Deleted: identified additional... Beta -catenin regulates Cripto- and Wnt3- dependent gene expression programs in mouse axis and mesoderm formation. Development, 130: 6283-6294. 2003

  20. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

    PubMed Central

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

    2016-01-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

  1. Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

    PubMed

    La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

    2016-08-01

    Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

  2. Genetic association study identifies a functional CNV in the WWOX gene contributes to the risk of intracranial aneurysms.

    PubMed

    Fan, Jin; Sun, Wen; Lin, Min; Yu, Ke; Wang, Jian; Duan, Dan; Zheng, Bo; Yang, Zhenghui; Wang, Qingsong

    2016-03-29

    Intracranial aneurysms (IAs) accounts for 85% of hemorrhagic stroke. Genetic factors have been known to play an important role in the development of IAs. A functional CNV (CNV-67048) of human WW domain-containing oxidoreductase (WWOX), which has been identified as a tumor suppressor gene in multiple cancers, was identified to be associated with gliomas risk previously. Here, we hypothesized that the CNV-67048 could also affect susceptibility of IAs. Based on a two-stage, case- control study with a total of 976 patients of IAs and 1,200 matched healthy controls, we found the effect size for per copy deletion was 1.35 (95% CI = 1.16-1.57; Ptrend = 1.18 × 10-4). Compared with the individuals having no deletion, significantly higher risk of IAs was detected for both subjects carrying 1 copy deletion (OR = 1.24, 95% CI = 1.02-1.52) and subjects carrying 2 copy deletion (OR = 1.77, 95% CI = 1.24-2.53). Real-time PCR was used to confirm the abnormal expression of WWOX in tissues of IA patients and influence of genotypes of CNV-67048. The expression level of WWOX in IA tissues was significantly lower than that in corresponding normal tissues (P = 0.004), and the deletion genotypes of CNV-67048 have lower WWOX mRNA levels in both tumor tissues and border tissues (P < 0.01). Our data suggests that the deletion genotypes of CNV-67048 in WWOX predispose their carriers to IAs, which might be a genetic biomarker to predict risk of IAs in Chinese.

  3. Cardiac Med1 deletion promotes early lethality, cardiac remodeling, and transcriptional reprogramming

    PubMed Central

    Spitler, Kathryn M.; Ponce, Jessica M.; Oudit, Gavin Y.; Hall, Duane D.

    2017-01-01

    The mediator complex, a multisubunit nuclear complex, plays an integral role in regulating gene expression by acting as a bridge between transcription factors and RNA polymerase II. Genetic deletion of mediator subunit 1 (Med1) results in embryonic lethality, due in large part to impaired cardiac development. We first established that Med1 is dynamically expressed in cardiac development and disease, with marked upregulation of Med1 in both human and murine failing hearts. To determine if Med1 deficiency protects against cardiac stress, we generated two cardiac-specific Med1 knockout mouse models in which Med1 is conditionally deleted (Med1cKO mice) or inducibly deleted in adult mice (Med1cKO-MCM mice). In both models, cardiac deletion of Med1 resulted in early lethality accompanied by pronounced changes in cardiac function, including left ventricular dilation, decreased ejection fraction, and pathological structural remodeling. We next defined how Med1 deficiency alters the cardiac transcriptional profile using RNA-sequencing analysis. Med1cKO mice demonstrated significant dysregulation of genes related to cardiac metabolism, in particular genes that are coordinated by the transcription factors Pgc1α, Pparα, and Errα. Consistent with the roles of these transcription factors in regulation of mitochondrial genes, we observed significant alterations in mitochondrial size, mitochondrial gene expression, complex activity, and electron transport chain expression under Med1 deficiency. Taken together, these data identify Med1 as an important regulator of vital cardiac gene expression and maintenance of normal heart function. NEW & NOTEWORTHY Disruption of transcriptional gene expression is a hallmark of dilated cardiomyopathy; however, its etiology is not well understood. Cardiac-specific deletion of the transcriptional coactivator mediator subunit 1 (Med1) results in dilated cardiomyopathy, decreased cardiac function, and lethality. Med1 deletion disrupted cardiac mitochondrial and metabolic gene expression patterns. PMID:28159809

  4. An inversion inv(4)(p12-p15.3) in autistic siblings implicates the 4p GABA receptor gene cluster.

    PubMed

    Vincent, J B; Horike, S I; Choufani, S; Paterson, A D; Roberts, W; Szatmari, P; Weksberg, R; Fernandez, B; Scherer, S W

    2006-05-01

    We describe the case of two brothers diagnosed with autism who both carry a paracentic inversion of the short arm of chromosome 4 (46,XY, inv(4)(p12-p15.3)). We have determined that this inversion is inherited from an apparently unaffected mother and unaffected maternal grandfather. Methods/ Using fluorescence in situ hybridisation analysis and Southern blot hybridisation we identified the breakpoints. The proximal breakpoint (4p12) maps to a region containing a cluster of gamma-aminobutyric acid A (GABA(A)) receptor genes, and directly interrupts the GABRG1 gene, the distal-most gene of the cluster. We also identified an insertion/deletion polymorphism for a approximately 2 kb LINE1 (L1) element that occurs within intron 7 of GABRG1. Our genotype analysis amongst autism families indicated that the L1 deletion allele did not show increased transmission to affected individuals. No linkage disequilibrium was evident between the L1 and single nucleotide polymorphisms in adjacent GABA(A) receptor genes on 4p, where a recent study has identified significant association with autism. Despite this, the identification of an inversion breakpoint disrupting GABRG1 provides solid support for the genetic involvement of the short arm of chromosome 4 in the genetic aetiology of autism, and for the hypothesis of disrupted GABA neurotransmission in autism.

  5. Large deletion at the CDC73 gene locus and search for predictive markers of the presence of a CDC73 genetic lesion.

    PubMed

    Muscarella, Lucia Anna; Turchetti, Daniela; Fontana, Andrea; Baorda, Filomena; Palumbo, Orazio; la Torre, Annamaria; de Martino, Danilo; Franco, Renato; Losito, Nunzia Simona; Repaci, Andrea; Pagotto, Uberto; Cinque, Luigia; Copetti, Massimiliano; Chiofalo, Maria Grazia; Pezzullo, Luciano; Graziano, Paolo; Scillitani, Alfredo; Guarnieri, Vito

    2018-04-17

    The Hyperparathyroidism with Jaw-Tumours syndrome is caused by mutations of the CDC73 gene: it has been suggested that early onset of the disease and high Ca 2+ levels may predict the presence of a CDC73 mutation. We searched for large deletions at the CDC73 locus in patients with: HPT-JT (nr 2), atypical adenoma (nr 7) or sporadic parathyroid carcinoma (nr 11) with a specific MLPA and qRT-PCR assays applied on DNA extracted from whole blood. A Medline search in database for all the papers reporting a CDC73 gene mutation, clinical/histological diagnosis, age at onset, Ca 2+ , PTH levels for familial/sporadic cases was conducted with the aim to possibly identify biochemical/clinical markers predictive, in first diagnosis, of the presence of a CDC73 gene mutation. A novel genomic deletion of the first 10 exons of the CDC73 gene was found in a 3-generation HPT-JT family, confirmed by SNP array analysis. A classification tree built on the published data, showed the highest probability of having a CDC73 mutation in subjects with age at the onset < 41.5 years (44/47 subjects, 93.6%, had the mutation). Whereas the lowest probability was found in subjects with age at the onset ≥ 41.5 years and Ca 2+ levels <13.96 mg/dL (7/20 subjects, 35.0%, had the mutation, odds ratio = 27.1, p < 0.001). We report a novel large genomic CDC73 gene deletion identified in an Italian HPT-JT family. Age at onset < 41.5 ys and Ca 2+ > 13.96 mg/dL are predictive for the presence of a CDC73 genetic lesion.

  6. Intragenic rearrangements in X-linked intellectual deficiency: results of a-CGH in a series of 54 patients and identification of TRPC5 and KLHL15 as potential XLID genes.

    PubMed

    Mignon-Ravix, Cécile; Cacciagli, Pierre; Choucair, Nancy; Popovici, Cornel; Missirian, Chantal; Milh, Mathieu; Mégarbané, André; Busa, Tiffany; Julia, Sophie; Girard, Nadine; Badens, Catherine; Sigaudy, Sabine; Philip, Nicole; Villard, Laurent

    2014-08-01

    High-resolution array comparative genomic hybridization (a-CGH) enables the detection of intragenic rearrangements, such as single exon deletion or duplication. This approach can lead to the identification of new disease genes. We report on the analysis of 54 male patients presenting with intellectual deficiency (ID) and a family history suggesting X-linked (XL) inheritance or maternal skewed X-chromosome inactivation (XCI), using a home-made X-chromosome-specific microarray covering the whole human X-chromosome at high resolution. The majority of patients had whole genome array-CGH prior to the selection and we did not include large rearrangements such as MECP2 and FMR1 duplications. We identified four rearrangements considered as causative or potentially pathogenic, corresponding to a detection rate of 8%. Two CNVs affected known XLID genes and were therefore considered as causative (IL1RAPL1 and OPHN1 intragenic deletions). Two new CNVs were considered as potentially pathogenic as they affected interesting candidates for ID. The first CNV is a deletion of the first exon of the TRPC5 gene, encoding a cation channel implicated in dendrite growth and patterning, in a child presenting with ID and an autism spectrum disorder (ASD). The second CNV is a partial deletion of KLHL15, in a patient with severe ID, epilepsy, and anomalies of cortical development. In both cases, in spite of strong arguments for clinical relevance, we were not able at this stage to confirm pathogenicity of the mutations, and the causality of the variants identified in XLID remains to be confirmed. © 2014 Wiley Periodicals, Inc.

  7. A 3.7 Mb Deletion Encompassing ZEB2 Causes a Novel Polled and Multisystemic Syndrome in the Progeny of a Somatic Mosaic Bull

    PubMed Central

    Capitan, Aurélien; Allais-Bonnet, Aurélie; Pinton, Alain; Marquant-Le Guienne, Brigitte; Le Bourhis, Daniel; Grohs, Cécile; Bouet, Stéphan; Clément, Laëtitia; Salas-Cortes, Laura; Venot, Eric; Chaffaux, Stéphane; Weiss, Bernard; Delpeuch, Arnaud; Noé, Guy; Rossignol, Marie-Noëlle; Barbey, Sarah; Dozias, Dominique; Cobo, Emilie; Barasc, Harmonie; Auguste, Aurélie; Pannetier, Maëlle; Deloche, Marie-Christine; Lhuilier, Emeline; Bouchez, Olivier; Esquerré, Diane; Salin, Gérald; Klopp, Christophe; Donnadieu, Cécile; Chantry-Darmon, Céline; Hayes, Hélène; Gallard, Yves; Ponsart, Claire; Boichard, Didier; Pailhoux, Eric

    2012-01-01

    Polled and Multisystemic Syndrome (PMS) is a novel developmental disorder occurring in the progeny of a single bull. Its clinical spectrum includes polledness (complete agenesis of horns), facial dysmorphism, growth delay, chronic diarrhea, premature ovarian failure, and variable neurological and cardiac anomalies. PMS is also characterized by a deviation of the sex-ratio, suggesting male lethality during pregnancy. Using Mendelian error mapping and whole-genome sequencing, we identified a 3.7 Mb deletion on the paternal bovine chromosome 2 encompassing ARHGAP15, GTDC1 and ZEB2 genes. We then produced control and affected 90-day old fetuses to characterize this syndrome by histological and expression analyses. Compared to wild type individuals, affected animals showed a decreased expression of the three deleted genes. Based on a comparison with human Mowat-Wilson syndrome, we suggest that deletion of ZEB2, is responsible for most of the effects of the mutation. Finally sperm-FISH, embryo genotyping and analysis of reproduction records confirmed somatic mosaicism in the founder bull and male-specific lethality during the first third of gestation. In conclusion, we identified a novel locus involved in bovid horn ontogenesis and suggest that epithelial-to-mesenchymal transition plays a critical role in horn bud differentiation. We also provide new insights into the pathogenicity of ZEB2 loss of heterozygosity in bovine and humans and describe the first case of male-specific lethality associated with an autosomal locus in a non-murine mammalian species. This result sets PMS as a unique model to study sex-specific gene expression/regulation. PMID:23152852

  8. A deletion affecting an LRR-RLK gene co-segregates with the fruit flat shape trait in peach.

    PubMed

    López-Girona, Elena; Zhang, Yu; Eduardo, Iban; Mora, José Ramón Hernández; Alexiou, Konstantinos G; Arús, Pere; Aranzana, María José

    2017-07-27

    In peach, the flat phenotype is caused by a partially dominant allele in heterozygosis (Ss), fruits from homozygous trees (SS) abort a few weeks after fruit setting. Previous research has identified a SSR marker (UDP98-412) highly associated with the trait, found suitable for marker assisted selection (MAS). Here we report a ∼10 Kb deletion affecting the gene PRUPE.6G281100, 400 Kb upstream of UDP98-412, co-segregating with the trait. This gene is a leucine-rich repeat receptor-like kinase (LRR-RLK) orthologous to the Brassinosteroid insensitive 1-associated receptor kinase 1 (BAK1) group. PCR markers suitable for MAS confirmed its strong association with the trait in a collection of 246 cultivars. They were used to evaluate the DNA from a round fruit derived from a somatic mutation of the flat variety 'UFO-4', revealing that the mutation affected the flat associated allele (S). Protein BLAST alignment identified significant hits with genes involved in different biological processes. Best protein hit occurred with AtRLP12, which may functionally complement CLAVATA2, a key regulator that controls the stem cell population size. RT-PCR analysis revealed the absence of transcription of the partially deleted allele. The data support PRUPE.6G281100 as a candidate gene for flat shape in peach.

  9. PAX6 molecular analysis and genotype–phenotype correlations in families with aniridia from Australasia and Southeast Asia

    PubMed Central

    Rudkin, Adam K.; Dubowsky, Andrew; Casson, Robert J.; Muecke, James S.; Mancel, Erica; Whiting, Mark; Mills, Richard A.D.; Burdon, Kathryn P.; Craig, Jamie E.

