A proteomic analysis of ferulic acid metabolism in Amycolatopsis sp. ATCC 39116.
Meyer, Florian; Netzer, Julius; Meinert, Christina; Voigt, Birgit; Riedel, Katharina; Steinbüchel, Alexander
2018-05-16
The pseudonocardiate Amycolatopsis sp. ATCC 39116 is used for the biotechnical production of natural vanillin from ferulic acid. Our laboratory has performed genetic modifications of this strain previously, but there are still many gaps in our knowledge regarding its vanillin tolerance and the general metabolism. We performed cultivations with this bacterium and compared the proteomes of stationary phase cells before ferulic acid feeding with those during ferulic acid feeding. Thereby, we identified 143 differently expressed proteins. Deletion mutants were constructed and characterized to analyze the function of nine corresponding genes. Using these mutants, we identified an active ferulic acid β-oxidation pathway and the enzymes which constitute this pathway. A combined deletion mutant in which the β-oxidation as well as non-β-oxidation pathways of ferulic acid degradation were deleted was unable to grow on ferulic acid as the sole source of carbon and energy. This mutant differs from the single deletion mutants and was unable to grow on ferulic acid. Furthermore, we showed that the non-β-oxidation pathway is involved in caffeic acid degradation; however, its deletion is complemented even in the double deletion mutant. This shows that both pathways can complement each other. The β-oxidation deletion mutant produced significantly reduced amounts of vanillic acid (0.12 instead of 0.35 g/l). Therefore, the resulting mutant could be used as an improved production strain. The quinone oxidoreductase deletion mutant (ΔytfG) degraded ferulic acid slower at first but produced comparable amounts of vanillin and significantly less vanillyl alcohol when compared to the parent strain.
Barkan, A; Mertz, J E
1981-02-01
The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.
Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi
2007-05-01
The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.
Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji
2009-09-01
We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.
The mouse lymphoma assay detects recombination, deletion, and aneuploidy.
Wang, Jianyong; Sawyer, Jeffrey R; Chen, Ling; Chen, Tao; Honma, Masamitsu; Mei, Nan; Moore, Martha M
2009-05-01
The mouse lymphoma assay (MLA) uses the thymidine kinase (Tk) gene of the L5178Y/Tk(+/-)-3.7.2C mouse lymphoma cell line as a reporter gene to evaluate the mutagenicity of chemical and physical agents. The MLA is recommended by both the United States Food and Drug Administration and the United States Environmental Protection Agency as the preferred in vitro mammalian cell mutation assay for genetic toxicology screening because it detects a wide range of genetic alterations, including both point mutations and chromosomal mutations. However, the specific types of chromosomal mutations that can be detected by the MLA need further clarification. For this purpose, three chemicals, including two clastogens and an aneugen (3'-azido-3'-deoxythymidine, mitomycin C, and taxol), were used to induce Tk mutants. Loss of heterozygosity (LOH) analysis was used to select mutants that could be informative as to whether they resulted from deletion, mitotic recombination, or aneuploidy. A combination of additional methods, G-banding analysis, chromosome painting, and a real-time PCR method to detect the copy number (CN) of the Tk gene was then used to provide a detailed analysis. LOH involving at least 25% of chromosome 11, a normal karyotype, and a Tk CN of 2 would indicate that the mutant resulted from recombination, whereas LOH combined with a karyotypically visible deletion of chromosome 11 and a Tk CN of 1 would indicate a deletion. Aneuploidy was confirmed using G-banding combined with chromosome painting analysis for mutants showing LOH at every microsatellite marker on chromosome 11. From this analysis, it is clear that mouse lymphoma Tk mutants can result from recombination, deletion, and aneuploidy.
Wright, Robin; Parrish, Mark L; Cadera, Emily; Larson, Lynnelle; Matson, Clinton K; Garrett-Engele, Philip; Armour, Chris; Lum, Pek Yee; Shoemaker, Daniel D
2003-07-30
Increased levels of HMG-CoA reductase induce cell type- and isozyme-specific proliferation of the endoplasmic reticulum. In yeast, the ER proliferations induced by Hmg1p consist of nuclear-associated stacks of smooth ER membranes known as karmellae. To identify genes required for karmellae assembly, we compared the composition of populations of homozygous diploid S. cerevisiae deletion mutants following 20 generations of growth with and without karmellae. Using an initial population of 1,557 deletion mutants, 120 potential mutants were identified as a result of three independent experiments. Each experiment produced a largely non-overlapping set of potential mutants, suggesting that differences in specific growth conditions could be used to maximize the comprehensiveness of similar parallel analysis screens. Only two genes, UBC7 and YAL011W, were identified in all three experiments. Subsequent analysis of individual mutant strains confirmed that each experiment was identifying valid mutations, based on the mutant's sensitivity to elevated HMG-CoA reductase and inability to assemble normal karmellae. The largest class of HMG-CoA reductase-sensitive mutations was a subset of genes that are involved in chromatin structure and transcriptional regulation, suggesting that karmellae assembly requires changes in transcription or that the presence of karmellae may interfere with normal transcriptional regulation. Copyright 2003 John Wiley & Sons, Ltd.
Yao, Kun; Duan, Zejun; Hu, Zeliang; Bian, Yu; Qi, Xueling
2014-10-01
To correlate the presence of chromosome 1p/19q deletion with the expression of R132H mutant IDH1 status in oligodendroglial tumors, and to explore molecular markers for predicting chemosensitivity of oligodendroglial tumors. The study included 75 oligodendroglial tumors (38 oligodendrogliomas and 37 oligoastrocytomas). Immunohistochemistry was used to detect the expression of R132H mutant IDH1 protein, and fluorescence in situ hybridization (FISH) was employed to detect 1p/19q deletion. Deletion of chromosome 1p and/or 19q was detected in 37 cases (37/75, 49.3%), among which co-deletion of 1p and 19q was seen in 34 cases (closely correlated, P < 0.01). Oligodendrogliomas WHOIIhad a slightly higher deletion rate than oligodendrogliomas WHO III, although without statistical significance. Oligodendrogliomas WHO IIand WHO III had a significantly higher deletion rate of chromosome 1p/19q than oligoastrocytomas WHO II and WHO III (P < 0.05). While combined loss of 1p/19q was always detected in oligodendrogliomas when FISH was positive, isolated 1p or 19q deletion was only found in oligoastrocytomas. The expression of R132H mutant IDH1 was detected in 51 of 75 cases (68.0%), in which oligodendrogliomas had a higher positive rate than oligoastrocytomas. Statistical analysis demonstrated a significant correlation between the expression of R132H mutant IDH1 protein and the presence of combined 1p/19q deletion in oligodendrogliomas (P < 0.05). A significant correlation was observed between the expression of R132H mutant protein and 1p/19q LOH.Expression of 132H mutant IDH1 protein is the potential biomarker for predicating the presence of 1p/19q deletion in oligodendrogliomas.
Du, Yu; Xie, Guizhen; Yang, Chunfa; Fang, Baishan; Chen, Hongwen
2014-06-01
pyrG(-) host cells are indispensable for pyrG(-) based transformation system. Isolations of pyrG(-) host cells by random mutations are limited by time-consuming, unclear genetic background and potential interferences of homogenous recombination. The purpose of this study was to construct brewing-wine Aspergillus oryzae pyrG(-) mutant by site-directed mutation of pyrG gene deletion which would be used as a host for further transformation. pMD-pyrGAB, a vector carrying pyrG deletion cassette, was used to construct pyrG(-) mutant of A. oryzae. Three stable pyrG deletion mutants of A. oryzae were isolated by resistant to 5-fluoroorotic acid and confirmed by polymerase chain reaction analysis, indicating that pyrG was completely excised. The ΔpyrG mutants were applied as pyrG(-) host cells to disrupt xdh gene encoding xylitol dehydrogenase, which involves in xylitol production of A. oryzae. The xdh disruption mutants were efficiently constructed by transforming a pMD-pyrG-xdh disruption plasmid carrying pyrG, and the produced xylitol concentration of the Δxdh mutant was three times as much as that of the ΔpyrG recipient. Site-directed pyrG gene deletion is thus an effective way for the isolation of pyrG(-) host cells, and the established host-vector system could be applied in further functional genomics analysis and molecular breeding of A. oryzae. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.
Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen
2016-03-15
High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.
Porwollik, Steffen; Santiviago, Carlos A; Cheng, Pui; Long, Fred; Desai, Prerak; Fredlund, Jennifer; Srikumar, Shabarinath; Silva, Cecilia A; Chu, Weiping; Chen, Xin; Canals, Rocío; Reynolds, M Megan; Bogomolnaya, Lydia; Shields, Christine; Cui, Ping; Guo, Jinbai; Zheng, Yi; Endicott-Yazdani, Tiana; Yang, Hee-Jeong; Maple, Aimee; Ragoza, Yury; Blondel, Carlos J; Valenzuela, Camila; Andrews-Polymenis, Helene; McClelland, Michael
2014-01-01
We constructed two collections of targeted single gene deletion (SGD) mutants and two collections of targeted multi-gene deletion (MGD) mutants in Salmonella enterica sv Typhimurium 14028s. The SGD mutant collections contain (1), 3517 mutants in which a single gene is replaced by a cassette containing a kanamycin resistance (KanR) gene oriented in the sense direction (SGD-K), and (2), 3376 mutants with a chloramphenicol resistance gene (CamR) oriented in the antisense direction (SGD-C). A combined total of 3773 individual genes were deleted across these SGD collections. The MGD collections contain mutants bearing deletions of contiguous regions of three or more genes and include (3), 198 mutants spanning 2543 genes replaced by a KanR cassette (MGD-K), and (4), 251 mutants spanning 2799 genes replaced by a CamR cassette (MGD-C). Overall, 3476 genes were deleted in at least one MGD collection. The collections with different antibiotic markers permit construction of all viable combinations of mutants in the same background. Together, the libraries allow hierarchical screening of MGDs for different phenotypic followed by screening of SGDs within the target MGD regions. The mutants of these collections are stored at BEI Resources (www.beiresources.org) and publicly available.
Novel Two-Step Hierarchical Screening of Mutant Pools Reveals Mutants under Selection in Chicks
Yang, Hee-Jeong; Bogomolnaya, Lydia M.; Elfenbein, Johanna R.; Endicott-Yazdani, Tiana; Reynolds, M. Megan; Porwollik, Steffen; Cheng, Pui; Xia, Xiao-Qin
2016-01-01
Contaminated chicken/egg products are major sources of human salmonellosis, yet the strategies used by Salmonella to colonize chickens are poorly understood. We applied a novel two-step hierarchical procedure to identify new genes important for colonization and persistence of Salmonella enterica serotype Typhimurium in chickens. A library of 182 S. Typhimurium mutants each containing a targeted deletion of a group of contiguous genes (for a total of 2,069 genes deleted) was used to identify regions under selection at 1, 3, and 9 days postinfection in chicks. Mutants in 11 regions were under selection at all assayed times (colonization mutants), and mutants in 15 regions were under selection only at day 9 (persistence mutants). We assembled a pool of 92 mutants, each deleted for a single gene, representing nearly all genes in nine regions under selection. Twelve single gene deletion mutants were under selection in this assay, and we confirmed 6 of 9 of these candidate mutants via competitive infections and complementation analysis in chicks. STM0580, STM1295, STM1297, STM3612, STM3615, and STM3734 are needed for Salmonella to colonize and persist in chicks and were not previously associated with this ability. One of these key genes, STM1297 (selD), is required for anaerobic growth and supports the ability to utilize formate under these conditions, suggesting that metabolism of formate is important during infection. We report a hierarchical screening strategy to interrogate large portions of the genome during infection of animals using pools of mutants of low complexity. Using this strategy, we identified six genes not previously known to be needed during infection in chicks, and one of these (STM1297) suggests an important role for formate metabolism during infection. PMID:26857572
Southern Analysis of Genomic Alterations in Gamma-Ray-Induced Aprt- Hamster Cell Mutants
Grosovsky, Andrew J.; Drobetsky, Elliot A.; deJong, Pieter J.; Glickman, Barry W.
1986-01-01
The role of genomic alterations in mutagenesis induced by ionizing radiation has been the subject of considerable speculation. By Southern blotting analysis we show here that 9 of 55 (approximately 1/6) gamma-ray-induced mutants at the adenine phosphoribosyl transferase (aprt) locus of Chinese hamster ovary (CHO) cells have a detectable genomic rearrangement. These fall into two classes: intragenic deletions and chromosomal rearrangements. In contrast, no major genomic alterations were detected among 67 spontaneous mutants, although two restriction site loss events were observed. Three gamma-ray-induced mutants were found to be intragenic deletions; all may have identical break-points. The remaining six gamma-ray-induced mutants demonstrating a genomic alteration appear to be the result of chromosomal rearrangements, possibly translocation or inversion events. None of the remaining gamma-ray-induced mutants showed any observable alteration in blotting pattern indicating a substantial role for point mutation in gamma-ray-induced mutagenesis at the aprt locus. PMID:3013724
NASA Technical Reports Server (NTRS)
Yamada, Y.; Park, M. S.; Okinaka, R. T.; Chen, D. J.
1996-01-01
Genetic alterations in gamma-ray- and alpha-particle-induced HPRT mutants were examined by multiplex polymerase chain reaction (PCR) analysis. A total of 39-63% of gamma-ray-induced and 31-57% of alpha-particle-induced mutants had partial or total deletions of the HPRT gene. The proportion of these deletion events was dependent on radiation dose, and at the resolution limits employed there were no significant differences between the spectra induced by equitoxic doses of alpha particles (0.2-0.4 Gy) and gamma rays (3 Gy). The molecular nature of the deletions was analyzed by the use of sequence tagged site (STS) primers and PCR amplification as a "probe" for specific regions of the human X chromosome within the Xq26 region. These STSs were closely linked and spanned regions approximately 1.7 Mbp from the telomeric side and 1.7 Mbp from the centromeric side of the HPRT gene. These markers include: DXS53, 299R, DXS79, yH3L, 3/19, PR1, PR25, H2, yH3R, 1/44, 1/67, 1/1, DXS86, D8C6, DXS10 and DXS144. STS analyses indicated that the maximum size of total deletions in radiation-induced HPRT mutants can be greater than 2.7 Mbp and deletion size appears to be dependent on radiation dose. There were no apparent differences in the sizes of the deletions induced by alpha particles or gamma rays. On the other hand, deletions containing portions of the HPRT gene were observed to be 800 kbp or less, and the pattern of the partial deletion induced by alpha particles appeared to be different from that induced by gamma rays.
Detection of three-base deletion by exciplex formation with perylene derivatives.
Kashida, Hiromu; Kondo, Nobuyo; Sekiguchi, Koji; Asanuma, Hiroyuki
2011-06-14
Here, we synthesized fluorescent DNA probes labeled with two perylene derivatives for the detection of a three-base deletion mutant. One such probe discriminated the three-base deletion mutant from the wild-type sequence by exciplex emission, and the deletion mutant was identifiable even by the naked eye. This journal is © The Royal Society of Chemistry 2011
Zhao, Feng; Meng, Songsong; Zhou, Deqing
2016-02-04
To construct heptyl glycosyltransferase gene II (waaF) gene deletion mutant of Vibrio parahaemolyticus, and explore the function of the waaF gene in Vibrio parahaemolyticus. The waaF gene deletion mutant was constructed by chitin-based transformation technology using clinical isolates, and then the growth rate, morphology and serotypes were identified. The different sources (O3, O5 and O10) waaF gene complementations were constructed through E. coli S17λpir strains conjugative transferring with Vibrio parahaemolyticus, and the function of the waaF gene was further verified by serotypes. The waaF gene deletion mutant strain was successfully constructed and it grew normally. The growth rate and morphology of mutant were similar with the wild type strains (WT), but the mutant could not occurred agglutination reaction with O antisera. The O3 and O5 sources waaF gene complementations occurred agglutination reaction with O antisera, but the O10 sources waaF gene complementations was not. The waaF gene was related with O-antigen synthesis and it was the key gene of O-antigen synthesis pathway in Vibrio parahaemolyticus. The function of different sources waaF gene were not the same.
Lee, Ji Yun; Ku, Bo Mi; Lim, Sung Hee; Lee, Min-Young; Kim, Haesu; Kim, Moonjin; Kim, Sungmin; Jung, Hyun Ae; Sun, Jong-Mu; Ahn, Jin Seok; Park, Keunchil; Ahn, Myung-Ju
2015-06-01
A germline BIM deletion polymorphism has been proposed to predict poor treatment response to certain kinase inhibitors. The purpose of this study was to explore whether the BIM deletion polymorphism predicts treatment efficacy of epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) in Korean patients with EGFR-mutant non-small-cell lung cancer (NSCLC). Peripheral blood samples from a total of 205 patients with EGFR-mutant NSCLC who were treated with EGFR TKIs between July 2008 and April 2013 were included. The incidence of BIM deletions in these samples was detected by polymerase chain reaction. We compared the clinical outcomes in patients with and without the polymorphism after treatment with EGFR TKIs (gefitinib or erlotinib). The BIM deletion polymorphism was present in 15.6% (32 of 205) of patients. One patient was homozygous for the deletion, and the remaining 31 had heterozygous deletions. The majority of patients were younger than 65 years (74%), female (68%), never smokers (76%), and had stage IV NSCLC (67%). There were no associations between the BIM deletion polymorphism and clinicopathological features including gender, age, smoking status, histology, stage, and number of metastasis sites. Patients with and without the BIM deletion polymorphism had similar objective response rates (91 vs. 84%, p = 0.585). Progression-free survival and overall survival did not differ significantly between patients with and without the BIM deletion polymorphism (median progression-free survival 12 vs. 11 months, p = 0.160; median overall survival 31 vs. 30 months, p = 0.452). Multivariate analysis identified significantly predictive markers for clinical outcomes of EGFR TKIs including Eastern Cooperative Oncology Group performance status 0-1, adenocarcinoma histology, recurrent disease, and EGFR mutation type. The results were validated in an independent cohort of 69 NSCLC patients. It remains to be determined whether the BIM deletion polymorphism provides intrinsic resistance or decreased sensitivity to EGFR TKIs in EGFR-mutant NSCLC patients.
Khater, Fida; Balestrino, Damien; Charbonnel, Nicolas; Dufayard, Jean François; Brisse, Sylvain; Forestier, Christiane
2015-01-01
Chaperone/usher (CU) assembly pathway is used by a wide range of Enterobacteriaceae to assemble adhesive surface structures called pili or fimbriae that play a role in bacteria-host cell interactions. In silico analysis revealed that the genome of Klebsiella pneumoniae LM21 harbors eight chromosomal CU loci belonging to γκп and ϭ clusters. Of these, only two correspond to previously described operons, namely type 1 and type 3-encoding operons. Isogenic usher deletion mutants of K. pneumoniae LM21 were constructed for each locus and their role in adhesion to animal (Intestine 407) and plant (Arabidopsis thaliana) cells, biofilm formation and murine intestinal colonization was investigated. Type 3 pili usher deleted mutant was impaired in all assays, whereas type 1 pili usher deleted mutant only showed attenuation in adhesion to plant cells and in intestinal colonization. The LM21ΔkpjC mutant was impaired in its capacity to adhere to Arabidopsis cells and to colonize the murine intestine, either alone or in co-inoculation experiments. Deletion of LM21kpgC induced a significant decrease in biofilm formation, in adhesion to animal cells and in colonization of the mice intestine. The LM21∆kpaC and LM21∆kpeC mutants were only attenuated in biofilm formation and the adhesion abilities to Arabidopsis cells, respectively. No clear in vitro or in vivo effect was observed for LM21∆kpbC and LM21∆kpdC mutants. The multiplicity of CU loci in K. pneumoniae genome and their specific adhesion pattern probably reflect the ability of the bacteria to adhere to different substrates in its diverse ecological niches. PMID:25751658
2010-01-01
Background The chromosome of Streptomyces has been shown to be unstable, frequently undergoing gross chromosomal rearrangements. However, the mechanisms underlying this phenomenon remain unclear, with previous studies focused on two chromosomal ends as targets for rearrangements. Here we investigated chromosomal instability of Streptomyces avermitilis, an important producer of avermectins, and characterized four gross chromosomal rearrangement events, including a major deletion in the central region. The present findings provide a valuable contribution to the mechanistic study of genetic instability in Streptomyces. Results Thirty randomly-selected "bald" mutants derived from the wild-type strain all contained gross chromosomal rearrangements of various types. One of the bald mutants, SA1-8, had the same linear chromosomal structure as the high avermectin-producing mutant 76-9. Chromosomes of both strains displayed at least three independent chromosomal rearrangements, including chromosomal arm replacement to form new 88-kb terminal inverted repeats (TIRs), and two major deletions. One of the deletions eliminated the 36-kb central region of the chromosome, but surprisingly did not affect viability of the cells. The other deletion (74-kb) was internal to the right chromosomal arm. The chromosome of another bald mutant, SA1-6, was circularized with deletions at both ends. No obvious homology was found in all fusion sequences. Generational stability analysis showed that the chromosomal structure of SA1-8 and SA1-6 was stable. Conclusions Various chromosomal rearrangements, including chromosomal arm replacement, interstitial deletions and chromosomal circularization, occurred in S. avermitilis by non-homologous recombination. The finding of an inner deletion involving in the central region of S. avermitilis chromosome suggests that the entire Streptomyces chromosome may be the target for rearrangements, which are not limited, as previously reported, to the two chromosomal ends. PMID:20653985
Gsell, Martina; Mascher, Gerald; Schuiki, Irmgard; Ploier, Birgit; Hrastnik, Claudia; Daum, Günther
2013-01-01
In the yeast, Saccharomyces cerevisiae, the synthesis of the essential phospholipid phosphatidylethanolamine (PE) is accomplished by a network of reactions which comprises four different pathways. The enzyme contributing most to PE formation is the mitochondrial phosphatidylserine decarboxylase 1 (Psd1p) which catalyzes conversion of phosphatidylserine (PS) to PE. To study the genome wide effect of an unbalanced cellular and mitochondrial PE level and in particular the contribution of Psd1p to this depletion we performed a DNA microarray analysis with a ∆psd1 deletion mutant. This approach revealed that 54 yeast genes were significantly up-regulated in the absence of PSD1 compared to wild type. Surprisingly, marked down-regulation of genes was not observed. A number of different cellular processes in different subcellular compartments were affected in a ∆psd1 mutant. Deletion mutants bearing defects in all 54 candidate genes, respectively, were analyzed for their growth phenotype and their phospholipid profile. Only three mutants, namely ∆gpm2, ∆gph1 and ∆rsb1, were affected in one of these parameters. The possible link of these mutations to PE deficiency and PSD1 deletion is discussed.
Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya
2018-02-01
In a previous study, we reported that a double gene deletion mutant for CreA and CreB, which constitute the regulatory machinery involved in carbon catabolite repression, exhibited improved production of α-amylase compared with the wild-type strain and single creA or creB deletion mutants in Aspergillus oryzae. Because A. oryzae can also produce biomass-degrading enzymes, such as xylolytic and cellulolytic enzymes, we examined the production levels of those enzymes in deletion mutants in this study. Xylanase and β-glucosidase activities in the wild-type were hardly detected in submerged culture containing xylose as the carbon source, whereas those enzyme activities were significantly increased in the single creA deletion (ΔcreA) and double creA and creB deletion (ΔcreAΔcreB) mutants. In particular, the ΔcreAΔcreB mutant exhibited >100-fold higher xylanase and β-glucosidase activities than the wild-type. Moreover, in solid-state culture, the β-glucosidase activity of the double deletion mutant was >7-fold higher than in the wild-type. These results suggested that deletion of both creA and creB genes could also efficiently improve the production levels of biomass-degrading enzymes in A. oryzae. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Molecular mapping within the mouse albino-deletion complex.
Johnson, D K; Hand, R E; Rinchik, E M
1989-01-01
Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427
Bao, Shaopan; Lu, Qicong; Dai, Heping; Zhang, Chao
2015-01-01
To develop applicable and susceptible models to evaluate the toxicity of nanoparticles, the antimicrobial effects of CuO nanoparticles (CuO-NPs) on various Saccharomyces cerevisiae (S. cerevisiae) strains (wild type, single-gene-deleted mutants, and multiple-gene-deleted mutants) were determined and compared. Further experiments were also conducted to analyze the mechanisms associated with toxicity using copper salt, bulk CuO (bCuO), carbon-shelled copper nanoparticles (C/Cu-NPs), and carbon nanoparticles (C-NPs) for comparisons. The results indicated that the growth inhibition rates of CuO-NPs for the wild-type and the single-gene-deleted strains were comparable, while for the multiple-gene deletion mutant, significantly higher toxicity was observed (P < 0.05). When the toxicity of the CuO-NPs to yeast cells was compared with the toxicities of copper salt and bCuO, we concluded that the toxicity of CuO-NPs should be attributed to soluble copper rather than to the nanoparticles. The striking difference in adverse effects of C-NPs and C/Cu-NPs with equivalent surface areas also proved this. A toxicity assay revealed that the multiple-gene-deleted mutant was significantly more sensitive to CuO-NPs than the wild type. Specifically, compared with the wild-type strain, copper was readily taken up by mutant strains when cell permeability genes were knocked out, and the mutants with deletions of genes regulated under oxidative stress (OS) were likely producing more reactive oxygen species (ROS). Hence, as mechanism-based gene inactivation could increase the susceptibility of yeast, the multiple-gene-deleted mutants should be improved model organisms to investigate the toxicity of nanoparticles. PMID:26386067
Maeda, K; Izawa, M; Nakajima, Y; Jin, Q; Hirose, T; Nakamura, T; Koshino, H; Kanamaru, K; Ohsato, S; Kamakura, T; Kobayashi, T; Yoshida, M; Kimura, M
2017-11-01
Histone deacetylases (HDACs) play an important role in the regulation of chromatin structure and gene expression. We found that dark pigmentation of Magnaporthe oryzae (anamorph Pyricularia oryzae) ΔMohda1, a mutant strain in which an orthologue of the yeast HDA1 was disrupted by double cross-over homologous recombination, was significantly stimulated in liquid culture. Analysis of metabolites in a ΔMohda1 mutant culture revealed that the accumulation of shunt products of the 1,8-dihydroxynaphthalene melanin and ergosterol pathways were significantly enhanced compared to the wild-type strain. Northern blot analysis of the ΔMohda1 mutant revealed transcriptional activation of three melanin genes that are dispersed throughout the genome of M. oryzae. The effect of deletion of the yeast HDA1 orthologue was also observed in Fusarium asiaticum from the Fusarium graminearum species complex; the HDF2 deletion mutant produced increased levels of nivalenol-type trichothecenes. These results suggest that histone modification via HDA1-type HDAC regulates the production of natural products in filamentous fungi. Natural products of fungi have significant impacts on human welfare, in both detrimental and beneficial ways. Although HDA1-type histone deacetylase is not essential for vegetative growth, deletion of the gene affects the expression of clustered secondary metabolite genes in some fungi. Here, we report that such phenomena are also observed in physically unlinked genes required for melanin biosynthesis in the rice blast fungus. In addition, production of Fusarium trichothecenes, previously reported to be unaffected by HDA1 deletion, was significantly upregulated in another Fusarium species. Thus, the HDA1-inactivation strategy may be regarded as a general approach for overproduction and/or discovery of fungal metabolites. © 2017 The Society for Applied Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de
1994-04-01
The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less
Fuchs, Walter; Fichtner, Dieter; Bergmann, Sven M; Mettenleiter, Thomas C
2011-06-01
Koi herpesvirus (KHV) causes a fatal disease in koi and common carp, but no reliable and genetically characterized vaccines are available up to now. Therefore, we generated KHV recombinants possessing deletions within the viral ribonucleotide reductase (RNR), thymidine kinase (TK), dUTPase, or TK and dUTPase genes, and their corresponding rescuants. All KHV mutants were replication competent in cultured cells. Whereas plaque sizes and titers of RNR-negative KHV were reduced, replication of the other mutants was not affected. Experimental infection of carp indicated attenuation of TK- or dUTPase-deleted KHV, and PCR analysis of tissue samples permitted differentiation of mutant from wild-type virus.
Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe
2012-01-01
Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures.
Coppin, Evelyne; Berteaux-Lecellier, Véronique; Bidard, Frédérique; Brun, Sylvain; Ruprich-Robert, Gwenaël; Espagne, Eric; Aït-Benkhali, Jinane; Goarin, Anne; Nesseir, Audrey; Planamente, Sara; Debuchy, Robert; Silar, Philippe
2012-01-01
Higher fungi, which comprise ascomycetes and basidiomycetes, play major roles in the biosphere. Their evolutionary success may be due to the extended dikaryotic stage of their life cycle, which is the basis for their scientific name: the Dikarya. Dikaryosis is maintained by similar structures, the clamp in basidiomycetes and the crozier in ascomycetes. Homeodomain transcription factors are required for clamp formation in all basidiomycetes studied. We identified all the homeobox genes in the filamentous ascomycete fungus Podospora anserina and constructed deletion mutants for each of these genes and for a number of gene combinations. Croziers developed normally in these mutants, including those with up to six deleted homeogenes. However, some mutants had defects in maturation of the fruiting body, an effect that could be rescued by providing wild-type maternal hyphae. Analysis of mutants deficient in multiple homeogenes revealed interactions between the genes, suggesting that they operate as a complex network. Similar to their role in animals and plants, homeodomain transcription factors in ascomycetes are involved in shaping multicellular structures. PMID:22662159
Favor, Jack; Bradley, Alan; Conte, Nathalie; Janik, Dirk; Pretsch, Walter; Reitmeir, Peter; Rosemann, Michael; Schmahl, Wolfgang; Wienberg, Johannes; Zaus, Irmgard
2009-08-01
In the mouse Pax6 function is critical in a dose-dependent manner for proper eye development. Pax6 contiguous gene deletions were shown to be homozygous lethal at an early embryonic stage. Heterozygotes express belly spotting and extreme microphthalmia. The eye phenotype is more severe than in heterozygous Pax6 intragenic null mutants, raising the possibility that deletions are functionally different from intragenic null mutations or that a region distinct from Pax6 included in the deletions affects eye phenotype. We recovered and identified the exact regions deleted in three new Pax6 deletions. All are homozygous lethal at an early embryonic stage. None express belly spotting. One expresses extreme microphthalmia and two express the milder eye phenotype similar to Pax6 intragenic null mutants. Analysis of Pax6 expression levels and the major isoforms excluded the hypothesis that the deletions expressing extreme microphthalmia are directly due to the action of Pax6 and functionally different from intragenic null mutations. A region distinct from Pax6 containing eight genes was identified for belly spotting. A second region containing one gene (Rcn1) was identified for the extreme microphthalmia phenotype. Rcn1 is a Ca(+2)-binding protein, resident in the endoplasmic reticulum, participates in the secretory pathway and expressed in the eye. Our results suggest that deletion of Rcn1 directly or indirectly contributes to the eye phenotype in Pax6 contiguous gene deletions.
Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs.
Harrington, Jill M; Kolodner, Richard D
2007-09-01
DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding.
Saccharomyces cerevisiae Msh2-Msh3 Acts in Repair of Base-Base Mispairs▿ †
Harrington, Jill M.; Kolodner, Richard D.
2007-01-01
DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding. PMID:17636021
A Defect in DNA Ligase4 Enhances the Frequency of TALEN-Mediated Targeted Mutagenesis in Rice1[OPEN
Cermak, Tomas; Sugimoto, Kazuhiko; Saika, Hiroaki; Mori, Akiko; Osakabe, Keishi; Hamada, Masao; Katayose, Yuichi; Voytas, Daniel F.
2016-01-01
We have established methods for site-directed mutagenesis via transcription activator-like effector nucleases (TALENs) in the endogenous rice (Oryza sativa) waxy gene and demonstrated stable inheritance of TALEN-induced somatic mutations to the progeny. To analyze the role of classical nonhomologous end joining (cNHEJ) and alternative nonhomologous end joining (altNHEJ) pathways in TALEN-induced mutagenesis in plant cells, we investigated whether a lack of DNA Ligase4 (Lig4) affects the kinetics of TALEN-induced double-strand break repair in rice cells. Deep-sequencing analysis revealed that the frequency of all types of mutations, namely deletion, insertion, combination of insertion with deletion, and substitution, in lig4 null mutant calli was higher than that in a lig4 heterozygous mutant or the wild type. In addition, the ratio of large deletions (greater than 10 bp) and deletions repaired by microhomology-mediated end joining (MMEJ) to total deletion mutations in lig4 null mutant calli was higher than that in the lig4 heterozygous mutant or wild type. Furthermore, almost all insertions (2 bp or greater) were shown to be processed via copy and paste of one or more regions around the TALENs cleavage site and rejoined via MMEJ regardless of genetic background. Taken together, our findings indicate that the dysfunction of cNHEJ leads to a shift in the repair pathway from cNHEJ to altNHEJ or synthesis-dependent strand annealing. PMID:26668331
Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui
2017-01-01
Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo, erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity. PMID:29312548
Xia, Jinjing; Bai, Hao; Yan, Bo; Li, Rong; Shao, Minhua; Xiong, Liwen; Han, Baohui
2017-12-12
Epidermal growth factor receptor tyrosine kinase inhibitors (EGFR TKIs) are widely applied to treat EGFR-mutant non-small cell lung cancer (NSCLC). BIM is a BH3 domain-containing protein encoded by BCL2L11. Some EGFR-mutant NSCLC patients showing BIM deletion polymorphism are resistant to EGFR TKIs. We retrospectively investigated BIM deletion polymorphism in NSCLC patients, its correlation with EGFR TKI (erlotinib) resistance, and the mechanism underlying the drug resistance. Among 245 EGFR-mutant NSCLC patients examined, BIM deletion polymorphism was detected in 43 (12.24%). Median progression-free and overall survival was markedly shorter in patients with BIM deletion polymorphism than with BIM wide-type. Moreover, NSCLC cells expressing EGFR-mutant harboring BIM polymorphism were more resistant to erlotinib-induced apoptosis than BIM wide-type cells. However, combined use of erlotinib and the BH3-mimetic ABT-737 up-regulated BIM expression and overcame erlotinib resistance in EGFR-mutant NSCLC cells harboring BIM deletion polymorphism. In vivo , erlotinib suppressed growth of BIM wide-type NSCLC cell xenographs by inducing apoptosis. Combined with ABT-737, erlotinib also suppressed NSCLC xenographs expressing EGFR-mutant harboring BIM deletion polymorphism. These results indicate that BIM polymorphism is closely related to a poor clinical response to EGFR TKIs in EGFR-mutant NSCLC patients, and that the BH3-mimetic ABT-737 restores BIM functionality and EGFR-TKI sensitivity.
Liu, Xiao-Hong; Ning, Guo-Ao; Huang, Lu-Yao; Zhao, Ya-Hui; Dong, Bo; Lu, Jian-Ping; Lin, Fu-Cheng
2016-01-01
Calpains are ubiquitous and well-conserved proteins that belong to the calcium-dependent, non-lysosomal cysteine protease family. In this study, 8 putative calpains were identified using Pfam domain analysis and BlastP searches in M. oryzae. Three single gene deletion mutants (ΔMocapn7, ΔMocapn9 and ΔMocapn14) and two double gene deletion mutants (ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7) were obtained using the high-throughput gene knockout system. The calpain disruption mutants showed defects in colony characteristics, conidiation, sexual reproduction and cell wall integrity. The mycelia of the ΔMocapn7, ΔMocapn4ΔMocapn7 and ΔMocapn9ΔMocapn7 mutants showed reduced pathogenicity on rice and barley. PMID:27502542
Daniil, Georgios; Zannis, Vassilis I; Chroni, Angeliki
2013-01-01
ATP binding cassette transporter G1 (ABCG1) mediates the cholesterol transport from cells to high-density lipoprotein (HDL), but the role of apolipoprotein A-I (apoA-I), the main protein constituent of HDL, in this process is not clear. To address this, we measured cholesterol efflux from HEK293 cells or J774 mouse macrophages overexpressing ABCG1 using as acceptors reconstituted HDL (rHDL) containing wild-type or various mutant apoA-I forms. It was found that ABCG1-mediated cholesterol efflux was severely reduced (by 89%) when using rHDL containing the carboxyl-terminal deletion mutant apoA-I[Δ(185-243)]. ABCG1-mediated cholesterol efflux was not affected or moderately decreased by rHDL containing amino-terminal deletion mutants and several mid-region deletion or point apoA-I mutants, and was restored to 69-99% of control by double deletion mutants apoA-I[Δ(1-41)Δ(185-243)] and apoA-I[Δ(1-59)Δ(185-243)]. These findings suggest that the central helices alone of apoA-I associated to rHDL can promote ABCG1-mediated cholesterol efflux. Further analysis showed that rHDL containing the carboxyl-terminal deletion mutant apoA-I[Δ(185-243)] only slightly reduced (by 22%) the ABCG1-mediated efflux of 7-ketocholesterol, indicating that depending on the sterol type, structural changes in rHDL-associated apoA-I affect differently the ABCG1-mediated efflux of cholesterol and 7-ketocholesterol. Overall, our findings demonstrate that rHDL-associated apoA-I structural changes affect the capacity of rHDL to accept cellular cholesterol by an ABCG1-mediated process. The structure-function relationship seen here between rHDL-associated apoA-I mutants and ABCG1-mediated cholesterol efflux closely resembles that seen before in lipid-free apoA-I mutants and ABCA1-dependent cholesterol efflux, suggesting that both processes depend on the same structural determinants of apoA-I.
Bonifield, Heather R.; Yamaguchi, Shigeru; Hughes, Kelly T.
2000-01-01
We investigated the posttranscriptional regulation of flgE, a class 2 gene that encodes the hook subunit protein of the flagella. RNase protection assays demonstrated that the flgE gene was transcribed at comparable levels in numerous strains defective in known steps of flagellar assembly. However, Western analyses of these strains demonstrated substantial differences in FlgE protein levels. Although wild-type FlgE levels were observed in strains with deletions of genes encoding components of the switch complex and the flagellum-specific secretion apparatus, no protein was detected in a strain with deletions of the rod, ring, and hook-associated proteins. To determine whether FlgE levels were affected by the stage of hook–basal-body assembly, Western analysis was performed on strains with mutations at individual loci encompassed by the deletion. FlgE protein was undetectable in rod mutants, intermediate in ring mutants, and wild type in hook-associated protein mutants. The lack of negative regulation in switch complex and flagellum-specific secretion apparatus deletion mutants blocked for flagellar construction prior to rod assembly suggests that these structures play a role in the negative regulation of FlgE. Quantitative Western analyses of numerous flagellar mutants indicate that FlgE levels reflect the stage at which flagellar assembly is blocked. These data provide evidence for negative posttranscriptional regulation of FlgE in response to the stage of flagellar assembly. PMID:10869084
Zhang, Mingming; Zhang, Keyu; Mehmood, Muhammad Aamer; Zhao, Zongbao Kent; Bai, Fengwu; Zhao, Xinqing
2017-12-01
The aim of this work was to study the effects of deleting acetate transporter gene ADY2 on growth and fermentation of Saccharomyces cerevisiae in the presence of inhibitors. Comparative transcriptome analysis revealed that three genes encoding plasma membrane carboxylic acid transporters, especially ADY2, were significantly downregulated under the zinc sulfate addition condition in the presence of acetic acid stress, and the deletion of ADY2 improved growth of S. cerevisiae under acetic acid, ethanol and hydrogen peroxide stresses. Consistently, a concomitant increase in ethanol production by 14.7% in the presence of 3.6g/L acetic acid was observed in the ADY2 deletion mutant of S. cerevisiae BY4741. Decreased intracellular acetic acid, ROS accumulation, and plasma membrane permeability were observed in the ADY2 deletion mutant. These findings would be useful for developing robust yeast strains for efficient ethanol production. Copyright © 2017 Elsevier Ltd. All rights reserved.
Intracistronic complementation in the simian virus 40 A gene.
Tornow, J; Cole, C N
1983-01-01
A set of eight simian virus 40 mutants was constructed with lesions in the A gene, which encodes the large tumor (T) antigen. These mutants have small deletions (3-20 base pairs) at either 0.497, 0.288, or 0.243 map units. Mutants having both in-phase and frameshift mutations at each site were isolated. Neither plaque formation nor replication of the mutant DNAs could be detected after transfection of monkey kidney cells. Another nonviable mutant, dlA2459, had a 14-base-pair deletion at 0.193 map unit and was positive for viral DNA replication. Each of the eight mutants were tested for ability to form plaques after cotransfection with dlA2459 DNA. The four mutants that had in-phase deletions were able to complement dlA2459. The other four, which had frameshift deletions, did not. No plaques were formed after cotransfection of cells with any other pair of group A mutants. This suggests that the defect in dlA2459 defines a distinct functional domain of simian virus 40 T antigen. Images PMID:6312452
Jimenez-Sandoval, Pedro; Vique-Sanchez, Jose Luis; Hidalgo, Marisol López; Velazquez-Juarez, Gilberto; Diaz-Quezada, Corina; Arroyo-Navarro, Luis Fernando; Moran, Gabriela Montero; Fattori, Juliana; Jessica Diaz-Salazar, A; Rudiño-Pinera, Enrique; Sotelo-Mundo, Rogerio; Figueira, Ana Carolina Migliorini; Lara-Gonzalez, Samuel; Benítez-Cardoza, Claudia G; Brieba, Luis G
2017-11-01
The protozoan parasite Trichomonas vaginalis contains two nearly identical triosephosphate isomerases (TvTIMs) that dissociate into stable monomers and dimerize upon substrate binding. Herein, we compare the role of the "ball and socket" and loop 3 interactions in substrate assisted dimer assembly in both TvTIMs. We found that point mutants at the "ball" are only 39 and 29-fold less catalytically active than their corresponding wild-type counterparts, whereas Δloop 3 deletions are 1502 and 9400-fold less active. Point and deletion mutants dissociate into stable monomers. However, point mutants assemble as catalytic competent dimers upon binding of the transition state substrate analog PGH, whereas loop 3 deletions remain monomeric. A comparison between crystal structures of point and loop 3 deletion monomeric mutants illustrates that the catalytic residues in point mutants and wild-type TvTIMs are maintained in the same orientation, whereas the catalytic residues in deletion mutants show an increase in thermal mobility and present structural disorder that may hamper their catalytic role. The high enzymatic activity present in monomeric point mutants correlates with the formation of dimeric TvTIMs upon substrate binding. In contrast, the low activity and lack of dimer assembly in deletion mutants suggests a role of loop 3 in promoting the formation of the active site as well as dimer assembly. Our results suggest that in TvTIMs the active site is assembled during dimerization and that the integrity of loop 3 and ball and socket residues is crucial to stabilize the dimer. Copyright © 2017 Elsevier B.V. All rights reserved.
Role of the XIAP-Cooper Axis in Prostate Cancer
2011-04-01
growing yeast transformed with a plasmid encoding human XIAP in Cu-free selective medium. Supplemental Cu was added to the medium 1-2 hours before...human XIAP into yeast deletion strains. We selected 16 deletion strains from the same background as our wild-type control (BY4741) for analysis. These...transformed with the XIAP expression plasmid. This objective is complete. Assess yeast deletion mutants for delivery of copper to XIAP. After
Pennucci, Roberta; Talpo, Francesca; Astro, Veronica; Montinaro, Valentina; Morè, Lorenzo; Cursi, Marco; Castoldi, Valerio; Chiaretti, Sara; Bianchi, Veronica; Marenna, Silvia; Cambiaghi, Marco; Tonoli, Diletta; Leocani, Letizia; Biella, Gerardo; D'Adamo, Patrizia; de Curtis, Ivan
2016-01-01
Rac GTPases regulate the development of cortical/hippocampal GABAergic interneurons by affecting the early development and migration of GABAergic precursors. We have addressed the function of Rac1 and Rac3 proteins during the late maturation of hippocampal interneurons. We observed specific phenotypic differences between conditional Rac1 and full Rac3 knockout mice. Rac1 deletion caused greater generalized hyperactivity and cognitive impairment compared with Rac3 deletion. This phenotype matched with a more evident functional impairment of the inhibitory circuits in Rac1 mutants, showing higher excitability and reduced spontaneous inhibitory currents in the CA hippocampal pyramidal neurons. Morphological analysis confirmed a differential modification of the inhibitory circuits: deletion of either Rac caused a similar reduction of parvalbumin-positive inhibitory terminals in the pyramidal layer. Intriguingly, cannabinoid receptor-1-positive terminals were strongly increased only in the CA1 of Rac1-depleted mice. This increase may underlie the stronger electrophysiological defects in this mutant. Accordingly, incubation with an antagonist for cannabinoid receptors partially rescued the reduction of spontaneous inhibitory currents in the pyramidal cells of Rac1 mutants. Our results show that Rac1 and Rac3 have independent roles in the formation of GABAergic circuits, as highlighted by the differential effects of their deletion on the late maturation of specific populations of interneurons. PMID:26582364
Zeng, Wenping; Wang, Jie; Wang, Ying; Lin, Jing; Fu, Yanping; Xie, Jiatao; Jiang, Daohong; Chen, Tao; Liu, Huiquan; Cheng, Jiasen
2018-01-01
Ascospores act as the primary inoculum of Fusarium graminearum, which causes the destructive disease Fusarium head blight (FHB), or scab. MicroRNAs (miRNAs) have been reported in the F. graminearum vegetative stage, and Fgdcl2 is involved in microRNA-like RNA (milRNA) biogenesis but has no major impact on vegetative growth, abiotic stress or pathogenesis. In the present study, we found that ascospore discharge was decreased in the Fgdcl1 deletion mutant, and completely blocked in the double-deletion mutant of Fgdcl1 and Fgdcl2. Besides, more immature asci were observed in the double-deletion mutant. Interestingly, the up-regulated differentially expressed genes (DEGs) common to ΔFgdcl1 and ΔFgdcl1/2 were related to ion transmembrane transporter and membrane components. The combination of small RNA and transcriptome sequencing with bioinformatics analysis predicted 143 novel milRNAs in wild-type perithecia, and 138 of these milRNAs partly or absolutely depended on Fgdcl1, while only 5 novel milRNAs were still obtained in the Fgdcl1 and Fgdcl2 double-deletion mutant. Furthermore, 117 potential target genes were predicted. Overall, Fgdcl1 and Fgdcl2 genes were partly functionally redundant in ascospore discharge and perithecium-specific milRNA generation in F. graminearum, and these perithecium-specific milRNAs play potential roles in sexual development. PMID:29755439
Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C; Loros, Jennifer J; Kück, Ulrich
2007-05-01
The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41-EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41-EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi.
Nowrousian, Minou; Frank, Sandra; Koers, Sandra; Strauch, Peter; Weitner, Thomas; Ringelberg, Carol; Dunlap, Jay C.; Loros, Jennifer J.; Kück, Ulrich
2013-01-01
Summary The filamentous fungus Sordaria macrospora develops complex fruiting bodies (perithecia) to propagate its sexual spores. Here, we present an analysis of the sterile mutant pro41 that is unable to produce mature fruiting bodies. The mutant carries a deletion of 4 kb and is complemented by the pro41 open reading frame that is contained within the region deleted in the mutant. In silico analyses predict PRO41 to be an endoplasmic reticulum (ER) membrane protein, and a PRO41–EGFP fusion protein colocalizes with ER-targeted DsRED. Furthermore, Western blot analysis shows that the PRO41–EGFP fusion protein is present in the membrane fraction. A fusion of the predicted N-terminal signal sequence of PRO41 with EGFP is secreted out of the cell, indicating that the signal sequence is functional. pro41 transcript levels are upregulated during sexual development. This increase in transcript levels was not observed in the sterile mutant pro1 that lacks a transcription factor gene. Moreover, microarray analysis of gene expression in the mutants pro1, pro41 and the pro1/41 double mutant showed that pro41 is partly epistatic to pro1. Taken together, these data show that PRO41 is a novel ER membrane protein essential for fruiting body formation in filamentous fungi. PMID:17501918
Minniti, Alicia N; Labarca, Mariana; Hurtado, Claudia; Brandan, Enrique
2004-10-01
In Caenorhabditis elegans, the identification of many enzymes involved in the synthesis and modification of glycosaminoglycans (GAGs), essential components of proteoglycans, has attained special attention in recent years. Mutations in all the genes that encode for GAG biosynthetic enzymes show defects in the development of the vulva, specifically in the invagination of the vulval epithelium. Mutants for certain heparan sulfate modifying enzymes present axonal and cellular guidance defects in specific neuronal classes. Although most of the enzymes involved in the biosynthesis and modification of heparan sulfate have been characterized in C. elegans, little is known regarding the core proteins to which these GAGs covalently bind in proteoglycans. A single syndecan homologue (sdn-1) has been identified in the C. elegans genome through sequence analysis. In the present study, we show that C. elegans synthesizes sulfated proteoglycans, seen as three distinct species in western blot analysis. In the sdn-1 (ok449) deletion mutant allele we observed the lack of one species, which corresponds to a 50 kDa product after heparitinase treatment. The expression of sdn-1 mRNA and sequencing revealed that sdn-1 (ok449) deletion mutants lack two glycosylation sites. Hence, the missing protein in the western blot analysis probably corresponds to SDN-1. In addition, we show that SDN-1 localizes to the C. elegans nerve ring, nerve cords and to the vulva. SDN-1 is found specifically phosphorylated in nerve ring neurons and in the vulva, in both wild-type worms and sdn-1 (ok449) deletion mutants. These mutants show a defective egg-laying phenotype. Our results show for the first time, the identification, localization and some functional aspects of syndecan in the nematode C. elegans.
1992-01-01
To elucidate the structural basis for membrane attachment of the alpha subunit of the stimulatory G protein (Gs alpha), mutant Gs alpha cDNAs with deletions of amino acid residues in the amino and/or carboxy termini were transiently expressed in COS-7 cells. The particulate and soluble fractions prepared from these cells were analyzed by immunoblot using peptide specific antibodies to monitor distribution of the expressed proteins. Transfection of mutant forms of Gs alpha with either 26 amino terminal residues deleted (delta 3-28) or with 59 amino terminal residues deleted (delta 1-59) resulted in immunoreactive proteins which localized primarily to the particulate fraction. Similarly, mutants with 10 (delta 385-394), 32 (delta 353-384), or 42 (delta 353-394) amino acid residues deleted from the carboxy terminus also localized to the particulate fraction, as did a mutant form of Gs alpha lacking amino acid residues at both the amino and carboxy termini (delta 3-28)/(delta 353-384). Mutant and wild type forms of Gs alpha demonstrated a similar degree of tightness in their binding to membranes as demonstrated by treatment with 2.5 M NaCl or 6 M urea, but some mutant forms were relatively resistant compared with wild type Gs alpha to solubilization by 15 mM NaOH or 1% sodium cholate. We conclude that: (a) deletion of significant portions of the amino and/or carboxyl terminus of Gs alpha is still compatible with protein expression; (b) deletion of these regions is insufficient to cause cytosolic localization of the expressed protein. The basis of Gs alpha membrane targeting remains to be elucidated. PMID:1400589
Ríos, Gabino; Naranjo, Miguel A; Iglesias, Domingo J; Ruiz-Rivero, Omar; Geraud, Marion; Usach, Antonio; Talón, Manuel
2008-01-01
Background Many fruit-tree species, including relevant Citrus spp varieties exhibit a reproductive biology that impairs breeding and strongly constrains genetic improvements. In citrus, juvenility increases the generation time while sexual sterility, inbreeding depression and self-incompatibility prevent the production of homozygous cultivars. Genomic technology may provide citrus researchers with a new set of tools to address these various restrictions. In this work, we report a valuable genomics-based protocol for the structural analysis of deletion mutations on an heterozygous background. Results Two independent fast neutron mutants of self-incompatible clementine (Citrus clementina Hort. Ex Tan. cv. Clemenules) were the subject of the study. Both mutants, named 39B3 and 39E7, were expected to carry DNA deletions in hemizygous dosage. Array-based Comparative Genomic Hybridization (array-CGH) using a Citrus cDNA microarray allowed the identification of underrepresented genes in these two mutants. Subsequent comparison of citrus deleted genes with annotated plant genomes, especially poplar, made possible to predict the presence of a large deletion in 39B3 of about 700 kb and at least two deletions of approximately 100 and 500 kb in 39E7. The deletion in 39B3 was further characterized by PCR on available Citrus BACs, which helped us to build a partial physical map of the deletion. Among the deleted genes, ClpC-like gene coding for a putative subunit of a multifunctional chloroplastic protease involved in the regulation of chlorophyll b synthesis was directly related to the mutated phenotype since the mutant showed a reduced chlorophyll a/b ratio in green tissues. Conclusion In this work, we report the use of array-CGH for the successful identification of genes included in a hemizygous deletion induced by fast neutron irradiation on Citrus clementina. The study of gene content and order into the 39B3 deletion also led to the unexpected conclusion that microsynteny and local gene colinearity in this species were higher with Populus trichocarpa than with the phylogenetically closer Arabidopsis thaliana. This work corroborates the potential of Citrus genomic resources to assist mutagenesis-based approaches for functional genetics, structural studies and comparative genomics, and hence to facilitate citrus variety improvement. PMID:18691431
A 76-bp deletion in the Mip gene causes autosomal dominant cataract in Hfi mice.
Sidjanin, D J; Parker-Wilson, D M; Neuhäuser-Klaus, A; Pretsch, W; Favor, J; Deen, P M; Ohtaka-Maruyama, C; Lu, Y; Bragin, A; Skach, W R; Chepelinsky, A B; Grimes, P A; Stambolian, D E
2001-06-15
Hfi is a dominant cataract mutation where heterozygotes show hydropic lens fibers and homozygotes show total lens opacity. The Hfi locus was mapped to the distal part of mouse chromosome 10 close to the major intrinsic protein (Mip), which is expressed only in cell membranes of lens fibers. Molecular analysis of Mip revealed a 76-bp deletion that resulted in exon 2 skipping in Mip mRNA. In Hfi/Hfi this deletion resulted in a complete absence of the wildtype Mip. In contrast, Hfi/+ animals had the same amount of wildtype Mip as +/+. Results from pulse-chase expression studies excluded hetero-oligomerization of wildtype and mutant Mip as a possible mechanism for cataract formation in the Hfi/+. We propose that the cataract phenotype in the Hfi heterozygote mutant is due to a detrimental gain of function by the mutant Mip resulting in either cytotoxicity or disruption in processing of other proteins important for the lens. Cataract formation in the Hfi/Hfi mouse is probably a combined result of both the complete loss of wildtype Mip and a gain of function of the mutant Mip. Copyright 2001 Academic Press.
miR-11 regulates pupal size of Drosophila melanogaster via directly targeting Ras85D.
Li, Yao; Li, Shengjie; Jin, Ping; Chen, Liming; Ma, Fei
2017-01-01
MicroRNAs play diverse roles in various physiological processes during Drosophila development. In the present study, we reported that miR-11 regulates pupal size during Drosophila metamorphosis via targeting Ras85D with the following evidences: pupal size was increased in the miR-11 deletion mutant; restoration of miR-11 in the miR-11 deletion mutant rescued the increased pupal size phenotype observed in the miR-11 deletion mutant; ectopic expression of miR-11 in brain insulin-producing cells (IPCs) and whole body shows consistent alteration of pupal size; Dilps and Ras85D expressions were negatively regulated by miR-11 in vivo; miR-11 targets Ras85D through directly binding to Ras85D 3'-untranslated region in vitro; removal of one copy of Ras85D in the miR-11 deletion mutant rescued the increased pupal size phenotype observed in the miR-11 deletion mutant. Thus, our current work provides a novel mechanism of pupal size determination by microRNAs during Drosophila melanogaster metamorphosis. Copyright © 2017 the American Physiological Society.
Marmiroli, M; Pagano, L; Pasquali, F; Zappettini, A; Tosato, V; Bruschi, C V; Marmiroli, N
2016-01-01
The use of cadmium sulphide quantum dots (CdS QDs) is increasing, particularly in the electronics industry. Their size (1-10 nm in diameter) is, however, such that they can be taken up by living cells. Here, a bakers' yeast (Saccharomyces cerevisiae) deletion mutant collection has been exploited to provide a high-throughput means of revealing the genetic basis for tolerance/susceptibility to CdS QD exposure. The deletion of 112 genes, some associated with the abiotic stress response, some with various metabolic processes, some with mitochondrial organization, some with transport and some with DNA repair, reduced the level of tolerance to CdS QDs. A gene ontology analysis highlighted the role of oxidative stress in determining the cellular response. The transformation of sensitive mutants with centromeric plasmids harbouring DNA from a wild type strain restored the wild type growth phenotype when the complemented genes encoded either HSC82, DSK2 or ALD3. The use of these simple eukaryote knock-out mutants for functional toxicogenomic analysis will inform studies focusing on higher organisms.
van der Geize, R.; de Jong, W.; Hessels, G. I.; Grommen, A. W. F.; Jacobs, A. A. C.; Dijkhuizen, L.
2008-01-01
A novel method to efficiently generate unmarked in-frame gene deletions in Rhodococcus equi was developed, exploiting the cytotoxic effect of 5-fluorocytosine (5-FC) by the action of cytosine deaminase (CD) and uracil phosphoribosyltransferase (UPRT) enzymes. The opportunistic, intracellular pathogen R. equi is resistant to high concentrations of 5-FC. Introduction of Escherichia coli genes encoding CD and UPRT conferred conditional lethality to R. equi cells incubated with 5-FC. To exemplify the use of the codA::upp cassette as counter-selectable marker, an unmarked in-frame gene deletion mutant of R. equi was constructed. The supA and supB genes, part of a putative cholesterol catabolic gene cluster, were efficiently deleted from the R. equi wild-type genome. Phenotypic analysis of the generated ΔsupAB mutant confirmed that supAB are essential for growth of R. equi on cholesterol. Macrophage survival assays revealed that the ΔsupAB mutant is able to survive and proliferate in macrophages comparable to wild type. Thus, cholesterol metabolism does not appear to be essential for macrophage survival of R. equi. The CD-UPRT based 5-FC counter-selection may become a useful asset in the generation of unmarked in-frame gene deletions in other actinobacteria as well, as actinobacteria generally appear to be 5-FC resistant and 5-FU sensitive. PMID:18984616
Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan
2008-01-01
Background Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, ~4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. Results As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. Conclusion We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s). PMID:19055778
Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan
2008-12-03
Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, approximately 4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s).
Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan
2017-01-01
Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418
Geber, A; Hitchcock, C A; Swartz, J E; Pullen, F S; Marsden, K E; Kwon-Chung, K J; Bennett, J E
1995-01-01
We have cloned and sequenced the structural genes encoding the delta 5,6 sterol desaturase (ERG3 gene) and the 14 alpha-methyl sterol demethylase (ERG11 gene) from Candida glabrata L5 (leu2). Single and double mutants of these genes were created by gene deletion. The phenotypes of these mutants, including sterol profiles, aerobic viabilities, antifungal susceptibilities, and generation times, were studied. Strain L5D (erg3 delta::LEU2) accumulated mainly ergosta-7,22-dien-3 beta-ol, was aerobically viable, and remained susceptible to antifungal agents but had a slower generation time than its parent strain. L5LUD (LEU2 erg11 delta::URA3) strains required medium supplemented with ergosterol and an anaerobic environment for growth. A spontaneous aerobically viable mutant, L5LUD40R (LEU erg11 delta::URA3), obtained from L5LUD (LEU2 erg11 delta::URA3), was found to accumulate lanosterol and obtusifoliol, was resistant to azole antifungal agents, demonstrated some increase in resistance to amphotericin B, and exhibited a 1.86-fold increase in generation time in comparison with L5 (leu2). The double-deletion mutant L5DUD61 (erg3 delta::LEU2 erg11 delta::URA3) was aerobically viable, produced mainly 14 alpha-methyl fecosterol, and had the same antifungal susceptibility pattern as L5LUD40R (LEU2 erg11 delta::URA3), and its generation time was threefold greater than that of L5 (leu2). Northern (RNA) analysis revealed that the single-deletion mutants had a marked increase in message for the undeleted ERG3 and ERG11 genes. These results indicate that differences in antifungal susceptibilities and the restoration of aerobic viability exist between the C. glabrata ergosterol mutants created in this study and those sterol mutants with similar genetic lesions previously reported for Saccharomyces cerevisiae. PMID:8593007
Secretome Analysis Defines the Major Role of SecDF in Staphylococcus aureus Virulence
Quiblier, Chantal; Seidl, Kati; Roschitzki, Bernd; Zinkernagel, Annelies S.; Berger-Bächi, Brigitte; Senn, Maria M.
2013-01-01
The Sec pathway plays a prominent role in protein export and membrane insertion, including the secretion of major bacterial virulence determinants. The accessory Sec constituent SecDF has been proposed to contribute to protein export. Deletion of Staphylococcus aureus secDF has previously been shown to reduce resistance, to alter cell separation, and to change the expression of certain virulence factors. To analyse the impact of the secDF deletion in S. aureus on protein secretion, a quantitative secretome analysis was performed. Numerous Sec signal containing proteins involved in virulence were found to be decreased in the supernatant of the secDF mutant. However, two Sec-dependent hydrolases were increased in comparison to the wild type, suggesting additional indirect, regulatory effects to occur upon deletion of secDF. Adhesion, invasion, and cytotoxicity of the secDF mutant were reduced in human umbilical vein endothelial cells. Virulence was significantly reduced using a Galleria mellonella insect model. Altogether, SecDF is a promising therapeutic target for controlling S. aureus infections. PMID:23658837
Xie, Yi; Kolisnychenko, Vitaliy; Paul-Satyaseela, Maneesh; Elliott, Simon; Parthasarathy, Geetha; Yao, Yufeng; Plunkett, Guy; Blattner, Frederick R; Kim, Kwang Sik
2006-08-01
Escherichia coli K1 is the most common gram-negative bacterium causing neonatal meningitis, but the mechanisms by which E. coli K1 causes meningitis are not clear. We identified 22 E. coli RS218-derived genomic islands (RDIs), using a comparative genome analysis of meningitis-causing E. coli K1 strain RS218 (O18:K1:H7) and laboratory K-12 strain MG1655. Series of RDI deletion mutants were constructed and examined for phenotypes relevant to E. coli K1 meningitis. We identified 9 RDI deletion mutants (RDI 1, 4, 7, 12, 13, 16, 20, 21, and 22) that exhibited defects in meningitis development. RDI 16 and 21 mutants had profound defects in the induction of a high level of bacteremia in neonatal rats, and RDI 4 mutants exhibited a moderate defect in the induction of bacteremia. RDI 1 and 22 mutants showed defects in the ability to invade human brain microvascular endothelial cells (HBMECs), and RDI 12 mutants were defective in the ability to bind to HBMECs. RDI 13 and 20 mutants were defective in the ability to both bind to and invade HBMECs. RDI 7 mutants were defective in the induction of bacteremia and in the ability to both bind to and invade HBMECs. These results provide a framework for the future discovery and analysis of bacteremia and meningitis caused by E. coli K1 strain RS218.
Sander, Peter; Clark, Simon; Petrera, Agnese; Vilaplana, Cristina; Meuli, Michael; Selchow, Petra; Zelmer, Andrea; Mohanan, Deepa; Andreu, Nuria; Rayner, Emma; Dal Molin, Michael; Bancroft, Gregory J; Johansen, Pål; Cardona, Pere-Joan; Williams, Ann; Böttger, Erik C
2015-03-10
Having demonstrated previously that deletion of zinc metalloprotease zmp1 in Mycobacterium bovis BCG increased immunogenicity of BCG vaccines, we here investigated the protective efficacy of BCG zmp1 deletion mutants in a guinea pig model of tuberculosis infection. zmp1 deletion mutants of BCG provided enhanced protection by reducing the bacterial load of tubercle bacilli in the lungs of infected guinea pigs. The increased efficacy of BCG due to zmp1 deletion was demonstrated in both BCG Pasteur and BCG Denmark indicating that the improved protection by zmp1 deletion is independent from the BCG sub-strain. In addition, unmarked BCG Δzmp1 mutant strains showed a better safety profile in a CB-17 SCID mouse survival model than the parental BCG strains. Together, these results support the further development of BCG Δzmp1 for use in clinical trials. Copyright © 2015 Elsevier Ltd. All rights reserved.
Xu, Zhihui; Chen, Rongjuan; Si, Lanlan; Lu, Shanshan; Li, Xiaodong; Wang, Shuai; Zhang, Kai; Li, Jin; Han, Juqiang; Xu, Dongping
2016-01-01
Objective The impact of hepatitis B virus (HBV) preS/S-gene mutations on occult HBV infection (OBI) is not fully understood. This study characterized multiple novel HBV preS/S-gene mutants obtained from an OBI patient. Methods PreS/S-gene mutants were analyzed by clonal sequencing. Viral replication and expression were analyzed by transfecting HBV genomic recombinants into HepG2 cells. Results Twenty-one preS/S-gene mutants were cloned from four sequential serum samples, including 13 mutants that were not previously documented: (1) sI/T126V+sG145R; (2) preS1 nt 3014−3198 deletion; (3) preS1 nt 3046−3177 deletion; (4) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion; (5) preS1 nt 3046−3177 deletion+s115−116 “INGTST” insertion+sG145R; (6) preS1 nt 3115−3123 deletion+sQ129N; (7) preS1 nt 3115−3123 deletion+s126−127 “RPCMNCTI” insertion; (8) s115−116 “INGTST” insertion; (9) s115−116 “INGTST” insertion+sG145R; (10) s126−127 “RPCMNCTI” insertion; (11) preS1 nt 2848−2862 deletion+preS2 initiation codon M→I; (12) s122−123 “KSTGLCK” insertion+sQ129N; and (13) preS2 initiation codon M→I+s131−133TSM→NST. The proportion of preS1 nt 3046−3177 deletion and preS2 initiation codon M→I+s131−133TSM→NST mutants increased in the viral pool with prolonged disease. The 13 novel OBI-related mutants showed a 51.2−99.9% decrease in HBsAg levels compared with that of the wild type. Additional N-glycosylation-associated mutations, sQ129N and s131−133TSM→NST, but not s126−127 “RPCMNCTI,” greatly attenuated anti-HBs binding to HBsAg. Compared with the wild type, replication and surface antigen promoter II activity of the preS1 nt 3046−3177 deletion mutant decreased by 43.3% and 97.0%, respectively. Conclusion PreS/S-gene mutations may play coordinated roles in the presentation of OBI and might be associated with disease progression. This has implications for HBV diagnosis and vaccine improvement. PMID:27182775
Jia, Shangang; Li, Aixia; Morton, Kyla; Avoles-Kianian, Penny; Kianian, Shahryar F.; Zhang, Chi; Holding, David
2016-01-01
To better understand maize endosperm filling and maturation, we used γ-irradiation of the B73 maize reference line to generate mutants with opaque endosperm and reduced kernel fill phenotypes, and created a population of 1788 lines including 39 Mo17 × F2s showing stable, segregating, and viable kernel phenotypes. For molecular characterization of the mutants, we developed a novel functional genomics platform that combined bulked segregant RNA and exome sequencing (BSREx-seq) to map causative mutations and identify candidate genes within mapping intervals. To exemplify the utility of the mutants and provide proof-of-concept for the bioinformatics platform, we present detailed characterization of line 937, an opaque mutant harboring a 6203 bp in-frame deletion covering six exons within the Opaque-1 gene. In addition, we describe mutant line 146 which contains a 4.8 kb intragene deletion within the Sugary-1 gene and line 916 in which an 8.6 kb deletion knocks out a Cyclin A2 gene. The publically available algorithm developed in this work improves the identification of causative deletions and its corresponding gaps within mapping peaks. This study demonstrates the utility of γ-irradiation for forward genetics in large nondense genomes such as maize since deletions often affect single genes. Furthermore, we show how this classical mutagenesis method becomes applicable for functional genomics when combined with state-of-the-art genomics tools. PMID:27261000
Jiao, Yang; Guo, Rongxian; Tang, Peipei; Kang, Xilong; Yin, Junlei; Wu, Kaiyue; Geng, Shizhong; Li, Qiuchun; Sun, Jun; Xu, Xiulong; Zhou, Xiaohui; Gan, Junji; Jiao, Xinan; Liu, Xiufan; Pan, Zhiming
2017-03-03
Salmonella enterica serovar Enteritidis (S. Enteritidis) has emerged as one of the most important food-borne pathogens for humans. Lipopolysaccharide (LPS), as a component of the outer membrane, is responsible for the virulence and smooth-to-rough transition in S. Enteritidis. In this study, we screened S. Enteritidis signature-tagged transposon mutant library using monoclonal antibody against somatic O 9 antigen (O 9 MAb) and O 9 factor rabbit antiserum to identify novel genes that are involved in smooth-to-rough transition. A total of 480 mutants were screened and one mutant with transposon insertion in rfbG gene had smooth-to-rough transition phenotype. In order to verify the role of rfbG gene, an rfbG insertion or deletion mutant was constructed using λ-Red recombination system. Phenotypic and biological analysis revealed that rfbG insertion or deletion mutants were similar to the wild-type strain in growth rate and biochemical properties, but the swimming motility was reduced. SE Slide Agglutination test and ELISA test showed that rfbG mutants do not stimulate animals to produce agglutinating antibody. In addition, the half-lethal dose (LD 50 ) of the rfbG deletion mutant strain was 10 6.6 -fold higher than that of the parent strain in a mouse model when injected intraperitoneally. These data indicate that the rfbG gene is involved in smooth-to-rough transition, swimming motility and virulence of S. Enteritidis. Furthermore, somatic O-antigen antibody-based approach to screen signature-tagged transposon mutants is feasible to clarify LPS biosynthesis and to find suitable markers in DIVA-vaccine research.
Lee, Ji-Yeon; Kim, Lee-Han; Kim, Ha-Eun; Park, Jae-Sin; Han, Kap-Hoon; Han, Dong-Min
2013-12-01
The nsdD gene encoding a GATA type transcription factor positively controls sexual development in Aspergillus nidulans. According to microarray data, 20 genes that were upregulated by deleting nsdD during various life cycle stages were randomly selected and deleted for functional analysis. None of the mutants showed apparent changes in growth or development compared with those of the wild-type except the AN3154 gene that encodes a putative APSES transcription factor and is an ortholog of Saccharomyces cerevisiae swi4. Deleting AN3154 resulted in retarded growth and development, and the gene was named rgdA (retared growth and development). The rgdA deletion mutant developed a reduced number of conidia even under favorable conditions for asexual development. The retarded growth and development was partially suppressed by the veA1 mutation. The conidial heads of the mutant aborted, showing reduced and irregular shaped phialides. Fruiting body development was delayed compared with that in the wild-type. The mutant did not respond to various nutritional or environmental factors that affected the development patterns. The rgdA gene was expressed at low levels throughout the life cycle and was not significantly affected by several regulators of sexual and asexual development such as nsdD, veA, stuA, or brlA. However, the rgdA gene affected brlA and abaA expression, which function as key regulators of asexual sporulation, suggesting that rgdA functions upstream of those genes.
Yokota, Atsushi; Sawada, Kazunori; Wada, Masaru
In the 1980s, Shiio and coworkers demonstrated using random mutagenesis that the following three phenotypes were effective for boosting lysine production by Corynebacterium glutamicum: (1) low-activity-level citrate synthase (CS L ), (2) phosphoenolpyruvate carboxylase (PEPC) resistant to feedback inhibition by aspartic acid (PEPC R ), and (3) pyruvate kinase (PYK) deficiency. Here, we reevaluated these phenotypes and their interrelationship in lysine production using recombinant DNA techniques.The pyk deletion and PEPC R (D299N in ppc) independently showed marginal effects on lysine production, but both phenotypes synergistically increased lysine yield, demonstrating the importance of PEPC as an anaplerotic enzyme in lysine production. Similar effects were also found for glutamic acid production. CS L (S252C in gltA) further increased lysine yield. Thus, using molecular techniques, the combination of these three phenotypes was reconfirmed to be effective for lysine production. However, a simple CS L mutant showed instabilities in growth and lysine yield.Surprisingly, the pyk deletion was found to increase biomass production in wild-type C. glutamicum ATCC13032 under biotin-sufficient conditions. The mutant showed a 37% increase in growth (based on OD 660 ) compared with the ATCC13032 strain in a complex medium containing 100 g/L glucose. Metabolome analysis revealed the intracellular accumulation of excess precursor metabolites. Thus, their conversion into biomass was considered to relieve the metabolic distortion in the pyk-deleted mutant. Detailed physiological studies of various pyk-deleted mutants also suggested that malate:quinone oxidoreductase (MQO) is important to control both the intracellular oxaloacetic acid (OAA) level and respiration rate. These findings may facilitate the rational use of C. glutamicum in fermentation industries.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Layton, A.D.; Cross, F.T.; Steigler, G.L.
1994-12-31
We have exposed Big Blue{trademark} transgenic mice by inhalation to 320, 640 and 960 Working Level Months (WLM) of radon progeny. Mice were sacrificed after 3, 6 and 9 days; the time periods required to obtain the exposures. Control mice were also sacrificed at each time interval. In each case all tissues were excised, flash frozen in liquid nitrogen, and stored at -80{degrees}C for further analysis. Twelve lacI mutations have been isolated from the lung tissue of a mouse from the 960-WLM exposure group; the lacI genes from these mutants have been sequenced. Sequence data indicate that three of themore » mutants have a C;G deletion at BP 978 and are possibly clonal in origin. Two mutants have multiple events within the gene: one has a an A:T to C:G transversion and a C:G insertion separated by 291 BPs; the second has a G:C to A:T transition as well as an A:T deletion followed by 6 base pairs downstream by a T:A insertion. Other mutations include a single G:C to A:T transition, a two base pair deletion, and a C:G to T:A transition. Mutant plaques are being evaluated from individual mice at other dose levels. Time course experiments are also planned. These studies will help define the molecular fine structure of mutations induced by high-LET radiation exposure.« less
Atago, Yuki; Shimodaira, Jun; Araki, Naoto; Bin Othman, Nor'azizi; Zakaria, Zuriati; Fukuda, Masao; Futami, Junichiro; Hara, Hirofumi
2016-05-01
Rhodococcus jostii RHA1 (RHA1) degrades polychlorinated biphenyl (PCB) via co-metabolism with biphenyl. To identify the novel open reading frames (ORFs) that contribute to PCB/biphenyl metabolism in RHA1, we compared chromatin immunoprecipitation chip and transcriptomic data. Six novel ORFs involved in PCB/biphenyl metabolism were identified. Gene deletion mutants of these 6 ORFs were made and were tested for their ability to grow on biphenyl. Interestingly, only the ro10225 deletion mutant showed deficient growth on biphenyl. Analysis of Ro10225 protein function showed that growth of the ro10225 deletion mutant on biphenyl was recovered when exogenous recombinant Ro10225 protein was added to the culture medium. Although Ro10225 protein has no putative secretion signal sequence, partially degraded Ro10225 protein was detected in conditioned medium from wild-type RHA1 grown on biphenyl. This Ro10225 fragment appeared to form a complex with another PCB/biphenyl oxidation enzyme. These results indicated that Ro10225 protein is essential for the formation of the PCB/biphenyl dioxygenase complex in RHA1.
Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.
An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja
2015-03-01
Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.
Denoel, P A; Crawford, R M; Zygmunt, M S; Tibor, A; Weynants, V E; Godfroid, F; Hoover, D L; Letesson, J J
1997-01-01
A bacterioferritin (BFR) deletion mutant of Brucella melitensis 16M was generated by gene replacement. The deletion was complemented with a broad-host-range vector carrying the wild-type bfr gene, pBBR-bfr. The survival and growth of the mutant, B. melitensis PAD 2-78, were similar to those of its parental strain in human monocyte-derived macrophages (MDM). These results suggest that BFR is not essential for the intracellular survival of B. melitensis in human MDM. PMID:9317046
Ameziane-Le Hir, Sarah; Paboeuf, Gilles; Tascon, Christophe; Hubert, Jean-François; Le Rumeur, Elisabeth; Vié, Véronique; Raguénès-Nicol, Céline
2016-07-26
Dystrophin (DYS) is a membrane skeleton protein whose mutations lead to lethal Duchenne muscular dystrophy or to the milder Becker muscular dystrophy (BMD). One third of BMD "in-frame" exon deletions are located in the region that codes for spectrin-like repeats R16 to R21. We focused on four prevalent mutated proteins deleted in this area (called RΔ45-47, RΔ45-48, RΔ45-49, and RΔ45-51 according to the deleted exon numbers), analyzing protein/membrane interactions. Two of the mutants, RΔ45-48 and RΔ45-51, led to mild pathologies and displayed a similar triple coiled-coil structure as the full-length DYS R16-21, whereas the two others, RΔ45-47 and RΔ45-49, induced more severe pathologies and showed "fractional" structures unrelated to the normal one. To explore lipid packing, small unilamellar liposomes (SUVs) and planar monolayers were used at various initial surface pressures. The dissociation constants determined by microscale thermophoresis (MST) were much higher for the full-length DYS R161-21 than for the mutants; thus the wild type protein has weaker SUV binding. Comparing surface pressures after protein adsorption and analysis of atomic force microscopy images of mixed protein/lipid monolayers revealed that the mutants insert more into the lipid monolayer than the wild type does. In fact, in both models every deletion mutant showed more interactions with membranes than the full-length protein did. This means that mutations in the R16-21 part of dystrophin disturb the protein's molecular behavior as it relates to membranes, regardless of whether the accompanying pathology is mild or severe.
Bhatt, Sanjay; Schoenly, Nathan E.; Lee, Anna Y.; Nislow, Corey; Bobek, Libuse A.
