Familial 46,XY sex reversal without campomelic dysplasia caused by a deletion upstream of the SOX9 gene

PubMed Central

Layman, Lawrence C.; Ullmann, Reinhard; Shen, Yiping; Ha, Kyungsoo; Rehman, Khurram; Looney, Stephen; McDonough, Paul G.; Kim, Hyung-Goo; Carr, Bruce R.

2014-01-01

Background 46,XY sex reversal is a rare disorder and familial cases are even more rare. The purpose of the present study was to determine the molecular basis for a family with three affected siblings who had 46,XY sex reversal. Methods DNA was extracted from three females with 46,XY sex reversal, two normal sisters, and both unaffected parents. All protein coding exons of the SRY and NR5A1 genes were subjected to PCR-based DNA sequencing. In addition, array comparative genomic hybridization was performed on DNA from all seven family members. A deletion was confirmed using quantitative polymerase chain reaction. Expression of SOX9 gene was quantified using reverse transcriptase polymerase chain reaction. Results A 349kb heterozygous deletion located 353kb upstream of the SOX9 gene on the long arm of chromosome 17 was discovered in the father and three affected siblings, but not in the mother. The expression of SOX9 was significantly decreased in the affected siblings. Two of three affected sisters had gonadoblastomas. Conclusion This is the first report of 46,XY sex reversal in three siblings who have a paternally inherited deletion upstream of SOX9 associated with reduced SOX9 mRNA expression. PMID:24907458

Conversion of Deletions during Recombination in Pneumococcal Transformation

PubMed Central

Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

1989-01-01

Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

UV-induced reversion of his4 frameshift mutations in rad6, rev1, and rev3 mutants of yeast.

PubMed

Lawrence, C W; O'Brien, T; Bond, J

1984-01-01

The UV-induced reversion of two his4 frameshift alleles was much reduced in rad6 mutants of Saccharomyces cerevisiae, an observation that is consistent with the hypothesis that RAD6 function is required for the induction of all types of genetic alteration in misrepair mutagenesis. The reversion of these his4 alleles, together with two others of the same type, was also reduced in rev1 and rev3 mutant strains; in these, however, the extent of the reduction varied considerably with test allele used, in a manner analogous to the results in these strains for base repair substitution test alleles. The general features of UV-induced frameshift and substitution mutagenesis therefore appear quite similar, indicating that they may depend on related processes. If this conclusion is correct, greater attention must be given to integrating models which account for the production of nucleotide additions and deletions into those concerning misrepair mutagenesis.

An internal deletion in MTH1 enables growth on glucose of pyruvate-decarboxylase negative, non-fermentative Saccharomyces cerevisiae

PubMed Central

2012-01-01

Background Pyruvate-decarboxylase negative (Pdc-) strains of Saccharomyces cerevisiae combine the robustness and high glycolytic capacity of this yeast with the absence of alcoholic fermentation. This makes Pdc-S. cerevisiae an interesting platform for efficient conversion of glucose towards pyruvate-derived products without formation of ethanol as a by-product. However, Pdc- strains cannot grow on high glucose concentrations and require C2-compounds (ethanol or acetate) for growth under conditions with low glucose concentrations, which hitherto has limited application in industry. Results Genetic analysis of a Pdc- strain previously evolved to overcome these deficiencies revealed a 225bp in-frame internal deletion in MTH1, encoding a transcriptional regulator involved in glucose sensing. This internal deletion contains a phosphorylation site required for degradation, thereby hypothetically resulting in increased stability of the protein. Reverse engineering of this alternative MTH1 allele into a non-evolved Pdc- strain enabled growth on 20 g l-1 glucose and 0.3% (v/v) ethanol at a maximum specific growth rate (0.24 h-1) similar to that of the evolved Pdc- strain (0.23 h-1). Furthermore, the reverse engineered Pdc- strain grew on glucose as sole carbon source, albeit at a lower specific growth rate (0.10 h-1) than the evolved strain (0.20 h-1). The observation that overexpression of the wild-type MTH1 allele also restored growth of Pdc-S. cerevisiae on glucose is consistent with the hypothesis that the internal deletion results in decreased degradation of Mth1. Reduced degradation of Mth1 has been shown to result in deregulation of hexose transport. In Pdc- strains, reduced glucose uptake may prevent intracellular accumulation of pyruvate and/or redox problems, while release of glucose repression due to the MTH1 internal deletion may contribute to alleviation of the C2-compound auxotrophy. Conclusions In this study we have discovered and characterised a mutation in MTH1 enabling Pdc- strains to grow on glucose as the sole carbon source. This successful example of reverse engineering not only increases the understanding of the glucose tolerance of evolved Pdc-S. cerevisiae, but also allows introduction of this portable genetic element into various industrial yeast strains, thereby simplifying metabolic engineering strategies. PMID:22978798