    2018-01-01

    Purpose Aniridia is a congenital disorder caused by variants in the PAX6 gene. In this study, we assessed the involvement of PAX6 in patients with aniridia from Australasia and Southeast Asia. Methods Twenty-nine individuals with aniridia from 18 families originating from Australia, New Caledonia, Cambodia, Sri Lanka, and Bhutan were included. The PAX6 gene was investigated for sequence variants and analyzed for deletions with multiplex ligation-dependent probe amplification. Results We identified 11 sequence variants and six chromosomal deletions, including one in mosaic. Four deleterious sequence variants were novel: p.(Pro81HisfsTer12), p.(Gln274Ter), p.(Ile29Thr), and p.(Met1?). Ocular complications were associated with a progressive loss of visual function as shown by a visual acuity ≤ 1.00 logMAR reported in 65% of eyes. The prevalence of keratopathy was statistically significantly higher in the Australasian cohort (78.6%) compared with the Southeast Asian cohort (9.1%, p=0.002). Variants resulting in protein truncating codons displayed limited genotype–phenotype correlations compared with other variants. Conclusions PAX6 variants and deletions were identified in 94% of patients with aniridia from Australasia and Southeast Asia. This study is the first report of aniridia and variations in PAX6 in individuals from Cambodia, Sri Lanka, Bhutan, and New Caledonia, and the largest cohort from Australia. PMID:29618921

  10. A Deletion in the N-Myc Downstream Regulated Gene 1 (NDRG1) Gene in Greyhounds with Polyneuropathy

    PubMed Central

    Drögemüller, Cord; Becker, Doreen; Kessler, Barbara; Kemter, Elisabeth; Tetens, Jens; Jurina, Konrad; Hultin Jäderlund, Karin; Flagstad, Annette; Perloski, Michele; Lindblad-Toh, Kerstin; Matiasek, Kaspar

    2010-01-01

    The polyneuropathy of juvenile Greyhound show dogs shows clinical similarities to the genetically heterogeneous Charcot-Marie-Tooth (CMT) disease in humans. The pedigrees containing affected dogs suggest monogenic autosomal recessive inheritance and all affected dogs trace back to a single male. Here, we studied the neuropathology of this disease and identified a candidate causative mutation. Peripheral nerve biopsies from affected dogs were examined using semi-thin histology, nerve fibre teasing and electron microscopy. A severe chronic progressive mixed polyneuropathy was observed. Seven affected and 17 related control dogs were genotyped on the 50k canine SNP chip. This allowed us to localize the causative mutation to a 19.5 Mb interval on chromosome 13 by homozygosity mapping. The NDRG1 gene is located within this interval and NDRG1 mutations have been shown to cause hereditary motor and sensory neuropathy-Lom in humans (CMT4D). Therefore, we considered NDRG1 a positional and functional candidate gene and performed mutation analysis in affected and control Greyhounds. A 10 bp deletion in canine NDRG1 exon 15 (c.1080_1089delTCGCCTGGAC) was perfectly associated with the polyneuropathy phenotype of Greyhound show dogs. The deletion causes a frame shift (p.Arg361SerfsX60) which alters several amino acids before a stop codon is encountered. A reduced level of NDRG1 transcript could be detected by RT-PCR. Western blot analysis demonstrated an absence of NDRG1 protein in peripheral nerve biopsy of an affected Greyhound. We thus have identified a candidate causative mutation for polyneuropathy in Greyhounds and identified the first genetically characterized canine CMT model which offers an opportunity to gain further insights into the pathobiology and therapy of human NDRG1 associated CMT disease. Selection against this mutation can now be used to eliminate polyneuropathy from Greyhound show dogs. PMID:20582309

  11. Identification of single gene deletions at 15q13.3: further evidence that CHRNA7 causes the 15q13.3 microdeletion syndrome phenotype.

    PubMed

    Hoppman-Chaney, N; Wain, K; Seger, P R; Superneau, D W; Hodge, J C

    2013-04-01

    The 15q13.3 microdeletion syndrome (OMIM #612001) is characterized by a wide range of phenotypic features, including intellectual disability, seizures, autism, and psychiatric conditions. This deletion is inherited in approximately 75% of cases and has been found in mildly affected and normal parents, consistent with variable expressivity and incomplete penetrance. The common deletion is approximately 2 Mb and contains several genes; however, the gene(s) responsible for the resulting clinical features have not been clearly defined. Recently, four probands were reported with small deletions including only the CHRNA7 gene. These patients showed a wide range of phenotypic features similar to those associated with the larger 15q13.3 microdeletion. To further correlate genotype and phenotype, we queried our database of >15,000 patients tested in the Mayo Clinic Cytogenetics Laboratory from 2008 to 2011 and identified 19 individuals (10 probands and 9 family members) with isolated heterozygous CHRNA7 gene deletions. All but two infants displayed multiple features consistent with 15q13.3 microdeletion syndrome. We also identified the first de novo deletion confined to CHRNA7 as well as the second known case with homozygous deletion of CHRNA7 only. These results provide further evidence implicating CHRNA7 as the gene responsible for the clinical findings associated with 15q13.3 microdeletion. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  12. [Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

    PubMed

    Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

    2016-08-01

    To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia 1.

  13. Systematic deletion of homeobox genes in Podospora anserina uncovers their roles in shaping the fruiting body.

    PubMed

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.

  14. Systematic Deletion of Homeobox Genes in Podospora anserina Uncovers Their Roles in Shaping the Fruiting Body

    PubMed Central

    Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe

    2012-01-01

    Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures. PMID:22662159

  15. Heterogeneity in Phenotype of Usher-Congenital Hyperinsulinism Syndrome

    PubMed Central

    Al Mutair, Angham N.; Brusgaard, Klaus; Bin-Abbas, Bassam; Hussain, Khalid; Felimban, Naila; Al Shaikh, Adnan; Christesen, Henrik T.

    2013-01-01

    OBJECTIVE To evaluate the phenotype of 15 children with congenital hyperinsulinism (CHI) and profound hearing loss, known as Homozygous 11p15-p14 Deletion syndrome (MIM #606528). RESEARCH DESIGN AND METHODS Prospective clinical follow-up and genetic analysis by direct sequencing, multiplex ligation-dependent probe amplification, and microsatellite markers. RESULTS Genetic testing identified the previous described homozygous deletion in 11p15, USH1C:c.(90+592)_ABCC8:c.(2694–528)del. Fourteen patients had severe CHI demanding near-total pancreatectomy. In one patient with mild, transient neonatal hypoglycemia and nonautoimmune diabetes at age 11 years, no additional mutations were found in HNF1A, HNF4A, GCK, INS, and INSR. Retinitis pigmentosa was found in two patients aged 9 and 13 years. No patients had enteropathy or renal tubular defects. Neuromotor development ranged from normal to severe delay with epilepsy. CONCLUSIONS The phenotype of Homozygous 11p15-p14 Deletion syndrome, or Usher-CHI syndrome, includes any severity of neonatal-onset CHI and severe, sensorineural hearing loss. Retinitis pigmentosa and nonautoimmune diabetes may occur in adolescence. PMID:23150283

  16. Heterogeneity in phenotype of usher-congenital hyperinsulinism syndrome: hearing loss, retinitis pigmentosa, and hyperinsulinemic hypoglycemia ranging from severe to mild with conversion to diabetes.

    PubMed

    Al Mutair, Angham N; Brusgaard, Klaus; Bin-Abbas, Bassam; Hussain, Khalid; Felimban, Naila; Al Shaikh, Adnan; Christesen, Henrik T

    2013-03-01

    To evaluate the phenotype of 15 children with congenital hyperinsulinism (CHI) and profound hearing loss, known as Homozygous 11p15-p14 Deletion syndrome (MIM #606528). Prospective clinical follow-up and genetic analysis by direct sequencing, multiplex ligation-dependent probe amplification, and microsatellite markers. Genetic testing identified the previous described homozygous deletion in 11p15, USH1C:c.(90+592)_ABCC8:c.(2694-528)del. Fourteen patients had severe CHI demanding near-total pancreatectomy. In one patient with mild, transient neonatal hypoglycemia and nonautoimmune diabetes at age 11 years, no additional mutations were found in HNF1A, HNF4A, GCK, INS, and INSR. Retinitis pigmentosa was found in two patients aged 9 and 13 years. No patients had enteropathy or renal tubular defects. Neuromotor development ranged from normal to severe delay with epilepsy. The phenotype of Homozygous 11p15-p14 Deletion syndrome, or Usher-CHI syndrome, includes any severity of neonatal-onset CHI and severe, sensorineural hearing loss. Retinitis pigmentosa and nonautoimmune diabetes may occur in adolescence.

  17. The feasibility study based on e-commerce instructions-focuses on detection and deletion of illegal content

    NASA Astrophysics Data System (ADS)

    Guo, Tianze; Bi, Siyu; Liu, Jiaming

    2018-04-01

    This essay legally restrains the illegal content based on the e-commerce directive and introduces that the European countries detect and notify illegal content through the instructions of competent authorities, notification of credible flaggers, user reports and technical tools. The illegal content should be deleted through the service terms and transparency report basing on prevent excessive deletions system. At the same time, use filters to detect and filter to against the recurrence of illegal content. By analyzing the advantages of China under the environment of cracking down on illegal content, this essay concludes that the success of China in cracking down on illegal content lies in all-round collaborative management model of countries, governments, enterprises and individuals. At the end of the essay, one is to build a training corpus that can automatically update the ability to identify the illegal content. And it proposes an optimization scheme that establish a complete set of address resolution procedures and classify IP address data according to big data analysis and DNS protection module to prevent hackers from spreading illegal content by tampering with DNS segments.

  18. Co-inheritance of α-thalassaemia and β-thalassaemia in a prenatal screening population in mainland China.

    PubMed

    Li, Jian; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi

    2014-12-01

    To determine the prevalence of α-thalassaemia in β-thalassaemia individuals in a Chinese population. The standard diagnostic marker for β-thalassaemia was elevation of the Hb A2 level (>3.5%) with low mean corpuscular volume. The common α-thalassaemia mutations were studied by molecular analysis in all identified β-thalassaemia carriers. A prevalence rate of 3.3% for β-thalassaemia was found in our population; α- and β-thalassaemia interactions were found to co-exist in 17.8% of the β-thalassaemia carriers. The -SEA deletion was the most common α-thalassaemia mutation co-inherited with β-thalassaemia, followed by the -α3.7 deletion, the -α4.2 deletion, Hb Quong Sze, and Hb Constant Spring. Our results suggest that it could be valuable to study co-existing α-globin mutations in subjects with β-thalassaemia trait in a prenatal screening programme, especially in populations with a high prevalence of haemoglobinopathies. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  19. Bovine Polledness – An Autosomal Dominant Trait with Allelic Heterogeneity

    PubMed Central

    Medugorac, Ivica; Seichter, Doris; Graf, Alexander; Russ, Ingolf; Blum, Helmut; Göpel, Karl Heinrich; Rothammer, Sophie; Förster, Martin; Krebs, Stefan

    2012-01-01

    The persistent horns are an important trait of speciation for the family Bovidae with complex morphogenesis taking place briefly after birth. The polledness is highly favourable in modern cattle breeding systems but serious animal welfare issues urge for a solution in the production of hornless cattle other than dehorning. Although the dominant inhibition of horn morphogenesis was discovered more than 70 years ago, and the causative mutation was mapped almost 20 years ago, its molecular nature remained unknown. Here, we report allelic heterogeneity of the POLLED locus. First, we mapped the POLLED locus to a ∼381-kb interval in a multi-breed case-control design. Targeted re-sequencing of an enlarged candidate interval (547 kb) in 16 sires with known POLLED genotype did not detect a common allele associated with polled status. In eight sires of Alpine and Scottish origin (four polled versus four horned), we identified a single candidate mutation, a complex 202 bp insertion-deletion event that showed perfect association to the polled phenotype in various European cattle breeds, except Holstein-Friesian. The analysis of the same candidate interval in eight Holsteins identified five candidate variants which segregate as a 260 kb haplotype also perfectly associated with the POLLED gene without recombination or interference with the 202 bp insertion-deletion. We further identified bulls which are progeny tested as homozygous polled but bearing both, 202 bp insertion-deletion and Friesian haplotype. The distribution of genotypes of the two putative POLLED alleles in large semi-random sample (1,261 animals) supports the hypothesis of two independent mutations. PMID:22737241

  20. Molecular mapping within the mouse albino-deletion complex.

    PubMed Central

    Johnson, D K; Hand, R E; Rinchik, E M

    1989-01-01

    Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

  1. CNV-RF Is a Random Forest-Based Copy Number Variation Detection Method Using Next-Generation Sequencing.

    PubMed

    Onsongo, Getiria; Baughn, Linda B; Bower, Matthew; Henzler, Christine; Schomaker, Matthew; Silverstein, Kevin A T; Thyagarajan, Bharat

    2016-11-01

    Simultaneous detection of small copy number variations (CNVs) (<0.5 kb) and single-nucleotide variants in clinically significant genes is of great interest for clinical laboratories. The analytical variability in next-generation sequencing (NGS) and artifacts in coverage data because of issues with mappability along with lack of robust bioinformatics tools for CNV detection have limited the utility of targeted NGS data to identify CNVs. We describe the development and implementation of a bioinformatics algorithm, copy number variation-random forest (CNV-RF), that incorporates a machine learning component to identify CNVs from targeted NGS data. Using CNV-RF, we identified 12 of 13 deletions in samples with known CNVs, two cases with duplications, and identified novel deletions in 22 additional cases. Furthermore, no CNVs were identified among 60 genes in 14 cases with normal copy number and no CNVs were identified in another 104 patients with clinical suspicion of CNVs. All positive deletions and duplications were confirmed using a quantitative PCR method. CNV-RF also detected heterozygous deletions and duplications with a specificity of 50% across 4813 genes. The ability of CNV-RF to detect clinically relevant CNVs with a high degree of sensitivity along with confirmation using a low-cost quantitative PCR method provides a framework for providing comprehensive NGS-based CNV/single-nucleotide variant detection in a clinical molecular diagnostics laboratory. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  2. Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy

    PubMed Central

    Kapoor, Saketh; Bindu, Parayil Sankaran; Taly, Arun B.; Sinha, Sanjib; Gayathri, Narayanappa; Rani, S. Vasantha; Chandak, Giriraj Ratan

    2012-01-01

    Purpose Waardenburg syndrome (WS) is characterized by sensorineural hearing loss and pigmentation defects of the eye, skin, and hair. It is caused by mutations in one of the following genes: PAX3 (paired box 3), MITF (microphthalmia-associated transcription factor), EDNRB (endothelin receptor type B), EDN3 (endothelin 3), SNAI2 (snail homolog 2, Drosophila) and SOX10 (SRY-box containing gene 10). Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder caused by mutations in the DMD gene. The purpose of this study was to identify the genetic causes of WS and DMD in an Indian family with two patients: one affected with WS and DMD, and another one affected with only WS. Methods Blood samples were collected from individuals for genomic DNA isolation. To determine the linkage of this family to the eight known WS loci, microsatellite markers were selected from the candidate regions and used to genotype the family. Exon-specific intronic primers for EDN3 were used to amplify and sequence DNA samples from affected individuals to detect mutations. A mutation in DMD was identified by multiplex PCR and multiplex ligation-dependent probe amplification method using exon-specific probes. Results Pedigree analysis suggested segregation of WS as an autosomal recessive trait in the family. Haplotype analysis suggested linkage of the family to the WS4B (EDN3) locus. DNA sequencing identified a novel missense mutation p.T98M in EDN3. A deletion mutation was identified in DMD. Conclusions This study reports a novel missense mutation in EDN3 and a deletion mutation in DMD in the same Indian family. The present study will be helpful in genetic diagnosis of this family and increases the mutation spectrum of EDN3. PMID:22876130

  3. Mosaicism of an ELANE mutation in an asymptomatic mother in a familial case of cyclic neutropenia.

    PubMed

    Hirata, Osamu; Okada, Satoshi; Tsumura, Miyuki; Karakawa, Shuhei; Matsumura, Itaru; Kimura, Yujiro; Maihara, Toshiro; Yasunaga, Shin'ichiro; Takihara, Yoshihiro; Ohara, Osamu; Kobayashi, Masao

    2015-07-01

    To confirm and characterize mosaicism of the cyclic neutropenia (CyN)-related mutation in the ELANE gene identified in the asymptomatic mother of patients with CyN. We identified sibling cases with CyN due to a novel heterozygous splicing site mutation, IVS4 +5SD G>T, in the ELANE gene, resulting in an internal in-frame deletion of 30 nucleotides (corresponding to a ten amino acid deletion, V161-F170). The mutated allele was also detected in their asymptomatic mother but at low frequency. We measured the frequency of the mutant allele from peripheral blood leukocytes (PBLs) by subcloning, and confirmed the allelic frequency of mosaicism in various cell types by massively parallel DNA sequencing (MPS) analysis. In the subcloning analysis, the mutant allele was identified in 21.36 % of PBLs from the asymptomatic mother, compared with 54.72 % of PBLs from the CyN patient. In the MPS analysis, the mutant allele was observed in approximately 30 % of mononuclear cells, CD3(+) T cells, CD14(+) monocytes and the buccal mucosa. Conversely, it was detected in low frequency in polymorphonuclear leukocytes (PLMLs) (3-4 %) and CD16(+) granulocytes (2-3 %). Mosaicism of the ELANE mutation has only previously been identified in one confirmed and one unconfirmed case of SCN. This is the first report of mosaicism of the ELANE mutation in a case of CyN. The MPS results suggest that this de novo mutation occurred during the two-cell stage of embryogenesis. PLMLs expressing the ELANE mutation were found to be actively undergoing apoptosis.