2013-01-01
To compare the effects of four antimicrobial peptides (MUC7 12-mer, histatin 12-mer, cathelicidin KR20, and a peptide containing lactoferricin amino acids 1 to 11) on the yeast Saccharomyces cerevisiae, we employed a genomewide fitness screen of combined collections of mutants with homozygous deletions of nonessential genes and heterozygous deletions of essential genes. When an arbitrary fitness score cutoffs of 1 (indicating a fitness defect, or hypersensitivity) and −1 (indicating a fitness gain, or resistance) was used, 425 of the 5,902 mutants tested exhibited altered fitness when treated with at least one peptide. Functional analysis of the 425 strains revealed enrichment among the identified deletions in gene groups associated with the Gene Ontology (GO) terms “ribosomal subunit,” “ribosome biogenesis,” “protein glycosylation,” “vacuolar transport,” “Golgi vesicle transport,” “negative regulation of transcription,” and others. Fitness profiles of all four tested peptides were highly similar, particularly among mutant strains exhibiting the greatest fitness defects. The latter group included deletions in several genes involved in induction of the RIM101 signaling pathway, including several components of the ESCRT sorting machinery. The RIM101 signaling regulates response of yeasts to alkaline and neutral pH and high salts, and our data indicate that this pathway also plays a prominent role in regulating protective measures against all four tested peptides. In summary, the results of the chemical genomic screens of S. cerevisiae mutant collection suggest that the four antimicrobial peptides, despite their differences in structure and physical properties, share many interactions with S. cerevisiae cells and consequently a high degree of similarity between their modes of action. PMID:23208710
Takeuchi, Shinji; Yoshimura, Kenichi; Fujiwara, Tadami; Ando, Masahiko; Shimizu, Shinobu; Nagase, Katsuhiko; Hasegawa, Yoshinori; Takahashi, Toshiaki; Katakami, Nobuyuki; Inoue, Akira; Yano, Seiji
2017-01-01
The BIM deletion polymorphism is reported to be associated with poor outcomes of epidermal growth factor receptor (EGFR)-mutant non-small cell lung cancer (NSCLC) treated with EGFR-TKIs, including gefitinib. We have shown that a histone deacetylase inhibitor, vorinostat, can epigenetically restore BIM function and apoptosis sensitivity to EGFR-TKIs in EGFR-mutant NSCLC cells with BIM deletion polymorphisms. The purpose of this study is to determine the feasibility of combined treatment of vorinostat with gefitinib in BIM deletion polymorphism positive EGFR-mutant NSCLC patients. BIM deletion polymorphism positive EGFR-mutant NSCLC patients treated with at least one EGFR-TKI and one regimen of chemotherapy are being recruited to this study. Vorinostat (200-400 mg) will be administered orally once daily on days 1-7, and gefitinib 250 mg orally once daily on days 1-14. With a fixed dose of gefitinib, the dose of vorinostat will be escalated following a conventional 3+3 design. The primary endpoint is to define the maximum tolerated dose (MTD) of vorinostat combined with 250 mg of gefitinib. This is the first phase I study of combined therapy with vorinostat and gefitinib for NSCLC patients double selected for an EGFR mutation and BIM deletion polymorphism. J. Med. Invest. 64: 321-325, August, 2017.
[Changes of biological behavioral of E. coli K1 after ppk1 gene deletion].
Peng, Liang; Pan, Jiayun; Luo, Su; Yang, Zhenghui; Huang, Mufang; Cao, Hong
2014-06-01
To study the changes in biological behaviors of meningitis E. coli K1 strain E44 after deletion of polyphosphate kinase 1 (ppk1) gene and explore the role of ppk1 in the pathogenesis of E. coli K1-induced meningitis. The wild-type strain E. coli K1 and ppk1 deletion mutant were exposed to heat at 56 degrees celsius; for 6 min, and their survival rates were determined. The adhesion and invasion of the bacteria to human brain microvascular endothelial cells (HBMECs) were observed using electron microscopy and quantitative tests. HBMECs were co-incubated with wild-type strain or ppk1 deletion mutant, and the cytoskeleton rearrangement was observed under laser scanning confocal microscope. The survival rate of the ppk1 deletion mutant was significantly lower than that of the wild-type strain after heat exposure. The ppk1 deletion mutant also showed lowered cell adhesion and invasion abilities and weakened ability to induce cytoskeleton rearrangement in HBMECs. ppk1 gene is important for E.coli K1 for heat resistance, cell adhesion and invasion, and for inducing cytoskeletal rearrangement in HBMECs.
Co-ordination of NDH and Cup proteins in CO2 uptake in cyanobacterium Synechocystis sp. PCC 6803.
Han, Xunling; Sun, Nan; Xu, Min; Mi, Hualing
2017-06-01
High and low affinity CO2-uptake systems containing CupA (NDH-1MS) and CupB (NDH-1MS'), respectively, have been identified in Synechocystis sp. PCC 6803, but it is yet unknown how the complexes function in CO2 uptake. In this work, we found that deletion of cupB significantly lowered the growth of cells, and deletion of both cupA and cupB seriously suppressed the growth below pH 7.0 even under 3% CO2. The rate of photosynthetic oxygen evolution was decreased slightly by deletion of cupA but significantly by deletion of cupB and more severely by deletion of both cupA and cupB, especially in response to changed pH conditions under 3% CO2. Furthermore, we found that assembly of CupB into NDH-1MS' was dependent on NdhD4 and NdhF4. NDH-1MS' was not affected in the NDH-1MS-degradation mutant and NDH-1MS was not affected in the NDH-1MS'-degradation mutants, indicating the existence of independent CO2-uptake systems under high CO2 conditions. The light-induced proton gradient across thylakoid membranes was significantly inhibited in ndhD-deletion mutants, suggesting that NdhDs functions in proton pumping. The carbonic anhydrase activity was suppressed partly in the cupA- or cupB-deletion mutant but severely in the mutant with both cupA and cupB deletion, indicating that CupA and CupB function in conversion of CO2 to HCO3-. In turn, deletion of cup genes lowered the transthylakoid membrane proton gradient and deletion of ndhDs decreased the CO2 hydration. Our results suggest that NDH-1M provides an alkaline region to activate Cup proteins involved in CO2 uptake. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Complex mosaic CDKL5 deletion with two distinct mutant alleles in a 4-year-old girl.
Boutry-Kryza, Nadia; Ville, Dorothée; Labalme, Audrey; Calender, Alain; Dupont, Jean-Michel; Touraine, Renaud; Edery, Patrick; des Portes, Vincent; Sanlaville, Damien; Lesca, Gaetan
2014-08-01
Mutations of the CDKL5 gene cause early epileptic encephalopathy. Patients manifest refractory epilepsy, beginning before the age of 3 months, which is associated with severe psychomotor delay and features that overlap with Rett syndrome. We report here a patient with mosaicism for CDKL5 exonic deletion, with the presence of two mutant alleles. The affected 4-year-old girl presented with infantile spasms, beginning at the age of 9 months, but subsequent progression of the disease was consistent with the classical CDKL5-related phenotype. A deletion of exons 17 and 18 was suspected on the basis of Multiplex Ligation Probe Amplification analysis, but unexpected results for cDNA analysis, which showed the presence of an abnormal transcript with the deletion of exon 18 only, led us to suspect that two distinct events might have occurred. We used custom array-CGH to determine the size and breakpoints of these deletions. Exon 18 was deleted from one of the abnormal alleles, and exon 17 was deleted from the other. A Fork Stalling and Template Switching (FoSTeS) mechanism was proposed to explain the two events, given the presence of regions of microhomology at the breakpoints. We propose here an original involvement of the FoSTeS mechanism to explain the co-occurrence of these two events in the CDKL5 gene in a single patient. This patient highlights the difficulties involved in the detection of such abnormalities, particularly when they occur in a mosaic state and involve two distinct mutational events in a single gene. © 2014 Wiley Periodicals, Inc.
Pan, Qunxing; He, Kongwang; Wang, Yongshan; Wang, Xiaoli; Ouyang, Wei
2013-06-01
An antigen-delivery system based on hybrid virus-like particles (VLPs) formed by the self-assembly of the capsid VP2 protein of porcine parvovirus (PPV) and expressing foreign peptides offers an alternative method for vaccination. In this study, the three-dimensional structure of the PPV capsid protein and surface loops deletion mutants were analyzed to define essential domains in PPV VP2 for the assembly of VLPs. Electron microscopic analysis and SDS-PAGE analysis confirmed the presence of abundant VLPs in a loop2 deletion mutant of expected size and appropriate morphology. Loop4 and loop2-loop4 deletion mutants, however, resulted in a lower number of particles and the morphology of the particles was not well preserved. Furthermore, the green fluorescent protein (gfp) gene was used as a model. GFP was observed at the same level in displacements mutants. However, GFP displacement mutants in loop2 construct allowed better adaptation for the fusion GFP to be further displayed on the surface of the capsid-like structure. Immunogenicity study showed that there is no obvious difference in mice inoculated with rAd-VP2(Δloop2), rAd-VP2(Δloop4), rAd-VP2(Δloop2-Δloop4), and PPV inactivated vaccine. The results suggested the possibility of inserting simultaneously B and T cell epitopes in the surface loop2 and the N-terminus. The combination of different types of epitopes (B, CD4+, and CD8+) in different positions of the PPV particles opens the way to the development of highly efficient vaccines, able to stimulate at the same time the different branches of the immune system.
Liu, Qun; Liu, Wei; Zeng, Baosheng; Wang, Guirong; Hao, Dejun; Huang, Yongping
2017-07-01
Olfaction plays an essential role in many important insect behaviors such as feeding and reproduction. To detect olfactory stimuli, an odorant receptor co-receptor (Orco) is required. In this study, we deleted the Orco gene in the Lepidopteran model insect, Bombyx mori, using a binary transgene-based clustered regulatory interspaced short palindromic repeats (CRISPR)/Cas9 system. We initially generated somatic mutations in two targeted sites, from which we obtained homozygous mutants with deletion of a 866 base pair sequence. Because of the flight inability of B. mori, we developed a novel method to examine the adult mating behavior. Considering the specialization in larval feeding, we examined food selection behavior in Orco somatic mutants by the walking trail analysis of silkworm position over time. Single sensillum recordings indicated that the antenna of the homozygous mutant was unable to respond to either of the two sex pheromones, bombykol or bombykal. An adult mating behavior assay revealed that the Orco mutant displayed a significantly impaired mating selection behavior in response to natural pheromone released by a wild-type female moth as well as an 11:1 mixture of bombykol/bombykal. The mutants also exhibited a decreased response to bombykol and, similar to wild-type moths, they displayed no response to bombykal. A larval feeding behavior assay revealed that the Orco mutant displayed defective selection for mulberry leaves and different concentrations of the volatile compound cis-jasmone found in mulberry leaves. Deletion of BmOrco severely disrupts the olfactory system, suggesting that BmOrco is indispensable in the olfactory pathway. The approach used for generating somatic and homozygous mutations also highlights a novel method for mutagenesis. This study on BmOrco function provides insights into the insect olfactory system and also provides a paradigm for agroforestry pest control. Copyright © 2017 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Degreve, Leo; Silva, Luciene B.
The structure and hydration of insulin-like growth factor 1 and an inactive mutant lacking the C region have been investigated in aqueous solution by molecular dynamics simulation. The overall structures of the two polypeptide resemble those determined by NMR spectroscopy. The deletion of the C region in the wild polypeptide introduces structural stability in the mutant, leading to a better definition of the secondary structure elements. A detailed hydration analysis was performed using the radial distribution functions and energy distributions. The backbone of the mutant is in general more solvent accessible than the wild polypeptide backbone. The structural rearrangements induced in the mutant led to changes in the solvent exposition of Tyr24 and Tyr60, which are residues important for ligand-receptor complex formation. Tyr24 exhibited a similar degree of solvent exposition in both IGF-1 and in the mutant; however, its hydroxyl group in the wild polypeptide is better solvated than in the mutant. Tyr60 was found to be solvent exposed in the wild protein, while in the mutant the involvement of its hydroxyl group in intramolecular hydrogen bonds led to it being buried away from the solvent.
Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie
2014-01-01
Background Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. Methods The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. Results The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. Conclusion The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival. PMID:26767045
Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie
2014-11-01
Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geller, A.I.; Keyomarsi, K.; Bryan, J.
1990-11-01
The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less
Song, Li; Cui, Hongyu; Tang, Lijie; Qiao, Xinyuan; Liu, Min; Jiang, Yanping; Cui, Wen; Li, Yijing
2014-07-01
Integration plasmids are often used in constructing chromosomal mutations, as it enables the alternation of genes at any location by integration or replacement. Food-grade integration vectors can integrate into the host genome without introducing any selectable markers or residual bases, and the recombination often happens in non-coding region. In this study we used the temperature-sensitive pWV01 replicon to construct 2 chloramphenicol-resistant integration plasmids (pGBHC32-upp) containing the uracil phosphoribosyl transferase (upp) gene as a counterselective marker for Lactobacillus casei (L. casei) ATCC393 and Lactococcus lactis (L. lactis) MG1363. We then ligated the designed homologous arms to the pGBHC32-upp plasmids to allow their integration to the bacterial chromosome, and selected upp deletion mutants of L. casei ATCC393 and L. lactis MG1363 in the presence of 5-fluorouracil (5-FU). Analysis of genetic stability, growth curve, carbon utilization and scanning electronic microscopy showed that, except for 5-FU resistance, there were no significant differences between the wild type and mutant lactic acid bacteria. The integration system and the upp deletion strains could be used in the insertion or deletion of genes at any location of the chromosome of both L. casei ATCC 393 and L. lactis MG1363, and the homologous recombination would not introduce any selectable markers or residual bases. These mutant strains can be further investigated for heterologous protein expression and construction of a live mucosal vaccine carrier. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Yanan; Niu, Xiangfeng; Shi, Mengliang; Pei, Guangsheng; Zhang, Xiaoqing; Chen, Lei; Zhang, Weiwen
2015-01-01
Cyanobacteria have been engineered to produce ethanol through recent synthetic biology efforts. However, one major challenge to the cyanobacterial systems for high-efficiency ethanol production is their low tolerance to the ethanol toxicity. With a major goal to identify novel transporters involved in ethanol tolerance, we constructed gene knockout mutants for 58 transporter-encoding genes of Synechocystis sp. PCC 6803 and screened their tolerance change under ethanol stress. The efforts allowed discovery of a mutant of slr0982 gene encoding an ATP-binding cassette transporter which grew poorly in BG11 medium supplemented with 1.5% (v/v) ethanol when compared with the wild type, and the growth loss could be recovered by complementing slr0982 in the Δslr0982 mutant, suggesting that slr0982 is involved in ethanol tolerance in Synechocystis. To decipher the tolerance mechanism involved, a comparative metabolomic and network-based analysis of the wild type and the ethanol-sensitive Δslr0982 mutant was performed. The analysis allowed the identification of four metabolic modules related to slr0982 deletion in the Δslr0982 mutant, among which metabolites like sucrose and L-pyroglutamic acid which might be involved in ethanol tolerance, were found important for slr0982 deletion in the Δslr0982 mutant. This study reports on the first transporter related to ethanol tolerance in Synechocystis, which could be a useful target for further tolerance engineering. In addition, metabolomic and network analysis provides important findings for better understanding of the tolerance mechanism to ethanol stress in Synechocystis. PMID:26052317
Ichinose, Sakurako; Tanaka, Mizuki; Shintani, Takahiro; Gomi, Katsuya
2014-01-01
In filamentous fungi, the expression of secretory glycoside hydrolase encoding genes, such as those for amylases, cellulases, and xylanases, is generally repressed in the presence of glucose. CreA and CreB have been observed to be regulating factors for carbon catabolite repression. In this study, we generated single and double deletion creA and/or creB mutants in Aspergillus oryzae. The α-amylase activities of each strain were compared under various culture conditions. For the wild-type strain, mRNA levels of α-amylase were markedly decreased in the later stage of submerged culture under inducing conditions, whereas this reduced expression was not observed for single creA and double creA/creB deletion mutants. In addition, α-amylase activity of the wild-type strain was reduced in submerged culture containing high concentrations of inducing sugars, whereas all constructed mutants showed higher α-amylase activities. In particular, the α-amylase activity of the double deletion mutant in a medium containing 5% starch was >10-fold higher than that of the wild-type strain under the same culture conditions. In solid-state cultures using wheat bran as a substrate, the α-amylase activities of single creA and double deletion mutants were >2-fold higher than that of the wild-type strain. These results suggested that deleting both creA and creB resulted in dramatic improvements in the production of secretory glycoside hydrolases in filamentous fungi.
Athenstaedt, Karin; Zweytick, Dagmar; Jandrositz, Anita; Kohlwein, Sepp Dieter; Daum, Günther
1999-01-01
Lipid particles of the yeast Saccharomyces cerevisiae were isolated at high purity, and their proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Major lipid particle proteins were identified by mass spectrometric analysis, and the corresponding open reading frames (ORFs) were deduced. In silicio analysis revealed that all lipid particle proteins contain several hydrophobic domains but none or only few (hypothetical) transmembrane spanning regions. All lipid particle proteins identified by function so far, such as Erg1p, Erg6p, and Erg7p (ergosterol biosynthesis) and Faa1p, Faa4p, and Fat1p (fatty acid metabolism), are involved in lipid metabolism. Based on sequence homology, another group of three lipid particle proteins may be involved in lipid degradation. To examine whether lipid particle proteins of unknown function are also involved in lipid synthesis, mutants with deletions of the respective ORFs were constructed and subjected to systematic lipid analysis. Deletion of YDL193w resulted in a lethal phenotype which could not be suppressed by supplementation with ergosterol or fatty acids. Other deletion mutants were viable under standard conditions. Strains with YBR177c, YMR313c, and YKL140w deleted exhibited phospholipid and/or neutral lipid patterns that were different from the wild-type strain and thus may be further candidate ORFs involved in yeast lipid metabolism. PMID:10515935
Zurawski, S M; Zurawski, G
1988-01-01
We have analyzed structure--function relationships of the protein hormone murine interleukin 2 by fine structural deletion mapping. A total of 130 deletion mutant proteins, together with some substitution and insertion mutant proteins, was expressed in Escherichia coli and analyzed for their ability to sustain the proliferation of a cloned murine T cell line. This analysis has permitted a functional map of the protein to be drawn and classifies five segments of the protein, which together contain 48% of the sequence, as unessential to the biological activity of the protein. A further 26% of the protein is classified as important, but not crucial, for the activity. Three regions, consisting of amino acids 32-35, 66-77 and 119-141 contain the remaining 26% of the protein and are critical to the biological activity of the protein. The functional map is discussed in the context of the possible role of the identified critical regions in the structure of the hormone and its binding to the interleukin 2 receptor complex. Images PMID:3261239
Egener, Tanja; Martin, Dietmar E.; Sarkar, Abhijit; Reinhold-Hurek, Barbara
2001-01-01
The endophytic diazotroph Azoarcus sp. strain BH72 is capable of infecting rice roots and of expressing the nitrogenase (nif) genes there. In order to study the genetic background for nitrogen fixation in strain BH72, the structural genes of nitrogenase (nifHDK) were cloned and sequenced. The sequence analysis revealed an unusual gene organization: downstream of nifHDK, a ferredoxin gene (fdxN; 59% amino acid sequence identity to R. capsulatus FdxN) and open reading frames showing 52 and 36% amino acid sequence identity to nifY of Pseudomonas stutzeri A15 and ORF1 of Azotobacter vinelandii were located. Northern blot analysis, reverse transcriptase PCR and primer extension analysis revealed that these six genes are located on one transcript transcribed from a ς54-type promoter. Shorter transcripts sequentially missing genes of the 3′ part of the full-length mRNA were more abundantly detected. Mutational analyses suggested that FdxN is an important but not the essential electron donor for dinitrogenase reductase. An in-frame deletion of fdxN resulted in reduced growth rates (59% ± 9%) and nitrogenase activities (81%) in nitrogen-fixing pure cultures in comparison to the wild type. Nitrogenase activity was fully complemented in an fdxN mutant which carried a nifH promoter-driven fdxN gene in trans. Also, in coculture with the ascomycete Acremonium alternatum, where strain BH72 develops intracytoplasmic membrane stacks, the nitrogenase activity in the fdxN deletion mutant was decreased to 56% of the wild-type level. Surprisingly, the fdxN deletion also had an effect on the rapid “switch-off” of nitrogenase activity in response to ammonium. Wild-type strain BH72 and the deletion mutant complemented with fdxN in trans showed a rapid reversible inactivation of acetylene reduction, while the deletion mutant did not cease to reduce acetylene. In concordance with the hypothesis that changes in the redox state of NifH or electron flux towards nitrogenase may be involved in the mechanism of physiological nitrogenase switch-off, our results suggest that the ferredoxin may be a component involved in this process. PMID:11371540
Belfield, Eric J.; Gan, Xiangchao; Mithani, Aziz; Brown, Carly; Jiang, Caifu; Franklin, Keara; Alvey, Elizabeth; Wibowo, Anjar; Jung, Marko; Bailey, Kit; Kalwani, Sharan; Ragoussis, Jiannis; Mott, Richard; Harberd, Nicholas P.
2012-01-01
Ionizing radiation has long been known to induce heritable mutagenic change in DNA sequence. However, the genome-wide effect of radiation is not well understood. Here we report the molecular properties and frequency of mutations in phenotypically selected mutant lines isolated following exposure of the genetic model flowering plant Arabidopsis thaliana to fast neutrons (FNs). Previous studies suggested that FNs predominantly induce deletions longer than a kilobase in A. thaliana. However, we found a higher frequency of single base substitution than deletion mutations. While the overall frequency and molecular spectrum of fast-neutron (FN)–induced single base substitutions differed substantially from those of “background” mutations arising spontaneously in laboratory-grown plants, G:C>A:T transitions were favored in both. We found that FN-induced G:C>A:T transitions were concentrated at pyrimidine dinucleotide sites, suggesting that FNs promote the formation of mutational covalent linkages between adjacent pyrimidine residues. In addition, we found that FNs induced more single base than large deletions, and that these single base deletions were possibly caused by replication slippage. Our observations provide an initial picture of the genome-wide molecular profile of mutations induced in A. thaliana by FN irradiation and are particularly informative of the nature and extent of genome-wide mutation in lines selected on the basis of mutant phenotypes from FN-mutagenized A. thaliana populations. PMID:22499668
Prevalence and Clinical Relevance of Exon 2 Deletion of COMMD1 in Bedlington Terriers in Korea.
Kim, Y G; Kim, S Y; Kim, J H; Lee, K K; Yun, Y M
2016-11-01
Deletion of exon 2 of copper metabolism domain containing 1 (COMMD1) results in copper toxicosis in Bedlington terriers (CT-BT). This study was conducted to identify the prevalence and clinical relevance of the COMMD1 mutation in Bedlington terriers in Korea. A total of 105 purebred Bedlington terriers (50 males, 55 females) from the kennels and pet dog clubs in Korea were examined during the period 2008-2013. A multiplex PCR was carried out to detect exon 2 deletion of COMMD1. Clinical analysis was performed on each genetic group, and clinical status of the dogs was followed up to estimate survival probability. Of the 105 samples, 52 (49%) were wild-type homozygote, 47 (45%) were heterozygote, and 6 (6%) were mutant-type homozygote. Plasma alanine aminotransferase (ALT) activity was increased in the mutant-type homozygous group >2 years of age (P < .0001). The survival probability of 6 mutant-type homozygotes surviving 2.5 years was 0.67, and 4 years was 0.5. Results show the prevalence and clinical relevance of exon 2 deletion of COMMD1 and could help establish a structured selective breeding program to prevent CT-BT in Korea. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.
Ma, Ji-Yong; Yan, Hai-Jun; Gu, Wei
2015-01-01
BIM deletion polymorphism was deemed to be associated with downregulation of BIM, resulting in a decreased apoptosis induced by epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in EGFR mutation-positive non-small cell lung cancer (NSCLC). However, accumulating evidences concerning the association between BIM deletion polymorphism and efficacy of EGFR-TKI and survival in EGFR-mutation-driven NSCLC patient reported contradictory results. A meta-analysis was conducted by combing six original eligible studies including 871 NSCLC patients. Our study showed that BIM deletion polymorphism was significantly associated with poor response to EGFR-TKI therapy in mutant EGFRNSCLC patients (P(h) = 0.309, P(z) = 0.001, OR = 0.39, 95% confidence interval (CI) = 0.23-0.67). Disease control rate (DCR) in mutant EGFRNSCLC patient with treatment of EGFR-TKI was significantly decreased in patients with BIM deletion polymorphism comparing to patients harbored BIM wild variant (P(h) = 0.583, P(Z) = 0.007, OR = 0.46, 95%CI = 0.25-0.85). EGFR mutation-derived NSCLC patient carrying BIM deletion polymorphism had a shorter progression-free survival (PFS; P(h) < 0.001, P(z) < 0.001, hazard ratio (HR) = 1.37, 95%CI = 1.09-1.71) and overall survival (OS; P(h) = 0.90, P(z) = 0.003, HR = 1.25, 95%CI = 1.08-1.45), than those harbored BIM wild variant. These results suggested that BIM deletion polymorphism might be a cause that contributes to primary EGFR-TKI resistance, and it could be used as a genetic predictor for EGFR-TKI outcome and an independent prognostic factor of EGFR mutation-driven NSCLC patient.
Pobre, Vânia; Arraiano, Cecília M
2015-02-14
The RNA steady-state levels in the cell are a balance between synthesis and degradation rates. Although transcription is important, RNA processing and turnover are also key factors in the regulation of gene expression. In Escherichia coli there are three main exoribonucleases (RNase II, RNase R and PNPase) involved in RNA degradation. Although there are many studies about these exoribonucleases not much is known about their global effect in the transcriptome. In order to study the effects of the exoribonucleases on the transcriptome, we sequenced the total RNA (RNA-Seq) from wild-type cells and from mutants for each of the exoribonucleases (∆rnb, ∆rnr and ∆pnp). We compared each of the mutant transcriptome with the wild-type to determine the global effects of the deletion of each exoribonucleases in exponential phase. We determined that the deletion of RNase II significantly affected 187 transcripts, while deletion of RNase R affects 202 transcripts and deletion of PNPase affected 226 transcripts. Surprisingly, many of the transcripts are actually down-regulated in the exoribonuclease mutants when compared to the wild-type control. The results obtained from the transcriptomic analysis pointed to the fact that these enzymes were changing the expression of genes related with flagellum assembly, motility and biofilm formation. The three exoribonucleases affected some stable RNAs, but PNPase was the main exoribonuclease affecting this class of RNAs. We confirmed by qPCR some fold-change values obtained from the RNA-Seq data, we also observed that all the exoribonuclease mutants were significantly less motile than the wild-type cells. Additionally, RNase II and RNase R mutants were shown to produce more biofilm than the wild-type control while the PNPase mutant did not form biofilms. In this work we demonstrate how deep sequencing can be used to discover new and relevant functions of the exoribonucleases. We were able to obtain valuable information about the transcripts affected by each of the exoribonucleases and compare the roles of the three enzymes. Our results show that the three exoribonucleases affect cell motility and biofilm formation that are two very important factors for cell survival, especially for pathogenic cells.
Altered Actions of Memantine and NMDA-Induced Currents in a New Grid2-Deleted Mouse Line
Kumagai, Ayako; Fujita, Akira; Yokoyama, Tomoki; Nonobe, Yuki; Hasaba, Yasuhiro; Sasaki, Tsutomu; Itoh, Yumi; Koura, Minako; Suzuki, Osamu; Adachi, Shigeki; Ryo, Haruko; Kohara, Arihiro; Tripathi, Lokesh P.; Sanosaka, Masato; Fukushima, Toshiki; Takahashi, Hiroyuki; Kitagawa, Kazuo; Nagaoka, Yasuo; Kawahara, Hidehisa; Mizuguchi, Kenji; Nomura, Taisei; Matsuda, Junichiro; Tabata, Toshihide; Takemori, Hiroshi
2014-01-01
Memantine is a non-competitive antagonist of the N-methyl-d-aspartate (NMDA) receptor, and is an approved drug for the treatment of moderate-to-severe Alzheimer’s disease. We identified a mouse strain with a naturally occurring mutation and an ataxic phenotype that presents with severe leg cramps. To investigate the phenotypes of these mutant mice, we screened several phenotype-modulating drugs and found that memantine (10 mg/kg) disrupted the sense of balance in the mutants. Moreover, the mutant mice showed an attenuated optokinetic response (OKR) and impaired OKR learning, which was also observed in wild-type mice treated with memantine. Microsatellite analyses indicated that the Grid2 gene-deletion is responsible for these phenotypes. Patch-clamp analysis showed a relatively small change in NMDA-dependent current in cultured granule cells from Grid2 gene-deleted mice, suggesting that GRID2 is important for correct NMDA receptor function. In general, NMDA receptors are activated after the activation of non-NMDA receptors, such as AMPA receptors, and AMPA receptor dysregulation also occurs in Grid2 mutant mice. Indeed, the AMPA treatment enhanced memantine susceptibility in wild-type mice, which was indicated by balance sense and OKR impairments. The present study explores a new role for GRID2 and highlights the adverse effects of memantine in different genetic backgrounds. PMID:25513882
NASA Technical Reports Server (NTRS)
McGuinness, S. M.; Shibuya, M. L.; Ueno, A. M.; Vannais, D. B.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)
1995-01-01
We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian AL human-hamster hybrid cells exposed to 137Cs gamma radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1- mutants by 137Cs gamma radiation. Molecular analysis of 235 S1- mutants using a series of DNA probes mapped to the human chromosome 11 in the AL hybrid cells revealed that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, 137Cs gamma rays alone or 137Cs gamma rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These "complex" mutations were rare for 137Cs gamma irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by 137Cs gamma irradiation.
Kochneva, G V; Kolosova, I V; Lupan, T A; Sivolobova, G F; Iudin, P V; Grazhdantseva, A A; Riabchikova, E I; Kandrina, N Iu; Shchelkunov, S N
2009-01-01
Mousepox (ectromelia) virus genome contains four genes encoding for kelch-like proteins EVM018, EVM027, EVM150 and EVM167. A complete set of insertion plasmids was constructed to allow the production of recombinant ectromelia viruses with targeted deletions of one to four genes of kelch family both individually (single mutants) and in different combinations (double, triple and quadruple mutants). It was shown that deletion of any of the three genes EVMO18, EVM027 or EVM167 resulted in reduction of 50% lethal dose (LD50) by five and more orders in outbred white mice infected intraperitoneally. Deletion of mousepox kelch-gene EVM150 did not influence the virus virulence. Two or more kelch-genes deletion also resulted in high level of attenuation, which could evidently be due to the lack of three genes EVM167, EVM018 and/or EVM027 identified as virulence factors. The local inflammatory process on the model of intradermal injection of mouse ear pinnae (vasodilatation level, hyperemia, cutaneous edema, arterial thrombosis) was significantly more intensive for wild type virus and virulent mutant deltaEVM150 in comparison with avirulent mutant AEVM167.
Sajid, Mohammed; Chevalley-Maurel, Séverine; Ramesar, Jai; Klop, Onny; Franke-Fayard, Blandine M. D.; Janse, Chris J.; Khan, Shahid M.
2011-01-01
Research on the biology of malaria parasites has greatly benefited from the application of reverse genetic technologies, in particular through the analysis of gene deletion mutants and studies on transgenic parasites that express heterologous or mutated proteins. However, transfection in Plasmodium is limited by the paucity of drug-selectable markers that hampers subsequent genetic modification of the same mutant. We report the development of a novel ‘gene insertion/marker out’ (GIMO) method for two rodent malaria parasites, which uses negative selection to rapidly generate transgenic mutants ready for subsequent modifications. We have created reference mother lines for both P. berghei ANKA and P. yoelii 17XNL that serve as recipient parasites for GIMO-transfection. Compared to existing protocols GIMO-transfection greatly simplifies and speeds up the generation of mutants expressing heterologous proteins, free of drug-resistance genes, and requires far fewer laboratory animals. In addition we demonstrate that GIMO-transfection is also a simple and fast method for genetic complementation of mutants with a gene deletion or mutation. The implementation of GIMO-transfection procedures should greatly enhance Plasmodium reverse-genetic research. PMID:22216235
Hu, Liyan; Pandey, Amit V; Eggimann, Sandra; Rüfenacht, Véronique; Möslinger, Dorothea; Nuoffer, Jean-Marc; Häberle, Johannes
2013-11-29
Argininosuccinic aciduria (ASA) is an autosomal recessive urea cycle disorder caused by deficiency of argininosuccinate lyase (ASL) with a wide clinical spectrum from asymptomatic to severe hyperammonemic neonatal onset life-threatening courses. We investigated the role of ASL transcript variants in the clinical and biochemical variability of ASA. Recombinant proteins for ASL wild type, mutant p.E189G, and the frequently occurring transcript variants with exon 2 or 7 deletions were (co-)expressed in human embryonic kidney 293T cells. We found that exon 2-deleted ASL forms a stable truncated protein with no relevant activity but a dose-dependent dominant negative effect on enzymatic activity after co-expression with wild type or mutant ASL, whereas exon 7-deleted ASL is unstable but seems to have, nevertheless, a dominant negative effect on mutant ASL. These findings were supported by structural modeling predictions for ASL heterotetramer/homotetramer formation. Illustrating the physiological relevance, the predominant occurrence of exon 7-deleted ASL was found in two patients who were both heterozygous for the ASL mutant p.E189G. Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. Especially, the exon 2-deleted ASL variant may form a heterotetramer with wild type or mutant ASL, causing markedly reduced ASL activity.
Somaraju Chalasani, Madhavi Latha; Muppirala, Madhavi; G Ponnam, Surya Prakash; Kannabiran, Chitra; Swarup, Ghanshyam
2013-01-01
Mutations in the eye lens gap junction protein connexin 50 cause cataract. Earlier we identified a frameshift mutant of connexin 50 (c.670insA; p.Thr203AsnfsX47) in a family with autosomal recessive cataract. The mutant protein is smaller and contains 46 aberrant amino acids at the C-terminus after amino acid 202. Here, we have analysed this frameshift mutant and observed that it localized to the endoplasmic reticulum (ER) but not in the plasma membrane. Moreover, overexpression of the mutant resulted in disintegration of the ER-Golgi intermediate compartment (ERGIC), reduction in the level of ERGIC-53 protein and breakdown of the Golgi in many cells. Overexpression of the frameshift mutant partially inhibited the transport of wild type connexin 50 to the plasma membrane. A deletion mutant lacking the aberrant sequence showed predominant localization in the ER and inhibited anterograde protein transport suggesting, therefore, that the aberrant sequence is not responsible for improper localization of the frameshift mutant. Further deletion analysis showed that the fourth transmembrane domain and a membrane proximal region (231-294 amino acids) of the cytoplasmic domain are needed for transport from the ER and localization to the plasma membrane. Our results show that a frameshift mutant of connexin 50 mislocalizes to the ER and causes disintegration of the ERGIC and Golgi. We have also identified a sequence of connexin 50 crucial for transport from the ER and localization to the plasma membrane.
Hattori, Mai; Ishikawa, Osamu; Oikawa, Daisuke; Amano, Hiroo; Yasuda, Masahito; Kaira, Kyoichi; Ishida-Yamamoto, Akemi; Nakano, Hajime; Sawamura, Daisuke; Terawaki, Shin-Ichi; Wakamatsu, Kaori; Tokunaga, Fuminori; Shimizu, Akira
2018-03-21
Piebaldism is a pigmentary disorder characterized by a white forelock and depigmented patches. Although the loss-of-function mutations in the KIT gene underlie the disease, the intracellular dynamics of the mutant KIT are largely unknown. We herein report a Japanese family with piebaldism in which the affected members showed a mild phenotype. The objective of this study is to investigate the functions and intracellular dynamics of the mutant KIT protein. We performed genetic analyses of the KIT gene using peripheral blood cells. We analyzed the intracellular localization of the mutant KIT protein in HEK293T cells transfected with wild-type (Wt) and/or mutant KIT genes. Immunoprecipitation analyses, immunoblotting and immunofluorescence studies were performed using antibodies against KIT and downstream signaling proteins. Glycosidase digestion analysis was performed to clarify the intracellular localization of KIT protein. A genetic analysis revealed a novel heterozygous mutation c.645_650delTGTGTC which results in the in-frame deletion of Val 216 and Ser 217 in the extracellular domain of KIT. Immunoprecipitation analyses confirmed that the wild and mutant KIT formed a heterodimer after treatment with stem cell factor (SCF); however, the phosphorylation of the downstream signaling factors was decreased. In an immunofluorescence study, the mutant KIT accumulated predominantly in the endoplasmic reticulum (ER) and was sparsely expressed on the cell surface. A glycosidase digestion study revealed that the mutant KIT is predominantly localized in the ER. These data reveal an aberrant function and intracellular localization of mutant KIT protein in piebaldism. Copyright © 2018 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.
Zhu, Congyi; Wang, Weili; Wang, Mingshuang; Ruan, Ruoxin; Sun, Xuepeng; He, Meixian; Mao, Cungui; Li, Hongye
2015-04-01
GDP-mannose:inositol-phosphorylceramide (MIPC) and its derivatives are important for Ca(2+) sensitization of Saccharomyces cerevisiae and for the virulence of Candida albicans, but its role in the virulence of plant fungal pathogens remains unclear. In this study, we report the identification and functional characterization of PdMit1, the gene encoding MIPC synthase in Penicillium digitatum, one of the most important pathogens of postharvest citrus fruits. To understand the function of PdMit1, a PdMit1 deletion mutant was generated. Compared to its wild-type control, the PdMit1 deletion mutant exhibited slow radial growth, decreased conidia production and delayed conidial germination, suggesting that PdMit1 is important for the growth of mycelium, sporulation and conidial germination. The PdMit1 deletion mutant also showed hypersensitivity to Ca(2+). Treatment with 250 mmol/l Ca(2+) induced vacuole fusion in the wild-type strain, but not in the PdMit1 deletion mutant. Treatment with 250mmol/lCaCl2 upregulated three Ca(2+)-ATPase genes in the wild-type strain, and this was significantly inhibited in the PdMit1 deletion mutant. These results suggest that PdMit1 may have a role in regulating vacuole fusion and expression of Ca(2+)-ATPase genes by controlling biosynthesis of MIPC, and thereby imparts P. digitatum Ca(2+) tolerance. However, we found that PdMit1 is dispensable for virulence of P. digitatum. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Yamamoto, O; Takakusa, N; Mishima, Y; Kominami, R; Muramatsu, M
1984-01-01
Sequences required for a faithful and efficient transcription of a cloned mouse ribosomal RNA gene (rDNA) are determined by testing a series of deletion mutants in an in vitro transcription system utilizing two kinds of mouse cellular extract. Deletion of sequences upstream of -40 or downstream of +52 causes only slight reduction in promoter activity as compared with the "wild-type" template. For upstream deletion mutants, the removal of a sequence between -40 and -35 causes a significant decrease in the capacity to direct efficient initiation. This decrease becomes more pronounced when the deletion reaches -32 and the sequence A-T-C-T-T-T, conserved among mouse, rat, and human rDNAs, is lost. Residual template activity is further reduced as more upstream sequence is deleted and finally becomes undetectable when the deletion is extended from -22 down to -17, corresponding to the loss of the conserved sequence T-A-T-T-G. As for downstream deletion mutants, the removal of the sequence downstream of +23 causes some (and further deletions up to +11 cause a more) serious decrease in template activity in vitro. These deletions involve other conserved sequences downstream of the transcription start site. However, the removal of the original transcription start site does not abolish the transcription initiation completely, provided that the whole upstream sequence is intact. Images PMID:6320178
Guo, Yunqing; Hu, Di; Guo, Jie; Li, Xiaowen; Guo, Jinyue; Wang, Xiliang; Xiao, Yuncai; Jin, Hui; Liu, Mei; Li, Zili; Bi, Dingren; Zhou, Zutao
2017-01-01
Riemerella anatipestifer, an avian pathogen, has resulted in enormous economic losses to the duck industry globally. Notwithstanding, little is known regarding the physiological, pathogenic and virulence mechanisms of Riemerella anatipestifer (RA) infection. However, the role of Ferric uptake regulator (Fur) in the virulence of R. anatipestifer has not, to date, been demonstrated. Using a genetic approach, unmarked gene deletion system, we evaluated the function of fur gene in the virulence of R. anatipestifer. For this purpose, we constructed a suicide vector containing pheS as a counter selectable marker for unmarked deletion of fur gene to investigate its role in the virulence. After successful transformation of the newly constructed vector, a mutant strain was characterized for genes regulated by iron and Fur using RNA-sequencing and a comparison was made between wild type and mutant strains in both iron restricted and enriched conditions. RNA-seq analysis of the mutant strain in a restricted iron environment showed the downregulation and upregulation of genes which were involved in either important metabolic pathways, transport processes, growth or cell membrane synthesis. Electrophoretic mobility shift assay was performed to identify the putative sequences recognized by Fur. The putative Fur-box sequence was 5′-GATAATGATAATCATTATC-3′. Lastly, the median lethal dose and histopathological investigations of animal tissues also illustrated mild pathological lesions produced by the mutant strain as compared to the wild type RA strain, hence showing declined virulence. Conclusively, an unmarked gene deletion system was successfully developed for RA and the role of the fur gene in virulence was explored comprehensively. PMID:28971067
Rapid and efficient galactose fermentation by engineered Saccharomyces cerevisiae.
Quarterman, Josh; Skerker, Jeffrey M; Feng, Xueyang; Liu, Ian Y; Zhao, Huimin; Arkin, Adam P; Jin, Yong-Su
2016-07-10
In the important industrial yeast Saccharomyces cerevisiae, galactose metabolism requires energy production by respiration; therefore, this yeast cannot metabolize galactose under strict anaerobic conditions. While the respiratory dependence of galactose metabolism provides benefits in terms of cell growth and population stability, it is not advantageous for producing fuels and chemicals since a substantial fraction of consumed galactose is converted to carbon dioxide. In order to force S. cerevisiae to use galactose without respiration, a subunit (COX9) of a respiratory enzyme was deleted, but the resulting deletion mutant (Δcox9) was impaired in terms of galactose assimilation. Interestingly, after serial sub-cultures on galactose, the mutant evolved rapidly and was able to use galactose via fermentation only. The evolved strain (JQ-G1) produced ethanol from galactose with a 94% increase in yield and 6.9-fold improvement in specific productivity as compared to the wild-type strain. (13)C-metabolic flux analysis demonstrated a three-fold reduction in carbon flux through the TCA cycle of the evolved mutant with redirection of flux toward the fermentation pathway. Genome sequencing of the JQ-G1 strain revealed a loss of function mutation in a master negative regulator of the Leloir pathway (Gal80p). The mutation (Glu348*) in Gal80p was found to act synergistically with deletion of COX9 for efficient galactose fermentation, and thus the double deletion mutant Δcox9Δgal80 produced ethanol 2.4 times faster and with 35% higher yield than a single knockout mutant with deletion of GAL80 alone. When we introduced a functional COX9 cassette back into the JQ-G1 strain, the JQ-G1-COX9 strain showed a 33% reduction in specific galactose uptake rate and a 49% reduction in specific ethanol production rate as compared to JQ-G1. The wild-type strain was also subjected to serial sub-cultures on galactose but we failed to isolate a mutant capable of utilizing galactose without respiration. We concluded that the metabolic "death valley" (i.e. no galactose utilization by the Δcox9 mutant) is a necessary intermediate phenotype to facilitate galactose utilization without respiration in yeast. The results in this study demonstrate a promising approach for directing adaptive evolution toward fermentative metabolism and for generating evolved yeast strains with improved phenotypes under anaerobic conditions. Copyright © 2016 Elsevier B.V. All rights reserved.
Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko
2016-01-01
Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Raterman, Erica L; Shapiro, Daniel D; Stevens, Daniel J; Schwartz, Kevin J; Welch, Rodney A
2013-09-01
During urinary tract infections (UTIs), uropathogenic Escherichia coli must maintain a delicate balance between sessility and motility to achieve successful infection of both the bladder and kidneys. Previous studies showed that cyclic dimeric GMP (c-di-GMP) levels aid in the control of the transition between motile and nonmotile states in E. coli. The yfiRNB locus in E. coli CFT073 contains genes for YfiN, a diguanylate cyclase, and its activity regulators, YfiR and YfiB. Deletion of yfiR yielded a mutant that was attenuated in both the bladder and the kidneys when tested in competition with the wild-type strain in the murine model of UTI. A double yfiRN mutant was not attenuated in the mouse model, suggesting that unregulated YfiN activity and likely increased cytoplasmic c-di-GMP levels cause a survival defect. Curli fimbriae and cellulose production were increased in the yfiR mutant. Expression of yhjH, a gene encoding a proven phosphodiesterase, in CFT073 ΔyfiR suppressed the overproduction of curli fimbriae and cellulose and further verified that deletion of yfiR results in c-di-GMP accumulation. Additional deletion of csgD and bcsA, genes necessary for curli fimbriae and cellulose production, respectively, returned colonization levels of the yfiR deletion mutant to wild-type levels. Peroxide sensitivity assays and iron acquisition assays displayed no significant differences between the yfiR mutant and the wild-type strain. These results indicate that dysregulation of c-di-GMP production results in pleiotropic effects that disable E. coli in the urinary tract and implicate the c-di-GMP regulatory system as an important factor in the persistence of uropathogenic E. coli in vivo.
Le Guennec, Kilan; Veugelen, Sarah; Quenez, Olivier; Szaruga, Maria; Rousseau, Stéphane; Nicolas, Gaël; Wallon, David; Fluchere, Frédérique; Frébourg, Thierry; De Strooper, Bart; Campion, Dominique; Chávez-Gutiérrez, Lucía; Rovelet-Lecrux, Anne
2017-08-01
Presenilin 1 (PSEN1) mutations are the main cause of autosomal dominant Early-onset Alzheimer Disease (EOAD). Among them, deletions of exon 9 have been reported to be associated with a phenotype of spastic paraparesis. Using exome data from a large sample of 522 EOAD cases and 584 controls to search for genomic copy-number variations (CNVs), we report here a novel partial, in-frame deletion of PSEN1, removing both exons 9 and 10. The patient presented with memory impairment associated with spastic paraparesis, both starting from the age of 56years. He presented a positive family history of EOAD. We performed functional analysis to elucidate the impact of this novel deletion on PSEN1 activity as part of the γ-secretase complex. The deletion does not affect the assembly of a mature protease complex but has an extreme impact on its global endopeptidase activity. The mutant carboxypeptidase-like activity is also strongly impaired and the deleterious mutant effect leads to an incomplete digestion of long Aβ peptides and enhances the production of Aβ43, which has been shown to be potently amyloidogenic and neurotoxic in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.
The effect of amino acid deletions and substitutions in the longest loop of GFP
Flores-Ramírez, Gabriela; Rivera, Manuel; Morales-Pablos, Alfredo; Osuna, Joel; Soberón, Xavier; Gaytán, Paul
2007-01-01
Background The effect of single and multiple amino acid substitutions in the green fluorescent protein (GFP) from Aequorea victoria has been extensively explored, yielding several proteins of diverse spectral properties. However, the role of amino acid deletions in this protein -as with most proteins- is still unknown, due to the technical difficulties involved in generating combinatorial in-phase amino acid deletions on a target region. Results In this study, the region I129-L142 of superglo GFP (sgGFP), corresponding to the longest loop of the protein and located far away from the central chromophore, was subjected to a random amino acid deletion approach, employing an in-house recently developed mutagenesis method termed Codon-Based Random Deletion (COBARDE). Only two mutants out of 16384 possible variant proteins retained fluorescence: sgGFP-Δ I129 and sgGFP-Δ D130. Interestingly, both mutants were thermosensitive and at 30°C sgGFP-Δ D130 was more fluorescent than the parent protein. In contrast with deletions, substitutions of single amino acids from residues F131 to L142 were well tolerated. The substitution analysis revealed a particular importance of residues F131, G135, I137, L138, H140 and L142 for the stability of the protein. Conclusion The behavior of GFP variants with both amino acid deletions and substitutions demonstrate that this loop is playing an important structural role in GFP folding. Some of the amino acids which tolerated any substitution but no deletion are simply acting as "spacers" to localize important residues in the protein structure. PMID:17594481
Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.; ...
2014-12-04
In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lewis, Derrick L.; Notey, Jaspreet S.; Chandrayan, Sanjeev K.
In this paper, a mutant (‘lab strain’) of the hyperthermophilic archaeon Pyrococcus furiosus DSM3638 exhibited an extended exponential phase and atypical cell aggregation behavior. Genomic DNA from the mutant culture was sequenced and compared to wild-type (WT) DSM3638, revealing 145 genes with one or more insertions, deletions, or substitutions (12 silent, 33 amino acid substitutions, and 100 frame shifts). Approximately, half of the mutated genes were transposases or hypothetical proteins. The WT transcriptome revealed numerous changes in amino acid and pyrimidine biosynthesis pathways coincidental with growth phase transitions, unlike the mutant whose transcriptome reflected the observed prolonged exponential phase. Targetedmore » gene deletions, based on frame-shifted ORFs in the mutant genome, in a genetically tractable strain of P. furiosus (COM1) could not generate the extended exponential phase behavior observed for the mutant. For example, a putative radical SAM family protein (PF2064) was the most highly up-regulated ORF (>25-fold) in the WT between exponential and stationary phase, although this ORF was unresponsive in the mutant; deletion of this gene in P. furiosus COM1 resulted in no apparent phenotype. On the other hand, frame-shifting mutations in the mutant genome negatively impacted transcription of a flagellar biosynthesis operon (PF0329-PF0338).Consequently, cells in the mutant culture lacked flagella and, unlike the WT, showed minimal evidence of exopolysaccharide-based cell aggregation in post-exponential phase. Finally, electron microscopy of PF0331-PF0337 deletions in P. furiosus COM1 showed that absence of flagella impacted normal cell aggregation behavior and, furthermore, indicated that flagella play a key role, beyond motility, in the growth physiology of P. furiosus.« less
Hirano, Tomonari; Kazama, Yusuke; Ishii, Kotaro; Ohbu, Sumie; Shirakawa, Yuki; Abe, Tomoko
2015-04-01
Heavy-ion beams are widely used for mutation breeding and molecular biology. Although the mutagenic effects of heavy-ion beam irradiation have been characterized by sequence analysis of some restricted chromosomal regions or loci, there have been no evaluations at the whole-genome level or of the detailed genomic rearrangements in the mutant genomes. In this study, using array comparative genomic hybridization (array-CGH) and resequencing, we comprehensively characterized the mutations in Arabidopsis thaliana genomes irradiated with Ar or Fe ions. We subsequently used this information to investigate the mutagenic effects of the heavy-ion beams. Array-CGH demonstrated that the average number of deleted areas per genome were 1.9 and 3.7 following Ar-ion and Fe-ion irradiation, respectively, with deletion sizes ranging from 149 to 602,180 bp; 81% of the deletions were accompanied by genomic rearrangements. To provide a further detailed analysis, the genomes of the mutants induced by Ar-ion beam irradiation were resequenced, and total mutations, including base substitutions, duplications, in/dels, inversions, and translocations, were detected using three algorithms. All three resequenced mutants had genomic rearrangements. Of the 22 DNA fragments that contributed to the rearrangements, 19 fragments were responsible for the intrachromosomal rearrangements, and multiple rearrangements were formed in the localized regions of the chromosomes. The interchromosomal rearrangements were detected in the multiply rearranged regions. These results indicate that the heavy-ion beams led to clustered DNA damage in the chromosome, and that they have great potential to induce complicated intrachromosomal rearrangements. Heavy-ion beams will prove useful as unique mutagens for plant breeding and the establishment of mutant lines. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Sass, G. L.; Mohler, J. D.; Walsh, R. C.; Kalfayan, L. J.; Searles, L. L.
1993-01-01
Mutations at the ovarian tumor (otu) gene of Drosophila melanogaster cause female sterility and generate a range of ovarian phenotypes. Quiescent (QUI) mutants exhibit reduced germ cell proliferation; in oncogenic (ONC) mutants germ cells undergo uncontrolled proliferation generating excessive numbers of undifferentiated cells; the egg chambers of differentiated (DIF) mutants differentiate to variable degrees but fail to complete oogenesis. We have examined mutations caused by insertion and deletion of P elements at the otu gene. The P element insertion sites are upstream of the major otu transcription start sites. In deletion derivatives, the P element, regulatory regions and/or protein coding sequences have been removed. In both insertion and deletion mutants, the level of otu expression correlates directly with the severity of the phenotype: the absence of otu function produces the most severe QUI phenotype while the ONC mutants express lower levels of otu than those which are DIF. The results of this study demonstrate that the diverse mutant phenotypes of otu are the consequence of different levels of otu function. PMID:8436274
Deletion of HAPS_2096 Increases Sensitivity to Cecropin B in Haemophilus parasuis.
Chen, Fanjie; Hu, Han; Li, Zhonghua; Huang, Jiacheng; Cai, Xuwang; Wang, Chunmei; He, Qigai; Cao, Jiyue
2015-01-01
Cecropin B (CB) is a very effective natural antimicrobial peptide that has shown great potential for future antimicrobial drug development. HAPS_2096 is a Haemophilus parasuis gene that encodes the periplasmic substrate-binding protein of an ATP-binding cassette-type amino acid transporter. In this research, we constructed and verified an HAPS_2096 deletion mutant and a complementary HAPS_2096 mutant of H. parasuis JS0135. A bactericidal assay revealed that the HAPS_2096 deletion mutant was significantly more sensitive than the wild-type strain to 0.25-0.5 µg/ml CB. However, the gene complementation alleviated the CB sensitivity of the mutant. Immunoelectron microscopy observation following a 30-min treatment with a sublethal concentration of CB (0.25 μg/ml) revealed more extensive morphological damage in the mutant strain than in the wild-type strain. Hence, our results suggest that the HAPS_2096 gene contributes to H. parasuis resistance to CB. © 2015 S. Karger AG, Basel.
Seif, R; Martin, R G
1979-01-01
Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation. Images PMID:229274
Seif, R; Martin, R G
1979-12-01
Simian virus 40 deletion mutants affecting the 20,000-dalton (20K) t antigen and tsA mutants rendering the 90K T antigen temperature sensitive, as well as double mutants containing both mutations, induced host DNA synthesis in resting rat cells at the restrictive temperature. Nonetheless, the deletion mutants and double mutants did not induce transformation in resting cells even at the permissive temperature. On the other hand, the deletion mutants did induce full transformants when actively growing rat cells were infected; the transformants grew efficiently in agar and to high saturation densities on platic. The double mutants did not induce T-antigen-independent (temperature-insensitive) transformants which were shown previously to arise preferentially from resting cells. Thus, small t antigen was dispensable for the maintenance of the transformed phenotype in T-antigen-dependent rat transformants (transformants derived from growing cells) and may play a role in the establishment of T-antigen-independent transformants. We attempt to establish a parallel between transformation induced by chemical carcinogens and simian virus 40-induced transformation.
Selection of recombinant MVA by rescue of the essential D4R gene.
Ricci, Patricia S; Schäfer, Birgit; Kreil, Thomas R; Falkner, Falko G; Holzer, Georg W
2011-12-12
Modified vaccinia virus Ankara (MVA) has become a promising vaccine vector due to its immunogenicity and its proven safety in humans. As a general approach for stringent and rapid selection of recombinant MVA, we assessed marker rescue of the essential viral D4R gene in an engineered deletion mutant that is fully replication defective in wild-type cells. Recombinant, replicating virus was obtained by re-introduction of the deleted viral gene as a dominant selection marker into the deletion mutant.
Transcription Factor RFX1 Is Crucial for Maintenance of Genome Integrity in Fusarium graminearum
Min, Kyunghun; Son, Hokyoung; Lim, Jae Yun; Choi, Gyung Ja; Kim, Jin-Cheol; Harris, Steven D.
2014-01-01
The survival of cellular organisms depends on the faithful replication and transmission of DNA. Regulatory factor X (RFX) transcription factors are well conserved in animals and fungi, but their functions are diverse, ranging from the DNA damage response to ciliary gene regulation. We investigated the role of the sole RFX transcription factor, RFX1, in the plant-pathogenic fungus Fusarium graminearum. Deletion of rfx1 resulted in multiple defects in hyphal growth, conidiation, virulence, and sexual development. Deletion mutants of rfx1 were more sensitive to various types of DNA damage than the wild-type strain. Septum formation was inhibited and micronuclei were produced in the rfx1 deletion mutants. The results of the neutral comet assay demonstrated that disruption of rfx1 function caused spontaneous DNA double-strand breaks (DSBs). The transcript levels of genes involved in DNA DSB repair were upregulated in the rfx1 deletion mutants. DNA DSBs produced micronuclei and delayed septum formation in F. graminearum. Green fluorescent protein (GFP)-tagged RFX1 localized in nuclei and exhibited high expression levels in growing hyphae and conidiophores, where nuclear division was actively occurring. RNA-sequencing-based transcriptomic analysis revealed that RFX1 suppressed the expression of many genes, including those required for the repair of DNA damage. Taken together, these findings indicate that the transcriptional repressor rfx1 performs crucial roles during normal cell growth by maintaining genome integrity. PMID:24465002
Genome-wide screen of Saccharomyces cerevisiae for killer toxin HM-1 resistance.
Miyamoto, Masahiko; Furuichi, Yasuhiro; Komiyama, Tadazumi
2011-01-01
We screened a set of Saccharomyces cerevisiae deletion mutants for resistance to killer toxin HM-1, which kills susceptible yeasts through inhibiting 1,3-beta-glucan synthase. By using HM-1 plate assay, we found that eight gene-deletion mutants had higher HM-1-resistance compared with the wild-type. Among these eight genes, five--ALG3, CAX4, MNS1, OST6 and YBL083C--were associated with N-glycan formation and maturation. The ALG3 gene has been shown before to be highly resistant to HM-1. The YBL083C gene may be a dubious open reading frame that overlaps partially the ALG3 gene. The deletion mutant of the MNS1 gene that encodes 1,2-alpha-mannosidase showed with a 13-fold higher HM-1 resistance compared with the wild-type. By HM-1 binding assay, the yeast plasma membrane fraction of alg3 and mns1 cells had less binding ability compared with wild-type cells. These results indicate that the presence of the terminal 1,3-alpha-linked mannose residue of the B-chain of the N-glycan structure is essential for interaction with HM-1. A deletion mutant of aquaglyceroporin Fps1p also showed increased HM-1 resistance. A deletion mutant of osmoregulatory mitogen-activated protein kinase Hog1p was more sensitive to HM-1, suggesting that high-osmolarity glycerol pathways plays an important role in the compensatory response to HM-1 action. Copyright © 2010 John Wiley & Sons, Ltd.
Rhodes, Ryan G.; Samarasam, Mudiarasan Napoleon; Shrivastava, Abhishek; van Baaren, Jessica M.; Pochiraju, Soumya; Bollampalli, Sreelekha; McBride, Mark J.
2010-01-01
Cells of the gliding bacterium Flavobacterium johnsoniae move rapidly over surfaces. Mutations in gldN cause a partial defect in gliding. A novel bacteriophage selection strategy was used to aid construction of a strain with a deletion spanning gldN and the closely related gene gldO in an otherwise wild-type F. johnsoniae UW101 background. Bacteriophage transduction was used to move a gldN mutation into F. johnsoniae UW101 to allow phenotypic comparison with the gldNO deletion mutant. Cells of the gldN mutant formed nonspreading colonies on agar but retained some ability to glide in wet mounts. In contrast, cells of the gldNO deletion mutant were completely nonmotile, indicating that cells require GldN, or the GldN-like protein GldO, to glide. Recent results suggest that Porphyromonas gingivalis PorN, which is similar in sequence to GldN, has a role in protein secretion across the outer membrane. Cells of the F. johnsoniae gldNO deletion mutant were defective in localization of the motility protein SprB to the cell surface, suggesting that GldN may be involved in secretion of components of the motility machinery. Cells of the gldNO deletion mutant were also deficient in chitin utilization and were resistant to infection by bacteriophages, phenotypes that may also be related to defects in protein secretion. PMID:20038590
Cell wall structure suitable for surface display of proteins in Saccharomyces cerevisiae.
Matsuoka, Hiroyuki; Hashimoto, Kazuya; Saijo, Aki; Takada, Yuki; Kondo, Akihiko; Ueda, Mitsuyoshi; Ooshima, Hiroshi; Tachibana, Taro; Azuma, Masayuki
2014-02-01
A display system for adding new protein functions to the cell surfaces of microorganisms has been developed, and applications of the system to various fields have been proposed. With the aim of constructing a cell surface environment suitable for protein display in Saccharomyces cerevisiae, the cell surface structures of cell wall mutants were investigated. Four cell wall mutant strains were selected by analyses using a GFP display system via a GPI anchor. β-Glucosidase and endoglucanase II were displayed on the cell surface in the four mutants, and their activities were evaluated. mnn2 deletion strain exhibited the highest activity for both the enzymes. In particular, endoglucanase II activity using carboxymethylcellulose as a substrate in the mutant strain was 1.9-fold higher than that of the wild-type strain. In addition, the activity of endoglucanase II released from the mnn2 deletion strain by Zymolyase 20T treatment was higher than that from the wild-type strain. The results of green fluorescent protein (GFP) and endoglucanase displays suggest that the amounts of enzyme displayed on the cell surface were increased by the mnn2 deletion. The enzyme activity of the mnn2 deletion strain was compared with that of the wild-type strain. The relative value (mnn2 deletion mutant/wild-type strain) of endoglucanase II activity using carboxymethylcellulose as a substrate was higher than that of β-glucosidase activity using p-nitrophenyl-β-glucopyranoside as a substrate, suggesting that the cell surface environment of the mnn2 deletion strain facilitates the binding of high-molecular-weight substrates to the active sites of the displayed enzymes. Copyright © 2014 John Wiley & Sons, Ltd.
Świątek, Magdalena A.; Gubbens, Jacob; Bucca, Giselda; Song, Eunjung; Yang, Yung-Hun; Laing, Emma; Kim, Byung-Gee; Smith, Colin P.
2013-01-01
Members of the ROK family of proteins are mostly transcriptional regulators and kinases that generally relate to the control of primary metabolism, whereby its member glucose kinase acts as the central control protein in carbon control in Streptomyces. Here, we show that deletion of SCO6008 (rok7B7) strongly affects carbon catabolite repression (CCR), growth, and antibiotic production in Streptomyces coelicolor. Deletion of SCO7543 also affected antibiotic production, while no major changes were observed after deletion of the rok family genes SCO0794, SCO1060, SCO2846, SCO6566, or SCO6600. Global expression profiling of the rok7B7 mutant by proteomics and microarray analysis revealed strong upregulation of the xylose transporter operon xylFGH, which lies immediately downstream of rok7B7, consistent with the improved growth and delayed development of the mutant on xylose. The enhanced CCR, which was especially obvious on rich or xylose-containing media, correlated with elevated expression of glucose kinase and of the glucose transporter GlcP. In liquid-grown cultures, expression of the biosynthetic enzymes for production of prodigionines, siderophores, and calcium-dependent antibiotic (CDA) was enhanced in the mutant, and overproduction of prodigionines was corroborated by matrix-assisted laser desorption ionization–time-of-flight analysis. These data present Rok7B7 as a pleiotropic regulator of growth, CCR, and antibiotic production in Streptomyces. PMID:23292782
Prieto, R; Yousibova, G L; Woloshuk, C P
1996-01-01
Aspergillus flavus mutant strain 649, which has a genomic DNA deletion of at least 120 kb covering the aflatoxin biosynthesis cluster, was transformed with a series of overlapping cosmids that contained DNA harboring the cluster of genes. The mutant phenotype of strain 649 was rescued by transformation with a combination of cosmid clones 5E6, 8B9, and 13B9, indicating that the cluster of genes involved in aflatoxin biosynthesis resides in the 90 kb of A. flavus genomic DNA carried by these clones. Transformants 5E6 and 20B11 and transformants 5E6 and 8B9 accumulated intermediate metabolites of the aflatoxin pathway, which were identified as averufanin and/or averufin, respectively.These data suggest that avf1, which is involved in the conversion of averufin to versiconal hemiacetal acetate, was present in the cosmid 13B9. Deletion analysis of 13B9 located the gene on a 7-kb DNA fragment of the cosmid. Transformants containing cosmid 8B9 converted exogenously supplied O-methylsterigmatocystin to aflatoxin, indicating that the oxidoreductase gene (ord1), which mediates the conversion of O-methylsterigmatocystin to aflatoxin, is carried by this cosmid. The analysis of transformants containing deletions of 8B9 led to the localization of ord1 on a 3.3-kb A. flavus genomic DNA fragment of the cosmid. PMID:8967772
Chen, Hongyu; Kandel, Prem P; Cruz, Luisa F; Cobine, Paul A; De La Fuente, Leonardo
2017-11-01
MopB is a major outer membrane protein (OMP) in Xylella fastidiosa, a bacterial plant pathogen that causes losses on many economically important crops. Based on in silico analysis, the uncharacterized MopB protein of X. fastidiosa contains a β-barrel structure with an OmpA-like domain and a predicted calcium-binding motif. Here, MopB function was studied by mutational analysis taking advantage of the natural competence of X. fastidiosa. Mutants of mopB were constructed in two different X. fastidiosa strains, the type strain Temecula and the more virulent WM1-1. Deletion of the mopB gene impaired cell-to-cell aggregation, surface attachment, and biofilm formation in both strains. Interestingly, mopB deletion completely abolished twitching motility. Electron microscopy of the bacterial cell surface revealed that mopB deletion eliminated type IV and type I pili formation, potentially caused by destabilization of the outer membrane. Both mopB mutants showed reduced virulence using tobacco (Nicotiana tabacum) as a host under greenhouse conditions. These results suggest that MopB has pleiotropic functions in biofilm formation and twitching motility and is important for virulence of X. fastidiosa.
Hepatitis B Virus Core Gene Mutations Which Block Nucleocapsid Envelopment
Koschel, Matthias; Oed, Daniela; Gerelsaikhan, Tudevdagwa; Thomssen, Reiner; Bruss, Volker
2000-01-01
Recently we generated a panel of hepatitis B virus core gene mutants carrying single insertions or deletions which allowed efficient expression of the core protein in bacteria and self-assembly of capsids. Eleven of these mutations were introduced into a eukaryotic core gene expression vector and characterized by trans complementation of a core-negative HBV genome in cotransfected human hepatoma HuH7 cells. Surprisingly, four mutants (two insertions [EFGA downstream of A11 and LDTASALYR downstream of R39] and two deletions [Y38-R39-E40 and L42]) produced no detectable capsids. The other seven mutants supported capsid formation and pregenome packaging/viral minus- and plus-strand-DNA synthesis but to different levels. Four of these seven mutants (two insertions [GA downstream of A11 and EHCSP downstream of P50] and two deletions [S44 and A80]) allowed virion morphogenesis and secretion. The mutant carrying a deletion of A80 at the tip of the spike protruding from the capsid was hepatitis B virus core antigen negative but wild type with respect to virion formation, indicating that this site might not be crucial for capsid-surface protein interactions during morphogenesis. The other three nucleocapsid-forming mutants (one insertion [LS downstream of S141] and two deletions [T12 and P134]) were strongly blocked in virion formation. The corresponding sites are located in the part of the protein forming the body of the capsid and not in the spike. These mutations may alter sites on the particle which contact surface proteins during envelopment, or they may block the appearance of a signal for the transport or the maturation of the capsid which is linked to viral DNA synthesis and required for envelopment. PMID:10590084
van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C
1997-05-01
We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.
Schübbe, Sabrina; Kube, Michael; Scheffel, André; Wawer, Cathrin; Heyen, Udo; Meyerdierks, Anke; Madkour, Mohamed H.; Mayer, Frank; Reinhardt, Richard; Schüler, Dirk
2003-01-01
Frequent spontaneous loss of the magnetic phenotype was observed in stationary-phase cultures of the magnetotactic bacterium Magnetospirillum gryphiswaldense MSR-1. A nonmagnetic mutant, designated strain MSR-1B, was isolated and characterized. The mutant lacked any structures resembling magnetosome crystals as well as internal membrane vesicles. The growth of strain MSR-1B was impaired under all growth conditions tested, and the uptake and accumulation of iron were drastically reduced under iron-replete conditions. A large chromosomal deletion of approximately 80 kb was identified in strain MSR-1B, which comprised both the entire mamAB and mamDC clusters as well as further putative operons encoding a number of magnetosome-associated proteins. A bacterial artificial chromosome clone partially covering the deleted region was isolated from the genomic library of wild-type M. gryphiswaldense. Sequence analysis of this fragment revealed that all previously identified mam genes were closely linked with genes encoding other magnetosome-associated proteins within less than 35 kb. In addition, this region was remarkably rich in insertion elements and harbored a considerable number of unknown gene families which appeared to be specific for magnetotactic bacteria. Overall, these findings suggest the existence of a putative large magnetosome island in M. gryphiswaldense and other magnetotactic bacteria. PMID:13129949
A 1-bp deletion in the gammaC-crystallin leads to dominant cataracts in mice.
Zhao, Liya; Li, Kai; Bao, Shimin; Zhou, Yuxun; Liang, Yinming; Zhao, Guoji; Chen, Ye; Xiao, Junhua
2010-08-01
To date around 140 genetic alleles have been identified as being responsible for mouse cataract pathology, including Crya, Cryb, Cryg, Maf, Pax6, Pitx3, Sox, Connexins, MIP, and Lim-2. We obtained a dominant cataract mouse model from a spontaneous mutation in the F1 hybrids of outbred strain ICR mice crossed to the inbred strain BALB/cJ mice. Heterozygous and homozygous mutants expressed a nuclear cataract in both eyes. In 8-day-old mice, histological analysis showed that polygon epithelial cells were in the equatorial region and cortex underneath, and vacuole and sponge-like degeneration were in the cortical area underneath the posterior lens capsule. The nucleus of the lens was a deeply stained pink, with the shorter fibers losing their normal arrangement. For the entire eye, there was a blank zone in the equatorial region in 8-day-old mice; however, there was a certain degree of atrophy in cornea tension and retina in the lens in 3-month-old mice. The lens had been serious damaged in the homozygous mutants. For mutation mapping, heterozygous carriers were mated to wild-type C3H/HeJ mice, and offspring (F1 generation) with cataracts were backcrossed to the wild-type C3H/HeJ mice again. N2 mice with cataracts were used for genotyping. Using genome-wide linkage analysis, the mutation was mapped to chromosome 1 and the Cryg gene cluster between two markers was confirmed as the candidate gene. After direct sequencing the cDNA of the Cryg gene cluster, a 1-bp deletion was found in exon 3 of the Crygc gene, leading to a stop codon at the 76th amino acid of exon 3 which results in production of a truncated protein in mutant mice (Leu160Stop). Bioinformatic analysis of the mutant gammaC-crystallin reveals that the COOH-terminal of the mutant protein deletes a beta-sheet, which affects the function of the lens proteins and leads to the development of cataracts.
Zhu, Chunhua; Sun, Boyi; Liu, Taigang; Zheng, Huajun; Gu, Wenyi; He, Wei; Sun, Fengjiao; Wang, Yaping; Yang, Meicheng; Bei, Weicheng; Peng, Xu; She, Qunxin; Xie, Lu; Chen, Lanming
2017-06-05
Vibrio parahaemolyticus causes serious seafood-borne gastroenteritis and death in humans. Raw seafood is often subjected to post-harvest processing and low-temperature storage. To date, very little information is available regarding the biological functions of cold shock proteins (CSPs) in the low-temperature survival of the bacterium. In this study, we determined the complete genome sequence of V. parahaemolyticus CHN25 (serotype: O5:KUT). The two main CSP-encoding genes (VpacspA and VpacspD) were deleted from the bacterial genome, and comparative transcriptomic analysis between the mutant and wild-type strains was performed to dissect the possible molecular mechanisms that underlie low-temperature adaptation by V. parahaemolyticus. The 5,443,401-bp V. parahaemolyticus CHN25 genome (45.2% G + C) consisted of two circular chromosomes and three plasmids with 4,724 predicted protein-encoding genes. One dual-gene and two single-gene deletion mutants were generated for VpacspA and VpacspD by homologous recombination. The growth of the ΔVpacspA mutant was strongly inhibited at 10 °C, whereas the VpacspD gene deletion strongly stimulated bacterial growth at this low temperature compared with the wild-type strain. The complementary phenotypes were observed in the reverse mutants (ΔVpacspA-com, and ΔVpacspD-com). The transcriptome data revealed that 12.4% of the expressed genes in V. parahaemolyticus CHN25 were significantly altered in the ΔVpacspA mutant when it was grown at 10 °C. These included genes that were involved in amino acid degradation, secretion systems, sulphur metabolism and glycerophospholipid metabolism along with ATP-binding cassette transporters. However, a low temperature elicited significant expression changes for 10.0% of the genes in the ΔVpacspD mutant, including those involved in the phosphotransferase system and in the metabolism of nitrogen and amino acids. The major metabolic pathways that were altered by the dual-gene deletion mutant (ΔVpacspAD) radically differed from those that were altered by single-gene mutants. Comparison of the transcriptome profiles further revealed numerous differentially expressed genes that were shared among the three mutants and regulators that were specifically, coordinately or antagonistically modulated by VpaCspA and VpaCspD. Our data also revealed several possible molecular coping strategies for low-temperature adaptation by the bacterium. This study is the first to describe the complete genome sequence of V. parahaemolyticus (serotype: O5:KUT). The gene deletions, complementary insertions, and comparative transcriptomics demonstrate that VpaCspA is a primary CSP in the bacterium, while VpaCspD functions as a growth inhibitor at 10 °C. These results have improved our understanding of the genetic basis for low-temperature survival by the most common seafood-borne pathogen worldwide.
Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.
Kirkegaard, K; Nelsen, B
1990-01-01
Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811
A proof of the DBRF-MEGN method, an algorithm for deducing minimum equivalent gene networks
2011-01-01
Background We previously developed the DBRF-MEGN (difference-based regulation finding-minimum equivalent gene network) method, which deduces the most parsimonious signed directed graphs (SDGs) consistent with expression profiles of single-gene deletion mutants. However, until the present study, we have not presented the details of the method's algorithm or a proof of the algorithm. Results We describe in detail the algorithm of the DBRF-MEGN method and prove that the algorithm deduces all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. Conclusions The DBRF-MEGN method provides all of the exact solutions of the most parsimonious SDGs consistent with expression profiles of gene deletion mutants. PMID:21699737
Mandl, C W; Holzmann, H; Meixner, T; Rauscher, S; Stadler, P F; Allison, S L; Heinz, F X
1998-03-01
The flavivirus genome is a positive-strand RNA molecule containing a single long open reading frame flanked by noncoding regions (NCR) that mediate crucial processes of the viral life cycle. The 3' NCR of tick-borne encephalitis (TBE) virus can be divided into a variable region that is highly heterogeneous in length among strains of TBE virus and in certain cases includes an internal poly(A) tract and a 3'-terminal conserved core element that is believed to fold as a whole into a well-defined secondary structure. We have now investigated the genetic stability of the TBE virus 3' NCR and its influence on viral growth properties and virulence. We observed spontaneous deletions in the variable region during growth of TBE virus in cell culture and in mice. These deletions varied in size and location but always included the internal poly(A) element of the TBE virus 3' NCR and never extended into the conserved 3'-terminal core element. Subsequently, we constructed specific deletion mutants by using infectious cDNA clones with the entire variable region and increasing segments of the core element removed. A virus mutant lacking the entire variable region was indistinguishable from wild-type virus with respect to cell culture growth properties and virulence in the mouse model. In contrast, even small extensions of the deletion into the core element led to significant biological effects. Deletions extending to nucleotides 10826, 10847, and 10870 caused distinct attenuation in mice without measurable reduction of cell culture growth properties, which, however, were significantly restricted when the deletion was extended to nucleotide 10919. An even larger deletion (to nucleotide 10994) abolished viral viability. In spite of their high degree of attenuation, these mutants efficiently induced protective immune responses even at low inoculation doses. Thus, 3'-NCR deletions represent a useful technique for achieving stable attenuation of flaviviruses that can be included in the rational design of novel flavivirus live vaccines.
Wang, Hong; Wang, Congcong; Li, Ya; Yue, Xiaofeng; Ma, Zhonghua; Talbot, Nicholas J.; Wang, Zhengyi
2013-01-01
Methylenetetrahydrofolate reductases (MTHFRs) play a key role in the biosynthesis of methionine in both prokaryotic and eukaryotic organisms. In this study, we report the identification of a novel T-DNA-tagged mutant WH672 in the rice blast fungus Magnaporthe oryzae, which was defective in vegetative growth, conidiation and pathogenicity. Analysis of the mutation confirmed a single T-DNA insertion upstream of MET13, which encodes a 626-amino-acid protein encoding a MTHFR. Targeted gene deletion of MET13 resulted in mutants that were non-pathogenic and significantly impaired in aerial growth and melanin pigmentation. All phenotypes associated with Δmet13 mutants could be overcome by addition of exogenous methionine. The M. oryzae genome contains a second predicted MTHFR-encoding gene, MET12. The deduced amino acid sequences of Met13 and Met12 share 32% identity. Interestingly, Δmet12 mutants produced significantly less conidia compared with the isogenic wild-type strain and grew very poorly in the absence of methionine, but were fully pathogenic. Deletion of both genes resulted in Δmet13Δmet12 mutants that showed similar phenotypes to single Δmet13 mutants. Taken together, we conclude that the MTHFR gene, MET13, is essential for infection-related morphogenesis by the rice blast fungus M. oryzae. PMID:24116181
Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji
2006-03-01
Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.
Cloning and expression of the tabtoxin biosynthetic region from Pseudomonas syringae.