A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

PubMed

Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

2015-01-01

Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

Genetic diversity of Plasmodium falciparum histidine-rich protein 2 in the China-Myanmar border area

PubMed Central

Li, Peipei; Xing, Hua; Zhao, Zhenjun; Yang, Zhaoqing; Cao, Yaming; Yan, Guiyun; Sattabongkot, Jetsumon; Cui, Liwang; Fan, Qi

2016-01-01

Deletion of the Plasmodium falciparum histidine-rich protein 2 (pfhrp2) gene may affect the performance of PfHRP2-based rapid diagnostic tests (RDTs). Here we investigated the genetic diversity of the pfhrp2 gene in clinical parasite isolates collected in recent years from the China-Myanmar border area. Deletion of pfhrp2 has been identified in 4 out of 97 parasite isolates. Sequencing of the pfhrp2 exon 2 from 67 isolates revealed a high level of genetic diversity in pfhrp2, which is reflected in the presence of many repeat types and their variants, as well as variable copy numbers and different arrangements of these repeats in parasite isolates. In addition, we observed pfhrp3 deletion in three of the four parasites harboring pfhrp2 deletion, suggesting of double deletions of both genes in these three isolates. Analysis of two cases, which were P. falciparum-positive by microscopy and PCR but failed by two PfHRP2-based RDTs, did not find pfhrp2 deletion. Further correlational studies of pfhrp2 polymorphisms with detection sensitivity are needed to identify factors influencing the performance of RDTs in malaria-endemic areas. PMID:26297799

Conditional Deletion of Prnp Rescues Behavioral and Synaptic Deficits after Disease Onset in Transgenic Alzheimer's Disease

PubMed Central

Kaufman, Adam C.; Herber, Charlotte S.; Haas, Laura T.; Robinson, Sophie; Lee, Michael K.

2017-01-01

Biochemical and genetic evidence implicate soluble oligomeric amyloid-β (Aβo) in triggering Alzheimer's disease (AD) pathophysiology. Moreover, constitutive deletion of the Aβo-binding cellular prion protein (PrPC) prevents development of memory deficits in APPswe/PS1ΔE9 mice, a model of familial AD. Here, we define the role of PrPC to rescue or halt established AD endophenotypes in a therapeutic disease-modifying time window after symptom onset. Deletion of Prnp at either 12 or 16 months of age fully reverses hippocampal synapse loss and completely rescues preexisting behavioral deficits by 17 months. In contrast, but consistent with a neuronal function for Aβo/PrPC signaling, plaque density, microgliosis, and astrocytosis are not altered. Degeneration of catecholaminergic neurons remains unchanged by PrPC reduction after disease onset. These results define the potential of targeting PrPC as a disease-modifying therapy for certain AD-related phenotypes after disease onset. SIGNIFICANCE STATEMENT The study presented here further elucidates our understanding of the soluble oligomeric amyloid-β–Aβo-binding cellular prion protein (PrPC) signaling pathway in a familial form of Alzheimer's disease (AD) by implicating PrPC as a potential therapeutic target for AD. In particular, genetic deletion of Prnp rescued several familial AD (FAD)-associated phenotypes after disease onset in a mouse model of FAD. This study underscores the therapeutic potential of PrPC deletion given that patients already present symptoms at the time of diagnosis. PMID:28842420