  4. Genetic analysis of an Indian family with members affected with Waardenburg syndrome and Duchenne muscular dystrophy.

    PubMed

    Kapoor, Saketh; Bindu, Parayil Sankaran; Taly, Arun B; Sinha, Sanjib; Gayathri, Narayanappa; Rani, S Vasantha; Chandak, Giriraj Ratan; Kumar, Arun

    2012-01-01

    Waardenburg syndrome (WS) is characterized by sensorineural hearing loss and pigmentation defects of the eye, skin, and hair. It is caused by mutations in one of the following genes: PAX3 (paired box 3), MITF (microphthalmia-associated transcription factor), EDNRB (endothelin receptor type B), EDN3 (endothelin 3), SNAI2 (snail homolog 2, Drosophila) and SOX10 (SRY-box containing gene 10). Duchenne muscular dystrophy (DMD) is an X-linked recessive disorder caused by mutations in the DMD gene. The purpose of this study was to identify the genetic causes of WS and DMD in an Indian family with two patients: one affected with WS and DMD, and another one affected with only WS. Blood samples were collected from individuals for genomic DNA isolation. To determine the linkage of this family to the eight known WS loci, microsatellite markers were selected from the candidate regions and used to genotype the family. Exon-specific intronic primers for EDN3 were used to amplify and sequence DNA samples from affected individuals to detect mutations. A mutation in DMD was identified by multiplex PCR and multiplex ligation-dependent probe amplification method using exon-specific probes. Pedigree analysis suggested segregation of WS as an autosomal recessive trait in the family. Haplotype analysis suggested linkage of the family to the WS4B (EDN3) locus. DNA sequencing identified a novel missense mutation p.T98M in EDN3. A deletion mutation was identified in DMD. This study reports a novel missense mutation in EDN3 and a deletion mutation in DMD in the same Indian family. The present study will be helpful in genetic diagnosis of this family and increases the mutation spectrum of EDN3.

  5. LARG at chromosome 11q23 has functional characteristics of a tumor suppressor in human breast cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ong, Danny C.T.; Rudduck, Christina; Chin, Koei

    2008-05-06

    Deletion of 11q23-q24 is frequent in a diverse variety of malignancies, including breast and colorectal carcinoma, implicating the presence of a tumor suppressor gene at that chromosomal region. We show here that LARG, from 11q23, has functional characteristics of a tumor suppressor. We examined a 6-Mb region on 11q23 by high-resolution deletion mapping, utilizing both loss of heterozygosity (LOH) analysis and microarray comparative genomic hybridization (CGH). LARG (also called ARHGEF12), identified from the analyzed region, was underexpressed in 34% of primary breast carcinomas and 80% of breast cancer cell lines including the MCF-7 line. Multiplex ligation-dependent probe amplification on 30more » primary breast cancers and six breast cancer cell lines showed that LARG had the highest frequency of deletion compared to the BCSC-1 and TSLC1 genes, two known candidate tumor suppressor genes from 11q. In vitro analysis of breast cancer cell lines that underexpress LARG showed that LARG could be reactivated by trichostatin A, a histone deacetylase inhibitor, but not by 5-Aza-2{prime}-deoxycytidine, a demethylating agent. Bisulfite sequencing and quantitative high-throughput analysis of DNA methylation confirmed the lack of CpG island methylation in LARG in breast cancer. Restoration of LARG expression in MCF-7 cells by stable transfection resulted in reduced proliferation and colony formation, suggesting that LARG has functional characteristics of a tumor suppressor gene.« less

  6. Analysis of C. elegans VIG-1 expression.

    PubMed

    Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

    2008-12-31

    Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

  7. A Comprehensive Strategy for Accurate Mutation Detection of the Highly Homologous PMS2.

    PubMed

    Li, Jianli; Dai, Hongzheng; Feng, Yanming; Tang, Jia; Chen, Stella; Tian, Xia; Gorman, Elizabeth; Schmitt, Eric S; Hansen, Terah A A; Wang, Jing; Plon, Sharon E; Zhang, Victor Wei; Wong, Lee-Jun C

    2015-09-01

    Germline mutations in the DNA mismatch repair gene PMS2 underlie the cancer susceptibility syndrome, Lynch syndrome. However, accurate molecular testing of PMS2 is complicated by a large number of highly homologous sequences. To establish a comprehensive approach for mutation detection of PMS2, we have designed a strategy combining targeted capture next-generation sequencing (NGS), multiplex ligation-dependent probe amplification, and long-range PCR followed by NGS to simultaneously detect point mutations and copy number changes of PMS2. Exonic deletions (E2 to E9, E5 to E9, E8, E10, E14, and E1 to E15), duplications (E11 to E12), and a nonsense mutation, p.S22*, were identified. Traditional multiplex ligation-dependent probe amplification and Sanger sequencing approaches cannot differentiate the origin of the exonic deletions in the 3' region when PMS2 and PMS2CL share identical sequences as a result of gene conversion. Our approach allows unambiguous identification of mutations in the active gene with a straightforward long-range-PCR/NGS method. Breakpoint analysis of multiple samples revealed that recurrent exon 14 deletions are mediated by homologous Alu sequences. Our comprehensive approach provides a reliable tool for accurate molecular analysis of genes containing multiple copies of highly homologous sequences and should improve PMS2 molecular analysis for patients with Lynch syndrome. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  8. Functional Analysis of the Aspergillus nidulans Kinome

    PubMed Central

    De Souza, Colin P.; Hashmi, Shahr B.; Osmani, Aysha H.; Andrews, Peter; Ringelberg, Carol S.; Dunlap, Jay C.; Osmani, Stephen A.

    2013-01-01

    The filamentous fungi are an ecologically important group of organisms which also have important industrial applications but devastating effects as pathogens and agents of food spoilage. Protein kinases have been implicated in the regulation of virtually all biological processes but how they regulate filamentous fungal specific processes is not understood. The filamentous fungus Aspergillus nidulans has long been utilized as a powerful molecular genetic system and recent technical advances have made systematic approaches to study large gene sets possible. To enhance A. nidulans functional genomics we have created gene deletion constructs for 9851 genes representing 93.3% of the encoding genome. To illustrate the utility of these constructs, and advance the understanding of fungal kinases, we have systematically generated deletion strains for 128 A. nidulans kinases including expanded groups of 15 histidine kinases, 7 SRPK (serine-arginine protein kinases) kinases and an interesting group of 11 filamentous fungal specific kinases. We defined the terminal phenotype of 23 of the 25 essential kinases by heterokaryon rescue and identified phenotypes for 43 of the 103 non-essential kinases. Uncovered phenotypes ranged from almost no growth for a small number of essential kinases implicated in processes such as ribosomal biosynthesis, to conditional defects in response to cellular stresses. The data provide experimental evidence that previously uncharacterized kinases function in the septation initiation network, the cell wall integrity and the morphogenesis Orb6 kinase signaling pathways, as well as in pathways regulating vesicular trafficking, sexual development and secondary metabolism. Finally, we identify ChkC as a third effector kinase functioning in the cellular response to genotoxic stress. The identification of many previously unknown functions for kinases through the functional analysis of the A. nidulans kinome illustrates the utility of the A. nidulans gene deletion constructs. PMID:23505451

  9. Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

    PubMed

    Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

    2018-03-01

    Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

  10. Combined cistrome and transcriptome analysis of SKI in AML cells identifies SKI as a co-repressor for RUNX1

    PubMed Central

    Feld, Christine; Sahu, Peeyush; Frech, Miriam; Finkernagel, Florian; Nist, Andrea; Stiewe, Thorsten; Bauer, Uta-Maria; Neubauer, Andreas

    2018-01-01

    Abstract SKI is a transcriptional co-regulator and overexpressed in various human tumors, for example in acute myeloid leukemia (AML). SKI contributes to the origin and maintenance of the leukemic phenotype. Here, we use ChIP-seq and RNA-seq analysis to identify the epigenetic alterations induced by SKI overexpression in AML cells. We show that approximately two thirds of differentially expressed genes are up-regulated upon SKI deletion, of which >40% harbor SKI binding sites in their proximity, primarily in enhancer regions. Gene ontology analysis reveals that many of the differentially expressed genes are annotated to hematopoietic cell differentiation and inflammatory response, corroborating our finding that SKI contributes to a myeloid differentiation block in HL60 cells. We find that SKI peaks are enriched for RUNX1 consensus motifs, particularly in up-regulated SKI targets upon SKI deletion. RUNX1 ChIP-seq displays that nearly 70% of RUNX1 binding sites overlap with SKI peaks, mainly at enhancer regions. SKI and RUNX1 occupy the same genomic sites and cooperate in gene silencing. Our work demonstrates for the first time the predominant co-repressive function of SKI in AML cells on a genome-wide scale and uncovers the transcription factor RUNX1 as an important mediator of SKI-dependent transcriptional repression. PMID:29471413

  11. Genetic and Biochemical Analysis of High Iron Toxicity in Yeast

    PubMed Central

    Lin, Huilan; Li, Liangtao; Jia, Xuan; Ward, Diane McVey; Kaplan, Jerry

    2011-01-01

    Iron storage in yeast requires the activity of the vacuolar iron transporter Ccc1. Yeast with an intact CCC1 are resistant to iron toxicity, but deletion of CCC1 renders yeast susceptible to iron toxicity. We used genetic and biochemical analysis to identify suppressors of high iron toxicity in Δccc1 cells to probe the mechanism of high iron toxicity. All genes identified as suppressors of high iron toxicity in aerobically grown Δccc1 cells encode organelle iron transporters including mitochondrial iron transporters MRS3, MRS4, and RIM2. Overexpression of MRS3 suppressed high iron toxicity by decreasing cytosolic iron through mitochondrial iron accumulation. Under anaerobic conditions, Δccc1 cells were still sensitive to high iron toxicity, but overexpression of MRS3 did not suppress iron toxicity and did not result in mitochondrial iron accumulation. We conclude that Mrs3/Mrs4 can sequester iron within mitochondria under aerobic conditions but not anaerobic conditions. We show that iron toxicity in Δccc1 cells occurred under both aerobic and anaerobic conditions. Microarray analysis showed no evidence of oxidative damage under anaerobic conditions, suggesting that iron toxicity may not be solely due to oxidative damage. Deletion of TSA1, which encodes a peroxiredoxin, exacerbated iron toxicity in Δccc1 cells under both aerobic and anaerobic conditions, suggesting a unique role for Tsa1 in iron toxicity. PMID:21115478

  12. Attenuation of monkeypox virus by deletion of genomic regions

    USGS Publications Warehouse

    Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.

    2015-01-01

    Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.

  13. Attenuation of monkeypox virus by deletion of genomic regions.

    PubMed

    Lopera, Juan G; Falendysz, Elizabeth A; Rocke, Tonie E; Osorio, Jorge E

    2015-01-15

    Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivo studies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Methods for Mediation Analysis with Missing Data

    ERIC Educational Resources Information Center

    Zhang, Zhiyong; Wang, Lijuan

    2013-01-01

    Despite wide applications of both mediation models and missing data techniques, formal discussion of mediation analysis with missing data is still rare. We introduce and compare four approaches to dealing with missing data in mediation analysis including list wise deletion, pairwise deletion, multiple imputation (MI), and a two-stage maximum…

  15. A patient with PMP22-related hereditary neuropathy and DBH-gene-related dysautonomia.

    PubMed

    Bartoletti-Stella, Anna; Chiaro, Giacomo; Calandra-Buonaura, Giovanna; Contin, Manuela; Scaglione, Cesa; Barletta, Giorgio; Cecere, Annagrazia; Garagnani, Paolo; Tieri, Paolo; Ferrarini, Alberto; Piras, Silvia; Franceschi, Claudio; Delledonne, Massimo; Cortelli, Pietro; Capellari, Sabina

    2015-10-01

    Recurrent focal neuropathy with liability to pressure palsies is a relatively frequent autosomal-dominant demyelinating neuropathy linked to peripheral myelin protein 22 (PMP22) gene deletions. The combination of PMP22 gene mutations with other genetic variants is known to cause a more severe phenotype than expected. We present the case of a patient with severe orthostatic hypotension since 12 years of age, who inherited a PMP22 gene deletion from his father. Genetic double trouble was suspected because of selective sympathetic autonomic disturbances. Through exome-sequencing analysis, we identified two novel mutations in the dopamine beta hydroxylase gene. Moreover, with interactome analysis, we excluded a further influence on the origin of the disease by variants in other genes. This case increases the number of unique patients presenting with dopamine-β-hydroxylase deficiency and of cases with genetically proven double trouble. Finding the right, complete diagnosis is crucial to obtain adequate medical care and appropriate genetic counseling.

  16. Analysis of a genome-wide set of gene deletions in the fission yeast Schizosaccharomyces pombe

    PubMed Central

    Duhig, Trevor; Nam, Miyoung; Palmer, Georgia; Han, Sangjo; Jeffery, Linda; Baek, Seung-Tae; Lee, Hyemi; Shim, Young Sam; Lee, Minho; Kim, Lila; Heo, Kyung-Sun; Noh, Eun Joo; Lee, Ah-Reum; Jang, Young-Joo; Chung, Kyung-Sook; Choi, Shin-Jung; Park, Jo-Young; Park, Youngwoo; Kim, Hwan Mook; Park, Song-Kyu; Park, Hae-Joon; Kang, Eun-Jung; Kim, Hyong Bai; Kang, Hyun-Sam; Park, Hee-Moon; Kim, Kyunghoon; Song, Kiwon; Song, Kyung Bin; Nurse, Paul; Hoe, Kwang-Lae

    2014-01-01

    SUMMARY We report the construction and analysis of 4,836 heterozygous diploid deletion mutants covering 98.4% of the fission yeast genome. This resource provides a powerful tool for biotechnological and eukaryotic cell biology research. Comprehensive gene dispensability comparisons with budding yeast, the first time such studies have been possible between two eukaryotes, revealed that 83% of single copy orthologues in the two yeasts had conserved dispensability. Gene dispensability differed for certain pathways between the two yeasts, including mitochondrial translation and cell cycle checkpoint control. We show that fission yeast has more essential genes than budding yeast and that essential genes are more likely than non-essential genes to be single copy, broadly conserved and to contain introns. Growth fitness analyses determined sets of haploinsufficient and haploproficient genes for fission yeast, and comparisons with budding yeast identified specific ribosomal proteins and RNA polymerase subunits, which may act more generally to regulate eukaryotic cell growth. PMID:20473289

  17. Phenotypic and Molecular Convergence of 2q23.1 Deletion Syndrome with Other Neurodevelopmental Syndromes Associated with Autism Spectrum Disorder

    PubMed Central

    Mullegama, Sureni V.; Alaimo, Joseph T.; Chen, Li; Elsea, Sarah H.