Kinscherf, T G; Coleman, R H; Barta, T M; Willis, D K
1991-01-01
Pseudomonas syringae BR2, a causal agent of bean wildfire, was subjected to Tn5 mutagenesis in an effort to isolate mutants unable to produce the beta-lactam antibiotic tabtoxin. Three of the tabtoxin-minus (Tox-) mutants generated appeared to have physically linked Tn5 insertions and retained their resistance to the active toxin form, tabtoxnine-beta-lactam (T beta L). The wild-type DNA corresponding to the mutated region was cloned and found to restore the Tn5 mutants to toxin production. The use of cloned DNA from the region as hybridization probes revealed that the region is highly conserved among tabtoxin-producing pathovars of P. syringae and that the region deletes at a relatively high frequency (10(-3)/CFU) in BR2. The Tox- deletion mutants also lost resistance to tabtoxinine-beta-lactam. A cosmid designated pRTBL823 restored toxin production and resistance to BR2 deletion mutants. This cosmid also converted the tabtoxin-naive P. syringae epiphyte Cit7 to toxin production and resistance, indicating that pRTBL823 contains a complete set of biosynthetic and resistance genes. Tox- derivatives of BR2 did not produce disease symptoms on bean. Clones that restored toxin production to both insertion and deletion mutants also restored the ability to cause disease. However, tabtoxin-producing Cit7 derivatives remained nonpathogenic on bean and tobacco, suggesting that tabtoxin production alone is not sufficient to cause disease. Images PMID:1648077
Patel, Dhaval S.; Garza-Garcia, Acely; Nanji, Manoj; McElwee, Joshua J.; Ackerman, Daniel; Driscoll, Paul C.; Gems, David
2008-01-01
The DAF-2 insulin/IGF-1 receptor regulates development, metabolism, and aging in the nematode Caenorhabditis elegans. However, complex differences among daf-2 alleles complicate analysis of this gene. We have employed epistasis analysis, transcript profile analysis, mutant sequence analysis, and homology modeling of mutant receptors to understand this complexity. We define an allelic series of nonconditional daf-2 mutants, including nonsense and deletion alleles, and a putative null allele, m65. The most severe daf-2 alleles show incomplete suppression by daf-18(0) and daf-16(0) and have a range of effects on early development. Among weaker daf-2 alleles there exist distinct mutant classes that differ in epistatic interactions with mutations in other genes. Mutant sequence analysis (including 11 newly sequenced alleles) reveals that class 1 mutant lesions lie only in certain extracellular regions of the receptor, while class 2 (pleiotropic) and nonconditional missense mutants have lesions only in the ligand-binding pocket of the receptor ectodomain or the tyrosine kinase domain. Effects of equivalent mutations on the human insulin receptor suggest an altered balance of intracellular signaling in class 2 alleles. These studies consolidate and extend our understanding of the complex genetics of daf-2 and its underlying molecular biology. PMID:18245374
A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1
de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean
2008-01-01
We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726
Nakae, Shunsuke; Kato, Takema; Murayama, Kazuhiro; Sasaki, Hikaru; Abe, Masato; Kumon, Masanobu; Kumai, Tadashi; Yamashiro, Kei; Inamasu, Joji; Hasegawa, Mitsuhiro; Kurahashi, Hiroki; Hirose, Yuichi
2017-01-01
Most IDH mutant gliomas harbor either 1p/19q co-deletions or TP53 mutation; 1p/19q co-deleted tumors have significantly better prognoses than tumors harboring TP53 mutations. To investigate the clinical factors that contribute to differences in tumor progression of IDH mutant gliomas, we classified recurrent tumor patterns based on MRI and correlated these patterns with their genomic characterization. Accordingly, in IDH mutant gliomas (N = 66), 1p/19 co-deleted gliomas only recurred locally, whereas TP53 mutant gliomas recurred both locally and in remote intracranial regions. In addition, diffuse tensor imaging suggested that remote intracranial recurrence in the astrocytomas, IDH-mutant with TP53 mutations may occur along major fiber bundles. Remotely recurrent tumors resulted in a higher mortality and significantly harbored an 8q gain; astrocytomas with an 8q gain resulted in significantly shorter overall survival than those without an 8q gain. OncoScan® arrays and next-generation sequencing revealed specific 8q regions (i.e., between 8q22 and 8q24) show a high copy number. In conclusion, only tumors with TP53 mutations showed patterns of remote recurrence in IDH mutant gliomas. Furthermore, an 8q gain was significantly associated with remote intracranial recurrence and can be considered a poor prognostic factor in astrocytomas, IDH-mutant. PMID:29156679
The capsule plays an important role in Escherichia coli K1 interactions with Acanthamoeba.
Jung, Suk-Yul; Matin, Abdul; Kim, Kwang Sik; Khan, Naveed Ahmed
2007-03-01
Escherichia coli K1 is shown to bind to, associate with, invade and survive inside Acanthamoeba, but the precise mechanisms associated with these events are unclear. We have previously shown that outer membrane protein A and lipopolysaccharide are critical bacterial determinants involved in E. coli K1 interactions with Acanthamoeba. Using an isogenic K1 capsule-deletion mutant (lacking the neuDB genes cluster that is necessary for the production of cytoplasmic precursors to the exopolysaccharide capsule), we observed that the capsule modulates and enhances E. coli K1 association and survival inside Acanthamoeba. The capsule-deletion mutant exhibited significantly reduced association compared with the wild type strain, E44. Similarly, the K1 capsule-deletion mutant exhibited limited ability for invasion/uptake by and survival inside Acanthamoeba. Next, we determined whether E. coli K1 survive inside Acanthamoeba during the encystment process and that viable bacteria can be isolated from the mature cysts. Using encystment assays, our findings revealed that E. coli K1, but not its capsule-deletion mutant, exhibit survival inside Acanthamoeba cysts. We believe this is the first demonstration that the K1 capsule plays an important role in E. coli K1 interactions with Acanthamoeba.
Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M
2015-10-01
Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.
Fu, Jiafang; Zong, Gongli; Zhang, Peipei; Gu, Yuanxin; Cao, Guangxiang
2018-04-01
Rv1057 is the only β-propeller protein in Mycobacterium tuberculosis, but its biological function is still unclear. In this study, we generated a deletion mutant of Rv1057 (D1057) in the virulent M. tuberculosis strain H37Rv and examined the characteristics of the mutant in vitro and in macrophages. We found that deletion of Rv1057 reduces secretion of the major virulence factor ESAT-6 and ESAT-6 stops in the cell envelope fraction during secretion, although ESAT-6 levels were similar in lysates of the mutant and control strains. In infected macrophages, Rv1057 deletion significantly reduced the secretion levels of cytokines IL-1β, IL-10, TNF-α, and INF-γ, but did not affect IL-4 and IL-8. D1057-infected macrophages also release less LDH and produce more nitric oxide (NO) than H37Rv- and D1057com (Rv1057 complemented strain of D1057com)-infected macrophages, indicating that D1057 has the decreased cytotoxicity compared to H37Rv or D1057com. In addition, the capacity of the Rv1057 deletion mutant to grow in macrophages was significantly lower than that of H37Rv and D1057com. Our findings support a role for Rv1057 in ESAT-6 secretion and in modulating the interactions between M. tuberculosis and macrophages.
Serrano, Amaya; Williams, Trevor; Simón, Oihane; López-Ferber, Miguel; Caballero, Primitivo
2013-01-01
A natural Spodoptera exigua multiple nucleopolyhedrovirus (SeMNPV) isolate from Florida shares a strikingly similar genotypic composition to that of a natural Spodoptera frugiperda MNPV (SfMNPV) isolate from Nicaragua. Both isolates comprise a high proportion of large-deletion genotypes that lack genes that are essential for viral replication or transmission. To determine the likely origins of such genotypically similar population structures, we performed genomic and functional analyses of these genotypes. The homology of nucleotides in the deleted regions was as high as 79%, similar to those of other colinear genomic regions, although some SfMNPV genes were not present in SeMNPV. In addition, no potential consensus sequences were shared between the deletion flanking sequences. These results indicate an evolutionary mechanism that independently generates and sustains deletion mutants within each virus population. Functional analyses using different proportions of complete and deletion genotypes were performed with the two viruses in mixtures of occlusion bodies (OBs) or co-occluded virions. Ratios greater than 3:1 of complete/deletion genotypes resulted in reduced pathogenicity (expressed as median lethal dose), but there were no significant changes in the speed of kill. In contrast, OB yields increased only in the 1:1 mixture. The three phenotypic traits analyzed provide a broader picture of the functional significance of the most extensively deleted SeMNPV genotype and contribute toward the elucidation of the role of such mutants in baculovirus populations. PMID:23204420
Ebi, Hiromichi; Oze, Isao; Nakagawa, Takayuki; Ito, Hidemi; Hosono, Satoyo; Matsuda, Fumihiko; Takahashi, Meiko; Takeuchi, Shinji; Sakao, Yukinori; Hida, Toyoaki; Faber, Anthony C; Tanaka, Hideo; Yatabe, Yasushi; Mitsudomi, Tetsuya; Yano, Seiji; Matsuo, Keitaro
2015-01-01
The BIM deletion polymorphism in intron 2 was found in a significant percent of the Asian population. Patients with epidermal growth factor receptor (EGFR) mutant lung cancers harboring this BIM polymorphism have shorter progression free survival and overall response rates to EGFR tyrosine kinase inhibitors. However, the association between the BIM deletion polymorphism and lung cancer risk is unknown. The BIM deletion polymorphism was screened by polymerase chain reaction in 765 lung cancer cases and 942 healthy individuals. Carriers possessing one allele of the BIM polymorphism were observed in 13.0% of control cases and 12.8% of lung cancer cases, similar to incidence rates reported earlier in healthy individuals. Homozygote for the BIM polymorphism was observed in four of 942 healthy controls and three of 765 lung cancer cases. The frequency of the BIM deletion polymorphism in lung cancer patients was not related to age, sex, smoking history, or family history of lung cancer. The BIM deletion polymorphism was found in 30 of 212 patients with EGFR wild type lung cancers and 16 of 120 patients with EGFR mutant lung cancers. The frequency of the BIM polymorphism is similar between cancers with wild type EGFR and mutated EGFR (p = 0.78). The BIM deletion polymorphism was not associated with lung cancer susceptibility. Furthermore, the BIM polymorphism is not associated with EGFR mutant lung cancer.
Circularized Chromosome with a Large Palindromic Structure in Streptomyces griseus Mutants
Uchida, Tetsuya; Ishihara, Naoto; Zenitani, Hiroyuki; Hiratsu, Keiichiro; Kinashi, Haruyasu
2004-01-01
Streptomyces linear chromosomes display various types of rearrangements after telomere deletion, including circularization, arm replacement, and amplification. We analyzed the new chromosomal deletion mutants Streptomyces griseus 301-22-L and 301-22-M. In these mutants, chromosomal arm replacement resulted in long terminal inverted repeats (TIRs) at both ends; different sizes were deleted again and recombined inside the TIRs, resulting in a circular chromosome with an extremely large palindrome. Short palindromic sequences were found in parent strain 2247, and these sequences might have played a role in the formation of this unique structure. Dynamic structural changes of Streptomyces linear chromosomes shown by this and previous studies revealed extraordinary strategies of members of this genus to keep a functional chromosome, even if it is linear or circular. PMID:15150216
Eraso, Jesus M.; Olsen, Randall J.; Beres, Stephen B.; Kachroo, Priyanka; Porter, Adeline R.; Nasser, Waleed; Bernard, Paul E.; DeLeo, Frank R.
2016-01-01
To obtain new information about Streptococcus pyogenes intrahost genetic variation during invasive infection, we sequenced the genomes of 2,954 serotype M1 strains recovered from a nonhuman primate experimental model of necrotizing fasciitis. A total of 644 strains (21.8%) acquired polymorphisms relative to the input parental strain. The fabT gene, encoding a transcriptional regulator of fatty acid biosynthesis genes, contained 54.5% of these changes. The great majority of polymorphisms were predicted to deleteriously alter FabT function. Transcriptome-sequencing (RNA-seq) analysis of a wild-type strain and an isogenic fabT deletion mutant strain found that between 3.7 and 28.5% of the S. pyogenes transcripts were differentially expressed, depending on the growth temperature (35°C or 40°C) and growth phase (mid-exponential or stationary phase). Genes implicated in fatty acid synthesis and lipid metabolism were significantly upregulated in the fabT deletion mutant strain. FabT also directly or indirectly regulated central carbon metabolism genes, including pyruvate hub enzymes and fermentation pathways and virulence genes. Deletion of fabT decreased virulence in a nonhuman primate model of necrotizing fasciitis. In addition, the fabT deletion strain had significantly decreased survival in human whole blood and during phagocytic interaction with polymorphonuclear leukocytes ex vivo. We conclude that FabT mutant progeny arise during infection, constitute a metabolically distinct subpopulation, and are less virulent in the experimental models used here. PMID:27600505
Enterococcus faecalis Constitutes an Unusual Bacterial Model in Lysozyme Resistance▿
Hébert, Laurent; Courtin, Pascal; Torelli, Riccardo; Sanguinetti, Maurizio; Chapot-Chartier, Marie-Pierre; Auffray, Yanick; Benachour, Abdellah
2007-01-01
Lysozyme is an important and widespread compound of the host constitutive defense system, and it is assumed that Enterococcus faecalis is one of the few bacteria that are almost completely lysozyme resistant. On the basis of the sequence analysis of the whole genome of E. faecalis V583 strain, we identified two genes that are potentially involved in lysozyme resistance, EF_0783 and EF_1843. Protein products of these two genes share significant homology with Staphylococcus aureus peptidoglycan O-acetyltransferase (OatA) and Streptococcus pneumoniae N-acetylglucosamine deacetylase (PgdA), respectively. In order to determine whether EF_0783 and EF_1843 are involved in lysozyme resistance, we constructed their corresponding mutants and a double mutant. The ΔEF_0783 mutant and ΔEF_0783 ΔEF_1843 double mutant were shown to be more sensitive to lysozyme than the parental E. faecalis JH2-2 strain and ΔEF_1843 mutant were. However, compared to other bacteria, such as Listeria monocytogenes or S. pneumoniae, the tolerance of ΔEF_0783 and ΔEF_0783 ΔEF_1843 mutants towards lysozyme remains very high. Peptidoglycan structure analysis showed that EF_0783 modifies the peptidoglycan by O acetylation of N-acetyl muramic acid, while the EF_1843 deletion has no obvious effect on peptidoglycan structure under the same conditions. Moreover, the EF_0783 and EF_1843 deletions seem to significantly affect the ability of E. faecalis to survive within murine macrophages. In all, while EF_0783 is currently involved in the lysozyme resistance of E. faecalis, peptidoglycan O acetylation and de-N-acetylation are not the main mechanisms conferring high levels of lysozyme resistance to E. faecalis. PMID:17785473
Lebel, Michel
2002-01-01
Werner syndrome (WS) is a rare autosomal recessive disorder characterized by genomic instability and the premature onset of a number of age-related diseases, including cancers. Accumulating evidence indicates that the WS gene product is involved in resolving aberrant DNA structures that may arise during the process of DNA replication and/or transcription. To estimate the frequency of DNA deletions directly in the skin of mouse embryos, mice with a deletion of part of the murine WRN helicase domain were created. These mutant mice were then crossed to the pink-eyed unstable animals, which have a 70 kb internal duplication at the pink-eyed dilution (p) gene. This report indicates that the frequency of deletion of the duplicated sequence at the p locus is elevated in mice with a mutation in the WRN allele when compared with wild-type mice. In addition, the inhibitor of topoisomerase I camptothecin also increases the frequency of deletion at the p locus. This frequency is even more elevated in WRN mutant mice treated with camptothecin. In contrast, while the inhibition of poly(ADP-ribose) polymerase (PARP) activity by 3-aminobenzamide increases the frequency of DNA deletion, mutant WRN mice are not significantly more sensitive to the inhibition of PARP activity than wild-type animals.
Phenotypic and genomic analysis of a fast neutron mutant population resource in soybean
USDA-ARS?s Scientific Manuscript database
Mutagenized populations have become indispensable resources for introducing variation and studying gene function in plant genomics research. We utilized fast neutron radiation to induce deletion mutations in the soybean genome and phenotypically screened the resulting population. We exposed approxim...
Induction of mutations by bismuth-212 alpha particles at two genetic loci in human B-lymphoblasts.
Metting, N F; Palayoor, S T; Macklis, R M; Atcher, R W; Liber, H L; Little, J B
1992-12-01
The human lymphoblast cell line TK6 was exposed to the alpha-particle-emitting radon daughter 212Bi by adding DTPA-chelated 212Bi directly to the cell suspension. Cytotoxicity and mutagenicity at two genetic loci were measured, and the molecular nature of mutant clones was studied by Southern blot analysis. Induced mutant fractions were 2.5 x 10(-5)/Gy at the hprt locus and 3.75 x 10(-5)/Gy at the tk locus. Molecular analysis of HPRT- mutant DNAs showed a high frequency (69%) of clones with partial or full deletions of the hprt gene among radiation-induced mutants compared with spontaneous mutants (31%). Chi-squared analyses of mutational spectra show a significant difference (P < or = 0.005) between spontaneous mutants and alpha-particle-induced mutants. Comparison with published studies of accelerator-produced heavy-ion exposures of TK6 cells indicates that the induction of mutations at the hprt locus, and perhaps a subset of mutations at the tk locus, is a simple linear function of particle fluence regardless of the ion species or its LET.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu Xiaohong; Zhang Shuhui; Lin Jing
The role of the hepatitis B virus X protein (HBx) in hepatocarcinogenesis remains controversial. To investigate the biological impact of hepatitis B virus x gene (HBx) mutation on hepatoma cells, plasmids expressing the full-length HBx or HBx deletion mutants were constructed. The biological activities in these transfectants were analyzed by a series of assays. Results showed that HBx3'-20 and HBx3'-40 amino acid deletion mutants exhibited an increase in cellular proliferation, focus formation, tumorigenicity, and invasive growth and metastasis through promotion of the cell cycle from G0/G1 to the S phase, when compared with the full-length HBx. In contrast, HBx3'-30 aminomore » acid deletion mutant repressed cell proliferation by blocking in G1 phase. The expression of P53, p21{sup WAF1}, p14{sup ARF}, and MDM2 proteins was regulated by expression of HBx mutants. In conclusions, HBx variants showed different effects and functions on cell proliferation and invasion by regulation of the cell cycle progression and its associated proteins expression.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
McGuinness, S.M.; Shibuya, M.L.; Ueno, A.M.
1995-06-01
We examined the effect of caffeine (1,3,7-trimethylxanthine) on the quantity and quality of mutations in cultured mammalian A{sub L} human-hamster hybrid cells exposed to {sup 137}Cs {gamma} radiation. At a dose (1.5 mg/ml for 16 h) that reduced the plating efficiency (PE) by 20%, caffeine was not itself a significant mutagen, but it increased by approximately twofold the slope of the dose-response curve for induction of S1{sup {minus}} mutants by {sup 137}Cs {gamma} radiation. Molecular analysis of 235 S1{sup {minus}} mutants using a series of DNA probes mapped to the human chromosome 11 in the A{sub L} hybrid cells revealedmore » that 73 to 85% of the mutations in unexposed cells and in cells treated with caffeine alone, {sup 137}Cs {gamma} rays alone or {sup 137}Cs {gamma} rays plus caffeine were large deletions involving millions of base pairs of DNA. Most of these deletions were contiguous with the region of the MIC1 gene at 11p13 that encodes the S1 cell surface antigen. In other mutants that had suffered multiple marker loss, the deletions were intermittent along chromosome 11. These {open_quotes}complex{close_quotes} mutations were rare for {sup 137}Cs {gamma} irradiation (1/63 = 1.5%) but relatively prevalent (23-50%) for other exposure conditions. Thus caffeine appears to alter both the quantity and quality of mutations induced by {sup 137}Cs {gamma} irradiation. 62 refs., 3 figs., 3 tabs.« less
Lu, Lin; Roberts, George G; Oszust, Cynthia; Hudson, Alan P
2005-10-01
A putative yeast mitochondrial upstream activating sequence (UAS) was used in a one-hybrid screening procedure that identified the YJR127C ORF on chromosome X. This gene was previously designated ZMS1 and is listed as a transcription factor on the SGD website. Real time RT-PCR assays showed that expression of YJR127C/ZMS1 was glucose-repressible, and a deletion mutant for the gene showed a growth defect on glycerol-based but not on glucose- or ethanol-based medium. Real time RT-PCR analyses identified severely attenuated transcript levels from GUT1 and GUT2 to be the source of that growth defect, the products of GUT1 and GUT2 are required for glycerol utilization. mRNA levels from a large group of mitochondria- and respiration-related nuclear genes also were shown to be attenuated in the deletion mutant. Importantly, transcript levels from the mitochondrial OLI1 gene, which has an associated organellar UAS, were attenuated in the DeltaYJR127C mutant during glycerol-based growth, but those from COX3 (OXI2), which lacks an associated mitochondrial UAS, were not. Transcriptome analysis of the glycerol-grown deletion mutant showed that genes in several metabolic and other categories are affected by loss of this gene product, including protein transport, signal transduction, and others. Thus, the product of YJR127C/ZMS1 is involved in transcriptional control for genes in both cellular genetic compartments, many of which specify products required for glycerol-based growth, respiration, and other functions.
Dzierzbicki, Piotr; Kaniak-Golik, Aneta; Malc, Ewa; Mieczkowski, Piotr; Ciesla, Zygmunt
2012-12-01
Oxidative stress is known to enhance the frequency of two major types of alterations in the mitochondrial genome of Saccharomyces cerevisiae: point mutations and large deletions resulting in the generation of respiration-deficient petite rhō mutants. We investigated the effect of antimycin A, a well-known agent inducing oxidative stress, on the stability of mtDNA. We show that antimycin enhances exclusively the generation of respiration-deficient petite mutants and this is accompanied by a significant increase in the level of reactive oxygen species (ROS) and in a marked drop of cellular ATP. Whole mitochondrial genome sequencing revealed that mtDNAs of antimycin-induced petite mutants are deleted for most of the wild-type sequence and usually contain one of the active origins of mtDNA replication: ori1, ori2 ori3 or ori5. We show that the frequency of antimycin-induced rhō mutants is significantly elevated in mutants deleted either for the RAD50 or XRS2 gene, both encoding the components of the MRX complex, which is known to be involved in the repair of double strand breaks (DSBs) in DNA. Furthermore, enhanced frequency of rhō mutants in cultures of antimycin-treated cells lacking Rad50 was further increased by the simultaneous absence of the Ogg1 glycosylase, an important enzyme functioning in mtBER. We demonstrate also that rad50Δ and xrs2Δ deletion mutants display a considerable reduction in the frequency of allelic mitochondrial recombination, suggesting that it is the deficiency in homologous recombination which is responsible for enhanced rearrangements of mtDNA in antimycin-treated cells of these mutants. Finally, we show that the generation of large-scale mtDNA deletions induced by antimycin is markedly decreased in a nuc1Δ mutant lacking the activity of the Nuc1 nuclease, an ortholog of the mammalian mitochondrial nucleases EndoG and ExoG. This result indicates that the nuclease plays an important role in processing of oxidative stress-induced lesions in the mitochondrial genome. Copyright © 2012 Elsevier B.V. All rights reserved.
Proteomic analysis of protein phosphatase Z1 from Candida albicans
Pfliegler, Walter P.; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Dombrádi, Viktor
2017-01-01
Protein phosphatase Z is a “novel type” fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for CaPpz1 in biofilm formation, was confirmed experimentally. Thus our unbiased proteomic approach lead to the discovery of a novel function for this phosphatase in C. albicans. PMID:28837603
Gots, Joseph S.; Benson, Charles E.; Shumas, Susan R.
1972-01-01
Certain proAB deletion mutants of Salmonella typhimurium were found to be simultaneously deleted in a gene required for the utilization of guanine and xanthine (designated gxu). These mutants were resistant to 8-azaguanine and when carrying an additional pur mutation were unable to use guanine or xanthine as a purine source. The defect was correlated with deficiencies in the uptake and phosphoribosyltransferase activities for guanine and xanthine. Hypoxanthine and adenine activities were unaltered. The deficiency was restored to normal by transduction to pro+ and in F′ merodiploids. PMID:4563984
Mundell, S J; Matharu, A-L; Nisar, S; Palmer, T M; Benovic, J L; Kelly, E
2010-02-01
We have investigated the effect of deletions of a postsynaptic density, disc large and zo-1 protein (PDZ) motif at the end of the COOH-terminus of the rat A(2B) adenosine receptor on intracellular trafficking following long-term exposure to the agonist 5'-(N-ethylcarboxamido)-adenosine. The trafficking of the wild type A(2B) adenosine receptor and deletion mutants expressed in Chinese hamster ovary cells was studied using an enzyme-linked immunosorbent assay in combination with immunofluorescence microscopy. The wild type A(2B) adenosine receptor and deletion mutants were all extensively internalized following prolonged treatment with NECA. The intracellular compartment through which the Gln(325)-stop receptor mutant, which lacks the Type II PDZ motif found in the wild type receptor initially trafficked was not the same as the wild type receptor. Expression of dominant negative mutants of arrestin-2, dynamin or Eps-15 inhibited internalization of wild type and Leu(330)-stop receptors, whereas only dominant negative mutant dynamin inhibited agonist-induced internalization of Gln(325)-stop, Ser(326)-stop and Phe(328)-stop receptors. Following internalization, the wild type A(2B) adenosine receptor recycled rapidly to the cell surface, whereas the Gln(325)-stop receptor did not recycle. Deletion of the COOH-terminus of the A(2B) adenosine receptor beyond Leu(330) switches internalization from an arrestin- and clathrin-dependent pathway to one that is dynamin dependent but arrestin and clathrin independent. The presence of a Type II PDZ motif appears to be essential for arrestin- and clathrin-dependent internalization, as well as recycling of the A(2B) adenosine receptor following prolonged agonist addition.
Identification of a functional capsule locus in Streptococcus mitis.
Rukke, H V; Hegna, I K; Petersen, F C
2012-04-01
The polysaccharide capsule of Streptococcus pneumoniae is a hallmark for virulence in humans. In its close relative Streptococcus mitis, a common human commensal, analysis of the sequenced genomes of six strains revealed the presence of a putative capsule locus in four of them. We constructed an isogenic S. mitis mutant from the type strain that lacked the 19 open reading frames in the capsule locus (Δcps mutant), using a deletion strategy similar to previous capsule functional studies in S. pneumoniae. Transmission electron microscopy and atomic force microscopy revealed a capsule-like structure in the S. mitis type strain that was absent or reduced in the Δcps mutant. Since S. mitis are predominant oral colonizers of tooth surfaces, we addressed the relevance of the capsule locus for the S. mitis overall surface properties, autoaggregation and biofilm formation. The capsule deletion resulted in a mutant with approximately two-fold increase in hydrophobicity. Binding to the Stains-all cationic dye was reduced by 40%, suggesting a reduction in the overall negative surface charge of the mutant. The mutant exhibited also increased autoaggregation in coaggregation buffer, and up to six-fold increase in biofilm levels. The results suggested that the capsule locus is associated with production of a capsule-like structure in S. mitis and indicated that the S. mitis capsule-like structure may confer surface attributes similar to those associated with the capsule in S. pneumoniae. © 2011 John Wiley & Sons A/S.
Yu, Hao; Kim, Kwang Sik
2010-02-01
We previously showed that cytotoxic necrotizing factor 1 (CNF1) contributes to Escherichia coli K1 invasion of human brain microvascular endothelial cells (HBMEC) and interacts with the receptor on the surface of HBMEC. CNF1 is the cytoplasmic protein, and it remains incompletely understood how CNF1 is secreted across the inner and outer membranes in E. coli K1. In order to investigate the genetic determinants for secretion of CNF1 in E. coli K1, we performed Tn5 mutagenesis screening by applying beta-lactamase as a reporter to monitor secretion of CNF1. We identified a Tn5 mutant that exhibited no beta-lactamase activity in the culture supernatant and in which the mutated gene encodes a ferredoxin gene (fdx). In the fdx deletion mutant, there was no evidence of translocation of CNF1 into HBMEC. Western blot analysis of the fdx deletion mutant revealed that ferredoxin is involved in translocation of CNF1 across the cytoplasmic membrane. The fdx mutant exhibited significantly decreased invasion of HBMEC, similar to the decreased HBMEC invasion observed with the CNF1 mutant. The failures to secrete CNF1 and invade HBMEC of the fdx mutant were restored to the levels of the parent strain by complementation with fdx. These findings demonstrate for the first time that ferredoxin is involved in secretion of CNF1 across the inner membrane in meningitis-causing E. coli K1.
Redrejo-Rodríguez, Modesto; Rodríguez, Javier M.; Suárez, Cristina; Salas, José
2013-01-01
The function of the African swine fever virus (ASFV) reparative DNA polymerase, Pol X, was investigated in the context of virus infection. Pol X is a late structural protein that localizes at cytoplasmic viral factories during DNA replication. Using an ASFV deletion mutant lacking the Pol X gene, we have shown that Pol X is not required for virus growth in Vero cells or swine macrophages under one-step growth conditions. However, at a low multiplicity of infection, when multiple rounds of replication occur, the growth of the mutant virus is impaired in swine macrophages but not in Vero cells, suggesting that Pol X is needed to repair the accumulated DNA damage. The replication of the mutant virus in Vero cells presents sensitivity to oxidative damage, and mutational analysis of viral DNA shows that deletion of Pol X results in an increase in the mutation frequency in macrophages. Therefore, our data reveal a biological role for ASFV Pol X in the context of the infected cell in the preservation of viral genetic information. PMID:23824796
Enhanced cellulase producing mutants developed from heterokaryotic Aspergillus strain.
Kaur, Baljit; Oberoi, H S; Chadha, B S
2014-03-01
A heterokaryon 28, derived through protoplast fusion between Aspergillus nidulans and Aspergillus tubingensis (Dal8), was subjected cyclic mutagenesis followed by selection on increasing levels of 2-deoxy glucose (2-DG) as selection marker. The derived deregulated cellulase hyper producing mutant '64', when compared to fusant 28, produced 9.83, 7.8, 3.2, 4.2 and 19.74 folds higher endoglucanase, β-glucosidase, cellobiohydrolase, FPase and xylanase, respectively, under shake cultures. The sequence analysis of PCR amplified β-glucosidase gene from wild and mutant showed nucleotide deletion/substitution. The mutants showed highly catalytic efficient β-glucosidase as evident from low Km and high Vmax values. The expression profiling through zymogram analysis also indicated towards over-expression of cellulases. The up/down regulated expressed proteins observed through SDS-PAGE were identified by Peptide mass fingerprinting The cellulase produced by mutants in conjunction with cellulase free xylanase derived from Thermomyces lanuginosus was used for efficient utilization of alkali treated rice straw for obtaining xylo-oligosaccharides and ethanol. Copyright © 2014 Elsevier Ltd. All rights reserved.
van Lier, Christina J; Tiner, Bethany L; Chauhan, Sadhana; Motin, Vladimir L; Fitts, Eric C; Huante, Matthew B; Endsley, Janice J; Ponnusamy, Duraisamy; Sha, Jian; Chopra, Ashok K
2015-03-01
We recently characterized the Δlpp Δpla double in-frame deletion mutant of Yersinia pestis CO92 molecularly, biologically, and immunologically. While Braun lipoprotein (Lpp) activates toll-like receptor-2 to initiate an inflammatory cascade, plasminogen activator (Pla) protease facilitates bacterial dissemination in the host. The Δlpp Δpla double mutant was highly attenuated in evoking bubonic and pneumonic plague, was rapidly cleared from mouse organs, and generated humoral and cell-mediated immune responses to provide subsequent protection to mice against a lethal challenge dose of wild-type (WT) CO92. Here, we further characterized the Δlpp Δpla double mutant in two murine macrophage cell lines as well as in primary human monocyte-derived macrophages to gauge its potential as a live-attenuated vaccine candidate. We first demonstrated that the Δpla single and the Δlpp Δpla double mutant were unable to survive efficiently in murine and human macrophages, unlike WT CO92. We observed that the levels of Pla and its associated protease activity were not affected in the Δlpp single mutant, and, likewise, deletion of the pla gene from WT CO92 did not alter Lpp levels. Further, our study revealed that both Lpp and Pla contributed to the intracellular survival of WT CO92 via different mechanisms. Importantly, the ability of the Δlpp Δpla double mutant to be phagocytized by macrophages, to stimulate production of tumor necrosis factor-α and interleukin-6, and to activate the nitric oxide killing pathways of the host cells remained unaltered when compared to the WT CO92-infected macrophages. Finally, macrophages infected with either the WT CO92 or the Δlpp Δpla double mutant were equally efficient in their uptake of zymosan particles as determined by flow cytometric analysis. Overall, our data indicated that although the Δlpp Δpla double mutant of Y. pestis CO92 was highly attenuated, it retained the ability to elicit innate and subsequent acquired immune responses in the host similar to that of WT CO92, which are highly desirable in a live-attenuated vaccine candidate. Copyright © 2015 Elsevier Ltd. All rights reserved.
Jin, Feng-Jie; Katayama, Takuya; Maruyama, Jun-Ichi; Kitamoto, Katsuhiko
2016-11-01
Genomic mapping of mutations using next-generation sequencing technologies has facilitated the identification of genes contributing to fundamental biological processes, including human diseases. However, few studies have used this approach to identify mutations contributing to heterologous protein production in industrial strains of filamentous fungi, such as Aspergillus oryzae. In a screening of A. oryzae strains that hyper-produce human lysozyme (HLY), we previously isolated an AUT1 mutant that showed higher production of various heterologous proteins; however, the underlying factors contributing to the increased heterologous protein production remained unclear. Here, using a comparative genomic approach performed with whole-genome sequences, we attempted to identify the genes responsible for the high-level production of heterologous proteins in the AUT1 mutant. The comparative sequence analysis led to the detection of a gene (AO090120000003), designated autA, which was predicted to encode an unknown cytoplasmic protein containing an alpha/beta-hydrolase fold domain. Mutation or deletion of autA was associated with higher production levels of HLY. Specifically, the HLY yields of the autA mutant and deletion strains were twofold higher than that of the control strain during the early stages of cultivation. Taken together, these results indicate that combining classical mutagenesis approaches with comparative genomic analysis facilitates the identification of novel genes involved in heterologous protein production in filamentous fungi.
Crawford, S; Goff, S P
1985-01-01
Deletion mutations in the 5' part of the pol gene of Moloney murine leukemia virus were generated by restriction enzyme site-directed mutagenesis of cloned proviral DNA. DNA sequence analysis indicated that one such deletion was localized entirely within the 5' part of the pol gene, did not affect the region encoding reverse transcriptase, and preserved the translational reading frame downstream of the mutation. The major viral precursor polyproteins (Pr65gag, Pr200gag-pol, and gPr80env) were synthesized at wild-type levels in cell lines carrying the mutant genome. These cell lines assembled and released wild-type levels of virion particles into the medium. Cleavage of both Pr65gag and Pr200gag-pol precursors to the mature proteins was completely blocked in the mutant virions. Surprisingly, these virions contained high levels of active reverse transcriptase; examination of the endogenous reverse transcription products synthesized by the mutant virions revealed normal amounts of minus-strand strong-stop DNA, indicating that the RNA genome was packaged and that reverse transcription in detergent-permeabilized virions was not significantly impaired. Processing of gPr80env to gP70env and P15E was not affected by the mutation, but cleavage of P15E to P12E was not observed. The mutant particles were poorly infectious; analysis indicated that infection was blocked at an early stage. The data are consistent with the idea that the 5' part of the pol gene encodes a protease directly responsible for processing Pr65gag, and possibly Pr200gag-pol, to the structural virion proteins. It appears that cleavage of the gag gene product is not required for budding and release of virions and that complete processing of the pol gene product to the mature form of reverse transcriptase is not required for its functional activation. Images PMID:3882995
Yao, Yufeng; Xie, Yi; Perace, Donna; Zhong, Yi; Lu, Jie; Tao, Jing; Guo, Xiaokui; Kim, Kwang Sik
2009-11-01
Type III secretion systems (T3SSs) have been documented in many Gram-negative bacteria, including enterohemorrhagic Escherichia coli. We have previously shown the existence of a putative T3SS in meningitis-causing E. coli K1 strains, referred to as E. coli type III secretion 2 (ETT2). The sequence of ETT2 in meningitis-causing E. coli K1 strain EC10 (O7:K1) revealed that ETT2 comprises the epr, epa and eiv genes, but bears mutations, deletions and insertions. We constructed the EC10 mutants deleted of ETT2 or eivA gene, and their contributions to bacterial pathogenesis were evaluated in human brain microvascular endothelial cells (HBMECs). The deletion mutant of ETT2 exhibited defects in invasion and intracellular survival compared with the parental E. coli K1 strain EC10. The mutant deleted of eivA within ETT2 was also significantly defective in invasion and intracellular survival in HBMECs, and the defects of the eiv mutant were restored to the levels of the parent strain EC10 by transcomplementation. These findings suggest that ETT2 plays a role in the pathogenesis of E. coli K1 infection, including meningitis.
Zhu, Jufen; Yu, Xinxu; Xie, Baogui; Gu, Xiaokui; Zhang, Zhenying; Li, Shaojie
2013-06-01
To gain insight into the regulatory mechanisms of oxidative stress responses in filamentous fungi, the genome-wide transcriptional response of Neurospora crassa to menadione was analysed by digital gene expression (DGE) profiling, which identified 779 upregulated genes and 576 downregulated genes. Knockout mutants affecting 130 highly-upregulated genes were tested for menadione sensitivity, which revealed that loss of the transcription factor siderophore regulation (SRE) (a transcriptional repressor for siderophore biosynthesis), catatase-3, cytochrome c peroxidase or superoxide dismutase 1 copper chaperone causes hypersensitivity to menadione. Deletion of sre dramatically increased transcription of the siderophore biosynthesis gene ono and the siderophore iron transporter gene sit during menadione stress, suggesting that SRE is required for repression of iron uptake under oxidative stress conditions. Contrary to its phenotype, the sre deletion mutant showed higher transcriptional levels of genes encoding reactive oxygen species (ROS) scavengers than wild type during menadione stress, which implies that the mutant suffers a higher level of oxidative stress than wild type. Uncontrolled iron uptake in the sre mutant might exacerbate cellular oxidative stress. This is the first report of a negative regulator of iron assimilation participating in the fungal oxidative stress response. In addition to SRE, eight other transcription factor genes were also menadione-responsive but their single gene knockout mutants showed wild-type menadione sensitivity. Two of them, named as mit-2 (menadione induced transcription factor-2) and mit-4 (menadione induced transcription factor-4), were selected for double mutant analysis. The double mutant was hypersensitive to menadione. Similarly, the double mutation of mit-2 and sre also had additive effects on menadione sensitivity, suggesting multiple transcription factors mediate oxidative stress resistance in an additive manner. Copyright © 2013 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Traeger, Stefanie; Nowrousian, Minou
2015-04-14
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. Copyright © 2015 Traeger and Nowrousian.
Traeger, Stefanie; Nowrousian, Minou
2015-01-01
During sexual development, filamentous ascomycetes form complex, three-dimensional fruiting bodies for the generation and dispersal of spores. In previous studies, we identified genes with evolutionary conserved expression patterns during fruiting body formation in several fungal species. Here, we present the functional analysis of two developmentally up-regulated genes, chs7 and sec22, in the ascomycete Sordaria macrospora. The genes encode a class VII (division III) chitin synthase and a soluble N-ethylmaleimide-sensitive-factor attachment protein receptor (SNARE) protein, respectively. Deletion mutants of chs7 had normal vegetative growth and were fully fertile but showed sensitivity toward cell wall stress. Deletion of sec22 resulted in a reduced number of ascospores and in defects in ascospore pigmentation and germination, whereas vegetative growth was normal in the mutant. A SEC22-EGFP fusion construct under control of the native sec22 promoter and terminator regions was expressed during different stages of sexual development. Expression of several development-related genes was deregulated in the sec22 mutant, including three genes involved in melanin biosynthesis. Our data indicate that chs7 is dispensable for fruiting body formation in S. macrospora, whereas sec22 is required for ascospore maturation and germination and thus involved in late stages of sexual development. PMID:25873638
Conesa, Christine; Ruotolo, Roberta; Soularue, Pascal; Simms, Tiffany A; Donze, David; Sentenac, André; Dieci, Giorgio
2005-10-01
We used genome-wide expression analysis in Saccharomyces cerevisiae to explore whether and how the expression of protein-coding, RNA polymerase (Pol) II-transcribed genes is influenced by a decrease in RNA Pol III-dependent transcription. The Pol II transcriptome was characterized in four thermosensitive, slow-growth mutants affected in different components of the RNA Pol III transcription machinery. Unexpectedly, we found only a modest correlation between altered expression of Pol II-transcribed genes and their proximity to class III genes, a result also confirmed by the analysis of single tRNA gene deletants. Instead, the transcriptome of all of the four mutants was characterized by increased expression of genes known to be under the control of the Gcn4p transcriptional activator. Indeed, GCN4 was found to be translationally induced in the mutants, and deleting the GCN4 gene eliminated the response. The Gcn4p-dependent expression changes did not require the Gcn2 protein kinase and could be specifically counteracted by an increased gene dosage of initiator tRNA(Met). Initiator tRNA(Met) depletion thus triggers a GCN4-dependent reprogramming of genome expression in response to decreased Pol III transcription. Such an effect might represent a key element in the coordinated transcriptional response of yeast cells to environmental changes.
Liu, Guodong; Chen, Yun; Færgeman, Nils J; Nielsen, Jens
2017-09-01
The sterol composition of membranes is known to influence many phenotypes of yeast. However, a systematic study of the relationship between sterol composition and stress resistances has not been conducted. Here, we therefore constructed single or double gene deletion mutants of the last four enzymes in ergosterol biosynthesis in a prototrophic genetic background of Saccharomyces cerevisiae. Identification of the sterol composition of these mutants revealed a high flexibility of the sterol-processing steps instead of the previously proposed sequential conversion. Compared with the wild type, the mutants showed altered resistances to different exogenous stresses regarding the specific growth rate and duration of lag phase. The erg5 deletion mutant whose sterol has a saturated side chain exhibited overall robust growth under the tested stress conditions. The thermotolerant phenotype of erg5 deletion mutant was reproduced in filamentous fungus Penicillium oxalicum. These results highlight the important role of sterols in the response of yeast cells to environmental stresses, and suggest the possibility of improving the robustness of industrial yeast strains by engineering their sterol composition. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Deletion of lactate dehydrogenase in Enterobacter aerogenes to enhance 2,3-butanediol production.
Jung, Moo-Young; Ng, Chiam Yu; Song, Hyohak; Lee, Jinwon; Oh, Min-Kyu
2012-07-01
2,3-Butanediol is an important bio-based chemical product, because it can be converted into several C4 industrial chemicals. In this study, a lactate dehydrogenase-deleted mutant was constructed to improve 2,3-butanediol productivity in Enterobacter aerogenes. To delete the gene encoding lactate dehydrogenase, λ Red recombination method was successfully adapted for E. aerogenes. The resulting strain produced a very small amount of lactate and 16.7% more 2,3-butanediol than that of the wild-type strain in batch fermentation. The mutant and its parental strain were then cultured with six different carbon sources, and the mutant showed higher carbon source consumption and microbial growth rates in all media. The 2,3-butanediol titer reached 69.5 g/l in 54 h during fed-batch fermentation with the mutant,which was 27.4% higher than that with the parental strain.With further optimization of the medium and aeration conditions,118.05 g/l 2,3-butanediol was produced in 54 h during fed-batch fermentation with the mutant. This is by far the highest titer of 2,3-butanediol with E. aerogenes achieved by metabolic pathway engineering.
Bourai, Neema; Jacobs, William R; Narayanan, Sujatha
2012-02-01
Mycobacterium tuberculosis genome encodes several high and low molecular mass penicillin binding proteins. One such low molecular mass protein is DacB2 encoded by open reading frame Rv2911 of M. tuberculosis which is predicted to play a role in peptidoglycan synthesis. In this study we have tried to gain an insight into the role of this accessory cell division protein in mycobacterial physiology by performing overexpression and deletion studies. The overproduction of DacB2 in non-pathogenic, fast growing mycobacterium Mycobacterium smegmatis mc(2)155 resulted in reduced growth, an altered colony morphology, a defect in sliding motility and biofilm formation. A point mutant of DacB2 was made wherein the active site serine residue was mutated to cysteine to abolish the penicillin binding function of protein. The overexpression of mutant protein showed similar results indicating that the effects produced were independent of protein's penicillin binding function. The gene encoding DacB2 was deleted in M. tuberculosis by specialized transduction method. The deletion mutant showed reduced growth in Sauton's medium under acidic and low oxygen availability. The in vitro infection studies with THP-1 cells showed increased intracellular survival of dacB2 mutant compared to parent and complemented strains. The colony morphology and antibiotic sensitivity of mutant and wild-type strains were similar. Copyright © 2011 Elsevier Ltd. All rights reserved.
Multigene signature for predicting prognosis of patients with 1p19q co-deletion diffuse glioma.
Hu, Xin; Martinez-Ledesma, Emmanuel; Zheng, Siyuan; Kim, Hoon; Barthel, Floris; Jiang, Tao; Hess, Kenneth R; Verhaak, Roel G W
2017-06-01
Co-deletion of 1p and 19q marks a diffuse glioma subtype associated with relatively favorable overall survival; however, heterogeneous clinical outcomes are observed within this category. We assembled gene expression profiles and sample annotation of 374 glioma patients carrying the 1p/19q co-deletion. We predicted 1p/19q status using gene expression when annotation was missing. A first cohort was randomly split into training (n = 170) and a validation dataset (n = 163). A second validation set consisted of 41 expression profiles. An elastic-net penalized Cox proportional hazards model was applied to build a classifier model through cross-validation within the training dataset. The selected 35-gene signature was used to identify high-risk and low-risk groups in the validation set, which showed significantly different overall survival (P = .00058, log-rank test). For time-to-death events, the high-risk group predicted by the gene signature yielded a hazard ratio of 1.78 (95% confidence interval, 1.02-3.11). The signature was also significantly associated with clinical outcome in the The Cancer Genome Atlas (CGA) IDH-mutant 1p/19q wild-type and IDH-wild-type glioma cohorts. Pathway analysis suggested that high risk was associated with increased acetylation activity and inflammatory response. Tumor purity was found to be significantly decreased in high-risk IDH-mutant with 1p/19q co-deletion gliomas and IDH-wild-type glioblastomas but not in IDH-wild-type lower grade or IDH-mutant, non-co-deleted gliomas. We identified a 35-gene signature that identifies high-risk and low-risk categories of 1p/19q positive glioma patients. We have demonstrated heterogeneity amongst a relatively new glioma subtype and provided a stepping stone towards risk stratification. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Kögel, D; Aboud, M; Flügel, R M
1995-01-01
Human foamy or spuma virus (HFV) codes for a distinct set of pol gen products. To determine the minimal requirements for the HFV enzymatic activities, defined residues of the reverse transcriptase (RT) and ribo-nuclease H (RNase H) domain of the HFV pol gene were mutated by site-specific PCR mutagenesis. The mutant gene products were bacterially expressed, purified by Ni2+ chelate affinity chromatography and characterised by Western blotting. The enzymatic activities of the individual recombinant HFV pol mutant proteins were characterised by the situ RT, RNase H and RNase H assays. Two substitution mutants reached RT activity levels higher than that of the intact recombinant HFV RT-RH-His. When the catalytically essential D508 was substituted by A508, 5% of RNase H activity was retained while DNA polymerase activity increased 2-fold. A deletion of 11 amino acid residues in the hinge region completely abolished DNA polymerase while RNase H activity decreased 2-fold. A deletion mutant in the C-terminal RH domain showed no RNase H but retained RNase H activity indicating that the activities are genetically separable. The combined data reveal that the HFV DNA polymerase and RNase H activities are interdependent. Images PMID:7544460
Dzelzkalns, V A; Bogorad, L
1988-01-01
Photosynthesis-defective mutants of the transformable cyanobacterium Synechocystis 6803 have been isolated following nitrosoguanidine mutagenesis. The photosystem II- phenotype of one of these mutants is shown by DNA sequencing to be attributable to a short deletion in psbC, the gene encoding the 44-kd, chlorophyll-binding protein of photosystem II. Although not a component of the reaction center of photosystem II, the 44-kd protein is none the less shown to be essential in vivo for photosystem II activity. The deletion in psbC also results in greatly diminished levels of D-2 (a component of the reaction center of photosystem II) indicating that the loss of the product of the psbC gene affects the assembly or stability of the photosystem II reaction center. The isolation of a clone capable of restoring both photosystem II activity and photoautotrophy to the mutant cells was aided by the observation that restriction fragments or cloned Synechocystis 6803 DNA applied in liquid or in melted agarose directly onto a lawn of Synechocystis 6803 will lead to the transformation of the cells. This in situ 'dot' transformation procedure provides a convenient method for the rapid identification of fractions or clones containing complementing Synechocystis 6803 DNA. Images PMID:3130247
Zhu, L X; Waldren, C A; Vannias, D; Hei, T K
1996-03-01
Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.
NASA Technical Reports Server (NTRS)
Zhu, L. X.; Waldren, C. A.; Vannias, D.; Hei, T. K.; Chatterjee, A. (Principal Investigator)
1996-01-01
Mutation induction by charged particles of defined linear energy transfer (LET) and gamma rays was scored using human-hamster hybrid AL cells. The LET values for charged particles accelerated at the Radiological Research Accelerator Facility ranged from 10 keV/microm protons to 150 keV/microm 4He ions. The induced mutant fractions at both the S1 and HGPRT loci were dependent on the dose and LET. In addition, for each dose examined, the mutant yield at the S1 locus was 30-60 fold higher than at the corresponding HGPRT locus. To determine whether the mutation spectrum was comparably dependent on dose and LET, independent S1- and HGPRT- mutants induced by 150 keV/microm 4He ions and gamma rays were isolated, and their DNA was analyzed by both Southern blotting and multiplex PCR methods. While the majority of radiation-induced mutants showed deletions of varying sizes, the relative percentage of large deletions was found to be related to both the dose and LET of the radiation examined. Using a mutation system that can detect multilocus changes, results of the present study show that radiation-induced chromosomal loss can be in the millions of base pairs.
Gene Deletions in Mycobacterium bovis BCG Stimulate Increased CD8+ T Cell Responses
Panas, Michael W.; Sixsmith, Jaimie D.; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T.; Moy, Brian T.; Lee, Sunhee; Schmitz, Joern E.; Jacobs, William R.; Porcelli, Steven A.; Haynes, Barton F.; Letvin, Norman L.
2014-01-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8+ T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8+ T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8+ T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8+ T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. PMID:25287928
Gene deletions in Mycobacterium bovis BCG stimulate increased CD8+ T cell responses.
Panas, Michael W; Sixsmith, Jaimie D; White, KeriAnn; Korioth-Schmitz, Birgit; Shields, Shana T; Moy, Brian T; Lee, Sunhee; Schmitz, Joern E; Jacobs, William R; Porcelli, Steven A; Haynes, Barton F; Letvin, Norman L; Gillard, Geoffrey O
2014-12-01
Mycobacteria, the etiological agents of tuberculosis and leprosy, have coevolved with mammals for millions of years and have numerous ways of suppressing their host's immune response. It has been suggested that mycobacteria may contain genes that reduce the host's ability to elicit CD8(+) T cell responses. We screened 3,290 mutant Mycobacterium bovis bacillus Calmette Guerin (BCG) strains to identify genes that decrease major histocompatibility complex (MHC) class I presentation of mycobacterium-encoded epitope peptides. Through our analysis, we identified 16 mutant BCG strains that generated increased transgene product-specific CD8(+) T cell responses. The genes disrupted in these mutant strains had disparate predicted functions. Reconstruction of strains via targeted deletion of genes identified in the screen recapitulated the enhanced immunogenicity phenotype of the original mutant strains. When we introduced the simian immunodeficiency virus (SIV) gag gene into several of these novel BCG strains, we observed enhanced SIV Gag-specific CD8(+) T cell responses in vivo. This study demonstrates that mycobacteria carry numerous genes that act to dampen CD8(+) T cell responses and suggests that genetic modification of these genes may generate a novel group of recombinant BCG strains capable of serving as more effective and immunogenic vaccine vectors. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Deletion mutation analysis on C-terminal domain of plant vacuolar H(+)-pyrophosphatase.
Lin, Hsin Hung; Pan, Yih Jiuan; Hsu, Shen Hsing; Van, Ru Chuan; Hsiao, Yi Yuong; Chen, Jiun Hsien; Pan, Rong Long
2005-10-15
Vacuolar H(+)-translocating inorganic pyrophosphatase (V-PPase; EC 3.6.1.1) is a homodimeric proton-translocase; it contains a single type of polypeptide of approximately 81kDa. A line of evidence demonstrated that the carboxyl terminus of V-PPase is relatively conserved in various plant V-PPases and presumably locates in the vicinity of the catalytic site. In this study, we attempt to identify the roles of the C-terminus of V-PPase by generating a series of C-terminal deletion mutants over-expressed in Saccharomyces cerevisiae, and determining their enzymatic and proton translocating reactions. Our results showed that the deletion mutation at last 5 amino acids in the C-terminus (DeltaC5) induced a dramatic decline in enzymatic activity, proton translocation, and coupling efficiency of V-PPase; but the mutant lacking last 10 amino acids (DeltaC10) retained about 60-70% of the enzymatic activity of wild-type. Truncation of the C-terminus by more than 10 amino acids completely abolished the enzymatic activity and proton translocation of V-PPase. Furthermore, the DeltaC10 mutant displayed a shift in T(1/2) (pretreatment temperature at which half enzymatic activity is observed) but not the optimal pH for PP(i) hydrolytic activity. The deletion of the C-terminus substantially modified apparent K(+) binding constant, but exert no significant changes in the Na(+)-, F(-)-, and Ca(2+)-inhibition of the enzymatic activity of V-PPase. Taken together, we speculate that the C-terminus of V-PPase may play a crucial role in sustaining enzymatic activity and is likely involved in the K(+)-regulation of the enzyme in an indirect manner.
Tiwari, Ruby; Bhalla, Prem L; Singh, Mohan B
2009-02-02
Bermuda grass (Cynodon dactylon; subfamily Chloridoideae) is an important source of seasonal aeroallergens in warm tropical and sub-tropical areas worldwide. Improved approaches to diagnosis and therapy of allergic diseases require a thorough understanding of the structure and epitopes on the allergen molecule that are crucial for the antigen-antibody interaction. This study describes the localization of the human IgE-binding regions of the major group 1 pollen allergen Cyn d 1 from Bermuda grass. A cDNA library was constructed from Bermuda grass pollen (BGP) using a Lambda gt11 expression vector. The gene encoding the Cyn d 1 allergen was isolated by screening the library with a mouse monoclonal antibody raised against grass group 1 allergen. In order to characterize the IgE epitopes on Cyn d 1, seven overlapping fragments and three deletion mutants were cloned and over-expressed in E. coli. The recombinant fragments and deletion mutants were evaluated for their comparative IgE reactivity with sera of non atopic individuals and grass pollen allergic patients by ELISA and a dot-blot assay. Analysis of IgE binding regions by overlapping fragments and deletion mutants identified two major allergenic regions corresponding to amino acids 120-170 and 224-244. Deletion of either or both regions led to a significant reduction in IgE binding, emphasizing the importance of the C-terminal region on Cyn d 1 in epitope-IgE interaction. Anti-Cyn d 1 IgE antibodies from allergic human sera recognize two epitopes located at the C-terminal end of the molecule. These data will enable the design of improved diagnostic and therapeutic approaches for BGP hypersensitivity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lin, Hui; Hurt, Jr., Richard Ashley; Johs, Alexander
2014-01-01
The hgcA and hgcB gene pair is essential for mercury (Hg) methylation by certain anaerobic bacteria,1 but little is known about how deletion of hgcAB affects cell surface interactions and intracellular uptake of Hg. Here, we compare hgcAB mutants with the wild-type (WT) strains of both Geobacter sulfurreducens PCA and Desulfovibrio desulfuricans ND132 and observe differences in Hg redox transformations, adsorption, and uptake in laboratory incubation studies. In both strains, deletion of hgcAB increased the reduction of Hg(II) but decreased the oxidation of Hg(0) under anaerobic conditions. The measured cellular thiol content in hgcAB mutants was lower than the WT,more » accounting for decreased adsorption and uptake of Hg. Despite the lack of methylation activity, Hg uptake by the hgcAB continued, albeit at a slower rate than the WT. These findings demonstrate that deletion of the hgcAB gene not only eliminates Hg methylation but also alters cell physiology, resulting in changes to Hg redox reactions, sorption, and uptake by cells.« less
Reduction of Aspergillus niger Virulence in Apple Fruits by Deletion of the Catalase Gene cpeB.
Zhang, Meng-Ke; Tang, Jun; Huang, Zhong-Qin; Hu, Kang-Di; Li, Yan-Hong; Han, Zhuo; Chen, Xiao-Yan; Hu, Lan-Ying; Yao, Gai-Fang; Zhang, Hua
2018-05-30
Aspergillus niger, a common saprophytic fungus, causes rot in many fruits. We studied the role of a putative catalase-peroxidase-encoding gene, cpeB, in oxidative stress and virulence in fruit. The cpeB gene was deleted in A. niger by homologous recombination, and the Δ cpeB mutant showed decreased CAT activity compared with that of the wild type. The cpeB gene deletion caused increased sensitivity to H 2 O 2 stress, and spore germination was significantly reduced; in addition, the reactive-oxygen-species (ROS) metabolites superoxide anions (·O 2 - ), hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) accumulated in the Δ cpeB mutant during H 2 O 2 stress. Furthermore, ROS metabolism in A. niger infected apples was determined, and our results showed that the Δ cpeB mutant induced an attenuated response in apple fruit during the fruit-pathogen interaction; the cpeB gene deletion significantly reduced the development of lesions, suggesting that the cpeB gene in A. niger is essential for full virulence in apples.
Mechanisms of mutagenesis in human cells exposed to 55 MeV protons
NASA Technical Reports Server (NTRS)
Gauny, S.; Wiese, C.; Kronenberg, A.
2001-01-01
Protons represent the major type of charged particle radiation in spaceflight environments. The purpose of this study was to assess mutations arising in human lymphoid cells exposed to protons. Mutations were quantitated at the thymidine kinase (TK1) locus in cell lines derived from the same donor: TK6 cells (wt TP53) and WTK1 cells (mutant TP53). WTK1 cells were much more susceptible to mutagenesis following proton exposure than TK6 cells. Intragenic deletions were observed among early-arising TK1 mutants in TK6 cells, but not in WTK1 cells where all of the mutants arose by LOH. Deletion was the predominant mode of LOH in TK6 cells, while allelic recombination was the major mode of LOH in WTK1 cells. Deletions were of variable lengths, from <1 cM to 64 cM, while mutations that arose by allelic recombination often extended to the telomere. In summary, proton exposures elicited many types of mutations at an autosomal locus in human cells. Most involved large scale loss of genetic information, either through deletion or by recombination.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pallan, Pradeep S.; Marshall, William S.; Harp, Joel
To understand the role of structural elements of RNA pseudoknots in controlling the extent of -1-type ribosomal frameshifting, we determined the crystal structure of a high-efficiency frameshifting mutant of the pseudoknot from potato leaf roll virus (PLRV). Correlations of the structure with available in vitro frameshifting data for PLRV pseudoknot mutants implicate sequence and length of a stem-loop linker as modulators of frameshifting efficiency. Although the sequences and overall structures of the RNA pseudoknots from PLRV and beet western yellow virus (BWYV) are similar, nucleotide deletions in the linker and adjacent minor groove loop abolish frameshifting only with the latter.more » Conversely, mutant PLRV pseudoknots with up to four nucleotides deleted in this region exhibit nearly wild-type frameshifting efficiencies. The crystal structure helps rationalize the different tolerances for deletions in the PLRV and BWYV RNAs, and we have used it to build a three-dimensional model of the PRLV pseudoknot with a four-nucleotide deletion. The resulting structure defines a minimal RNA pseudoknot motif composed of 22 nucleotides capable of stimulating -1-type ribosomal frameshifts.« less
2012-01-01
Background Monoterpenes present a large and versatile group of unsaturated hydrocarbons of plant origin with widespread use in the fragrance as well as food industry. The anaerobic β-myrcene degradation pathway in Castellaniella defragrans strain 65Phen differs from well known aerobic, monooxygenase-containing pathways. The initial enzyme linalool dehydratase-isomerase ldi/LDI catalyzes the hydration of β-myrcene to (S)-(+)-linalool and its isomerization to geraniol. A high-affinity geraniol dehydrogenase geoA/GeDH and a geranial dehydrogenase geoB/GaDH contribute to the formation of geranic acid. A genetic system was for the first time applied for the betaproteobacterium to prove in vivo the relevance of the linalool dehydratase-isomerase and the geraniol dehydrogenase. In-frame deletion cassettes were introduced by conjugation and two homologous recombination events. Results Polar effects were absent in the in-frame deletion mutants C. defragrans Δldi and C. defragrans ΔgeoA. The physiological characterization of the strains demonstrated a requirement of the linalool dehydratase-isomerase for growth on acyclic monoterpenes, but not on cyclic monoterpenes. The deletion of geoA resulted in a phenotype with hampered growth rate on monoterpenes as sole carbon and energy source as well as reduced biomass yields. Enzyme assays revealed the presence of a second geraniol dehydrogenase. The deletion mutants were in trans complemented with the broad-host range expression vector pBBR1MCS-4ldi and pBBR1MCS-2geoA, restoring in both cases the wild type phenotype. Conclusions In-frame deletion mutants of genes in the anaerobic β-myrcene degradation revealed novel insights in the in vivo function. The deletion of a high-affinity geraniol dehydrogenase hampered, but did not preclude growth on monoterpenes. A second geraniol dehydrogenase activity was present that contributes to the β-myrcene degradation pathway. Growth on cyclic monoterpenes independent of the initial enzyme LDI suggests the presence of a second enzyme system activating unsaturated hydrocarbons. PMID:22947208
Identification of New Virulence Factors and Vaccine Candidates for Yersinia pestis
Andersson, Jourdan A.; Sha, Jian; Erova, Tatiana E.; Fitts, Eric C.; Ponnusamy, Duraisamy; Kozlova, Elena V.; Kirtley, Michelle L.; Chopra, Ashok K.
2017-01-01
Earlier, we reported the identification of new virulence factors/mechanisms of Yersinia pestis using an in vivo signature-tagged mutagenesis (STM) screening approach. From this screen, the role of rbsA, which encodes an ATP-binding protein of ribose transport system, and vasK, an essential component of the type VI secretion system (T6SS), were evaluated in mouse models of plague and confirmed to be important during Y. pestis infection. However, many of the identified genes from the screen remained uncharacterized. In this study, in-frame deletion mutants of ypo0815, ypo2884, ypo3614-3168 (cyoABCDE), and ypo1119-1120, identified from the STM screen, were generated. While ypo0815 codes for a general secretion pathway protein E (GspE) of the T2SS, the ypo2884-encoded protein has homology to the βγ crystallin superfamily, cyoABCDE codes for the cytochrome o oxidase operon, and the ypo1119-1120 genes are within the Tol-Pal system which has multiple functions. Additionally, as our STM screen identified three T6SS-associated genes, and, based on in silico analysis, six T6SS clusters and multiple homologs of the T6SS effector hemolysin-coregulated protein (Hcp) exist in Y. pestis CO92, we also targeted these T6SS clusters and effectors for generating deletion mutants. These deletion mutant strains exhibited varying levels of attenuation (up to 100%), in bubonic or pneumonic murine infection models. The attenuation could be further augmented by generation of combinatorial deletion mutants, namely ΔlppΔypo0815, ΔlppΔypo2884, ΔlppΔcyoABCDE, ΔvasKΔhcp6, and Δypo2720-2733Δhcp3. We earlier showed that deletion of the lpp gene, which encodes Braun lipoprotein (Lpp) and activates Toll-like receptor-2, reduced virulence of Y. pestis CO92 in murine models of bubonic and pneumonic plague. The surviving mice infected with ΔlppΔcyoABCDE, ΔvasKΔhcp6, and Δypo2720-2733Δhcp3 mutant strains were 55–100% protected upon subsequent re-challenge with wild-type CO92 in a pneumonic model. Further, evaluation of the attenuated T6SS mutant strains in vitro revealed significant alterations in phagocytosis, intracellular survival in murine macrophages, and their ability to induce cytotoxic effects on macrophages. The results reported here provide further evidence of the utility of the STM screening approach for the identification of novel virulence factors and to possibly target such genes for the development of novel live-attenuated vaccine candidates for plague. PMID:29090192
Identification of New Virulence Factors and Vaccine Candidates for Yersinia pestis.
Andersson, Jourdan A; Sha, Jian; Erova, Tatiana E; Fitts, Eric C; Ponnusamy, Duraisamy; Kozlova, Elena V; Kirtley, Michelle L; Chopra, Ashok K
2017-01-01
Earlier, we reported the identification of new virulence factors/mechanisms of Yersinia pestis using an in vivo signature-tagged mutagenesis (STM) screening approach. From this screen, the role of rbsA , which encodes an ATP-binding protein of ribose transport system, and vasK , an essential component of the type VI secretion system (T6SS), were evaluated in mouse models of plague and confirmed to be important during Y. pestis infection. However, many of the identified genes from the screen remained uncharacterized. In this study, in-frame deletion mutants of ypo0815, ypo2884, ypo3614-3168 (cyoABCDE) , and ypo1119-1120 , identified from the STM screen, were generated. While ypo0815 codes for a general secretion pathway protein E (GspE) of the T2SS, the ypo2884 -encoded protein has homology to the βγ crystallin superfamily, cyoABCDE codes for the cytochrome o oxidase operon, and the ypo1119-1120 genes are within the Tol-Pal system which has multiple functions. Additionally, as our STM screen identified three T6SS-associated genes, and, based on in silico analysis, six T6SS clusters and multiple homologs of the T6SS effector hemolysin-coregulated protein (Hcp) exist in Y. pestis CO92, we also targeted these T6SS clusters and effectors for generating deletion mutants. These deletion mutant strains exhibited varying levels of attenuation (up to 100%), in bubonic or pneumonic murine infection models. The attenuation could be further augmented by generation of combinatorial deletion mutants, namely Δ lpp Δ ypo0815 , Δ lpp Δ ypo2884 , Δ lpp Δ cyoABCDE , Δ vasK Δ hcp6 , and Δ ypo2720-2733 Δ hcp3 . We earlier showed that deletion of the lpp gene, which encodes Braun lipoprotein (Lpp) and activates Toll-like receptor-2, reduced virulence of Y. pestis CO92 in murine models of bubonic and pneumonic plague. The surviving mice infected with Δ lpp Δ cyoABCDE , Δ vasK Δ hcp6 , and Δ ypo2720-2733 Δ hcp3 mutant strains were 55-100% protected upon subsequent re-challenge with wild-type CO92 in a pneumonic model. Further, evaluation of the attenuated T6SS mutant strains in vitro revealed significant alterations in phagocytosis, intracellular survival in murine macrophages, and their ability to induce cytotoxic effects on macrophages. The results reported here provide further evidence of the utility of the STM screening approach for the identification of novel virulence factors and to possibly target such genes for the development of novel live-attenuated vaccine candidates for plague.
Li, Wei; Wang, Jian-Hui; Zhang, Cui-Ying; Ma, Hong-Xia; Xiao, Dong-Guang
2017-06-01
Acetate esters and higher alcohols greatly influence the quality and flavor profiles of Chinese Baijiu (Chinese liquor). Various mutants have been constructed to investigate the interactions of ATF1 overexpression, IAH1 deletion, and BAT2 deletion on the production of acetate esters and higher alcohols. The results showed that the overexpression of ATF1 under the control of the PGK1 promoter with BAT2 and IAH1 double-gene deletion led to a higher production of acetate esters and a lower production of higher alcohols than the overexpression of ATF1 with IAH1 deletion or overexpression of ATF1 with BAT2 deletion. Moreover, deletion of IAH1 in ATF1 overexpression strains effectively increased the production of isobutyl acetate and isoamyl acetate by reducing the hydrolysis of acetate esters. The decline in the production of higher alcohol by the ATF1 overexpression strains with BAT2 deletion is due to the interaction of ATF1 overexpression and BAT2 deletion. Mutants with varying abilities of producing acetate esters and higher alcohols were developed by genetic engineering. These strains have great potential for industrial application.
Duncan, R; Horne, D; Strong, J E; Leone, G; Pon, R T; Yeung, M C; Lee, P W
1991-06-01
We have been investigating structure-function relationships in the reovirus cell attachment protein sigma 1 using various deletion mutants and protease analysis. In the present study, a series of deletion mutants were constructed which lacked 90, 44, 30, 12, or 4 amino acids from the C-terminus of the 455-amino acid-long reovirus type 3 (T3) sigma 1 protein. The full-length and truncated sigma 1 proteins were expressed in an in vitro transcription/translation system and assayed for L cell binding activity. It was found that the removal of as few as four amino acids from the C-terminus drastically affected the cell binding function of the sigma 1 protein. The C-terminal-truncated proteins were further characterized using trypsin, chymotrypsin, and monoclonal and polyclonal antibodies. Our results indicated that the C-terminal portions of the mutant proteins were misfolded, leading to a loss in cell binding function. The N-terminal fibrous tail of the proteins was unaffected by the deletions as was sigma 1 oligomerization, further illustrating the discrete structural and functional roles of the N- and C-terminal domains of sigma 1. In an attempt to identify smaller, functional peptides, full-length sigma 1 expressed in vitro was digested with trypsin and subsequently with chymotrypsin under various conditions. The results clearly demonstrated the highly stable nature of the C-terminal globular head of sigma 1, even when separated from the N-terminal fibrous tail. We concluded that: (1) the C-terminal globular head of sigma 1 exists as a compact, protease-resistant oligomeric structure; (2) an intact C-terminus is required for proper head folding and generation of the conformationally dependent cell binding domain.
Molecular analysis of hprt mutations induced by chromium picolinate in CHO AA8 cells.
Coryell, Virginia H; Stearns, Diane M
2006-11-07
Chromium picolinate (CrPic) is a popular dietary supplement, marketed to the public for weight loss, bodybuilding, and control of blood sugar. Recommendations for long-term use at high dosages have led to questions regarding its safety. Previous studies have reported that CrPic can cause chromosomal aberrations and mutations. The purpose of the current work was to compare the mutagenicity of CrPic as a suspension in acetone versus a solution in DMSO, and to characterize the hprt mutations induced by CrPic in CHO AA8 cells. Treatments of 2% acetone or 2% DMSO alone produced no significant increase in 6-thioguanine (6-TG)-resistant mutants after 48 h exposures. Mutants resistant to 6-TG were generated by exposing cells for 48 h to 80 microg/cm(2) CrPic in acetone or to 1.0mM CrPic in DMSO. CrPic in acetone produced an average induced mutation frequency (MF) of 56 per 10(6) surviving cells relative to acetone solvent. CrPic in acetone was 3.5-fold more mutagenic than CrPic in DMSO, which produced an MF of 16.2. Characterization of 61 total mutations in 48 mutants generated from exposure to CrPic in acetone showed that base substitutions comprised 33% of the mutations, with transversions being predominant; deletions made up 62% of the mutations, with one-exon deletions predominating; and 1-4 bp insertions made up 5% of the characterized mutations. CrPic induced a statistically greater number of deletions and a statistically smaller number of base substitutions than have been measured in spontaneously generated mutants. These data confirm previous studies showing that CrPic is mutagenic, and support the contention that further study is needed to verify the safety of CrPic for human consumption.
Zhang, Yuanbao; Wei, Chao; Jiang, Wendi; Wang, Lei; Li, Churui; Wang, Yunyue; Dow, John Maxwell; Sun, Wenxian
2013-01-01
Bacterial leaf streak caused by Xanthomonas oryzae pv. oryzicola (Xoc) is one of the most important diseases in rice. However, little is known about the pathogenicity mechanisms of Xoc. Here we have investigated the function of three HD-GYP domain regulatory proteins in biofilm formation, the synthesis of virulence factors and virulence of Xoc. Deletion of rpfG resulted in altered production of extracellular polysaccharides (EPS), abolished virulence on rice and enhanced biofilm formation, but had little effect on the secretion of proteases and motility. In contrast, mutational analysis showed that the other two HD-GYP domain proteins had no effect on virulence factor synthesis and tested phenotypes. Mutation of rpfG led to up-regulation of the type III secretion system and altered expression of three putative glycosyltransferase genes gumD, pgaC and xagB, which are part of operons directing the synthesis of different extracellular polysaccharides. The pgaABCD and xagABCD operons were greatly up-regulated in the Xoc ΔrpfG mutant, whereas the expression of the gum genes was unaltered or slightly enhanced. The elevated biofilm formation of the Xoc ΔrpfG mutant was dramatically reduced upon deletion of gumD, xagA and xagB, but not when pgaA and pgaC were deleted. Interestingly, only the ΔgumD mutant, among these single gene mutants, exhibits multiple phenotype alterations including reduced biofilm and EPS production and attenuated virulence on rice. These data indicate that RpfG is a global regulator that controls biofilm formation, EPS production and bacterial virulence in Xoc and that both gumD- and xagB-dependent EPS contribute to biofilm formation under different conditions. PMID:23544067
Role of mannitol dehydrogenases in osmoprotection of Gluconobacter oxydans.
Zahid, Nageena; Deppenmeier, Uwe
2016-12-01
Gluconobacter (G.) oxydans is able to incompletely oxidize various sugars and polyols for the production of biotechnologically important compound. Recently, we have shown that the organism produces and accumulates mannitol as compatible solute under osmotic stress conditions. The present study describes the role of two cytoplasmic mannitol dehydrogenases for osmotolerance of G. oxydans. It was shown that Gox1432 is a NADP + -dependent mannitol dehydrogenase (EC 1.1.1.138), while Gox0849 uses NAD + as cofactor (EC 1.1.1.67). The corresponding genes were deleted and the mutants were analyzed for growth under osmotic stress and non-stress conditions. A severe growth defect was detected for Δgox1432 when grown in high osmotic media, while the deletion of gox0849 had no effect when cells were exposed to 450 mM sucrose in the medium. Furthermore, the intracellular mannitol content was reduced in the mutant lacking the NADP + -dependent enzyme Gox1432 in comparison to the parental strain and the Δgox0849 mutant under stress conditions. In addition, transcriptional analysis revealed that Gox1432 is more important for mannitol production in G. oxydans than Gox0849 as the transcript abundance of gene gox1432 was 30-fold higher than of gox0849. In accordance, the activity of the NADH-dependent enzyme Gox0849 in the cell cytoplasm was 10-fold lower in comparison to the NADPH-dependent mannitol dehydrogenase Gox1432. Overexpression of gox1432 in the corresponding deletion mutant restored growth of the cells under osmotic stress, further strengthening the importance of the NADP + -dependent mannitol dehydrogenase for osmotolerance in G. oxydans. These findings provide detailed insights into the molecular mechanism of mannitol-mediated osmoprotection in G. oxydans and are helpful engineering strains with improved osmotolerance for biotechnological applications.
Cole, C N; Tornow, J; Clark, R; Tjian, R
1986-01-01
The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional domains. Images PMID:3003386
Tiner, Bethany L.; Kirtley, Michelle L.; Erova, Tatiana E.; Popov, Vsevolod L.; Baze, Wallace B.; van Lier, Christina J.; Ponnusamy, Duraisamy; Andersson, Jourdan A.; Motin, Vladimir L.; Chauhan, Sadhana
2015-01-01
Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. PMID:25605764
Tiner, Bethany L; Sha, Jian; Kirtley, Michelle L; Erova, Tatiana E; Popov, Vsevolod L; Baze, Wallace B; van Lier, Christina J; Ponnusamy, Duraisamy; Andersson, Jourdan A; Motin, Vladimir L; Chauhan, Sadhana; Chopra, Ashok K
2015-04-01
Previously, we showed that deletion of genes encoding Braun lipoprotein (Lpp) and MsbB attenuated Yersinia pestis CO92 in mouse and rat models of bubonic and pneumonic plague. While Lpp activates Toll-like receptor 2, the MsbB acyltransferase modifies lipopolysaccharide. Here, we deleted the ail gene (encoding the attachment-invasion locus) from wild-type (WT) strain CO92 or its lpp single and Δlpp ΔmsbB double mutants. While the Δail single mutant was minimally attenuated compared to the WT bacterium in a mouse model of pneumonic plague, the Δlpp Δail double mutant and the Δlpp ΔmsbB Δail triple mutant were increasingly attenuated, with the latter being unable to kill mice at a 50% lethal dose (LD50) equivalent to 6,800 LD50s of WT CO92. The mutant-infected animals developed balanced TH1- and TH2-based immune responses based on antibody isotyping. The triple mutant was cleared from mouse organs rapidly, with concurrent decreases in the production of various cytokines and histopathological lesions. When surviving animals infected with increasing doses of the triple mutant were subsequently challenged on day 24 with the bioluminescent WT CO92 strain (20 to 28 LD50s), 40 to 70% of the mice survived, with efficient clearing of the invading pathogen, as visualized in real time by in vivo imaging. The rapid clearance of the triple mutant, compared to that of WT CO92, from animals was related to the decreased adherence and invasion of human-derived HeLa and A549 alveolar epithelial cells and to its inability to survive intracellularly in these cells as well as in MH-S murine alveolar and primary human macrophages. An early burst of cytokine production in macrophages elicited by the triple mutant compared to WT CO92 and the mutant's sensitivity to the bactericidal effect of human serum would further augment bacterial clearance. Together, deletion of the ail gene from the Δlpp ΔmsbB double mutant severely attenuated Y. pestis CO92 to evoke pneumonic plague in a mouse model while retaining the required immunogenicity needed for subsequent protection against infection. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Genomic anatomy of the Tyrp1 (brown) deletion complex
Smyth, Ian M.; Wilming, Laurens; Lee, Angela W.; Taylor, Martin S.; Gautier, Phillipe; Barlow, Karen; Wallis, Justine; Martin, Sancha; Glithero, Rebecca; Phillimore, Ben; Pelan, Sarah; Andrew, Rob; Holt, Karen; Taylor, Ruth; McLaren, Stuart; Burton, John; Bailey, Jonathon; Sims, Sarah; Squares, Jan; Plumb, Bob; Joy, Ann; Gibson, Richard; Gilbert, James; Hart, Elizabeth; Laird, Gavin; Loveland, Jane; Mudge, Jonathan; Steward, Charlie; Swarbreck, David; Harrow, Jennifer; North, Philip; Leaves, Nicholas; Greystrong, John; Coppola, Maria; Manjunath, Shilpa; Campbell, Mark; Smith, Mark; Strachan, Gregory; Tofts, Calli; Boal, Esther; Cobley, Victoria; Hunter, Giselle; Kimberley, Christopher; Thomas, Daniel; Cave-Berry, Lee; Weston, Paul; Botcherby, Marc R. M.; White, Sharon; Edgar, Ruth; Cross, Sally H.; Irvani, Marjan; Hummerich, Holger; Simpson, Eleanor H.; Johnson, Dabney; Hunsicker, Patricia R.; Little, Peter F. R.; Hubbard, Tim; Campbell, R. Duncan; Rogers, Jane; Jackson, Ian J.