Carcinogens induce reversion of the mouse pink-eyed unstable mutation

PubMed Central

Schiestl, Robert H.; Aubrecht, Jiri; Khogali, Fathia; Carls, Nicholas

1997-01-01

Deletions and other genome rearrangements are associated with carcinogenesis and inheritable diseases. The pink-eyed unstable (pun) mutation in the mouse is caused by duplication of a 70-kb internal fragment of the p gene. Spontaneous reversion events in homozygous pun/pun mice occur through deletion of a duplicated sequence. Reversion events in premelanocytes in the mouse embryo detected as black spots on the gray fur of the offspring were inducible by the carcinogen x-rays, ethyl methanesulfonate, methyl methanesulfonate, ethyl nitrosourea, benzo[a]pyrene, trichloroethylene, benzene, and sodium arsenate. The latter three carcinogens are not detectable with several in vitro or in vivo mutagenesis assays. We studied the molecular mechanism of the carcinogen-induced reversion events by cDNA analysis using reverse transcriptase–PCR method and identified the induced reversion events as deletions. DNA deletion assays may be sensitive indicators for carcinogen exposure. PMID:9114032

The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

PubMed

Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

2017-03-01

Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Psi- vectors: murine leukemia virus-based self-inactivating and self-activating retroviral vectors.

PubMed Central

Delviks, K A; Hu, W S; Pathak, V K

1997-01-01

We have developed murine leukemia virus (MLV)-based self-inactivating and self-activating vectors to show that the previously demonstrated high-frequency direct repeat deletions are not unique to spleen necrosis virus (SNV) or the neomycin drug resistance gene. Retroviral vectors pKD-HTTK and pKD-HTpTK containing direct repeats composed of segments of the herpes simplex virus type 1 thymidine kinase (HTK) gene were constructed; in pKD-HTpTK, the direct repeat flanked the MLV packaging signal. The generation of hypoxanthine-aminopterin-thymidine-resistant colonies after one cycle of retroviral replication demonstrated functional reconstitution of the HTK gene. Quantitative Southern analysis indicated that direct repeat deletions occurred in 57 and 91% of the KD-HTTK and KD-HTpTK proviruses, respectively. These results demonstrate that (i) deletion of direct repeats occurs at similar high frequencies in SNV and MLV vectors, (ii) MLV psi can be efficiently deleted by using direct repeats, (iii) suicide genes can be functionally reconstituted during reverse transcription, and (iv) the psi region may be a hot spot for reverse transcriptase template switching events. PMID:9223521

Antibiotic Combinations That Enable One-Step, Targeted Mutagenesis of Chromosomal Genes.

PubMed

Lee, Wonsik; Do, Truc; Zhang, Ge; Kahne, Daniel; Meredith, Timothy C; Walker, Suzanne

2018-06-08

Targeted modification of bacterial chromosomes is necessary to understand new drug targets, investigate virulence factors, elucidate cell physiology, and validate results of -omics-based approaches. For some bacteria, reverse genetics remains a major bottleneck to progress in research. Here, we describe a compound-centric strategy that combines new negative selection markers with known positive selection markers to achieve simple, efficient one-step genome engineering of bacterial chromosomes. The method was inspired by the observation that certain nonessential metabolic pathways contain essential late steps, suggesting that antibiotics targeting a late step can be used to select for the absence of genes that control flux into the pathway. Guided by this hypothesis, we have identified antibiotic/counterselectable markers to accelerate reverse engineering of two increasingly antibiotic-resistant pathogens, Staphylococcus aureus and Acinetobacter baumannii. For S. aureus, we used wall teichoic acid biosynthesis inhibitors to select for the absence of tarO and for A. baumannii, we used colistin to select for the absence of lpxC. We have obtained desired gene deletions, gene fusions, and promoter swaps in a single plating step with perfect efficiency. Our method can also be adapted to generate markerless deletions of genes using FLP recombinase. The tools described here will accelerate research on two important pathogens, and the concept we outline can be readily adapted to any organism for which a suitable target pathway can be identified.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Epstein, N.; Than, K.A. Culp, K.M.