    2015-01-01

    Roughly 20% of autism spectrum disorders (ASD) are syndromic with a well-established genetic cause. Studying the genes involved can provide insight into the molecular and cellular mechanisms of ASD. 2q23.1 deletion syndrome (causative gene, MBD5) is a recently identified genetic neurodevelopmental disorder associated with ASD. Mutations in MBD5 have been found in ASD cohorts. In this study, we provide a phenotypic update on the prevalent features of 2q23.1 deletion syndrome, which include severe intellectual disability, seizures, significant speech impairment, sleep disturbance, and autistic-like behavioral problems. Next, we examined the phenotypic, molecular, and network/pathway relationships between nine neurodevelopmental disorders associated with ASD: 2q23.1 deletion Rett, Angelman, Pitt-Hopkins, 2q23.1 duplication, 5q14.3 deletion, Kleefstra, Kabuki make-up, and Smith-Magenis syndromes. We show phenotypic overlaps consisting of intellectual disability, speech delay, seizures, sleep disturbance, hypotonia, and autistic-like behaviors. Molecularly, MBD5 possibly regulates the expression of UBE3A, TCF4, MEF2C, EHMT1 and RAI1. Network analysis reveals that there could be indirect protein interactions, further implicating function for these genes in common pathways. Further, we show that when MBD5 and RAI1 are haploinsufficient, they perturb several common pathways that are linked to neuronal and behavioral development. These findings support further investigations into the molecular and pathway relationships among genes linked to neurodevelopmental disorders and ASD, which will hopefully lead to common points of regulation that may be targeted toward therapeutic intervention. PMID:25853262

  18. Metachronous Medulloblastoma in a Child With Successfully Treated Neuroblastoma: Case Report and Novel Findings of DNA Sequencing.

    PubMed

    Eterovic, Agda Karina; Maher, Ossama M; Chandra, Joya; Chen, Ken; Huse, Jason; Zaky, Wafik

    2018-06-01

    Metachronous neoplasms have rarely been reported in patients with neuroblastoma. This report presents the clinical case of a 23-month-old child who was diagnosed with an anaplastic medulloblastoma 5 months after completing treatment for stage IV neuroblastoma. The patient was treated with complete surgical resection and adjuvant chemoradiation followed by maintenance chemotherapy at an outside institution and came to our institution for further management. A pathologic diagnosis and review of both the suprarenal and posterior fossa masses were performed, as well as a genetic analysis of both cerebellar tumor tissue and blood using next-generation gene sequencing. At our institution, the patient was submitted to induction chemotherapy followed by high-dose chemotherapy and autologous stem cell transplantation and remains free of disease 2 years after completion of treatment. Genetic analysis revealed multiple somatic copy number variations with most deleted genes located in 2q37, a region which harbors genes involved in epigenetic regulation and tumor suppression. A homozygous deletion was found in the TSC2 gene, which is a clinically actionable gene, and patients with activating deletions in TSC2 can potentially be eligible for basket clinical trials with mTOR inhibitors. Germline single nucleotide variants were also identified in multiple genes involved in cancer (ALK, FGFR3, FLT3/4, HNF1A, NCOR1 , and NOTCH2/3 ), cancer predisposition ( TP53, TSC1 , and BRCA1/2) , and genes involved in DNA repair ( MSH6, PMS2, POLE , and ATM ). Metachronous neoplasms are rare and challenging to treat, hence genetic analysis and referral are needed to exclude hereditary cause. DNA sequencing of the tumor and germline can help identify alterations that increase predisposition or can be used to guide treatment decisions on recurrence and when standard options fail. Copyright © 2018 by the National Comprehensive Cancer Network.

  19. The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines.

    PubMed

    Kristensen, Tatjana P; Maria Cherian, Reeja; Gray, Fiona C; MacNeill, Stuart A

    2014-01-01

    The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies.

  20. Genome wide profiling in oral squamous cell carcinoma identifies a four genetic marker signature of prognostic significance

    PubMed Central

    Vincent-Chong, Vui King; Salahshourifar, Iman; Woo, Kar Mun; Anwar, Arif; Razali, Rozaimi; Gudimella, Ranganath; Rahman, Zainal Ariff Abdul; Ismail, Siti Mazlipah; Kallarakkal, Thomas George; Ramanathan, Anand; Wan Mustafa, Wan Mahadzir; Abraham, Mannil Thomas; Tay, Keng Kiong; Zain, Rosnah Binti

    2017-01-01

    Background Cancers of the oral cavity are primarily oral squamous cell carcinomas (OSCCs). Many of the OSCCs present at late stages with an exceptionally poor prognosis. A probable limitation in management of patients with OSCC lies in the insufficient knowledge pertaining to the linkage between copy number alterations in OSCC and oral tumourigenesis thereby resulting in an inability to deliver targeted therapy. Objectives The current study aimed to identify copy number alterations (CNAs) in OSCC using array comparative genomic hybridization (array CGH) and to correlate the CNAs with clinico-pathologic parameters and clinical outcomes. Materials and methods Using array CGH, genome-wide profiling was performed on 75 OSCCs. Selected genes that were harboured in the frequently amplified and deleted regions were validated using quantitative polymerase chain reaction (qPCR). Thereafter, pathway and network functional analysis were carried out using Ingenuity Pathway Analysis (IPA) software. Results Multiple chromosomal regions including 3q, 5p, 7p, 8q, 9p, 10p, 11q were frequently amplified, while 3p and 8p chromosomal regions were frequently deleted. These findings were in confirmation with our previous study using ultra-dense array CGH. In addition, amplification of 8q, 11q, 7p and 9p and deletion of 8p chromosomal regions showed a significant correlation with clinico-pathologic parameters such as the size of the tumour, metastatic lymph nodes and pathological staging. Co-amplification of 7p, 8q, 9p and 11q regions that harbored amplified genes namely CCND1, EGFR, TPM2 and LRP12 respectively, when combined, continues to be an independent prognostic factor in OSCC. Conclusion Amplification of 3q, 5p, 7p, 8q, 9p, 10p, 11q and deletion of 3p and 8p chromosomal regions were recurrent among OSCC patients. Co-alteration of 7p, 8q, 9p and 11q was found to be associated with clinico-pathologic parameters and poor survival. These regions contain genes that play critical roles in tumourigenesis pathways. PMID:28384287

  1. Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

    PubMed Central

    Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

    2010-01-01

    Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

  2. Recurrent Distal 7q11.23 Deletion Including HIP1 and YWHAG Identified in Patients with Intellectual Disabilities, Epilepsy, and Neurobehavioral Problems

    PubMed Central

    Ramocki, Melissa B.; Bartnik, Magdalena; Szafranski, Przemyslaw; Kołodziejska, Katarzyna E.; Xia, Zhilian; Bravo, Jaclyn; Miller, G. Steve; Rodriguez, Diana L.; Williams, Charles A.; Bader, Patricia I.; Szczepanik, Elżbieta; Mazurczak, Tomasz; Antczak-Marach, Dorota; Coldwell, James G.; Akman, Cigdem I.; McAlmon, Karen; Cohen, Melinda P.; McGrath, James; Roeder, Elizabeth; Mueller, Jennifer; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Bocian, Ewa; Shaw, Chad A.; Cheung, Sau Wai; Mazurczak, Tadeusz; Stankiewicz, Paweł

    2010-01-01

    We report 26 individuals from ten unrelated families who exhibit variable expression and/or incomplete penetrance of epilepsy, learning difficulties, intellectual disabilities, and/or neurobehavioral abnormalities as a result of a heterozygous microdeletion distally adjacent to the Williams-Beuren syndrome region on chromosome 7q11.23. In six families with a common recurrent ∼1.2 Mb deletion that includes the Huntingtin-interacting protein 1 (HIP1) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (YWHAG) genes and that is flanked by large complex low-copy repeats, we identified sites for nonallelic homologous recombination in two patients. There were no cases of this ∼1.2 Mb distal 7q11.23 deletion copy number variant identified in over 20,000 control samples surveyed. Three individuals with smaller, nonrecurrent deletions (∼180–500 kb) that include HIP1 but not YWHAG suggest that deletion of HIP1 is sufficient to cause neurological disease. Mice with targeted mutation in the Hip1 gene (Hip1−/−) develop a neurological phenotype characterized by failure to thrive, tremor, and gait ataxia. Overall, our data characterize a neurodevelopmental and epilepsy syndrome that is likely caused by recurrent and nonrecurrent deletions, including HIP1. These data do not exclude the possibility that YWHAG loss of function is also sufficient to cause neurological phenotypes. Based on the current knowledge of Hip1 protein function and its proposed role in AMPA and NMDA ionotropic glutamate receptor trafficking, we believe that HIP1 haploinsufficiency in humans will be amenable to rational drug design for improved seizure control and cognitive and behavioral function. PMID:21109226

  3. Recurrent distal 7q11.23 deletion including HIP1 and YWHAG identified in patients with intellectual disabilities, epilepsy, and neurobehavioral problems.

    PubMed

    Ramocki, Melissa B; Bartnik, Magdalena; Szafranski, Przemyslaw; Kołodziejska, Katarzyna E; Xia, Zhilian; Bravo, Jaclyn; Miller, G Steve; Rodriguez, Diana L; Williams, Charles A; Bader, Patricia I; Szczepanik, Elżbieta; Mazurczak, Tomasz; Antczak-Marach, Dorota; Coldwell, James G; Akman, Cigdem I; McAlmon, Karen; Cohen, Melinda P; McGrath, James; Roeder, Elizabeth; Mueller, Jennifer; Kang, Sung-Hae L; Bacino, Carlos A; Patel, Ankita; Bocian, Ewa; Shaw, Chad A; Cheung, Sau Wai; Mazurczak, Tadeusz; Stankiewicz, Paweł

    2010-12-10

    We report 26 individuals from ten unrelated families who exhibit variable expression and/or incomplete penetrance of epilepsy, learning difficulties, intellectual disabilities, and/or neurobehavioral abnormalities as a result of a heterozygous microdeletion distally adjacent to the Williams-Beuren syndrome region on chromosome 7q11.23. In six families with a common recurrent ∼1.2 Mb deletion that includes the Huntingtin-interacting protein 1 (HIP1) and tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma (YWHAG) genes and that is flanked by large complex low-copy repeats, we identified sites for nonallelic homologous recombination in two patients. There were no cases of this ∼1.2 Mb distal 7q11.23 deletion copy number variant identified in over 20,000 control samples surveyed. Three individuals with smaller, nonrecurrent deletions (∼180-500 kb) that include HIP1 but not YWHAG suggest that deletion of HIP1 is sufficient to cause neurological disease. Mice with targeted mutation in the Hip1 gene (Hip1⁻(/)⁻) develop a neurological phenotype characterized by failure to thrive, tremor, and gait ataxia. Overall, our data characterize a neurodevelopmental and epilepsy syndrome that is likely caused by recurrent and nonrecurrent deletions, including HIP1. These data do not exclude the possibility that YWHAG loss of function is also sufficient to cause neurological phenotypes. Based on the current knowledge of Hip1 protein function and its proposed role in AMPA and NMDA ionotropic glutamate receptor trafficking, we believe that HIP1 haploinsufficiency in humans will be amenable to rational drug design for improved seizure control and cognitive and behavioral function. Copyright © 2010 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  4. [Detection of large deletions in X linked Alport syndrome using competitive multiplex fluorescence polymerase chain reaction].

    PubMed

    Wang, F; Zhang, Y Q; Ding, J; Yu, L X

    2017-10-18

    To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions removing more than 30 exons of COL4A5 gene, one large deletion removing at least 1 exon of COL4A5 gene, and one small deletion involving 13 bps. No duplication was found. Our results show that multiplex competitive fluorescence polymerase chain reaction is a good alternative to classical techniques for large deletion genotyping in X-linked Alport syndrome.

  5. The 2p21 deletion syndrome: characterization of the transcription content.

    PubMed

    Parvari, Ruti; Gonen, Yael; Alshafee, Ismael; Buriakovsky, Sophia; Regev, Kfir; Hershkovitz, Eli

    2005-08-01

    The vast majority of small-deletion syndromes are caused by haploinsufficiency of one or several genes and are transmitted as dominant traits. We have previously identified a homozygous deletion of 179,311 bp on chromosome 2p21 as the cause of a unique syndrome, inherited in a recessive mode, consisting of cystinuria, neonatal seizures, hypotonia, severe somatic and developmental delay, facial dysmorphism, and reduced activity of all the respiratory chain enzymatic complexes that are encoded in the mitochondria. We now present the transcription content of this region: Multiple splicing variants of the genes protein phosphatase 1B (formerly 2C) magnesium-dependent, beta isoform (PPM1B), SLC3A1, and KIAA0436 (approved gene symbol PREPL) were identified and their patterns of expression analyzed. The spliced variants are predicted to have additional functions compared to the known variants and their patterns of expression fit the tissues affected by the syndrome. The first exon of an additional gene (C2orf34) is encoded in the deleted region and the gene is not expressed in the patients. In addition several transcripts with very short open reading frames are also encoded in the deletion. The identification of all transcripts encoded in the region deleted in the patients is the first step in the study of the genotype-phenotype correlation of the 2p21 patients.

  6. Avoidance of pseudogene interference in the detection of 3' deletions in PMS2.

    PubMed

    Vaughn, Cecily P; Hart, Kimberly J; Samowitz, Wade S; Swensen, Jeffrey J

    2011-09-01

    Lynch syndrome is characterized by mutations in the mismatch repair genes MLH1, MSH2, MSH6, and PMS2. In PMS2, detection of mutations is confounded by numerous pseudogenes. Detection of 3' deletions is particularly complicated by the pseudogene PMS2CL, which has strong similarity to PMS2 exons 9 and 11-15, due to extensive gene conversion. A newly designed multiplex ligation-dependent probe amplification (MLPA) kit incorporates probes for variants found in both PMS2 and PMS2CL. This provides detection of deletions, but does not allow localization of deletions to the gene or pseudogene. To address this, we have developed a methodology incorporating reference samples with known copy numbers of variants, and paired MLPA results with sequencing of PMS2 and PMS2CL. We tested a subset of clinically indicated samples for which mutations were either unidentified or not fully characterized using existing methods. We identified eight unrelated patients with deletions encompassing exons 9-15, 11-15, 13-15, 14-15, and 15. By incorporating specific, characterized reference samples and sequencing the gene and pseudogene it is possible to identify deletions in this region of PMS2 and provide clinically relevant results. This methodology represents a significant advance in the diagnosis of patients with Lynch syndrome caused by PMS2 mutations. © 2011 Wiley-Liss, Inc.

  7. Mutation spectrum of Chinese patients with Bartter syndrome

    PubMed Central

    Han, Yue; Lin, Yi; Sun, Qing; Wang, Shujuan; Gao, Yanxia; Shao, Leping

    2017-01-01

    Objective Bartter syndrome (BS) has been rarely reported in Chinese population except for a few case reports. This investigation was aimed to analyze the mutations of the causal genes in sixteen Chinese patients with BS, and review their followup and treatment. Methods Identify mutations by the next generation sequencing and the multiplex ligation-dependent probe amplification (MLPA). Clinical characteristics and biochemical findings at the first presentation as well as follow-up were reviewed. Results 15 different CLCNKB gene mutations were identified in fourteen patients with BS, including 11 novel ones. A novel missense mutation and a novel small deletion were found from SLC12A1 gene. A novel gross deletion was found in CLCNKA gene. A recurrent missense mutation was identified from BSND gene. We found that the whole gene deletion mutation of CLCNKB gene was the most frequent mutation (32%), and the rate of gross deletion was up to 50 percent in this group of Chinese patients. Conclusion The present study has found 19 mutations, including 14 novel ones, which would enrich the human gene mutation database (HGMD) and provide valuable references to the genetic counseling and diagnosis of the Chinese population. PMID:29254190

  8. Molecular and biochemical identification of alien chromosome additions in shallot (Allium cepa L. Aggregatum group) carrying extra chromosome(s) of bunching onion (A. fistulosum L.).