2006-01-01
Chromosome deletions in the mouse have proven invaluable in the dissection of gene function. The brown deletion complex comprises >28 independent genome rearrangements, which have been used to identify several functional loci on chromosome 4 required for normal embryonic and postnatal development. We have constructed a 172-bacterial artificial chromosome contig that spans this 22-megabase (Mb) interval and have produced a contiguous, finished, and manually annotated sequence from these clones. The deletion complex is strikingly gene-poor, containing only 52 protein-coding genes (of which only 39 are supported by human homologues) and has several further notable genomic features, including several segments of >1 Mb, apparently devoid of a coding sequence. We have used sequence polymorphisms to finely map the deletion breakpoints and identify strong candidate genes for the known phenotypes that map to this region, including three lethal loci (l4Rn1, l4Rn2, and l4Rn3) and the fitness mutant brown-associated fitness (baf). We have also characterized misexpression of the basonuclin homologue, Bnc2, associated with the inversion-mediated coat color mutant white-based brown (Bw). This study provides a molecular insight into the basis of several characterized mouse mutants, which will allow further dissection of this region by targeted or chemical mutagenesis. PMID:16505357
Burall, Laurel S; Laksanalamai, Pongpan; Datta, Atin R
2012-02-01
Listeria monocytogenes can survive and grow in refrigerated temperatures and high-salt environments. In an effort to better understand the associated mechanisms, a library of ∼ 5,200 transposon mutants of LS411, a food isolate from the Jalisco cheese outbreak, were screened for their ability to grow in brain heart infusion (BHI) broth at 5°C or in the presence of 7% NaCl and two mutants with altered growth profiles were identified. The LS522 mutant has a transposon insertion between secA2 and iap and showed a significant reduction in growth in BHI broth at 5°C and in the presence of 7% NaCl. Reverse transcriptase quantitative PCR (RT-qPCR) revealed a substantial reduction in the expression of iap. Additionally, a hypothetical gene (met), containing a putative S-adenosylmethionine-dependent methyltransferase domain, downstream of iap had downregulated expression. In-frame deletion mutants of iap and met were created in LS411. The LS560 (LS411 Δiap) mutant showed reduced growth at 5°C and in the presence of 7% salt, confirming its role in cold and salt growth attenuation. Surprisingly, the LS655 (LS411 Δmet) mutant showed slightly increased growth during refrigeration, though no alteration was seen in salt growth relative to the wild-type strain. The LS527 mutant, containing an insertion 36 bp upstream of the gbu operon, showed reduced expression of the gbu transcript by RT-qPCR and also showed growth reduction at 5°C and in the presence of 7% salt. This attenuation was severely exacerbated when the mutant was grown under the combined stresses. Analysis of the gbu operon deletion mutant showed decreased growth in 7% salt and refrigeration, supporting the previously characterized role for this gene in cold and salt adaptation. These studies indicate the potential for an intricate relationship between environmental stress regulation and virulence in L. monocytogenes.
Burall, Laurel S.; Laksanalamai, Pongpan
2012-01-01
Listeria monocytogenes can survive and grow in refrigerated temperatures and high-salt environments. In an effort to better understand the associated mechanisms, a library of ∼ 5,200 transposon mutants of LS411, a food isolate from the Jalisco cheese outbreak, were screened for their ability to grow in brain heart infusion (BHI) broth at 5°C or in the presence of 7% NaCl and two mutants with altered growth profiles were identified. The LS522 mutant has a transposon insertion between secA2 and iap and showed a significant reduction in growth in BHI broth at 5°C and in the presence of 7% NaCl. Reverse transcriptase quantitative PCR (RT-qPCR) revealed a substantial reduction in the expression of iap. Additionally, a hypothetical gene (met), containing a putative S-adenosylmethionine-dependent methyltransferase domain, downstream of iap had downregulated expression. In-frame deletion mutants of iap and met were created in LS411. The LS560 (LS411 Δiap) mutant showed reduced growth at 5°C and in the presence of 7% salt, confirming its role in cold and salt growth attenuation. Surprisingly, the LS655 (LS411 Δmet) mutant showed slightly increased growth during refrigeration, though no alteration was seen in salt growth relative to the wild-type strain. The LS527 mutant, containing an insertion 36 bp upstream of the gbu operon, showed reduced expression of the gbu transcript by RT-qPCR and also showed growth reduction at 5°C and in the presence of 7% salt. This attenuation was severely exacerbated when the mutant was grown under the combined stresses. Analysis of the gbu operon deletion mutant showed decreased growth in 7% salt and refrigeration, supporting the previously characterized role for this gene in cold and salt adaptation. These studies indicate the potential for an intricate relationship between environmental stress regulation and virulence in L. monocytogenes. PMID:22179239
Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L
2010-05-01
Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.
Schmale, H; Ivell, R; Breindl, M; Darmer, D; Richter, D
1984-01-01
The vasopressin gene from normal and diabetes insipidus (Brattleboro) rats has been isolated and sequenced. Except for a single deletion of a G residue in region coding for the neurophysin carrier protein the approximately 2300 nucleotides of both genes are identical. Blot analysis of hypothalamic RNA as well as transfection and microinjection experiments indicate that the mutant gene is correctly transcribed and spliced, however the resulting mRNA is not efficiently translated. Images Fig. 2. Fig. 3. PMID:6526016
Tiozzo, Caterina; Danopoulos, Soula; Lavarreda-Pearce, Maria; Baptista, Sheryl; Varimezova, Radka; Al Alam, Denise; Warburton, David; Virender, Rehan; De Langhe, Stijn; Di Cristofano, Antonio
2014-01-01
Even though the role of the tyrosine phosphatase Pten as a tumor suppressor gene has been well established in thyroid cancer, its role during thyroid development is still elusive. We therefore targeted Pten deletion in the thyroid epithelium by crossing Ptenflox/flox with a newly developed Nkx2.1-cre driver line in the BALB/c and C57BL/6 genetic backgrounds. C57BL/6 homozygous Pten mutant mice died around 2 weeks of age due to tracheal and esophageal compression by a hyperplasic thyroid. By contrast, BALB/c homozygous Pten mutant mice survived up to 2 years, but with a slightly increased thyroid volume. Characterization of the thyroid glands from C57BL/6 homozygous Pten mutant mice at postnatal day 14 (PN14) showed abnormally enlarged tissue with areas of cellular hyperplasia, disruption of the normal architecture, and follicular degeneration. In addition, differing degrees of hypothyroidism, thyroxine (T4) decrease, and thyroid-stimulating hormone elevation between the strains in the mutants and the heterozygous mutant were detected at PN14. Finally, C57BL/6 heterozygous Pten mutant mice developed thyroid tumors after 2 years of age. Our results indicate that Pten has a pivotal role in thyroid development and its deletion results in thyroid tumor formation, with the timing and severity of the tumor depending on the particular genetic background. PMID:22167068
Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi
2016-05-24
Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.
Potential complications when developing gene deletion clones in Xylella fastidiosa.
Johnson, Kameka L; Cursino, Luciana; Athinuwat, Dusit; Burr, Thomas J; Mowery, Patricia
2015-04-16
The Gram-negative xylem-limited bacterium, Xylella fastidiosa, is an important plant pathogen that infects a number of high value crops. The Temecula 1 strain infects grapevines and induces Pierce's disease, which causes symptoms such as scorching on leaves, cluster collapse, and eventual plant death. In order to understand the pathogenesis of X. fastidiosa, researchers routinely perform gene deletion studies and select mutants via antibiotic markers. Site-directed pilJ mutant of X. fastidiosa were generated and selected on antibiotic media. Mutant cultures were assessed by PCR to determine if they were composed of purely transformant cells or included mixtures of non-transformants cells. Then pure pilJ mutant and wildtype cells were mixed in PD2 medium and following incubation and exposure to kanamycin were assessed by PCR for presence of mutant and wildtype populations. We have discovered that when creating clones of targeted mutants of X. fastidiosa Temecula 1 with selection on antibiotic plates, X. fastidiosa lacking the gene deletion often persist in association with targeted mutant cells. We believe this phenomenon is due to spontaneous antibiotic resistance and/or X. fastidiosa characteristically forming aggregates that can be comprised of transformed and non-transformed cells. A combined population was confirmed by PCR, which showed that targeted mutant clones were mixed with non-transformed cells. After repeated transfer and storage the non-transformed cells became the dominant clone present. We have discovered that special precautions are warranted when developing a targeted gene mutation in X. fastidiosa because colonies that arise following transformation and selection are often comprised of transformed and non-transformed cells. Following transfer and storage the cells can consist primarily of the non-transformed strain. As a result, careful monitoring of targeted mutant strains must be performed to avoid mixed populations and confounding results.
Wargo, Matthew J
2013-01-01
Pseudomonas aeruginosa can acquire and metabolize a variety of molecules including choline, an abundant host-derived molecule. In P. aeruginosa, choline is oxidized to glycine betaine which can be used as an osmoprotectant, a sole source of carbon and nitrogen, and as an inducer of the virulence factor, hemolytic phospholipase C (PlcH) via the transcriptional regulator GbdR. The primary objective was to determine the contribution of choline conversion to glycine betaine to P. aeruginosa survival during mouse lung infection. A secondary objective was to gain insight into the relative contributions of the different roles of glycine betaine to P. aeruginosa survival during infection. Using a model of acute murine pneumonia, we determined that deletion of the choline oxidase system (encoded by betBA) decreased P. aeruginosa survival in the mouse lung. Deletion of the glycine betaine demethylase genes (gbcA-B), required for glycine betaine catabolism, did not impact P. aeruginosa survival in the lung. Thus, the defect of the betBA mutant was not due to a requirement for glycine betaine catabolism or dependence on a downstream metabolite. Deletion of betBA decreased the abundance of plcH transcript during infection, which suggested a role for PlcH in the betBA survival defect. To test the contribution of plcH to the betBA mutant phenotype a betBAplcHR double deletion mutant was generated. The betBA and betBAplcHR double mutant had a small but significant survival defect compared to the plcHR single mutant, suggesting that regulation of plcH expression is not the only role for glycine betaine during infection. The conclusion was that choline acquisition and its oxidation to glycine betaine contribute to P. aeruginosa survival in the mouse lung. While defective plcH induction can explain a portion of the betBA mutant phenotype, the exact mechanisms driving the betBA mutant survival defect remain unknown.
Wargo, Matthew J.
2013-01-01
Pseudomonas aeruginosa can acquire and metabolize a variety of molecules including choline, an abundant host-derived molecule. In P. aeruginosa, choline is oxidized to glycine betaine which can be used as an osmoprotectant, a sole source of carbon and nitrogen, and as an inducer of the virulence factor, hemolytic phospholipase C (PlcH) via the transcriptional regulator GbdR. The primary objective was to determine the contribution of choline conversion to glycine betaine to P. aeruginosa survival during mouse lung infection. A secondary objective was to gain insight into the relative contributions of the different roles of glycine betaine to P. aeruginosa survival during infection. Using a model of acute murine pneumonia, we determined that deletion of the choline oxidase system (encoded by betBA) decreased P. aeruginosa survival in the mouse lung. Deletion of the glycine betaine demethylase genes (gbcA-B), required for glycine betaine catabolism, did not impact P. aeruginosa survival in the lung. Thus, the defect of the betBA mutant was not due to a requirement for glycine betaine catabolism or dependence on a downstream metabolite. Deletion of betBA decreased the abundance of plcH transcript during infection, which suggested a role for PlcH in the betBA survival defect. To test the contribution of plcH to the betBA mutant phenotype a betBAplcHR double deletion mutant was generated. The betBA and betBAplcHR double mutant had a small but significant survival defect compared to the plcHR single mutant, suggesting that regulation of plcH expression is not the only role for glycine betaine during infection. The conclusion was that choline acquisition and its oxidation to glycine betaine contribute to P. aeruginosa survival in the mouse lung. While defective plcH induction can explain a portion of the betBA mutant phenotype, the exact mechanisms driving the betBA mutant survival defect remain unknown. PMID:23457628
Mbikay, Majambu; Croissandeau, Gilles; Sirois, Francine; Anini, Younes; Mayne, Janice; Seidah, Nabil G; Chrétien, Michel
2007-06-15
Proprotein convertase 1 (PC1) is a neuroendocrine proteinase involved in the proteolytic activation of precursors to hormones and neuropeptides. To determine the physiological importance of PC1, we produced a mutant mouse from embryonic stem cells in which its locus (Pcsk1) had been inactivated by homologous recombination. The inactivating mutation consisted of a 32.7-kb internal deletion and a 1.8 kb insertion of the bacterial neomycin resistance gene (neo) under the mouse phosphoglycerate kinase 1 protein (PGKneo). Intercross of Pcsk1(+/-) mice produced no Pcsk1(-/-) offspring or blastocysts; in addition, more than 80% of the offspring were Pcsk1(+/-). These observations suggested that the mutation caused preimplantation lethality of homozygous embryos and preferential transmission of the mutant allele. Interestingly, RT-PCR analysis on RNA from endocrine tissues from Pcsk1(+/-) mice revealed the presence of aberrant transcripts specifying the N-terminal half of the PC1 propeptide fused to neo gene product. Mass spectrometric profiles of proopiomelanocortin-derived peptides in the anterior pituitary were similar between Pcsk1(+/-) and Pcsk1(+/+) mice, but significantly different between male and female mice of the same genotype. Relative to their wild-type counterparts, female mutant mice exhibited stunted growth under a low fat diet, and catch-up growth under a high-fat diet. The complex phenotype exhibited by this Pcsk1 mutant mouse model may be due to PC1 deficiency aggravated by expression of aberrant gene products from the mutant allele.
diCenzo, George C; Finan, Turlough M
2018-01-01
The rate at which all genes within a bacterial genome can be identified far exceeds the ability to characterize these genes. To assist in associating genes with cellular functions, a large-scale bacterial genome deletion approach can be employed to rapidly screen tens to thousands of genes for desired phenotypes. Here, we provide a detailed protocol for the generation of deletions of large segments of bacterial genomes that relies on the activity of a site-specific recombinase. In this procedure, two recombinase recognition target sequences are introduced into known positions of a bacterial genome through single cross-over plasmid integration. Subsequent expression of the site-specific recombinase mediates recombination between the two target sequences, resulting in the excision of the intervening region and its loss from the genome. We further illustrate how this deletion system can be readily adapted to function as a large-scale in vivo cloning procedure, in which the region excised from the genome is captured as a replicative plasmid. We next provide a procedure for the metabolic analysis of bacterial large-scale genome deletion mutants using the Biolog Phenotype MicroArray™ system. Finally, a pipeline is described, and a sample Matlab script is provided, for the integration of the obtained data with a draft metabolic reconstruction for the refinement of the reactions and gene-protein-reaction relationships in a metabolic reconstruction.
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
The histidine permease gene (HIP1) of Saccharomyces cerevisiae.
Tanaka, J; Fink, G R
1985-01-01
The histidine-specific permease gene (HIP1) of Saccharomyces cerevisiae has been mapped, cloned, and sequenced. The HIP1 gene maps to the right arm of chromosome VII, approx. 11 cM distal to the ADE3 gene. The gene was isolated as an 8.6-kb BamHI-Sau3A fragment by complementation of the histidine-specific permease deficiency in recipient yeast cells. We sequenced a 2.4-kb subfragment of this BamHI-Sau3A fragment containing the HIP1 gene and identified a 1596-bp open reading frame (ORF). We confirmed the assignment of the 1596-bp ORF as the HIP1 coding sequence by sequencing a hip1 nonsense mutation. Analysis of the amino acid (aa) sequence of the HIP1 gene reveals several hydrophobic stretches, but shows no obvious N-terminal signal peptide. We have constructed a deletion of the HIP1 gene in vitro and replaced the wild-type copy of the gene with this deletion. The hip1 deletion mutant can grow when it is supplemented with 30 mM histidine, 50 times the amount required for the growth of HIP1 cells. Revertants of this deletion mutant able to grow on a normal level of histidine arise by mutation in unlinked genes. Both these observations suggest that there are additional, low-affinity pathways for histidine uptake.
Kwon, Seomun; Lee, Jaejoon; Jeon, Jongbum; Kim, Seongbeom; Park, Sook-Young; Jeon, Junhyun; Lee, Yong-Hwan
2018-06-01
Acetylation of histone H3 lysine 56 (H3K56) by the fungal-specific histone acetyltransferase Rtt109 plays important roles in maintaining genome integrity and surviving DNA damage. Here we investigated the implications of Rtt109-mediated response to DNA damage on development and pathogenesis of the rice blast fungus, Magnaporthe oryzae (anamorph: Pyricularia oryzae). The ortholog of Rtt109 in M. oryzae (MoRtt109) was found via sequence homology and its functionality confirmed by phenotypic complementation of the Saccharomyces cerevisiae Rtt109 deletion strain. Targeted deletion of MoRtt109 resulted in a significant reduction in acetylation of H3K56 and rendered the fungus defective in hyphal growth and asexual reproduction. Furthermore, the deletion mutant displayed hypersensitivity to genotoxic agents, confirming the conserved importance of Rtt109 in genome integrity maintenance and genotoxic stress tolerance. Elevated expression of DNA repair genes and the results of the comet assay were consistent with constitutive endogenous DNA damage. Although the conidia produced from the mutant were not impaired in germination and appressorium morphogenesis, the mutant was significantly less pathogenic on rice leaves. Transcriptomic analysis provided insight into the factors underlying phenotypic defects that are associated with deficiency of H3K56 acetylation. Overall, our results indicate that MoRtt109 is a conserved histone acetyltransferase that affects proliferation and asexual fecundity of M. oryzae through maintenance of genome integrity and response to DNA damage.
Hiller, Ekkehard; Istel, Fabian; Tscherner, Michael; Brunke, Sascha; Ames, Lauren; Firon, Arnaud; Green, Brian; Cabral, Vitor; Marcet-Houben, Marina; Jacobsen, Ilse D.; Quintin, Jessica; Seider, Katja; Frohner, Ingrid; Glaser, Walter; Jungwirth, Helmut; Bachellier-Bassi, Sophie; Chauvel, Murielle; Zeidler, Ute; Ferrandon, Dominique; Gabaldón, Toni; Hube, Bernhard; d'Enfert, Christophe; Rupp, Steffen; Cormack, Brendan; Haynes, Ken; Kuchler, Karl
2014-01-01
The opportunistic fungal pathogen Candida glabrata is a frequent cause of candidiasis, causing infections ranging from superficial to life-threatening disseminated disease. The inherent tolerance of C. glabrata to azole drugs makes this pathogen a serious clinical threat. To identify novel genes implicated in antifungal drug tolerance, we have constructed a large-scale C. glabrata deletion library consisting of 619 unique, individually bar-coded mutant strains, each lacking one specific gene, all together representing almost 12% of the genome. Functional analysis of this library in a series of phenotypic and fitness assays identified numerous genes required for growth of C. glabrata under normal or specific stress conditions, as well as a number of novel genes involved in tolerance to clinically important antifungal drugs such as azoles and echinocandins. We identified 38 deletion strains displaying strongly increased susceptibility to caspofungin, 28 of which encoding proteins that have not previously been linked to echinocandin tolerance. Our results demonstrate the potential of the C. glabrata mutant collection as a valuable resource in functional genomics studies of this important fungal pathogen of humans, and to facilitate the identification of putative novel antifungal drug target and virulence genes. PMID:24945925
Zou, Yanming; He, Lina; Chi, Feng; Jong, Ambrose; Huang, Sheng-He
2008-12-01
IbeT is a downstream gene of the invasion determinant ibeA in the chromosome of a clinical isolate of Escherichia coli K1 strain RS218 (serotype 018:K1:H7). Both ibeT and ibeA are in the same operon. Our previous mutagenesis and complementation studies suggested that ibeT may coordinately contribute to E. coli K1 invasion with ibeA. An isogenic in-frame deletion mutant of ibeT has been made by chromosomal gene replacement with a recombinant suicide vector carrying a fragment with an ibeT internal deletion. The characteristics of the mutant in meningitic E. coli infection were examined in vitro [cell culture of human brain microvascular endothelial cells (HBMEC)] and in vivo (infant rat model of E. coli meningitis) in comparison with the parent strain. The ibeT deletion mutant was significantly less adhesive and invasive than its parent strain E. coli E44 in vitro, and the adhesion- and invasion-deficient phenotypes of the mutant can be complemented by the ibeT gene. Recombinant IbeT protein is able to block E. coli E44 invasion of HBMEC. Furthermore, the ibeT deletion mutant is less capable of colonizing intestine and less virulent in bacterial translocation across the blood-brain barrier (BBB) than its parent E. coli E44 in vivo. These data suggest that ibeT-mediated E. coli K1 adhesion is associated with the bacterial invasion process.
Involvement of NADH Oxidase in Biofilm Formation in Streptococcus sanguinis
Ge, Xiuchun; Shi, Xiaoli; Shi, Limei; Liu, Jinlin; Stone, Victoria; Kong, Fanxiang; Kitten, Todd; Xu, Ping
2016-01-01
Biofilms play important roles in microbial communities and are related to infectious diseases. Here, we report direct evidence that a bacterial nox gene encoding NADH oxidase is involved in biofilm formation. A dramatic reduction in biofilm formation was observed in a Streptococcus sanguinis nox mutant under anaerobic conditions without any decrease in growth. The membrane fluidity of the mutant bacterial cells was found to be decreased and the fatty acid composition altered, with increased palmitic acid and decreased stearic acid and vaccenic acid. Extracellular DNA of the mutant was reduced in abundance and bacterial competence was suppressed. Gene expression analysis in the mutant identified two genes with altered expression, gtfP and Idh, which were found to be related to biofilm formation through examination of their deletion mutants. NADH oxidase-related metabolic pathways were analyzed, further clarifying the function of this enzyme in biofilm formation. PMID:26950587
Zhang, Le; Willemse, Joost; Hoskisson, Paul A; van Wezel, Gilles P
2018-05-09
Cell division during the reproductive phase of the Streptomyces life-cycle requires tight coordination between synchronous formation of multiple septa and DNA segregation. One remarkable difference with most other bacterial systems is that cell division in Streptomyces is positively controlled by the recruitment of FtsZ by SsgB. Here we show that deletion of ylmD (SCO2081) or ylmE (SCO2080), which lie in operon with ftsZ in the dcw cluster of actinomycetes, has major consequences for sporulation-specific cell division in Streptomyces coelicolor. Electron and fluorescence microscopy demonstrated that ylmE mutants have a highly aberrant phenotype with defective septum synthesis, and produce very few spores with low viability and high heat sensitivity. FtsZ-ring formation was also highly disturbed in ylmE mutants. Deletion of ylmD had a far less severe effect on sporulation. Interestingly, the additional deletion of ylmD restored sporulation to the ylmE null mutant. YlmD and YlmE are not part of the divisome, but instead localize diffusely in aerial hyphae, with differential intensity throughout the sporogenic part of the hyphae. Taken together, our work reveals a function for YlmD and YlmE in the control of sporulation-specific cell division in S. coelicolor, whereby the presence of YlmD alone results in major developmental defects.
Jarnuczak, Andrew F.; Eyers, Claire E.; Schwartz, Jean‐Marc; Grant, Christopher M.
2015-01-01
Molecular chaperones play an important role in protein homeostasis and the cellular response to stress. In particular, the HSP70 chaperones in yeast mediate a large volume of protein folding through transient associations with their substrates. This chaperone interaction network can be disturbed by various perturbations, such as environmental stress or a gene deletion. Here, we consider deletions of two major chaperone proteins, SSA1 and SSB1, from the chaperone network in Sacchromyces cerevisiae. We employ a SILAC‐based approach to examine changes in global and local protein abundance and rationalise our results via network analysis and graph theoretical approaches. Although the deletions result in an overall increase in intracellular protein content, correlated with an increase in cell size, this is not matched by substantial changes in individual protein concentrations. Despite the phenotypic robustness to deletion of these major hub proteins, it cannot be simply explained by the presence of paralogues. Instead, network analysis and a theoretical consideration of folding workload suggest that the robustness to perturbation is a product of the overall network structure. This highlights how quantitative proteomics and systems modelling can be used to rationalise emergent network properties, and how the HSP70 system can accommodate the loss of major hubs. PMID:25689132
Vijayan, Saptha; Mallick, Sathi; Dutta, Mouparna; Narayani, M; Ghosh, Anindya S
2014-02-01
MreB is a cytoskeletal protein, which is responsible for maintaining proper cellular morphology and is essential for cell survival. Likewise, penicillin-binding protein 5 (PBP5) helps in maintaining cell shape, though non-essential for survival. The contradicting feature of these two proteins paves the way for this study, wherein we attempt to draw a relation on the nature of distribution of MreB in PBP deletion mutants. The study revealed that the uniform MreB helices/patches were destabilized/disturbed at the zone of deformities of the PBP mutants, whereas the helical patterns were retained at the regions maintaining a rod shape. We interpret that MreB remains functional irrespective of its distribution being misguided by the aberrant shapes of PBP mutants.
Somatic mitochondrial mutation in gastric cancer.
Burgart, L. J.; Zheng, J.; Shu, Q.; Strickler, J. G.; Shibata, D.
1995-01-01
Likely hot spots for mutations are mitochondrial sequences as there is less repair and more damage by carcinogens compared with nuclear sequences. A somatic 50-bp mitochondrial D-loop deletion was detected in four gastric adenocarcinomas. The deletion included the CSB2 region and was flanked by 9-bp direct repeats. The deletion was more frequent in adenocarcinomas arising from the gastroesophageal junction (4/32, 12.5%) compared with more distal tumors (0/45). Topographical analysis revealed the absence of the deletion from normal tissues except in focal portions of smooth muscle in one case. In two cases, apparent mutant homoplasmy was present throughout two tumors, including their metastases. In the two other cases, the mutation was present in only minor focal portions ( < 5%) of their primary tumors. These findings document the presence of somatic mitochondrial alterations in gastric cancer, which may reflect the environmental and genetic influences operative during tumor progression. Images Figure 3 Figure 4 Figure 5 PMID:7573355
CcpN Controls Central Carbon Fluxes in Bacillus subtilis▿ ‡
Tännler, Simon; Fischer, Eliane; Le Coq, Dominique; Doan, Thierry; Jamet, Emmanuel; Sauer, Uwe; Aymerich, Stéphane
2008-01-01
The transcriptional regulator CcpN of Bacillus subtilis has been recently characterized as a repressor of two gluconeogenic genes, gapB and pckA, and of a small noncoding regulatory RNA, sr1, involved in arginine catabolism. Deletion of ccpN impairs growth on glucose and strongly alters the distribution of intracellular fluxes, rerouting the main glucose catabolism from glycolysis to the pentose phosphate (PP) pathway. Using transcriptome analysis, we show that during growth on glucose, gapB and pckA are the only protein-coding genes directly repressed by CcpN. By quantifying intracellular fluxes in deletion mutants, we demonstrate that derepression of pckA under glycolytic condition causes the growth defect observed in the ccpN mutant due to extensive futile cycling through the pyruvate carboxylase, phosphoenolpyruvate carboxykinase, and pyruvate kinase. Beyond ATP dissipation via this cycle, PckA activity causes a drain on tricarboxylic acid cycle intermediates, which we show to be the main reason for the reduced growth of a ccpN mutant. The high flux through the PP pathway in the ccpN mutant is modulated by the flux through the alternative glyceraldehyde-3-phosphate dehydrogenases, GapA and GapB. Strongly increased concentrations of intermediates in upper glycolysis indicate that GapB overexpression causes a metabolic jamming of this pathway and, consequently, increases the relative flux through the PP pathway. In contrast, derepression of sr1, the third known target of CcpN, plays only a marginal role in ccpN mutant phenotypes. PMID:18586936
Olson, Daniel G.; Giannone, Richard J.; Hettich, Robert L.
2013-01-01
The CipA scaffoldin protein plays a key role in the Clostridium thermocellum cellulosome. Previous studies have revealed that mutants deficient in binding or solubilizing cellulose also exhibit reduced expression of CipA. To confirm that CipA is, in fact, necessary for rapid solubilization of crystalline cellulose, the gene was deleted from the chromosome using targeted gene deletion technologies. The CipA deletion mutant exhibited a 100-fold reduction in cellulose solubilization rate, although it was eventually able to solubilize 80% of the 5 g/liter cellulose initially present. The deletion mutant was complemented by a copy of cipA expressed from a replicating plasmid. In this strain, Avicelase activity was restored, although the rate was 2-fold lower than that in the wild type and the duration of the lag phase was increased. The cipA coding sequence is located at the beginning of a gene cluster containing several other genes thought to be responsible for the structural organization of the cellulosome, including olpB, orf2p, and olpA. Tandem mass spectrometry revealed a 10-fold reduction in the expression of olpB, which may explain the lower growth rate. This deletion experiment adds further evidence that CipA plays a key role in cellulose solubilization by C. thermocellum, and it raises interesting questions about the differential roles of the anchor scaffoldin proteins OlpB, Orf2p, and SdbA. PMID:23204466
Functional Profiling Using the Saccharomyces Genome Deletion Project Collections.
Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri
2016-09-01
The ability to measure and quantify the fitness of an entire organism requires considerably more complex approaches than simply using traditional "omic" methods that examine, for example, the abundance of RNA transcripts, proteins, or metabolites. The yeast deletion collections represent the only systematic, comprehensive set of null alleles for any organism in which such fitness measurements can be assayed. Generated by the Saccharomyces Genome Deletion Project, these collections allow the systematic and parallel analysis of gene functions using any measurable phenotype. The unique 20-bp molecular barcodes engineered into the genome of each deletion strain facilitate the massively parallel analysis of individual fitness. Here, we present functional genomic protocols for use with the yeast deletion collections. We describe how to maintain, propagate, and store the deletion collections and how to perform growth fitness assays on single and parallel screening platforms. Phenotypic fitness analyses of the yeast mutants, described in brief here, provide important insights into biological functions, mechanisms of drug action, and response to environmental stresses. It is important to bear in mind that the specific assays described in this protocol represent some of the many ways in which these collections can be assayed, and in this description particular attention is paid to maximizing throughput using growth as the phenotypic measure. © 2016 Cold Spring Harbor Laboratory Press.
Basak, Papri; Maitra-Majee, Susmita; Das, Jayanta Kumar; Mukherjee, Abhishek; Ghosh Dastidar, Shubhra; Pal Choudhury, Pabitra
2017-01-01
A molecular evolutionary analysis of a well conserved protein helps to determine the essential amino acids in the core catalytic region. Based on the chemical properties of amino acid residues, phylogenetic analysis of a total of 172 homologous sequences of a highly conserved enzyme, L-myo-inositol 1-phosphate synthase or MIPS from evolutionarily diverse organisms was performed. This study revealed the presence of six phylogenetically conserved blocks, out of which four embrace the catalytic core of the functional protein. Further, specific amino acid modifications targeting the lysine residues, known to be important for MIPS catalysis, were performed at the catalytic site of a MIPS from monocotyledonous model plant, Oryza sativa (OsMIPS1). Following this study, OsMIPS mutants with deletion or replacement of lysine residues in the conserved blocks were made. Based on the enzyme kinetics performed on the deletion/replacement mutants, phylogenetic and structural comparison with the already established crystal structures from non-plant sources, an evolutionarily conserved peptide stretch was identified at the active pocket which contains the two most important lysine residues essential for catalytic activity. PMID:28950028
Kristensen, Tatjana P; Maria Cherian, Reeja; Gray, Fiona C; MacNeill, Stuart A
2014-01-01
The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies.
Secretome analysis of Aspergillus fumigatus reveals Asp-hemolysin as a major secreted protein.
Wartenberg, Dirk; Lapp, Katrin; Jacobsen, Ilse D; Dahse, Hans-Martin; Kniemeyer, Olaf; Heinekamp, Thorsten; Brakhage, Axel A
2011-11-01
Surface-associated and secreted proteins represent primarily exposed components of Aspergillus fumigatus during host infection. Several secreted proteins are known to be involved in defense mechanisms or immune evasion, thus, probably contributing to pathogenicity. Furthermore, several secreted antigens were identified as possible biomarkers for the verification of diseases caused by Aspergillus species. Nevertheless, there is only limited knowledge about the composition of the secretome and about molecular functions of particular proteins. To identify secreted proteins potentially essential for virulence, the core secretome of A. fumigatus grown in minimal medium was determined. Two-dimensional gel electrophoretic separation and subsequent MALDI-TOF-MS/MS analyses resulted in the identification of 64 different proteins. Additionally, secretome analyses of A. fumigatus utilizing elastin, collagen or keratin as main carbon and nitrogen source were performed. Thereby, the alkaline serine protease Alp1 was identified as the most abundant protein and hence presumably represents an important protease during host infection. Interestingly, the Asp-hemolysin (Asp-HS), which belongs to the protein family of aegerolysins and which was often suggested to be involved in fungal virulence, was present in the secretome under all growth conditions tested. In addition, a second, non-secreted protein with an aegerolysin domain annotated as Asp-hemolysin-like (HS-like) protein can be found to be encoded in the genome of A. fumigatus. Generation and analysis of Asp-HS and HS-like deletion strains revealed no differences in phenotype compared to the corresponding wild-type strain. Furthermore, hemolysis and cytotoxicity was not altered in both single-deletion and double-deletion mutants lacking both aegerolysin genes. All mutant strains showed no attenuation in virulence in a mouse infection model for invasive pulmonary aspergillosis. Overall, this study provides a comprehensive analysis of secreted proteins of A. fumigatus and a detailed characterization of hemolysin mutants. Copyright © 2011 Elsevier GmbH. All rights reserved.
Denz, Christopher R; Zhang, Chi; Jia, Pingping; Du, Jianfeng; Huang, Xupei; Dube, Syamalima; Thomas, Anish; Poiesz, Bernard J; Dube, Dipak K
2011-09-01
Tropomyosins are a family of actin-binding proteins that show cell-specific diversity by a combination of multiple genes and alternative RNA splicing. Of the 4 different tropomyosin genes, TPM4 plays a pivotal role in myofibrillogenesis as well as cardiac contractility in amphibians. In this study, we amplified and sequenced the upstream regulatory region of the TPM4 gene from both normal and mutant axolotl hearts. To identify the cis-elements that are essential for the expression of the TPM4, we created various deletion mutants of the TPM4 promoter DNA, inserted the deleted segments into PGL3 vector, and performed promoter-reporter assay using luciferase as the reporter gene. Comparison of sequences of the promoter region of the TPM4 gene from normal and mutant axolotl revealed no mutations in the promoter sequence of the mutant TPM4 gene. CArG box elements that are generally involved in controlling the expression of several other muscle-specific gene promoters were not found in the upstream regulatory region of the TPM4 gene. In deletion experiments, loss of activity of the reporter gene was noted upon deletion which was then restored upon further deletion suggesting the presence of both positive and negative cis-elements in the upstream regulatory region of the TPM4 gene. We believe that this is the first axolotl promoter that has ever been cloned and studied with clear evidence that it functions in mammalian cell lines. Although striated muscle-specific cis-acting elements are absent from the promoter region of TPM4 gene, our results suggest the presence of positive and negative cis-elements in the promoter region, which in conjunction with positive and negative trans-elements may be involved in regulating the expression of TPM4 gene in a tissue-specific manner.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Jing; Arentshorst, Mark; Nair, Deepa
Rapid acidification of the culture medium by the production of organic acids and the production of acid-induced proteases are key characteristics of the filamentous fungus Aspergillus niger. The D15 mutant of A. niger is non-acidifying mutant and used often for the expression of recombinant proteins in A. niger, because of its reduced production of extracellular proteases under non-acidic conditions. In this study, the D15 mutant is characterized in detail. Strongly reduced levels of citric and oxalic acid were observed in the D15 mutant both in shake flask cultures and in controlled batch cultivations. To identify the mutation in the D15more » mutant, we successfully combined high-throughput sequencing (Illumina) with bulk segregant analysis. Because of the lack of a sexual cycle for A. niger, the parasexual cycle was used to generate a pool of segregants. From the 52 single nucleotide polymorphisms (SNPs) between the parental strains, three SNPs were homozygous in the genomic DNA of pool of segregants. These three SNPs mapped to all the right arm of chromosome II, indicating that this region contains the genetic locus affecting the phenotype related to acid production. Of the three SNPs, one mutation resulted in a missense mutation in the gene encoding the A. niger homologue of the A. nidulans methyltransferase gene laeA. Complementation analysis of the original mutant with the laeA gene and targeted disruption of laeA further confirmed that LaeA is involved in citric acid production in A. niger lab (N402) and citric acid production strains (ATCC 11414). Analysis of the secondary metabolite (SM) profile of the laeA mutants indicate that LaeA is required for the production of several SMs (asperrubrol, atromentin and JBIR86), but deletion of laeA also resulted in the presence of SMs (aspernigrin A/B and BMS-192548) that were not detected in the wild-type strain. The levels of ten other SMs were not strongly affected as a result of laeA deletion indicating that only a limited number of SM gene clusters are controlled by LaeA activity.« less
Construction of a psb C deletion strain in Synechocystis 6803.
Goldfarb, N; Knoepfle, N; Putnam-Evans, C
1997-01-01
Synechocystis 6803 is a cyanobacterium that carries out-oxygenic photosynthesis. We are interested in the introduction of mutations in the large extrinsic loop region of the CP43 protein of Photosystem II (PSII). CP43 appears to be required for the stable assembly of the PSII complex and also appears to play a role in photosynthetic oxygen evolution. Deletion of short segments of the large extrinsic loop results in mutants incapable of evolving oxygen. Alterations in psbC, the gene encoding CP43, are introduced into Synechocystis 6803 by transformation and homologous recombination. Specifically, plasmid constructs bearing the site-directed mutations are introduced into a deletion strain where the portion of the gene encoding the area of mutation has been deleted and replaced by a gene conferring antibiotic resistance. We have constructed a deletion strain of Synechocystis appropriate for the introduction of mutations in the large extrinsic loop of CP43 and have used it successfully to produce site-directed mutants.
Chen, Xuelan; Tang, Li; Jiao, Haitao; Xu, Feng; Xiong, Yonghua
2013-01-04
ArgR, coded by the argR gene from Corynebacterium crenatum AS 1.542, acts as a negative regulator in arginine biosynthetic pathway. However, the effect of argR on transcriptional levels of the related biosynthetic genes has not been reported. Here, we constructed a deletion mutant of argR gene: C. crenatum AS 1.542 Delta argR using marker-less knockout technology, and compared the changes of transcriptional levels of the arginine biosynthetic genes between the mutant strain and the wild-type strain. We used marker-less knockout technology to construct C. crenatum AS 1.542 Delta argR and analyzed the changes of the relate genes at the transcriptional level using real-time fluorescence quantitative PCR. C. crenatum AS 1.542 Delta argR was successfully obtained and the transcriptional level of arginine biosynthetic genes in this mutant increased significantly with an average of about 162.1 folds. The arginine biosynthetic genes in C. crenatum are clearly controlled by the negative regulator ArgR. However, the deletion of this regulator does not result in a clear change in arginine production in the bacteria.
Identification of Yeast V-ATPase Mutants by Western Blots Analysis of Whole Cell Lysates
NASA Astrophysics Data System (ADS)
Parra-Belky, Karlett
2002-11-01
A biochemistry laboratory was designed for an undergraduate course to help students better understand the link between molecular engineering and biochemistry. Students identified unknown yeast strains with high specificity using SDS-PAGE and Western blot analysis of whole cell lysates. This problem-solving exercise is a common application of biochemistry in biotechnology research. Three different strains were used: a wild-type and two mutants for the proton pump vacuolar ATPase (V-ATPase). V-ATPases are multisubunit enzymes and the mutants used were deletion mutants; each lacked one structural gene of the complex. After three, three-hour labs, mutant strains were easily identified by the students and distinguished from wild-type cells analyzing the pattern of SDS-PAGE distribution of proteins. Identifying different subunits of one multimeric protein allowed for discussion of the structure and function of this metabolic enzyme, which captured the interest of the students. The experiment can be adapted to other multimeric protein complexes and shows improvement of the described methodology over previous reports, perhaps because the problem and its solution are representative of the type of techniques currently used in research labs.
Erdemir, Aysegul; Mutlu, Ozal
2017-06-01
Lactate dehydrogenase (LDH) is an important metabolic enzyme in glycolysis and it has been considered as the main energy source in many organisms including apicomplexan parasites. Differences at the active site loop of the host and parasite LDH's makes this enzyme an attractive target for drug inhibitors. In this study, five amino acid insertions in the active site pocket of Theileria annulata LDH (TaLDH) were deleted by PCR-based site-directed mutagenesis, expression and activity analysis of mutant and wild type TaLDH enzymes were performed. Removal of the insertion at the active site loop caused production of an inactive enzyme. Furthermore, structures of wild and mutant enzymes were predicted by comparative modeling and the importance of the insertions at the active site loop were also assigned by molecular docking and dynamics simulations in order to evaluate essential role of this loop for the enzymatic activity. Pentapeptide insertion removal resulted in loss of LDH activity due to deletion of Trp96 and conformational change of Arg98 because of loop instability. Analysis of wild type and mutant enzymes with comparative molecular dynamics simulations showed that the fluctuations of the loop residues increase in mutant enzyme. Together with in silico studies, in vitro results revealed that active site loop has a vital role in the enzyme activity and our findings promise hope for the further drug design studies against theileriosis and other apicomplexan parasite diseases. Copyright © 2017 Elsevier Inc. All rights reserved.
Crabtree, Mary B.; Kent Crockett, Rebekah J.; Bird, Brian H.; Nichol, Stuart T.; Erickson, Bobbie Rae; Biggerstaff, Brad J.; Horiuchi, Kalanthe; Miller, Barry R.
2012-01-01
Background Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Methodology and Principal Findings Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. Conclusions/Significance In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes. PMID:22563517
Crabtree, Mary B; Kent Crockett, Rebekah J; Bird, Brian H; Nichol, Stuart T; Erickson, Bobbie Rae; Biggerstaff, Brad J; Horiuchi, Kalanthe; Miller, Barry R
2012-01-01
Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes.
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Engineering the bacterial shapes for enhanced inclusion bodies accumulation.
Jiang, Xiao-Ran; Wang, Huan; Shen, Rui; Chen, Guo-Qiang
2015-05-01
Many bacteria can accumulate inclusion bodies such as sulfur, polyphosphate, glycogen, proteins or polyhydroxyalkanoates. To exploit bacteria as factories for effective production of inclusion bodies, a larger intracellular space is needed for more inclusion body accumulation. In this study, polyhydroxybutyrate (PHB) was investigated as an inclusion bodies representative to be accumulated by Escherichia coli JM109SG. Various approaches were taken to increase the bacterial cell sizes including deletion on actin-like protein gene mreB, weak expression of mreB in mreB deletion mutant, and weak expression of mreB in mreB deletion mutant under inducible expression of SulA, the inhibitor of division ring protein FtsZ. All of the methods resulted in different levels of increases in bacterial sizes and PHB granules accumulation. Remarkably, an increase of over 100% PHB accumulation was observed in recombinant E. coli overexpressing mreB in an mreB deletion mutant under inducible expression of FtsZ inhibiting protein SulA. The molecular mechanism of enlarged bacterial size was found to be directly relate to weakened cytoskeleton which was the result of broken skeleton helix. Copyright © 2015 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Denef, V. J.; Klappenbach, J. A.; Patrauchan, M. A.; Florizone, C.; Rodrigues, J. L. M.; Tsoi, T. V.; Verstraete, W.; Eltis, L. D.; Tiedje, J. M.
2006-01-01
Transcriptomic and proteomic analyses of Burkholderia xenovorans LB400, a potent polychlorinated biphenyl (PCB) degrader, have implicated growth substrate- and phase-dependent expression of three benzoate-catabolizing pathways: a catechol ortho cleavage (ben-cat) pathway and two benzoyl-coenzyme A pathways, encoded by gene clusters on the large chromosome (boxC) and the megaplasmid (boxM). To elucidate the significance of this apparent redundancy, we constructed mutants with deletions of the ben-cat pathway (the ΔbenABCD::kan mutant), the boxC pathway (the ΔboxABC::kan mutant), and both pathways (the ΔbenABCDΔ boxABC::kan mutant). All three mutants oxidized benzoate in resting-cell assays. However, the ΔbenABCD::kan and ΔbenABCD ΔboxABC::kan mutants grew at reduced rates on benzoate and displayed increased lag phases. By contrast, growth on succinate, on 4-hydroxybenzoate, and on biphenyl was unaffected. Microarray and proteomic analyses revealed that cells of the ΔbenABCD::kan mutant growing on benzoate expressed both box pathways. Overall, these results indicate that all three pathways catabolize benzoate. Deletion of benABCD abolished the ability of LB400 to grow using 3-chlorobenzoate. None of the benzoate pathways could degrade 2- or 4-chlorobenzoate, indicating that the pathway redundancy does not directly contribute to LB400's PCB-degrading capacities. Finally, an extensive sigmaE-regulated oxidative stress response not present in wild-type LB400 grown on benzoate was detected in these deletion mutants, supporting our earlier suggestion that the box pathways are preferentially active under reduced oxygen tension. Our data further substantiate the expansive network of tightly interconnected and complexly regulated aromatic degradation pathways in LB400. PMID:16391095
Nguyen, Huong Minh
2014-01-01
ABSTRACT Bacteriophage T7 terminator Tφ is a class I intrinsic terminator coding for an RNA hairpin structure immediately followed by oligo(U), which has been extensively studied in terms of its transcription termination mechanism, but little is known about its physiological or regulatory functions. In this study, using a T7 mutant phage, where a 31-bp segment of Tφ was deleted from the genome, we discovered that deletion of Tφ from T7 reduces the phage burst size but delays lysis timing, both of which are disadvantageous for the phage. The burst downsizing could directly result from Tφ deletion-caused upregulation of gene 17.5, coding for holin, among other Tφ downstream genes, because infection of gp17.5-overproducing Escherichia coli by wild-type T7 phage showed similar burst downsizing. However, the lysis delay was not associated with cellular levels of holin or lysozyme or with rates of phage adsorption. Instead, when allowed to evolve spontaneously in five independent adaptation experiments, the Tφ-lacking mutant phage, after 27 or 29 passages, recovered both burst size and lysis time reproducibly by deleting early genes 0.5, 0.6, and 0.7 of class I, among other mutations. Deletion of genes 0.5 to 0.7 from the Tφ-lacking mutant phage decreased expression of several Tφ downstream genes to levels similar to that of the wild-type phage. Accordingly, phage T7 lysis timing is associated with cellular levels of Tφ downstream gene products. This suggests the involvement of unknown factor(s) besides the known lysis proteins, lysozyme and holin, and that Tφ plays a role of optimizing burst size and lysis time during T7 infection. IMPORTANCE E. coli PMID:24335287
Salyers, A A; Guthrie, E P
1988-01-01
Bacteroides thetaiotaomicron, an obligate anaerobe normally found in high concentrations in the human colon, is one of the few colon bacteria that can ferment host mucopolysaccharides such as chondroitin sulfate. Previously, we found that a directed insertional mutation in the gene that codes for the chondroitinase II gene of B. thetaiotaomicron did not affect growth on chondroitin sulfate despite the fact that chondroitinase II accounts for 70% of the total cellular chondroitinase activity. Thus, the chondroitinase II gene did not seem to contribute significantly to growth on chondroitin sulfate when the bacteria were grown in laboratory medium. To determine whether this enzyme is important for bacteria growing in the intestinal tract, we tested the ability of a strain that does not produce chondroitinase II to colonize the intestinal tracts of germfree mice and to compete with wild-type B. thetaiotaomicron. The mutant used in these experiments carried a 0.5-kilobase deletion in the chondroitinase II gene and was constructed so that, unlike the original insertion mutant, it contained no exogenous DNA. The deletion mutant colonized the intestinal tracts of germfree mice at the same levels as the wild type. When a mixture of the deletion mutant and wild type was used to colonize germfree mice, the percent wild type, measured by colony hybridization with the deleted 0.5-kilobase fragment as the hybridization probe, did not rise to 100% even after periods as long as 9 weeks. In most experiments, the percent wild type did not rise significantly above the percent in the original mixture.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:3140726
Katsuma, Susumu; Shimada, Toru
2015-03-01
Several lines of evidence have shown that the deletion of the ecdysteroid UDP-glucosyltransferase gene (egt) from the nucleopolyhedrovirus (NPV) genome increases the killing speed of host lepidopteran larvae. However, it has not been investigated in detail whether the effects of egt deletion depend on the larval stages of the host insect. In this study, we performed bioassays using 10 continuous larval stages of the 4th- or 5th-instar Bombyx mori larvae and B. mori NPV egt mutants. The fast-killing phenotype was observed in the egt mutants only when the infection process progressed through larval-larval transition. All day-2 4th-instar larvae infected with the egt mutants entered the molting stage and died much earlier than wild-type-infected larvae. Bodies of egt mutant-infected larvae were filled with excessive fluid immediately after head capsule slippage, owing presumably to the degeneration of Malpighian tubules. Fourth- or 5th-instar larvae infected with the egt mutants at early stages of each instar died similarly to those infected with the wild-type virus. Under infection in the middle stages of the 5th-instar, the survival time of egt mutant-infected larvae was significantly longer than that of the wild-type virus-infected larvae. These results clearly show that the effects of egt deletion on killing speed of NPV are largely dependent on the developmental stage of the host larvae infected by the virus. Copyright © 2015 Elsevier Inc. All rights reserved.
Sha, Jian; Kirtley, Michelle L.; van Lier, Christina J.; Wang, Shaofei; Erova, Tatiana E.; Kozlova, Elena V.; Cao, Anthony; Cong, Yingzi; Fitts, Eric C.; Rosenzweig, Jason A.
2013-01-01
Braun (murein) lipoprotein (Lpp) and lipopolysaccharide (LPS) are major components of the outer membranes of Enterobacteriaceae family members that are capable of triggering inflammatory immune responses by activating Toll-like receptors 2 and 4, respectively. Expanding on earlier studies that demonstrated a role played by Lpp in Yersinia pestis virulence in mouse models of bubonic and pneumonic plague, we characterized an msbB in-frame deletion mutant incapable of producing an acyltransferase that is responsible for the addition of lauric acid to the lipid A moiety of LPS, as well as a Δlpp ΔmsbB double mutant of the highly virulent Y. pestis CO92 strain. Although the ΔmsbB single mutant was minimally attenuated, the Δlpp single mutant and the Δlpp ΔmsbB double mutant were significantly more attenuated than the isogenic wild-type (WT) bacterium in bubonic and pneumonic animal models (mouse and rat) of plague. These data correlated with greatly reduced survivability of the aforementioned mutants in murine macrophages. Furthermore, the Δlpp ΔmsbB double mutant was grossly compromised in its ability to disseminate to distal organs in mice and in evoking cytokines/chemokines in infected animal tissues. Importantly, mice that survived challenge with the Δlpp ΔmsbB double mutant, but not the Δlpp or ΔmsbB single mutant, in a pneumonic plague model were significantly protected against a subsequent lethal WT CO92 rechallenge. These data were substantiated by the fact that the Δlpp ΔmsbB double mutant maintained an immunogenicity comparable to that of the WT strain and induced long-lasting T-cell responses against heat-killed WT CO92 antigens. Taken together, the data indicate that deletion of the msbB gene augmented the attenuation of the Δlpp mutant by crippling the spread of the double mutant to the peripheral organs of animals and by inducing cytokine/chemokine responses. Thus, the Δlpp ΔmsbB double mutant could provide a new live-attenuated background vaccine candidate strain, and this should be explored in the future. PMID:23275092
Martin, N C; Underbrink-Lyon, K
1981-01-01
We have used a cloned yeast mitochondrial tRNAUCNSer gene as a probe to detect RNA species that are transcripts from this gene in wild-type Saccharomyces cerevisiae and in petite deletion mutants. In RNA from wild-type cells, the tRNA is the most prominent transcript of the gene. In RNA from deletion mutants that retain this gene but have lost other regions of mtDNA, high molecular weight transcripts containing the tRNAUCNSer sequences accumulate but tRNAUCNSer is not made. tRNAUCNSer synthesis can be restored in these mutants when they are mated to other deletion mutants that retain a different portion of the mitochondrial genome. Protein synthesis is not necessary for the restoration, and the restoration is not due to a nuclear effect or to an effect of mating alone, because strains without mtDNA are not able to restore tRNA synthesis. These results definitively demonstrate the existence of a yeast mitochondrial locus that is necessary for tRNA synthesis and, because the restoration of tRNAUCNSer synthesis appears to result from intergenic complementation, not recombination, indicate that this locus acts in trans. Images PMID:6795621
USDA-ARS?s Scientific Manuscript database
The coat protein (CP) of Wheat streak mosaic virus (WSMV; genus Tritimovirus, family Potyviridae) tolerates deletion of amino acids 36 to 84 for efficient systemic infection of wheat. This study demonstrates that deletion of CP amino acids 58 to 84, but not 36 to 57, from WSMV genome induced severe ...
Evans, Jessica J; Gygli, Patrick E; McCaskill, Julienne; DeVeaux, Linda C
2018-04-20
The haloarchaea are unusual in possessing genes for multiple homologs to the ubiquitous single-stranded DNA binding protein (SSB or replication protein A, RPA) found in all three domains of life. Halobacterium salinarum contains five homologs: two are eukaryotic in organization, two are prokaryotic and are encoded on the minichromosomes, and one is uniquely euryarchaeal. Radiation-resistant mutants previously isolated show upregulation of one of the eukaryotic-type RPA genes. Here, we have created deletions in the five RPA operons. These deletion mutants were exposed to DNA-damaging conditions: ionizing radiation, UV radiation, and mitomycin C. Deletion of the euryarchaeal homolog, although not lethal as in Haloferax volcanii , causes severe sensitivity to all of these agents. Deletion of the other RPA/SSB homologs imparts a variable sensitivity to these DNA-damaging agents, suggesting that the different RPA homologs have specialized roles depending on the type of genomic insult encountered.
USDA-ARS?s Scientific Manuscript database
Ustilago maydis, causal agent of corn smut disease, is a dimorphic fungus alternating between a saprobic budding haploid, and an obligate pathogenic filamentous dikaryon. Maize responds to U. maydis colonization by producing tumorous structures, and only within these does the fungus sporulate, produ...
Beauvais, Anne; Bozza, Silvia; Kniemeyer, Olaf; Formosa, Céline; Balloy, Viviane; Henry, Christine; Roberson, Robert W.; Dague, Etienne; Chignard, Michel; Brakhage, Axel A.; Romani, Luigina; Latgé, Jean-Paul
2013-01-01
α-(1,3)-Glucan is a major component of the cell wall of Aspergillus fumigatus, an opportunistic human fungal pathogen. There are three genes (AGS1, AGS2 and AGS3) controlling the biosynthesis of α-(1,3)-glucan in this fungal species. Deletion of all the three AGS genes resulted in a triple mutant that was devoid of α-(1,3)-glucan in its cell wall; however, its growth and germination was identical to that of the parental strain in vitro. In the experimental murine aspergillosis model, this mutant was less pathogenic than the parental strain. The AGS deletion resulted in an extensive structural modification of the conidial cell wall, especially conidial surface where the rodlet layer was covered by an amorphous glycoprotein matrix. This surface modification was responsible for viability reduction of conidia in vivo, which explains decrease in the virulence of triple agsΔ mutant. PMID:24244155
Chu, Zhen-Jian; Sun, Huan-Huan; Ying, Sheng-Hua; Feng, Ming-Guang
2017-08-01
Cyclophilin B (CypB) was previously revealed as one of many putative secretory proteins in the transcriptome of Beauveria bassiana infection to a lepidopteran pest. Here we show a main localization of CypB in hyphal cell walls and septa and its essential role in the in vitro and in vivo asexual cycles of the fungal insect pathogen. Deletion of cypB reduced colony growth by 16-42% on two rich media and 30 scant media with different carbon or nitrogen sources. The deletion mutant suffered a delayed conidiation on a standard medium and a final 47% reduction in conidial yield, accompanied with drastic transcript depression of several key genes required for conidiation and conidial maturation. The mutant conidia required 10h longer to germinate 50% at optimal 25°C than wild-type conidia. Intriguingly, cultivation of the mutant conidia in a trehalose-peptone broth mimic to insect hemolymph resulted in 83% reduction in blastospore yield but only slight decrease in biomass level, indicating severe defects in transition of hyphae to blastospores. LT 50 for the deletion mutant against Galleria mellonella larvae through normal cuticle infection was prolonged to 7.4d from a wild-type estimate of 4.7d. During colony growth, additionally, the deletion mutant displayed hypersensitivity to Congo red, menadione, H 2 O 2 and heat shock but increased tolerance to cyclosporine A and rapamycin. All of changes were restored by targeted gene complementation. Altogether, CypB takes part in sustaining normal growth, aerial conidiation, conidial germination, dimorphic transition, stress tolerance and pathogenicity in B. bassiana. Copyright © 2017 Elsevier Inc. All rights reserved.
Buniello, Annalisa; Hardisty-Hughes, Rachel E.; Pass, Johanna C.; Bober, Eva; Smith, Richard J.; Steel, Karen P.
2013-01-01
The recessive mouse mutant headbobber (hb) displays the characteristic behavioural traits associated with vestibular defects including headbobbing, circling and deafness. This mutation was caused by the insertion of a transgene into distal chromosome 7 affecting expression of native genes. We show that the inner ear of hb/hb mutants lacks semicircular canals and cristae, and the saccule and utricle are fused together in a single utriculosaccular sac. Moreover, we detect severe abnormalities of the cochlear sensory hair cells, the stria vascularis looks severely disorganised, Reissner's membrane is collapsed and no endocochlear potential is detected. Myo7a and Kcnj10 expression analysis show a lack of the melanocyte-like intermediate cells in hb/hb stria vascularis, which can explain the absence of endocochlear potential. We use Trp2 as a marker of melanoblasts migrating from the neural crest at E12.5 and show that they do not interdigitate into the developing strial epithelium, associated with abnormal persistence of the basal lamina in the hb/hb cochlea. We perform array CGH, deep sequencing as well as an extensive expression analysis of candidate genes in the headbobber region of hb/hb and littermate controls, and conclude that the headbobber phenotype is caused by: 1) effect of a 648 kb deletion on distal Chr7, resulting in the loss of three protein coding genes (Gpr26, Cpmx2 and Chst15) with expression in the inner ear but unknown function; and 2) indirect, long range effect of the deletion on the expression of neighboring genes on Chr7, associated with downregulation of Hmx3, Hmx2 and Nkx1.2 homeobox transcription factors. Interestingly, deletions of the orthologous region in humans, affecting the same genes, have been reported in nineteen patients with common features including sensorineural hearing loss and vestibular problems. Therefore, we propose that headbobber is a useful model to gain insight into the mechanisms underlying deafness in human 10qter deletion syndrome. PMID:23457544
Bi, Hongkai; Sun, Lianle; Fukamachi, Toshihiko; Saito, Hiromi; Kobayashi, Hiroshi
2009-05-01
The major histone-like Escherichia coli protein, HU, is composed of alpha and beta subunits respectively encoded by hupA and hupB in Escherichia coli. A mutant deficient in both hupA and hupB grew at a slightly slower rate than the wild type at pH 7.5. Growth of the mutant diminished with a decrease in pH, and no growth was observed at pH 4.6. Mutants of either hupA or hupB grew at all pH levels tested. The arginine-dependent survival at pH 2.5 was diminished approximately 60-fold by the deletion of both hupA and hupB, whereas the survival was slightly affected by the deletion of either hupA or hupB. The mRNA levels of adiA and adiC, which respectively encode arginine decarboxylase and arginine/agmatine antiporter, were low in the mutant deficient in both hupA and hupB. The deletion of both hupA and hupB had little effect on survival at pH 2.5 in the presence of glutamate or lysine, and expression of the genes for glutamate and lysine decarboxylases was not impaired by the deletion of the HU genes. These results suggest that HU regulates expression of the specific set of genes required for growth and survival in acidic environments.
Pesko, Kendra N; Fitzpatrick, Kelly A; Ryan, Elizabeth M; Shi, Pei-Yong; Zhang, Bo; Lennon, Niall J; Newman, Ruchi M; Henn, Matthew R; Ebel, Gregory D
2012-05-25
Most RNA viruses exist in their hosts as a heterogeneous population of related variants. Due to error prone replication, mutants are constantly generated which may differ in individual fitness from the population as a whole. Here we characterize three WNV isolates that contain, along with full-length genomes, mutants with large internal deletions to structural and nonstructural protein-coding regions. The isolates were all obtained from lorikeets that died from WNV at the Rio Grande Zoo in Albuquerque, NM between 2005 and 2007. The deletions are approximately 2kb, in frame, and result in the elimination of the complete envelope, and portions of the prM and NS-1 proteins. In Vero cell culture, these internally deleted WNV genomes function as defective interfering particles, reducing the production of full-length virus when introduced at high multiplicities of infection. In mosquitoes, the shortened WNV genomes reduced infection and dissemination rates, and virus titers overall, and were not detected in legs or salivary secretions at 14 or 21 days post-infection. In mice, inoculation with internally deleted genomes did not attenuate pathogenesis relative to full-length or infectious clone derived virus, and shortened genomes were not detected in mice at the time of death. These observations provide evidence that large deletions may occur within flavivirus populations more frequently than has generally been appreciated and suggest that they impact population phenotype minimally. Additionally, our findings suggest that highly similar mutants may frequently occur in particular vertebrate hosts. Copyright © 2012 Elsevier Inc. All rights reserved.
Buglino, John A; Resh, Marilyn D
2010-06-23
Sonic hedgehog (Shh) is a palmitoylated protein that plays key roles in mammalian development and human cancers. Palmitoylation of Shh is required for effective long and short range Shh-mediated signaling. Attachment of palmitate to Shh is catalyzed by Hedgehog acyltransferase (Hhat), a member of the membrane bound O-acyl transferase (MBOAT) family of multipass membrane proteins. The extremely hydrophobic composition of MBOAT proteins has limited their biochemical characterization. Except for mutagenesis of two conserved residues, there has been no structure-function analysis of Hhat, and the regions of the protein required for Shh palmitoylation are unknown. Here we undertake a systematic approach to identify residues within Hhat that are required for protein stability and/or enzymatic activity. We also identify a second, novel MBOAT homology region (residues 196-234) that is required for Hhat activity. In total, ten deletion mutants and eleven point mutants were generated and analyzed. Truncations at the N- and C-termini of Hhat yielded inactive proteins with reduced stability. Four Hhat mutants with deletions within predicted loop regions and five point mutants retained stability but lost palmitoylation activity. We purified two point mutants, W378A and H379A, with defective Hhat activity. Kinetic analyses revealed alterations in apparent K(m) and V(max) for Shh and/or palmitoyl CoA, changes that likely explain the catalytic defects observed for these mutants. This study has pinpointed specific regions and multiple residues that regulate Hhat stability and catalysis. Our findings should be applicable to other MBOAT proteins that mediate lipid modification of Wnt proteins and ghrelin, and should serve as a model for understanding how secreted morphogens are modified by palmitoyl acyltransferases.
Gleiter, H M; Haag, E; Shen, J R; Eaton-Rye, J J; Inoue, Y; Vermaas, W F; Renger, G
1994-10-11
Several autotrophic mutant strains of Synechocystis sp. PCC 6803 carrying short deletions or a single-site mutation within the large, lumen-exposed loop (loop E) of the chlorophyll a-binding photosystem II core protein, CP47, are analyzed for their functional properties by measuring the flash-induced pattern of thermoluminescence, oxygen yield, and fluorescence quantum yield. A physiological and biochemical characterization of these mutant strains has been given in two previous reports [Eaton-Rye, J.J., & Vermaas, W.F.J. (1991) Plant Mol. Biol. 17, 1165-1177; Haag, E., Eaton-Rye, J.J., Renger, G., & Vermaas, S. F.J. (1993) Biochemistry 32, 4444-4454]. The results of the present study show that deletion of charged and conserved amino acids in a region roughly located between residues 370 and 390 decreases the binding affinity of the extrinsic PS II-O protein to photosystem II. Marked differences with PSII-O deletion mutants are observed with respect to Ca2+ requirement and the flash-induced pattern of oxygen evolution. Under conditions where a sufficient light activation is provided, the psbB mutants assayed in this study reveal normal S-state parameters and lifetimes. The results bear two basic implications: (i) the manganese involved in water oxidation can still be bound in a functionally normal or only slightly distorted manner, and (ii) the binding of the extrinsic PS II-O protein to photosystem II is impaired in mutants carrying a deletion in the domain between residues 370 and 390, but the presence of the PS II-O protein is still of functional relevance for the PS II complex, e.g., for maintenance of a high-affinity binding site for Ca2+ and/or involvement during the process of photoactivation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cho, Yangrae; Srivastava, Akhil; Ohm, Robin A.
2012-05-01
Alternaria brassicicola is a successful saprophyte and necrotrophic plant pathogen. Several A. brassicicola genes have been characterized as affecting pathogenesis of Brassica species. To study regulatory mechanisms of pathogenesis, we mined 421 genes in silico encoding putative transcription factors in a machine-annotated, draft genome sequence of A. brassicicola. In this study, targeted gene disruption mutants for 117 of the transcription factor genes were produced and screened. Three of these genes were associated with pathogenesis. Disruption mutants of one gene (AbPacC) were nonpathogenic and another gene (AbVf8) caused lesions less than half the diameter of wild-type lesions. Unexpectedly, mutants of themore » third gene, Amr1, caused lesions with a two-fold larger diameter than the wild type and complementation mutants. Amr1 is a homolog of Cmr1, a transcription factor that regulates melanin biosynthesis in several fungi. We created gene deletion mutants of ?amr1 and characterized their phenotypes. The ?amr1 mutants used pectin as a carbon source more efficiently than the wild type, were melanin-deficient, and more sensitive to UV light and glucanase digestion. The AMR1 protein was localized in the nuclei of hyphae and in highly melanized conidia during the late stage of plant pathogenesis. RNA-seq analysis revealed that three genes in the melanin biosynthesis pathway, along with the deleted Amr1 gene, were expressed at low levels in the mutants. In contrast, many hydrolytic enzyme-coding genes were expressed at higher levels in the mutants than in the wild type during pathogenesis. The results of this study suggested that a gene important for survival in nature negatively affected virulence, probably by a less efficient use of plant cell-wall materials. We speculate that the functions of the Amr1 gene are important to the success of A. brassicicola as a competitive saprophyte and plant parasite.« less
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N.; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-01-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar ‘Sasanishiki’) that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined. PMID:23381954
Isolation of a novel UVB-tolerant rice mutant obtained by exposure to carbon-ion beams.
Takano, Nao; Takahashi, Yuko; Yamamoto, Mitsuru; Teranishi, Mika; Yamaguchi, Hiroko; Sakamoto, Ayako N; Hase, Yoshihiro; Fujisawa, Hiroko; Wu, Jianzhong; Matsumoto, Takashi; Toki, Seiichi; Hidema, Jun
2013-07-01
UVB radiation suppresses photosynthesis and protein biosynthesis in plants, which in turn decreases growth and productivity. Here, an ultraviolet-B (UVB)-tolerant rice mutant, utr319 (UV Tolerant Rice 319), was isolated from a mutagenized population derived from 2500 M1 seeds (of the UVB-resistant cultivar 'Sasanishiki') that were exposed to carbon ions. The utr319 mutant was more tolerant to UVB than the wild type. Neither the levels of UVB-induced cyclobutane pyrimidine dimers (CPDs) or (6-4) pyrimidine-pyrimidone photodimers [(6-4) photoproducts], nor the repair of CPDs or (6-4) photoproducts, was altered in the utr319 mutant. Thus, the utr319 mutant may be impaired in the production of a previously unidentified factor that confers UVB tolerance. To identify the mutated region in the utr319 mutant, microarray-based comparative genomic hybridization analysis was performed. Two adjacent genes on chromosome 7, Os07g0264900 and Os07g0265100, were predicted to represent the mutant allele. Sequence analysis of the chromosome region in utr319 revealed a deletion of 45 419 bp. RNAi analysis indicated that Os07g0265100 is most likely the mutated gene. Database analysis indicated that the Os07g0265100 gene, UTR319, encodes a putative protein with unknown characteristics or function. In addition, the homologs of UTR319 are conserved only among land plants. Therefore, utr319 is a novel UVB-tolerant rice mutant and UTR319 may be crucial for the determination of UVB sensitivity in rice, although the function of UTR319 has not yet been determined.
Pds5 regulators segregate cohesion and condensation pathways in Saccharomyces cerevisiae
Tong, Kevin; Skibbens, Robert V.
2015-01-01
Cohesins are required both for the tethering together of sister chromatids (termed cohesion) and subsequent condensation into discrete structures—processes fundamental for faithful chromosome segregation into daughter cells. Differentiating between cohesin roles in cohesion and condensation would provide an important advance in studying chromatin metabolism. Pds5 is a cohesin-associated factor that is essential for both cohesion maintenance and condensation. Recent studies revealed that ELG1 deletion suppresses the temperature sensitivity of pds5 mutant cells. However, the mechanisms through which Elg1 may regulate cohesion and condensation remain unknown. Here, we report that ELG1 deletion from pds5-1 mutant cells results in a significant rescue of cohesion, but not condensation, defects. Based on evidence that Elg1 unloads the DNA replication clamp PCNA from DNA, we tested whether PCNA overexpression would similarly rescue pds5-1 mutant cell cohesion defects. The results indeed reveal that elevated levels of PCNA rescue pds5-1 temperature sensitivity and cohesion defects, but do not rescue pds5-1 mutant cell condensation defects. In contrast, RAD61 deletion rescues the condensation defect, but importantly, neither the temperature sensitivity nor cohesion defects exhibited by pds5-1 mutant cells. In combination, these findings reveal that cohesion and condensation are separable pathways and regulated in nonredundant mechanisms. These results are discussed in terms of a new model through which cohesion and condensation are spatially regulated. PMID:25986377
Pds5 regulators segregate cohesion and condensation pathways in Saccharomyces cerevisiae.
Tong, Kevin; Skibbens, Robert V
2015-06-02
Cohesins are required both for the tethering together of sister chromatids (termed cohesion) and subsequent condensation into discrete structures-processes fundamental for faithful chromosome segregation into daughter cells. Differentiating between cohesin roles in cohesion and condensation would provide an important advance in studying chromatin metabolism. Pds5 is a cohesin-associated factor that is essential for both cohesion maintenance and condensation. Recent studies revealed that ELG1 deletion suppresses the temperature sensitivity of pds5 mutant cells. However, the mechanisms through which Elg1 may regulate cohesion and condensation remain unknown. Here, we report that ELG1 deletion from pds5-1 mutant cells results in a significant rescue of cohesion, but not condensation, defects. Based on evidence that Elg1 unloads the DNA replication clamp PCNA from DNA, we tested whether PCNA overexpression would similarly rescue pds5-1 mutant cell cohesion defects. The results indeed reveal that elevated levels of PCNA rescue pds5-1 temperature sensitivity and cohesion defects, but do not rescue pds5-1 mutant cell condensation defects. In contrast, RAD61 deletion rescues the condensation defect, but importantly, neither the temperature sensitivity nor cohesion defects exhibited by pds5-1 mutant cells. In combination, these findings reveal that cohesion and condensation are separable pathways and regulated in nonredundant mechanisms. These results are discussed in terms of a new model through which cohesion and condensation are spatially regulated.
Deletion of Ku80 causes early aging independent of chronic inflammation and Rag-1-induced DSBs.
Holcomb, Valerie B; Vogel, Hannes; Hasty, Paul
2007-01-01
Animal models of premature aging are often defective for DNA repair. Ku80-mutant mice are disabled for nonhomologous end joining; a pathway that repairs both spontaneous DNA double-strand breaks (DSBs) and induced DNA DSBs generated by the action of a complex composed of Rag-1 and Rag-2 (Rag). Rag is essential for inducing DSBs important for assembling V(D)J segments of antigen receptor genes that are required for lymphocyte development. Thus, deletion of either Rag-1 or Ku80 causes severe combined immunodeficiency (scid) leading to chronic inflammation. In addition, Rag-1 induces breaks at non-B DNA structures. Previously we reported Ku80-mutant mice undergo premature aging, yet we do not know the root cause of this phenotype. Early aging may be caused by either defective repair of spontaneous DNA damage, defective repair of Rag-1-induced breaks or chronic inflammation caused by scid. To address this issue, we analyzed aging in control and Ku80-mutant mice deleted for Rag-1 such that both cohorts are scid and suffer from chronic inflammation. We make two observations: (1) chronic inflammation does not cause premature aging in these mice and (2) Ku80-mutant mice exhibit early aging independent of Rag-1. Therefore, this study supports defective repair of spontaneous DNA damage as the root cause of early aging in Ku80-mutant mice.
Heavy ion mutagenesis: linear energy transfer effects and genetic linkage
NASA Technical Reports Server (NTRS)
Kronenberg, A.; Gauny, S.; Criddle, K.; Vannais, D.; Ueno, A.; Kraemer, S.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)
1995-01-01
We have characterized a series of 69 independent mutants at the endogenous hprt locus of human TK6 lymphoblasts and over 200 independent S1-deficient mutants of the human x hamster hybrid cell line AL arising spontaneously or following low-fluence exposures to densely ionizing Fe ions (600 MeV/amu, linear energy transfer = 190 keV/microns). We find that large deletions are common. The entire hprt gene (> 44 kb) was missing in 19/39 Fe-induced mutants, while only 2/30 spontaneous mutants lost the entire hprt coding sequence. When the gene of interest (S1 locus = M1C1 gene) is located on a nonessential human chromosome 11, multilocus deletions of several million base pairs are observed frequently. The S1 mutation frequency is more than 50-fold greater than the frequency of hprt mutants in the same cells. Taken together, these results suggest that low-fluence exposures to Fe ions are often cytotoxic due to their ability to create multilocus deletions that may often include the loss of essential genes. In addition, the tumorigenic potential of these HZE heavy ions may be due to the high potential for loss of tumor suppressor genes. The relative insensitivity of the hprt locus to mutation is likely due to tight linkage to a gene that is required for viability.
Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S
1996-03-01
In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamei, Yuka; Tamura, Takayuki; Yoshida, Ryo
2011-04-01
Highlights: {yields}We demonstrate that two genes in the yeast GABA metabolism pathway affect aging. {yields} Deletion of the UGA1 or GAD1 genes extends replicative lifespan. {yields} Addition of GABA to wild-type cultures has no effect on lifespan. {yields} Intracellular GABA levels do not differ in longevity mutants and wild-type cells. {yields} Levels of tricarboxylic acid cycle intermediates positively correlate with lifespan. -- Abstract: Many of the genes involved in aging have been identified in organisms ranging from yeast to human. Our previous study showed that deletion of the UGA3 gene-which encodes a zinc-finger transcription factor necessary for {gamma}-aminobutyric acid (GABA)-dependentmore » induction of the UGA1 (GABA aminotransferase), UGA2 (succinate semialdehyde dehydrogenase), and UGA4 (GABA permease) genes-extends replicative lifespan in the budding yeast Saccharomycescerevisiae. Here, we found that deletion of UGA1 lengthened the lifespan, as did deletion of UGA3; in contrast, strains with UGA2 or UGA4 deletions exhibited no lifespan extension. The {Delta}uga1 strain cannot deaminate GABA to succinate semialdehyde. Deletion of GAD1, which encodes the glutamate decarboxylase that converts glutamate into GABA, also increased lifespan. Therefore, two genes in the GABA metabolism pathway, UGA1 and GAD1, were identified as aging genes. Unexpectedly, intracellular GABA levels in mutant cells (except for {Delta}uga2 cells) did not differ from those in wild-type cells. Addition of GABA to culture media, which induces transcription of the UGA structural genes, had no effect on replicative lifespan of wild-type cells. Multivariate analysis of {sup 1}H nuclear magnetic resonance spectra for the whole-cell metabolite levels demonstrated a separation between long-lived and normal-lived strains. Gas chromatography-mass spectrometry analysis of identified metabolites showed that levels of tricarboxylic acid cycle intermediates positively correlated with lifespan extension. These results strongly suggest reduced activity of the GABA-metabolizing enzymes extends lifespan by shifting carbon metabolism toward respiration, as calorie restriction does.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuwasako, Kenji, E-mail: kuwasako@fc.miyazaki-u.ac.jp; Kitamura, Kazuo; Nagata, Sayaka
2010-02-12
Receptor activity-modifying protein 2 (RAMP2) enables calcitonin receptor-like receptor (CRLR) to form an adrenomedullin (AM)-specific receptor. Here we investigated the function of the cytoplasmic C-terminal tail (C-tail) of human (h)CRLR by co-transfecting its C-terminal mutants into HEK-293 cells stably expressing hRAMP2. Deleting the C-tail from CRLR disrupted AM-evoked cAMP production or receptor internalization, but did not affect [{sup 125}I]AM binding. We found that CRLR residues 428-439 are required for AM-evoked cAMP production, though deleting this region had little effect on receptor internalization. Moreover, pretreatment with pertussis toxin (100 ng/mL) led to significant increases in AM-induced cAMP production via wild-type CRLR/RAMP2more » complexes. This effect was canceled by deleting CRLR residues 454-457, suggesting Gi couples to this region. Flow cytometric analysis revealed that CRLR truncation mutants lacking residues in the Ser/Thr-rich region extending from Ser{sup 449} to Ser{sup 467} were unable to undergo AM-induced receptor internalization and, in contrast to the effect on wild-type CRLR, overexpression of GPCR kinases-2, -3 and -4 failed to promote internalization of CRLR mutants lacking residues 449-467. Thus, the hCRLR C-tail is crucial for AM-evoked cAMP production and internalization of the CRLR/RAMP2, while the receptor internalization is dependent on the aforementioned GPCR kinases, but not Gs coupling.« less
Zhang, Chengkang; Luo, Zenghong; He, Dongdong; Su, Li; Yin, Hui; Wang, Guo; Liu, Hong; Rensing, Christopher; Wang, Zonghua
2018-01-01
Rho GTPases are signaling macromolecules that are associated with developmental progression and pathogenesis of Fusarium graminearum . Generally, enzymatic activities of Rho GTPases are regulated by Rho GTPase guanine nucleotide exchange factors (RhoGEFs). In this study, we identified a putative RhoGEF encoding gene ( FgBUD3 ) in F. graminearum database and proceeded further by using a functional genetic approach to generate FgBUD3 targeted gene deletion mutant. Phenotypic analysis results showed that the deletion of FgBUD3 caused severe reduction in growth of FgBUD3 mutant generated during this study. We also observed that the deletion of FgBUD3 completely abolished sexual reproduction and triggered the production of abnormal asexual spores with nearly no septum in ΔFgbud3 strain. Further results obtained from infection assays conducted during this research revealed that the FgBUD3 defective mutant lost its pathogenicity on wheat and hence, suggests FgBud3 plays an essential role in the pathogenicity of F. graminearum . Additional, results derived from yeast two-hybrid assays revealed that FgBud3 strongly interacted with FgRho4 compared to the interaction with FgRho2, FgRho3, and FgCdc42. Moreover, we found that FgBud3 interacted with both GTP-bound and GDP-bound form of FgRho4. From these results, we subsequently concluded that, the Rho4-interacting GEF protein FgBud3 crucially promotes vegetative growth, asexual and sexual development, cell division and pathogenicity in F. graminearum .
Identification of an essential virulence gene of cyprinid herpesvirus 3.
Boutier, Maxime; Gao, Yuan; Vancsok, Catherine; Suárez, Nicolás M; Davison, Andrew J; Vanderplasschen, Alain
2017-09-01
The genus Cyprinivirus consists of a growing list of phylogenetically related viruses, some of which cause severe economic losses to the aquaculture industry. The archetypal member, cyprinid herpesvirus 3 (CyHV-3) causes mass mortalities worldwide in koi and common carp. A CyHV-3 mutant was described previously that is attenuated in vivo by a deletion affecting two genes (ORF56 and ORF57). The relative contributions of ORF56 and ORF57 to the safety and efficacy profile of this vaccine candidate have now been assessed by analysing viruses individually deleted for ORF56 or ORF57. Inoculation of these viruses into carp demonstrated that the absence of ORF56 did not affect virulence, whereas the absence of ORF57 led to an attenuation comparable to, though slightly less than, that of the doubly deleted virus. To demonstrate further the role of ORF57 as a key virulence factor, a mutant retaining the ORF57 region but unable to express the ORF57 protein was produced by inserting multiple in-frame stop codons into the coding region. Analysis of this virus in vivo revealed a safety and efficacy profile comparable to that of the doubly deleted virus. These findings show that ORF57 encodes an essential CyHV-3 virulence factor. They also indicate that ORF57 orthologues in other cypriniviruses may offer promising targets for the rational design of attenuated recombinant vaccines. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Jarnuczak, Andrew F; Eyers, Claire E; Schwartz, Jean-Marc; Grant, Christopher M; Hubbard, Simon J
2015-09-01
Molecular chaperones play an important role in protein homeostasis and the cellular response to stress. In particular, the HSP70 chaperones in yeast mediate a large volume of protein folding through transient associations with their substrates. This chaperone interaction network can be disturbed by various perturbations, such as environmental stress or a gene deletion. Here, we consider deletions of two major chaperone proteins, SSA1 and SSB1, from the chaperone network in Sacchromyces cerevisiae. We employ a SILAC-based approach to examine changes in global and local protein abundance and rationalise our results via network analysis and graph theoretical approaches. Although the deletions result in an overall increase in intracellular protein content, correlated with an increase in cell size, this is not matched by substantial changes in individual protein concentrations. Despite the phenotypic robustness to deletion of these major hub proteins, it cannot be simply explained by the presence of paralogues. Instead, network analysis and a theoretical consideration of folding workload suggest that the robustness to perturbation is a product of the overall network structure. This highlights how quantitative proteomics and systems modelling can be used to rationalise emergent network properties, and how the HSP70 system can accommodate the loss of major hubs. © 2015 The Authors. PROTEOMICS published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
2017-10-01
Model Core Facility at MD Anderson has generated a genomic deletion of LINK-A using CRISPR /Cas9 technology based on collaboration. The single...Generation of LINK-A deletion mutant using CRISPR /Cas9 technology. A, Illustration of genomic deletion region of LINK-A (Chr1: 238644075-238644134
Min, Kyunghun; Lee, Jungkwan; Kim, Jin-Cheol; Kim, Sang Gyu; Kim, Young Ho; Vogel, Steven; Trail, Frances; Lee, Yin-Won
2010-01-01
Head blight, caused by Gibberella zeae, is a significant disease among cereal crops, including wheat, barley, and rice, due to contamination of grain with mycotoxins. G. zeae is spread by ascospores forcibly discharged from sexual fruiting bodies forming on crop residues. In this study, we characterized a novel gene, ROA, which is required for normal sexual development. Deletion of ROA (Δroa) resulted in an abnormal size and shape of asci and ascospores but did not affect vegetative growth. The Δroa mutation triggered round ascospores and insufficient cell division after spore delimitation. The asci of the Δroa strain discharged fewer ascospores from the perithecia but achieved a greater dispersal distance than those of the wild-type strain. Turgor pressure within the asci was calculated through the analysis of osmolytes in the epiplasmic fluid. Deletion of the ROA gene appeared to increase turgor pressure in the mutant asci. The higher turgor pressure of the Δroa mutant asci and the mutant spore shape contributed to the longer distance dispersal. When the Δroa mutant was outcrossed with a Δmat1-2 mutant, a strain that contains a green fluorescence protein (GFP) marker in place of the MAT1-2 gene, unusual phenotypic segregation occurred. The ratio of GFP to non-GFP segregation was 1:1; however, all eight spores had the same shape. Taken together, the results of this study suggest that ROA plays multiple roles in maintaining the proper morphology and discharge of ascospores in G. zeae. PMID:20802018
Chihara, Carol J.; Song, Chunyan; LaMonte, Greg; Fetalvero, Kristina; Hinchman, Kristy; Phan, Helen; Pineda, Mario; Robinson, Kelly; Schneider, Gregory P.
2005-01-01
The omega (ome) gene product is a modifier of larval cuticle protein 5 and its alleles (and duplicates) in the third instar of Drosophila melanogaster. Using deletion mapping the locus mapped to 70F-71A on the left arm of chromosome 3. A homozygote null mutant (ome 1) shows a pleiotropic phenotype that affected the size, developmental time of the flies, and the fertility (or perhaps the behavior) of homozygous mutant males. The omega gene was verified as producing a dipeptidyl peptidase IV (DPPIV) by genetic analysis, substrate specificity and pH optimum. The identity of the gene was confirmed as CG32145 (cytology 70F4) in the Celera Database (Berkeley Drosophila Genome Project), which is consistent with its deletion map position. The genomic structure of the gene is described and the decrease in DPPIV activity in the mutant ome1 is shown to be due to the gene CG32145 (omega). The D. melanogaster omega DPPIV enzyme was partially purified and characterized. The exons of the ome1 mutant were sequenced and a base substitution mutation in exon 4 was identified that would yield a truncated protein caused by a stop codon. A preliminary study of the compartmentalization of the omega DPPIV enzyme in several organs is also reported. Abbreviations: DPPIV dipeptidyl peptidase IV LCP5 & LCP6 third instar larval cuticle proteins 5 & 6 ome & ome1 omega locus name (CG32145) and mutant allele in D. melanogaster pNA paranotroanilide PMID:17119608
Autographa californica multiple nucleopolyhedrovirus PK-1 is essential for nucleocapsid assembly
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liang, Changyong, E-mail: cyliang@yzu.edu.cn; Li, Min; Dai, Xuejuan
2013-09-01
PK-1 (Ac10) is a baculovirus-encoded serine/threonine kinase and its function is unclear. Our results showed that a pk-1 knockout AcMNPV failed to produce infectious progeny, while the pk-1 repair virus could rescue this defect. qPCR analysis demonstrated that pk-1 deletion did not affect viral DNA replication. Analysis of the repaired recombinants with truncated pk-1 mutants demonstrated that the catalytic domain of protein kinases of PK-1 was essential to viral infectivity. Moreover, those PK-1 mutants that could rescue the infectious BV production defect exhibited kinase activity in vitro. Therefore, it is suggested that the kinase activity of PK-1 is essential inmore » regulating viral propagation. Electron microscopy revealed that pk-1 deletion affected the formation of normal nucleocapsids. Masses of electron-lucent tubular structures were present in cell transfected with pk-1 knockout bacmid. Therefore, PK-1 appears to phosphorylate some viral or cellular proteins that are essential for DNA packaging to regulate nucleocapsid assembly. - Highlights: • A pk-1 knockout AcMNPV failed to produce infectious progeny. • The pk-1 deletion did not affect viral DNA replication. • The catalytic domain of protein kinases (PKc) of PK-1 was essential to viral infectivity. • The kinase activity of PK-1 is essential in regulating viral propagation. • PK-1 appears to phosphorylate some viral proteins that are essential for DNA packaging to regulate nucleocapsid assembly.« less
In vivo and in vitro analyses of a Bombyx mori nucleopolyhedrovirus mutant lacking functional vfgf.
Katsuma, Susumu; Horie, Satoshi; Daimon, Takaaki; Iwanaga, Masashi; Shimada, Toru
2006-11-10
All lepidopteran baculovirus genomes sequenced to date encode a viral fibroblast growth factor homolog (vfgf), suggesting that vfgf may play an important role in the infection cycle of lepidopteran baculoviruses. Here, we describe the characterization of a Bombyx mori nucleopolyhedrovirus (BmNPV) mutant lacking functional vfgf. We constructed a vfgf deletion mutant (BmFGFD) and characterized it in BmN cells and B. mori larvae. We observed that budded virus (BV) production was reduced in BmFGFD-infected BmN cells and B. mori larvae. The larval bioassays also revealed that deletion of vfgf did not reduce the infectivity; however, the mutant virus did take 20 h longer to kill B. mori larvae than wild-type BmNPV, when tested either by BV injection or by polyhedrin-inclusion body ingestion. These results suggest that BmNPV vfgf is involved in efficient virus production in BmN cells and B. mori larvae.
Flint, Annika; Sun, Yi-Qian; Stintzi, Alain
2012-01-01
Campylobacter jejuni, a microaerophilic bacterium, is the most frequent cause of human bacterial gastroenteritis. C. jejuni is exposed to harmful reactive oxygen species (ROS) produced during its own normal metabolic processes and during infection from the host immune system and from host intestinal microbiota. These ROS will damage DNA and proteins and cause peroxidation of lipids. Consequently, identifying ROS defense mechanisms is important for understanding how Campylobacter survives this environmental stress during infection. Construction of a ΔCj1386 isogenic deletion mutant and phenotypic assays led to its discovery as a novel oxidative stress defense gene. The ΔCj1386 mutant has an increased sensitivity toward hydrogen peroxide. The Cj1386 gene is located directly downstream from katA (catalase) in the C. jejuni genome. A ΔkatAΔ Cj1386 double deletion mutant was constructed and exhibited a sensitivity to hydrogen peroxide similar to that seen in the ΔCj1386 and ΔkatA single deletion mutants. This observation suggests that Cj1386 may be involved in the same detoxification pathway as catalase. Despite identical KatA abundances, catalase activity assays showed that the ΔCj1386 mutant had a reduced catalase activity relative to that of wild-type C. jejuni. Heme quantification of KatA protein from the ΔCj1386 mutant revealed a significant decrease in heme concentration. This indicates an important role for Cj1386 in heme trafficking to KatA within C. jejuni. Interestingly, the ΔCj1386 mutant had a reduced ability to colonize the ceca of chicks and was outcompeted by the wild-type strain for colonization of the gastrointestinal tract of neonate piglets. These results indicate an important role for Cj1386 in Campylobacter colonization and pathogenesis.
Flint, Annika; Sun, Yi-Qian
2012-01-01
Campylobacter jejuni, a microaerophilic bacterium, is the most frequent cause of human bacterial gastroenteritis. C. jejuni is exposed to harmful reactive oxygen species (ROS) produced during its own normal metabolic processes and during infection from the host immune system and from host intestinal microbiota. These ROS will damage DNA and proteins and cause peroxidation of lipids. Consequently, identifying ROS defense mechanisms is important for understanding how Campylobacter survives this environmental stress during infection. Construction of a ΔCj1386 isogenic deletion mutant and phenotypic assays led to its discovery as a novel oxidative stress defense gene. The ΔCj1386 mutant has an increased sensitivity toward hydrogen peroxide. The Cj1386 gene is located directly downstream from katA (catalase) in the C. jejuni genome. A ΔkatAΔ Cj1386 double deletion mutant was constructed and exhibited a sensitivity to hydrogen peroxide similar to that seen in the ΔCj1386 and ΔkatA single deletion mutants. This observation suggests that Cj1386 may be involved in the same detoxification pathway as catalase. Despite identical KatA abundances, catalase activity assays showed that the ΔCj1386 mutant had a reduced catalase activity relative to that of wild-type C. jejuni. Heme quantification of KatA protein from the ΔCj1386 mutant revealed a significant decrease in heme concentration. This indicates an important role for Cj1386 in heme trafficking to KatA within C. jejuni. Interestingly, the ΔCj1386 mutant had a reduced ability to colonize the ceca of chicks and was outcompeted by the wild-type strain for colonization of the gastrointestinal tract of neonate piglets. These results indicate an important role for Cj1386 in Campylobacter colonization and pathogenesis. PMID:22081390
Huang, Haichan; Liu, Xiaobo; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J
2016-09-01
Heparosan, the capsular polysaccharide of Escherichia coli K5 having a carbohydrate backbone similar to that of heparin, has become a potential precursor for bioengineering heparin. In the heparosan biosynthesis pathway, the gene waaR encoding α-1-, 2- glycosyltransferase catalyze s the third glucosyl residues linking to the oligosaccharide chain. In the present study, a waaR deletion mutant of E. coli K5 was constructed. The mutant showed improvement of capsule polysaccharide yield. It is interesting that the heparosan molecular weight of the mutant is reduced and may become more suitable as a precursor for the production of low molecular weight heparin derived from the wild-type K5 capsular polysaccharide.
Maintenance of Epithelial Stem Cells by Cbl Proteins
2013-09-01
our research findings during the entire grant period (Sept. 2010 – Aug. 2013). 1. Analysis of Cbl functions in progenitor-type mammary epithelial...catenin pathway, but further investigation is required to establish this. 2. Analysis of Cbl functions in vivo using gene mutant mouse models We...Nandwani N, Gu H, Band V, Band H. Rapidly fatal myeloproliferative disorders in mice with deletion of Casitas B-cell lymphoma (Cbl) and Cbl-b in
Ponnusamy, Duraisamy; Fitts, Eric C.; Erova, Tatiana E.; Kozlova, Elena V.; Kirtley, Michelle L.; Tiner, Bethany L.; Andersson, Jourdan A.
2015-01-01
The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). PMID:25754198
2011-01-01
Background Cellulase and hemicellulase genes in the fungus Trichoderma reesei are repressed by glucose and induced by lactose. Regulation of the cellulase genes is mediated by the repressor CRE1 and the activator XYR1. T. reesei strain Rut-C30 is a hypercellulolytic mutant, obtained from the natural strain QM6a, that has a truncated version of the catabolite repressor gene, cre1. It has been previously shown that bacterial mutants lacking phosphoglucose isomerase (PGI) produce more nucleotide precursors and amino acids. PGI catalyzes the second step of glycolysis, the formation of fructose-6-P from glucose-6-P. Results We deleted the gene pgi1, encoding PGI, in the T. reesei strain Rut-C30 and we introduced the cre1 gene in a Δpgi1 mutant. Both Δpgi1 and cre1+Δpgi1 mutants showed a pellet-like and growth as well as morphological alterations compared with Rut-C30. None of the mutants grew in media with fructose, galactose, xylose, glycerol or lactose but they grew in media with glucose, with fructose and glucose, with galactose and fructose or with lactose and fructose. No growth was observed in media with xylose and glucose. On glucose, Δpgi1 and cre1+Δpgi1 mutants showed higher cellulase activity than Rut-C30 and QM6a, respectively. But in media with lactose, none of the mutants improved the production of the reference strains. The increase in the activity did not correlate with the expression of mRNA of the xylanase regulator gene, xyr1. Δpgi1 mutants were also affected in the extracellular β-galactosidase activity. Levels of mRNA of the glucose 6-phosphate dehydrogenase did not increase in Δpgi1 during growth on glucose. Conclusions The ability to grow in media with glucose as the sole carbon source indicated that Trichoderma Δpgi1 mutants were able to use the pentose phosphate pathway. But, they did not increase the expression of gpdh. Morphological characteristics were the result of the pgi1 deletion. Deletion of pgi1 in Rut-C30 increased cellulase production, but only under repressing conditions. This increase resulted partly from the deletion itself and partly from a genetic interaction with the cre1-1 mutation. The lower cellulase activity of these mutants in media with lactose could be attributed to a reduced ability to hydrolyse this sugar but not to an effect on the expression of xyr1. PMID:21609467
Ponnusamy, Duraisamy; Fitts, Eric C; Sha, Jian; Erova, Tatiana E; Kozlova, Elena V; Kirtley, Michelle L; Tiner, Bethany L; Andersson, Jourdan A; Chopra, Ashok K
2015-05-01
The identification of new virulence factors in Yersinia pestis and understanding their molecular mechanisms during an infection process are necessary in designing a better vaccine or to formulate an appropriate therapeutic intervention. By using a high-throughput, signature-tagged mutagenic approach, we created 5,088 mutants of Y. pestis strain CO92 and screened them in a mouse model of pneumonic plague at a dose equivalent to 5 50% lethal doses (LD50) of wild-type (WT) CO92. From this screen, we obtained 118 clones showing impairment in disseminating to the spleen, based on hybridization of input versus output DNA from mutant pools with 53 unique signature tags. In the subsequent screen, 20/118 mutants exhibited attenuation at 8 LD50 when tested in a mouse model of bubonic plague, with infection by 10/20 of the aforementioned mutants resulting in 40% or higher survival rates at an infectious dose of 40 LD50. Upon sequencing, six of the attenuated mutants were found to carry interruptions in genes encoding hypothetical proteins or proteins with putative functions. Mutants with in-frame deletion mutations of two of the genes identified from the screen, namely, rbsA, which codes for a putative sugar transport system ATP-binding protein, and vasK, a component of the type VI secretion system, were also found to exhibit some attenuation at 11 or 12 LD50 in a mouse model of pneumonic plague. Likewise, among the remaining 18 signature-tagged mutants, 9 were also attenuated (40 to 100%) at 12 LD50 in a pneumonic plague mouse model. Previously, we found that deleting genes encoding Braun lipoprotein (Lpp) and acyltransferase (MsbB), the latter of which modifies lipopolysaccharide function, reduced the virulence of Y. pestis CO92 in mouse models of bubonic and pneumonic plague. Deletion of rbsA and vasK genes from either the Δlpp single or the Δlpp ΔmsbB double mutant augmented the attenuation to provide 90 to 100% survivability to mice in a pneumonic plague model at 20 to 50 LD50. The mice infected with the Δlpp ΔmsbB ΔrbsA triple mutant at 50 LD50 were 90% protected upon subsequent challenge with 12 LD50 of WT CO92, suggesting that this mutant or others carrying combinational deletions of genes identified through our screen could potentially be further tested and developed into a live attenuated plague vaccine(s). Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Cheng, Changyong; Dong, Zhimei; Han, Xiao; Wang, Hang; Jiang, Li; Sun, Jing; Yang, Yongchun; Ma, Tiantian; Shao, Chunyan; Wang, Xiaodu; Chen, Zhongwei; Fang, Weihuan; Freitag, Nancy E; Huang, Huarong; Song, Houhui
2017-01-01
Microbes employ the thioredoxin system to defend against oxidative stress and ensure correct disulfide bonding to maintain protein function. Listeria monocytogenes has been shown to encode a putative thioredoxin, TrxA, but its biological roles and underlying mechanisms remain unknown. Here, we showed that expression of L. monocytogenes TrxA is significantly induced in bacteria treated with the thiol-specific oxidizing agent, diamide. Deletion of trxA markedly compromised tolerance of the pathogen to diamide, and mainly impaired early stages of infection in human intestinal epithelial Caco-2 cells. In addition, most trxA mutant bacteria were not associated with polymerized actin, and the rare bacteria that were associated with polymerized actin displayed very short tails or clouds during infection. Deletion or constitutive overexpression of TrxA, which was regulated by SigH, severely attenuated the virulence of the pathogen. Transcriptome analysis of L. monocytogenes revealed over 270 genes that were differentially transcribed in the Δ trxA mutant compared to the wild-type, especially for the virulence-associated genes plcA, mpl, hly, actA , and plcB . Particularly, deletion of TrxA completely reduced LLO expression, and thereby led to a thoroughly impaired hemolytic activity. Expression of these virulence factors are positively regulated by the master regulator PrfA that was found here to use TrxA to maintain its reduced forms for activation. Interestingly, the trxA deletion mutant completely lacked flagella and was non-motile. We further confirmed that this deficiency is attributable to TrxA in maintaining the reduced intracellular monomer status of MogR, the key regulator for flagellar formation, to ensure correct dimerization. In summary, we demonstrated for the first time that L. monocytogenes thioredoxin A as a vital cellular reductase is essential for maintaining a highly reducing environment in the bacterial cytosol, which provides a favorable condition for protein folding and activation, and therefore contributes to bacterial virulence and motility.
Weber, J A; Taxman, D J; Lu, Q; Gilmour, D S
1997-01-01
GAGA factor, TFIID, and paused polymerase are present on the hsp70 promoter in Drosophila melanogaster prior to transcriptional activation. In order to investigate the interplay between these components, mutant constructs were analyzed after they had been transformed into flies on P elements. One construct lacked the TATA box and the other lacked the upstream regulatory region where GAGA factor binds. Transcription of each mutant during heat shock was at least 50-fold less than that of a normal promoter construct. Before and after heat shock, both mutant promoters were found to adopt a DNase I hypersensitive state that included the region downstream from the transcription start site. High-resolution analysis of the DNase I cutting pattern identified proteins that could be contributing to the hypersensitivity. GAGA factor footprints were clearly evident in the upstream region of the TATA deletion construct, and a partial footprint possibly caused by TFIID was evident on the TATA box of the upstream deletion construct. Permanganate treatment of intact salivary glands was used to further characterize each promoter construct. Paused polymerase and TFIID were readily detected on the normal promoter construct, whereas both deletions exhibited reduced levels of each of these factors. Hence both the TATA box and the upstream region are required to efficiently recruit TFIID and a paused polymerase to the promoter prior to transcriptional activation. In contrast, GAGA factor appears to be capable of binding and establishing a DNase I hypersensitive region in the absence of TFIID and polymerase. Interestingly, purified GAGA factor was found to bind near the transcription start site, and the strength of this interaction was increased by the presence of the upstream region. GAGA factor alone might be capable of establishing an open chromatin structure that encompasses the upstream regulatory region as well as the core promoter region, thus facilitating the binding of TFIID. PMID:9199313
Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M
2015-07-02
Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Costes, S.; Sachs, R.; Hlatky, L.; Vannais, D.; Waldren, C.; Fouladi, B.; Chatterjee, A. (Principal Investigator)
2001-01-01
A mathematical model is used to analyze mutant spectra for large mutations induced by low-LET radiation. The model equations are based mainly on two-break misrejoining that leads to deletions or translocations. It is assumed, as a working hypothesis, that the initial damage induced by low-LET radiation is located randomly in the genome. Specifically, we analyzed data for two hemizygous loci: CD59- mutants, mainly very large-scale deletions (>3 Mbp), in human-hamster hybrid cells, and data from the literature on those HPRT- mutants which involve at least deletion of the whole gene, and often of additional flanking markers (approximately 50-kbp to approximately 4.4-Mbp deletions). For five data sets, we estimated f, the probability that two given breaks on the same chromosome will misrejoin to make a deletion, as a function of the separation between the breaks. We found that f is larger for nearby breaks than for breaks that are more widely separated; i.e., there is a "proximity effect". For acute irradiation, the values of f determined from the data are consistent with the corresponding break misrejoining parameters found previously in quantitative modeling of chromosome aberrations. The value of f was somewhat smaller for protracted irradiation than for acute irradiation at a given total dose; i.e., the mutation data show a decrease that was smaller than expected for dose protraction by fractionation or low dose rate.
Differential accumulation of nif structural gene mRNA in Azotobacter vinelandii.
Hamilton, Trinity L; Jacobson, Marty; Ludwig, Marcus; Boyd, Eric S; Bryant, Donald A; Dean, Dennis R; Peters, John W
2011-09-01
Northern analysis was employed to investigate mRNA produced by mutant strains of Azotobacter vinelandii with defined deletions in the nif structural genes and in the intergenic noncoding regions. The results indicate that intergenic RNA secondary structures effect the differential accumulation of transcripts, supporting the high Fe protein-to-MoFe protein ratio required for optimal diazotrophic growth.
Laniewski, Paweł; Mitra, Arindam; Karaca, Kemal; Khan, Ayub; Prasad, Rajeev; Curtiss, Roy; Roland, Kenneth L
2014-09-01
Salmonella enterica serovar Gallinarum is the etiological agent of fowl typhoid, which constitutes a considerable economic problem for poultry growers in developing countries. The vaccination of chickens seems to be the most effective strategy to control the disease in those areas. We constructed S. Gallinarum strains with a deletion of the global regulatory gene fur and evaluated their virulence and protective efficacy in Rhode Island Red chicks and Brown Leghorn layers. The fur deletion mutant was avirulent and, when delivered orally to chicks, elicited excellent protection against lethal S. Gallinarum challenge. It was not as effective when given orally to older birds, although it was highly immunogenic when delivered by intramuscular injection. We also examined the effect of a pmi mutant and a combination of fur deletions with mutations in the pmi and rfaH genes, which affect O-antigen synthesis, and ansB, whose product inhibits host T-cell responses. The S. Gallinarum Δpmi mutant was only partially attenuated, and the ΔansB mutant was fully virulent. The Δfur Δpmi and Δfur ΔansB double mutants were attenuated but not protective when delivered orally to the chicks. However, a Δpmi Δfur strain was highly immunogenic when administered intramuscularly. All together, our results show that the fur gene is essential for the virulence of S. Gallinarum, and the fur mutant is effective as a live recombinant vaccine against fowl typhoid. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Mutations in CIC and IDH1 cooperatively regulate 2-hydroxyglutarate levels and cell clonogenicity
Chittaranjan, Suganthi; Chan, Susanna; Yang, Cindy; Yang, Kevin C.; Chen, Vincent; Moradian, Annie; Firme, Marlo; Song, Jungeun; Go, Nancy E.; Blough, Michael D.; Chan, Jennifer A.; Cairncross, J. Gregory; Gorski, Sharon M.; Morin, Gregg B.; Yip, Stephen; Marra, Marco A.
2014-01-01
The majority of oligodendrogliomas (ODGs) exhibit combined losses of chromosomes 1p and 19q and mutations of isocitrate dehydrogenase (IDH1-R132H or IDH2-R172K). Approximately 70% of ODGs with 1p19q co-deletions harbor somatic mutations in the Capicua Transcriptional Repressor (CIC) gene on chromosome 19q13.2. Here we show that endogenous long (CIC-L) and short (CIC-S) CIC proteins are predominantly localized to the nucleus or cytoplasm, respectively. Cytoplasmic CIC-S is found in close proximity to the mitochondria. To study wild type and mutant CIC function and motivated by the paucity of 1p19q co-deleted ODG lines, we created HEK293 and HOG stable cell lines ectopically co-expressing CIC and IDH1. Non-mutant lines displayed increased clonogenicity, but cells co-expressing the mutant IDH1-R132H with either CIC-S-R201W or -R1515H showed reduced clonogenicity in an additive manner, demonstrating cooperative effects in our assays. Expression of mutant CIC-R1515H increased cellular 2-Hydroxyglutarate (2HG) levels compared to wild type CIC in IDH1-R132H background. Levels of phosphorylated ATP-citrate Lyase (ACLY) were lower in cell lines expressing mutant CIC-S proteins compared to cells expressing wild type CIC-S, supporting a cytosolic citrate metabolism-related mechanism of reduced clonogenicity in our in vitro model systems. ACLY or phospho-ACLY were similarly reduced in CIC-mutant 1p19q co-deleted oligodendroglioma patient samples. PMID:25277207
Ritt, Jean-François; Raymond, Frédéric; Leprohon, Philippe; Légaré, Danielle; Corbeil, Jacques; Ouellette, Marc
2013-01-01
Background The human protozoan parasites Leishmania are prototrophic for pyrimidines with the ability of both de novo biosynthesis and uptake of pyrimidines. Methodology/Principal Findings Five independent L. infantum mutants were selected for resistance to the pyrimidine analogue 5-fluorouracil (5-FU) in the hope to better understand the metabolism of pyrimidine in Leishmania. Analysis of the 5-FU mutants by comparative genomic hybridization and whole genome sequencing revealed in selected mutants the amplification of DHFR-TS and a deletion of part of chromosome 10. Point mutations in uracil phosphorybosyl transferase (UPRT), thymidine kinase (TK) and uridine phosphorylase (UP) were also observed in three individual resistant mutants. Transfection experiments confirmed that these point mutations were responsible for 5-FU resistance. Transport studies revealed that one resistant mutant was defective for uracil and 5-FU import. Conclusion/Significance This study provided further insights in pyrimidine metabolism in Leishmania and confirmed that multiple mutations can co-exist and lead to resistance in Leishmania. PMID:24278495
Xie, Dongfang; Lv, Changjiang; Fang, Hui; Yang, Weikang; Hu, Sheng; Zhao, Weirui; Huang, Jun; Mei, Lehe
2017-12-25
Chiral amines are important building blocks for the synthesis of pharmaceutical products and fine chemicals. Highly stereoselective synthesis of chiral amines compounds through asymmetric amination has attracted more and more attention. ω-transaminases (ω-TAs) are a promising class of natural biocatalysts which provide an efficient and environment-friendly access to production of chiral amines with stringent enantioselectivity and excellent catalytic efficiency. Compared with (S)-ω-TA, the research focused on (R)-ω-TA was relatively less. However, increasing demand for chiral (R)-amines as pharmaceutical intermediates has rendered industrial applications of (R)-ω-TA more attractive. Improving the thermostability of (R)-ω-TA with potential biotechnological application will facilitate the preparation of chiral amines. In this study, the dynamic surface loop with higher B-factor from Aspergillus terreus (R)-ω-TA was predicted by two computer softwares (PyMOL and YASARA). Then mutant enzymes were obtained by deleting amino acid residues of a dynamic surface loop using site-directed mutagenesis. The results showed that the best two mutants R131del and P132-E133del improved thermostability by 2.6 ℃ and 0.9 ℃ in T₅₀¹⁰ (41.1 ℃ and 39.4 ℃, respectively), and 2.2-fold and 1.5-fold in half-life (t1/2) at 40 ℃ (15.0 min and 10.0 min, respectively), compared to that of wild type. Furtherly, the thermostability mechanism of the mutant enzymes was investigated by molecular dynamics (MD) simulation and intermolecular interaction analysis. R131del in the loop region has lower root mean square fluctuation (RMSF) than the wild type at 400 K for 10 ns, and mutant enzyme P132-E133del increases four hydrogen bonds in the loop region. In this study, we obtain two stability-increased mutants of (R)-ω-TA from A. terreus by deleting its dynamic surface loop and also provide methodological guidance for the use of rational design to enhance the thermal stability of other enzymes.
A Homozygous Nme7 Mutation Is Associated with Situs Inversus Totalis.
Reish, Orit; Aspit, Liam; Zouella, Arielle; Roth, Yehudah; Polak-Charcon, Sylvie; Baboushkin, Tatiana; Benyamini, Lilach; Scheetz, Todd E; Mussaffi, Huda; Sheffield, Val C; Parvari, Ruti
2016-08-01
We investigated the cause of situs inversus totalis (SIT) in two siblings from a consanguineous family. Genotyping and whole-exome analysis revealed a homozygous change in NME7, resulting in deletion of an exon causing an in-frame deletion of 34 amino acids located in the second NDK domain of the protein and segregated with the defective lateralization in the family. NME7 is an important developmental gene, and NME7 protein is a component of the γ-tubulin ring complex. This mutation is predicted to affect the interaction of NME7 protein with this complex as it deletes the amino acids crucial for the binding. SIT associated with homozygous deletion in our patients is in line with Nme7(-/-) mutant mice phenotypes consisting of congenital hydrocephalus and SIT, indicating a novel human laterality patterning role for NME7. Further cases are required to elaborate the full human phenotype associated with NME7 mutations. © 2016 WILEY PERIODICALS, INC.
Fraenkel, D. G.; Banerjee, Santimoy
1972-01-01
Genes for three enzymes of intermediary sugar metabolism in E. coli, zwf (glucose 6-phosphate dehydrogenase, constitutive), edd (gluconate 6-phosphate dehydrase, inducible), and eda (2-keto-3-deoxygluconate 6-phosphate aldolase, differently inducible) are closely linked on the E. coli genetic map, the overall gene order being man... old... eda. edd. zwf... cheB... uvrC... his. One class of apparent revertants of an eda mutant strain contains a secondary mutation in edd, and some of these mutations are deletions extending into zwf. We have used a series of spontaneous edd-zwf deletions to map a series of point mutants in zwf and thus report the first fine structure map of a gene for a constitutive enzyme (zwf). PMID:4560065
Hu, Jin; You, Wujin; Wang, Bin; Hu, Xueying; Tan, Chen; Liu, Jinlin; Chen, Huanchun; Bei, Weicheng
2015-01-01
Streptococcus suis serotype 2 (S. suis 2) causes sepsis and meningitis in piglets and humans, and results in one of the most serious bacterial diseases affecting the production of commercial pigs around the world. Due to the failure of the current inactivated vaccine to protect against the disease, development of a new attenuated live vaccine against S. suis 2 by deleting essential virulence factors is urgently needed. We have previously reported the construction and characterization of an SsPep single gene deletion mutant strain ΔSsPep based on S. suis 2. Our previous results have shown that SsPep plays a critical role in the pathogenesis of S. suis 2. In this study, a precisely defined double-deletion mutant ΔSsPep/ΔSsPspC of S. suis 2 without antibiotic-resistance markers was constructed based on ΔSsPep, and the levels of virulence of the wild-type (WT) and ΔSsPep/ΔSsPspC were compared in a mouse experimental infection model. We demonstrated that the double mutant ΔSsPep/ΔSsPspC was less virulent than the WT, and could induce a noticeable antibody response. Analysis of IgG subclasses (IgG1 and IgG2a) indicated that both Th1 and Th2 responses were induced by ΔSsPep/ΔSsPspC, although the IgG2a (Th1) response predominated over the IgG1 (Th2) response. Moreover, ΔSsPep/ΔSsPspC could confer 90% protective efficacy against challenge with a lethal dose of fully virulent S. suis 2. Taken together, these data demonstrate that ΔSsPep/ΔSsPspC can be used as an effective live vaccine and provide a novel strategy against infection of S. suis 2. Copyright © 2014 Elsevier GmbH. All rights reserved.
Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang
2018-01-01
Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how this knowledge can be used to engineer the isomeric composition and the chain lengths of the olefins produced by this organism.
Molecular Determinants of Sporulation in Ashbya gossypii
Wasserstrom, Lisa; Lengeler, Klaus B.; Walther, Andrea; Wendland, Jürgen
2013-01-01
Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants sporulation is severely reduced, while deletion of KAR4 as well as of homologs of central Saccharomyces cerevisiae regulators of sporulation, IME1, IME2, IME4, and NDT80, abolishes sporulation in A. gossypii. Comparison of RNAseq transcript profiles of sporulation-deficient mutants identified a set of 67 down-regulated genes, most of which were up-regulated in the oversporulating ste12 mutant. One of these differentially expressed genes is an endoglucanase encoded by ENG2. We found that Eng2p promotes hyphal fragmentation as part of the developmental program of sporulation, which generates single-celled sporangia. Sporulation-deficient strains are arrested in their development but form sporangia. Supply of new nutrients enabled sporangia to return to hyphal growth, indicating that these cells are not locked in meiosis. Double-strand break (DSB) formation by Spo11 is apparently not required for sporulation; however, the absence of DMC1, which repairs DSBs in S. cerevisiae, results in very poor sporulation in A. gossypii. We present a comprehensive analysis of the gene repertoire governing sporulation in A. gossypii and suggest an altered regulation of IME1 expression compared to S. cerevisiae. PMID:23833180
Molecular determinants of sporulation in Ashbya gossypii.
Wasserstrom, Lisa; Lengeler, Klaus B; Walther, Andrea; Wendland, Jürgen
2013-09-01
Regulation of development and entry into sporulation is critical for fungi to ensure survival of unfavorable environmental conditions. Here we present an analysis of gene sets regulating sporulation in the homothallic ascomycete Ashbya gossypii. Deletion of components of the conserved pheromone/starvation MAP kinase cascades, e.g., STE11 and STE7, results in increased sporulation. In kar3 mutants sporulation is severely reduced, while deletion of KAR4 as well as of homologs of central Saccharomyces cerevisiae regulators of sporulation, IME1, IME2, IME4, and NDT80, abolishes sporulation in A. gossypii. Comparison of RNAseq transcript profiles of sporulation-deficient mutants identified a set of 67 down-regulated genes, most of which were up-regulated in the oversporulating ste12 mutant. One of these differentially expressed genes is an endoglucanase encoded by ENG2. We found that Eng2p promotes hyphal fragmentation as part of the developmental program of sporulation, which generates single-celled sporangia. Sporulation-deficient strains are arrested in their development but form sporangia. Supply of new nutrients enabled sporangia to return to hyphal growth, indicating that these cells are not locked in meiosis. Double-strand break (DSB) formation by Spo11 is apparently not required for sporulation; however, the absence of DMC1, which repairs DSBs in S. cerevisiae, results in very poor sporulation in A. gossypii. We present a comprehensive analysis of the gene repertoire governing sporulation in A. gossypii and suggest an altered regulation of IME1 expression compared to S. cerevisiae.
Zebrafish foxP2 Zinc Finger Nuclease Mutant Has Normal Axon Pathfinding
Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J.; Fujimoto, Esther; Quist, Tyler S.; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J.; Bonkowsky, Joshua L.
2012-01-01
foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2nd coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development. PMID:22937139
Zebrafish foxP2 zinc finger nuclease mutant has normal axon pathfinding.
Xing, Lingyan; Hoshijima, Kazuyuki; Grunwald, David J; Fujimoto, Esther; Quist, Tyler S; Sneddon, Jacob; Chien, Chi-Bin; Stevenson, Tamara J; Bonkowsky, Joshua L
2012-01-01
foxP2, a forkhead-domain transcription factor, is critical for speech and language development in humans, but its role in the establishment of CNS connectivity is unclear. While in vitro studies have identified axon guidance molecules as targets of foxP2 regulation, and cell culture assays suggest a role for foxP2 in neurite outgrowth, in vivo studies have been lacking regarding a role for foxP2 in axon pathfinding. We used a modified zinc finger nuclease methodology to generate mutations in the zebrafish foxP2 gene. Using PCR-based high resolution melt curve analysis (HRMA) of G0 founder animals, we screened and identified three mutants carrying nonsense mutations in the 2(nd) coding exon: a 17 base-pair (bp) deletion, an 8bp deletion, and a 4bp insertion. Sequence analysis of cDNA confirmed that these were frameshift mutations with predicted early protein truncations. Homozygous mutant fish were viable and fertile, with unchanged body morphology, and no apparent differences in CNS apoptosis, proliferation, or patterning at embryonic stages. There was a reduction in expression of the known foxP2 target gene cntnap2 that was rescued by injection of wild-type foxP2 transcript. When we examined axon pathfinding using a pan-axonal marker or transgenic lines, including a foxP2-neuron-specific enhancer, we did not observe any axon guidance errors. Our findings suggest that foxP2 is not necessary for axon pathfinding during development.
Marchesini, María Inés; Connolly, Joseph; Delpino, María Victoria; Baldi, Pablo C.; Mujer, Cesar V.; DelVecchio, Vito G.; Comerci, Diego J.
2011-01-01
Choloylglycine hydrolase (CGH, E.C. 3.5.1.24) is a conjugated bile salt hydrolase that catalyses the hydrolysis of the amide bond in conjugated bile acids. Bile salt hydrolases are expressed by gastrointestinal bacteria, and they presumably decrease the toxicity of host's conjugated bile salts. Brucella species are the causative agents of brucellosis, a disease affecting livestock and humans. CGH confers Brucella the ability to deconjugate and resist the antimicrobial action of bile salts, contributing to the establishment of a successful infection through the oral route in mice. Additionally, cgh-deletion mutant was also attenuated in intraperitoneally inoculated mice, which suggests that CGH may play a role during systemic infection other than hydrolyzing conjugated bile acids. To understand the role CGH plays in B. abortus virulence, we infected phagocytic and epithelial cells with a cgh-deletion mutant (Δcgh) and found that it is defective in the internalization process. This defect along with the increased resistance of Δcgh to the antimicrobial action of polymyxin B, prompted an analysis of the cell envelope of this mutant. Two-dimensional electrophoretic profiles of Δcgh cell envelope-associated proteins showed an altered expression of Omp2b and different members of the Omp25/31 family. These results were confirmed by Western blot analysis with monoclonal antibodies. Altogether, the results indicate that Brucella CGH not only participates in deconjugation of bile salts but also affects overall membrane composition and host cell internalization. PMID:22174816
Marchesini, María Inés; Connolly, Joseph; Delpino, María Victoria; Baldi, Pablo C; Mujer, Cesar V; DelVecchio, Vito G; Comerci, Diego J
2011-01-01
Choloylglycine hydrolase (CGH, E.C. 3.5.1.24) is a conjugated bile salt hydrolase that catalyses the hydrolysis of the amide bond in conjugated bile acids. Bile salt hydrolases are expressed by gastrointestinal bacteria, and they presumably decrease the toxicity of host's conjugated bile salts. Brucella species are the causative agents of brucellosis, a disease affecting livestock and humans. CGH confers Brucella the ability to deconjugate and resist the antimicrobial action of bile salts, contributing to the establishment of a successful infection through the oral route in mice. Additionally, cgh-deletion mutant was also attenuated in intraperitoneally inoculated mice, which suggests that CGH may play a role during systemic infection other than hydrolyzing conjugated bile acids. To understand the role CGH plays in B. abortus virulence, we infected phagocytic and epithelial cells with a cgh-deletion mutant (Δcgh) and found that it is defective in the internalization process. This defect along with the increased resistance of Δcgh to the antimicrobial action of polymyxin B, prompted an analysis of the cell envelope of this mutant. Two-dimensional electrophoretic profiles of Δcgh cell envelope-associated proteins showed an altered expression of Omp2b and different members of the Omp25/31 family. These results were confirmed by Western blot analysis with monoclonal antibodies. Altogether, the results indicate that Brucella CGH not only participates in deconjugation of bile salts but also affects overall membrane composition and host cell internalization.
Crane, Jonathan M.; Verkman, Alan S.
2009-01-01
Summary We investigated the molecular determinants of aquaporin-4 (AQP4) assembly in orthogonal arrays of particles (OAPs) by visualizing fluorescently labeled AQP4 mutants in cell membranes using quantum-dot single-particle tracking and total internal reflection fluorescence microscopy. The full-length `long' (M1) form of AQP4 diffused freely in membranes and did not form OAPs, whereas the `short' (M23) form of AQP4 formed OAPs and was nearly immobile. Analysis of AQP4 deletion mutants revealed progressive disruption of OAPs by the addition of three to seven residues at the AQP4-M23 N-terminus, with polyalanines as effective as native AQP4 fragments. OAPs disappeared upon downstream deletions of AQP4-M23, which, from analysis of point mutants, involves N-terminus interactions of residues Val24, Ala25 and Phe26. OAP formation was also prevented by introducing proline residues at sites just downstream from the hydrophobic N-terminus of AQP4-M23. AQP1, an AQP4 homolog that does not form OAPs, was induced to form OAPs upon replacement of its N-terminal domain with that of AQP4-M23. Our results indicate that OAP formation by AQP4-M23 is stabilized by hydrophobic intermolecular interactions involving N-terminus residues, and that absence of OAPs in AQP4-M1 results from non-selective blocking of this interaction by seven residues just upstream from Met23. PMID:19240114
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Eun-Gyung; Linial, Maxine L.
2006-03-30
The Rous sarcoma virus (RSV) Gag polyprotein is the only protein required for virus assembly and release. We previously found that deletion of either one of the two Cys-His (CH) motifs in the RSV nucleocapsid (NC) protein did not abrogate Gag-Gag interactions, RNA binding, or packaging but greatly reduced virus production (E-G. Lee, A. Alidina et al., J. Virol. 77: 2010-2020, 2003). In this report, we have further investigated the effects of mutations in the CH motifs on virus assembly and release. Precise deletion of either CH motif, without affecting surrounding basic residues, reduced virus production by approximately 10-fold, similarmore » to levels seen for late (L) domain mutants. Strikingly, transmission electron microscopy revealed that virions of both {delta}CH1 and {delta}CH2 mutants were assembled normally at the plasma membrane but were arrested in budding. Virus particles remained tethered to the membrane or to each other, reminiscent of L domain mutants, although the release defect appears to be independent of the L domain functions. Therefore, two CH motifs are likely to be required for budding independent of a requirement for either Gag-Gag interactions or RNA packaging.« less
Nanamiya, H; Ohashi, Y; Asai, K; Moriya, S; Ogasawara, N; Fujita, M; Sadaie, Y; Kawamura, F
1998-07-01
Using a strain carrying a clpC-bgaB transcriptional fusion at the amyE locus, we found that the expression of a clpC operon was induced at the end of exponential growth in a sigmaB-independent manner and ceased around T3.5 in the wild type but not in a spo0H mutant. This suggests that some gene product(s) whose expression is dependent on sigmaH function is required for the turn-off of clpC transcription during an early stage of sporulation. A clpC deletion mutant showed a temperature-sensitive sporulation phenotype and exhibited an abnormally large accumulation of sigmaH in the cell at 45 degrees C after T2, at which time the sigmaH level in the wild type had begun to decrease. These results, together with the fact that spo0H transcription in the clpC deletion mutant was similar to that of the wild type, suggested that ClpC may be responsible for the degradation of sigmaH after the accomplishment of its role in sporulation. Moreover, as expected from these results, overproduction of Spo0A was also observed after the initiation of sporulation in the clpC deletion mutant at 45 degrees C.
Structure and biosynthesis of two exopolysaccharides produced by Lactobacillus johnsonii FI9785.
Dertli, Enes; Colquhoun, Ian J; Gunning, A Patrick; Bongaerts, Roy J; Le Gall, Gwénaëlle; Bonev, Boyan B; Mayer, Melinda J; Narbad, Arjan
2013-11-01
Exopolysaccharides were isolated and purified from Lactobacillus johnsonii FI9785, which has previously been shown to act as a competitive exclusion agent to control Clostridium perfringens in poultry. Structural analysis by NMR spectroscopy revealed that L. johnsonii FI9785 can produce two types of exopolysaccharide: EPS-1 is a branched dextran with the unusual feature that every backbone residue is substituted with a 2-linked glucose unit, and EPS-2 was shown to have a repeating unit with the following structure: -6)-α-Glcp-(1-3)-β-Glcp-(1-5)-β-Galf-(1-6)-α-Glcp-(1-4)-β-Galp-(1-4)-β-Glcp-(1-. Sites on both polysaccharides were partially occupied by substituent groups: 1-phosphoglycerol and O-acetyl groups in EPS-1 and a single O-acetyl group in EPS-2. Analysis of a deletion mutant (ΔepsE) lacking the putative priming glycosyltransferase gene located within a predicted eps gene cluster revealed that the mutant could produce EPS-1 but not EPS-2, indicating that epsE is essential for the biosynthesis of EPS-2. Atomic force microscopy confirmed the localization of galactose residues on the exterior of wild type cells and their absence in the ΔepsE mutant. EPS2 was found to adopt a random coil structural conformation. Deletion of the entire 14-kb eps cluster resulted in an acapsular mutant phenotype that was not able to produce either EPS-2 or EPS-1. Alterations in the cell surface properties of the EPS-specific mutants were demonstrated by differences in binding of an anti-wild type L. johnsonii antibody. These findings provide insights into the biosynthesis and structures of novel exopolysaccharides produced by L. johnsonii FI9785, which are likely to play an important role in biofilm formation, protection against harsh environment of the gut, and colonization of the host.
Wang, Ming-yi; Chen, Cheng; Shao, Chen; Wang, Shao-bo; Wang, Ai-chu; Yang, Ya-chao; Yuan, Xiao-yan; Shao, Shi-he
2015-04-01
The function of intact long-type DupA protein in Helicobacter pylori was analyzed using immunoblotting and molecular biology techniques in the study. After cloning, expression and purification, ATPase activity of DupA protein was detected. Antibody was produced for localization and interaction proteins analysis. The dupA-deleted mutant was generated for adhesion and CagA protein translocation assay, susceptibility to different pH, IL-8 secretion assay, cytotoxicity to MKN-45 cells and proteins-involved apoptosis analysis. DupA protein exhibited an ATPase activity (129.5±17.8 U/mgprot) and located in bacterial membrane, while it did not involve the adhesion and CagA protein delivery of H. pylori. DupA protein involved the urease secretion as the interaction proteins. The wild type strain had a stronger growth in low pH than the dupA-deleted mutant (p < 0.001). IL-8 productions from GES-1 cells infected with the wild type strain were significantly higher than from those with the mutant (p < 0.001). The amounts of vital MKN-45 cells were decreased and the numbers of apoptotic cells were increased with the wild type strain, compared to those with the mutant after 12 h (p < 0.05). The increase of cleaved Caspase-3 and Bax was significantly higher and the decrease of Bcl-2 was more obvious in MKN-45 cells exposed to the wild type strain than that exposed to the mutant after 6 h. We demonstrate that intact long-type DupA protein located in membrane as ATPase is a true virulence factor associated with duodenal ulcer development involving the IL-8 induction and urease secretion, while it inhibits gastric cancer cell growth in vitro by activating the mitochondria-mediated apoptotic pathway. Copyright © 2015 Elsevier Ltd. All rights reserved.
Structure and Biosynthesis of Two Exopolysaccharides Produced by Lactobacillus johnsonii FI9785*
Dertli, Enes; Colquhoun, Ian J.; Gunning, A. Patrick; Bongaerts, Roy J.; Le Gall, Gwénaëlle; Bonev, Boyan B.; Mayer, Melinda J.; Narbad, Arjan
2013-01-01
Exopolysaccharides were isolated and purified from Lactobacillus johnsonii FI9785, which has previously been shown to act as a competitive exclusion agent to control Clostridium perfringens in poultry. Structural analysis by NMR spectroscopy revealed that L. johnsonii FI9785 can produce two types of exopolysaccharide: EPS-1 is a branched dextran with the unusual feature that every backbone residue is substituted with a 2-linked glucose unit, and EPS-2 was shown to have a repeating unit with the following structure: -6)-α-Glcp-(1–3)-β-Glcp-(1–5)-β-Galf-(1–6)-α-Glcp-(1–4)-β-Galp-(1–4)-β-Glcp-(1-. Sites on both polysaccharides were partially occupied by substituent groups: 1-phosphoglycerol and O-acetyl groups in EPS-1 and a single O-acetyl group in EPS-2. Analysis of a deletion mutant (ΔepsE) lacking the putative priming glycosyltransferase gene located within a predicted eps gene cluster revealed that the mutant could produce EPS-1 but not EPS-2, indicating that epsE is essential for the biosynthesis of EPS-2. Atomic force microscopy confirmed the localization of galactose residues on the exterior of wild type cells and their absence in the ΔepsE mutant. EPS2 was found to adopt a random coil structural conformation. Deletion of the entire 14-kb eps cluster resulted in an acapsular mutant phenotype that was not able to produce either EPS-2 or EPS-1. Alterations in the cell surface properties of the EPS-specific mutants were demonstrated by differences in binding of an anti-wild type L. johnsonii antibody. These findings provide insights into the biosynthesis and structures of novel exopolysaccharides produced by L. johnsonii FI9785, which are likely to play an important role in biofilm formation, protection against harsh environment of the gut, and colonization of the host. PMID:24019531
Molon, Mateusz; Zadrag-Tecza, Renata; Bilinski, Tomasz
2015-05-08
Longevity of the selected "longevity mutants" of yeast was studied using two methods. The standard method was based on counting the number of daughter cells produced. Modification of that method allowed for establishing the length of life expressed in units of time. It appeared that all the studied "deletion longevity mutants" showed a statistically meaningful increase in the number of daughters produced (replicative lifespan), whereas only one of the mutants, previously regarded as "short lived", showed a meaningful increase in the time of life. The analysis of the available data shows that the time of life of most yeast strains is similar irrespective of their genetic background and mutations, which suggests a quasi-programmed nature of yeast death. Copyright © 2015 Elsevier Inc. All rights reserved.
Wang, Q; Liu, Q; Ma, Y; Rui, H; Zhang, Y
2007-11-01
To characterize the luxO gene in fish pathogen Vibrio alginolyticus MVP01 and investigate its roles in regulation of extracellular products (ECP) and siderophore production. The luxO gene was cloned from V. alginolyticus MVP01. Genetic analysis revealed that it encoded a protein with high similarity to other LuxO homologues. The luxO in-frame deletion mutant and rpoN null mutant were constructed with suicide plasmids. We demonstrated that sole deletion in LuxO increased the secretion of extracellular protease and haemolytic products, but decreased siderophore production for V. alginolyticus MVP01. Mutants with null rpoN displayed significantly enhanced protease level and siderophore production while notable reduction in haemolytic activities of ECP. Vibrio alginolyticus harbours functional luxO gene that regulates the secretion of extracellular protease and haemolytic materials as well as siderophore production in either sigma(54) dependent or independent manners. The current study demonstrated that V. alginolyticus MVP01 produces extracellular protease and haemolytic activity material as well as siderophore, which may be characteristics of the virulence of the strain. Revelations that secretion of these products is under the regulation of LuxO and sigma(54) as well as the potential quorum sensing systems in V. alginolyticus MVP01 will expedite the understanding of vibriosis pathogenesis.
Lowenthal, Andrew C.; Simon, Christopher; Fair, Amber S.; Mehmood, Khalid; Terry, Karianne; Anastasia, Stephanie; Ottemann, Karen M.
2009-01-01
Helicobacter pylori is a chemotactic bacterium that has three CheV proteins in its predicted chemotaxis signal transduction system. CheV proteins contain both CheW- and response-regulator-like domains. To determine the function of these proteins, we developed a fixed-time diffusion method that would quantify bacterial direction change without needing to define particular behaviours, to deal with the many behaviours that swimming H. pylori exhibit. We then analysed mutants that had each cheV gene deleted individually and found that the behaviour of each mutant differed substantially from wild-type and the other mutants. cheV1 and cheV2 mutants displayed smooth swimming behaviour, consistent with decreased cellular CheY-P, similar to a cheW mutant. In contrast, the cheV3 mutation had the opposite effect and the mutant cells appeared to change direction frequently. Additional analysis showed that the cheV mutants displayed aberrant behaviour as compared to the wild-type in the soft-agar chemotaxis assay. The soft-agar assay phenotype was less extreme compared to that seen in the fixed-time diffusion model, suggesting that the cheV mutants are able to partially compensate for their defects under some conditions. Each cheV mutant furthermore had defects in mouse colonization that ranged from severe to modest, consistent with a role in chemotaxis. These studies thus show that the H. pylori CheV proteins each differently affect swimming behaviour. PMID:19332820
Ando, Akira; Tanaka, Fumiko; Murata, Yoshinori; Takagi, Hiroshi; Shima, Jun
2006-03-01
Yeasts used in bread making are exposed to high concentrations of sucrose during sweet dough fermentation. Despite its importance, tolerance to high-sucrose stress is poorly understood at the gene level. To clarify the genes required for tolerance to high-sucrose stress, genome-wide screening was undertaken using the complete deletion strain collection of diploid Saccharomyces cerevisiae. The screening identified 273 deletions that yielded high sucrose sensitivity, approximately 20 of which were previously uncharacterized. These 273 deleted genes were classified based on their cellular function and localization of their gene products. Cross-sensitivity of the high-sucrose-sensitive mutants to high concentrations of NaCl and sorbitol was studied. Among the 273 sucrose-sensitive deletion mutants, 269 showed cross-sensitivities to sorbitol or NaCl, and four (i.e. ade5,7, ade6, ade8, and pde2) were specifically sensitive to high sucrose. The general stress response pathways via high-osmolarity glycerol and stress response element pathways and the function of the invertase in the ade mutants were similar to those in the wild-type strain. In the presence of high-sucrose stress, intracellular contents of ATP in ade mutants were at least twofold lower than that of the wild-type cells, suggesting that depletion of ATP is a factor in sensitivity to high-sucrose stress. The genes identified in this study might be important for tolerance to high-sucrose stress, and therefore should be target genes in future research into molecular modification for breeding of yeast tolerant to high-sucrose stress.
Son, Moonil; Lee, Kyung-Mi; Yu, Jisuk; Kang, Minji; Park, Jin Man; Kwon, Sun-Jung
2013-01-01
The accumulation of viral RNA depends on many host cellular factors. The hexagonal peroxisome (Hex1) protein is a fungal protein that is highly expressed when the DK21 strain of Fusarium graminearum virus 1 (FgV1) infects its host, and Hex1 affects the accumulation of FgV1 RNA. The Hex1 protein is the major constituent of the Woronin body (WB), which is a peroxisome-derived electron-dense core organelle that seals the septal pore in response to hyphal wounding. To clarify the role of Hex1 and the WB in the relationship between FgV1 and Fusarium graminearum, we generated targeted gene deletion and overexpression mutants. Although neither HEX1 gene deletion nor overexpression substantially affected vegetative growth, both changes reduced the production of asexual spores and reduced virulence on wheat spikelets in the absence of FgV1 infection. However, the vegetative growth of deletion and overexpression mutants was increased and decreased, respectively, upon FgV1 infection compared to that of an FgV1-infected wild-type isolate. Viral RNA accumulation was significantly decreased in deletion mutants but was significantly increased in overexpression mutants compared to the viral RNA accumulation in the virus-infected wild-type control. Overall, these data indicate that the HEX1 gene plays a direct role in the asexual reproduction and virulence of F. graminearum and facilitates viral RNA accumulation in the FgV1-infected host fungus. PMID:23864619
Guo, Haiyong; Hall, Jeffrey W.; Yang, Junshu; Ji, Yinduo
2017-01-01
The SaeRS two-component system plays important roles in regulation of key virulence factors and pathogenicity. In this study, however, we found that the deletion mutation of saeRS enhanced bacterial survival in human blood, whereas complementation of the mutant with SaeRS returned survival to wild-type levels. Moreover, these phenomena were observed in different MRSA genetic background isolates, including HA-MRSA WCUH29, CA-MRSA 923, and MW2. To elucidate which gene(s) regulated by SaeRS contribute to the effect, we conducted a series of complementation studies with selected known SaeRS target genes in trans. We found coagulase complementation abolished the enhanced survival of the SaeRS mutant in human blood. The coa and saeRS deletion mutants exhibited a similar survival phenotype in blood. Intriguingly, heterologous expression of coagulase decreased survival of S. epidermidis in human blood. Further, the addition of recombinant coagulase to blood significantly decreased the survival of S. aureus. Further, analysis revealed staphylococcal resistance to killing by hydrogen peroxide was partially dependent on the presence or absence of coagulase. Furthermore, complementation with coagulase, but not SaeRS, returned saeRS/coa double mutant survival in blood to wild-type levels. These data indicate SaeRS modulates bacterial survival in blood in coagulase-dependent manner. Our results provide new insights into the role of staphylococcal SaeRS and coagulase on bacterial survival in human blood. PMID:28611950
Shin, Kwang-Soo; Park, Hee-Soo; Kim, Young; Heo, In-Beom; Kim, Young Hwan; Yu, Jae-Hyuk
2016-10-04
Aspergillus fumigatus reproduces and infects host by forming a high number of small asexual spores (conidia). The velvet proteins are global transcriptional regulators governing the complex process of conidiogenesis in this fungus. Here, to further understand the velvet-mediated regulation, we carried out comparative proteomic analyses of conidia of wild type (WT) and three velvet mutants (ΔveA, ΔvelB and ΔvosA). Cluster analysis of 184 protein spots showing at least 1.5-fold differential accumulation between WT and mutants reveal the clustering of WT- ΔveA and ΔvelB-ΔvosA. Among 43 proteins identified by Nano-LC-ESI-MS/MS, 23 including several heat shock proteins showed more than two-fold reduction in both the ∆velB and ∆vosA conidia. On the contrary, three proteins exhibited more than five-fold increase in ∆veA only, including the putative RNA polymerase II degradation factor DefA. The deletion of defA resulted in a reduced number of conidia and restricted colony growth. In addition, the defA deletion mutant conidia showed hypersensitivity against the DNA damaging agents NQO and MMS, while the ΔveA mutant conidia were more resistant against to NQO. Taken together, we propose that VeA controls protein level of DefA in conidia, which are dormant and equipped with multiple layers of protection against environmental cues. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Zhang, Xiaolin; Li, Nan; Qin, Ting; Huang, Bei; Nie, Pin
2017-11-01
Flavobacterium columnare is the pathogenic agent of columnaris disease in aquaculture. Using a recently developed gene deletion strategy, two genes that encode the Glyco_hydro_19 domain (GH19 domain) containing proteins, ghd-1 and ghd-2, were deleted separately and together from the F. columnare G4 wild type strain. Surprisingly, the single-, Δ ghd-1 and Δ ghd-2, and double-gene mutants, Δ ghd-1 Δghd -2, all had rhizoid and non-rhizoid colony morphotypes, which we named Δ ghd-1, Δ ghd-2, Δ ghd-1 Δ ghd-2, and NΔ ghd-1, NΔ ghd-2, and NΔ ghd-1 Δ ghd-2. However, chitin utilization was not detected in either these mutants or in the wild type. Instead, skimmed milk degradation was observed for the mutants and the wild type; the non-rhizoid strain NΔ ghd-2 exhibited higher degradation activity as revealed by the larger transparent circle on the skimmed milk plate. Using zebrafish as the model organism, we found that non-rhizoid mutants had higher LD50 values and were less virulent because zebrafish infected with these survived longer. Transcriptome analysis between the non-rhizoid and rhizoid colony morphotypes of each mutant, i.e., NΔ ghd -1 versus (vs) Δ ghd-1, NΔ ghd-2 vs Δ ghd-2, and NΔ ghd-1 Δ ghd-2 vs Δ ghd-1 Δ ghd-2, revealed a large number of differentially expressed genes, among which 39 genes were common in three of the pairs compared. Although most of these genes encode hypothetical proteins, a few molecules such as phage tail protein, rhs element Vgr protein, thiol-activated cytolysin, and TonB-dependent outer membrane receptor precursor, expression of which was down-regulated in non-rhizoid mutants but up-regulated in rhizoid mutants, may play a role F. columnare virulence.
Carrión, Javier; Folgueira, Cristina; Soto, Manuel; Fresno, Manuel; Requena, Jose M
2011-07-27
Visceral leishmaniasis is the most severe form of leishmaniasis and no effective vaccine exists. The use of live attenuated vaccines is emerging as a promising vaccination strategy. In this study, we tested the ability of a Leishmania infantum deletion mutant, lacking both HSP70-II alleles (ΔHSP70-II), to provide protection against Leishmania infection in the L. major-BALB/c infection model. Administration of the mutant line by either intraperitoneal, intravenous or subcutaneous route invariably leads to the production of high levels of NO and the development in mice of type 1 immune responses, as determined by analysis of anti-Leishmania IgG subclasses. In addition, we have shown that ΔHSP70-II would be a safe live vaccine as immunodeficient SCID mice, and hamsters (Mesocricetus auratus), infected with mutant parasites did not develop any sign of pathology. The results suggest that the ΔHSP70-II mutant is a promising and safe vaccine, but further studies in more appropriate animal models (hamsters and dogs) are needed to appraise whether this attenuate mutant would be useful as vaccine against visceral leishmaniasis.
Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F
2014-01-01
Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.
Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.
2014-01-01
Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259
Overlap of copper and iron uptake systems in mitochondria in Saccharomyces cerevisiae
Wang, Jing; Gammon, Micah G.; Maynard, Margaret K.; White, Olivia L.; Cobine, Jai A.; Mahone, Wilkerson K.
2016-01-01
In Saccharomyces cerevisiae, the mitochondrial carrier family protein Pic2 imports copper into the matrix. Deletion of PIC2 causes defects in mitochondrial copper uptake and copper-dependent growth phenotypes owing to decreased cytochrome c oxidase activity. However, copper import is not completely eliminated in this mutant, so alternative transport systems must exist. Deletion of MRS3, a component of the iron import machinery, also causes a copper-dependent growth defect on non-fermentable carbon. Deletion of both PIC2 and MRS3 led to a more severe respiratory growth defect than either individual mutant. In addition, MRS3 expressed from a high copy number vector was able to suppress the oxygen consumption and copper uptake defects of a strain lacking PIC2. When expressed in Lactococcus lactis, Mrs3 mediated copper and iron import. Finally, a PIC2 and MRS3 double mutant prevented the copper-dependent activation of a heterologously expressed copper sensor in the mitochondrial intermembrane space. Taken together, these data support a role for the iron transporter Mrs3 in copper import into the mitochondrial matrix. PMID:26763345
Osmond, B C; Specht, C A; Robbins, P W
1999-09-28
We screened Saccharomyces strains for mutants that are synthetically lethal with deletion of the major chitin synthase gene CHS3. In addition to finding, not surprisingly, that mutations in major cell wall-related genes such as FKS1 (glucan synthase) and mutations in any of the Golgi glycosylation complex genes (MNN9 family) are lethal in combination with chs3Delta, we found that a mutation in Srv2p, a bifunctional regulatory gene, is notably lethal in the chs3 deletion. In extending studies of fks1-chitin synthase 3 interactions, we made the surprising discovery that deletion of CSD3/CHS6, a gene normally required for Chs3p delivery and activity in vivo, was not lethal with fks1 and, in fact, that lack of Csd3p/Chs6p did not decrease the high level of stress-related chitin made in the fks1 mutant. This finding suggests that "stress response" chitin synthesis proceeds through an alternate Chs3p targeting pathway.
Osmond, Barbara C.; Specht, Charles A.; Robbins, Phillips W.
1999-01-01
We screened Saccharomyces strains for mutants that are synthetically lethal with deletion of the major chitin synthase gene CHS3. In addition to finding, not surprisingly, that mutations in major cell wall-related genes such as FKS1 (glucan synthase) and mutations in any of the Golgi glycosylation complex genes (MNN9 family) are lethal in combination with chs3Δ, we found that a mutation in Srv2p, a bifunctional regulatory gene, is notably lethal in the chs3 deletion. In extending studies of fks1-chitin synthase 3 interactions, we made the surprising discovery that deletion of CSD3/CHS6, a gene normally required for Chs3p delivery and activity in vivo, was not lethal with fks1 and, in fact, that lack of Csd3p/Chs6p did not decrease the high level of stress-related chitin made in the fks1 mutant. This finding suggests that “stress response” chitin synthesis proceeds through an alternate Chs3p targeting pathway. PMID:10500155
Soh, Sheila X; Siddiqui, Fahad J; Allen, John C; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J; Tan, Daniel S; Tan, Eng-Huat; Ong, S Tiong; Lim, Wan-Teck
2017-06-20
A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06-2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251-2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603-4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063-1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised.
Staab, A.; Plaut, R. D.; Pratt, C.; Lovett, S. P.; Wiley, M. R.; Biggs, T. D.; Bernhards, R. C.; Beck, L. C.; Palacios, G. F.; Stibitz, S.; Jones, K. L.; Goodwin, B. G.; Smith, M. A.
2017-01-01
ABSTRACT Here, we report the draft genome sequences of three laboratory variants of Bacillus anthracis Sterne and their double (Δlef Δcya) and triple (Δpag Δlef Δcya) toxin gene deletion derivatives. PMID:29122874
Effects of ion beam irradiation on size of mutant sector and genetic damage in Arabidopsis
NASA Astrophysics Data System (ADS)
Hase, Yoshihiro; Nozawa, Shigeki; Narumi, Issay; Oono, Yutaka
2017-01-01
Size of mutant sector and genetic damage were evaluated in Arabidopsis to further our understanding of effective ion beam use in plant mutation breeding. Arabidopsis seeds, heterozygous for the GLABRA1 (GL1) gene (GL1/gl1-1), were irradiated with 15.8 MeV/u neon ions (mean linear energy transfer (LET): 352 keV/μm), 17.3 MeV/u carbon ions (113 keV/μm), or 60Co gamma rays. The frequency and size of glabrous sectors generated because of inactivation of the GL1 allele were examined. The frequency and overall size of large deletions were evaluated based on the loss of heterozygosity of DNA markers using DNA isolated from glabrous tissue. Irrespective of the radiation properties, plants with mutant sectors were obtained at similar frequencies at the same effective dosage necessary for survival reduction. Ion beams tended to induce larger mutant sectors than gamma rays. The frequency of large deletions (>several kbp) increased as the LET value increased, with chromosome regions larger than 100 kbp lost in most large deletions. The distorted segregation ratio of glabrous plants in the progenies of irradiated GL1/gl1-1 plants suggested frequent occurrence of chromosome rearrangement, especially those subjected to neon ions. Exposure to ion beams with moderate LET values (30-110 keV/μm) is thought effective for inducing mutant sectors without causing extensive genetic damage.
Anwar, Naeem; Sem, Xiao Hui; Rhen, Mikael
2013-01-01
In Salmonella enterica serovar Typhimurium, oxidoreductases of the thioredoxin superfamily contribute to bacterial invasiveness, intracellular replication and to the virulence in BALB/c mice as well as in the soil nematode Caenorhabditis elegans. The scsABCD gene cluster, present in many but not all enteric bacteria, codes for four putative oxidoreductases of the thioredoxin superfamily. Here we have analyzed the potential role of the scs genes in oxidative stress tolerance and virulence in S. Typhimurium. An scsABCD deletion mutant showed moderate sensitization to the redox-active transition metal ion copper and increased protein carbonylation upon exposure to hydrogen peroxide. Still, the scsABCD mutant was not significantly affected for invasiveness or intracellular replication in respectively cultured epithelial or macrophage-like cells. However, we noted a significant copper chloride sensitivity of SPI1 T3SS mediated invasiveness that strongly depended on the presence of the scs genes. The scsABCD deletion mutant was not attenuated in animal infection models. In contrast, the mutant showed a moderate increase in its competitive index upon intraperitoneal challenge and enhanced invasiveness in small intestinal ileal loops of BALB/c mice. Moreover, deletion of the scsABCD genes restored the invasiveness of a trxA mutant in epithelial cells and its virulence in C. elegans. Our findings thus demonstrate that the scs gene cluster conditionally affects virulence and underscore the complex interactions between oxidoreductases of the thioredoxin superfamily in maintaining host adaptation of S. Typhimurium. PMID:23750221
Vaze, Nachiket D.; Park, Sin; Brooks, Ari D.; Fridman, Alexander; Joshi, Suresh G.
2017-01-01
A lab-scale, tunable, single-filament, point-to-point nonthermal dieletric-barrier discharge (DBD) plasma device was built to study the mechanisms of inactivation of aerosolized bacterial pathogens. The system inactivates airborne antibiotic-resistant pathogens efficiently. Nebulization mediated pre-optimized (4 log and 7 log) bacterial loads were challenged to plasma-charged aerosols, and lethal and sublethal doses determined using colony assay, and cell viability assay; and the loss of membrane potential and cellular respiration were determined using cell membrane potential assay and XTT assay. Using the strategies of Escherichia coli wildtype, over-expression mutant, deletion mutants, and peroxide and heat stress scavenging, we analyzed activation of intracellular reactive oxygen species (ROS) and heat shock protein (hsp) chaperons. Superoxide dismutase deletion mutants (ΔsodA, ΔsodB, ΔsodAΔsodB) and catalase mutants ΔkatG and ΔkatEΔkatG did not show significant difference from wildtype strain, and ΔkatE and ΔahpC was found significantly more susceptible to cell death than wildtype. The oxyR regulon was found to mediate plasma-charged aerosol-induced oxidative stress in bacteria. Hsp deficient E. coli (ΔhtpG, ΔgroEL, ΔclpX, ΔgrpE) showed complete inactivation of cells at ambient temperature, and the treatment at cold temperature (4°C) significantly protected hsp deletion mutants and wildtype cells, and indicate a direct involvement of hsp in plasma-charged aerosol mediated E. coli cell death. PMID:28166240
Song, Na; Dai, Qingqing; Zhu, Baitao; Wu, Yuxing; Xu, Ming; Voegele, Ralf Thomas; Gao, Xiaoning; Kang, Zhensheng; Huang, Lili
2017-01-01
In fungi, heterotrimeric guanine-nucleotide binding proteins (G-proteins) are key elements of signal transduction pathways, which control growth, asexual and sexual development, as well as virulence. In this study, we have identified two genes encoding heterotrimeric G protein alpha subunits, named Gvm2 and Gvm3, from Valsa mali, the causal agent of apple Valsa canker. Characterization of Gvm2 and Gvm3 mutants indicates that Gvm3 may be a crucial regulator of vegetative growth. Deletion of the corresponding gene results in a 20% reduction in growth rate. Besides, Gvm2 and Gvm3 seem to be involved in asexual reproduction, and mutants are hypersensitive to oxidative and cell membrane stresses. Interestingly, both G protein alpha subunits were most probably involved in V. mali virulence. In infection assays using Malus domestica cv. 'Fuji' leaves and twigs, the size of lesions caused by deletion mutants △Gvm2, or △Gvm3 are significantly reduced. Furthermore, many genes encoding hydrolytic enzymes-important virulence factors in V. mali-are expressed at a lower level in these deletion mutants. Our results suggest that Gvm2 and Gvm3 play an important role in virulence probably by regulation of expression of cell wall degrading enzymes. △Gvm2, and △Gvm3 mutants were further analyzed with respect to their impact on the transcript levels of genes in the cAMP/PKA pathway. The expression of the genes encoding adenylate cyclase VmAC, protein kinase A (PKA) regulatory subunit VmPKR, and PKA catalytic subunit VmPKA1 are down-regulated in both mutants. Further analyses indicated that intracellular cAMP level and PKA activity are down-regulated in the △Gvm3 mutant, but are basically unchanged in the △Gvm2 mutant. Overall, our findings indicate that both Gvm2 and Gvm3 play diverse roles in the modulation of vegetative growth, asexual development, and virulence in V. mali.