Alpha-thalassemia (alpha-thal) is characterized by the absence or reduction in synthesis of the alpha-globin chain due to either deletions or other abnormalities involving the alpha-globin genes located on the short arm of chromosome 16. The diploid cells have four alpha chain genes. The deletion of one, two, three or all four of these genes could result in mild to a complete alpha chain deficiency known as the Hydrops fetalis syndrome or alpha-thal-1, which causes fetal death. It is important to develop a sensitive test to detect carriers of alpha-thal-1 trait for genetic counseling. It has recently been observed that themore » presence of minute amounts of zeta-globin chains (0.01-1%) could serve as a biological marker of alpha-thal carriers. Because high sensitivity is required, we constructed a monoclonal antibody-based immunoassay which can be analyzed either by colorimetric or fluorimetric methods. By testing blood samples from individuals of Southeast Asian ancestry, we were able to show that various forms and combinations of deletions or inactivations of two or three alpha-globin genes results in alpha-thalassemia conditions that have elevated levels of the zeta-chain. Sensitivity achieved in these tests was < 0.1% zeta chain, or as low as 5 ng zeta-chain. Data correlate with results from reversed phase HPLC.« less

Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene.

PubMed

Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji

2006-03-01

Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.

Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

PubMed

Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

2015-01-20

In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides.

PubMed

Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

2017-05-31

Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides

PubMed Central

Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall’Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

2017-01-01

Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome. PMID:28561789

Forward genetics in Candida albicans that reveals the Arp2/3 complex is required for hyphal formation, but not endocytosis

PubMed Central

Epp, Elias; Walther, Andrea; Guylaine, Lépine; Leon, Zully; Mullick, Alaka; Raymond, Martine; Wendland, Jürgen; Whiteway, Malcolm

2014-01-01

Summary Candida albicans is a diploid fungal pathogen lacking a defined complete sexual cycle, and thus has been refractory to standard forward genetic analysis. Instead, transcription profiling and reverse genetic strategies based on Saccharomyces cerevisiae have typically been used to link genes to functions. To overcome restrictions inherent in such indirect approaches, we have investigated a forward genetic mutagenesis strategy based on the UAU1 technology. We screened 4700 random insertion mutants for defects in hyphal development and linked two new genes (ARP2 and VPS52) to hyphal growth. Deleting ARP2 abolished hyphal formation, generated round and swollen yeast phase cells, disrupted cortical actin patches and blocked virulence in mice. The mutants also showed a global lack of induction of hyphae-specific genes upon the yeast-to-hyphae switch. Surprisingly, both arp2Δ/Δ and arp2Δ/Δarp3Δ/Δ mutants were still able to endocytose FM4-64 and Lucifer Yellow, although as shown by time-lapse movies internalization of FM4-64 was somewhat delayed in mutant cells. Thus the non-essential role of the Arp2/3 complex discovered by forward genetic screening in C. albicans showed that uptake of membrane components from the plasma membrane to vacuolar structures is not dependent on this actin nucleating machinery. PMID:20141603

Sequence quality analysis tool for HIV type 1 protease and reverse transcriptase.