    PubMed

    Yaguchi, Shigenori; Hang, Tran Thi Minh; Tsukazaki, Hikaru; Hoa, Vu Quynh; Masuzaki, Shin-ichi; Wako, Tadayuki; Masamura, Noriya; Onodera, Shuichi; Shiomi, Norio; Yamauchi, Naoki; Shigyo, Masayoshi

    2009-02-01

    To develop the bunching onion (Allium fistulosum L.; genomes, FF) chromosome-specific genetic markers for identifying extra chromosomes, eight shallot (A. cepa L. Aggregatum group; genomes, AA)--A. fistulosum monosomic addition plants (AA+nF) and 62 shallot--A. fistulosum single-alien deletion plants (AAF-nF) were analyzed by 23 different chromosome-specific genetic markers of shallot. The eight monosomic addition plants consisted of one AA+2F, two AA+6F, and five AA+8F. Of the 62 single-alien deletion plants, 60 could be identified as six different single-alien deletion lines (AAF-1F, -3F, -4F, -6F, -7F, and -8F) out of the eight possible types. Several single-alien deletion lines were classified on the basis of leaf and bulb characteristics. AAF-8F had the largest number of expanded leaves of five deletion plants. AAF-7F grew most vigorously, as expressed by its long leaf blade and biggest bulb size. AAF-4F had very small bulbs. AAF-7F and AAF-8F had different bulbs from those of shallot as well as other types of single-alien deletion lines in skin and outer scale color. Regarding the sugar content of the bulb tissues, the single-alien deletion lines showed higher fructan content than shallot. Moreover, shallot could not produce fructan with degree of polymerization (DP) 12 or higher, although the single-alien deletion lines showed DP 20 or higher. The content of S-alk(en)yl-L-cysteine sulfoxide (ACSO) in the single-alien deletion lines was significantly lower than that in shallot. These results indicated that chromosomes from A. fistulosum might carry anonymous factors to increase the highly polymerized fructan production and inhibit the synthesis of ACSO in shallot bulbs. Accordingly, alien chromosomes from A. fistulosum in shallot would contribute to modify the quality of shallot bulbs.

  9. Genetic Mapping of Brain Plasticity Across Development in Williams Syndrome: ERP Markers of Face and Language Processing

    PubMed Central

    Mills, D. L.; Dai, L.; Fishman, I.; Yam, A.; Appelbaum, L. G.; Galaburda, A.; Bellugi, U.; Korenberg, J. R.

    2014-01-01

    In Williams Syndrome (WS), a known genetic deletion results in atypical brain function with strengths in face and language processing. We examined how genetic influences on brain activity change with development. In three studies, ERPs from large samples of children, adolescents, and adults with the full genetic deletion for WS were compared to typically developing controls, and two adults with partial deletions for WS. Studies 1 and 2 identified ERP markers of brain plasticity in WS across development. Study 3 suggested that in adults with partial deletions for WS, specific genes may be differentially implicated in face and language processing. PMID:24219698

  10. Rapid deletion plasmid construction methods for protoplast and Agrobacterium based fungal transformation systems

    USDA-ARS?s Scientific Manuscript database

    Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...

  11. Predominance of a 6 bp deletion in exon 2 of the LDL receptor gene in Africans with familial hypercholesterolaemia

    PubMed Central

    Thiart, R.; Scholtz, C.; Vergotine, J.; Hoogendijk, C.; de Villiers, J N. P; Nissen, H.; Brusgaard, K.; Gaffney, D.; Hoffs, M.; Vermaak, W; Kotze, M.

    2000-01-01

    In South Africa, the high prevalence of familial hypercholesterolaemia (FH) among Afrikaners, Jews, and Indians as a result of founder genes is in striking contrast to its reported virtual absence in the black population in general. In this study, the molecular basis of primary hypercholesterolaemia was studied in 16 Africans diagnosed with FH. DNA analysis using three screening methods resulted in the identification of seven different mutations in the coding region of the low density lipoprotein (LDLR) gene in 10 of the patients analysed. These included a 6 bp deletion (GCGATG) accounting for 28% of defective alleles, and six point mutations (D151H, R232W, R385Q, E387K, P678L, and R793Q) detected in single families. The Sotho patient with missense mutation R232W was also heterozygous for a de novo splicing defect 313+1G→A. Several silent mutations/polymorphisms were detected in the LDLR and apolipoprotein B genes, including a base change (g→t) at nucleotide position −175 in the FP2 LDLR regulatory element. This promoter variant was detected at a significantly higher (p<0.05) frequency in FH patients compared to controls and occurred in cis with mutation E387K in one family. Analysis of four intragenic LDLR gene polymorphisms showed that the same chromosomal background was identified at this locus in the four FH patients with the 6 bp deletion. Detection of the 6 bp deletion in Xhosa, Pedi, and Tswana FH patients suggests that it is an ancient mutation predating tribal separation approximately 3000 years ago.


Keywords: apolipoprotein B; hypercholesterolaemia; low density lipoprotein receptor; mutation PMID:10882754

  12. SSCP analysis and sequencing of the human prion protein gene (PRNP) detects two different 24 bp deletions in an atypical Alzheimer`s disease family

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Perry, R.T.; Go, R.C.P.; Harrell, L.E.

    1995-02-27

    Alzheimer`s disease (AD) is a progressive, degenerative neurological disorder of the central nervous system. AD is the fourth leading cause of death in elderly persons 65 years or older in Western industrialized societies. The etiology of AD is unknown, but clinical, pathological, epidemiological, and molecular investigations suggest it is etiologically heterogeneous. Mutations in the amyloid protein are rare and segregate with the disease in a few early-onset familial AD (FAD) families. Similarities between AD and the unconventional viral (UCV) diseases, and between the amyloid and prion proteins, implicate the human prion protein gene (PRNP) as another candidate gene. Single strandmore » conformation polymorphism (SSCP) analysis was used to screen for mutations at this locus in 82 AD patients from 54 families (30 FAD), vs. 39 age-matched controls. A 24-bp deletion around codon 68 that codes for one of five Gly-Pro rich octarepeats was identified in two affected sibs and one offspring of one late-onset FAD family. Two other affected sibs, three unaffected sibs, and three offspring from this family, in addition to one sporadic AD patient and three age-matched controls, were heterozygous for another octarepeat deletion located around codon 82. Two of the four affected sibs had features of PD, including one who was autopsy-verified AD and PD. Although these deletions were found infrequently in other AD patients and controls, they appear to be a rare polymorphism that is segregating in this FAD family. It does not appear that mutations at the PRNP locus are frequently associated with AD in this population. 54 refs., 4 figs.« less

  13. Techniques for Large-Scale Bacterial Genome Manipulation and Characterization of the Mutants with Respect to In Silico Metabolic Reconstructions.

    PubMed

    diCenzo, George C; Finan, Turlough M

    2018-01-01

    The rate at which all genes within a bacterial genome can be identified far exceeds the ability to characterize these genes. To assist in associating genes with cellular functions, a large-scale bacterial genome deletion approach can be employed to rapidly screen tens to thousands of genes for desired phenotypes. Here, we provide a detailed protocol for the generation of deletions of large segments of bacterial genomes that relies on the activity of a site-specific recombinase. In this procedure, two recombinase recognition target sequences are introduced into known positions of a bacterial genome through single cross-over plasmid integration. Subsequent expression of the site-specific recombinase mediates recombination between the two target sequences, resulting in the excision of the intervening region and its loss from the genome. We further illustrate how this deletion system can be readily adapted to function as a large-scale in vivo cloning procedure, in which the region excised from the genome is captured as a replicative plasmid. We next provide a procedure for the metabolic analysis of bacterial large-scale genome deletion mutants using the Biolog Phenotype MicroArray™ system. Finally, a pipeline is described, and a sample Matlab script is provided, for the integration of the obtained data with a draft metabolic reconstruction for the refinement of the reactions and gene-protein-reaction relationships in a metabolic reconstruction.

  14. DGCR6 at the proximal part of the DiGeorge critical region is involved in conotruncal heart defects

    PubMed Central

    Gao, Wenming; Higaki, Takashi; Eguchi-Ishimae, Minenori; Iwabuki, Hidehiko; Wu, Zhouying; Yamamoto, Eiichi; Takata, Hidemi; Ohta, Masaaki; Imoto, Issei; Ishii, Eiichi; Eguchi, Mariko

    2015-01-01

    Cardiac anomaly is one of the hallmarks of DiGeorge syndrome (DGS), observed in approximately 80% of patients. It often shows a characteristic morphology, termed as conotruncal heart defects. In many cases showing only the conotruncal heart defect, deletion of 22q11.2 region cannot be detected by fluorescence in situ hybridization (FISH), which is used to detect deletion in DGS. We investigated the presence of genomic aberrations in six patients with congenital conotruncal heart defects, who show no deletion at 22q11.2 in an initial screening by FISH. In these patients, no abnormalities were identified in the coding region of the TBX1 gene, one of the key genes responsible for the phenotype of DGS. However, when copy number alteration was analyzed by high-resolution array analysis, a small deletion or duplication in the proximal end of DiGeorge critical region was detected in two patients. The affected region contains the DGCR6 and PRODH genes. DGCR6 has been reported to affect the expression of the TBX1 gene. Our results suggest that altered dosage of gene(s) other than TBX1, possibly DGCR6, may also be responsible for the development of conotruncal heart defects observed in patients with DGS and, in particular, in those with stand-alone conotruncal heart defects. PMID:27081520

  15. GM2 Gangliosidosis in Shiba Inu Dogs with an In-Frame Deletion in HEXB.

    PubMed

    Kolicheski, A; Johnson, G S; Villani, N A; O'Brien, D P; Mhlanga-Mutangadura, T; Wenger, D A; Mikoloski, K; Eagleson, J S; Taylor, J F; Schnabel, R D; Katz, M L

    2017-09-01

    Consistent with a tentative diagnosis of neuronal ceroid lipofuscinosis (NCL), autofluorescent cytoplasmic storage bodies were found in neurons from the brains of 2 related Shiba Inu dogs with a young-adult onset, progressive neurodegenerative disease. Unexpectedly, no potentially causal NCL-related variants were identified in a whole-genome sequence generated with DNA from 1 of the affected dogs. Instead, the whole-genome sequence contained a homozygous 3 base pair (bp) deletion in a coding region of HEXB. The other affected dog also was homozygous for this 3-bp deletion. Mutations in the human HEXB ortholog cause Sandhoff disease, a type of GM2 gangliosidosis. Thin-layer chromatography confirmed that GM2 ganglioside had accumulated in an affected Shiba Inu brain. Enzymatic analysis confirmed that the GM2 gangliosidosis resulted from a deficiency in the HEXB encoded protein and not from a deficiency in products from HEXA or GM2A, which are known alternative causes of GM2 gangliosidosis. We conclude that the homozygous 3-bp deletion in HEXB is the likely cause of the Shiba Inu neurodegenerative disease and that whole-genome sequencing can lead to the early identification of potentially disease-causing DNA variants thereby refocusing subsequent diagnostic analyses toward confirming or refuting candidate variant causality. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  16. Prevalence and Clinical Relevance of Exon 2 Deletion of COMMD1 in Bedlington Terriers in Korea.

    PubMed

    Kim, Y G; Kim, S Y; Kim, J H; Lee, K K; Yun, Y M

    2016-11-01

    Deletion of exon 2 of copper metabolism domain containing 1 (COMMD1) results in copper toxicosis in Bedlington terriers (CT-BT). This study was conducted to identify the prevalence and clinical relevance of the COMMD1 mutation in Bedlington terriers in Korea. A total of 105 purebred Bedlington terriers (50 males, 55 females) from the kennels and pet dog clubs in Korea were examined during the period 2008-2013. A multiplex PCR was carried out to detect exon 2 deletion of COMMD1. Clinical analysis was performed on each genetic group, and clinical status of the dogs was followed up to estimate survival probability. Of the 105 samples, 52 (49%) were wild-type homozygote, 47 (45%) were heterozygote, and 6 (6%) were mutant-type homozygote. Plasma alanine aminotransferase (ALT) activity was increased in the mutant-type homozygous group >2 years of age (P < .0001). The survival probability of 6 mutant-type homozygotes surviving 2.5 years was 0.67, and 4 years was 0.5. Results show the prevalence and clinical relevance of exon 2 deletion of COMMD1 and could help establish a structured selective breeding program to prevent CT-BT in Korea. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

  17. Prader-Willi Syndrome due to an Unbalanced de novo Translocation t(15;19)(q12;p13.3).

    PubMed

    Dang, Vy; Surampalli, Abhilasha; Manzardo, Ann M; Youn, Stephanie; Butler, Merlin G; Gold, June-Anne; Kimonis, Virginia E

    2016-01-01

    Prader-Willi syndrome (PWS) is a complex, multisystem genetic disorder characterized by endocrine, neurologic, and behavioral abnormalities. We report the first case of an unbalanced de novo reciprocal translocation of chromosomes 15 and 19, 45,XY,-15,der(19)t(15;19)(q12;p13.3), resulting in monosomy for the PWS critical chromosome region. Our patient had several typical features of PWS including infantile hypotonia, a poor suck and feeding difficulties, tantrums, skin picking, compulsions, small hands and feet, and food seeking, but not hypopigmentation, a micropenis, cryptorchidism or obesity as common findings seen in PWS at the time of examination at 6 years of age. He had seizures noted from 1 to 3 years of age and marked cognitive delay. High-resolution SNP microarray analysis identified an atypical PWS type I deletion in chromosome 15 involving the proximal breakpoint BP1. The deletion extended beyond the GABRB3 gene but was proximal to the usual distal breakpoint (BP3) within the 15q11q13 region, and GABRA5, GABRG3, and OCA2 genes were intact. No deletion of band 19p13.3 was detected; therefore, the patient was not at an increased risk of tumors from the Peutz-Jeghers syndrome associated with a deletion of the STK11 gene. © 2016 S. Karger AG, Basel.

  18. The histidine permease gene (HIP1) of Saccharomyces cerevisiae.

    PubMed

    Tanaka, J; Fink, G R

    1985-01-01

    The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.

  19. Complete Deletion of the Fucose Operon in Haemophilus influenzae Is Associated with a Cluster in Multilocus Sequence Analysis-Based Phylogenetic Group II Related to Haemophilus haemolyticus: Implications for Identification and Typing

    PubMed Central

    de Gier, Camilla; Kirkham, Lea-Ann S.

    2015-01-01

    Nonhemolytic variants of Haemophilus haemolyticus are difficult to differentiate from Haemophilus influenzae despite a wide difference in pathogenic potential. A previous investigation characterized a challenging set of 60 clinical strains using multiple PCRs for marker genes and described strains that could not be unequivocally identified as either species. We have analyzed the same set of strains by multilocus sequence analysis (MLSA) and near-full-length 16S rRNA gene sequencing. MLSA unambiguously allocated all study strains to either of the two species, while identification by 16S rRNA sequence was inconclusive for three strains. Notably, the two methods yielded conflicting identifications for two strains. Most of the “fuzzy species” strains were identified as H. influenzae that had undergone complete deletion of the fucose operon. Such strains, which are untypeable by the H. influenzae multilocus sequence type (MLST) scheme, have sporadically been reported and predominantly belong to a single branch of H. influenzae MLSA phylogenetic group II. We also found evidence of interspecies recombination between H. influenzae and H. haemolyticus within the 16S rRNA genes. Establishing an accurate method for rapid and inexpensive identification of H. influenzae is important for disease surveillance and treatment. PMID:26378279

  20. Hepatocyte-specific deletion of hepatocyte nuclear factor-4α in adult mice results in increased hepatocyte proliferation.