Buczynski, Kimberly A; Kim, Seong K; O'Callaghan, Dennis J
2005-10-01
The sole immediate-early (IE) gene of equine herpesvirus 1 (EHV-1) encodes a major regulatory protein of 1487 amino acids (aa) capable of modulating gene expression from both early and late promoters and also of trans-repressing its own promoter. Using a specially designed recombination system and a library of IE linker-insertion, deletion, point, and nonsense mutant constructs that encode forms of the IE protein (IEP) harboring mutations within all five regions, 17 mutant viruses were generated and characterized. Ribonuclease protection analyses revealed that all 17 mutants synthesize the IE mRNA in RK-13 cells, whereas those that failed to replicate on non-complementing RK-13 cells displayed a defect in the transcription of either an important early gene (EICP0) and/or an essential late gene (glycoprotein D). Western blot analyses showed that the IEP was synthesized and detectable in cells infected with each mutant virus, including those mutants that failed to replicate on non-complementing RK-13 cells. Eleven of the 17 mutants were capable of growth on non-complementing RK-13 cells, whereas mutant viruses with deletions within the serine-rich tract (SRT), nucleus localization signal (NLS), or DNA-binding domain (DBD) were capable of growth only on the IEP-producing cell line (IE13.1). Lastly, temperature shift experiments revealed that mutant viruses containing deletions within the C-terminus (KyAn1029 and KyAn1411) or within the SRT (KyADeltaSRT2) of the IEP exhibited a temperature-sensitive phenotype in that these viruses, in contrast to the parent KyA, failed to replicate at 39 degrees C. Overall, these results indicate that the C-terminus of the IEP is not essential for IEP function in cell culture, but this region contains elements that enhance the function(s) of the IEP. The initial characterization of these 17 EHV-1 mutants has shown that sequences totaling at least 43% of the IEP are not essential for virus replication in cell culture.
Fitzgerald, Timothy L; Powell, Jonathan J; Stiller, Jiri; Weese, Terri L; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C Lynne; Li, Zhongyi; Manners, John M; Kazan, Kemal
2015-01-01
Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed.
Fitzgerald, Timothy L.; Powell, Jonathan J.; Stiller, Jiri; Weese, Terri L.; Abe, Tomoko; Zhao, Guangyao; Jia, Jizeng; McIntyre, C. Lynne; Li, Zhongyi; Manners, John M.; Kazan, Kemal
2015-01-01
Reverse genetic techniques harnessing mutational approaches are powerful tools that can provide substantial insight into gene function in plants. However, as compared to diploid species, reverse genetic analyses in polyploid plants such as bread wheat can present substantial challenges associated with high levels of sequence and functional similarity amongst homoeologous loci. We previously developed a high-throughput method to identify deletions of genes within a physically mutagenized wheat population. Here we describe our efforts to combine multiple homoeologous deletions of three candidate disease susceptibility genes (TaWRKY11, TaPFT1 and TaPLDß1). We were able to produce lines featuring homozygous deletions at two of the three homoeoloci for all genes, but this was dependent on the individual mutants used in crossing. Intriguingly, despite extensive efforts, viable lines possessing homozygous deletions at all three homoeoloci could not be produced for any of the candidate genes. To investigate deletion size as a possible reason for this phenomenon, we developed an amplicon sequencing approach based on synteny to Brachypodium distachyon to assess the size of the deletions removing one candidate gene (TaPFT1) in our mutants. These analyses revealed that genomic deletions removing the locus are relatively large, resulting in the loss of multiple additional genes. The implications of this work for the use of heavy ion mutagenesis for reverse genetic analyses in wheat are discussed. PMID:25719507
Deletion of a target gene in Indica rice via CRISPR/Cas9.
Wang, Ying; Geng, Lizhao; Yuan, Menglong; Wei, Juan; Jin, Chen; Li, Min; Yu, Kun; Zhang, Ya; Jin, Huaibing; Wang, Eric; Chai, Zhijian; Fu, Xiangdong; Li, Xianggan
2017-08-01
Using CRISPR/Cas9, we successfully deleted large fragments of the yield-related gene DENSE AND ERECT PANICLE1 in Indica rice at relatively high frequency and generated gain-of-function dep1 mutants. CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 is a rapidly developing technology used to produce gene-specific modifications in both mammalian and plant systems. Most CRISPR-induced modifications in plants reported to date have been small insertions or deletions. Few large target gene deletions have thus far been reported, especially for Indica rice. In this study, we designed multiple CRISPR sgRNAs and successfully deleted DNA fragments in the gene DENSE AND ERECT PANICLE1 (DEP1) in the elite Indica rice line IR58025B. We achieved deletion frequencies of up to 21% for a 430 bp target and 9% for a 10 kb target among T0 events. Constructs with four sgRNAs did not generate higher full-length deletion frequencies than constructs with two sgRNAs. The multiple mutagenesis frequency reached 93% for four targets, and the homozygous mutation frequency reached 21% at the T0 stage. Important yield-related trait characteristics, such as dense and erect panicles and reduced plant height, were observed in dep1 homozygous T0 mutant plants produced by CRISPR/Cas9. Therefore, we successfully obtained deletions in DEP1 in the Indica background using the CRISPR/Cas9 editing tool at relatively high frequency.
Genetic Dissection of Midbrain Dopamine Neuron Development in vivo
Ellisor, Debra; Rieser, Caroline; Voelcker, Bettina; Machan, Jason T.; Zervas, Mark
2012-01-01
Midbrain dopamine (MbDA) neurons are partitioned into medial and lateral cohorts that control complex functions. However, the genetic underpinnings of MbDA neuron heterogeneity are unclear. While it is known that Wnt1-expressing progenitors contribute to MbDA neurons, the role of Wnt1 in MbDA neuron development in vivo is unresolved. We show that mice with a spontaneous point mutation in Wnt1 have a unique phenotype characterized by the loss of medial MbDA neurons concomitant with a severe depletion of Wnt1-expressing progenitors and diminished LMX1a-expressing progenitors. Wnt1 mutant embryos also have alterations in a hierarchical gene regulatory loop suggesting multiple gene involvement in the Wnt1 mutant MbDA neuron phenotype. To investigate this possibility, we conditionally deleted Gbx2, Fgf8, and En1/2 after their early role in patterning and asked whether these genetic manipulations phenocopied the depletion of MbDA neurons in Wnt1 mutants. The conditional deletion of Gbx2 did not result in re-positioning or distribution of MbDA neurons. The temporal deletion of Fgf8 did not result in the loss of either LMX1a-expressing progenitors nor the initial population of differentiated MbDA neurons, but did result in a complete loss of MbDA neurons at later stages. The temporal deletion and species specific manipulation of En1/2 demonstrated a continued and species specific role of Engrailed genes in MbDA neuron development. Notably, our conditional deletion experiments revealed phenotypes dissimilar to Wnt1 mutants indicating the unique role of Wnt1 in MbDA neuron development. By placing Wnt1, Fgf8, and En1/2 in the context of their temporal requirement for MbDA neuron development, we further deciphered the developmental program underpinning MbDA neuron progenitors. PMID:23041116
Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng
2013-09-15
The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.
Demko, Viktor; Ako, Eugene; Perroud, Pierre-François; Quatrano, Ralph; Olsen, Odd-Arne
2016-07-01
Deletion of the ancestral gene of the land plant multigene family of receptor like kinase CR4 in Physcomitrella patens demonstrates involvement in developmental control of gametophytic and sporophytic organs. The CRINKLY4 (CR4) family of receptor kinases in angiosperms consists of three clades, one including CR4, the CR4-related CCR1 and CCR2, a second including CCR3 and CCR4 family members, and a third and more distant clade. In addition to crinkly leaves in maize, which gave rise to the mutant gene name, CR4 is implicated in ovule, embryo, flower and root development in Arabidopsis thaliana. In root tips of the same species the module including a CLAVATA3/ESR-related protein, an Arabidopsis CR4, a CLAVATA1 and a WUSCHEL-related homeobox 5 (CLE40-ACR4-CLV1-WOX5) is implicated in meristem cell regulation. In embryos and shoots, CR4 acts together with A. thaliana MERISTEM LAYER 1 and PROTODERMAL FACTOR 2 to promote A. thaliana epidermis differentiation. Phylogenetic analysis has demonstrated that early land plants, e.g. mosses carry a single ancestral CR4 gene, together with genes encoding the other members of the CLE40-ACR4-CLV1-WOX5 signaling module. Here we show that CR4 serves as a broad regulator of morphogenesis both in gametophyte phyllids, archegonia and in sporophyte epidermis of the moss Physcomitrella patens. The phenotype of the CR4 deletion mutant in moss provides insight into the role of the ancestral CR4 gene as a regulator of development in early land plants.
Extracellular Identification of a Processed Type II ComR/ComS Pheromone of Streptococcus mutans
Khan, Rabia; Rukke, Håkon V.; Ricomini Filho, Antonio Pedro; Fimland, Gunnar; Arntzen, Magnus Ø.; Thiede, Bernd
2012-01-01
The competence-stimulating peptide (CSP) and the sigX-inducing peptide (XIP) are known to induce Streptococcus mutans competence for genetic transformation. For both pheromones, direct identification of the native peptides has not been accomplished. The fact that extracellular XIP activity was recently observed in a chemically defined medium devoid of peptides, as mentioned in an accompanying paper (K. Desai, L. Mashburn-Warren, M. J. Federle, and D. A. Morrison, J. Bacteriol. 194:3774–3780, 2012), provided ideal conditions for native XIP identification. To search for the XIP identity, culture supernatants were filtered to select for peptides of less than 3 kDa, followed by C18 extraction. One peptide, not detected in the supernatant of a comS deletion mutant, was identified by tandem mass spectrometry (MS/MS) fragmentation as identical to the ComS C-terminal sequence GLDWWSL. ComS processing did not require Eep, a peptidase involved in processing or import of bacterial small hydrophobic peptides, since eep deletion had no inhibitory effect on XIP production or on synthetic XIP response. We investigated whether extracellular CSP was also produced. A reporter assay for CSP activity detection, as well as MS analysis of supernatants, revealed that CSP was not present at detectable levels. In addition, a mutant with deletion of the CSP-encoding gene comC produced endogenous XIP levels similar to those of a nondeletion mutant. The results indicate that XIP pheromone production is a natural phenomenon that may occur in the absence of natural CSP pheromone activity and that the heptapeptide GLDWWSL is an extracellular processed form of ComS, possibly the active XIP pheromone. This is the first report of direct identification of a ComR/ComS pheromone. PMID:22609914
Pavlova, Sylvia I; Jin, Ling; Gasparovich, Stephen R; Tao, Lin
2013-07-01
Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci.
Kirst, Henning; Garcia-Cerdan, Jose Gines; Zurbriggen, Andreas; Ruehle, Thilo; Melis, Anastasios
2012-01-01
The truncated light-harvesting antenna size3 (tla3) DNA insertional transformant of Chlamydomonas reinhardtii is a chlorophyll-deficient mutant with a lighter green phenotype, a lower chlorophyll (Chl) per cell content, and higher Chl a/b ratio than corresponding wild-type strains. Functional analyses revealed a higher intensity for the saturation of photosynthesis and greater light-saturated photosynthetic activity in the tla3 mutant than in the wild type and a Chl antenna size of the photosystems that was only about 40% of that in the wild type. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western-blot analyses showed that the tla3 strain was deficient in the Chl a/b light-harvesting complex. Molecular and genetic analyses revealed a single plasmid insertion in chromosome 4 of the tla3 nuclear genome, causing deletion of predicted gene g5047 and plasmid insertion within the fourth intron of downstream-predicted gene g5046. Complementation studies defined that gene g5047 alone was necessary and sufficient to rescue the tla3 mutation. Gene g5047 encodes a C. reinhardtii homolog of the chloroplast-localized SRP43 signal recognition particle, whose occurrence and function in green microalgae has not hitherto been investigated. Biochemical analysis showed that the nucleus-encoded and chloroplast-localized CrCpSRP43 protein specifically operates in the assembly of the peripheral components of the Chl a/b light-harvesting antenna. This work demonstrates that cpsrp43 deletion in green microalgae can be employed to generate tla mutants with a substantially diminished Chl antenna size. The latter exhibit improved solar energy conversion efficiency and photosynthetic productivity under mass culture and bright sunlight conditions. PMID:23043081
Pavlova, Sylvia I.; Jin, Ling; Gasparovich, Stephen R.
2013-01-01
Ethanol consumption and poor oral hygiene are risk factors for oral and oesophageal cancers. Although oral streptococci have been found to produce excessive acetaldehyde from ethanol, little is known about the mechanism by which this carcinogen is produced. By screening 52 strains of diverse oral streptococcal species, we identified Streptococcus gordonii V2016 that produced the most acetaldehyde from ethanol. We then constructed gene deletion mutants in this strain and analysed them for alcohol and acetaldehyde dehydrogenases by zymograms. The results showed that S. gordonii V2016 expressed three primary alcohol dehydrogenases, AdhA, AdhB and AdhE, which all oxidize ethanol to acetaldehyde, but their preferred substrates were 1-propanol, 1-butanol and ethanol, respectively. Two additional dehydrogenases, S-AdhA and TdhA, were identified with specificities to the secondary alcohol 2-propanol and threonine, respectively, but not to ethanol. S. gordonii V2016 did not show a detectable acetaldehyde dehydrogenase even though its adhE gene encodes a putative bifunctional acetaldehyde/alcohol dehydrogenase. Mutants with adhE deletion showed greater tolerance to ethanol in comparison with the wild-type and mutant with adhA or adhB deletion, indicating that AdhE is the major alcohol dehydrogenase in S. gordonii. Analysis of 19 additional strains of S. gordonii, S. mitis, S. oralis, S. salivarius and S. sanguinis showed expressions of up to three alcohol dehydrogenases, but none showed detectable acetaldehyde dehydrogenase, except one strain that showed a novel ALDH. Therefore, expression of multiple alcohol dehydrogenases but no functional acetaldehyde dehydrogenase may contribute to excessive production of acetaldehyde from ethanol by certain oral streptococci. PMID:23637459
Kristensen, Tatjana P.; Maria Cherian, Reeja; Gray, Fiona C.; MacNeill, Stuart A.
2014-01-01
The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies. PMID:24723920
CRISPR/Cas9-Induced Double-Strand Break Repair in Arabidopsis Nonhomologous End-Joining Mutants.
Shen, Hexi; Strunks, Gary D; Klemann, Bart J P M; Hooykaas, Paul J J; de Pater, Sylvia
2017-01-05
Double-strand breaks (DSBs) are one of the most harmful DNA lesions. Cells utilize two main pathways for DSB repair: homologous recombination (HR) and nonhomologous end-joining (NHEJ). NHEJ can be subdivided into the KU-dependent classical NHEJ (c-NHEJ) and the more error-prone KU-independent backup-NHEJ (b-NHEJ) pathways, involving the poly (ADP-ribose) polymerases (PARPs). However, in the absence of these factors, cells still seem able to adequately maintain genome integrity, suggesting the presence of other b-NHEJ repair factors or pathways independent from KU and PARPs. The outcome of DSB repair by NHEJ pathways can be investigated by using artificial sequence-specific nucleases such as CRISPR/Cas9 to induce DSBs at a target of interest. Here, we used CRISPR/Cas9 for DSB induction at the Arabidopsis cruciferin 3 (CRU3) and protoporphyrinogen oxidase (PPO) genes. DSB repair outcomes via NHEJ were analyzed using footprint analysis in wild-type plants and plants deficient in key factors of c-NHEJ (ku80), b-NHEJ (parp1 parp2), or both (ku80 parp1 parp2). We found that larger deletions of >20 bp predominated after DSB repair in ku80 and ku80 parp1 parp2 mutants, corroborating with a role of KU in preventing DSB end resection. Deletion lengths did not significantly differ between ku80 and ku80 parp1 parp2 mutants, suggesting that a KU- and PARP-independent b-NHEJ mechanism becomes active in these mutants. Furthermore, microhomologies and templated insertions were observed at the repair junctions in the wild type and all mutants. Since these characteristics are hallmarks of polymerase θ-mediated DSB repair, we suggest a possible role for this recently discovered polymerase in DSB repair in plants. Copyright © 2017 Shen et al.
Barny, Iris; Perrault, Isabelle; Michel, Christel; Soussan, Mickael; Goudin, Nicolas; Rio, Marlène; Thomas, Sophie; Attié-Bitach, Tania; Hamel, Christian; Dollfus, Hélène; Kaplan, Josseline; Rozet, Jean-Michel; Gerard, Xavier
2018-05-16
CEP290 mutations cause a spectrum of ciliopathies from Leber congenital amaurosis type 10 (LCA10) to embryo-lethal Meckel syndrome (MKS). Using panel-based molecular diagnosis testing for inherited retinal diseases, we identified two individuals with some preserved vision despite biallelism for presumably truncating CEP290 mutations. The first one carried a homozygous 1 base-pair deletion in exon 17, introducing a premature termination codon (PTC) in exon 18 (c.1666del; p.Ile556Phefs*17). mRNA analysis revealed a basal exon skipping (BES) of exon 18, providing mutant cells with the ability to escape protein truncation, while disrupting the reading frame in controls. The second individual harbored compound heterozygous nonsense mutations in exon 8 (c.508A>T, p.Lys170*) and exon 32 (c.4090G>T, p.Glu1364*), respectively. Some CEP290 lacking exon 8 were detected in mutant fibroblasts but not in controls whereas some skipping of exon 32 occurred in both lines, but with higher amplitude in the mutant. Considering that the deletion of either exon maintains the reading frame in either line, skipping in mutant cells likely involves nonsense-associated altered splicing (NAS) alone (exon 8), or with BES (exon 32). Skipping of PTC-containing exons in mutant cells allowed production of CEP290 isoforms with preserved ability to assemble into a high molecular weight complex and to interact efficiently with proteins important for cilia formation and intraflagellar trafficking. In contrast, studying LCA10 and MKS fibroblasts we show moderate to severe cilia alterations, providing support for a correlation between disease severity and the ability of cells to express shortened, yet functional, CEP290 isoforms.
Computer-Aided Resolution of an Experimental Paradox in Bacterial Chemotaxis
Abouhamad, Walid N.; Bray, Dennis; Schuster, Martin; Boesch, Kristin C.; Silversmith, Ruth E.; Bourret, Robert B.
1998-01-01
Escherichia coli responds to its environment by means of a network of intracellular reactions which process signals from membrane-bound receptors and relay them to the flagellar motors. Although characterization of the reactions in the chemotaxis signaling pathway is sufficiently complete to construct computer simulations that predict the phenotypes of mutant strains with a high degree of accuracy, two previous experimental investigations of the activity remaining upon genetic deletion of multiple signaling components yielded several contradictory results (M. P. Conley, A. J. Wolfe, D. F. Blair, and H. C. Berg, J. Bacteriol. 171:5190–5193, 1989; J. D. Liu and J. S. Parkinson, Proc. Natl. Acad. Sci. USA 86:8703–8707, 1989). For example, “building up” the pathway by adding back CheA and CheY to a gutted strain lacking chemotaxis genes resulted in counterclockwise flagellar rotation whereas “breaking down” the pathway by deleting chemotaxis genes except cheA and cheY resulted in alternating episodes of clockwise and counterclockwise flagellar rotation. Our computer simulation predicts that trace amounts of CheZ expressed in the gutted strain could account for this difference. We tested this explanation experimentally by constructing a mutant containing a new deletion of the che genes that cannot express CheZ and verified that the behavior of strains built up from the new deletion does in fact conform to both the phenotypes observed for breakdown strains and computer-generated predictions. Our findings consolidate the present view of the chemotaxis signaling pathway and highlight the utility of molecularly based computer models in the analysis of complex biochemical networks. PMID:9683468
Quek, Richard; Farid, Mohamad; Kanjanapan, Yada; Lim, Cindy; Tan, Iain Beehuat; Kesavan, Sittampalam; Lim, Tony Kiat Hon; Oon, Lynette Lin-Ean; Goh, Brian Kp; Chan, Weng Hoong; Teo, Melissa; Chung, Alexander Yf; Ong, Hock Soo; Wong, Wai Keong; Tan, Patrick; Yip, Desmond
2017-06-01
Benefit of adjuvant imatinib therapy following curative resection in patients with intermediate-risk gastrointestinal stromal tumor (GIST) is unclear. GIST-specific exon mutations, in particular exon 11 deletions, have been shown to be prognostic. We hypothesize that specific KIT mutations may improve risk stratification in patients with intermediate-risk GIST, identifying a subgroup of patients who may benefit from adjuvant therapy. In total, 142 GIST patients with complete clinicopathologic and mutational data from two sites were included. Risk classification was based on the modified National Institute of Health (NIH) criteria. In this cohort, 74% (n = 105) of patients harbored a KIT mutation; 61% (n = 86) were found in exon 11 of which nearly 70% were KIT exon 11 deletions (n = 60). A total of 18% (n = 25) of cases were classified as having intermediate-risk disease. Univariate analysis confirmed tumor size, mitotic index, nongastric origin, presence of tumor rupture and modified NIH criteria were adversely prognostic for relapse-free survival (RFS). Among KIT/PDGFRA mutants, KIT exon 11 deletions had a significantly worse prognosis (hazard ratio 2.31; 95% confidence interval, 1.30-4.10; P = 0.003). Multivariate analysis confirmed KIT exon 11 deletion (P = 0.003) and clinical risk classification (P < 0.001) as independent adverse prognostic factors for RFS. Intermediate-risk patients harboring KIT exon 11 deletions had RFS outcomes similar to high-risk patients. The presence of KIT exon 11 deletion mutation in patients with intermediate-risk GIST is associated with an inferior clinical outcome with RFS similar to high-risk patients. © 2016 John Wiley & Sons Australia, Ltd.
Montibus, Mathilde; Ducos, Christine; Bonnin-Verdal, Marie-Noelle; Bormann, Jorg; Ponts, Nadia; Richard-Forget, Florence; Barreau, Christian
2013-01-01
Redox sensing is of primary importance for fungi to cope with oxidant compounds found in their environment. Plant pathogens are particularly subject to the oxidative burst during the primary steps of infection. In the budding yeast Saccharomyces cerevisiae, it is the transcription factor Yap1 that mediates the response to oxidative stress via activation of genes coding for detoxification enzymes. In the cereal pathogen Fusarium graminearum, Fgap1 a homologue of Yap1 was identified and its role was investigated. During infection, this pathogen produces mycotoxins belonging to the trichothecenes family that accumulate in the grains. The global regulation of toxin biosynthesis is not completely understood. However, it is now clearly established that an oxidative stress activates the production of toxins by F. graminearum. The involvement of Fgap1 in this activation was investigated. A deleted mutant and a strain expressing a truncated constitutive form of Fgap1 were constructed. None of the mutants was affected in pathogenicity. The deleted mutant showed higher level of trichothecenes production associated with overexpression of Tri genes. Moreover activation of toxin accumulation in response to oxidative stress was no longer observed. Regarding the mutant with the truncated constitutive form of Fgap1, toxin production was strongly reduced. Expression of oxidative stress response genes was not activated in the deleted mutant and expression of the gene encoding the mitochondrial superoxide dismutase MnSOD1 was up-regulated in the mutant with the truncated constitutive form of Fgap1. Our results demonstrate that Fgap1 plays a key role in the link between oxidative stress response and F. graminearum secondary metabolism. PMID:24349499
Legrand, Melanie; Chan, Christine L.; Jauert, Peter A.; Kirkpatrick, David T.
2011-01-01
Genome rearrangements, a common feature of Candida albicans isolates, are often associated with the acquisition of antifungal drug resistance. In Saccharomyces cerevisiae, perturbations in the S-phase checkpoints result in the same sort of Gross Chromosomal Rearrangements (GCRs) observed in C. albicans. Several proteins are involved in the S. cerevisiae cell cycle checkpoints, including Mec1p, a protein kinase of the PIKK (phosphatidyl inositol 3-kinase-like kinase) family and the central player in the DNA damage checkpoint. Sgs1p, the ortholog of BLM, the Bloom’s syndrome gene, is a RecQ-related DNA helicase; cells from BLM patients are characterized by an increase in genome instability. Yeast strains bearing deletions in MEC1 or SGS1 are viable (in contrast to the inviability seen with loss of MEC1 in S. cerevisiae) but the different deletion mutants have significantly different phenotypes. The mec1Δ/Δ colonies have a wild-type colony morphology, while the sgs1Δ/Δ mutants are slow-growing, producing wrinkled colonies with pseudohyphal-like cells. The mec1Δ/Δ mutants are only sensitive to ethylmethane sulfonate (EMS), methylmethane sulfonate (MMS), and hydroxyurea (HU) but the sgs1Δ/Δ mutants exhibit a high sensitivity to all DNA-damaging agents tested. In an assay for chromosome 1 integrity, the mec1Δ/Δ mutants exhibit an increase in genome instability; no change was observed in the sgs1Δ/Δ mutants. Finally, loss of MEC1 does not affect sensitivity to the antifungal drug fluconazole, while loss of SGS1 leads to an increased susceptibility to fluconazole. Neither deletion elevated the level of antifungal drug resistance acquisition. PMID:21511048
Yanase, Masaki; Aikoh, Tohru; Sawada, Kazunori; Ogura, Kotaro; Hagiwara, Takuya; Imai, Keita; Wada, Masaru; Yokota, Atsushi
2016-08-01
Various attempts have been made to enhance lysine production in Corynebacterium glutamicum. Pyruvate kinase (PYK) defect is one of the strategies used to enhance the supply of oxaloacetic acid (OAA), a precursor metabolite for lysine biosynthesis. However, inconsistent effects of this mutation have been reported: positive effects of PYK defect in mutants having phosphoenolpyruvate carboxylase (PEPC) desensitized to feedback inhibition by aspartic acid, while negative effects in simple PYK gene (pyk) knockout mutants. To address these discrepancies, the effects of pyk deletion on lysine yield were investigated with or without the D299N mutation in ppc rendering PEPC desensitization. C. glutamicum ATCC13032 mutant strain P with a feedback inhibition-desensitized aspartokinase was used as the parent strain, producing 9.36 g/L lysine from 100 g/L glucose in a jar fermentor culture. Under these conditions, while the simple mutant D2 with pyk deletion or R2 with the PEPC-desensitization mutation showed marginally increased lysine yield (∼1.1-fold, not significant), the mutant DR2 strain having both mutations showed synergistically increased lysine productivity (1.38-fold, 12.9 g/L). Therefore, the pyk deletion is effective under a PEPC-desensitized background, which ensures enhanced supply of OAA, thus clarifying the discrepancies. A citrate synthase defective mutation (S252C in gltA) further increased the lysine yield in strain DR2 (1.68-fold, 15.7 g/L). Thus, these three mutations coordinately enhanced the lysine yield. Both the malate:quinone oxidoreductase activity and respiration rate were significantly reduced in strains D2 and DR2. Overall, these results provide valuable knowledge for engineering the anaplerotic reaction to increase lysine yield in C. glutamicum. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Herrgård, Markus J.
2014-01-01
High-cell-density fermentation for industrial production of chemicals can impose numerous stresses on cells due to high substrate, product, and by-product concentrations; high osmolarity; reactive oxygen species; and elevated temperatures. There is a need to develop platform strains of industrial microorganisms that are more tolerant toward these typical processing conditions. In this study, the growth of six industrially relevant strains of Escherichia coli was characterized under eight stress conditions representative of fed-batch fermentation, and strains W and BL21(DE3) were selected as platforms for transposon (Tn) mutagenesis due to favorable resistance characteristics. Selection experiments, followed by either targeted or genome-wide next-generation-sequencing-based Tn insertion site determination, were performed to identify mutants with improved growth properties under a subset of three stress conditions and two combinations of individual stresses. A subset of the identified loss-of-function mutants were selected for a combinatorial approach, where strains with combinations of two and three gene deletions were systematically constructed and tested for single and multistress resistance. These approaches allowed identification of (i) strain-background-specific stress resistance phenotypes, (ii) novel gene deletion mutants in E. coli that confer single and multistress resistance in a strain-background-dependent manner, and (iii) synergistic effects of multiple gene deletions that confer improved resistance over single deletions. The results of this study underscore the suboptimality and strain-specific variability of the genetic network regulating growth under stressful conditions and suggest that further exploration of the combinatorial gene deletion space in multiple strain backgrounds is needed for optimizing strains for microbial bioprocessing applications. PMID:25085490
Chang, Huang-Chih; Chen, Yu-Mu; Tseng, Chia-Cheng; Huang, Kuo-Tung; Wang, Chin-Chou; Chen, Yung-Che; Lai, Chien-Hao; Fang, Wen-Feng; Kao, Hsu-Ching; Lin, Meng-Chih
2017-03-01
Epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs) are first-choice treatments for advanced non-small-cell lung cancer patients harboring EGFR mutations. Although EGFR mutations are strongly predictive of patients' outcomes and their response to treatment with EGFR-TKIs, early failure of first-line therapy with EGFR-TKIs in patients with EGFR mutations is not rare. Besides several clinical factors influencing EGFR-TKI efficacies studied earlier such as the Eastern Cooperative Oncology Group performance status or uncommon mutation, we would like to see whether semi-quantify EGFR mutation gene expression calculated by 2 -ΔΔct was a prognostic factor in EGFR-mutant non-small cell lung cancer patients receiving first-line EGFR-TKIs. This retrospective study reviews 926 lung cancer patients diagnosed from January 2011 to October 2013 at the Kaohsiung Chang Gung Memorial Hospital in Taiwan. Of 224 EGFR-mutant adenocarcinoma patients, 148 patients who had 2 -ΔΔct data were included. The best cutoff values of 2 -ΔΔct for in-frame deletions in exon 19 (19 deletion) and a position 858 substituted from leucine (L) to an arginine (R) in exon 21 (L858R) were determined using receiver operating characteristic curves. Patients were divided into high and low 2 -ΔΔct expression based on the above cutoff level. The best cutoff point of 2 -ΔΔct value of 19 deletion and L858R was 31.1 and 104.7, respectively. In all, 92 (62.1%) patients showed high 2 -ΔΔct expression and 56 patients (37.9%) low 2 -ΔΔct expression. The mean age was 65.6 years. Progression-free survival of 19 deletion mutant patients with low versus high expression level was 17.07 versus 12.04 months (P = 0.004), respectively. Progression-free survival of L858 mutant patients was 13.75 and 7.96 months (P = 0.008), respectively. EGFR-mutant lung adenocarcinoma patients with lower EGFR gene expression had longer progression-free survival duration without interfering overall survival.
Vengalil, Seena; Preethish-Kumar, Veeramani; Polavarapu, Kiran; Mahadevappa, Manjunath; Sekar, Deepha; Purushottam, Meera; Thomas, Priya Treesa; Nashi, Saraswathi; Nalini, Atchayaram
2017-01-01
Studies of cases of Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) confirmed by multiplex ligation-dependent probe amplification (MLPA) have determined the clinical characteristics, genotype, and relations between the reading frame and phenotype for different countries. This is the first such study from India. A retrospective genotype-phenotype analysis of 317 MLPA-confirmed patients with DMD or BMD who visited the neuromuscular clinic of a quaternary referral center in southern India. The 317 patients comprised 279 cases of DMD (88%), 32 of BMD (10.1%), and 6 of intermediate phenotype (1.9%). Deletions accounted for 91.8% of cases, with duplications causing the remaining 8.2%. There were 254 cases of DMD (91%) with deletions and 25 (9%) due to duplications, and 31 cases (96.8%) of BMD with deletions and 1 (3.2%) due to duplication. All six cases of intermediate type were due to deletions. The most-common mutation was a single-exon deletion. Deletions of six or fewer exons constituted 68.8% of cases. The deletion of exon 50 was the most common. The reading-frame rule held in 90% of DMD and 94% of BMD cases. A tendency toward a lower IQ and earlier wheelchair dependence was observed with distal exon deletions, though a significant correlation was not found. The reading-frame rule held in 90% to 94% of children, which is consistent with reports from other parts of the world. However, testing by MLPA is a limitation, and advanced sequencing methods including analysis of the structure of mutant dystrophin is needed for more-accurate assessments of the genotype-phenotype correlation.
Functional profiles of orphan membrane transporters in the life cycle of the malaria parasite
Kenthirapalan, Sanketha; Waters, Andrew P.; Matuschewski, Kai; Kooij, Taco W. A.
2016-01-01
Assigning function to orphan membrane transport proteins and prioritizing candidates for detailed biochemical characterization remain fundamental challenges and are particularly important for medically relevant pathogens, such as malaria parasites. Here we present a comprehensive genetic analysis of 35 orphan transport proteins of Plasmodium berghei during its life cycle in mice and Anopheles mosquitoes. Six genes, including four candidate aminophospholipid transporters, are refractory to gene deletion, indicative of essential functions. We generate and phenotypically characterize 29 mutant strains with deletions of individual transporter genes. Whereas seven genes appear to be dispensable under the experimental conditions tested, deletion of any of the 22 other genes leads to specific defects in life cycle progression in vivo and/or host transition. Our study provides growing support for a potential link between heavy metal homeostasis and host switching and reveals potential targets for rational design of new intervention strategies against malaria. PMID:26796412
Yeast MRX deletions have short chronological life span and more triacylglycerols.
Kanagavijayan, Dhanabalan; Rajasekharan, Ram; Srinivasan, Malathi
2016-02-01
Saccharomyces cerevisiae is an excellent model organism for lipid research. Here, we have used yeast haploid RAdiation Damage (RAD) deletion strains to study life span and lipid storage patterns. RAD genes are mainly involved in DNA repair mechanism and hence, their deletions have resulted in shorter life span. Viable RAD mutants were screened for non-polar lipid content, and some of the mutants showed significantly high amounts of triacylglycerol (TAG) and steryl ester, besides short chronological life span. Among these, RAD50, MRE11 and XRS2 form a complex, MRX that is involved in homologous recombination that showed an increase in the amount of TAG. Microarray data of single MRX deletions revealed that besides DNA damage signature genes, lipid metabolism genes are also differentially expressed. Lipid biosynthetic genes (LPP1, SLC1) were upregulated and lipid hydrolytic gene (TGL3) was downregulated. We observed that rad50Δ, mre11Δ, xrs2Δ and mrxΔ strains have high number of lipid droplets (LDs) with fragmented mitochondria. These mutants have a short chronological life span compared to wild type. Aged wild-type cells also accumulated TAG with LDs of ∼2.0 μm in diameter. These results suggest that TAG accumulation and big size LDs could be possible markers for premature or normal aging. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Frey, Stefan; Lahmann, Yasmine; Hartmann, Thomas; Seiler, Stephan; Pöggeler, Stefanie
2015-08-01
The striatin interacting phosphatase and kinase (STRIPAK) complex, which is composed of striatin, protein phosphatase PP2A and kinases, is required for fruiting-body development and cell fusion in the filamentous ascomycete Sordaria macrospora. Here, we report on the interplay of the glycosylphosphatidylinositol (GPI)-anchored protein SmGPI1 with the kinase activator SmMOB3, a core component of human and fungal STRIPAK complexes. SmGPI1 is conserved among filamentous ascomycetes and was first identified in a yeast two-hybrid screen using SmMOB3 as bait. The physical interaction of SmMOB3 and SmGPI1 was verified by co-immunoprecipitation. In vivo localization and differential centrifugation revealed that SmGPI1 is predominantly secreted and attached to the cell wall but is also associated with mitochondria and appears to be a dual-targeted protein. Deletion of Smgpi1 led to an increased number of fruiting bodies that were normally shaped but reduced in size. In addition, Smmob3 and Smgpi1 genetically interact. In the sterile ΔSmmob3 background deletion of Smgpi1 restores fertility, vegetative growth as well as hyphal-fusion defects. The suppression effect was specific for the ΔSmmob3 mutant as deletion of Smgpi1 in other STRIPAK mutants does not restore fertility. © 2015 John Wiley & Sons Ltd.
Liu, Xin; Han, Qi; Xu, Jianhong; Wang, Jian; Shi, Jianrong
2015-11-10
In this study, we characterized FgIlv2 and FgIlv6, the catalytic and regulatory subunits of acetohydroxyacid synthase (AHAS) from the important wheat head scab fungus Fusarium graminearum. AHAS catalyzes the first common step in the parallel pathways toward branched-chain amino acids (BCAAs: isoleucine, leucine, valine) and is the inhibitory target of several commercialized herbicides. Both FgILV2 and FgILV6 deletion mutants were BCAA-auxotrophic and showed reduced aerial hyphal growth and red pigmentation when cultured on PDA plates. Conidial formation was completely blocked in the FgILV2 deletion mutant ΔFgIlv2-4 and significantly reduced in the FgILV6 deletion mutant ΔFgIlv6-12. The auxotrophs of ΔFgIlv2-4 and ΔFgIlv6-12 could be restored by exogenous addition of BCAAs but relied on the designated nitrogen source the medium contained. Deletion of FgILV2 or FgILV6 also leads to hypersensitivity to various cellular stresses and reduced deoxynivalenol production. ΔFgIlv2-4 lost virulence completely on flowering wheat heads, whereas ΔFgIlv6-12 could cause scab symptoms in the inoculated spikelet but lost its aggressiveness. Taken together, our study implies the potential value of antifungals targeting both FgIlv2 and FgIlv6 in F. graminearum.
Cross, F R; Garber, E A; Hanafusa, H
1985-01-01
We have constructed deletions within the region of cloned Rous sarcoma virus DNA coding for the N-terminal 30 kilodaltons of p60src. Infectious virus was recovered after transfection. Deletions of amino acids 15 to 149, 15 to 169, or 149 to 169 attenuated but did not abolish transforming activity, as assayed by focus formation and anchorage-independent growth. These deletions also had only slight effects on the tyrosine kinase activity of the mutant src protein. Deletion of amino acids 169 to 264 or 15 to 264 completely abolished transforming activity, and src kinase activity was reduced at least 10-fold. However, these mutant viruses generated low levels of transforming virus by recombination with the cellular src gene. The results suggest that as well as previously identified functional domains for p60src myristylation and membrane binding (amino acids 1 to 14) and tyrosine kinase activity (amino acids 250 to 526), additional N-terminal sequences (particularly amino acids 82 to 169) can influence the transforming activity of the src protein. Images PMID:2426576
Obermannova, Barbora; Sumnik, Zdenek; Dusatkova, Petra; Cinek, Ondrej; Grant, Michael; Lebl, Jan; Hendy, Geoffrey N
2016-04-01
Autosomal dominant hypocalcemia (ADH) is a rare disorder caused by activating mutations of the calcium-sensing receptor (CASR). The treatment of ADH patients with 1α-hydroxylated vitamin D derivatives can cause hypercalciuria leading to nephrocalcinosis. We studied a girl who presented with hypoparathyroidism and asymptomatic hypocalcemia at age 2.5 years. Mutations of CASR were investigated by DNA sequencing. Functional analyses of mutant and WT CASRs were done in transiently transfected human embryonic kidney (HEK293) cells. The proband and her father are heterozygous for an eight-nucleotide deletion c.2703_2710delCCTTGGAG in the CASR encoding the intracellular domain of the protein. Transient expression of CASR constructs in kidney cells in vitro suggested greater cell surface expression of the mutant receptor with a left-shifted extracellular calcium dose-response curve relative to that of the WT receptor consistent with gain of function. Initial treatment of the patient with calcitriol led to increased urinary calcium excretion. Evaluation for mosaicism in the paternal grandparents of the proband was negative. We describe a novel naturally occurring deletion mutation within the CASR that apparently arose de novo in the father of the ADH proband. Functional analysis suggests that the cytoplasmic tail of the CASR contains determinants that regulate the attenuation of signal transduction. Early molecular analysis of the CASR gene in patients with isolated idiopathic hypoparathyroidism is recommended because of its relevance to clinical outcome and treatment choice. In ADH patients, calcium supplementation and low-dose cholecalciferol avoids hypocalcemic symptoms without compromising renal function. © 2016 European Society of Endocrinology.
USDA-ARS?s Scientific Manuscript database
Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...
Kraatz, Franziska; Wernike, Kerstin; Reiche, Sven; Aebischer, Andrea; Reimann, Ilona; Beer, Martin
2018-03-01
Schmallenberg virus (SBV) induces fetal malformation, abortions and stillbirth in ruminants. While the non-structural protein NSs is a major virulence factor, the biological function of NSm, the second non-structural protein which consists of three hydrophobic transmembrane (I, III, V) and two non-hydrophobic regions (II, IV), is still unknown. Here, a series of NSm mutants displaying deletions of nearly the entire NSm or of the non-hydrophobic domains was generated and the intracellular distribution of NSm was assessed. SBV-NSm is dispensable for the generation of infectious virus and mutants lacking domains II - V showed growth properties similar to the wild-type virus. In addition, a comparable intracellular distribution of SBV-NSm was observed in mammalian cells infected with domain II mutants or wild-type virus. In both cases, NSm co-localized with the glycoprotein Gc in the Golgi compartment. However, domain IV-deletion mutants showed an altered distribution pattern and no co-localization of NSm and Gc. Copyright © 2018 Elsevier Inc. All rights reserved.
Da Silva, Fabio; Massa, Filippo; Motamedi, Fariba Jian; Vidal, Valerie; Rocha, Ana Sofia; Gregoire, Elodie P; Cai, Chen-Leng; Wagner, Kay Dietrich; Schedl, Andreas
2018-05-31
Coronary artery anomalies are common congenital disorders with serious consequences in adult life. Coronary circulation begins when the coronary stems form connections between the aorta and the developing vascular plexus. We recently identified the WNT signaling modulator R-spondin 3 (Rspo3), as a crucial regulator of coronary stem proliferation. Using expression analysis and tissue-specific deletion we now demonstrate that Rspo3 is primarily produced by cardiomyocytes. Moreover, we have employed CRISPR/Cas9 technology to generate novel Lgr4-null alleles that showed a significant decrease in coronary stem proliferation and thus phenocopied the coronary artery defects seen in Rspo3 mutants. Interestingly, Lgr4 mutants displayed slightly hypomorphic right ventricles, an observation also made after myocardial specific deletion of Rspo3. These results shed new light on the role of Rspo3 in heart development and demonstrate that LGR4 is the principal R-spondin 3 receptor in the heart. Copyright © 2018 Elsevier Inc. All rights reserved.
Mosaicism of an ELANE mutation in an asymptomatic mother in a familial case of cyclic neutropenia.
Hirata, Osamu; Okada, Satoshi; Tsumura, Miyuki; Karakawa, Shuhei; Matsumura, Itaru; Kimura, Yujiro; Maihara, Toshiro; Yasunaga, Shin'ichiro; Takihara, Yoshihiro; Ohara, Osamu; Kobayashi, Masao
2015-07-01
To confirm and characterize mosaicism of the cyclic neutropenia (CyN)-related mutation in the ELANE gene identified in the asymptomatic mother of patients with CyN. We identified sibling cases with CyN due to a novel heterozygous splicing site mutation, IVS4 +5SD G>T, in the ELANE gene, resulting in an internal in-frame deletion of 30 nucleotides (corresponding to a ten amino acid deletion, V161-F170). The mutated allele was also detected in their asymptomatic mother but at low frequency. We measured the frequency of the mutant allele from peripheral blood leukocytes (PBLs) by subcloning, and confirmed the allelic frequency of mosaicism in various cell types by massively parallel DNA sequencing (MPS) analysis. In the subcloning analysis, the mutant allele was identified in 21.36 % of PBLs from the asymptomatic mother, compared with 54.72 % of PBLs from the CyN patient. In the MPS analysis, the mutant allele was observed in approximately 30 % of mononuclear cells, CD3(+) T cells, CD14(+) monocytes and the buccal mucosa. Conversely, it was detected in low frequency in polymorphonuclear leukocytes (PLMLs) (3-4 %) and CD16(+) granulocytes (2-3 %). Mosaicism of the ELANE mutation has only previously been identified in one confirmed and one unconfirmed case of SCN. This is the first report of mosaicism of the ELANE mutation in a case of CyN. The MPS results suggest that this de novo mutation occurred during the two-cell stage of embryogenesis. PLMLs expressing the ELANE mutation were found to be actively undergoing apoptosis.
Yagasaki, Hiroshi; Hamanoue, Satoshi; Oda, Tsukasa; Nakahata, Tatsutoshi; Asano, Shigetaka; Yamashita, Takayuki
2004-12-01
Fanconi anemia (FA) is a rare autosomal recessive disorder of hematopoiesis, with at least 11 complementation groups. FANCA, a gene for group A, accounts for the majority of FA patients. Previous studies of FANCA mutations revealed high allelic heterogeneity, frequent occurrence of large deletions, and interpopulation differences. However, systematic mutational analysis, including gene dosage assay to detect large deletions, has not been documented for Asian populations. A newly developed TaqMan quantitative PCR-based gene dosage assay, combined with sequencing of exons and cDNA fragments, allowed for detection of 48 mutant alleles of FANCA in 27 (77%) of 35 unrelated Japanese FA families with no detectable mutations in FANCC or FANCG. We identified 29 different mutations (21 nucleotide substitutions or small deletions/insertions and eight large deletions), at least 20 of which were novel. The FANCA mutational spectrum of the Japanese was different from that of other ethnic groups so far studied. This is the largest scale of mutation analysis of FANCA in the Japanese population. Characterization of these mutations provided new information regarding the mutagenesis mechanisms and structure-function relationship of FANCA. Specifically, our data suggest that diverse mechanisms including nonhomologous recombination as well as Alu-mediated homologous recombination are involved in the generation of large deletions in FANCA. Copyright 2004 Wiley-Liss, Inc.
Mitochondrial and Cytoplasmic ROS Have Opposing Effects on Lifespan
Schaar, Claire E.; Dues, Dylan J.; Spielbauer, Katie K.; Machiela, Emily; Cooper, Jason F.; Senchuk, Megan; Hekimi, Siegfried; Van Raamsdonk, Jeremy M.
2015-01-01
Reactive oxygen species (ROS) are highly reactive, oxygen-containing molecules that can cause molecular damage within the cell. While the accumulation of ROS-mediated damage is widely believed to be one of the main causes of aging, ROS also act in signaling pathways. Recent work has demonstrated that increasing levels of superoxide, one form of ROS, through treatment with paraquat, results in increased lifespan. Interestingly, treatment with paraquat robustly increases the already long lifespan of the clk-1 mitochondrial mutant, but not other long-lived mitochondrial mutants such as isp-1 or nuo-6. To genetically dissect the subcellular compartment in which elevated ROS act to increase lifespan, we deleted individual superoxide dismutase (sod) genes in clk-1 mutants, which are sensitized to ROS. We find that only deletion of the primary mitochondrial sod gene, sod-2 results in increased lifespan in clk-1 worms. In contrast, deletion of either of the two cytoplasmic sod genes, sod-1 or sod-5, significantly decreases the lifespan of clk-1 worms. Further, we show that increasing mitochondrial superoxide levels through deletion of sod-2 or treatment with paraquat can still increase lifespan in clk-1;sod-1 double mutants, which live shorter than clk-1 worms. The fact that mitochondrial superoxide can increase lifespan in worms with a detrimental level of cytoplasmic superoxide demonstrates that ROS have a compartment specific effect on lifespan – elevated ROS in the mitochondria acts to increase lifespan, while elevated ROS in the cytoplasm decreases lifespan. This work also suggests that both ROS-dependent and ROS-independent mechanisms contribute to the longevity of clk-1 worms. PMID:25671321
Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.
Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D
2015-01-01
Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage associated stresses.
A mechanistic model of tau amyloid aggregation based on direct observation of oligomers
NASA Astrophysics Data System (ADS)
Shammas, Sarah L.; Garcia, Gonzalo A.; Kumar, Satish; Kjaergaard, Magnus; Horrocks, Mathew H.; Shivji, Nadia; Mandelkow, Eva; Knowles, Tuomas P. J.; Mandelkow, Eckhard; Klenerman, David
2015-04-01
Protein aggregation plays a key role in neurodegenerative disease, giving rise to small oligomers that may become cytotoxic to cells. The fundamental microscopic reactions taking place during aggregation, and their rate constants, have been difficult to determine due to lack of suitable methods to identify and follow the low concentration of oligomers over time. Here we use single-molecule fluorescence to study the aggregation of the repeat domain of tau (K18), and two mutant forms linked with familial frontotemporal dementia, the deletion mutant ΔK280 and the point mutant P301L. Our kinetic analysis reveals that aggregation proceeds via monomeric assembly into small oligomers, and a subsequent slow structural conversion step before fibril formation. Using this approach, we have been able to quantitatively determine how these mutations alter the aggregation energy landscape.
Smith, Mark R.; Boenzli, Matthew G.; Hindagolla, Vihangi; Ding, Jun; Miller, John M.; Hutchison, James E.; Greenwood, Jeffrey A.; Abeliovich, Hagai
2013-01-01
Positively charged gold nanoparticles (0.8-nm core diameter) reduced yeast survival, but not growth, at a concentration of 10 to 100 μg/ml. Among 17 resistant deletion mutants isolated in a genome-wide screen, highly significant enrichment was observed for respiration-deficient mutants lacking genes encoding proteins associated with the mitochondrion. PMID:23144132
Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W
2015-07-01
The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.
Sun, Si; Yu, Hui; Wang, Huijie; Zhao, Xinmin; Zhao, Xintai; Wu, Xianghua; Qiao, Jie; Chang, Jianhua; Wang, Jialei
2017-01-01
Background Non-small-cell lung cancer (NSCLC) patients with epidermal growth factor receptor (EGFR) mutations might develop primary and secondary resistance to tyrosine kinase inhibitors (TKIs). The proapoptotic protein Bcl-2-like 11 (BIM) is a key modulator of apoptosis triggered by EGFR-TKIs. The recent studies have indicated that some patients with positive EGFR mutations were refractory to EGFR-TKIs if they harbored a BIM deletion polymorphism. The purpose of this study was to investigate whether BIM polymorphism predicts treatment efficacy of EGFR-TKIs in Chinese NSCLC patients. Patients and methods A cohort of advanced NSCLC patients with EGFR mutations and treated with EGFR-TKIs (gefitinib or erlotinib) were recruited. We drew peripheral blood to determinate BIM deletion status and then compared patients’ clinical outcomes according to the BIM deletion status. Additionally, we electronically searched eligible cohort studies and conducted a meta-analysis to pool event risk. Results The exploratory cohort study included 140 patients. Patients with and without the BIM deletion polymorphism had similar objective response rates (ORRs, 48.5 vs 63.0%, P=0.16), disease control rate (DCR, 93.9 vs 97.0%, P=0.60) and adverse reactions. Similar progression-free survival (PFS) and overall survival (OS) were noted in overall population (P=0.27 for PFS and P=0.61 for OS) and prespecified patient subgroups. The meta-analysis included 10 eligible cohort studies involving 1,317 NSCLC patients. It showed the positive BIM deletion was associated with shorter PFS (hazard ratio =1.45; P=0.02). Nonsignificant differences existed for ORR, DCR and OS. Conclusion The expanded meta-analysis results demonstrated the positive BIM deletion predicts shorter PFS in NSCLC patients after treatment with EGFR-TKIs while other clinical measures do not. A large multicenter well-designed cohort study involving other concurrent genetic alterations is warranted. PMID:28435285
Sun, Si; Yu, Hui; Wang, Huijie; Zhao, Xinmin; Zhao, Xintai; Wu, Xianghua; Qiao, Jie; Chang, Jianhua; Wang, Jialei
2017-01-01
Non-small-cell lung cancer (NSCLC) patients with epidermal growth factor receptor ( EGFR ) mutations might develop primary and secondary resistance to tyrosine kinase inhibitors (TKIs). The proapoptotic protein Bcl-2-like 11 (BIM) is a key modulator of apoptosis triggered by EGFR-TKIs. The recent studies have indicated that some patients with positive EGFR mutations were refractory to EGFR-TKIs if they harbored a BIM deletion polymorphism. The purpose of this study was to investigate whether BIM polymorphism predicts treatment efficacy of EGFR-TKIs in Chinese NSCLC patients. A cohort of advanced NSCLC patients with EGFR mutations and treated with EGFR-TKIs (gefitinib or erlotinib) were recruited. We drew peripheral blood to determinate BIM deletion status and then compared patients' clinical outcomes according to the BIM deletion status. Additionally, we electronically searched eligible cohort studies and conducted a meta-analysis to pool event risk. The exploratory cohort study included 140 patients. Patients with and without the BIM deletion polymorphism had similar objective response rates (ORRs, 48.5 vs 63.0%, P =0.16), disease control rate (DCR, 93.9 vs 97.0%, P =0.60) and adverse reactions. Similar progression-free survival (PFS) and overall survival (OS) were noted in overall population ( P =0.27 for PFS and P =0.61 for OS) and prespecified patient subgroups. The meta-analysis included 10 eligible cohort studies involving 1,317 NSCLC patients. It showed the positive BIM deletion was associated with shorter PFS (hazard ratio =1.45; P =0.02). Nonsignificant differences existed for ORR, DCR and OS. The expanded meta-analysis results demonstrated the positive BIM deletion predicts shorter PFS in NSCLC patients after treatment with EGFR-TKIs while other clinical measures do not. A large multicenter well-designed cohort study involving other concurrent genetic alterations is warranted.
Sidhu-Muñoz, Rebeca S; Sancho, Pilar; Vizcaíno, Nieves
2016-04-15
Mutants in several genes have been obtained on the genetic background of virulent rough (lacking O-polysaccharide) Brucella ovis PA. The target genes encode outer membrane proteins previously associated with the virulence of smooth (bearing O-polysaccharide chains in the lipopolysaccharide) Brucella strains. Multiple attempts to delete omp16, coding for a homologue to peptidoglycan-associated lipoproteins, were unsuccessful, which suggests that Omp16 is probably essential for in vitro survival of B. ovis PA. Single deletion of omp10 or omp19-that encode two other outer membrane lipoproteins--was achieved, but the simultaneous removal of both genes failed, suggesting an essential complementary function between both proteins. Two other deletion mutants, defective in the Tol-C-homologue BepC or in the SP41 adhesin, were also obtained. Surprisingly when compared to previous results obtained with smooth Brucella, none of the B. ovis mutants showed attenuation in the virulence, either in the mouse model or in cellular models of professional and non-professional phagocytes. Additionally, and in contrast to the observations reported with smooth Brucella strains, several properties related to the outer membrane remained almost unaltered. These results evidence new distinctive traits between naturally rough B. ovis and smooth brucellae. Copyright © 2016 Elsevier B.V. All rights reserved.
Ajore, Ram; Raiser, David; McConkey, Marie; Jöud, Magnus; Boidol, Bernd; Mar, Brenton; Saksena, Gordon; Weinstock, David M; Armstrong, Scott; Ellis, Steven R; Ebert, Benjamin L; Nilsson, Björn
2017-04-01
Heterozygous inactivating mutations in ribosomal protein genes (RPGs) are associated with hematopoietic and developmental abnormalities, activation of p53, and altered risk of cancer in humans and model organisms. Here we performed a large-scale analysis of cancer genome data to examine the frequency and selective pressure of RPG lesions across human cancers. We found that hemizygous RPG deletions are common, occurring in about 43% of 10,744 cancer specimens and cell lines. Consistent with p53-dependent negative selection, such lesions are underrepresented in TP53 -intact tumors ( P ≪ 10 -10 ), and shRNA-mediated knockdown of RPGs activated p53 in TP53 -wild-type cells. In contrast, we did not see negative selection of RPG deletions in TP53 -mutant tumors. RPGs are conserved with respect to homozygous deletions, and shRNA screening data from 174 cell lines demonstrate that further suppression of hemizygously deleted RPGs inhibits cell growth. Our results establish RPG haploinsufficiency as a strikingly common vulnerability of human cancers that associates with TP53 mutations and could be targetable therapeutically. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Galli, Alvaro; Cervelli, Tiziana; Schiestl, Robert H
2003-05-01
The DNA polymerase delta (Pol3p/Cdc2p) allele pol3-t of Saccharomyces cerevisiae has previously been shown to increase the frequency of deletions between short repeats (several base pairs), between homologous DNA sequences separated by long inverted repeats, and between distant short repeats, increasing the frequency of genomic deletions. We found that the pol3-t mutation increased intrachromosomal recombination events between direct DNA repeats up to 36-fold and interchromosomal recombination 14-fold. The hyperrecombination phenotype of pol3-t was partially dependent on the Rad52p function but much more so on Rad1p. However, in the double-mutant rad1 Delta rad52 Delta, the pol3-t mutation still increased spontaneous intrachromosomal recombination frequencies, suggesting that a Rad1p Rad52p-independent single-strand annealing pathway is involved. UV and gamma-rays were less potent inducers of recombination in the pol3-t mutant, indicating that Pol3p is partly involved in DNA-damage-induced recombination. In contrast, while UV- and gamma-ray-induced intrachromosomal recombination was almost completely abolished in the rad52 or the rad1 rad52 mutant, there was still good induction in those mutants in the pol3-t background, indicating channeling of lesions into the above-mentioned Rad1p Rad52p-independent pathway. Finally, a heterozygous pol3-t/POL3 mutant also showed an increased frequency of deletions and MMS sensitivity at the restrictive temperature, indicating that even a heterozygous polymerase delta mutation might increase the frequency of genetic instability.
van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K
2014-06-01
Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.
van Lier, Christina J.; Sha, Jian; Kirtley, Michelle L.; Cao, Anthony; Tiner, Bethany L.; Erova, Tatiana E.; Cong, Yingzi; Kozlova, Elena V.; Popov, Vsevolod L.; Baze, Wallace B.
2014-01-01
Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4+ and CD8+ T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection. PMID:24686064
Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos
2015-01-01
Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947
Martin, R.; Walther, A.; Wendland, J.
2004-01-01
Cytoplasmic dynein is a microtubule-associated minus-end-directed motor protein. CaDYN1 encodes the single dynein heavy-chain gene of Candida albicans. The open reading frames of both alleles of CaDYN1 were completely deleted via a PCR-based approach. Cadyn1 mutants are viable but grow more slowly than the wild type. In vivo time-lapse microscopy was used to compare growth of wild-type (SC5314) and dyn1 mutant strains during yeast growth and after hyphal induction. During yeast-like growth, Cadyn1 strains formed chains of cells. Chromosomal TUB1-GFP and HHF1-GFP alleles were used both in wild-type and mutant strains to monitor the orientation of mitotic spindles and nuclear positioning in C. albicans. In vivo fluorescence time-lapse analyses with HHF1-GFP over several generations indicated defects in dyn1 cells in the realignment of spindles with the mother-daughter axis of yeast cells compared to that of the wild type. Mitosis in the dyn1 mutant, in contrast to that of wild-type yeast cells, was very frequently completed in the mother cells. Nevertheless, daughter nuclei were faithfully transported into the daughter cells, resulting in only a small number of multinucleate cells. Cadyn1 mutant strains responded to hypha-inducing media containing l-proline or serum with initial germ tube formation. Elongation of the hyphal tubes eventually came to a halt, and these tubes showed a defect in the tipward localization of nuclei. Using a heterozygous DYN1/dyn1 strain in which the remaining copy was controlled by the regulatable MAL2 promoter, we could switch between wild-type and mutant phenotypes depending on the carbon source, indicating that the observed mutant phenotypes were solely due to deletion of DYN1. PMID:15590831
2018-01-01
ABSTRACT Botrytis cinerea is a plant-pathogenic fungus producing apothecia as sexual fruiting bodies. To study the function of mating type (MAT) genes, single-gene deletion mutants were generated in both genes of the MAT1-1 locus and both genes of the MAT1-2 locus. Deletion mutants in two MAT genes were entirely sterile, while mutants in the other two MAT genes were able to develop stipes but never formed an apothecial disk. Little was known about the reprogramming of gene expression during apothecium development. We analyzed transcriptomes of sclerotia, three stages of apothecium development (primordia, stipes, and apothecial disks), and ascospores by RNA sequencing. Ten secondary metabolite gene clusters were upregulated at the onset of sexual development and downregulated in ascospores released from apothecia. Notably, more than 3,900 genes were differentially expressed in ascospores compared to mature apothecial disks. Among the genes that were upregulated in ascospores were numerous genes encoding virulence factors, which reveals that ascospores are transcriptionally primed for infection prior to their arrival on a host plant. Strikingly, the massive transcriptional changes at the initiation and completion of the sexual cycle often affected clusters of genes, rather than randomly dispersed genes. Thirty-five clusters of genes were jointly upregulated during the onset of sexual reproduction, while 99 clusters of genes (comprising >900 genes) were jointly downregulated in ascospores. These transcriptional changes coincided with changes in expression of genes encoding enzymes participating in chromatin organization, hinting at the occurrence of massive epigenetic regulation of gene expression during sexual reproduction. PMID:29440571
Das, G; Henning, D; Wright, D; Reddy, R
1988-01-01
Whereas the genes coding for trimethyl guanosine-capped snRNAs are transcribed by RNA polymerase II, the U6 RNA genes are transcribed by RNA polymerase III. In this study, we have analyzed the cis-regulatory elements involved in the transcription of a mouse U6 snRNA gene in vitro and in frog oocytes. Transcriptional analysis of mutant U6 gene constructs showed that, unlike most known cases of polymerase III transcription, intragenic sequences except the initiation nucleotide are dispensable for efficient and accurate transcription of U6 gene in vitro. Transcription of 5' deletion mutants in vitro and in frog oocytes showed that the upstream region, within 79 bp from the initiation nucleotide, contains elements necessary for U6 gene transcription. Transcription studies were carried out in frog oocytes with U6 genes containing 5' distal sequence; these studies revealed that the distal element acts as an orientation-dependent enhancer when present upstream to the gene, while it is orientation-independent but distance-dependent enhancer when placed down-stream to the U6 gene. Analysis of 3' deletion mutants showed that the transcription termination of U6 RNA is dependent on a T cluster present on the 3' end of the gene, thus providing further support to other lines of evidence that U6 genes are transcribed by RNA polymerase III. These observations suggest the involvement of a composite of components of RNA polymerase II and III transcription machineries in the transcription of U6 genes by RNA polymerase III. Images PMID:3366121
Zhang, Peng; Tan, Song; Berry, James O; Li, Peng; Ren, Na; Li, Shuang; Yang, Guang; Wang, Wei-Bing; Qi, Xiao-Ting; Yin, Li-Ping
2014-11-07
Malus xiaojinensis iron-regulated transporter 1 (Mx IRT1) is a highly effective inducible iron transporter in the iron efficient plant Malus xiaojinensis. As a multi-pass integral plasma membrane (PM) protein, Mx IRT1 is predicted to consist of eight transmembrane domains, with a putative N-terminal signal peptide (SP) of 1-29 amino acids. To explore the role of the putative SP, constructs expressing Mx IRT1 (with an intact SP) and Mx DsIRT1 (with a deleted SP) were prepared for expression in Arabidopsis and in yeast. Mx IRT1 could rescue the iron-deficiency phenotype of an Arabidopsis irt1 mutant, and complement the iron-limited growth defect of the yeast mutant DEY 1453 (fet3fet4). Furthermore, fluorescence analysis indicated that a chimeric Mx IRT1-eGFP (enhanced Green Fluorescent Protein) construct was translocated into the ER (Endoplasmic reticulum) for the PM sorting pathway. In contrast, the SP-deleted Mx DsIRT1 could not rescue either of the mutant phenotypes, nor direct transport of the GFP signal into the ER. Interestingly, immunoblot analysis indicated that the SP was not cleaved from the mature protein following transport into the ER. Taken together, data presented here provides strong evidence that an uncleaved SP determines ER-targeting of Mx IRT1 during the initial sorting stage, thereby enabling the subsequent transport and integration of this protein into the PM for its crucial role in iron uptake.
Developing a Drosophila Model of Schwannomatosis
2013-02-01
Drosophila melanogaster has become an important model system for cancer studies. Reduced redundancy in the Drosophila genome compared with that of...of high-resolution deletion coverage of the Drosophila melanogaster genome . Nat. Genet. 36, 288-292. Pastor-Pareja, J. C., Wu, M. and Xu. T. (2008...microarray analysis of the entire Drosophila melanogaster genome and compared gene expression profiles of wild type, dCap-D3 and rbf1 mutant
Essential roles for Cdx in murine primitive hematopoiesis.
Brooke-Bisschop, Travis; Savory, Joanne G A; Foley, Tanya; Ringuette, Randy; Lohnes, David
2017-02-15
The Cdx transcription factors play essential roles in primitive hematopoiesis in the zebrafish where they exert their effects, in part, through regulation of hox genes. Defects in hematopoiesis have also been reported in Cdx mutant murine embryonic stem cell models, however, to date no mouse model reflecting the zebrafish Cdx mutant hematopoietic phenotype has been described. This is likely due, in part, to functional redundancy among Cdx members and the early lethality of Cdx2 null mutants. To circumvent these limitations, we used Cre-mediated conditional deletion to assess the impact of concomitant loss of Cdx1 and Cdx2 on murine primitive hematopoiesis. We found that Cdx1/Cdx2 double mutants exhibited defects in primitive hematopoiesis and yolk sac vasculature concomitant with reduced expression of several genes encoding hematopoietic transcription factors including Scl/Tal1. Chromatin immunoprecipitation analysis revealed that Scl was occupied by Cdx2 in vivo, and Cdx mutant hematopoietic yolk sac differentiation defects could be rescued by expression of exogenous Scl. These findings demonstrate critical roles for Cdx members in murine primitive hematopoiesis upstream of Scl. Copyright © 2017 Elsevier Inc. All rights reserved.
Trombley, Michael P; Post, Deborah M B; Rinker, Sherri D; Reinders, Lorri M; Fortney, Kate R; Zwickl, Beth W; Janowicz, Diane M; Baye, Fitsum M; Katz, Barry P; Spinola, Stanley M; Bauer, Margaret E
2015-01-01
Haemophilus ducreyi resists the cytotoxic effects of human antimicrobial peptides (APs), including α-defensins, β-defensins, and the cathelicidin LL-37. Resistance to LL-37, mediated by the sensitive to antimicrobial peptide (Sap) transporter, is required for H. ducreyi virulence in humans. Cationic APs are attracted to the negatively charged bacterial cell surface. In other gram-negative bacteria, modification of lipopolysaccharide or lipooligosaccharide (LOS) by the addition of positively charged moieties, such as phosphoethanolamine (PEA), confers AP resistance by means of electrostatic repulsion. H. ducreyi LOS has PEA modifications at two sites, and we identified three genes (lptA, ptdA, and ptdB) in H. ducreyi with homology to a family of bacterial PEA transferases. We generated non-polar, unmarked mutants with deletions in one, two, or all three putative PEA transferase genes. The triple mutant was significantly more susceptible to both α- and β-defensins; complementation of all three genes restored parental levels of AP resistance. Deletion of all three PEA transferase genes also resulted in a significant increase in the negativity of the mutant cell surface. Mass spectrometric analysis revealed that LptA was required for PEA modification of lipid A; PtdA and PtdB did not affect PEA modification of LOS. In human inoculation experiments, the triple mutant was as virulent as its parent strain. While this is the first identified mechanism of resistance to α-defensins in H. ducreyi, our in vivo data suggest that resistance to cathelicidin LL-37 may be more important than defensin resistance to H. ducreyi pathogenesis.
Analysis of Expression Pattern and Genetic Deletion of Netrin5 in the Developing Mouse
Garrett, Andrew M.; Jucius, Thomas J.; Sigaud, Liam P. R.; Tang, Fu-Lei; Xiong, Wen-Cheng; Ackerman, Susan L.; Burgess, Robert W.
2016-01-01
Boundary cap cells (BCC) are a transient, neural-crest-derived population found at the motor exit point (MEP) and dorsal root entry zone (DREZ) of the embryonic spinal cord. These cells contribute to the central/peripheral nervous system (CNS/PNS) boundary, and in their absence neurons and glia from the CNS migrate into the PNS. We found Netrin5 (Ntn5), a previously unstudied member of the netrin gene family, to be robustly expressed in BCC. We generated Ntn5 knockout mice and examined neurodevelopmental and BCC-related phenotypes. No abnormalities in cranial nerve guidance, dorsal root organization, or sensory projections were found. However, Ntn5 mutant embryos did have ectopic motor neurons (MNs) that migrated out of the ventral horn and into the motor roots. Previous studies have implicated semaphorin6A (Sema6A) in BCC signaling to plexinA2 (PlxnA2)/neuropilin2 (Nrp2) in MNs in restricting MN cell bodies to the ventral horn, particularly in the caudal spinal cord. In Ntn5 mutants, ectopic MNs are likely to be a different population, as more ectopias were found rostrally. Furthermore, ectopic MNs in Ntn5 mutants were not immunoreactive for NRP2. The netrin receptor deleted in colorectal cancer (DCC) is a potential receptor for NTN5 in MNs, as similar ectopic neurons were found in Dcc mutant mice, but not in mice deficient for other netrin receptors. Thus, Ntn5 is a novel netrin family member that is expressed in BCC, functioning to prevent MN migration out of the CNS. PMID:26858598
Nahar, Rahul; Zhai, Weiwei; Zhang, Tong; Takano, Angela; Khng, Alexis J; Lee, Yin Yeng; Liu, Xingliang; Lim, Chong Hee; Koh, Tina P T; Aung, Zaw Win; Lim, Tony Kiat Hon; Veeravalli, Lavanya; Yuan, Ju; Teo, Audrey S M; Chan, Cheryl X; Poh, Huay Mei; Chua, Ivan M L; Liew, Audrey Ann; Lau, Dawn Ping Xi; Kwang, Xue Lin; Toh, Chee Keong; Lim, Wan-Teck; Lim, Bing; Tam, Wai Leong; Tan, Eng-Huat; Hillmer, Axel M; Tan, Daniel S W
2018-01-15
EGFR-mutant lung adenocarcinomas (LUAD) display diverse clinical trajectories and are characterized by rapid but short-lived responses to EGFR tyrosine kinase inhibitors (TKIs). Through sequencing of 79 spatially distinct regions from 16 early stage tumors, we show that despite low mutation burdens, EGFR-mutant Asian LUADs unexpectedly exhibit a complex genomic landscape with frequent and early whole-genome doubling, aneuploidy, and high clonal diversity. Multiple truncal alterations, including TP53 mutations and loss of CDKN2A and RB1, converge on cell cycle dysregulation, with late sector-specific high-amplitude amplifications and deletions that potentially beget drug resistant clones. We highlight the association between genomic architecture and clinical phenotypes, such as co-occurring truncal drivers and primary TKI resistance. Through comparative analysis with published smoking-related LUAD, we postulate that the high intra-tumor heterogeneity observed in Asian EGFR-mutant LUAD may be contributed by an early dominant driver, genomic instability, and low background mutation rates.
Groenewegen, W A; Krul, E S; Schonfeld, G
1993-06-01
We have identified a new truncation of apoB in a large kindred with hypobetalipoproteinemia that arose by an ambiguous deletion of one of four different groups of base-pairs. Eleven affected members of the kindred had total cholesterols (C) of 114 +/- 28, LDL-Cs of 46 +/- 21, and apoBs of 47 +/- 25 (all in mg/dl, mean +/- SD). These levels were lower (P < 0.0001) than in 15 unaffected relatives. On Western blotting, apoB-100 and a second major band corresponding to apoB-52 were seen in the affected individuals. The majority of the plasma apoB-52 was associated with a smaller than normal low density lipoprotein (LDL) particle. The molecular basis for this apoB-52 truncation is a 5-bp deletion, converting the sequence between cDNA nucleotide 7276 and 7283 from 5'-AAGTTAAG-3' into the mutant sequence 5'-AAG-3'. This results in a frameshift starting at amino acid residue 2357 and a termination codon at amino acid residue 2362. Deletion of one of four different groups of five consecutive bases, i.e., AAGTT, AGTTA, GTTAA, and TTAAG, all result in the same mutant sequence. Thus, the precise deletion is ambiguous. We propose that a misaligned pairing mechanism involving repeat sequences is compatible with this deletion mutation. We have noted similar ambiguous deletions associated with apoB-37, apoB-40, and a number of single base deletions and some may also be explained by a misaligned pairing mechanism. Small ambiguous deletions appear to constitute a major proportion of the apoB gene mutation spectrum suggesting that it may be a suitable model for studying the mechanisms of such mutations.
Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F.
2012-01-01
Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 E. coli, but their second generation homozygous progeny do not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5′ and 3′, respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q10. Here we show that the Q9 content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q9 content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. PMID:22735617
Gomez, Fernando; Saiki, Ryoichi; Chin, Randall; Srinivasan, Chandra; Clarke, Catherine F
2012-09-10
Coenzyme Q (ubiquinone or Q) is an essential lipid component of the mitochondrial electron transport chain. In Caenorhabditis elegans Q biosynthesis involves at least nine steps, including the hydroxylation of the hydroquinone ring by CLK-1 and two O-methylation steps mediated by COQ-3. We characterize two C. elegans coq-3 deletion mutants, and show that while each has defects in Q synthesis, their phenotypes are distinct. First generation homozygous coq-3(ok506) mutants are fertile when fed the standard lab diet of Q-replete OP50 Escherichia coli, but their second generation homozygous progeny does not reproduce. In contrast, the coq-3(qm188) deletion mutant remains sterile when fed Q-replete OP50. Quantitative PCR analyses suggest that the longer qm188 deletion may alter expression of the flanking nuo-3 and gdi-1 genes, located 5' and 3', respectively of coq-3 within an operon. We surmise that variable expression of nuo-3, a subunit of complex I, or of gdi-1, a guanine nucleotide dissociation inhibitor, may act in combination with defects in Q biosynthesis to produce a more severe phenotype. The phenotypes of both coq-3 mutants are more drastic as compared to the C. elegans clk-1 mutants. When fed OP50, clk-1 mutants reproduce for many generations, but show reduced fertility, slow behaviors, and enhanced life span. The coq-3 and clk-1 mutants all show arrested development and are sterile when fed the Q-deficient E. coli strain GD1 (harboring a mutation in the ubiG gene). However, unlike clk-1 mutant worms, neither coq-3 mutant strain responded to dietary supplementation with purified exogenous Q(10). Here we show that the Q(9) content can be determined in lipid extracts from just 200 individual worms, enabling the determination of Q content in the coq-3 mutants unable to reproduce. An extra-chromosomal array expressing wild-type C. elegans coq-3 rescued fertility of both coq-3 mutants and partially restored steady-state levels of COQ-3 polypeptide and Q(9) content, indicating that primary defect in both is limited to coq-3. The limited response of the coq-3 mutants to dietary supplementation with Q provides a powerful model to probe the effectiveness of exogenous Q supplementation as compared to restoration of de novo Q biosynthesis. Copyright © 2012 Elsevier B.V. All rights reserved.
Murayama, Yuki; Ogura, Teru; Yamanaka, Kunitoshi
2015-03-27
CDC-48 (also called VCP or p97 in mammals and Cdc48p in yeast) is a AAA (ATPases associated with diverse cellular activities) chaperone and participates in a wide range of cellular activities including modulation of protein complexes and protein aggregates. UFD-2 and UFD-3, C-terminal adaptors for CDC-48, reportedly bind to CDC-48 in a mutually exclusive manner and they may modulate the fate of substrates for CDC-48. However, their cellular functions have not yet been elucidated. In this study, we found that CDC-48 preferentially interacts with UFD-3 in Caenorhabditis elegans. We also found that the number of polyglutamine (polyQ) aggregates was reduced in the ufd-3 deletion mutant but not in the ufd-2 deletion mutant. Furthermore, the lifespan and motility of the ufd-3 deletion mutant, where polyQ40::GFP was expressed, were greatly decreased. Taken together, we propose that UFD-3 may promote the formation of polyQ aggregates to reduce the polyQ toxicity in C. elegans. Copyright © 2015 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Kazama, Yusuke; Ishii, Kotaro; Aonuma, Wataru; Ikeda, Tokihiro; Kawamoto, Hiroki; Koizumi, Ayako; Filatov, Dmitry A.; Chibalina, Margarita; Bergero, Roberta; Charlesworth, Deborah; Abe, Tomoko; Kawano, Shigeyuki
2016-01-01
Sex chromosomes are particularly interesting regions of the genome for both molecular genetics and evolutionary studies; yet, for most species, we lack basic information, such as the gene order along the chromosome. Because they lack recombination, Y-linked genes cannot be mapped genetically, leaving physical mapping as the only option for establishing the extent of synteny and homology with the X chromosome. Here, we developed a novel and general method for deletion mapping of non-recombining regions by solving “the travelling salesman problem”, and evaluate its accuracy using simulated datasets. Unlike the existing radiation hybrid approach, this method allows us to combine deletion mutants from different experiments and sources. We applied our method to a set of newly generated deletion mutants in the dioecious plant Silene latifolia and refined the locations of the sex-determining loci on its Y chromosome map.
Liu, Hongbing; Chen, Shaowei; Yao, Xiao; Li, Yuwen; Chen, Chao-Hui; Liu, Jiao; Saifudeen, Zubaida; El-Dahr, Samir S
2018-05-18
Nephron progenitor cells (NPCs) are Six2-positive metanephric mesenchyme cells, which undergo self-renewal and differentiation to give rise to nephrons until the end of nephrogenesis. Histone deacetylases (HDACs) are a group of epigenetic regulators that control cell fate, but their role in balancing NPC renewal and differentiation is unknown. Here, we report that NPC-specific deletion of Hdac1 and Hdac2 genes in mice results in early postnatal lethality owing to renal hypodysplasia and loss of NPCs. HDAC1/2 interact with the NPC renewal regulators Six2, Osr1 and Sall1, and are co-bound along with Six2 on the Six2 enhancer. Although the mutant NPCs differentiate into renal vesicles (RVs), Hdac1/2 mutant kidneys lack nascent nephrons or mature glomeruli, a phenocopy of Lhx1 mutants. Transcriptional profiling and network analysis identified disrupted expression of Lhx1 and its downstream genes, Dll1 and Hnf1a/4a , as key mediators of the renal phenotype. Finally, although HDAC1/2-deficient NPCs and RVs overexpress hyperacetylated p53, Trp53 deletion failed to rescue the renal dysgenesis. We conclude that the epigenetic regulators HDAC1 and HDAC2 control nephrogenesis via interactions with the transcriptional programs of nephron progenitors and renal vesicles. © 2018. Published by The Company of Biologists Ltd.