PubMed

Delong, Allison K; Wu, Mingham; Bennett, Diane; Parkin, Neil; Wu, Zhijin; Hogan, Joseph W; Kantor, Rami

2012-08-01

Access to antiretroviral therapy is increasing globally and drug resistance evolution is anticipated. Currently, protease (PR) and reverse transcriptase (RT) sequence generation is increasing, including the use of in-house sequencing assays, and quality assessment prior to sequence analysis is essential. We created a computational HIV PR/RT Sequence Quality Analysis Tool (SQUAT) that runs in the R statistical environment. Sequence quality thresholds are calculated from a large dataset (46,802 PR and 44,432 RT sequences) from the published literature ( http://hivdb.Stanford.edu ). Nucleic acid sequences are read into SQUAT, identified, aligned, and translated. Nucleic acid sequences are flagged if with >five 1-2-base insertions; >one 3-base insertion; >one deletion; >six PR or >18 RT ambiguous bases; >three consecutive PR or >four RT nucleic acid mutations; >zero stop codons; >three PR or >six RT ambiguous amino acids; >three consecutive PR or >four RT amino acid mutations; >zero unique amino acids; or <0.5% or >15% genetic distance from another submitted sequence. Thresholds are user modifiable. SQUAT output includes a summary report with detailed comments for troubleshooting of flagged sequences, histograms of pairwise genetic distances, neighbor joining phylogenetic trees, and aligned nucleic and amino acid sequences. SQUAT is a stand-alone, free, web-independent tool to ensure use of high-quality HIV PR/RT sequences in interpretation and reporting of drug resistance, while increasing awareness and expertise and facilitating troubleshooting of potentially problematic sequences.

Increasing Muscle Mass Improves Vascular Function in Obese (db/db) Mice

PubMed Central

Qiu, Shuiqing; Mintz, James D.; Salet, Christina D.; Han, Weihong; Giannis, Athanassios; Chen, Feng; Yu, Yanfang; Su, Yunchao; Fulton, David J.; Stepp, David W.

2014-01-01

Background A sedentary lifestyle is an independent risk factor for cardiovascular disease and exercise has been shown to ameliorate this risk. Inactivity is associated with a loss of muscle mass, which is also reversed with isometric exercise training. The relationship between muscle mass and vascular function is poorly defined. The aims of the current study were to determine whether increasing muscle mass by genetic deletion of myostatin, a negative regulator of muscle growth, can influence vascular function in mesenteric arteries from obese db/db mice. Methods and Results Myostatin expression was elevated in skeletal muscle of obese mice and associated with reduced muscle mass (30% to 50%). Myostatin deletion increased muscle mass in lean (40% to 60%) and obese (80% to 115%) mice through increased muscle fiber size (P<0.05). Myostatin deletion decreased adipose tissue in lean mice, but not obese mice. Markers of insulin resistance and glucose tolerance were improved in obese myostatin knockout mice. Obese mice demonstrated an impaired endothelial vasodilation, compared to lean mice. This impairment was improved by superoxide dismutase mimic Tempol. Deletion of myostatin improved endothelial vasodilation in mesenteric arteries in obese, but not in lean, mice. This improvement was blunted by nitric oxide (NO) synthase inhibitor l‐NG‐nitroarginine methyl ester (l‐NAME). Prostacyclin (PGI2)‐ and endothelium‐derived hyperpolarizing factor (EDHF)‐mediated vasodilation were preserved in obese mice and unaffected by myostatin deletion. Reactive oxygen species) was elevated in the mesenteric endothelium of obese mice and down‐regulated by deletion of myostatin in obese mice. Impaired vasodilation in obese mice was improved by NADPH oxidase inhibitor (GKT136901). Treatment with sepiapterin, which increases levels of tetrahydrobiopterin, improved vasodilation in obese mice, an improvement blocked by l‐NAME. Conclusions Increasing muscle mass by genetic deletion of myostatin improves NO‐, but not PGI2‐ or EDHF‐mediated vasodilation in obese mice; this vasodilation improvement is mediated by down‐regulation of superoxide. PMID:24965025

Multiple genetic origins of histidine-rich protein 2 gene deletion in Plasmodium falciparum parasites from Peru