    PubMed

    Walesky, Chad; Gunewardena, Sumedha; Terwilliger, Ernest F; Edwards, Genea; Borude, Prachi; Apte, Udayan

    2013-01-01

    Hepatocyte nuclear factor-4α (HNF4α) is known as the master regulator of hepatocyte differentiation. Recent studies indicate that HNF4α may inhibit hepatocyte proliferation via mechanisms that have yet to be identified. Using a HNF4α knockdown mouse model based on delivery of inducible Cre recombinase via an adeno-associated virus 8 viral vector, we investigated the role of HNF4α in the regulation of hepatocyte proliferation. Hepatocyte-specific deletion of HNF4α resulted in increased hepatocyte proliferation. Global gene expression analysis showed that a majority of the downregulated genes were previously known HNF4α target genes involved in hepatic differentiation. Interestingly, ≥500 upregulated genes were associated with cell proliferation and cancer. Furthermore, we identified potential negative target genes of HNF4α, many of which are involved in the stimulation of proliferation. Using chromatin immunoprecipitation analysis, we confirmed binding of HNF4α at three of these genes. Furthermore, overexpression of HNF4α in mouse hepatocellular carcinoma cells resulted in a decrease in promitogenic gene expression and cell cycle arrest. Taken together, these data indicate that, apart from its role in hepatocyte differentiation, HNF4α actively inhibits hepatocyte proliferation by repression of specific promitogenic genes.

  1. Identification of a new variant of Chlamydia trachomatis in Mexico.

    PubMed

    Escobedo-Guerra, Marcos R; Katoku-Herrera, Mitzuko; Lopez-Hurtado, Marcela; Villagrana-Zesati, Jesus Roberto; de Haro-Cruz, María de J; Guerra-Infante, Fernando M

    2018-04-07

    Chlamydia trachomatis is one of the main etiological agents of sexually transmitted infections worldwide. In 2006, a Swedish variant of C. trachomatis (Swedish-nvCT), which has a deletion of 377bp in the plasmid, was reported. In Latin America, Swedish-nvCT infections have not been reported. We investigated the presence of Swedish-nvCT in women with infertility in Mexico. Swedish-nvCT was searched in 69C. trachomatis positive samples from 2339 endocervical specimens. We designed PCR primers to identify the deletion in the plasmid in the ORF1, and the presence of a repeated 44bp in the ORF3. The sample with the deletion was genotyped with the genes of the major outer membrane protein A (ompA) and the polymorphic membrane protein (pmpH). The deletion was detected in one of the 69 samples positive C. trachomatis of 2339 endocervical exudates. The nucleotide sequence analysis of the ompA shows a high degree of similarity with the Swedish nvCT (98%), however the variant found belongs to serovar D. The nucleotide sequence of the pmpH gene associates to the variant found in the genitourinary pathotype of the Swedish-nvCT but in different clusters. Our results revealed the presence of a new variant of C. trachomatis in Mexican patients. This variant found in Mexico belongs to serovar D based on the in silico analysis of the ompA and pmpH genes and differs to the Swedish-nvCT (serovars E). For these variants of C. trachomatis that have been found it is necessary to carry out a more detailed analysis, although the role of this mutation has not been demonstrated in the pathogenesis. Copyright © 2018 Elsevier España, S.L.U. and Sociedad Española de Enfermedades Infecciosas y Microbiología Clínica. All rights reserved.

  2. Metabolic Plasticity and Inter-Compartmental Interactions in Rice Metabolism: An Analysis from Reaction Deletion Study.

    PubMed

    Shaw, Rahul; Kundu, Sudip

    2015-01-01

    More than 20% of the total caloric intake of human population comes from rice. The expression of rice genes and hence, the concentration of enzymatic proteins might vary due to several biotic and abiotic stresses. It in turn, can influence the overall metabolism and survivability of rice plant. Thus, understanding the rice cellular metabolism, its plasticity and potential readjustments under different perturbations can help rice biotechnologists to design efficient rice cultivars. Here, using the flux balance analysis (FBA) method, with the help of in-silico reaction deletion strategy, we study the metabolic plasticity of genome-scale metabolic model of rice leaf. A set of 131 reactions, essential for the production of primary biomass precursors is identified; deletion of any of them can inhibit the overall biomass production. Usability Index (IU) for the rest of the reactions are estimated and based on this parameter, they are classified into three categories-maximally-favourable, quasi-favourable and unfavourable for the primary biomass production. The lower value of 1 - IU of a reaction suggests that the cell cannot easily bypass it for biomass production. While some of the alternative paths are energetically equally efficient, others demand for higher photon. The variations in (i) ATP/NADPH ratio, (ii) exchange of metabolites through chloroplastic transporters and (iii) total biomass production are also presented here. Mutual metabolic dependencies of different cellular compartments are also demonstrated.

  3. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups

    PubMed Central

    Curtis, Christina; Shah, Sohrab P.; Chin, Suet-Feung; Turashvili, Gulisa; Rueda, Oscar M.; Dunning, Mark J.; Speed, Doug; Lynch, Andy G.; Samarajiwa, Shamith; Yuan, Yinyin; Gräf, Stefan; Ha, Gavin; Haffari, Gholamreza; Bashashati, Ali; Russell, Roslin; McKinney, Steven; Langerød, Anita; Green, Andrew; Provenzano, Elena; Wishart, Gordon; Pinder, Sarah; Watson, Peter; Markowetz, Florian; Murphy, Leigh; Ellis, Ian; Purushotham, Arnie; Børresen-Dale, Anne-Lise; Brenton, James D.; Tavaré, Simon; Caldas, Carlos; Aparicio, Samuel

    2012-01-01

    The elucidation of breast cancer subgroups and their molecular drivers requires integrated views of the genome and transcriptome from representative numbers of patients. We present an integrated analysis of copy number and gene expression in a discovery and validation set of 997 and 995 primary breast tumours, respectively, with long-term clinical follow-up. Inherited variants (copy number variants and single nucleotide polymorphisms) and acquired somatic copy number aberrations (CNAs) were associated with expression in ~40% of genes, with the landscape dominated by cis- and trans-acting CNAs. By delineating expression outlier genes driven in cis by CNAs, we identified putative cancer genes, including deletions in PPP2R2A, MTAP and MAP2K4. Unsupervised analysis of paired DNA–RNA profiles revealed novel subgroups with distinct clinical outcomes, which reproduced in the validation cohort. These include a high-risk, oestrogen-receptor-positive 11q13/14 cis-acting subgroup and a favourable prognosis subgroup devoid of CNAs. Trans-acting aberration hotspots were found to modulate subgroup-specific gene networks, including a TCR deletion-mediated adaptive immune response in the ‘CNA-devoid’ subgroup and a basal-specific chromosome 5 deletion-associated mitotic network. Our results provide a novel molecular stratification of the breast cancer population, derived from the impact of somatic CNAs on the transcriptome. PMID:22522925

  4. Clinical utility of an array comparative genomic hybridization analysis for Williams syndrome.

    PubMed

    Yagihashi, Tatsuhiko; Torii, Chiharu; Takahashi, Reiko; Omori, Mikimasa; Kosaki, Rika; Yoshihashi, Hiroshi; Ihara, Masahiro; Minagawa-Kawai, Yasuyo; Yamamoto, Junichi; Takahashi, Takao; Kosaki, Kenjiro

    2014-11-01

    To reveal the relation between intellectual disability and the deleted intervals in Williams syndrome, we performed an array comparative genomic hybridization analysis and standardized developmental testing for 11 patients diagnosed as having Williams syndrome based on fluorescent in situ hybridization testing. One patient had a large 4.2-Mb deletion spanning distally beyond the common 1.5-Mb intervals observed in 10/11 patients. We formulated a linear equation describing the developmental age of the 10 patients with the common deletion; the developmental age of the patient with the 4.2-Mb deletion was significantly below the expectation (developmental age = 0.51 × chronological age). The large deletion may account for the severe intellectual disability; therefore, the use of array comparative genomic hybridization may provide practical information regarding individuals with Williams syndrome. © 2014 Japanese Teratology Society.

  5. Deletion endpoint allele-specificity in the developmentally regulated elimination of an internal sequence (IES) in Paramecium.

    PubMed Central

    Dubrana, K; Le Mouël, A; Amar, L

    1997-01-01

    Ciliated protozoa undergo thousands of site-specific DNA deletion events during the programmed development of micronuclear genomes to macronuclear genomes. Two deletion elements, W1 and W2, were identified in the Paramecium primaurelia wild-type 156 strain. Here, we report the characterization of both elements in wild-type strain 168 and show that they display variant deletion patterns when compared with those of strain 156. The W1 ( 168 ) element is defective for deletion. The W2 ( 168 ) element is excised utilizing two alternative boundaries on one side, both are different from the boundary utilized to excise the W2156 element. By crossing the 156 and 168 strains, we demonstrate that the definition of all deletion endpoints are each controlled by cis -acting determinant(s) rather than by strain-specific trans-acting factor(s). Sequence comparison of all deleted DNA segments indicates that the 5'-TA-3'terminal sequence is strictly required at their ends. Furthermore the identity of the first eight base pairs of these ends to a previously established consensus sequence correlates with the frequency of the corresponding deletion events. Our data implies the existence of an adaptive convergent evolution of these Paramecium deleted DNA segment end sequences. PMID:9171098

  6. Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

    PubMed

    Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

    2007-05-01

    The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

  7. Single-gene deletions that restore mating competence to diploid yeast.

    PubMed

    Schmidlin, Tom; Kaeberlein, Matt; Kudlow, Brian A; MacKay, Vivian; Lockshon, Daniel; Kennedy, Brian K

    2008-03-01

    Using the Saccharomyces cerevisiae MATa/MATalpha ORF deletion collection, homozygous deletion strains were identified that undergo mating with MATa or MATalpha haploids. Seven homozygous deletions were identified that confer enhanced mating. Three of these, lacking CTF8, CTF18, and DCC1, mate at a low frequency with either MATa or MATalpha haploids. The products of these genes form a complex involved in sister chromatid cohesion. Each of these strains also exhibits increased chromosome loss rates, and mating likely occurs due to loss of one copy of chromosome III, which bears the MAT locus. Three other homozygous diploid deletion strains, ylr193cDelta/ylr193cDelta, yor305wDelta/yor305wDelta, and ypr170cDelta/ypr170cDelta, mate at very low frequencies with haploids of either or both mating types. However, an ist3Delta/ist3Delta strain mates only with MATa haploids. It is shown that IST3, previously linked to splicing, is required for efficient processing of the MATa1 message, particularly the first intron. As a result, the ist3Delta/ist3Delta strain expresses unbalanced ratios of Matalpha to Mata proteins and therefore mates with MATa haploids. Accordingly, mating in this diploid can be repressed by introduction of a MATa1 cDNA. In summary, this study underscores and elaborates upon predicted pathways by which mutations restore mating function to yeast diploids and identifies new mutants warranting further study.

  8. Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

    PubMed

    Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

    2017-03-27

    Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

  9. Prenatal diagnosis of two fetuses with deletions of 8p23.1, critical region for congenital diaphragmatic hernia and heart defects.

    PubMed

    Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba

    2013-07-01

    Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.

  10. A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease

    PubMed Central

    Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

    2018-01-01

    Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT, and DLD genes. Among the wide range of disease-causing mutations in BCKDHB, only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient’s unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD. PMID:29740478

  11. A Novel Whole Gene Deletion of BCKDHB by Alu-Mediated Non-allelic Recombination in a Chinese Patient With Maple Syrup Urine Disease.

    PubMed

    Liu, Gang; Ma, Dingyuan; Hu, Ping; Wang, Wen; Luo, Chunyu; Wang, Yan; Sun, Yun; Zhang, Jingjing; Jiang, Tao; Xu, Zhengfeng

    2018-01-01

    Maple syrup urine disease (MSUD) is an autosomal recessive inherited metabolic disorder caused by mutations in the BCKDHA, BCKDHB, DBT , and DLD genes. Among the wide range of disease-causing mutations in BCKDHB , only one large deletion has been associated with MSUD. Compound heterozygous mutations in BCKDHB were identified in a Chinese patient with typical MSUD using next-generation sequencing, quantitative PCR, and array comparative genomic hybridization. One allele presented a missense mutation (c.391G > A), while the other allele had a large deletion; both were inherited from the patient's unaffected parents. The deletion breakpoints were characterized using long-range PCR and sequencing. A novel 383,556 bp deletion (chr6: g.80811266_81194921del) was determined, which encompassed the entire BCKDHB gene. The junction site of the deletion was localized within a homologous sequence in two AluYa5 elements. Hence, Alu-mediated non-allelic homologous recombination is speculated as the mutational event underlying the large deletion. In summary, this study reports a recombination mechanism in the BCKDHB gene causing a whole gene deletion in a newborn with MSUD.

  12. Further delineation of the 15q13 microdeletion and duplication syndromes: a clinical spectrum varying from non-pathogenic to a severe outcome.

    PubMed

    van Bon, B W M; Mefford, H C; Menten, B; Koolen, D A; Sharp, A J; Nillesen, W M; Innis, J W; de Ravel, T J L; Mercer, C L; Fichera, M; Stewart, H; Connell, L E; Ounap, K; Lachlan, K; Castle, B; Van der Aa, N; van Ravenswaaij, C; Nobrega, M A; Serra-Juhé, C; Simonic, I; de Leeuw, N; Pfundt, R; Bongers, E M; Baker, C; Finnemore, P; Huang, S; Maloney, V K; Crolla, J A; van Kalmthout, M; Elia, M; Vandeweyer, G; Fryns, J P; Janssens, S; Foulds, N; Reitano, S; Smith, K; Parkel, S; Loeys, B; Woods, C G; Oostra, A; Speleman, F; Pereira, A C; Kurg, A; Willatt, L; Knight, S J L; Vermeesch, J R; Romano, C; Barber, J C; Mortier, G; Pérez-Jurado, L A; Kooy, F; Brunner, H G; Eichler, E E; Kleefstra, T; de Vries, B B A

    2009-08-01

    Recurrent 15q13.3 microdeletions were recently identified with identical proximal (BP4) and distal (BP5) breakpoints and associated with mild to moderate mental retardation and epilepsy. To assess further the clinical implications of this novel 15q13.3 microdeletion syndrome, 18 new probands with a deletion were molecularly and clinically characterised. In addition, we evaluated the characteristics of a family with a more proximal deletion between BP3 and BP4. Finally, four patients with a duplication in the BP3-BP4-BP5 region were included in this study to ascertain the clinical significance of duplications in this region. The 15q13.3 microdeletion in our series was associated with a highly variable intra- and inter-familial phenotype. At least 11 of the 18 deletions identified were inherited. Moreover, 7 of 10 siblings from four different families also had this deletion: one had a mild developmental delay, four had only learning problems during childhood, but functioned well in daily life as adults, whereas the other two had no learning problems at all. In contrast to previous findings, seizures were not a common feature in our series (only 2 of 17 living probands). Three patients with deletions had cardiac defects and deletion of the KLF13 gene, located in the critical region, may contribute to these abnormalities. The limited data from the single family with the more proximal BP3-BP4 deletion suggest this deletion may have little clinical significance. Patients with duplications of the BP3-BP4-BP5 region did not share a recognisable phenotype, but psychiatric disease was noted in 2 of 4 patients. Overall, our findings broaden the phenotypic spectrum associated with 15q13.3 deletions and suggest that, in some individuals, deletion of 15q13.3 is not sufficient to cause disease. The existence of microdeletion syndromes, associated with an unpredictable and variable phenotypic outcome, will pose the clinician with diagnostic difficulties and challenge the commonly used paradigm in the diagnostic setting that aberrations inherited from a phenotypically normal parent are usually without clinical consequences.