Lian, Hui-Yong; Robertson, E Douglas; Hiraga, Shin-ichiro; Alvino, Gina M; Collingwood, David; McCune, Heather J; Sridhar, Akila; Brewer, Bonita J; Raghuraman, M K; Donaldson, Anne D
2011-05-15
DNA replication in Saccharomyces cerevisiae proceeds according to a temporal program. We have investigated the role of the telomere-binding Ku complex in specifying late replication of telomere-proximal sequences. Genome-wide analysis shows that regions extending up to 80 kb from telomeres replicate abnormally early in a yku70 mutant. We find that Ku does not appear to regulate replication time by binding replication origins directly, nor is its effect on telomere replication timing mediated by histone tail acetylation. We show that Ku instead regulates replication timing through its effect on telomere length, because deletion of the telomerase regulator Pif1 largely reverses the short telomere defect of a yku70 mutant and simultaneously rescues its replication timing defect. Consistent with this conclusion, deleting the genome integrity component Elg1 partially rescued both length and replication timing of yku70 telomeres. Telomere length-mediated control of replication timing requires the TG(1-3) repeat-counting component Rif1, because a rif1 mutant replicates telomeric regions early, despite having extended TG(1-3) tracts. Overall, our results suggest that the effect of Ku on telomere replication timing results from its impact on TG(1-3) repeat length and support a model in which Rif1 measures telomere repeat length to ensure that telomere replication timing is correctly programmed.
USDA-ARS?s Scientific Manuscript database
Quality Protein Maize (QPM) is a hard kernel variant of the high-lysine mutant, opaque-2. Using gamma irradiation, we created opaque QPM variants to identify opaque-2 modifier genes and to investigate deletion mutagenesis combined with Illumina sequencing as a maize functional genomics tool. A K0326...
Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter
2017-05-31
Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.
Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall’Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter
2017-01-01
Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome. PMID:28561789
USDA-ARS?s Scientific Manuscript database
Genomes from fifteen porcine reproductive and respiratory syndrome virus (PRRSV) isolates were derived simultaneously using 454 pyrosequencing technology. The viral isolates sequenced were from a recent swine study, in which engineered Type 2 prototype PRRSV strain VR-2332 mutants, with 87, 184, 200...
Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Do, Loc Thi Binh Xuan; Mai, Linh Thi Dam; Pham, Duc-Ngoc; Tran, Huyen Thi Thanh; Le, Diep Hong; Nguyen, Huy Quang; Tran, Van-Tuan
2017-06-01
Aspergillus oryzae is a filamentous fungus widely used in food industry and as a microbial cell factory for recombinant protein production. Due to the inherent resistance of A. oryzae to common antifungal compounds, genetic transformation of this mold usually requires auxotrophic mutants. In this study, we show that Agrobacterium tumefaciens-mediated transformation (ATMT) method is very efficient for deletion of the pyrG gene in different Aspergillus oryzae wild-type strains to generate uridine/uracil auxotrophic mutants. Our data indicated that all the obtained uridine/uracil auxotrophic transformants, which are 5- fluoroorotic acid (5-FOA) resistant, exist as the pyrG deletion mutants. Using these auxotrophic mutants and the pyrG selectable marker for genetic transformation via A. tumefaciens, we could get about 1060 transformants per 10 6 fungal spores. In addition, these A. oryzae mutants were also used successfully for expression of the DsRed fluorescent reporter gene under control of the A. oryzae amyB promoter by the ATMT method, which resulted in obvious red transformants on agar plates. Our work provides a new and effective approach for constructing the uridine/uracil auxotrophic mutants in the importantly industrial fungus A. oryzae. This strategy appears to be applicable to other filamentous fungi to develop similar genetic transformation systems based on auxotrophic/nutritional markers for food-grade recombinant applications.
Gangaiah, Dharanesh; Li, Wei; Fortney, Kate R; Janowicz, Diane M; Ellinger, Sheila; Zwickl, Beth; Katz, Barry P; Spinola, Stanley M
2013-02-01
The carbon storage regulator A (CsrA) controls a wide variety of bacterial processes, including metabolism, adherence, stress responses, and virulence. Haemophilus ducreyi, the causative agent of chancroid, harbors a homolog of csrA. Here, we generated an unmarked, in-frame deletion mutant of csrA to assess its contribution to H. ducreyi pathogenesis. In human inoculation experiments, the csrA mutant was partially attenuated for pustule formation compared to its parent. Deletion of csrA resulted in decreased adherence of H. ducreyi to human foreskin fibroblasts (HFF); Flp1 and Flp2, the determinants of H. ducreyi adherence to HFF cells, were downregulated in the csrA mutant. Compared to its parent, the csrA mutant had a significantly reduced ability to tolerate oxidative stress and heat shock. The enhanced sensitivity of the mutant to oxidative stress was more pronounced in bacteria grown to stationary phase compared to that in bacteria grown to mid-log phase. The csrA mutant also had a significant survival defect within human macrophages when the bacteria were grown to stationary phase but not to mid-log phase. Complementation in trans partially or fully restored the mutant phenotypes. These data suggest that CsrA contributes to virulence by multiple mechanisms and that these contributions may be more profound in bacterial cell populations that are not rapidly dividing in the human host.
2011-01-01
Background Visceral leishmaniasis is the most severe form of leishmaniasis and no effective vaccine exists. The use of live attenuated vaccines is emerging as a promising vaccination strategy. Results In this study, we tested the ability of a Leishmania infantum deletion mutant, lacking both HSP70-II alleles (ΔHSP70-II), to provide protection against Leishmania infection in the L. major-BALB/c infection model. Administration of the mutant line by either intraperitoneal, intravenous or subcutaneous route invariably leads to the production of high levels of NO and the development in mice of type 1 immune responses, as determined by analysis of anti-Leishmania IgG subclasses. In addition, we have shown that ΔHSP70-II would be a safe live vaccine as immunodeficient SCID mice, and hamsters (Mesocricetus auratus), infected with mutant parasites did not develop any sign of pathology. Conclusions The results suggest that the ΔHSP70-II mutant is a promising and safe vaccine, but further studies in more appropriate animal models (hamsters and dogs) are needed to appraise whether this attenuate mutant would be useful as vaccine against visceral leishmaniasis. PMID:21794145
A yeast-based genetic screening to identify human proteins that increase homologous recombination.
Collavoli, Anita; Comelli, Laura; Rainaldi, Giuseppe; Galli, Alvaro
2008-05-01
To identify new human proteins implicated in homologous recombination (HR), we set up 'a papillae assay' to screen a human cDNA library using the RS112 strain of Saccharomyces cerevisiae containing an intrachromosomal recombination substrate. We isolated 23 cDNAs, 11 coding for complete proteins and 12 for partially deleted proteins that increased HR when overexpressed in yeast. We characterized the effect induced by the overexpression of the complete human proteasome subunit beta 2, the partially deleted proteasome subunits alpha 3 and beta 8, the ribosomal protein L12, the brain abundant membrane signal protein (BASP1) and the human homologue to v-Ha-RAS (HRAS), which elevated HR by 2-6.5-fold over the control. We found that deletion of the RAD52 gene, which has a key role in most HR events, abolished the increase of HR induced by the proteasome subunits and HRAS; by contrast, the RAD52 deletion did not affect the high level of HR due to BASP1 and RPL12. This suggests that the proteins stimulated yeast HR via different mechanisms. Overexpression of the complete beta 2 human proteasome subunit or the partially deleted alpha 3 and beta 8 subunits increased methyl methanesulphonate (MMS) resistance much more in the rad52 Delta mutant than in the wild-type. Overexpression of RPL12 and BASP1 did not affect MMS resistance in both the wild-type and the rad52 Delta mutant, whereas HRAS decreased MMS resistance in the rad52 Delta mutant. The results indicate that these proteins may interfere with the pathway(s) involved in the repair of MMS-induced DNA damage. Finally, we provide further evidence that yeast is a helpful tool to identify human proteins that may have a regulatory role in HR.
Lin, Yu; Xing, Zhen; She, Dejun; Yang, Xiefeng; Zheng, Yingyan; Xiao, Zebin; Wang, Xingfu; Cao, Dairong
2017-06-01
Currently, isocitrate dehydrogenase (IDH) mutation and 1p/19q co-deletion are proven diagnostic biomarkers for both grade II and III oligodendrogliomas (ODs). Non-invasive diffusion-weighted imaging (DWI), susceptibility-weighted imaging (SWI), and dynamic susceptibility contrast perfusion-weighted imaging (DSC-PWI) are widely used to provide physiological information (cellularity, hemorrhage, calcifications, and angiogenesis) of neoplastic histology and tumor grade. However, it is unclear whether DWI, SWI, and DSC-PWI are able to stratify grades of IDH-mutant and 1p/19q co-deleted ODs. We retrospectively reviewed the conventional MRI (cMRI), DWI, SWI, and DSC-PWI obtained on 33 patients with IDH-mutated and 1p/19q co-deleted ODs. Features of cMRI, normalized ADC (nADC), intratumoral susceptibility signals (ITSSs), normalized maxim CBV (nCBV), and normalized maximum CBF (nCBF) were compared between low-grade ODs (LGOs) and high-grade ODs (HGOs). Receiver operating characteristic curve and logistic regression were applied to determine diagnostic performances. HGOs tended to present with prominent edema and enhancement. nADC, ITSSs, nCBV, and nCBF were significantly different between groups (all P < 0.05). The combination of SWI and DSC-PWI for grading resulted in sensitivity and specificity of 100.00 and 93.33%, respectively. IDH-mutant and 1p/19q co-deleted ODs can be stratified by grades using cMRI and advanced magnetic resonance imaging techniques including DWI, SWI, and DSC-PWI. Combined ITSSs with nCBV appear to be a promising option for grading molecularly defined ODs in clinical practice.
Qiu, Z; Hobman, T C; McDonald, H L; Seto, N O; Gillam, S
1992-01-01
The role of N-linked glycosylation in processing and intracellular transport of rubella virus glycoprotein E2 has been studied by expressing glycosylation mutants of E2 in COS cells. A panel of E2 glycosylation mutants were generated by oligonucleotide-directed mutagenesis. Each of the three potential N-linked glycosylation sites was eliminated separately as well as in combination with the other two sites. Expression of the E2 mutant proteins in COS cells indicated that in rubella virus M33 strain, all three sites are used for the addition of N-linked oligosaccharides. Removal of any of the glycosylation sites resulted in slower glycan processing, lower stability, and aberrant disulfide bonding of the mutant proteins, with the severity of defect depending on the number of deleted carbohydrate sites. The mutant proteins were transported to the endoplasmic reticulum and Golgi complex but were not detected on the cell surface. However, the secretion of the anchor-free form of E2 into the medium was not completely blocked by the removal of any one of its glycosylation sites. This effect was dependent on the position of the deleted glycosylation site. Images PMID:1583721
A genome-wide screen of bacterial mutants that enhance dauer formation in C. elegans.
Khanna, Amit; Kumar, Jitendra; Vargas, Misha A; Barrett, LaKisha; Katewa, Subhash; Li, Patrick; McCloskey, Tom; Sharma, Amit; Naudé, Nicole; Nelson, Christopher; Brem, Rachel; Killilea, David W; Mooney, Sean D; Gill, Matthew; Kapahi, Pankaj
2016-12-13
Molecular pathways involved in dauer formation, an alternate larval stage that allows Caenorhabditis elegans to survive adverse environmental conditions during development, also modulate longevity and metabolism. The decision to proceed with reproductive development or undergo diapause depends on food abundance, population density, and temperature. In recent years, the chemical identities of pheromone signals that modulate dauer entry have been characterized. However, signals derived from bacteria, the major source of nutrients for C. elegans, remain poorly characterized. To systematically identify bacterial components that influence dauer formation and aging in C. elegans, we utilized the individual gene deletion mutants in E. coli (K12). We identified 56 diverse E. coli deletion mutants that enhance dauer formation in an insulin-like receptor mutant (daf-2) background. We describe the mechanism of action of a bacterial mutant cyaA, that is defective in the production of cyclic AMP, which extends lifespan and enhances dauer formation through the modulation of TGF-β (daf-7) signaling in C. elegans. Our results demonstrate the importance of bacterial components in influencing developmental decisions and lifespan in C. elegans. Furthermore, we demonstrate that C. elegans is a useful model to study bacterial-host interactions.
Speed genome editing by transient CRISPR/Cas9 targeting and large DNA fragment deletion.
Luo, Jing; Lu, Liaoxun; Gu, Yanrong; Huang, Rong; Gui, Lin; Li, Saichao; Qi, Xinhui; Zheng, Wenping; Chao, Tianzhu; Zheng, Qianqian; Liang, Yinming; Zhang, Lichen
2018-06-07
Genetic engineering of cell lines and model organisms has been facilitated enormously by the CRISPR/Cas9 system. However, in cell lines it remains labor intensive and time consuming to obtain desirable mutant clones due to the difficulties in isolating the mutated clones and sophisticated genotyping. In this study, we have validated fluorescent protein reporter aided cell sorting which enables the isolation of maximal diversity in mutant cells. We further applied two spectrally distinct fluorescent proteins DsRed2 and ECFP as reporters for independent CRISPR/Cas9 mediated targeting, which allows for one-cell-one-well sorting of the mutant cells. Because of ultra-high efficiency of the CRISPR/Cas9 system with dual reporters and large DNA fragment deletion resulting from independent loci cleavage, monoclonal mutant cells could be easily identified by conventional PCR. In the speed genome editing method presented here, sophisticated genotyping methods are not necessary to identify loss of function mutations after CRISPR/Cas9 genome editing, and desirable loss of function mutant clones could be obtained in less than one month following transfection. Copyright © 2018 Elsevier B.V. All rights reserved.
Brenner, John L.; Jasiewicz, Kristen L.; Fahley, Alisha F.; Kemp, Benedict J.; Abbott, Allison L.
2010-01-01
Summary MicroRNAs (miRNAs) are small, non-coding RNAs that regulate the translation and/or the stability of their mRNA targets. Previous work showed that for most miRNA genes of C. elegans, single gene knockouts did not result in detectable mutant phenotypes [1]. This may be due, in part, to functional redundancy between miRNAs. However, in most cases, worms carrying deletions of all members of a miRNA family do not display strong mutant phenotypes [2]. They may function together with unrelated miRNAs or with non-miRNA genes in regulatory networks, possibly to ensure the robustness of developmental mechanisms. To test this, we examined worms lacking individual miRNAs in genetically sensitized backgrounds. These include genetic backgrounds with reduced processing and activity of all miRNAs or with reduced activity of a wide array of regulatory pathways [3]. Using these two approaches, mutant phenotypes were identified for 25 out of 31 miRNAs included in this analysis. Our findings describe biological roles for individual miRNAs and suggest that use of sensitized genetic backgrounds provides an efficient approach for miRNA functional analysis. PMID:20579881
A CRISPR Cas9-based gene drive platform for genetic interaction analysis in Candida albicans
Shapiro, Rebecca S.; Chavez, Alejandro; Porter, Caroline B. M.; Hamblin, Meagan; Kaas, Christian S.; DiCarlo, James E.; Zeng, Guisheng; Xu, Xiaoli; Revtovich, Alexey V.; Kirienko, Natalia V.; Wang, Yue; Church, George M.; Collins, James J.
2018-01-01
Candida albicans is the leading cause of fungal infections; yet, complex genetic interaction analysis remains cumbersome in this diploid pathogen. Here, we developed a CRISPR-Cas9-based ‘gene drive array’ (GDA) platform to facilitate efficient genetic analysis in C. albicans. In our system, a modified DNA donor molecule acts as a selfish genetic element, replaces the targeted site, and propagates to replace additional wild-type loci. Using mating-competent C. albicans haploids, each carrying a different gene drive disabling a gene of interest, we are able to create diploid strains that are homozygous double-deletion mutants. We generate double-gene deletion libraries to demonstrate this technology, targeting antifungal efflux and biofilm adhesion factors. We screen these libraries to identify virulence regulators and determine how genetic networks shift under diverse conditions. This platform transforms our ability to perform genetic interaction analysis in C. albicans and is readily extended to other fungal pathogens. PMID:29062088
Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R
2017-07-01
Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.
Wu, Yao; Du, Jie; Xu, Guoqiang; Jiang, Linghuo
2016-05-01
Saccharomyces cerevisiae is the most widely used fermentation organism for ethanol production. However, the gene expression regulatory networks behind the ethanol fermentation are still not fully understood. Using a static fermentation model, we examined the ethanol yields on biomass of deletion mutants for 77 yeast genes encoding nonessential transcription factors, and found that deletion mutants for ACE2 and SWI5 showed dramatically increased ethanol yields. Overexpression of ACE2 or SWI5 in wild type cells reduced their ethanol yields. Furthermore, among the 34 target genes regulated by Ace2 and Swi5, deletion of CTS1,RPS4a,SIC1,EGT2,DSE2, or SCP160 led to increased ethanol yields, with the former two showing higher effects. Overexpression of CTS1 or RPS4a in both ace2/ace2 and swi5/swi5 mutants reduced their ethanol yields. In contrast, deletion of MCR1 or HO significantly decreased ethanol yields, with the former one showing the highest effect. Therefore, Ace2 and Swi5 are two negative regulators of ethanol yield during static fermentation of yeast cells, and both CTS1 and RPS4a are major effectors mediating these two transcription factors in regulating ethanol production. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Teng, Ching-Hao; Xie, Yi; Shin, Sooan; Di Cello, Francescopaolo; Paul-Satyaseela, Maneesh; Cai, Mian; Kim, Kwang Sik
2006-10-01
We have previously shown that outer membrane protein A (OmpA) and type 1 fimbriae are the bacterial determinants involved in Escherichia coli K1 binding to human brain microvascular endothelial cells (HBMEC), which constitute the blood-brain barrier. In investigating the role of OmpA in E. coli K1 binding to HBMEC, we showed for the first time that ompA deletion decreased the expression of type 1 fimbriae in E. coli K1. Decreased expression of type 1 fimbriae in the ompA deletion mutant was largely the result of driving the fim promoter toward the type 1 fimbrial phase-OFF orientation. mRNA levels of fimB and fimE were found to be decreased with the OmpA mutant compared to the parent strain. Of interest, the ompA deletion further decreased the abilities of E. coli K1 to bind to and invade HBMEC under the conditions of fixing type 1 fimbria expression in the phase-ON or phase-OFF status. These findings suggest that the decreased ability of the OmpA mutant to interact with HBMEC is not entirely due to its decreased type 1 fimbrial expression and that OmpA and type 1 fimbriae facilitate the interaction of E. coli K1 with HBMEC at least in an additive manner.
Chayakulkeeree, Methee; Johnston, Simon Andrew; Oei, Johanes Bijosono; Lev, Sophie; Williamson, Peter Richard; Wilson, Christabel Frewen; Zuo, Xiaoming; Leal, Ana Lusia; Vainstein, Marilene Henning; Meyer, Wieland; Sorrell, Tania Christine; May, Robin Charles; Djordjevic, Julianne Teresa
2011-01-01
Summary Secreted phospholipase B1 (CnPlb1) is essential for dissemination of Cryptococcus neoformans to the central nervous system (CNS) yet essential components of its secretion machinery remain to be elucidated. Using gene deletion analysis we demonstrate that CnPlb1 secretion is dependent on the CnSEC14 product, CnSec14-1p. CnSec14-1p is a homologue of the phosphatidylinositol transfer protein (PITP) ScSec14p, which is essential for secretion and viability in Saccharomyces cerevisiae. In contrast to CnPlb1, neither laccase 1 (Lac1)-induced melanization within the cell wall nor capsule induction were negatively impacted in CnSEC14-1 deletion mutants (CnΔsec14-1 and CnΔsec14-1CnΔsfh5). Similar to the CnPLB1 deletion mutant (CnΔplb1), CnΔsec14-1 was hypo-virulent in mice and did not disseminate to the CNS by day 14 post infection. Furthermore, macrophage expulsion of live CnΔsec14-1 and CnΔplb1 (vomocytosis) was reduced. Individual deletion of CnSEC14-2, a closely-related CnSEC14-1 homologue, and CnSFH5, a distantly-related SEC fourteen-like homologue, did not abrogate CnPlb1 secretion or virulence. However, reconstitution of CnΔsec14-1 with CnSEC14-1 or CnSEC14-2 restored both phenotypes, consistent with functional genetic redundancy. We conclude that CnPlb1 secretion is SEC14-dependent and that C. neoformans preferentially exports virulence determinants to the cell periphery via distinct pathways. We also demonstrate that CnPlb1 secretion is essential for vomocytosis. PMID:21453402
A test of the transcription model for biased inheritance of yeast mitochondrial DNA.
Lorimer, H E; Brewer, B J; Fangman, W L
1995-09-01
Two strand-specific origins of replication appear to be required for mammalian mitochondrial DNA (mtDNA) replication. Structural equivalents of these origins are found in the rep sequences of Saccharomyces cerevisiae mtDNA. These striking similarities have contributed to a universal model for the initiation of mtDNA replication in which a primer is created by cleavage of an origin region transcript. Consistent with this model are the properties of deletion mutants of yeast mtDNA ([rho-]) with a high density of reps (HS [rho-]). These mutant mtDNAs are preferentially inherited by the progeny resulting from the mating of HS [rho-] cells with cells containing wild-type mtDNA ([rho+]). This bias is presumed to result from a replication advantage conferred on HS [rho-] mtDNA by the high density of rep sequences acting as origins. To test whether transcription is indeed required for the preferential inheritance of HS [rho-] mtDNA, we deleted the nuclear gene (RPO41) for the mitochondrial RNA polymerase, reducing transcripts by at least 1000-fold. Since [rho-] genomes, but not [rho+] genomes, are stable when RPO41 is deleted, we examined matings between HS [rho-] and neutral [rho-] cells. Neutral [rho-] mtDNAs lack rep sequences and are not preferentially inherited in [rho-] x [rho+] crosses. In HS [rho-] x neutral [rho-] matings, the HS [rho-] mtDNA was preferentially inherited whether both parents were wild type or both were deleted for RPO41. Thus, transcription from the rep promoter does not appear to be necessary for biased inheritance. Our results, and analysis of the literature, suggest that priming by transcription is not a universal mechanism for mtDNA replication initiation.
Nishimoto, Takuto; Watanabe, Takeru; Furuta, Masakazu; Kataoka, Michihiko; Kishida, Masao
2016-01-01
The roles of catalase and trehalose in Saccharomyces cerevisiae subject to hydrogen peroxide (H2O2) treatment were examined by measuring the catalase activity and intracellular trehalose levels in mutants lacking catalase or trehalose synthetase. Intracellular trehalose was elevated but the survival rate after H2O2 treatment remained low in mutants with deletion of the Catalase T gene. On the other hand, deletion of the trehalose synthetase gene increased the catalase activity in mutated yeast to levels higher than those in the wild-type strain, and these mutants exhibited some degree of tolerance to H2O2 treatment. These results suggest that Catalase T is critical in the yeast response to oxidative damage caused by H2O2 treatment, but trehalose also plays a role in protection against H2O2 treatment.
Zhou, Mingxu; Guo, Zhiyan; Yang, Yang; Duan, Qiangde; Zhang, Qi; Yao, Fenghua; Zhu, Jun; Zhang, Xinjun; Hardwidge, Philip R; Zhu, Guoqiang
2014-01-10
Bacteria that form biofilms are often highly resistant to antibiotics and are capable of evading the host immune system. To evaluate the role of flagellin and F4 fimbriae on biofilm formation by enterotoxigenic Escherichia coli (ETEC), we deleted the fliC (encoding the major flagellin protein) and/or the faeG (encoding the major subunit of F4 fimbriae) genes from ETEC C83902. Biofilm formation was reduced in the fliC mutant but increased in the faeG mutant, as compared with the wild-type strain. The expression of AI-2 quorum sensing associated genes was regulated in the fliC and faeG mutants, consistent with the biofilm formation of these strains. But, deleting fliC and/or faeG also inhibited AI-2 quorum sensing activity. Copyright © 2013 Elsevier B.V. All rights reserved.
Data on quantification of signaling pathways activated by KIT and PDGFRA mutants.
Bahlawane, Christelle; Schmitz, Martine; Letellier, Elisabeth; Arumugam, Karthik; Nicot, Nathalie; Nazarov, Petr V; Haan, Serge
2016-12-01
The present data are related to the article entitled "Insights into ligand stimulation effects on gastro-intestinal stromal tumors signaling" (C. Bahlawane, M. Schmitz, E. Letellier, K. Arumugam, N. Nicot, P.V. Nazarov, S. Haan, 2016) [1]. Constitutive and ligand-derived signaling pathways mediated by KIT and PDGFRA mutated proteins found in gastrointestinal stromal tumors (GIST) were compared. Expression of mutant proteins was induced by doxycycline in an isogenic background (Hek293 cells). Kit was identified by FACS at the cell surface and found to be quickly degraded or internalized upon SCF stimulation for both Kit Wild type and Kit mutant counterparts. Investigation of the main activated pathways in GIST unraveled a new feature specific for oncogenic KIT mutants, namely their ability to be further activated by Kit ligand, the stem cell factor (scf). We were also able to identify the MAPK pathway as the most prominent target for a common inhibition of PDGFRA and KIT oncogenic signaling. Western blotting and micro-array analysis were applied to analyze the capacities of the mutant to induce an effective STATs response. Among all Kit mutants, only Kit Ex11 deletion mutant was able to elicit an effective STATs response whereas all PDGFRA were able to do so.
Allen, John C.; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A.; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C.; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J.; Tan, Daniel S.; Tan, Eng-Huat; Ong, S. Tiong; Lim, Wan-Teck
2017-01-01
Background A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. Results In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06–2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251–2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603–4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063–1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. Materials and Methods 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. Conclusions In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised. PMID:28467813
Rey, María-Dolores; Martín, Azahara C; Smedley, Mark; Hayta, Sadiye; Harwood, Wendy; Shaw, Peter; Moore, Graham
2018-01-01
Wild relatives provide an important source of useful traits in wheat breeding. Wheat and wild relative hybrids have been widely used in breeding programs to introduce such traits into wheat. However, successful introgression is limited by the low frequency of homoeologous crossover (CO) between wheat and wild relative chromosomes. Hybrids between wheat carrying a 70 Mb deletion on chromosome 5B ( ph1b ) and wild relatives, have been exploited to increase the level of homoeologous CO, allowing chromosome exchange between their chromosomes. In ph1b -rye hybrids, CO number increases from a mean of 1 CO to 7 COs per cell. CO number can be further increased up to a mean of 12 COs per cell in these ph1b hybrids by treating the plants with Hoagland solution. More recently, it was shown that the major meiotic crossover gene ZIP4 on chromosome 5B ( TaZIP4-B2 ) within the 70 Mb deletion, was responsible for the restriction of homoeologous COs in wheat-wild relative hybrids, confirming the ph1b phenotype as a complete Tazip4-B2 deletion mutant ( Tazip4-B2 ph1b) . In this study, we have identified the particular Hoagland solution constituent responsible for the increased chiasma frequency in Tazip4-B2 ph1b mutant-rye hybrids and extended the analysis to Tazip4-B2 TILLING and CRISPR mutant- Ae variabilis hybrids. Chiasma frequency at meiotic metaphase I, in the absence of each Hoagland solution macronutrient (NH 4 H 2 PO 4 , KNO 3 , Ca (NO 3 )2·4H 2 O or Mg SO 4 ·7H 2 O) was analyzed. A significant decrease in homoeologous CO frequency was observed when the Mg 2+ ion was absent. A significant increase of homoeologous CO frequency was observed in all analyzed hybrids, when plants were irrigated with a 1 mM Mg 2+ solution. These observations suggest a role for magnesium supplementation in improving the success of genetic material introgression from wild relatives into wheat.
Harren, Karin
2013-01-01
In the filamentous phytopathogen Botrytis cinerea, the Ca2+/calcineurin signaling cascade has been shown to play an important role in fungal growth, differentiation, and virulence. This study deals with the functional characterization of two components of this pathway, the putative calcium channel proteins Cch1 and Mid1. The cch1 and mid1 genes were deleted, and single and double knockout mutants were analyzed during different stages of the fungal life cycle. Our data indicate that Cch1 and Mid1 are functionally required for vegetative growth under conditions of low extracellular calcium, since the growth of both deletion mutants is strongly impaired when they are exposed to the Ca2+-chelating agents EGTA and 1,2-bis(o-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid (BAPTA). The impact of external Ca2+ was investigated by supplementing with CaCl2 and the ionophore A23187, both of which resulted in elevated growth for all mutants. However, deletion of either gene had no impact on germination, sporulation, hyphal morphology, or virulence. By use of the aequorin reporter system to measure intracellular calcium levels, no differences between the mutant strains and the wild type were obtained. Localization studies revealed a subcellular distribution of the Mid1–green fluorescent protein (GFP) fusion protein in network-like filaments, probably the endoplasmic reticulum (ER) membranes, indicating that Mid1 is not a plasma membrane-located calcium channel in B. cinerea. PMID:23475703
Wang, Zhao; Zhang, Hong; Liu, Caiyun; Xing, Junjie; Chen, Xiao-Lin
2018-01-01
Ubiquitination is an essential protein modification in eukaryotic cells, which is reversible. Deubiquitinating enzymes (DUBs) catalyze deubiquitination process to reverse ubiquitination, maintain ubiquitin homeostasis or promote protein degradation by recycling ubiquitins. In order to investigate effects of deubiquitination process in plant pathogenic fungus Magnaporthe oryzae , we generated deletion mutants of MoUBP14 . Ortholog of MoUbp14 was reported to play general roles in ubiquitin-mediated protein degradation in Saccharomyces cerevisiae . The Δ Moubp14 mutant lost its pathogenicity and was severely reduced in mycelial growth, sporulation, carbon source utilization, and increased in sensitivity to distinct stresses. The mutant was blocked in penetration, which could due to defect in turgor generation. It is also blocked in invasive growth, which could due to reduction in stress tolerance and nutrient utilization. Deletion of UBP14 also led to accumulation of free polyubiquitin chains. Pulldown assay identified some proteins related to carbohydrate metabolism and stress response may putatively interact with MoUbp14, including two key rate-limiting enzymes of gluconeogenesis, MoFbp1 and MoPck1. These two proteins were degraded when the glucose was supplied to M. oryzae grown in low glucose media for a short period of time (∼12 h), and this process required MoUbp14. In summary, pleiotropic phenotypes of the deletion mutants indicated that MoUbp14 is required for different developments and pathogenicity of M. oryzae .
NASA Technical Reports Server (NTRS)
Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.
1997-01-01
A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.
de Paiva, Jacqueline Boldrin; Penha Filho, Rafael Antonio Casarin; Arguello, Yuli Melisa Sierra; Berchieri Junior, Ângelo; Lemos, Manuel Victor Franco; Barrow, Paul A.
2009-01-01
Salmonella enterica serovar Gallinarum (SG) is a fowl typhoid agent in chickens and is a severe disease with worldwide economic impact as its mortality may reach up to 80%. It is one of a small group of serovars that typically produces typhoid-like infections in a narrow range of host species and which therefore represents a good model for human typhoid. The survival mechanisms are not considered to be virulent mechanisms but are essential for the life of the bacterium. Mutants of Salmonella Gallinarum containing defective genes, related to cobalamin biosynthesis and which Salmonella spp. has to be produced to survive when it is in an anaerobic environment, were produced in this study. Salmonella Gallinarum is an intracellular parasite. Therefore, this study could provide information about whether vitamin B12 biosynthesis might be essential to its survival in the host. The results showed that the singular deletion in cbiA or cobS genes did not interfere in the life of Salmonella Gallinarum in the host, perhaps because single deletion is not enough to impede vitamin B12 biosynthesis. It was noticed that diluted SG mutants with single deletion produced higher mortality than the wild strain of SG. When double mutation was carried out, the Salmonella Gallinarum mutant was unable to provoke mortality in susceptible chickens. This work showed that B12 biosynthesis is a very important step in the metabolism of Salmonella Gallinarum during the infection of the chickens. Further research on bacterium physiology should be carried out to elucidate the events described in this research and to assess the mutant as a vaccine strain. PMID:24031393
NASA Technical Reports Server (NTRS)
Kraemer, S. M.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)
1997-01-01
Small mutations, megabase deletions, and aneuploidy are involved in carcinogenesis and genetic defects, so it is important to be able to quantify these mutations and understand mechanisms of their creation. We have previously quantified a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in a hamster-human hybrid cell line AL. S1- mutants have lost expression of a human cell surface antigen, S1, which is encoded by the M1C1 gene at 11p13 so that mutants can be detected via a complement-mediated cytotoxicity assay in which S1+ cells are killed and S1- cells survive. But loss of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the AL hybrid, so that mutants that have lost the entire chromosome 11 die and escape detection. To circumvent this, we fused AL with Chinese hamster ovary (CHO) cells to produce a new hybrid, ALC, in which the requirement for maintaining 11p15.5 is relieved, allowing us to detect mutations events involving loss of 11p15.5. We evaluated the usefulness of this hybrid by conducting mutagenesis studies with colcemid, 137Cs gamma-radiation and UV 254 nm light. Colcemid induced 1000 more S1- mutants per unit dose in ALC than in AL; the increase for UV 254 nm light was only two-fold; and the increase for 137Cs gamma-rays was 12-fold. The increase in S1- mutant fraction in ALC cells treated with colcemid and 137Cs gamma-rays were largely due to chromosome loss and 11p deletions often containing a breakpoint within the centromeric region.
van Lidth de Jeude, J F; Meijer, B J; Wielenga, M C B; Spaan, C N; Baan, B; Rosekrans, S L; Meisner, S; Shen, Y H; Lee, A S; Paton, J C; Paton, A W; Muncan, V; van den Brink, G R; Heijmans, J
2017-06-15
Intestinal epithelial stem cells are highly sensitive to differentiation induced by endoplasmic reticulum (ER) stress. Colorectal cancer develops from mutated intestinal epithelial stem cells. The most frequent initiating mutation occurs in Apc, which results in hyperactivated Wnt signalling. This causes hyperproliferation and reduced sensitivity to chemotherapy, but whether these mutated stem cells are sensitive to ER stress induced differentiation remains unknown. Here we examined this by generating mice in which both Apc and ER stress repressor chaperone Grp78 can be conditionally deleted from the intestinal epithelium. For molecular studies, we used intestinal organoids derived from these mice. Homozygous loss of Apc alone resulted in crypt elongation, activation of the Wnt signature and accumulation of intestinal epithelial stem cells, as expected. This phenotype was however completely rescued on activation of ER stress by additional deletion of Grp78. In these Apc-Grp78 double mutant animals, stem cells were rapidly lost and repopulation occurred by non-mutant cells that had escaped recombination, suggesting that Apc-Grp78 double mutant stem cells had lost self-renewal capacity. Although in Apc-Grp78 double mutant mice the Wnt signature was lost, these intestines exhibited ubiquitous epithelial presence of nuclear β-catenin. This suggests that ER stress interferes with Wnt signalling downstream of nuclear β-catenin. In conclusion, our findings indicate that ER stress signalling results in loss of Apc mutated intestinal epithelial stem cells by interference with the Wnt signature. In contrast to many known inhibitors of Wnt signalling, ER stress acts downstream of β-catenin. Therefore, ER stress poses a promising target in colorectal cancers, which develop as a result of Wnt activating mutations.
Qian, Chen; Johs, Alexander; Chen, Hongmei; ...
2016-07-27
Geobacter sulfurreducens PCA can reduce, sorb, and methylate mercury (Hg); however, the underlying biochemical mechanisms of these processes and interdependent metabolic pathways remain unknown. In this study, shotgun proteomics was used to compare global proteome profiles between wild-type G. sulfurreducens PCA and two mutant strains: a ΔhgcAB mutant, which is deficient in two genes known to be essential for Hg methylation and a ΔomcBESTZ mutant, which is deficient in five outer membrane c-type cytochromes and thus impaired in its ability for dissimilatory metal ion reduction. We were able to delineate the global response of G. sulfurreducens PCA in both mutantsmore » and identify cellular networks and metabolic pathways that were affected by the loss of these genes. Deletion of hgcAB increased the relative abundances of proteins implicated in extracellular electron transfer, including most of the c-type cytochromes, PilA-C, and OmpB, and is consistent with a previously observed increase in Hg reduction in the hgcAB mutant. Deletion of omcBESTZ was found to significantly increase relative abundances of various methyltransferases, suggesting that a loss of dissimilatory reduction capacity results in elevated activity among one-carbon metabolic pathways and thus increased methylation. We show that G. sulfurreducens PCA encodes only the folate branch of the Wood Ljungdahl pathway, and proteins associated with the folate branch were found at lower abundance in the ΔhgcAB mutant strain than the wild type. In conclusion, this observation supports the hypothesis that the function of HgcA and HgcB may be linked to one carbon metabolism through the folate branch of the Wood-Ljungdahl pathway by providing methyl groups required for Hg methylation.« less
Heddergott, Christoph; Bruns, Sandra; Nietzsche, Sandor; Leonhardt, Ines; Kurzai, Oliver; Kniemeyer, Olaf; Brakhage, Axel A
2012-05-01
Dermatophytes are the most common cause of superficial mycoses in humans and animals. They can coexist with their hosts for many years without causing significant symptoms but also cause highly inflammatory diseases. To identify mechanisms involved in the modulation of the host response during infection caused by the zoophilic dermatophyte Arthroderma benhamiae, cell wall-associated surface proteins were studied. By two-dimensional gel electrophoresis, we found that a hydrophobin protein designated HypA was the dominant cell surface protein. HypA was also detected in the supernatant during the growth and conidiation of the fungus. The A. benhamiae genome harbors only a single hydrophobin gene, designated hypA. A hypA deletion mutant was generated, as was a complemented hypA mutant strain (hypA(C)). In contrast to the wild type and the complemented strain, the hypA deletion mutant exhibited "easily wettable" mycelia and conidia, indicating the loss of surface hydrophobicity of both morphotypes. Compared with the wild type, the hypA deletion mutant triggered an increased activation of human neutrophil granulocytes and dendritic cells, characterized by an increased release of the immune mediators interleukin-6 (IL-6), IL-8, IL-10, and tumor necrosis factor alpha (TNF-α). For the first time, we observed the formation of neutrophil extracellular traps against dermatophytes, whose level of formation was increased by the ΔhypA mutant compared with the wild type. Furthermore, conidia of the ΔhypA strain were killed more effectively by neutrophils. Our data suggest that the recognition of A. benhamiae by the cellular immune defense system is notably influenced by the presence of the surface rodlet layer formed by the hydrophobin HypA.
Heddergott, Christoph; Bruns, Sandra; Nietzsche, Sandor; Leonhardt, Ines; Kurzai, Oliver; Kniemeyer, Olaf
2012-01-01
Dermatophytes are the most common cause of superficial mycoses in humans and animals. They can coexist with their hosts for many years without causing significant symptoms but also cause highly inflammatory diseases. To identify mechanisms involved in the modulation of the host response during infection caused by the zoophilic dermatophyte Arthroderma benhamiae, cell wall-associated surface proteins were studied. By two-dimensional gel electrophoresis, we found that a hydrophobin protein designated HypA was the dominant cell surface protein. HypA was also detected in the supernatant during the growth and conidiation of the fungus. The A. benhamiae genome harbors only a single hydrophobin gene, designated hypA. A hypA deletion mutant was generated, as was a complemented hypA mutant strain (hypAC). In contrast to the wild type and the complemented strain, the hypA deletion mutant exhibited “easily wettable” mycelia and conidia, indicating the loss of surface hydrophobicity of both morphotypes. Compared with the wild type, the hypA deletion mutant triggered an increased activation of human neutrophil granulocytes and dendritic cells, characterized by an increased release of the immune mediators interleukin-6 (IL-6), IL-8, IL-10, and tumor necrosis factor alpha (TNF-α). For the first time, we observed the formation of neutrophil extracellular traps against dermatophytes, whose level of formation was increased by the ΔhypA mutant compared with the wild type. Furthermore, conidia of the ΔhypA strain were killed more effectively by neutrophils. Our data suggest that the recognition of A. benhamiae by the cellular immune defense system is notably influenced by the presence of the surface rodlet layer formed by the hydrophobin HypA. PMID:22408226
Replication of poliovirus RNA and subgenomic RNA transcripts in transfected cells.
Collis, P S; O'Donnell, B J; Barton, D J; Rogers, J A; Flanegan, J B
1992-01-01
Full-length and subgenomic poliovirus RNAs were transcribed in vitro and transfected into HeLa cells to study viral RNA replication in vivo. RNAs with deletion mutations were analyzed for the ability to replicate in either the absence or the presence of helper RNA by using a cotransfection procedure and Northern (RNA) blot analysis. An advantage of this approach was that viral RNA replication and genetic complementation could be characterized without first isolating conditional-lethal mutants. A subgenomic RNA with a large in-frame deletion in the capsid coding region (P1) replicated more efficiently than full-length viral RNA transcripts. In cotransfection experiments, both the full-length and subgenomic RNAs replicated at slightly reduced levels and appeared to interfere with each other's replication. In contrast, a subgenomic RNA with a similarly sized out-of-frame deletion in P1 did not replicate in transfected cells, either alone or in the presence of helper RNA. Similar results were observed with an RNA transcript containing a large in-frame deletion spanning the P1, P2, and P3 coding regions. A mutant RNA with an in-frame deletion in the P1-2A coding sequence was self-replicating but at a significantly reduced level. The replication of this RNA was fully complemented after cotransfection with a helper RNA that provided 2A in trans. A P1-2A-2B in-frame deletion, however, totally blocked RNA replication and was not complemented. Control experiments showed that all of the expected viral proteins were both synthesized and processed when the RNA transcripts were translated in vitro. Thus, our results indicated that 2A was a trans-acting protein and that 2B and perhaps other viral proteins were cis acting during poliovirus RNA replication in vivo. Our data support a model for poliovirus RNA replication which directly links the translation of a molecule of plus-strand RNA with the formation of a replication complex for minus-strand RNA synthesis. Images PMID:1328676
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes.
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-02-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information.
Whole-Genome Sequencing of Sordaria macrospora Mutants Identifies Developmental Genes
Nowrousian, Minou; Teichert, Ines; Masloff, Sandra; Kück, Ulrich
2012-01-01
The study of mutants to elucidate gene functions has a long and successful history; however, to discover causative mutations in mutants that were generated by random mutagenesis often takes years of laboratory work and requires previously generated genetic and/or physical markers, or resources like DNA libraries for complementation. Here, we present an alternative method to identify defective genes in developmental mutants of the filamentous fungus Sordaria macrospora through Illumina/Solexa whole-genome sequencing. We sequenced pooled DNA from progeny of crosses of three mutants and the wild type and were able to pinpoint the causative mutations in the mutant strains through bioinformatics analysis. One mutant is a spore color mutant, and the mutated gene encodes a melanin biosynthesis enzyme. The causative mutation is a G to A change in the first base of an intron, leading to a splice defect. The second mutant carries an allelic mutation in the pro41 gene encoding a protein essential for sexual development. In the mutant, we detected a complex pattern of deletion/rearrangements at the pro41 locus. In the third mutant, a point mutation in the stop codon of a transcription factor-encoding gene leads to the production of immature fruiting bodies. For all mutants, transformation with a wild type-copy of the affected gene restored the wild-type phenotype. Our data demonstrate that whole-genome sequencing of mutant strains is a rapid method to identify developmental genes in an organism that can be genetically crossed and where a reference genome sequence is available, even without prior mapping information. PMID:22384404
Bravo Ruiz, Gustavo; Di Pietro, Antonio; Roncero, M Isabel G
2016-04-01
The genome of the tomato pathogen Fusarium oxysporum f. sp. lycopersici encodes eight different polygalacturonases (PGs): four endoPGs and four exoPGs. Quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) revealed that endoPGs pg1 and pg5 and exoPGs pgx4 and pgx6 are expressed at significant levels during growth on citrus pectin, polygalacturonic acid or the monomer galacturonic acid, as well as during the infection of tomato plants. The remaining PG genes exhibit low expression levels under all the conditions tested. Secreted PG activity was decreased significantly during growth on pectin in the single deletion mutants lacking either pg1 or pgx6, as well as in the double mutant. Although the single deletion mutants did not display a significant virulence reduction on tomato plants, the Δpg1Δpgx6 double mutant was significantly attenuated in virulence. The combined action of exoPGs and endoPGs is thus essential for plant infection by the vascular wilt fungus F. oxysporum. © 2015 BSPP and John Wiley & Sons Ltd.
Paterson, Gavin K; Cone, Danielle B; Northen, Helen; Peters, Sarah E; Maskell, Duncan J
2009-05-01
The glycolytic enzyme triosephosphate isomerase (tpi) (EC 5.3.1.1) plays a key role in central carbon metabolism yet few studies have characterized isogenic bacterial mutants lacking this enzyme and none have examined its role in the in vivo fitness of a bacterial pathogen. Here we have deleted tpiA in Salmonella enterica serovar Typhimurium and found that the mutant had an altered morphology, displaying an elongated shape compared with the wild type. In a mouse model of typhoid fever the tpiA mutant was attenuated for growth as assessed by bacterial counts in the livers and spleens of infected mice. However, this attenuation was not deemed sufficient for consideration of a tpiA mutant as a live attenuated vaccine strain. These phenotypes were complemented by provision of tpiA on pBR322. We therefore provide the first demonstration that tpiA is required for full in vivo fitness of a bacterial pathogen, and that it has a discernable impact on cell morphology.
McLean, K M; Gutman, P D; Minton, K W; Clark, E P
1992-06-01
Cells cope with radiation damage through several mechanisms: (1) increased DNA repair activity, (2) scavenging and inactivation of radiation-induced radical molecules, and (3) entry into a G0-like quiescent state. We have investigated a chromosomal rearrangement to elucidate further the molecular and genetic mechanisms underlying these phenomena. A mutant of Escherichia coli JM83 (phi 80dlacZ delta M15) was isolated that demonstrated significantly increased resistance to both ionizing and ultraviolet radiation. Surviving fractions of mutant and wild-type cells were measured following exposure to standardized doses of radiation. Increased radioresistance was directly related to a chromosomal alteration near the bacteriophage phi 80 attachment site (attB), as initially detected by the LacZ- phenotype of the isolate. Southern hybridization of chromosomal DNA from the mutant and wild-type E. coli JM83 strains indicated that a deletion had occurred. We propose that the deletion near the attB locus produces the radioresistant phenotype of the E. coli JM83 LacZ- mutant, perhaps through the alteration or inactivation of a gene or its controlling element(s).
Watase, K; Sekiguchi, M; Matsui, T A; Tagawa, Y; Wada, K
1997-01-01
We reported that a 33-amino-acid deletion (from tyrosine-715 to glycine-747) in a putative extracellular loop of GluR3 produced a mutant that exhibited dominant negative effects upon the functional expression of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors [Sekiguchi et al. (1994) J. Biol. Chem. 269, 14559-14565]. In this study, we searched for a key residue in the dominant negative effects to explore the mechanism and examined the role of the residue in the function of the AMPA receptor. We prepared 20 GluR3 mutants with amino acid substitutions within the 33-amino-acid-region, and dominant negative effects were tested electrophysiologically in Xenopus oocytes co-expressing the mutant and normal subunits. Among the mutants, only a GluR3 mutant in which an original cysteine (Cys)-722 was replaced by alanine exhibited a dominant negative effect comparable with that of the original mutant in which the entire 33-amino-acid segment is deleted. The co-expression of the Cys-722 mutant did not inhibit the translation of normal subunits in oocytes. The Cys-722 mutant formed a functional homomeric receptor with significantly higher affinity for glutamate or kainate than a homomeric GluR3 receptor. The Cys-722 mutation greatly enhanced the sensitivity of GluR3 for aniracetam, which alters kinetic properties of AMPA receptors. The kainate-induced currents in oocytes expressing the Cys-722 mutant alone showed strong inward rectification. These results suggest that the Cys-722 in GluR3 is important for dominant negative effects and plays a crucial role in the determination of pharmacological properties in AMPA receptor function. PMID:9065754
Pluskal, Tomáš; Sajiki, Kenichi; Becker, Joanne; Takeda, Kojiro; Yanagida, Mitsuhiro
2016-06-01
Living organisms have evolved multiple sophisticated mechanisms to deal with reactive oxygen species. We constructed a collection of twelve single-gene deletion strains of the fission yeast Schizosaccharomyces pombe designed for the study of oxidative and heavy metal stress responses. This collection contains deletions of biosynthetic enzymes of glutathione (Δgcs1 and Δgsa1), phytochelatin (Δpcs2), ubiquinone (Δabc1) and ergothioneine (Δegt1), as well as catalase (Δctt1), thioredoxins (Δtrx1 and Δtrx2), Cu/Zn- and Mn- superoxide dismutases (SODs; Δsod1 and Δsod2), sulfiredoxin (Δsrx1) and sulfide-quinone oxidoreductase (Δhmt2). First, we employed metabolomic analysis to examine the mutants of the glutathione biosynthetic pathway. We found that ophthalmic acid was produced by the same enzymes as glutathione in S. pombe. The identical genetic background of the strains allowed us to assess the severity of the individual gene knockouts by treating the deletion strains with oxidative agents. Among other results, we found that glutathione deletion strains were not particularly sensitive to peroxide or superoxide, but highly sensitive to cadmium stress. Our results show the astonishing diversity in cellular adaptation mechanisms to various types of oxidative and metal stress and provide a useful tool for further research into stress responses. © 2016 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.
Peacock, Thomas P; Benton, Donald J; James, Joe; Sadeyen, Jean-Remy; Chang, Pengxiang; Sealy, Joshua E; Bryant, Juliet E; Martin, Stephen R; Shelton, Holly; Barclay, Wendy S; Iqbal, Munir
2017-07-15
H9N2 avian influenza viruses are enzootic in poultry across Asia and North Africa, where they pose a threat to human health as both zoonotic agents and potential pandemic candidates. Poultry vaccination against H9N2 viruses has been employed in many regions; however, vaccine effectiveness is frequently compromised due to antigenic drift arising from amino acid substitutions in the major influenza virus antigen hemagglutinin (HA). Using selection with HA-specific monoclonal antibodies, we previously identified H9N2 antibody escape mutants that contained deletions of amino acids in the 220 loop of the HA receptor binding sites (RBSs). Here we analyzed the impact of these deletions on virus zoonotic infection characteristics and fitness. We demonstrated that mutant viruses with RBS deletions are able to escape polyclonal antiserum binding and are able to infect and be transmitted between chickens. We showed that the deletion mutants have increased binding to human-like receptors and greater replication in primary human airway cells; however, the mutant HAs also displayed reduced pH and thermal stability. In summary, we infer that variant influenza viruses with deletions in the 220 loop could arise in the field due to immune selection pressure; however, due to reduced HA stability, we conclude that these viruses are unlikely to be transmitted from human to human by the airborne route, a prerequisite for pandemic emergence. Our findings underscore the complex interplay between antigenic drift and viral fitness for avian influenza viruses as well as the challenges of predicting which viral variants may pose the greatest threats for zoonotic and pandemic emergence. IMPORTANCE Avian influenza viruses, such as H9N2, cause disease in poultry as well as occasionally infecting humans and are therefore considered viruses with pandemic potential. Many countries have introduced vaccination of poultry to try to control the disease burden; however, influenza viruses are able to rapidly evolve to escape immune pressure in a process known as "antigenic drift." Previously, we experimentally generated antigenic-drift variants in the laboratory, and here, we test our "drifted" viruses to assess their zoonotic infection characteristics and transmissibility in chickens. We found that the drifted viruses were able to infect and be transmitted between chickens and showed increased binding to human-like receptors. However, the drift mutant viruses displayed reduced stability, and we predict that they are unlikely to be transmitted from human to human and cause an influenza pandemic. These results demonstrate the complex relationship between antigenic drift and the potential of avian influenza viruses to infect humans. Copyright © 2017 Peacock et al.
Litwin, Christine M.; Byrne, Burke L.
1998-01-01
Vibrio vulnificus is a halophilic, marine pathogen that has been associated with septicemia and serious wound infections in patients with iron overload and preexisting liver disease. For V. vulnificus, the ability to acquire iron from the host has been shown to correlate with virulence. V. vulnificus is able to use host iron sources such as hemoglobin and heme. We previously constructed a fur mutant of V. vulnificus which constitutively expresses at least two iron-regulated outer membrane proteins, of 72 and 77 kDa. The N-terminal amino acid sequence of the 77-kDa protein purified from the V. vulnificus fur mutant had 67% homology with the first 15 amino acids of the mature protein of the Vibrio cholerae heme receptor, HutA. In this report, we describe the cloning, DNA sequence, mutagenesis, and analysis of transcriptional regulation of the structural gene for HupA, the heme receptor of V. vulnificus. DNA sequencing of hupA demonstrated a single open reading frame of 712 amino acids that was 50% identical and 66% similar to the sequence of V. cholerae HutA and similar to those of other TonB-dependent outer membrane receptors. Primer extension analysis localized one promoter for the V. vulnificus hupA gene. Analysis of the promoter region of V. vulnificus hupA showed a sequence homologous to the consensus Fur box. Northern blot analysis showed that the transcript was strongly regulated by iron. An internal deletion in the V. vulnificus hupA gene, done by using marker exchange, resulted in the loss of expression of the 77-kDa protein and the loss of the ability to use hemin or hemoglobin as a source of iron. The hupA deletion mutant of V. vulnificus will be helpful in future studies of the role of heme iron in V. vulnificus pathogenesis. PMID:9632577
A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat
2010-01-01
Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819
Tim18, a component of the mitochondrial translocator, mediates yeast cell death induced by arsenic.
Du, Li; Yu, Yong; Li, Zidong; Chen, Jingsi; Liu, Yan; Xia, Yongjing; Liu, Xiangjun
2007-08-01
Evidence is presented that Tim18, a mitochondria translocase, plays a role in the previously described apoptosis induced by arsenite in Saccharomyces cerevisiae. Tim18 deletion mutant exhibited resistance to arsenite. After arsenite treatment, both the wild type and Tim18-deficient cells showed reactive oxygen species (ROS) production. Arsenite induced the higher expression of tim18 in wild type yeast cells. We found that the tim18 deletion mutant also exhibited resistance to other apoptotic stresses such as acetic acid, H2O2, and hyperosmotic stress. These results suggest that Tim18 is important for yeast cell death induced by arsenic, and it may act downstream of ROS production.
Toh-E, Akio; Ohkusu, Misako; Shimizu, Kiminori; Yamaguchi, Masashi; Ishiwada, Naruhiko; Watanabe, Akira; Kamei, Katsuhiko
2017-12-01
We constructed deletion mutants of Cryptococcus neoformans var neoformans (serotype D) genes encoding late ergosterol biosynthetic pathway enzymes and found that the mutations enhanced susceptibility to various drugs including micafungin, one of the echinocandins, to which wild-type Cryptococcus strains show no susceptibility. Furthermore, through isolation of a mutant resistant to micafungin from a micafungin-sensitive erg mutant and genetic analysis of it, we found that the responsible mutation occurred in the hotspot 2 of FKS1 encoding β-1, 3-glucan synthase, indicating that micafungin inhibited the growth of the erg mutant via inhibiting Fks1 activity. Addition of ergosterol to the culture of the erg mutants recovered the resistance to micafungin, suggesting that the presence of ergosterol in membrane inhibits the accession of micafungin to its target. We found that a loss of one of genes encoding subunits of v-ATPase, VPH1, made Cryptococcus cells sensitive to micafungin. Our observation that the erg2 vph1 double mutant was more sensitive to micafungin than either single mutant suggests that these two genes act differently in becoming resistant to micafungin. The erg mutants allowed us to study the physiological significance of β-1, 3-glucan synthesis in C. neoformans; the inhibition of β-1, 3-glucan synthesis induced cell death and changes in cellular morphology. By observing the erg mutant cells recovering from the growth inhibition imposed by micafungin, we recognized β-1, 3-glucan synthesis would suppress filamentous growth in C. neoformans.
Molecular Analysis of DMP1 Mutants Causing Autosomal Recessive Hypophosphatemic Rickets
Farrow, Emily G.; Davis, Siobhan I.; Ward, Leanne M.; Summers, Lelia J.; Bubbear, Judith S.; Keen, Richard; Stamp, Trevor C.B.; Baker, Laurence R. I.; Bonewald, Lynda F.; White, Kenneth E.
2009-01-01
We previously demonstrated that the mutations Met1Val (M1V) and the deletion of nucleotides 1484-1490 (1484-1490del) in Dentin matrix protein-1 (DMP1) cause the novel disorder autosomal recessive hypophosphatemic rickets (ARHR), which is associated with elevated Fibroblast growth factor-23 (FGF23). To further understand the role of DMP1 in ARHR, we undertook molecular genetic and in vitro expression studies. First, we examined a kindred with a severe hypophosphatemic rickets phenotype and recessive inheritance. Analyses of this family demonstrated that the affected members had elevated serum FGF23 and carried a large, biallelic deletion that removed the majority of DMP1. At a minimum, this deletion encompassed 49 kb between DMP1 exon 3 and an intergenic region 5′ to the next telomeric gene, integrin-binding sialoprotein (IBSP). We next performed immunofluorescent studies in cells to understand the effects of the known ARHR mutations on DMP1 cellular processing. These analyses showed that the M1V DMP1 mutant was not sorted to the trans-Golgi network (TGN) and secretory pathway, but filled the entire cytoplasm. In contrast, the 1484-1490del mutant localized to the TGN and was secreted, similar to wild type DMP1. The 1484-1490del mutation replaces the DMP1 18 C-terminal amino acids with 33 non-native residues. Truncation of wild type DMP1 by these native 18 residues followed by Western blot and confocal microscopic analyses demonstrated a wild type expression pattern when compared with the 1484-1490del mutant, indicating that the last 18 residues are not critical for cellular trafficking, but that the 33 additional residues arising from the 1484-1490del mutation likely compromise DMP1 processing. The relationship between DMP1 and FGF23 is unclear. To test endogenous DMP1 response to serum metabolites that also regulate FGF23, UMR-106 cells were treated with 1,25(OH)2 vitamin D (1×10−7M) and showed a 12-fold increase in DMP1 mRNA and protein at 24 hr. In summary, we have identified a novel DMP1 deletion as the cause of ARHR, as well as demonstrated that the ARHR mutations alter DMP1 cellular processing, and that DMP1 can be regulated by vitamin D. Taken together, this work expands our understanding of the genetic and molecular mechanisms associated with DMP1 alterations causing ARHR. PMID:19007919
Todd, Antonette R; Donofrio, Nicole; Sripathi, Venkateswara R; McClean, Phillip E; Lee, Rian K; Pastor-Corrales, Marcial; Kalavacharla, Venu Kal
2017-05-23
Common bean ( Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg , (Complements resistance gene), which is required for Ur-3 -mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant "Sierra" and susceptible crg) with rust race 53 of U. appendiculatus , isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of "Sierra" leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations.
Todd, Antonette R.; Donofrio, Nicole; Sripathi, Venkateswara R.; McClean, Phillip E.; Lee, Rian K.; Pastor-Corrales, Marcial; Kalavacharla, Venu (Kal)
2017-01-01
Common bean (Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg, (Complements resistance gene), which is required for Ur-3-mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant “Sierra” and susceptible crg) with rust race 53 of U. appendiculatus, isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of “Sierra” leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations. PMID:28545258
Si, Wei; Wang, Xiumei; Liu, Huifang; Yu, Shenye; Li, Zhaoli; Chen, Liping; Zhang, Wanjiang; Liu, Siguo
2015-01-01
To construct a novel live, attenuated Salmonella vaccine, the lon, cpxR and cpdB genes were deleted from a wild-type Salmonella enterica serovar Enteritidis-6 (SM-6) strain using the phage λ Red homologous recombination system, resulting in SM-△CpxR, SM-△C/Lon and SM-△C/L/CpdB. The growth curves of strain SM-△C/Lon grew more rapidly than the other strains and had OD 600 values higher than the other strains starting at the 4 h time point. The growth curves of strain SM-△C/L/CpdB were relatively flat. The colonization time of SM-△C/L/CpdB is about 8-10 days. Deleting the lon/cpxR/cpdB (SM-6) genes resulted in an approximate 10(3)-fold attenuation in virulence assessed by the analysis of the LD50 of specific pathogen-free (SPF) chicks. This result indicated that the deletion of the lon, cpxR and cpdB genes induced significant virulence attenuation. The protective effects of SM-△C/L/CpdB vaccination in SPF chicks against 5 × 10(9) colony forming units (CFU) of S. Enteritidis were resulted from the induction of an effective immune response. These findings demonstrate the potential of mutant SM-△C/L/CpdB to be used as an effective vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.
An interactional network of genes involved in chitin synthesis in Saccharomyces cerevisiae.
Lesage, Guillaume; Shapiro, Jesse; Specht, Charles A; Sdicu, Anne-Marie; Ménard, Patrice; Hussein, Shamiza; Tong, Amy Hin Yan; Boone, Charles; Bussey, Howard
2005-02-16
In S. cerevisiae the beta-1,4-linked N-acetylglucosamine polymer, chitin, is synthesized by a family of 3 specialized but interacting chitin synthases encoded by CHS1, CHS2 and CHS3. Chs2p makes chitin in the primary septum, while Chs3p makes chitin in the lateral cell wall and in the bud neck, and can partially compensate for the lack of Chs2p. Chs3p requires a pathway of Bni4p, Chs4p, Chs5p, Chs6p and Chs7p for its localization and activity. Chs1p is thought to have a septum repair function after cell separation. To further explore interactions in the chitin synthase family and to find processes buffering chitin synthesis, we compiled a genetic interaction network of genes showing synthetic interactions with CHS1, CHS3 and genes involved in Chs3p localization and function and made a phenotypic analysis of their mutants. Using deletion mutants in CHS1, CHS3, CHS4, CHS5, CHS6, CHS7 and BNI4 in a synthetic genetic array analysis we assembled a network of 316 interactions among 163 genes. The interaction network with CHS3, CHS4, CHS5, CHS6, CHS7 or BNI4 forms a dense neighborhood, with many genes functioning in cell wall assembly or polarized secretion. Chitin levels were altered in 54 of the mutants in individually deleted genes, indicating a functional relationship between them and chitin synthesis. 32 of these mutants triggered the chitin stress response, with elevated chitin levels and a dependence on CHS3. A large fraction of the CHS1-interaction set was distinct from that of the CHS3 network, indicating broad roles for Chs1p in buffering both Chs2p function and more global cell wall robustness. Based on their interaction patterns and chitin levels we group interacting mutants into functional categories. Genes interacting with CHS3 are involved in the amelioration of cell wall defects and in septum or bud neck chitin synthesis, and we newly assign a number of genes to these functions. Our genetic analysis of genes not interacting with CHS3 indicate expanded roles for Chs4p, Chs5p and Chs6p in secretory protein trafficking and of Bni4p in bud neck organization.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Bozue, Joel; Cote, Christopher K; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J; Kijek, Todd K; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G; Bell, Todd; Worsham, Patricia
2014-01-01
Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge.
Bozue, Joel; Cote, Christopher K.; Chance, Taylor; Kugelman, Jeffrey; Kern, Steven J.; Kijek, Todd K.; Jenkins, Amy; Mou, Sherry; Moody, Krishna; Fritz, David; Robinson, Camenzind G.; Bell, Todd; Worsham, Patricia
2014-01-01
Bacterial proteins destined for the Tat pathway are folded before crossing the inner membrane and are typically identified by an N-terminal signal peptide containing a twin arginine motif. Translocation by the Tat pathway is dependent on the products of genes which encode proteins possessing the binding site of the signal peptide and mediating the actual translocation event. In the fully virulent CO92 strain of Yersinia pestis, the tatA gene was deleted. The mutant was assayed for loss of virulence through various in vitro and in vivo assays. Deletion of the tatA gene resulted in several consequences for the mutant as compared to wild-type. Cell morphology of the mutant bacteria was altered and demonstrated a more elongated form. In addition, while cultures of the mutant strain were able to produce a biofilm, we observed a loss of adhesion of the mutant biofilm structure compared to the biofilm produced by the wild-type strain. Immuno-electron microscopy revealed a partial disruption of the F1 antigen on the surface of the mutant. The virulence of the ΔtatA mutant was assessed in various murine models of plague. The mutant was severely attenuated in the bubonic model with full virulence restored by complementation with the native gene. After small-particle aerosol challenge in a pneumonic model of infection, the mutant was also shown to be attenuated. In contrast, when mice were challenged intranasally with the mutant, very little difference in the LD50 was observed between wild-type and mutant strains. However, an increased time-to-death and delay in bacterial dissemination was observed in mice infected with the ΔtatA mutant as compared to the parent strain. Collectively, these findings demonstrate an essential role for the Tat pathway in the virulence of Y. pestis in bubonic and small-aerosol pneumonic infection but less important role for intranasal challenge. PMID:25101850
Zhang, Min-Juan; Tian, Cai-Hong; Fan, Xiao-Ying; Lou, Yi-Han; Cheng, Ruo-Lin; Zhang, Chuan-Xi
2012-07-01
Bombyx mori nucleopolyhedrovirus (BmNPV) ORF54 (Bm54), a member of the viral desmoplakin N-terminus superfamily, is homologous to Autographa californica nucleopolyhedrovirus (AcMNPV) ORF66, which is required for the efficient egress of nucleocapsids from the nucleus and occlusion body formation. In this paper, we generated a bacmid with the Bm54 gene deleted via homologous recombination in Escherichia coli and characterized the mutant virus using a transfection-infection assay and transmission electron microscopy analysis. Our results demonstrated that the cells transfected with viral DNA lacking Bm54 produced non-infectious budded viruses (BVs). Electron microscopy showed that although the deletion of Bm54 did not affect assembly and release of nucleocapsids, it severely affected polyhedron formation. In conclusion, deletion of Bm54 resulted in non-infectious BV and defective polyhedra. Although the sequences of Bm54 and Ac66 are very similar, the two genes function quite differently in the regulation of viral life cycle.
Braberg, Hannes; Moehle, Erica A.; Shales, Michael; Guthrie, Christine; Krogan, Nevan J.
2014-01-01
We have achieved a residue-level resolution of genetic interaction mapping – a technique that measures how the function of one gene is affected by the alteration of a second gene – by analyzing point mutations. Here, we describe how to interpret point mutant genetic interactions, and outline key applications for the approach, including interrogation of protein interaction interfaces and active sites, and examination of post-translational modifications. Genetic interaction analysis has proven effective for characterizing cellular processes; however, to date, systematic high-throughput genetic interaction screens have relied on gene deletions or knockdowns, which limits the resolution of gene function analysis and poses problems for multifunctional genes. Our point mutant approach addresses these issues, and further provides a tool for in vivo structure-function analysis that complements traditional biophysical methods. We also discuss the potential for genetic interaction mapping of point mutations in human cells and its application to personalized medicine. PMID:24842270
Beatson, Scott A.; Ben Zakour, Nouri L.; Totsika, Makrina; ...
2015-05-01
Urinary tract infections (UTIs) are among the most common infectious diseases of humans, with Escherichia coli for >80% of all cases. One extreme of UTI is asymptomatic bacteriuria (ABU), which occurs as an asymptomatic carrier state that resembles commensalism. Here, to understand the evolution and molecular mechanisms that underpin ABU, the genome of the ABU E. coli strain VR50 was sequenced. Analysis of the complete genome indicated that it most resembles E. coli K-12, with the addition of a 94-kb genomic island (GI-VR50-pheV), eight prophages, and multiple plasmids. GI-VR50- pheV has a mosaic structure and contains genes encoding a numbermore » of UTI-associated virulence factors, namely, Afa (afimbrial adhesin), two autotransporter proteins (Ag43 and Sat), and aerobactin. We demonstrated that the presence of this island in VR50 confers its ability to colonize the murine bladder, as a VR50 mutant with GI-VR50- pheV deleted was attenuated in a mouse model of UTI in vivo. We established that Afa is the island-encoded factor responsible for this phenotype using two independent deletion (Afa operon and AfaE adhesin) mutants. E. coli VR50 afa and VR50 afaE displayed significantly decreased ability to adhere to human bladder epithelial cells. In the mouse model of UTI, VR50 afa and VR50 afaE displayed reduced bladder colonization compared to wild-type VR50, similar to the colonization level of the GI-VR50- pheV mutant. In conlusion, our study suggests that E. coli VR50 is a commensal-like strain that has acquired fitness factors that facilitate colonization of the human bladder.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beatson, Scott A.; Ben Zakour, Nouri L.; Totsika, Makrina
Urinary tract infections (UTIs) are among the most common infectious diseases of humans, with Escherichia coli for >80% of all cases. One extreme of UTI is asymptomatic bacteriuria (ABU), which occurs as an asymptomatic carrier state that resembles commensalism. Here, to understand the evolution and molecular mechanisms that underpin ABU, the genome of the ABU E. coli strain VR50 was sequenced. Analysis of the complete genome indicated that it most resembles E. coli K-12, with the addition of a 94-kb genomic island (GI-VR50-pheV), eight prophages, and multiple plasmids. GI-VR50- pheV has a mosaic structure and contains genes encoding a numbermore » of UTI-associated virulence factors, namely, Afa (afimbrial adhesin), two autotransporter proteins (Ag43 and Sat), and aerobactin. We demonstrated that the presence of this island in VR50 confers its ability to colonize the murine bladder, as a VR50 mutant with GI-VR50- pheV deleted was attenuated in a mouse model of UTI in vivo. We established that Afa is the island-encoded factor responsible for this phenotype using two independent deletion (Afa operon and AfaE adhesin) mutants. E. coli VR50 afa and VR50 afaE displayed significantly decreased ability to adhere to human bladder epithelial cells. In the mouse model of UTI, VR50 afa and VR50 afaE displayed reduced bladder colonization compared to wild-type VR50, similar to the colonization level of the GI-VR50- pheV mutant. In conlusion, our study suggests that E. coli VR50 is a commensal-like strain that has acquired fitness factors that facilitate colonization of the human bladder.« less
Lorenz, M C; Heitman, J
1998-01-01
Nitrogen-starved diploid cells of the yeast Saccharomyces cerevisiae differentiate into a filamentous, pseudohyphal growth form. Recognition of nitrogen starvation is mediated, at least in part, by the ammonium permease Mep2p and the Galpha subunit Gpa2p. Genetic activation of the pheromone-responsive MAP kinase cascade, which is also required for filamentous growth, only weakly suppresses the filamentation defect of Deltamep2/Deltamep2 and Deltagpa2/Deltagpa2 strain. Surprisingly, deletion of Mep1p, an ammonium permease not previously thought to regulate differentiation, significantly enhances the potency of MAP kinase activation, such that the STE11-4 allele induces filamentation to near wild-type levels in Deltamep1/Deltamep1 Deltamep2/Deltamep2 and Deltamep1/Deltamep1 Deltagpa2/Deltagpa2 strains. To identify additional regulatory components, we isolated high-copy suppressors of the filamentation defect of the Deltamep1/Deltamep1 Deltamep2/Deltamep2 mutant. Multicopy expression of TEC1, PHD1, PHD2 (MSS10/MSN1/FUP4), MSN5, CDC6, MSS11, MGA1, SKN7, DOT6, HMS1, HMS2, or MEP2 each restored filamentation in a Deltamep1/Deltamep1 Deltamep2/Deltamep2 strain. Overexpression of SRK1 (SSD1), URE2, DAL80, MEP1, or MEP3 suppressed only the growth defect of the Deltamep1/Deltamep1 Deltamep2/Deltamep2 mutant strain. Characterization of these genes through deletion analysis and epistasis underscores the complexity of this developmental pathway and suggests that stress conditions other than nitrogen deprivation may also promote filamentous growth. PMID:9832522
Beatson, Scott A; Ben Zakour, Nouri L; Totsika, Makrina; Forde, Brian M; Watts, Rebecca E; Mabbett, Amanda N; Szubert, Jan M; Sarkar, Sohinee; Phan, Minh-Duy; Peters, Kate M; Petty, Nicola K; Alikhan, Nabil-Fareed; Sullivan, Mitchell J; Gawthorne, Jayde A; Stanton-Cook, Mitchell; Nhu, Nguyen Thi Khanh; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Hancock, Viktoria; Ussery, David W; Ulett, Glen C; Schembri, Mark A
2015-05-01
Urinary tract infections (UTIs) are among the most common infectious diseases of humans, with Escherichia coli responsible for >80% of all cases. One extreme of UTI is asymptomatic bacteriuria (ABU), which occurs as an asymptomatic carrier state that resembles commensalism. To understand the evolution and molecular mechanisms that underpin ABU, the genome of the ABU E. coli strain VR50 was sequenced. Analysis of the complete genome indicated that it most resembles E. coli K-12, with the addition of a 94-kb genomic island (GI-VR50-pheV), eight prophages, and multiple plasmids. GI-VR50-pheV has a mosaic structure and contains genes encoding a number of UTI-associated virulence factors, namely, Afa (afimbrial adhesin), two autotransporter proteins (Ag43 and Sat), and aerobactin. We demonstrated that the presence of this island in VR50 confers its ability to colonize the murine bladder, as a VR50 mutant with GI-VR50-pheV deleted was attenuated in a mouse model of UTI in vivo. We established that Afa is the island-encoded factor responsible for this phenotype using two independent deletion (Afa operon and AfaE adhesin) mutants. E. coli VR50afa and VR50afaE displayed significantly decreased ability to adhere to human bladder epithelial cells. In the mouse model of UTI, VR50afa and VR50afaE displayed reduced bladder colonization compared to wild-type VR50, similar to the colonization level of the GI-VR50-pheV mutant. Our study suggests that E. coli VR50 is a commensal-like strain that has acquired fitness factors that facilitate colonization of the human bladder. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
PD-L1 expression according to the EGFR status in primary lung adenocarcinoma.
Takada, Kazuki; Toyokawa, Gouji; Tagawa, Tetsuzo; Kohashi, Kenichi; Shimokawa, Mototsugu; Akamine, Takaki; Takamori, Shinkichi; Hirai, Fumihiko; Shoji, Fumihiro; Okamoto, Tatsuro; Oda, Yoshinao; Maehara, Yoshihiko
2018-02-01
It was reported that programmed cell death-ligand 1 (PD-L1) expression is associated with smoking and wild-type epidermal growth factor receptor (EGFR) in lung adenocarcinoma. However, the association between PD-L1 expression and EGFR mutation site in EGFR mutation-positive lung adenocarcinoma is unclear. We retrospectively examined the relationship between PD-L1 expression and EGFR status in 441 surgically resected primary lung adenocarcinomas. Membrane PD-L1 expression on tumor cells was evaluated by immunohistochemical analysis using a PD-L1 antibody (clone SP142) and defined by tumor proportion scores (TPSs) of 0%, 1-4%, 5-49%, and ≥50%, respectively. Two hundred and eighteen (49.4%) patients had wild-type EGFR, and 223 (50.6%) had mutant EGFR-98 (44.0%) with exon 19 deletion, 116 (52.0%) with exon 21 L858R point mutation, and nine (4.0%) with another EGFR mutation. Overall, Fisher's exact test showed that PD-L1 positivity was associated with wild-type EGFR, and there was only one case with PD-L1 TPS ≥50% among the cases with mutant EGFR. The analysis of cases with mutant EGFR indicated no significant association between EGFR mutation site and PD-L1 expression. However, the prevalence of PD-L1 TPS 5-49% was higher among patients with EGFR exon 19 deletion than with EGFR exon 21 L858R point mutation. PD-L1 expression was significantly associated with wild-type EGFR, and PD-L1 TPS ≥50% seldom overlaps with presence of driver oncogene EGFR. There was no significant difference in PD-L1 expression among the EGFR mutation sites. Copyright © 2017 Elsevier B.V. All rights reserved.
Ben Zakour, Nouri L.; Totsika, Makrina; Forde, Brian M.; Watts, Rebecca E.; Mabbett, Amanda N.; Szubert, Jan M.; Sarkar, Sohinee; Phan, Minh-Duy; Peters, Kate M.; Petty, Nicola K.; Alikhan, Nabil-Fareed; Sullivan, Mitchell J.; Gawthorne, Jayde A.; Stanton-Cook, Mitchell; Nhu, Nguyen Thi Khanh; Chong, Teik Min; Yin, Wai-Fong; Chan, Kok-Gan; Hancock, Viktoria; Ussery, David W.; Ulett, Glen C.
2015-01-01
Urinary tract infections (UTIs) are among the most common infectious diseases of humans, with Escherichia coli responsible for >80% of all cases. One extreme of UTI is asymptomatic bacteriuria (ABU), which occurs as an asymptomatic carrier state that resembles commensalism. To understand the evolution and molecular mechanisms that underpin ABU, the genome of the ABU E. coli strain VR50 was sequenced. Analysis of the complete genome indicated that it most resembles E. coli K-12, with the addition of a 94-kb genomic island (GI-VR50-pheV), eight prophages, and multiple plasmids. GI-VR50-pheV has a mosaic structure and contains genes encoding a number of UTI-associated virulence factors, namely, Afa (afimbrial adhesin), two autotransporter proteins (Ag43 and Sat), and aerobactin. We demonstrated that the presence of this island in VR50 confers its ability to colonize the murine bladder, as a VR50 mutant with GI-VR50-pheV deleted was attenuated in a mouse model of UTI in vivo. We established that Afa is the island-encoded factor responsible for this phenotype using two independent deletion (Afa operon and AfaE adhesin) mutants. E. coli VR50afa and VR50afaE displayed significantly decreased ability to adhere to human bladder epithelial cells. In the mouse model of UTI, VR50afa and VR50afaE displayed reduced bladder colonization compared to wild-type VR50, similar to the colonization level of the GI-VR50-pheV mutant. Our study suggests that E. coli VR50 is a commensal-like strain that has acquired fitness factors that facilitate colonization of the human bladder. PMID:25667270
Mutagenic effects of a single and an exact number of alpha particles in mammalian cells
NASA Technical Reports Server (NTRS)
Hei, T. K.; Wu, L. J.; Liu, S. X.; Vannais, D.; Waldren, C. A.; Randers-Pehrson, G.
1997-01-01
One of the main uncertainties in risk estimation for environmental radon exposure using lung cancer data from underground miners is the extrapolation from high- to low-dose exposure where multiple traversal is extremely rare. The biological effects of a single alpha particle are currently unknown. Using the recently available microbeam source at the Radiological Research Accelerator Facility at Columbia University, we examined the frequencies and molecular spectrum of S1- mutants induced in human-hamster hybrid (A(L)) cells by either a single or an exact number of alpha particles. Exponentially growing cells were stained briefly with a nontoxic concentration of Hoechst dye for image analysis, and the location of individual cells was computer-monitored. The nucleus of each cell was irradiated with either 1,2,4, or 8 alpha particles at a linear energy transfer of 90 keV/microm consistent with the energy spectrum of domestic radon exposure. Although single-particle traversal was only slightly cytotoxic to A(L) cells (survival fraction approximately 0.82), it was highly mutagenic, and the induced mutant fraction averaged 110 mutants per 10(5) survivors. In addition, both toxicity and mutant induction were dose-dependent. Multiplex PCR analysis of mutant DNA showed that the proportion of mutants with multilocus deletions increased with the number of particle traversals. These data provide direct evidence that a single a particle traversing a nucleus will have a high probability of resulting in a mutation and highlight the need for radiation protection at low doses.
Mutagenic effects of a single and an exact number of alpha particles in mammalian cells.
Hei, T K; Wu, L J; Liu, S X; Vannais, D; Waldren, C A; Randers-Pehrson, G
1997-04-15
One of the main uncertainties in risk estimation for environmental radon exposure using lung cancer data from underground miners is the extrapolation from high- to low-dose exposure where multiple traversal is extremely rare. The biological effects of a single alpha particle are currently unknown. Using the recently available microbeam source at the Radiological Research Accelerator Facility at Columbia University, we examined the frequencies and molecular spectrum of S1- mutants induced in human-hamster hybrid (A(L)) cells by either a single or an exact number of alpha particles. Exponentially growing cells were stained briefly with a nontoxic concentration of Hoechst dye for image analysis, and the location of individual cells was computer-monitored. The nucleus of each cell was irradiated with either 1,2,4, or 8 alpha particles at a linear energy transfer of 90 keV/microm consistent with the energy spectrum of domestic radon exposure. Although single-particle traversal was only slightly cytotoxic to A(L) cells (survival fraction approximately 0.82), it was highly mutagenic, and the induced mutant fraction averaged 110 mutants per 10(5) survivors. In addition, both toxicity and mutant induction were dose-dependent. Multiplex PCR analysis of mutant DNA showed that the proportion of mutants with multilocus deletions increased with the number of particle traversals. These data provide direct evidence that a single a particle traversing a nucleus will have a high probability of resulting in a mutation and highlight the need for radiation protection at low doses.
Jiménez-Ortigosa, Cristina; Aimanianda, Vishukumar; Muszkieta, Laetitia; Mouyna, Isabelle; Alsteens, David; Pire, Stéphane; Beau, Remi; Krappmann, Sven; Beauvais, Anne; Dufrêne, Yves F.
2012-01-01
Aspergillus fumigatus has two chitin synthases (CSMA and CSMB) with a myosin motor-like domain (MMD) arranged in a head-to-head configuration. To understand the function of these chitin synthases, single and double csm mutant strains were constructed and analyzed. Although there was a slight reduction in mycelial growth of the mutants, the total chitin synthase activity and the cell wall chitin content were similar in the mycelium of all of the mutants and the parental strain. In the conidia, chitin content in the ΔcsmA strain cell wall was less than half the amount found in the parental strain. In contrast, the ΔcsmB mutant strain and, unexpectedly, the ΔcsmA/ΔcsmB mutant strain did not show any modification of chitin content in their conidial cell walls. In contrast to the hydrophobic conidia of the parental strain, conidia of all of the csm mutants were hydrophilic due to the presence of an amorphous material covering the hydrophobic surface-rodlet layer. The deletion of CSM genes also resulted in an increased susceptibility of resting and germinating conidia to echinocandins. These results show that the deletion of the CSMA and CSMB genes induced a significant disorganization of the cell wall structure, even though they contribute only weakly to the overall cell wall chitin synthesis. PMID:22964252
Enhanced recognition memory following glycine transporter 1 deletion in forebrain neurons.
Singer, Philipp; Boison, Detlev; Möhler, Hanns; Feldon, Joram; Yee, Benjamin K
2007-10-01
Selective deletion of glycine transporter 1 (GlyT1) in forebrain neurons enhances N-methyl-D-aspartate receptor (NMDAR)-dependent neurotransmission and facilitates associative learning. These effects are attributable to increases in extracellular glycine availability in forebrain neurons due to reduced glycine re-uptake. Using a forebrain- and neuron-specific GlyT1-knockout mouse line (CamKIIalphaCre; GlyT1tm1.2fl/fI), the authors investigated whether this molecular intervention can affect recognition memory. In a spontaneous object recognition memory test, enhanced preference for a novel object was demonstrated in mutant mice relative to littermate control subjects at a retention interval of 2 hr, but not at 2 min. Furthermore, mutants were responsive to a switch in the relative spatial positions of objects, whereas control subjects were not. These potential procognitive effects were demonstrated against a lack of difference in contextual novelty detection: Mutant and control subjects showed equivalent preference for a novel over a familiar context. Results therefore extend the possible range of potential promnesic effects of specific forebrain neuronal GlyT1 deletion from associative learning to recognition memory and further support the possibility that mnemonic functions can be enhanced by reducing GlyT1 function. (PsycINFO Database Record (c) 2007 APA, all rights reserved).
Frahm, Michael; Kocijancic, Dino; Rohde, Manfred; Eckweiler, Denitsa; Bielecka, Agata; Bueno, Emilio; Cava, Felipe; Abraham, Wolf-Rainer; Curtiss, Roy; Häussler, Susanne; Erhardt, Marc; Weiss, Siegfried
2016-01-01
ABSTRACT Recombinant attenuated Salmonella enterica serovar Typhimurium strains are believed to act as powerful live vaccine carriers that are able to elicit protection against various pathogens. Auxotrophic mutations, such as a deletion of aroA, are commonly introduced into such bacteria for attenuation without incapacitating immunostimulation. In this study, we describe the surprising finding that deletion of aroA dramatically increased the virulence of attenuated Salmonella in mouse models. Mutant bacteria lacking aroA elicited increased levels of the proinflammatory cytokine tumor necrosis factor alpha (TNF-α) after systemic application. A detailed genetic and phenotypic characterization in combination with transcriptomic and metabolic profiling demonstrated that ΔaroA mutants display pleiotropic alterations in cellular physiology and lipid and amino acid metabolism, as well as increased sensitivity to penicillin, complement, and phagocytic uptake. In concert with other immunomodulating mutations, deletion of aroA affected flagellin phase variation and gene expression of the virulence-associated genes arnT and ansB. Finally, ΔaroA strains displayed significantly improved tumor therapeutic activity. These results highlight the importance of a functional shikimate pathway to control homeostatic bacterial physiology. They further highlight the great potential of ΔaroA-attenuated Salmonella for the development of vaccines and cancer therapies with important implications for host-pathogen interactions and translational medicine. PMID:27601574
Targeting skeletal endothelium to ameliorate bone loss.
Xu, Ren; Yallowitz, Alisha; Qin, An; Wu, Zhuhao; Shin, Dong Yeon; Kim, Jung-Min; Debnath, Shawon; Ji, Gang; Bostrom, Mathias P; Yang, Xu; Zhang, Chao; Dong, Han; Kermani, Pouneh; Lalani, Sarfaraz; Li, Na; Liu, Yifang; Poulos, Michael G; Wach, Amanda; Zhang, Yi; Inoue, Kazuki; Di Lorenzo, Annarita; Zhao, Baohong; Butler, Jason M; Shim, Jae-Hyuck; Glimcher, Laurie H; Greenblatt, Matthew B
2018-06-01
Recent studies have identified a specialized subset of CD31 hi endomucin hi (CD31 hi EMCN hi ) vascular endothelium that positively regulates bone formation. However, it remains unclear how CD31 hi EMCN hi endothelium levels are coupled to anabolic bone formation. Mice with an osteoblast-specific deletion of Shn3, which have markedly elevated bone formation, demonstrated an increase in CD31 hi EMCN hi endothelium. Transcriptomic analysis identified SLIT3 as an osteoblast-derived, SHN3-regulated proangiogenic factor. Genetic deletion of Slit3 reduced skeletal CD31 hi EMCN hi endothelium, resulted in low bone mass because of impaired bone formation and partially reversed the high bone mass phenotype of Shn3 -/- mice. This coupling between osteoblasts and CD31 hi EMCN hi endothelium is essential for bone healing, as shown by defective fracture repair in SLIT3-mutant mice and enhanced fracture repair in SHN3-mutant mice. Finally, administration of recombinant SLIT3 both enhanced bone fracture healing and counteracted bone loss in a mouse model of postmenopausal osteoporosis. Thus, drugs that target the SLIT3 pathway may represent a new approach for vascular-targeted osteoanabolic therapy to treat bone loss.
Toyama, H; Anthony, C; Lidstrom, M E
1998-09-01
Methylobacterium extorquens AM1 is a pink-pigmented facultative methylotroph which is widely used for analyzing pathways of C1 metabolism with biochemical and molecular biological techniques. To facilitate this approach, we have applied a new method to construct insertion or disruption mutants with drug resistance genes by electroporation. By using this method, mutants were obtained in four genes present in the mxa methylotrophy gene cluster for which the functions were unknown, mxaR, mxaS, mxaC and mxaD. These mutants were unable to grow on methanol except the mutant of mxaD, which showed reduced growth on methanol.
CRISPR/Cas9 mediated genome editing in ES cells and its application for chimeric analysis in mice.
Oji, Asami; Noda, Taichi; Fujihara, Yoshitaka; Miyata, Haruhiko; Kim, Yeon Joo; Muto, Masanaga; Nozawa, Kaori; Matsumura, Takafumi; Isotani, Ayako; Ikawa, Masahito
2016-08-17
Targeted gene disrupted mice can be efficiently generated by expressing a single guide RNA (sgRNA)/CAS9 complex in the zygote. However, the limited success of complicated genome editing, such as large deletions, point mutations, and knockins, remains to be improved. Further, the mosaicism in founder generations complicates the genotypic and phenotypic analyses in these animals. Here we show that large deletions with two sgRNAs as well as dsDNA-mediated point mutations are efficient in mouse embryonic stem cells (ESCs). The dsDNA-mediated gene knockins are also feasible in ESCs. Finally, we generated chimeric mice with biallelic mutant ESCs for a lethal gene, Dnajb13, and analyzed their phenotypes. Not only was the lethal phenotype of hydrocephalus suppressed, but we also found that Dnajb13 is required for sperm cilia formation. The combination of biallelic genome editing in ESCs and subsequent chimeric analysis provides a useful tool for rapid gene function analysis in the whole organism.
Carmen Herranz, Ma; Sanchez-Navarro, Jesús-Angel; Saurí, Ana; Mingarro, Ismael; Pallás, Vicente
2005-08-15
The movement protein (MP) of Prunus necrotic ringspot virus (PNRSV) is required for cell-to-cell movement. MP subcellular localization studies using a GFP fusion protein revealed highly punctate structures between neighboring cells, believed to represent plasmodesmata. Deletion of the RNA-binding domain (RBD) of PNRSV MP abolishes the cell-to-cell movement. A mutational analysis on this RBD was performed in order to identify in vivo the features that govern viral transport. Loss of positive charges prevented the cell-to-cell movement even though all mutants showed a similar accumulation level in protoplasts to those observed with the wild-type (wt) MP. Synthetic peptides representing the mutants and wild-type RBDs were used to study RNA-binding affinities by EMSA assays being approximately 20-fold lower in the mutants. Circular dichroism analyses revealed that the secondary structure of the peptides was not significantly affected by mutations. The involvement of the affinity changes between the viral RNA and the MP in the viral cell-to-cell movement is discussed.
Yao, Qiu-Mei; Zhou, Jiao; Gale, Robert Peter; Li, Jin-Lan; Li, Ling-Di; Li, Ning; Chen, Shan-Shan; Ruan, Guo-Rui
2015-10-01
Calreticulin (CALR) mutations were recently identified in a substantial proportion of persons with essential thrombocythemia (ET) and with primary myelofibrosis (PMF) without JAK2(V617F). Consequently rapid, sensitive, and specific methods to detect and quantify these mutations are needed. We studied samples from 1088 persons with myeloproliferative neoplasms (MPNs) including 421 JAK2(V617F) negative subjects with ET, PMF, polycythemia vera (PV), chronic myeloid leukemia (CML) and hyper-eosinophilic syndrome (HES). Detection of CALR exon 9 mutations was done by PCR amplification followed by fragment length analysis and direct sequencing. Dilution assays were used to determine CALR mutant allele burden. We detected CALR mutations in blood and bone marrow samples from 152 subjects with ET and with PMF but not in samples from normal or persons with PV, CML, or HES. CALR mutant peaks were distinct from wild-type peaks and dilution experiments indicated a sensitivity level of 0.5-5% for a CALR mutant allele in a wild-type background. Diverse types of mutations were detected including deletions, insertions, and complex indels. All mutations were confirmed by direct sequencing. We also used dilution experiments to quantify mutant allele burden. We were able to reproducibly detect mutant allele levels as low 5% (0.5-5%) in a wild-type background. PCR amplification followed by fragment length analysis is a rapid, sensitive, and specific method for screening persons with MPNs for CALR mutations, especially those with ET and PMF and for estimating mutant allele burden.
Deletion of degQ gene enhances outer membrane vesicle production of Shewanella oneidensis cells.
Ojima, Yoshihiro; Mohanadas, Thivagaran; Kitamura, Kosei; Nunogami, Shota; Yajima, Reiki; Taya, Masahito
2017-04-01
Shewanella oneidensis is a Gram-negative facultative anaerobe that can use a wide variety of terminal electron acceptors for anaerobic respiration. In this study, S. oneidensis degQ gene, encoding a putative periplasmic serine protease, was cloned and expressed. The activity of purified DegQ was inhibited by diisopropyl fluorophosphate, a typical serine protease-specific inhibitor, indicating that DegQ is a serine protease. In-frame deletion and subsequent complementation of the degQ were carried out to examine the effect of envelope stress on the production of outer membrane vesicles (OMVs). Analysis of periplasmic proteins from the resulting S. oneidensis strain showed that deletion of degQ induced protein accumulation and resulted in a significant decrease in protease activity within the periplasmic space. OMVs from the wild-type and mutant strains were purified and observed by transmission electron microscopy. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of the OMVs showed a prominent band at ~37 kDa. Nanoliquid chromatography-tandem mass spectrometry analysis identified three outer membrane porins (SO3896, SO1821, and SO3545) as dominant components of the band, suggesting that these proteins could be used as indices for comparing OMV production by S. oneidensis strains. Quantitative evaluation showed that degQ-deficient cells had a fivefold increase in OMV production compared with wild-type cells. Thus, the increased OMV production following the deletion of DegQ in S. oneidensis may be responsible for the increase in envelope stress.
Zhang, Cui-Ying; Qi, Ya-Nan; Ma, Hong-Xia; Li, Wei; Dai, Long-Hai; Xiao, Dong-Guang
2015-04-01
An appropriate level of higher alcohols produced by yeast during the fermentation is one of the most important factors influencing Chinese rice wine quality. In this study, BAT1 and BAT2 single- and double-gene-deletion mutant strains were constructed from an industrial yeast strain RY1 to decrease higher alcohols during Chinese rice wine fermentation. The results showed that the BAT2 single-gene-deletion mutant strain produced best improvement in the production of higher alcohols while remaining showed normal growth and fermentation characteristics. Furthermore, a BAT2 single-gene-deletion diploid engineered strain RY1-Δbat2 was constructed and produced low levels of isobutanol and isoamylol (isoamyl alcohol and active amyl alcohol) in simulated fermentation of Chinese rice wine, 92.40 and 303.31 mg/L, respectively, which were 33.00 and 14.20 % lower than those of the parental strain RY1. The differences in fermentation performance between RY1-Δbat2 and RY1 were minor. Therefore, construction of this yeast strain is important in future development in Chinese wine industry and provides insights on generating yeast strains for other fermented alcoholic beverages.
E4orf1 Limits the Oncolytic Potential of the E1B-55K Deletion Mutant Adenovirus▿
Thomas, Michael A.; Broughton, Robin S.; Goodrum, Felicia D.; Ornelles, David A.
2009-01-01
Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G1 phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G1 restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3′-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function. PMID:19129452
E4orf1 limits the oncolytic potential of the E1B-55K deletion mutant adenovirus.
Thomas, Michael A; Broughton, Robin S; Goodrum, Felicia D; Ornelles, David A
2009-03-01
Clinical trials have shown oncolytic adenoviruses to be tumor selective with minimal toxicity toward normal tissue. The virus ONYX-015, in which the gene encoding the early region 1B 55-kDa (E1B-55K) protein is deleted, has been most effective when used in combination with either chemotherapy or radiation therapy. Therefore, improving the oncolytic nature of tumor-selective adenoviruses remains an important objective for improving this form of cancer therapy. Cells infected during the G(1) phase of the cell cycle with the E1B-55K deletion mutant virus exhibit a reduced rate of viral late protein synthesis, produce fewer viral progeny, and are less efficiently killed than cells infected during the S phase. Here we demonstrate that the G(1) restriction imposed on the E1B-55K deletion mutant virus is due to the viral oncogene encoded by open reading frame 1 of early region 4 (E4orf1). E4orf1 has been reported to signal through the phosphatidylinositol 3'-kinase pathway leading to the activation of Akt, mTOR, and p70 S6K. Evidence presented here shows that E4orf1 may also induce the phosphorylation of Akt and p70 S6K in a manner that depends on Rac1 and its guanine nucleotide exchange factor Tiam1. Accordingly, agents that have been reported to disrupt the Tiam1-Rac1 interaction or to prevent phosphorylation of the ribosomal S6 kinase partially alleviated the E4orf1 restriction to late viral protein synthesis and enhanced tumor cell killing by the E1B-55K mutant virus. These results demonstrate that E4orf1 limits the oncolytic nature of a conditionally replicating adenovirus such as ONYX-015. The therapeutic value of similar oncolytic adenoviruses may be improved by abrogating E4orf1 function.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ueno, Kazuma; Saito, Mayu; Nagashima, Makiko
Highlights: •A targeted genome screen identified 5 gene groups affecting Wsc1p recycling. •V-ATPase-dependent luminal acidification is required for Wsc1p recycling. •Activity of V-ATPase might be required for cargo recognition by the retromer complex. -- Abstract: Wsc1p is a major cell wall sensor protein localized at the polarized cell surface. The localization of Wsc1p is maintained by endocytosis and recycling from endosomes back to the cell surface, but changes to the vacuole when cells are subjected to heat stress. Exploiting this unique property of Wsc1p, we screened for yeast single-gene deletion mutants exhibiting defects in Wsc1p trafficking. By expressing 3GFP-tagged Wsc1pmore » in mutants with deleted genes whose function is related to intracellular trafficking, we identified 5 gene groups affecting Wsc1p trafficking, impaired respectively in endocytic internalization, multivesicular body sorting, the GARP complex, endosomal maturation/vacuolar fusion, and V-ATPase. Interestingly, deletion of the VPH1 gene, encoding the V{sub o} subunit of vacuolar-type H{sup +}-ATPase (V-ATPase), led to mis-localization of Wsc1p from the plasma membrane to the vacuole. In addition, disruption of other V-ATPase subunits (vma mutants) also caused defects of Wsc1p trafficking and vacuolar acidification similar to those seen in the vph1Δ mutant. Moreover, we found that deletion of the VPS26 gene, encoding a subunit of the retromer complex, also caused a defect in Wsc1p recycling and mis-localization of Wsc1p to the vacuole. These findings clarified the previously unidentified Wsc1p recycling pathway and requirement of V-ATPase-dependent luminal acidification for Wsc1p recycling.« less
Sharma, Vijay K; Dean-Nystrom, Evelyn A; Casey, Thomas A
2011-07-12
Escherichia coli O157:H7 colonizes cattle intestines by using the locus of enterocyte effacement (LEE)-encoded proteins. The induction of systemic immune response against LEE-encoded proteins, therefore, will prove effective in reducing E. coli O157:H7 colonization in cattle. The previous studies have demonstrated that a hha (encodes for a hemolysin expression modulating protein) deletion enhances expression of LEE-encoded proteins and a sepB (encodes an ATPase required for the secretion of LEE-encoded proteins) deletion results in intracellular accumulation of LEE proteins. In this study, we demonstrate the efficacy of the hha and hha sepB deletion mutants as bacterins for reducing fecal shedding of E. coli O157:H7 in experimentally inoculated weaned calves. The weaned calves were injected intramuscularly with the bacterins containing 10(9) heat-killed cells of the hha(+) wild-type or hha or hha sepB isogenic mutants, and boosted with the same doses 2- and 4-weeks later. The evaluation of the immune response two weeks after the last booster immunization revealed that the calves vaccinated with the hha mutant bacterin had higher antibody titers against LEE proteins compared to the titers for these antibodies in the calves vaccinated with the hha sepB mutant or hha(+) wild-type bacterins. Following oral inoculations with 10(10) CFU of the wild-type E. coli O157:H7, the greater numbers of calves in the group vaccinated with the hha or hha sepB mutant bacterins stopped shedding the inoculum strain within a few days after the inoculations compared to the group of calves vaccinated with the hha(+) wild-type bacterin or PBS sham vaccine. Thus, the use of bacterins prepared from the hha and hha sepB mutants for reducing colonization of E. coli O157:H7 in cattle could represent a potentially important pre-harvest strategy to enhance post-harvest safety of bovine food products, water and produce. Copyright © 2011 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Brown midrib (bmr) mutants in sorghum (Sorghum bicolor (L.) Moench) and several other C4 grasses are associated with reduced lignin concentration, altered lignin composition and improved cell wall digestibility, which are desirable properties in biomass development for the emerging lignocellulosic b...
USDA-ARS?s Scientific Manuscript database
A small fast neutron mutant population has been established from Phaseolus vulgaris cv. Red Hawk. We leveraged the available P. vulgaris genome sequence and high throughput next generation DNA sequencing to examine the genomic structure of five Phaseolus vulgaris cv. Red Hawk fast neutron mutants wi...
Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.)
2013-01-01
Background Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. Results The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. Conclusion These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes. PMID:24280269
Isolation of a novel mutant gene for soil-surface rooting in rice (Oryza sativa L.).
Hanzawa, Eiko; Sasaki, Kazuhiro; Nagai, Shinsei; Obara, Mitsuhiro; Fukuta, Yoshimichi; Uga, Yusaku; Miyao, Akio; Hirochika, Hirohiko; Higashitani, Atsushi; Maekawa, Masahiko; Sato, Tadashi
2013-11-20
Root system architecture is an important trait affecting the uptake of nutrients and water by crops. Shallower root systems preferentially take up nutrients from the topsoil and help avoid unfavorable environments in deeper soil layers. We have found a soil-surface rooting mutant from an M2 population that was regenerated from seed calli of a japonica rice cultivar, Nipponbare. In this study, we examined the genetic and physiological characteristics of this mutant. The primary roots of the mutant showed no gravitropic response from the seedling stage on, whereas the gravitropic response of the shoots was normal. Segregation analyses by using an F2 population derived from a cross between the soil-surface rooting mutant and wild-type Nipponbare indicated that the trait was controlled by a single recessive gene, designated as sor1. Fine mapping by using an F2 population derived from a cross between the mutant and an indica rice cultivar, Kasalath, revealed that sor1 was located within a 136-kb region between the simple sequence repeat markers RM16254 and 2935-6 on the terminal region of the short arm of chromosome 4, where 13 putative open reading frames (ORFs) were found. We sequenced these ORFs and detected a 33-bp deletion in one of them, Os04g0101800. Transgenic plants of the mutant transformed with the genomic fragment carrying the Os04g0101800 sequence from Nipponbare showed normal gravitropic responses and no soil-surface rooting. These results suggest that sor1, a rice mutant causing soil-surface rooting and altered root gravitropic response, is allelic to Os04g0101800, and that a 33-bp deletion in the coding region of this gene causes the mutant phenotypes.
Mutant power: using mutant allele collections for yeast functional genomics.
Norman, Kaitlyn L; Kumar, Anuj
2016-03-01
The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kreysing, J.; Bohne, W.; Boesenberg, C.
The authors identified a patient suffering from late-infantile metachromatic leukodystrophy (MLD) who has a residual arylsulfatase A (ARSA) activity of about 10%. Fibroblasts of the patient show significant sulfatide degradation activity exceeding that of adult MLD patients. Analysis of the ARSA gene in this patient revealed heterozygosity for two new mutant alleles: in one allele, deletion of C 447 in exon 2 leads to a frameshift and to a premature stop codon at amino acid position 105; in the second allele, a G[yields]A transition in exon 5 causes a Gly[sup 309][yields]Ser substitution. Transient expression of the mutant Ser[sup 309]-ARSA resultedmore » in only 13% enzyme activity of that observed in cells expressing normal ARSA. The mutant ARSA is correctly targeted to the lyosomes but is unstable. These findings are in contrast to previous results showing that the late-infantile type of MLD is always associated with the complete absence of ARSA activity. The expression of the mutant ARSA protein may be influenced by particular features of oligodendrocytes, such that the level of mutant enzymes is lower in these cells than in others. 23 refs., 4 figs., 2 tabs.« less
Russell, P W; Orndorff, P E
1992-01-01
We describe the characterization of two genes, fimF and fimG (also called pilD), that encode two minor components of type 1 pili in Escherichia coli. Defined, in-frame deletion mutations were generated in vitro in each of these two genes. A double mutation that had deletions identical to both single lesions was also constructed. Examination of minicell transcription and translation products of parental and mutant plasmids revealed that, as predicted from the nucleotide sequence and previous reports, the fimF gene product was a protein of ca. 16 kDa and that the fimG gene product was a protein of ca. 14 kDa. Each of the constructions was introduced, via homologous recombination, into the E. coli chromosome. All three of the resulting mutants produced type 1 pili and exhibited hemagglutination of guinea pig erythrocytes. The latter property was also exhibited by partially purified pili isolated from each of the mutants. Electron microscopic examination revealed that the fimF mutant had markedly reduced numbers of pili per cell, whereas the fimG mutant had very long pili. The double mutant displayed the characteristics of both single mutants. However, pili in the double mutant were even longer than those seen in the fimG mutant, and the numbers of pili were even fewer than those displayed by the fimF mutant. All three mutants could be complemented in trans with a single-copy-number plasmid bearing the appropriate parental gene or genes to give near-normal parental piliation. On the basis of the phenotypes exhibited by the single and double mutants, we believe that the fimF gene product may aid in initiating pilus assembly and that the fimG product may act as an inhibitor of pilus polymerization. In contrast to previous studies, we found that neither gene product was required for type 1 pilus receptor binding. Images PMID:1355769
Singh, Bhoj Raj; Chandra, Mudit; Hansda, Dhananjoy; Alam, Javed; Babu, Narayanan; Siddiqui, Mehtab Z; Agrawal, Ravi K; Sharma, Gautam
2013-04-01
Salmonella enterica subspecies enterica serovar Abortusequi (S. Abortusequi), a host adapted Salmonella causes abortions, still births and foal mortality in equids. Though known since more than 100 years, it is still a problem in many of the developing countries including India. There is dearth of really good vaccine affording immunity lasting at least for one full gestation. In search of a potential vaccine candidate, three defined deletion mutants (deltaaroA, deltahtrA and deltaaroAdeltahtrA) of S. Abortusequi were tested in guinea pig model for attenuation, safety, immunogenicity, humoral immune response, protective efficacy and persistence in host. The deltahtrA and deltaaroAdeltahtrA mutants were found to be safe on oral inoculation in doses as high as 4.2 x 10(9) cfu/animal. Also through subcutaneous inoculation deltaaroAdeltahtrA mutant did not induce any abortion in pregnant guinea pigs. All the three mutants did not induce any illness or death in 1-2 week-old baby guinea pigs except deltahtrA mutant which caused mortality on intraperitoneal inoculation. Inoculation with mutants protected against challenge and increased breeding efficiency of guinea pigs. After >4.5 months of mutant inoculation, guinea pigs were protected against abortifacient dose of wild type S. Abortusequi and mother guinea pigs also conferred resistance to their babies to the similar challenge. Early humoral immune response of S. Abortusequi mutants was characteristic. Faecal excretion of deltaaroA and htrA mutants was detected up to 45 days of inoculation in guinea pigs while deltaaroAdeltahtrA mutant could not be detected after 21 days of inoculation. The results indicated that the double deletion mutant (deltaaroAdeltahtrA) was the most effective and safe candidate for vaccination against S. Abortusequi through mucosal route of inoculation.
Plummer, Amy; Halsey, Kirstie; Lovegrove, Alison; Hammond-Kosack, Kim
2017-01-01
Pathogenic fungi must extend filamentous hyphae across solid surfaces to cause diseases of plants. However, the full inventory of genes which support this is incomplete and many may be currently concealed due to their essentiality for the hyphal growth form. During a random T-DNA mutagenesis screen performed on the pleomorphic wheat (Triticum aestivum) pathogen Zymoseptoria tritici, we acquired a mutant unable to extend hyphae specifically when on solid surfaces. In contrast “yeast-like” growth, and all other growth forms, were unaffected. The inability to extend surface hyphae resulted in a complete loss of virulence on plants. The affected gene encoded a predicted type 2 glycosyltransferase (ZtGT2). Analysis of >800 genomes from taxonomically diverse fungi highlighted a generally widespread, but discontinuous, distribution of ZtGT2 orthologues, and a complete absence of any similar proteins in non-filamentous ascomycete yeasts. Deletion mutants of the ZtGT2 orthologue in the taxonomically un-related fungus Fusarium graminearum were also severely impaired in hyphal growth and non-pathogenic on wheat ears. ZtGT2 expression increased during filamentous growth and electron microscopy on deletion mutants (ΔZtGT2) suggested the protein functions to maintain the outermost surface of the fungal cell wall. Despite this, adhesion to leaf surfaces was unaffected in ΔZtGT2 mutants and global RNAseq-based gene expression profiling highlighted that surface-sensing and protein secretion was also largely unaffected. However, ΔZtGT2 mutants constitutively overexpressed several transmembrane and secreted proteins, including an important LysM-domain chitin-binding virulence effector, Zt3LysM. ZtGT2 likely functions in the synthesis of a currently unknown, potentially minor but widespread, extracellular or outer cell wall polysaccharide which plays a key role in facilitating many interactions between plants and fungi by enabling hyphal growth on solid matrices. PMID:29020037
Xie, Fang; Li, Gang; Wang, Yalei; Zhang, Yanhe; Zhou, Long; Wang, Chengcheng; Liu, Shuanghong; Liu, Siguo; Wang, Chunlai
2017-01-01
Pyridoxal 5'-phosphate (PLP) is an essential cofactor for numerous enzymes involved in a diversity of cellular processes in living organisms. Previous analysis of the Actinobacillus pleuropneumoniae S-8 genome sequence revealed the presence of pdxS and pdxT genes, which are implicated in deoxyxylulose 5-phosphate (DXP)-independent pathway of PLP biosynthesis; however, little is known about their roles in A. pleuropneumoniae pathogenicity. Our data demonstrated that A. pleuropneumoniae could synthesize PLP by PdxS and PdxT enzymes. Disruption of the pdxS and pdxT genes rendered the pathogen auxotrophic for PLP, and the defective growth as a result of these mutants was chemically compensated by the addition of PLP, suggesting the importance of PLP production for A. pleuropneumoniae growth and viability. Additionally, the pdxS and pdxT deletion mutants displayed morphological defects as indicated by irregular and aberrant shapes in the absence of PLP. The reduced growth of the pdxS and pdxT deletion mutants under osmotic and oxidative stress conditions suggests that the PLP synthases PdxS/PdxT are associated with the stress tolerance of A. pleuropneumoniae. Furthermore, disruption of the PLP biosynthesis pathway led to reduced colonization and attenuated virulence of A. pleuropneumoniae in the BALB/c mouse model. The data presented in this study reveal the critical role of PLP synthases PdxS/PdxT in viability, stress tolerance, and virulence of A. pleuropneumoniae.
Murakami, Shinya; Kuehnle, Katrin; Stern, David B.
2005-01-01
Numerous nuclear gene products are required for the correct expression of organellar genes. One such gene in the green alga Chlamydomonas reinhardtii is MCD1, whose product is required for stability of the chloroplast-encoded petD mRNA. In mcd1 mutants, which are non-photosynthetic, petD mRNA is degraded by a 5′–3′ exonuclease activity, resulting in a failure to synthesize its product, subunit IV of the cytochrome b 6/f complex. Here, we report the sequence of the wild-type MCD1 gene, which encodes a large and novel putative protein. Analysis of three mutant alleles showed that two harbored large deletions, but that one allele, mcd1-2, had a single base change resulting in a nonsense codon near the N-terminus. This same mutant allele can be suppressed by a second-site mutation in the nuclear MCD2 gene, whereas mcd2-1 cannot suppress the deletion in mcd1-1 (Esposito,D. Higgs,D.C. Drager,R.G. Stern, D.B. and Girard-Bascou,J. (2001) Curr. Genet., 39, 40–48). We report the cloning of mcd2-1, and show that the mutation lies in a tRNASer(CGA), which has been modified to translate the nonsense codon in mcd1-2. We discuss how the existence of a large tRNASer gene family may permit this suppression without pleiotropic consequences. PMID:15947135
Xie, Ning; Chapeland-Leclerc, Florence; Silar, Philippe; Ruprich-Robert, Gwenaël
2014-01-01
Transformation of plant biomass into biofuels may supply environmentally friendly alternative biological sources of energy. Laccases are supposed to be involved in the lysis of lignin, a prerequisite step for efficient breakdown of cellulose into fermentable sugars. The role in development and plant biomass degradation of the nine canonical laccases belonging to three different subfamilies and one related multicopper oxidase of the Ascomycota fungus Podospora anserina was investigated by targeted gene deletion. The 10 genes were inactivated singly, and multiple mutants were constructed by genetic crosses. lac6(Δ), lac8(Δ) and mco(Δ) mutants were significantly reduced in their ability to grow on lignin-containing materials, but also on cellulose and plastic. Furthermore, lac8(Δ), lac7(Δ), mco(Δ) and lac6(Δ) mutants were defective towards resistance to phenolic substrates and H2 O2 , which may also impact lignocellulose breakdown. Double and multiple mutants were generally more affected than single mutants, evidencing redundancy of function among laccases. Our study provides the first genetic evidences that laccases are major actors of wood utilization in a fungus and that they have multiple roles during this process apart from participation in lignin lysis. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Functional improvement of Saccharomyces cerevisiae to reduce volatile acidity in wine.
Luo, Zongli; Walkey, Christopher J; Madilao, Lufiani L; Measday, Vivien; Van Vuuren, Hennie J J
2013-08-01
Control of volatile acidity (VA) is a major issue for wine quality. In this study, we investigated the production of VA by a deletion mutant of the fermentation stress response gene AAF1 in the budding yeast Saccharomyces cerevisiae. Fermentations were carried out in commercial Chardonnay grape must to mimic industrial wine-making conditions. We demonstrated that a wine yeast strain deleted for AAF1 reduced acetic acid levels in wine by up to 39.2% without increasing the acetaldehyde levels, revealing a potential for industrial application. Deletion of the cytosolic aldehyde dehydrogenase gene ALD6 also reduced acetic acid levels dramatically, but increased the acetaldehyde levels by 41.4%, which is not desired by the wine industry. By comparison, ALD4 and the AAF1 paralog RSF2 had no effects on acetic acid production in wine. Deletion of AAF1 was detrimental to the growth of ald6Δ and ald4Δald6Δ mutants, but had no effect on acetic acid production. Overexpression of AAF1 dramatically increased acetic acid levels in wine in an Ald6p-dependent manner, indicating that Aaf1p regulates acetic acid production mainly via Ald6p. Overexpression of AAF1 in an ald4Δald6Δ strain produced significantly more acetic acid in wine than the ald4Δald6Δ mutant, suggesting that Aaf1p may also regulate acetic acid synthesis independently of Ald4p and Ald6p. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Lethal factor is not required for Bacillus anthracis virulence in guinea pigs and rabbits.
Levy, Haim; Weiss, Shay; Altboum, Zeev; Schlomovitz, Josef; Rothschild, Nili; Blachinsky, Eran; Kobiler, David
2011-11-01
The major virulence factor of Bacillus anthracis is the tripartite anthrax toxin, comprising the protective antigen (PA), lethal factor (LF) and edema factor (EF). The LF of B. anthracis is a metalloprotease that has been shown to play an important role in pathogenicity. Deletion of this gene (lef) in the Sterne strain was reported to dramatically reduce the pathogenicity of this strain in mice, and was reported to be as dramatic as the deletion of PA. We evaluated the effect on pathogenicity of the lef deletion in the fully virulent Vollum strain in guinea pigs and NZW rabbits by either subcutaneous injection or intranasal instillation. In guinea pigs, no major differences between the mutant strain and the wild type could be detected in the LD(50) or mean time to death values. On the other hand, the lef deletion caused death of 50-70% of all rabbits infected with the mutant spores at doses equivalent or higher than the wild type LD(50). The surviving rabbits, which were infected with spore doses higher than the wild type LD(50), developed a protective immune response that conferred resistance to challenge with the wild type strain. These findings may indicate that the mutant lacking the LF is capable of host colonization which causes death in 50-70% of the animals and a protective immune response in the others. These results indicate that unlike the data obtained in mice, the LF mutation does not abolish B. anthracis pathogenicity. Copyright © 2011 Elsevier Ltd. All rights reserved.
Zhao, Wei; Niu, Ke; Zhao, Jian; Jin, Yi-ming; Sui, Ting-ting; Wang, Wen
2013-09-01
Human astrovirus (HAstV) is one of the leading causes of actue virual diarrhea in infants. HAstV-induced epithdlial cell apoptosis plays an important role in the pathogenesis of HAstV infection. Our previous study indicated that HAstV non-structural protein nsPla C-terminal protein nsPla/4 was the major apoptosis functional protein and probably contained the main apoptosis domains. In order to screen for astrovirus encoded apoptotic protien, nsPla/4 and six turncated proteins, which possessed nsPla/4 protein different function domain ,were cloned into green fluorescent protein (GFP) vector pEG-FP-N3. After 24-72 h transfection, the fusion protein expression in BHK21 cells, was analysis by fluorescence microscope and Western blot. The results indicated seven fusion proteins were observed successfully in BHK21 cell after transfected for 24 h. Western blot analysis showed that the level of fusion protein expressed in BHK21 cells was increased significantly at 72h compared to 48h in transfected cells. The successful expression of deletion mutants of nsPla/4 protein was an important foundation to gain further insights into the function of apoptosis domains of nsPla/4 protein and it would also provide research platform to further confirm the molecule pathogenic mechanism of human astrovirus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Yuan-I; Hsu, Sheng-Chieh; Chau, Gar-Yang
2011-01-21
Research highlights: {yields} Verifying by direct methylation assay the substrate sites of PRMT1 in the hnRNP K protein. {yields} Identifying the preferred PMRT1 methylation regions in hnRNP K by kinetic analysis. {yields} Linking methylation in regulating nuclear localization of hnRNP K. -- Abstract: Protein arginine methylation plays crucial roles in numerous cellular processes. Heterogeneous nuclear ribonucleoprotein K (hnRNP K) is a multi-functional protein participating in a variety of cellular functions including transcription and RNA processing. HnRNP K is methylated at multiple sites in the glycine- and arginine-rich (RGG) motif. Using various RGG domain deletion mutants of hnRNP K as substrates,more » here we show by direct methylation assay that protein arginine methyltransferase 1 (PRMT1) methylated preferentially in a.a. 280-307 of the RGG motif. Kinetic analysis revealed that deletion of a.a. 280-307, but not a.a. 308-327, significantly inhibited rate of methylation. Importantly, nuclear localization of hnRNP K was significantly impaired in mutant hnRNP K lacking the PRMT1 methylation region or upon pharmacological inhibition of methylation. Together our results identify preferred PRMT1 methylation sequences of hnRNP K by direct methylation assay and implicate a role of arginine methylation in regulating intracellular distribution of hnRNP K.« less
Kastenmayer, Robin J; Maruri-Avidal, Liliana; Americo, Jeffrey L; Earl, Patricia L; Weisberg, Andrea S; Moss, Bernard
2014-03-01
Some orthopoxviruses including cowpox virus embed virus particles in dense bodies, comprised of the A-type inclusion (ATI) protein, which may provide long-term environmental protection. This strategy could be beneficial if the host population is sparse or spread is inefficient or indirect. However, the formation of ATI may be neutral or disadvantageous for orthopoxviruses that rely on direct respiratory spread. Disrupted ATI open reading frames in orthopoxviruses such as variola virus, the agent of smallpox, and monkeypox virus suggests that loss of this feature provided positive selection. To test this hypothesis, we constructed cowpox virus mutants with deletion of the ATI gene or another gene required for embedding virions. The ATI deletion mutant caused greater weight loss and higher replication in the respiratory tract than control viruses, supporting our hypothesis. Deletion of the gene for embedding virions had a lesser effect, possibly due to known additional functions of the encoded protein. Published by Elsevier Inc.
NASA Astrophysics Data System (ADS)
Kurosaka, Goyu; Abe, Fumiyoshi
2018-01-01
In the yeast Saccharomyces cerevisiae, hydrostatic pressure at 25 MPa is known to be nonlethal but significantly impairs the uptake of tryptophan by the permease Tat2, thereby inhibiting the growth of strains that require tryptophan from the medium. Here, we found that the lack of the YPR153W gene, so far poorly characterized for its role in yeast, caused a serious adverse effect on the growth at 10-25 MPa in the strain that required tryptophan. Deletion for YPR153W resulted in an increased rate of pressure-induced degradation of Tat2, suggesting that Tat2 is destabilized in the YPR153W deletion mutant at 25 MPa. Overexpression of the TAT2 gene enabled the deletion mutant to grow at 25 MPa. These results suggest that Ypr153w is essential for the stability and proper transport function of Tat2 under pressure at 10-25 MPa.
2014-01-01
Background Insertion duplication mutagenesis (IDM) and in-frame deletion (IFD) are common techniques for studying gene function, and have been applied to pneumolysin (ply), a virulence gene in Streptococcus pneumoniae (D39). Discrepancies in virulence between the two techniques were observed in both the previous and present studies. This phenomenon was also observed during mutation analysis of autolysin (lytA). Results Our data showed that target gene restoration (TGR) occurred in IDM mutants, even in the presence of antibiotics, while the IFD mutants were stable. In PCR result, TGR occurred later in IDM-ply and -lytA mutants cultured in non-supplemented medium (4–5 h) compared with those grown in medium supplemented with erythromycin (erm)/chloramphenicol (cat) (3–4 h), but plateaued faster. Real-time PCR for detecting TGR had been performed. When compared with 8-h culture, TGR detection increased from Day 1 and Day 2 of IDM mutant’s culture. erm-sensitive clones from IDM mutant were found. Southern blot hybridization and Western blotting also confirmed the phenomenon of TGR. The median survival of mice following intraperitoneal (IP) injection with a 3-h culture of IDM-mutants was significantly longer than that with an 8-h culture, irrespective of antibiotic usage. The median survival time of mice following IP injection of a 3-h culture versus an 8-h culture of IDM-ply in the absence of antibiotics was 10 days versus 2 days (p = 0.031), respectively, while in the presence of erm, the median survival was 5 days versus 2.5 days (p = 0.037), respectively. For an IDM-lytA mutant, the corresponding values were 8.5 days versus 2 days (p = 0.019), respectively, for non-supplemented medium, and 2.5 versus 2 days (p = 0.021), respectively, in the presence of cat. A comparable survival rate was observed between WT D39 and an 8-h IDM culture. Conclusion TGR in IDM mutants should be monitored to avoid inconsistent results, and misinterpretation of data due to TGR could lead to important biological meaning being overlooked. Therefore, based on these results, IFD is preferable to IDM for disruption of target genes. PMID:24558977
Blockade of a key region in the extracellular domain inhibits HER2 dimerization and signaling.
Menendez, Javier A; Schroeder, Barbara; Peirce, Susan K; Vellon, Luciano; Papadimitropoulou, Adriana; Espinoza, Ingrid; Lupu, Ruth
2015-06-01
Several treatment strategies target the human epidermal growth factor receptor 2 (HER2) in breast carcinomas, including monoclonal antibodies directed against HER2's extracellular domain (ECD) and small molecule inhibitors of its tyrosine kinase activity. Yet, novel therapies are needed that prevent HER2 dimerization with other HER family members, because current treatments are only partially effective. To test the hypothesis that HER2 activation requires a protein sequence in the HER2-ECD that mediates HER2 homo- and heterodimerization, we introduced a series of deletion mutations in the third subdomain of HER2-ECD. These deletion mutants were retrovirally expressed in breast cancer (BC) cells that naturally overexpress HER2 and in noncancerous, HER2-negative breast epithelial cells. One-factor analysis of variance or Student's t test were used to analyze differences. All statistical tests were two-sided. The smallest deletion in the ECD domain of HER2, which removed only 16 amino acids (HER2-ECDΔ451-466), completely disrupted the oncogenic potential of HER2. In contrast to wild-type HER2, the mutant-inhibited anchorage-independent growth (mean number of colonies: mutant, 70, 95% confidence interval [CI] = 55 to 85; wild-type, 400, 95% CI = 320 to 480, P < .001) increased sensitivity to paclitaxel treatment in both transformed and nontransformed cells. Overexpression of HER2Δ451-466 efficiently inhibited activation of HER1, HER2, and HER3 in all cell lines tested. These findings reveal that an essential "activating" sequence exists in the extracellular domain of HER2. Disruption of this sequence disables the HER2 dimerization loop, blocks subsequent activation of HER2-driven oncogenic signaling, and generates a dominant-negative form of HER2. Reagents specifically against this molecular activation switch may represent a novel targeted approach for the management of HER2-overexpressing carcinomas. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Ji, S H; Gururani, M A; Lee, J W; Ahn, B-O; Chun, S-C
2014-03-01
We have isolated a severe dwarf mutant derived from a Ds (Dissociation) insertion mutant rice (Oryza sativa var. japonica c.v. Dongjin). This severe dwarf phenotype, has short and dark green leaves, reduced shoot growth early in the seedling stage, and later severe dwarfism with failure to initiate flowering. When treated with bioactive GA3 , mutants are restored to the normal wild-type phenotype. Reverse transcription PCR analyses of 22 candidate genes related to the gibberellin (GA) biosynthesis pathway revealed that among 22 candidate genes tested, a dwarf mutant transcript was not expressed only in one OsKS2 gene. Genetic analysis revealed that the severe dwarf phenotype was controlled by recessive mutation of a single nuclear gene. The putative OsKS2 gene was a chromosome 4-located ent-kaurene synthase (KS), encoding the enzyme that catalyses an early step of the GA biosynthesis pathway. Sequence analysis revealed that osks2 carried a 1-bp deletion in the ORF region of OsKS2, which led to a loss-of-function mutation. The expression pattern of OsKS2 in wild-type cv Dongjin, showed that it is expressed in all organs, most prominently in the stem and floral organs. Morphological characteristics of the dwarf mutant showed dramatic modifications in internal structure and external morphology. We propose that dwarfism in this mutant is caused by a point mutation in OsKS2, which plays a significant role in growth and development of higher plants. Further investigation on OsKS2 and other OsKS-like proteins is underway and may yield better understanding of the putative role of OsKS in severe dwarf mutants. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Kamisaka, Yasushi; Kimura, Kazuyoshi; Uemura, Hiroshi; Yamaoka, Masakazu
2013-08-01
Lipid production by Saccharomyces cerevisiae was improved by overexpression of the yeast diacylglycerol acyltransferase Dga1p lacking the N-terminal 29 amino acids (Dga1∆Np), which was previously found to be an active form in the ∆snf2 mutant. Overexpression of Dga1∆Np in the ∆snf2 mutant, however, did not increase lipid content as expected, which prompted us to search for a more suitable strain in which to study the role of Dga1∆Np in lipid accumulation. We found that the overexpression of Dga1∆Np in the ∆dga1 mutant effectively increased the lipid content up to about 45 % in the medium containing 10 % glucose. The high lipid content of the transformant was dependent on glucose concentration, nitrogen limitation, and active leucine biosynthesis. To better understand the effect of dga1 disruption on the ability of Dga1∆Np to stimulate lipid accumulation, the ∆dga1-1 mutant, in which the 3'-terminal 36 bp of the dga1 open reading frame (ORF) remained, and the ∆dga1-2 mutant, in which the 3'-terminal 36 bp were also deleted, were prepared with URA3 disruption cassettes. Surprisingly, the overexpression of Dga1∆Np in the ∆dga1-1 mutant had a lower lipid content than the original ∆dga1 mutant, whereas overexpression in the ∆dga1-2 mutant led to a high lipid content of about 45 %. These results indicated that deletion of the 3' terminal region of the dga1 ORF, rather than abrogation of genomic Dga1p expression, was crucial for the effect of Dga1∆Np on lipid accumulation. To investigate whether dga1 disruption affected gene expression adjacent to DGA1, we found that the overexpression of Esa1p together with Dga1∆Np in the ∆dga1 mutant reverted the lipid content to the level of the wild-type strain overexpressing Dga1∆Np. In addition, RT-qPCR analysis revealed that ESA1 mRNA expression in the ∆dga1 mutant was decreased compared to the wild-type strain at the early stages of culture, suggesting that lowered Esa1p expression is involved in the effect of dga1 disruption on Dga1∆Np-dependent lipid accumulation. These results provide a new strategy to engineer S. cerevisiae for optimal lipid production.
Pham, Nikki T.; Wei, Tong; Schackwitz, Wendy S.; Lipzen, Anna M.; Duong, Phat Q.; Jones, Kyle C.; Ruan, Deling; Bauer, Diane; Peng, Yi; Schmutz, Jeremy
2017-01-01
The availability of a whole-genome sequenced mutant population and the cataloging of mutations of each line at a single-nucleotide resolution facilitate functional genomic analysis. To this end, we generated and sequenced a fast-neutron-induced mutant population in the model rice cultivar Kitaake (Oryza sativa ssp japonica), which completes its life cycle in 9 weeks. We sequenced 1504 mutant lines at 45-fold coverage and identified 91,513 mutations affecting 32,307 genes, i.e., 58% of all rice genes. We detected an average of 61 mutations per line. Mutation types include single-base substitutions, deletions, insertions, inversions, translocations, and tandem duplications. We observed a high proportion of loss-of-function mutations. We identified an inversion affecting a single gene as the causative mutation for the short-grain phenotype in one mutant line. This result reveals the usefulness of the resource for efficient, cost-effective identification of genes conferring specific phenotypes. To facilitate public access to this genetic resource, we established an open access database called KitBase that provides access to sequence data and seed stocks. This population complements other available mutant collections and gene-editing technologies. This work demonstrates how inexpensive next-generation sequencing can be applied to generate a high-density catalog of mutations. PMID:28576844
[Construction of FANCA mutant protein from Fanconi anemia patient and analysis of its function].
Chen, Fei; Zhang, Ke-Jian; Zuo, Xue-Lan; Zeng, Xian-Chang
2007-11-01
To study FANCA protein expression in Fanconi anemia patient's (FA) cells and explore its function. FANCA protein expression was analyzed in 3 lymphoblast cell lines derived from 3 cases of type A FA (FA-A) patients using Western blot. Nucleus and cytoplasm localization of FANCA protein was analyzed in one case of FA-A which contained a truncated FANCA (exon 5 deletion). The FANCA mutant was constructed from the same patient and its interaction with FANCG was evaluated by mammalian two-hybrid (M2H) assay. FANCA protein was not detected in the 3 FA-A patients by rabbit anti-human MoAb, but a truncated FANCA protein was detected in 1 of them by mouse anti-human MoAb. The truncated FANCA could not transport from cytoplasm into nucleus. The disease-associated FANCA mutant was defective in binding to FANCG in M2H system. FANCA proteins are defective in the 3 FA-A patients. Disfunction of disease-associated FANCA mutant proved to be the pathogenic mutations in FANCA gene. Exon 5 of FANCA gene was involved in the interaction between FANCA and FANCG.
Suppression of retroviral MA deletions by the amino-terminal membrane-binding domain of p60src.
Wills, J W; Craven, R C; Weldon, R A; Nelle, T D; Erdie, C R
1991-01-01
The molecular mechanism by which retroviral Gag proteins are directed to the plasma membrane for the formation of particles (budding) is unknown, but it is widely believed that the MA domain, located at the amino terminus, plays a critical role. Consistent with this idea, we found that small deletions in this segment of the Rous sarcoma virus Gag protein completely blocked particle formation. The mutant proteins appear to have suffered only localized structural damage since they could be rescued (i.e., packaged into particles) when coexpressed with Gag proteins that are competent for particle formation. To our surprise, the effects of the MA deletions could be completely suppressed by fusing as few as seven residues of the myristylated amino terminus of the oncoprotein p60src to the beginning of the mutant Gag proteins. Particles produced by the chimeras were of the same density as the wild type. Two myristylated peptides having sequences distinct from that of p60src were entirely unable to suppress MA deletions, indicating that myristate alone is not a sufficient membrane targeting signal. We hypothesize that the amino terminus of p60src suppresses the effects of MA deletions by diverting the Rous sarcoma virus Gag protein from its normal site of assembly to the Src receptor for particle formation. Images PMID:1710290
Competitive Genomic Screens of Barcoded Yeast Libraries
Urbanus, Malene; Proctor, Michael; Heisler, Lawrence E.; Giaever, Guri; Nislow, Corey
2011-01-01
By virtue of advances in next generation sequencing technologies, we have access to new genome sequences almost daily. The tempo of these advances is accelerating, promising greater depth and breadth. In light of these extraordinary advances, the need for fast, parallel methods to define gene function becomes ever more important. Collections of genome-wide deletion mutants in yeasts and E. coli have served as workhorses for functional characterization of gene function, but this approach is not scalable, current gene-deletion approaches require each of the thousands of genes that comprise a genome to be deleted and verified. Only after this work is complete can we pursue high-throughput phenotyping. Over the past decade, our laboratory has refined a portfolio of competitive, miniaturized, high-throughput genome-wide assays that can be performed in parallel. This parallelization is possible because of the inclusion of DNA 'tags', or 'barcodes,' into each mutant, with the barcode serving as a proxy for the mutation and one can measure the barcode abundance to assess mutant fitness. In this study, we seek to fill the gap between DNA sequence and barcoded mutant collections. To accomplish this we introduce a combined transposon disruption-barcoding approach that opens up parallel barcode assays to newly sequenced, but poorly characterized microbes. To illustrate this approach we present a new Candida albicans barcoded disruption collection and describe how both microarray-based and next generation sequencing-based platforms can be used to collect 10,000 - 1,000,000 gene-gene and drug-gene interactions in a single experiment. PMID:21860376
Gene Editing and Gene-Based Therapeutics for Cardiomyopathies.
Ohiri, Joyce C; McNally, Elizabeth M
2018-04-01
With an increasing understanding of genetic defects leading to cardiomyopathy, focus is shifting to correcting these underlying genetic defects. One approach involves treating mutant RNA through antisense oligonucleotides; the first drug has received regulatory approval to treat specific mutations associated with Duchenne muscular dystrophy. Gene editing is being evaluated in the preclinical setting. For inherited cardiomyopathies, genetic correction strategies require tight specificity for the mutant allele. Gene-editing methods are being tested to create deletions that may be useful to restore protein expression by through the bypass of mutations that restore protein production. Site-specific gene editing, which is required to correct many point mutations, is a less efficient process than inducing deletions. Copyright © 2017 Elsevier Inc. All rights reserved.
Nakamura, Hidetoshi; Katayama, Takuya; Okabe, Tomoya; Iwashita, Kazuhiro; Fujii, Wataru; Kitamoto, Katsuhiko; Maruyama, Jun-Ichi
2017-07-11
Numerous strains of Aspergillus oryzae are industrially used for Japanese traditional fermentation and for the production of enzymes and heterologous proteins. In A. oryzae, deletion of the ku70 or ligD genes involved in non-homologous end joining (NHEJ) has allowed high gene targeting efficiency. However, this strategy has been mainly applied under the genetic background of the A. oryzae wild strain RIB40, and it would be laborious to delete the NHEJ genes in many A. oryzae industrial strains, probably due to their low gene targeting efficiency. In the present study, we generated ligD mutants from the A. oryzae industrial strains by employing the CRISPR/Cas9 system, which we previously developed as a genome editing method. Uridine/uracil auxotrophic strains were generated by deletion of the pyrG gene, which was subsequently used as a selective marker. We examined the gene targeting efficiency with the ecdR gene, of which deletion was reported to induce sclerotia formation under the genetic background of the strain RIB40. As expected, the deletion efficiencies were high, around 60~80%, in the ligD mutants of industrial strains. Intriguingly, the effects of the ecdR deletion on sclerotia formation varied depending on the strains, and we found sclerotia-like structures under the background of the industrial strains, which have never been reported to form sclerotia. The present study demonstrates that introducing ligD mutation by genome editing is an effective method allowing high gene targeting efficiency in A. oryzae industrial strains.
Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su
2015-01-20
In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.
Effective screen of CRISPR/Cas9-induced mutants in rice by single-strand conformation polymorphism.
Zheng, Xuelian; Yang, Shixin; Zhang, Dengwei; Zhong, Zhaohui; Tang, Xu; Deng, Kejun; Zhou, Jianping; Qi, Yiping; Zhang, Yong
2016-07-01
A method based on DNA single-strand conformation polymorphism is demonstrated for effective genotyping of CRISPR/Cas9-induced mutants in rice. Clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated 9 (Cas9) has been widely adopted for genome editing in many organisms. A large proportion of mutations generated by CRISPR/Cas9 are very small insertions and deletions (indels), presumably because Cas9 generates blunt-ended double-strand breaks which are subsequently repaired without extensive end-processing. CRISPR/Cas9 is highly effective for targeted mutagenesis in the important crop, rice. For example, homozygous mutant seedlings are commonly recovered from CRISPR/Cas9-treated calli. However, many current mutation detection methods are not very suitable for screening homozygous mutants that typically carry small indels. In this study, we tested a mutation detection method based on single-strand conformational polymorphism (SSCP). We found it can effectively detect small indels in pilot experiments. By applying the SSCP method for CRISRP-Cas9-mediated targeted mutagenesis in rice, we successfully identified multiple mutants of OsROC5 and OsDEP1. In conclusion, the SSCP analysis will be a useful genotyping method for rapid identification of CRISPR/Cas9-induced mutants, including the most desirable homozygous mutants. The method also has high potential for similar applications in other plant species.
Jiménez, Natalia; Senchenkova, Sofya N; Knirel, Yuriy A; Pieretti, Giuseppina; Corsaro, Maria M; Aquilini, Eleonora; Regué, Miguel; Merino, Susana; Tomás, Juan M
2012-07-01
The presence of cell-bound K1 capsule and K1 polysaccharide in culture supernatants was determined in a series of in-frame nonpolar core biosynthetic mutants from Escherichia coli KT1094 (K1, R1 core lipopolysaccharide [LPS] type) for which the major core oligosaccharide structures were determined. Cell-bound K1 capsule was absent from mutants devoid of phosphoryl modifications on L-glycero-D-manno-heptose residues (HepI and HepII) of the inner-core LPS and reduced in mutants devoid of phosphoryl modification on HepII or devoid of HepIII. In contrast, in all of the mutants, K1 polysaccharide was found in culture supernatants. These results were confirmed by using a mutant with a deletion spanning from the hldD to waaQ genes of the waa gene cluster to which individual genes were reintroduced. A nuclear magnetic resonance (NMR) analysis of core LPS from HepIII-deficient mutants showed an alteration in the pattern of phosphoryl modifications. A cell extract containing both K1 capsule polysaccharide and LPS obtained from an O-antigen-deficient mutant could be resolved into K1 polysaccharide and core LPS by column chromatography only when EDTA and deoxycholate (DOC) buffer were used. These results suggest that the K1 polysaccharide remains cell associated by ionically interacting with the phosphate-negative charges of the core LPS.
Jiménez, Natalia; Senchenkova, Sofya N.; Knirel, Yuriy A.; Pieretti, Giuseppina; Corsaro, Maria M.; Aquilini, Eleonora; Regué, Miguel; Merino, Susana
2012-01-01
The presence of cell-bound K1 capsule and K1 polysaccharide in culture supernatants was determined in a series of in-frame nonpolar core biosynthetic mutants from Escherichia coli KT1094 (K1, R1 core lipopolysaccharide [LPS] type) for which the major core oligosaccharide structures were determined. Cell-bound K1 capsule was absent from mutants devoid of phosphoryl modifications on l-glycero-d-manno-heptose residues (HepI and HepII) of the inner-core LPS and reduced in mutants devoid of phosphoryl modification on HepII or devoid of HepIII. In contrast, in all of the mutants, K1 polysaccharide was found in culture supernatants. These results were confirmed by using a mutant with a deletion spanning from the hldD to waaQ genes of the waa gene cluster to which individual genes were reintroduced. A nuclear magnetic resonance (NMR) analysis of core LPS from HepIII-deficient mutants showed an alteration in the pattern of phosphoryl modifications. A cell extract containing both K1 capsule polysaccharide and LPS obtained from an O-antigen-deficient mutant could be resolved into K1 polysaccharide and core LPS by column chromatography only when EDTA and deoxycholate (DOC) buffer were used. These results suggest that the K1 polysaccharide remains cell associated by ionically interacting with the phosphate-negative charges of the core LPS. PMID:22522903
Friendly fire: redirecting herpes simplex virus-1 for therapeutic applications.
Advani, S J; Weichselbaum, R R; Whitley, R J; Roizman, B
2002-09-01
Herpes simplex virus-1 (HSV-1) is a relatively large double-stranded DNA virus encoding at least 89 proteins with well characterized disease pathology. An understanding of the functions of viral proteins together with the ability to genetically engineer specific viral mutants has led to the development of attenuated HSV-1 for gene therapy. This review highlights the progress in creating attenuated genetically engineered HSV-1 mutants that are either replication competent (viral non-essential gene deleted) or replication defective (viral essential gene deleted). The choice between a replication-competent or -defective virus is based on the end-goal of the therapeutic intervention. Replication-competent HSV-1 mutants have primarily been employed as antitumor oncolytic viruses, with the lytic nature of the virus harnessed to destroy tumor cells selectively. In replacement gene therapy, replication-defective viruses have been utilized as delivery vectors. The advantages of HSV-1 vectors are that they infect quiescent and dividing cells efficiently and can encode for relatively large transgenes.
Meng, Xianrong; Liu, Xueling; Zhang, Liyuan; Hou, Bo; Li, Binyou; Tan, Chen; Li, Zili; Zhou, Rui; Li, Shaowen
2016-09-01
Outer membrane protein X (OmpX) and its homologues have been proposed to contribute to the virulence in various bacterial species. But, their role in virulence of extraintestinal pathogenic Escherichia coli (ExPEC) is yet to be determined. This study evaluates the role of OmpX in ExPEC virulence in vitro and in vivo using a clinical strain PPECC42 of porcine origin. The ompX deletion mutant exhibited increased swimming motility and decreased adhesion to, and invasion of pulmonary epithelial A549 cell, compared to the wild-type strain. A mild increase in LD50 and distinct decrease in bacterial load in such organs as heart, liver, spleen, lung and kidney were observed in mice infected with the ompX mutant. Complementation of the complete ompX gene in trans restored the virulence of mutant strain to the level of wild-type strain. Our results reveal that OmpX contributes to ExPEC virulence, but may be not an indispensable virulence determinant.
Fine Mapping and Candidate Gene Analysis of the Leaf-Color Gene ygl-1 in Maize
Guan, Haiying; Xu, Xiangbo; He, Chunmei; Liu, Chunxiao; Liu, Qiang; Dong, Rui; Liu, Tieshan; Wang, Liming
2016-01-01
A novel yellow-green leaf mutant yellow-green leaf-1 (ygl-1) was isolated in self-pollinated progenies from the cross of maize inbred lines Ye478 and Yuanwu02. The mutant spontaneously showed yellow-green character throughout the lifespan. Meanwhile, the mutant reduced contents of chlorophyll and Car, arrested chloroplast development and lowered the capacity of photosynthesis compared with the wild-type Lx7226. Genetic analysis revealed that the mutant phenotype was controlled by a recessive nuclear gene. The ygl-1 locus was initially mapped to an interval of about 0.86 Mb in bin 1.01 on the short arm of chromosome 1 using 231 yellow-green leaf individuals of an F2 segregating population from ygl-1/Lx7226. Utilizing four new polymorphic SSR markers, the ygl-1 locus was narrowed down to a region of about 48 kb using 2930 and 2247 individuals of F2 and F3 mapping populations, respectively. Among the three predicted genes annotated within this 48 kb region, GRMZM2G007441, which was predicted to encode a cpSRP43 protein, had a 1-bp nucleotide deletion in the coding region of ygl-1 resulting in a frame shift mutation. Semi-quantitative RT-PCR analysis revealed that YGL-1 was constitutively expressed in all tested tissues and its expression level was not significantly affected in the ygl-1 mutant from early to mature stages, while light intensity regulated its expression both in the ygl-1 mutant and wild type seedlings. Furthermore, the mRNA levels of some genes involved in chloroplast development were affected in the six-week old ygl-1 plants. These findings suggested that YGL-1 plays an important role in chloroplast development of maize. PMID:27100184
A single-base deletion in soybean flavonol synthase gene is associated with magenta flower color.
Takahashi, Ryoji; Githiri, Stephen M; Hatayama, Kouta; Dubouzet, Emilyn G; Shimada, Norimoto; Aoki, Toshio; Ayabe, Shin-ichi; Iwashina, Tsukasa; Toda, Kyoko; Matsumura, Hisakazu
2007-01-01
The Wm locus of soybean [Glycine max (L.) Merr.] controls flower color. Dominant Wm and recessive wm allele of the locus produce purple and magenta flower, respectively. A putative full-length cDNA of flavonol synthase (FLS), gmfls1 was isolated by 5' RACE and end-to-end PCR from a cultivar Harosoy with purple flower (WmWm). Sequence analysis revealed that gmfls1 consisted of 1,208 nucleotides encoding 334 amino acids. It had 59-72% homology with FLS proteins of other plant species. Conserved dioxygenase domains A and B were found in the deduced polypeptide. Sequence comparison between Harosoy and Harosoy-wm (magenta flower mutant of Harosoy; wmwm) revealed that they differed by a single G deletion in the coding region of Harosoy-wm. The deletion changed the subsequent reading frame resulting in a truncated polypeptide consisting of 37 amino acids that lacked the dioxygenase domains A and B. Extracts of E. coli cells expressing gmfls1 of Harosoy catalyzed the formation of quercetin from dihydroquercetin, whereas cell extracts expressing gmfls1 of Harosoy-wm had no FLS activity. Genomic Southern analysis suggested the existence of three to four copies of the FLS gene in the soybean genome. CAPS analysis was performed to detect the single-base deletion. Harosoy and Clark (WmWm) exhibited longer fragments, while Harosoy-wm had shorter fragments due to the single-base deletion. The CAPS marker co-segregated with genotypes at Wm locus in a F(2) population segregating for the locus. Linkage mapping using SSR markers revealed that the Wm and gmfls1 were mapped at similar position in the molecular linkage group F. The above results strongly suggest that gmfls1 represents the Wm gene and that the single-base deletion may be responsible for magenta flower color.
Liang, Hong; Ko, Christopher H.; Herman, Todd; Gaber, Richard F.
1998-01-01
Deletion of TRK1 and TRK2 abolishes high-affinity K+ uptake in Saccharomyces cerevisiae, resulting in the inability to grow on typical synthetic growth medium unless it is supplemented with very high concentrations of potassium. Selection for spontaneous suppressors that restored growth of trk1Δ trk2Δ cells on K+-limiting medium led to the isolation of cells with unusual gain-of-function mutations in the glucose transporter genes HXT1 and HXT3 and the glucose/galactose transporter gene GAL2. 86Rb uptake assays demonstrated that the suppressor mutations conferred increased uptake of the ion. In addition to K+, the mutant hexose transporters also conferred permeation of other cations, including Na+. Because the selection strategy required such gain of function, mutations that disrupted transporter maturation or localization to the plasma membrane were avoided. Thus, the importance of specific sites in glucose transport could be independently assessed by testing for the ability of the mutant transporter to restore glucose-dependent growth to cells containing null alleles of all of the known functional glucose transporter genes. Twelve sites, most of which are conserved among eukaryotic hexose transporters, were revealed to be essential for glucose transport. Four of these have previously been shown to be essential for glucose transport by animal or plant transporters. Eight represented sites not previously known to be crucial for glucose uptake. Each suppressor mutant harbored a single mutation that altered an amino acid(s) within or immediately adjacent to a putative transmembrane domain of the transporter. Seven of 38 independent suppressor mutations consisted of in-frame insertions or deletions. The nature of the insertions and deletions revealed a striking DNA template dependency: each insertion generated a trinucleotide repeat, and each deletion involved the removal of a repeated nucleotide sequence. PMID:9447989
EGFR mutant allelic-specific imbalance assessment in routine samples of non-small cell lung cancer.
Malapelle, Umberto; Vatrano, Simona; Russo, Stefania; Bellevicine, Claudio; de Luca, Caterina; Sgariglia, Roberta; Rocco, Danilo; de Pietro, Livia; Riccardi, Fernando; Gobbini, Elisa; Righi, Luisella; Troncone, Giancarlo
2015-09-01
In non-small cell lung cancer (NSCLC), the epidermal growth factor receptor (EGFR) gene may undergo both mutations and copy number gains. EGFR mutant allele-specific imbalance (MASI) occurs when the ratio of mutant-to-wild-type alleles increases significantly. In this study, by using a previously validated microfluidic-chip-based technology, EGFR-MASI occurred in 25/67 mutant cases (37%), being more frequently associated with EGFR exon 19 deletions (p=0.033). In a subset of 49 treated patients, we assessed whether MASI is a modifier of anti-EGFR treatment benefit. The difference in progression-free survival and overall survival between EGFR-MASI-positive and EGFR-MASI-negative groups of patients did not show a statistical significance. In conclusion, EGFR-MASI is a significant event in NSCLC, specifically associated with EGFR exon 19 deletions. However, EGFR-MASI does not seem to play a role in predicting the response to first-generation EGFR small molecules inhibitors. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Fuchs, W; Ziemann, K; Teifke, J P; Werner, O; Mettenleiter, T C
2000-03-01
The DNA sequence of the infectious laryngotracheitis virus (ILTV) UL50, UL51 and UL52 gene homologues was determined. Although the deduced UL50 protein lacks the first of five conserved domains of the corresponding proteins of mammalian alphaherpesviruses, the ILTV gene product was also shown to possess dUTPase activity. The generation of UL50-negative ILTV mutants was facilitated by recombination plasmids encoding green fluorescent protein (GFP), and expression constructs of predicted transactivator proteins of ILTV (alphaTIF, ICP4) were successfully used to increase the infectivity of viral genomic DNA. A GFP-expressing UL50-deletion mutant of ILTV showed reduced cell-to-cell spread in vitro, and was attenuated in vivo. A similar deletion mutant without the foreign gene, however, propagated like wild-type ILTV in cell culture and was pathogenic in chickens. We conclude that the viral dUTPase is not required for efficient replication of ILTV in the respiratory tract of infected animals. The replication defect of the GFP-expressing ILTV recombinant is most likely caused by toxic effects of the reporter gene product, since spontaneously occurring inactivation mutants exhibited wild-type-like growth.
Bormann, Jörg; Tudzynski, Paul
2009-12-01
The putative Claviceps purpurea homologue of the Saccharomyces cerevisiae stretch-activated calcium ion channel Mid1 was investigated for its role in vegetative growth, differentiation and pathogenicity on rye (Secale cereale). Gene replacement mutants of Cl. purpurea mid1 were not affected in polar growth and branching in axenic culture but showed a significantly reduced growth rate. The growth defect could not be complemented by Ca(2+) supplementation, in contrast to mid1 mutants in yeast, but the altered sensitivity of the mutants to changes in external and internal Ca(2+) concentrations indicates some role of Mid1 in Ca(2+) homeostasis. The major effect of mid1 deletion, however, was the complete loss of virulence: infected rye plants showed no disease symptoms at all. Detailed analyses of in vitro-infected rye ovaries demonstrated that the Deltamid1 mutants had multiple apical branches and were unable to infect the host tissue, suggesting that Mid1 is essential for generating the necessary mechanical force for penetration. This is believed to be the first report of an essential role for a Mid1 homologue in the virulence of a plant-pathogenic fungus.
Briggs, Robert E; Hauglund, Melissa J; Maheswaran, Samuel K; Tatum, Fred M
2013-11-01
A temperature-sensitive shuttle vector, pBB80C, was utilized to generate in-frame deletion mutants of the leukotoxin structural gene (lktA) of Mannheimia haemolytica serotypes 1, 2, 5, 6, 7, 8, 9, and 12. Culture supernatants from the mutants contained a truncated protein with an approximate molecular weight of 66 kDa which was reactive to anti-leukotoxin monoclonal antibody. No protein reactive to anti-LktA monoclonal antibody was detected at the molecular weight 100-105 kDa of native LktA. Sheep and goats vaccinated intramuscularly with a mixture of serotypes 5 and 6 mutants were resistant to virulent challenge with a mixture of the wild-type parent strains. These vaccinates responded serologically to both vaccine serotypes and exhibited markedly-reduced lung lesion volume and pulmonary infectious load compared to control animals. Control animals yielded a mixture of serotypes from lung lobes, but the proportion even within an individual animal varied widely from 95% serotype 5-95% serotype 6. Cultures recovered from liver were homogeneous, but two animals yielded serotype 5 and the other two yielded serotype 6 in pure culture. Published by Elsevier Ltd.
Lochlainn, Seosamh Ó; Amoah, Stephen; Graham, Neil S; Alamer, Khalid; Rios, Juan J; Kurup, Smita; Stoute, Andrew; Hammond, John P; Østergaard, Lars; King, Graham J; White, Phillip J; Broadley, Martin R
2011-12-08
Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service.
2011-01-01
Background Targeted Induced Loci Lesions IN Genomes (TILLING) is increasingly being used to generate and identify mutations in target genes of crop genomes. TILLING populations of several thousand lines have been generated in a number of crop species including Brassica rapa. Genetic analysis of mutants identified by TILLING requires an efficient, high-throughput and cost effective genotyping method to track the mutations through numerous generations. High resolution melt (HRM) analysis has been used in a number of systems to identify single nucleotide polymorphisms (SNPs) and insertion/deletions (IN/DELs) enabling the genotyping of different types of samples. HRM is ideally suited to high-throughput genotyping of multiple TILLING mutants in complex crop genomes. To date it has been used to identify mutants and genotype single mutations. The aim of this study was to determine if HRM can facilitate downstream analysis of multiple mutant lines identified by TILLING in order to characterise allelic series of EMS induced mutations in target genes across a number of generations in complex crop genomes. Results We demonstrate that HRM can be used to genotype allelic series of mutations in two genes, BraA.CAX1a and BraA.MET1.a in Brassica rapa. We analysed 12 mutations in BraA.CAX1.a and five in BraA.MET1.a over two generations including a back-cross to the wild-type. Using a commercially available HRM kit and the Lightscanner™ system we were able to detect mutations in heterozygous and homozygous states for both genes. Conclusions Using HRM genotyping on TILLING derived mutants, it is possible to generate an allelic series of mutations within multiple target genes rapidly. Lines suitable for phenotypic analysis can be isolated approximately 8-9 months (3 generations) from receiving M3 seed of Brassica rapa from the RevGenUK TILLING service. PMID:22152063
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630
Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C; Munro, Cindy L; Kitten, Todd
2005-09-01
Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis.
Paik, Sehmi; Senty, Lauren; Das, Sankar; Noe, Jody C.; Munro, Cindy L.; Kitten, Todd
2005-01-01
Streptococcus sanguinis is a gram-positive, facultative anaerobe and a normal inhabitant of the human oral cavity. It is also one of the most common agents of infective endocarditis, a serious endovascular infection. To identify virulence factors for infective endocarditis, signature-tagged mutagenesis (STM) was applied to the SK36 strain of S. sanguinis, whose genome is being sequenced. STM allows the large-scale creation, in vivo screening, and recovery of a series of mutants with altered virulence. Screening of 800 mutants by STM identified 38 putative avirulent and 5 putative hypervirulent mutants. Subsequent molecular analysis of a subset of these mutants identified genes encoding undecaprenol kinase, homoserine kinase, anaerobic ribonucleotide reductase, adenylosuccinate lyase, and a hypothetical protein. Virulence reductions ranging from 2-to 150-fold were confirmed by competitive index assays. One putatively hypervirulent strain with a transposon insertion in an intergenic region was identified, though increased virulence was not confirmed in competitive index assays. All mutants grew comparably to SK36 in aerobic broth culture except for the homoserine kinase mutant. Growth of this mutant was restored by the addition of threonine to the medium. Mutants containing an insertion or in-frame deletion in the anaerobic ribonucleotide reductase gene failed to grow under strictly anaerobic conditions. The results suggest that housekeeping functions such as cell wall synthesis, amino acid and nucleic acid synthesis, and the ability to survive under anaerobic conditions are important virulence factors in S. sanguinis endocarditis. PMID:16113327