  13. Assessment of the frequency of the 22q11 deletion in Afrikaner schizophrenic patients.

    PubMed

    Wiehahn, G J; Bosch, G P; du Preez, R R; Pretorius, H W; Karayiorgou, M; Roos, J L

    2004-08-15

    A hemizygous deletion of the q11 band on chromosome 22 occurs in 1 of every 5,950 live births (0.017%). The deletion is mediated by low copy repeats (LCRs) flanking this locus. Presence of the deletion is associated with variable phenotypic expression, which can include distinctive facial dysmorphologies, congenital heart disease and learning disabilities. An unusually high percentage of individuals with this deletion (25-30%) have been described to develop schizophrenia or schizoaffective disorder. In previous studies, the prevalence of the 22q11 deletion in patients with schizophrenia was found to be approximately 2% in Caucasian adults and 6% in childhood-onset cases. Both these frequencies represent a dramatic increase from the prevalence of the deletion in the general population. In this study, we investigate the occurrence of the 22q11 deletion in an independent sample of schizophrenic patients of Afrikaner origin. We first ascertained a sample of 85 patients who meet full diagnostic criteria for schizophrenia for presence of two or more of the clinical features associated with presence of the 22q11 deletion. A group of six patients (7%) met these criteria. This group was subjected to fluorescent in situ hybridization (FISH) and presence of the 22q11 deletion was confirmed for two subjects. Our study therefore confirms the previously reported rate of 2% frequency of the 22q11 deletion in adult schizophrenic patients and provides a two-stage screening protocol to identify these patients. Copyright 2004 Wiley-Liss, Inc.

  14. Islands of non-essential genes, including a DNA translocation operon, in the genome of bacteriophage 0305ϕ8-36

    PubMed Central

    Pathria, Saurav; Rolando, Mandy; Lieman, Karen; Hayes, Shirley; Hardies, Stephen; Serwer, Philip

    2012-01-01

    We investigate genes of lytic, Bacillus thuringiensis bacteriophage 0305ϕ8-36 that are non-essential for laboratory propagation, but might have a function in the wild. We isolate deletion mutants to identify these genes. The non-permutation of the genome (218.948 Kb, with a 6.479 Kb terminal repeat and 247 identified orfs) simplifies isolation of deletion mutants. We find two islands of non-essential genes. The first island (3.01% of the genomic DNA) has an informatically identified DNA translocation operon. Deletion causes no detectable growth defect during propagation in a dilute agarose overlay. Identification of the DNA translocation operon begins with a DNA relaxase and continues with a translocase and membrane-binding anchor proteins. The relaxase is in a family, first identified here, with homologs in other bacteriophages. The second deleted island (3.71% of the genome) has genes for two metallo-protein chaperonins and two tRNAs. Deletion causes a significant growth defect. In addition, (1) we find by “in situ” (in-plaque) single-particle fluorescence microscopy that adsorption to the host occurs at the tip of the 486 nm long tail, (2) we develop a procedure of 0305ϕ8-36 purification that does not cause tail contraction, and (3) we then find by electron microscopy that 0305ϕ8-36 undergoes tail tip-tail tip dimerization that potentially blocks adsorption to host cells, presumably with effectiveness that increases as the bacteriophage particle concentration increases. These observations provide an explanation of the previous observation that 0305ϕ8-36 does not lyse liquid cultures, even though 0305ϕ8-36 is genomically lytic. PMID:22666654

  15. Calpains are involved in asexual and sexual development, cell wall integrity and pathogenicity of the rice blast fungus

    PubMed Central

    Liu, Xiao-Hong; Ning, Guo-Ao; Huang, Lu-Yao; Zhao, Ya-Hui; Dong, Bo; Lu, Jian-Ping; Lin, Fu-Cheng

    2016-01-01

    Calpains are ubiquitous and well-conserved proteins that belong to the calcium-dependent, non-lysosomal cysteine protease family. In this study, 8 putative calpains were identified using Pfam domain analysis and BlastP searches in M. oryzae. Three single gene deletion mutants (ΔMocapn7, ΔMocapn9 and ΔMocapn14) and two double gene deletion mutants (ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7) were obtained using the high-throughput gene knockout system. The calpain disruption mutants showed defects in colony characteristics, conidiation, sexual reproduction and cell wall integrity. The mycelia of the ΔMocapn7, ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7 mutants showed reduced pathogenicity on rice and barley. PMID:27502542

  16. Detection of 1p36 deletion by clinical exome-first diagnostic approach.

    PubMed

    Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei

    2016-01-01

    Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis.

  17. Detection of 1p36 deletion by clinical exome-first diagnostic approach

    PubMed Central

    Watanabe, Miki; Hayabuchi, Yasunobu; Ono, Akemi; Naruto, Takuya; Horikawa, Hideaki; Kohmoto, Tomohiro; Masuda, Kiyoshi; Nakagawa, Ryuji; Ito, Hiromichi; Kagami, Shoji; Imoto, Issei

    2016-01-01

    Although chromosome 1p36 deletion syndrome is considered clinically recognizable based on characteristic features, the clinical manifestations of patients during infancy are often not consistent with those observed later in life. We report a 4-month-old girl who showed multiple congenital anomalies and developmental delay, but no clinical signs of syndromic disease caused by a terminal deletion in 1p36.32-p36.33 that was first identified by targeted-exome sequencing for molecular diagnosis. PMID:28428889

  18. Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.

    PubMed

    Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V

    1992-12-01

    Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the aniridia candidate gene (AN2) and the Wilms tumor predisposition gene (WT1). This is therefore a rare case of an inherited WAGR deletion. Wilms tumor has so far only been associated with sporadic de novo aniridia cases. We have shown that a cosmid probe for a candidate aniridia gene, homologous to the mouse Pax-6 gene, is deleted in cell lines from aniridia patients with previously characterized deletions at 11p13, while another cosmid marker mapping between two aniridia-associated translocation breakpoints (and hence a second candidate marker) is present on both chromosomes. These results support the Pax-6 homologue as a strong candidate for the AN2 gene. FISH with cosmid probes has proved to be a fast and reliable technique for the molecular analysis of deletions. It can be used with limited amounts of material and has strong potential for clinical applications.

  19. Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.

    PubMed

    Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih

    2017-01-01

    Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.

  20. Identifying Effective Signals to Predict Deleted and Suspended Accounts on Twitter across Languages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Volkova, Svitlana; Bell, Eric B.

    Social networks have an ephemerality to them where accounts and messages are constantly being edited, deleted, or marked as private. This continuous change comes from concerns around privacy, a potential desire for deception, and spam-like behavior. In this study we analyze multiple large datasets of thousands of active and deleted Twitter accounts to produce a series of predictive features for the removal or shutdown of an account. We have selected these accounts from speakers of three languages -- Russian, Spanish, and English to evaluate if speakers of various languages behave differently with regards to deleting accounts. We find that unlikemore » previously used profile and network features, the discourse of deleted vs. active accounts forms the basis for highly accurate account deletion prediction. More precisely, we observed that the presence of a certain set of terms in user tweets leads to a higher likelihood for that user's account deletion. We show that the predictive power of profile, language, affect, and network features is not consistent across speakers of the three evaluated languages.« less

  1. Cytogenetic and molecular analysis in Angelman syndrome.

    PubMed

    Zackowski, J L; Nicholls, R D; Gray, B A; Bent-Williams, A; Gottlieb, W; Harris, P J; Waters, M F; Driscoll, D J; Zori, R T; Williams, C A

    1993-04-01

    We report on cytogenetic and molecular analyses of 29 Angelman syndrome (AS) individuals ascertained in 1990 through the first National Angelman Syndrome Conference. High resolution GTG- and GBG-banded chromosomes were studied. Standard molecular analysis with six 15q11q13 DNA sequences was used to analyze copy number and parental origin of 15q11q13. Concordance between molecular and cytogenetic data was excellent. The combined data showed that 23 of the 27 probands (85%) on whom we had definitive results have deletions of the chromosome 15q11q13 region. Two classes of deletion were detected molecularly: most patients were deleted for the 5 more proximal probes, but in 2 cases the deletion extended distally to include in sixth probe. In the 13 cases where the parental origin of the deleted chromosome 15 could be established, it was maternal. There were no cases of uniparental disomy. Cytological observations of the relative sizes of the heterochromatic regions of the short arm of chromosome 15 suggested that chromosomes with large heterochromatic blocks may be more prone to de novo deletion.

  2. Mutation and deletion of the pseudoautosomal gene SHOX cause Leri-Weill dyschondrosteosis.

    PubMed

    Shears, D J; Vassal, H J; Goodman, F R; Palmer, R W; Reardon, W; Superti-Furga, A; Scambler, P J; Winter, R M

    1998-05-01

    Leri-Weill Dyschondrosteosis (LWD; OMIM 127300) is a dominantly inherited skeletal dysplasia characterized by disproportionate short stature with predominantly mesomelic limb shortening. Expression is variable and consistently more severe in females, who frequently display the Madelung deformity of the forearm (shortening and bowing of the radius with dorsal subluxation of the distal ulna). The rare Langer Mesomelic Dysplasia (LD; OMIM 249700), characterized by severe short stature with hypoplasia/aplasia of the ulna and fibula, has been postulated to be the homozygous form of LWD (refs 4-6). In a six-generation pedigree with LWD, we established linkage to the marker DXYS6814 in the pseudoautosomal region (PAR1) of the X and Y chromosomes (Z max=6.28; theta=0). Linkage analysis of three smaller pedigrees increased the lod score to 8.68 (theta=0). We identified submicroscopic PAR1 deletions encompassing the recently described short stature homeobox-containing gene SHOX (refs 7,8) segregating with the LWD phenotype in 5 families. A point mutation leading to a premature stop in exon 4 of SHOX was identified in one LWD family.

  3. Mutation detection using automated fluorescence-based sequencing.

    PubMed

    Montgomery, Kate T; Iartchouck, Oleg; Li, Li; Perera, Anoja; Yassin, Yosuf; Tamburino, Alex; Loomis, Stephanie; Kucherlapati, Raju

    2008-04-01

    The development of high-throughput DNA sequencing techniques has made direct DNA sequencing of PCR-amplified genomic DNA a rapid and economical approach to the identification of polymorphisms that may play a role in disease. Point mutations as well as small insertions or deletions are readily identified by DNA sequencing. The mutations may be heterozygous (occurring in one allele while the other allele retains the normal sequence) or homozygous (occurring in both alleles). Sequencing alone cannot discriminate between true homozygosity and apparent homozygosity due to the loss of one allele due to a large deletion. In this unit, strategies are presented for using PCR amplification and automated fluorescence-based sequencing to identify sequence variation. The size of the project and laboratory preference and experience will dictate how the data is managed and which software tools are used for analysis. A high-throughput protocol is given that has been used to search for mutations in over 200 different genes at the Harvard Medical School - Partners Center for Genetics and Genomics (HPCGG, http://www.hpcgg.org/). Copyright 2008 by John Wiley & Sons, Inc.

  4. IFRD1 Is a Candidate Gene for SMNA on Chromosome 7q22-q23

    PubMed Central

    Brkanac, Zoran; Spencer, David; Shendure, Jay; Robertson, Peggy D.; Matsushita, Mark; Vu, Tiffany; Bird, Thomas D.; Olson, Maynard V.; Raskind, Wendy H.

    2009-01-01

    We have established strong linkage evidence that supports mapping autosomal-dominant sensory/motor neuropathy with ataxia (SMNA) to chromosome 7q22-q32. SMNA is a rare neurological disorder whose phenotype encompasses both the central and the peripheral nervous system. In order to identify a gene responsible for SMNA, we have undertaken a comprehensive genomic evaluation of the region of linkage, including evaluation for repeat expansion and small deletions or duplications, capillary sequencing of candidate genes, and massively parallel sequencing of all coding exons. We excluded repeat expansion and small deletions or duplications as causative, and through microarray-based hybrid capture and massively parallel short-read sequencing, we identified a nonsynonymous variant in the human interferon-related developmental regulator gene 1 (IFRD1) as a disease-causing candidate. Sequence conservation, animal models, and protein structure evaluation support the involvement of IFRD1 in SMNA. Mutation analysis of IFRD1 in additional patients with similar phenotypes is needed for demonstration of causality and further evaluation of its importance in neurological diseases. PMID:19409521

  5. Whole-genome copy number variation analysis in anophthalmia and microphthalmia.

    PubMed

    Schilter, K F; Reis, L M; Schneider, A; Bardakjian, T M; Abdul-Rahman, O; Kozel, B A; Zimmerman, H H; Broeckel, U; Semina, E V

    2013-11-01

    Anophthalmia/microphthalmia (A/M) represent severe developmental ocular malformations. Currently, mutations in known genes explain less than 40% of A/M cases. We performed whole-genome copy number variation analysis in 60 patients affected with isolated or syndromic A/M. Pathogenic deletions of 3q26 (SOX2) were identified in four independent patients with syndromic microphthalmia. Other variants of interest included regions with a known role in human disease (likely pathogenic) as well as novel rearrangements (uncertain significance). A 2.2-Mb duplication of 3q29 in a patient with non-syndromic anophthalmia and an 877-kb duplication of 11p13 (PAX6) and a 1.4-Mb deletion of 17q11.2 (NF1) in two independent probands with syndromic microphthalmia and other ocular defects were identified; while ocular anomalies have been previously associated with 3q29 duplications, PAX6 duplications, and NF1 mutations in some cases, the ocular phenotypes observed here are more severe than previously reported. Three novel regions of possible interest included a 2q14.2 duplication which cosegregated with microphthalmia/microcornea and congenital cataracts in one family, and 2q21 and 15q26 duplications in two additional cases; each of these regions contains genes that are active during vertebrate ocular development. Overall, this study identified causative copy number mutations and regions with a possible role in ocular disease in 17% of A/M cases. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  6. Whole-genome copy number variation analysis in anophthalmia and microphthalmia

    PubMed Central

    Schilter, Kala F.; Reis, Linda M.; Schneider, Adele; Bardakjian, Tanya M.; Abdul-Rahman, Omar; Kozel, Beth A.; Zimmerman, Holly H.; Broeckel, Ulrich; Semina, Elena V.

    2014-01-01

    Anophthalmia and microphthalmia (A/M) represent severe developmental ocular malformations. Currently, mutations in known genes explain less than 40% of A/M cases. We performed whole genome copy number variation analysis in sixty patients affected with isolated or syndromic A/M. Pathogenic deletions of 3q26 (SOX2) were identified in four independent patients with syndromic microphthalmia. Other variants of interest included regions with a known role in human disease (likely pathogenic) as well as novel rearrangements (uncertain significance). A 2.2-Mb duplication of 3q29 in a patient with nonsyndromic anophthalmia and an 877-kb duplication of 11p13 (PAX6) and a 1.4-Mb deletion of 17q11.2 (NF1) in two independent probands with syndromic microphthalmia and other ocular defects were identified; while ocular anomalies have been previously associated with 3q29 duplications, PAX6 duplications, and NF1 mutations in some cases, the ocular phenotypes observed here are more severe than previously reported. Three novel regions of possible interest included a 2q14.2 duplication which cosegregated with microphthalmia/microcornea and congenital cataracts in one family, and 2q21 and 15q26 duplications in two additional cases; each of these regions contains genes that are active during vertebrate ocular development. Overall, this study identified causative copy number mutations and regions with a possible role in ocular disease in 17% of A/M cases. PMID:23701296

  7. A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease.

    PubMed

    Zhang, Xiaoqing; Xu, Yuejuan; Liu, Deyuan; Geng, Juan; Chen, Sun; Jiang, Zhengwen; Fu, Qihua; Sun, Kun

    2015-05-08

    Copy number variations (CNVs) of chromosomal region 22q11.2 are associated with a subset of patients with congenital heart disease (CHD). Accurate and efficient detection of CNV is important for genetic analysis of CHD. The aim of the study was to introduce a novel approach named CNVplex®, a high-throughput analysis technique designed for efficient detection of chromosomal CNVs, and to explore the prevalence of sub-chromosomal imbalances in 22q11.2 loci in patients with CHD from a single institute. We developed a novel technique, CNVplex®, for high-throughput detection of sub-chromosomal copy number aberrations. Modified from the multiplex ligation-dependent probe amplification (MLPA) method, it introduced a lengthening ligation system and four universal primer sets, which simplified the synthesis of probes and significantly improved the flexibility of the experiment. We used 110 samples, which were extensively characterized with chromosomal microarray analysis and MLPA, to validate the performance of the newly developed method. Furthermore, CNVplex® was used to screen for sub-chromosomal imbalances in 22q11.2 loci in 818 CHD patients consecutively enrolled from Shanghai Children's Medical Center. In the methodology development phase, CNVplex® detected all copy number aberrations that were previously identified with both chromosomal microarray analysis and MLPA, demonstrating 100% sensitivity and specificity. In the validation phase, 22q11.2 deletion and 22q11.2 duplication were detected in 39 and 1 of 818 patients with CHD by CNVplex®, respectively. Our data demonstrated that the frequency of 22q11.2 deletion varied among sub-groups of CHD patients. Notably, 22q11.2 deletion was more commonly observed in cases with conotruncal defect (CTD) than in cases with non-CTD (P<0.001). With higher resolution and more probes against selected chromosomal loci, CNVplex® also identified several individuals with small CNVs and alterations in other chromosomes. CNVplex® is sensitive and specific in its detection of CNVs, and it is an alternative to MLPA for batch screening of pathogenetic CNVs in known genomic loci.

  8. Genetic modifiers of Velo- cardio- facial syndrome/DiGeorge syndrome

    PubMed Central

    Aggarwal, Vimla S.; Morrow, Bernice E.

    2009-01-01

    Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that Tbx1, a T- box containing transcription factor present on the deleted region, is likely responsible for the etiology of the syndrome. Furthermore, mutations in TBX1 have been found in rare non-deleted patients. Despite having the same sized deletion, most VCFS/DGS patients exhibit significant clinical variability. Stochastic, environmental and genetic factors likely modify the phenotype of patients with the disorder. Here, we review mouse genetics studies which may help identify genetic modifiers for VCFS/DGS. PMID:18636633

  9. A method for rapid, targeted CNV genotyping identifies rare variants associated with neurocognitive disease.

    PubMed

    Mefford, Heather C; Cooper, Gregory M; Zerr, Troy; Smith, Joshua D; Baker, Carl; Shafer, Neil; Thorland, Erik C; Skinner, Cindy; Schwartz, Charles E; Nickerson, Deborah A; Eichler, Evan E

    2009-09-01

    Copy-number variants (CNVs) are substantial contributors to human disease. A central challenge in CNV-disease association studies is to characterize the pathogenicity of rare and possibly incompletely penetrant events, which requires the accurate detection of rare CNVs in large numbers of individuals. Cost and throughput issues limit our ability to perform these studies. We have adapted the Illumina BeadXpress SNP genotyping assay and developed an algorithm, SNP-Conditional OUTlier detection (SCOUT), to rapidly and accurately detect both rare and common CNVs in large cohorts. This approach is customizable, cost effective, highly parallelized, and largely automated. We applied this method to screen 69 loci in 1105 children with unexplained intellectual disability, identifying pathogenic variants in 3.1% of these individuals and potentially pathogenic variants in an additional 2.3%. We identified seven individuals (0.7%) with a deletion of 16p11.2, which has been previously associated with autism. Our results widen the phenotypic spectrum of these deletions to include intellectual disability without autism. We also detected 1.65-3.4 Mbp duplications at 16p13.11 in 1.1% of affected individuals and 350 kbp deletions at 15q11.2, near the Prader-Willi/Angelman syndrome critical region, in 0.8% of affected individuals. Compared to published CNVs in controls they are significantly (P = 4.7 x 10(-5) and 0.003, respectively) enriched in these children, supporting previously published hypotheses that they are neurocognitive disease risk factors. More generally, this approach offers a previously unavailable balance between customization, cost, and throughput for analysis of CNVs and should prove valuable for targeted CNV detection in both research and diagnostic settings.

  10. Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

    PubMed

    Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

    1996-03-01

    In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

  11. Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

    PubMed

    Möller, M; Hellberg, Å; Olsson, M L

    2018-02-01

    ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

  12. Molecular and clinical characterization of two patients with Prader-Willi syndrome and atypical deletions of proximal chromosome 15q.

    PubMed

    Calounova, Gabriela; Hedvicakova, Petra; Silhanova, Eva; Kreckova, Gabriela; Sedlacek, Zdenek

    2008-08-01

    Prader-Willi syndrome (PWS) is caused by the disturbed expression of genes from the imprinted region of 15q11-q13, but the specific contributions of individual genes remain unknown. Most paternal PWS deletions are bracketed by recurrent breakpoints BP1 or BP2 and BP3. Atypical deletions are very rare. In the present work, we describe the molecular analysis of two patients with atypical deletions using microsatellite analysis, methylation-specific MLPA, and microarray CGH. A deletion of about 2 Mb in Patient 1 started at BP2 and ended in the middle of the typically deleted region within the UBE3A gene. The deletion in Patient 2 started 1.3 Mb distal from BP2 within the C15ORF2 gene, extended over 9.5 Mb, and ended within the AVEN gene in proximal 15q14. In Patient 1 both deletion breakpoints involved repetitive regions, which precluded cloning of the junction and pointed to non-allelic homologous recombination as a possible mechanism of this rearrangement. The breakpoints in Patient 2 were sequenced, and their structure suggested non-homologous end joining as the most likely cause of this deletion. The phenotype of both patients did not depart significantly from the typical clinical picture of PWS, although some symptoms in Patient 2 were also reminiscent of the phenotype of individuals with the recently described 15q13.3 microdeletion syndrome. Our findings support previous observations of relatively mild phenotypic effects resulting from deletions that extend distally from the PWS region and observations of the modest effects of different types of genetic defects on the spectrum and severity of symptoms in PWS. Copyright 2008 Wiley-Liss, Inc.

  13. Increased Sensitivity of Diagnostic Mutation Detection by Re-analysis Incorporating Local Reassembly of Sequence Reads.

    PubMed

    Watson, Christopher M; Camm, Nick; Crinnion, Laura A; Clokie, Samuel; Robinson, Rachel L; Adlard, Julian; Charlton, Ruth; Markham, Alexander F; Carr, Ian M; Bonthron, David T

    2017-12-01

    Diagnostic genetic testing programmes based on next-generation DNA sequencing have resulted in the accrual of large datasets of targeted raw sequence data. Most diagnostic laboratories process these data through an automated variant-calling pipeline. Validation of the chosen analytical methods typically depends on confirming the detection of known sequence variants. Despite improvements in short-read alignment methods, current pipelines are known to be comparatively poor at detecting large insertion/deletion mutations. We performed clinical validation of a local reassembly tool, ABRA (assembly-based realigner), through retrospective reanalysis of a cohort of more than 2000 hereditary cancer cases. ABRA enabled detection of a 96-bp deletion, 4-bp insertion mutation in PMS2 that had been initially identified using a comparative read-depth approach. We applied an updated pipeline incorporating ABRA to the entire cohort of 2000 cases and identified one previously undetected pathogenic variant, a 23-bp duplication in PTEN. We demonstrate the effect of read length on the ability to detect insertion/deletion variants by comparing HiSeq2500 (2 × 101-bp) and NextSeq500 (2 × 151-bp) sequence data for a range of variants and thereby show that the limitations of shorter read lengths can be mitigated using appropriate informatics tools. This work highlights the need for ongoing development of diagnostic pipelines to maximize test sensitivity. We also draw attention to the large differences in computational infrastructure required to perform day-to-day versus large-scale reprocessing tasks.

  14. Alu-mediated recombination defect in IGF1R: haploinsufficiency in a patient with short stature.

    PubMed

    Harmel, Eva-Maria; Binder, Gerhard; Barnikol-Oettler, Anja; Caliebe, Janina; Kiess, Wieland; Losekoot, Monique; Ranke, Michael B; Rappold, Gudrun A; Schlicke, Marina; Stobbe, Heike; Wit, Jan M; Pfäffle, Roland; Klammt, Jürgen

    2013-01-01

    The insulin-like growth factor (IGF) receptor (IGF1R) is essential for normal development and growth. IGF1R mutations cause IGF-1 resistance resulting in intrauterine and postnatal growth failure. The phenotypic spectrum related to IGF1R mutations remains to be fully understood. Auxological and endocrinological data of a patient identified previously were assessed. The patient's fibroblasts were studied to characterize the IGF1R deletion, mRNA fate, protein expression and signalling capabilities. The boy, who carries a heterozygous IGF1R exon 6 deletion caused by Alu element-mediated recombination and a heterozygous SHOX variant (p.Met240Ile), was born appropriate for gestational age but developed proportionate short stature postnatally. IGF-1 levels were low-normal. None of the stigmata associated with SHOX deficiency or sporadically observed in IGF1R mutation carriers were present. Nonsense-mediated mRNA decay led to a substantial decline of IGF1R dosage and IGF-1-dependent receptor autophosphorylation but not impaired downstream signalling. We present the first detailed report of an intragenic IGF1R deletion identified in a patient who, apart from short stature, deviates from all established markers that qualify a growth-retarded child for IGF1R analysis. Although such children will usually escape routine clinical mutation screenings, they can contribute to the understanding of factors and mechanisms that cooperate with the IGF1R. © 2013 S. Karger AG, Basel.

  15. Human retinoblastoma susceptibility gene: genomic organization and analysis of heterozygous intragenic deletion mutants.

    PubMed Central

    Bookstein, R; Lee, E Y; To, H; Young, L J; Sery, T W; Hayes, R C; Friedmann, T; Lee, W H

    1988-01-01

    A gene in chromosome region 13q14 has been identified as the human retinoblastoma susceptibility (RB) gene on the basis of altered gene expression found in virtually all retinoblastomas. In order to further characterize the RB gene and its structural alterations, we examined genomic clones of the RB gene isolated from both a normal human genomic library and a library made from DNA of the retinoblastoma cell line Y79. First, a restriction and exon map of the RB gene was constructed by aligning overlapping genomic clones, yielding three contiguous regions ("contigs") of 150 kilobases total length separated by two gaps. At least 20 exons were identified in genomic clones, and these were provisionally numbered. Second, two overlapping genomic clones that demonstrated a DNA deletion of exons 2 through 6 from one RB allele were isolated from the Y79 library. To confirm and extend this result, a unique sequence probe from intron 1 was used to detect similar and possibly identical heterozygous deletions in genomic DNA from three retinoblastoma cell lines, thereby explaining the origins of their shortened RB mRNA transcripts. The same probe detected genomic rearrangements in fibroblasts from two hereditary retinoblastoma patients, indicating that intron 1 includes a frequent site for mutations conferring predisposition to retinoblastoma. Third, this probe also detected a polymorphic site for BamHI with allele frequencies near 0.5/0.5. Identification of commonly mutated regions will contribute significantly to genetic diagnosis in retinoblastoma patients and families. Images PMID:2895471

  16. Osteogenesis imperfecta type I: second-trimester diagnosis and incidental identification of a dominant COL1A1 deletion mutation in the paucisymptomatic father.

    PubMed

    Chen, Chih-Ping; Su, Yi-Ning; Chang, Tung-Yao; Chern, Schu-Rern; Chen, Chen-Yu; Su, Jun-Wei; Wang, Wayseen

    2012-06-01

    To present second-trimester ultrasound and molecular diagnosis for osteogenesis imperfecta (OI) type I in a female fetus and incidental identification of a dominant COL1A1 deletion mutation in her paucisymptomatic father. A 30-year-old, primigravid woman was referred for genetic counseling in the second trimester because of bowing of the fetal lower limbs. She and her husband were non-consanguineous, and there was no family history of skeletal dysplasias. Prenatal ultrasound at 22 weeks of gestation revealed short and curved right femur and left tibia, and a short left fibula. The lengths of other long bones were normal. The husband was 158 cm tall, had blue sclerae, a history of habitual subluxation and dislocation of bilateral elbows and left knee, and an episode of left ulna fracture, and was not aware of his being affected with OI type I. The woman underwent amniocentesis. Cytogenetic analysis revealed a karyotype of 46,XX. Molecular analysis of the amniocytes revealed a heterozygous deletion mutation of c.1064_1068delCTGGT in exon 17 of the COL1A1 gene. By genetic testing the husband was found to carry the same mutation. Despite counseling of favorable outcome for OI type I with the parents, the woman elected to terminate the pregnancy. Postnatal skeletal X-ray findings were consistent with OI type I. Prenatal ultrasound diagnosis of mild forms of OI should include molecular analysis of type I collagen genes in both fetus and parents. Molecular genetic analysis of the family may incidentally identify a collagen gene mutation in the paucisymptomatic affected parent. Copyright © 2012. Published by Elsevier B.V.

  17. 76 FR 8352 - Privacy Act of 1974; System of Records

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-02-14

    ... agency or component from which there is specific retrieval of information using a personal identifier (i...; System of Records AGENCY: Defense Information Systems Agency, DoD. ACTION: Notice to delete three systems of records. SUMMARY: The Defense Information Systems Agency is deleting three systems of records...

  18. 75 FR 54115 - Procurement List: Proposed Additions and Deletions

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-03

    ... proposing to add services to the Procurement List that will be furnished by nonprofit agencies employing persons who are blind or have other severe disabilities and to delete products previously furnished by... Government identified in this notice will be required to procure the services listed below from nonprofit...

  19. Bcgitis and vaccine-derived poliovirus infection in a patient with a novel deletion in RAG1 binding site.

    PubMed

    Canessa, C; Romano, F; Lippi, F; Bianchi, L; Kashef, S; Rezaei, N; Moriondo, M; Nieddu, F; Martini, M; Azzari, C

    2013-01-01

    A girl who developed severe BCGitis and vaccine-derived poliovirus infection was discovered to have a novel deletion of RAG1. A neonatal screening program for SCID would identify affected infants at birth, before live vaccines are administered.

  20. A SHORT SEQUENCE IMMEDIATELY UPSTREAM OF THE INTERNAL REPEAT ELEMENTS IS CRITICAL FOR KSHV LANA MEDIATED DNA REPLICATION AND IMPACTS EPISOME PERSISTENCE

    PubMed Central

    León Vázquez, Erika De; Juillard, Franceline; Rosner, Bernard; Kaye, Kenneth M.

    2013-01-01

    Kaposi’s sarcoma-associated herpesvirus LANA (1162 residues) mediates episomal persistence of viral genomes during latency. LANA mediates viral DNA replication and segregates episomes to daughter nuclei. A 59 residue deletion immediately upstream of the internal repeat elements rendered LANA highly deficient for DNA replication and modestly deficient for the ability to segregate episomes, while smaller deletions did not. The 59 amino acid deletion reduced LANA episome persistence by ~14-fold, while sequentially smaller deletions resulted in ~3-fold, or no deficiency. Three distinct LANA regions reorganized heterochromatin, one of which contains the deleted sequence, but the deletion did not abolish LANA’s ability to alter chromatin. Therefore, this work identifies a short internal LANA sequence that is critical for DNA replication, has modest effects on episome segregation, and substantially impacts episome persistence; this region may exert its effects through an interacting host cell protein(s). PMID:24314665

Top