PubMed Central

Akinyi, Sheila; Hayden, Tonya; Gamboa, Dionicia; Torres, Katherine; Bendezu, Jorge; Abdallah, Joseph F.; Griffing, Sean M.; Quezada, Wilmer Marquiño; Arrospide, Nancy; De Oliveira, Alexandre Macedo; Lucas, Carmen; Magill, Alan J.; Bacon, David J.; Barnwell, John W.; Udhayakumar, Venkatachalam

2013-01-01

The majority of malaria rapid diagnostic tests (RDTs) detect Plasmodium falciparum histidine-rich protein 2 (PfHRP2), encoded by the pfhrp2 gene. Recently, P. falciparum isolates from Peru were found to lack pfhrp2 leading to false-negative RDT results. We hypothesized that pfhrp2-deleted parasites in Peru derived from a single genetic event. We evaluated the parasite population structure and pfhrp2 haplotype of samples collected between 1998 and 2005 using seven neutral and seven chromosome 8 microsatellite markers, respectively. Five distinct pfhrp2 haplotypes, corresponding to five neutral microsatellite-based clonal lineages, were detected in 1998-2001; pfhrp2 deletions occurred within four haplotypes. In 2003-2005, outcrossing among the parasite lineages resulted in eight population clusters that inherited the five pfhrp2 haplotypes seen previously and a new haplotype; pfhrp2 deletions occurred within four of these haplotypes. These findings indicate that the genetic origin of pfhrp2 deletion in Peru was not a single event, but likely occurred multiple times. PMID:24077522

Rare Copy Number Deletions Predict Individual Variation in Intelligence

PubMed Central

Yeo, Ronald A.; Gangestad, Steven W.; Liu, Jingyu; Calhoun, Vince D.; Hutchison, Kent E.

2011-01-01

Phenotypic variation in human intellectual functioning shows substantial heritability, as demonstrated by a long history of behavior genetic studies. Many recent molecular genetic studies have attempted to uncover specific genetic variations responsible for this heritability, but identified effects capture little variance and have proven difficult to replicate. The present study, motivated an interest in “mutation load” emerging from evolutionary perspectives, examined the importance of the number of rare (or infrequent) copy number variations (CNVs), and the total number of base pairs included in such deletions, for psychometric intelligence. Genetic data was collected using the Illumina 1MDuoBeadChip Array from a sample of 202 adult individuals with alcohol dependence, and a subset of these (N = 77) had been administered the Wechsler Abbreviated Scale of Intelligence (WASI). After removing CNV outliers, the impact of rare genetic deletions on psychometric intelligence was investigated in 74 individuals. The total length of the rare deletions significantly and negatively predicted intelligence (r = −.30, p = .01). As prior studies have indicated greater heritability in individuals with relatively higher parental socioeconomic status (SES), we also examined the impact of ethnicity (Anglo/White vs. Other), as a proxy measure of SES; these groups did not differ on any genetic variable. This categorical variable significantly moderated the effect of length of deletions on intelligence, with larger effects being noted in the Anglo/White group. Overall, these results suggest that rare deletions (between 5% and 1% population frequency or less) adversely affect intellectual functioning, and that pleotropic effects might partly account for the association of intelligence with health and mental health status. Significant limitations of this research, including issues of generalizability and CNV measurement, are discussed. PMID:21298096

Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast.

PubMed

Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A

2016-06-01

Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3' end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. Copyright © 2016 Larson et al.

Interconnections Between RNA-Processing Pathways Revealed by a Sequencing-Based Genetic Screen for Pre-mRNA Splicing Mutants in Fission Yeast

PubMed Central

Larson, Amy; Fair, Benjamin Jung; Pleiss, Jeffrey A.

2016-01-01

Pre-mRNA splicing is an essential component of eukaryotic gene expression and is highly conserved from unicellular yeasts to humans. Here, we present the development and implementation of a sequencing-based reverse genetic screen designed to identify nonessential genes that impact pre-mRNA splicing in the fission yeast Schizosaccharomyces pombe, an organism that shares many of the complex features of splicing in higher eukaryotes. Using a custom-designed barcoding scheme, we simultaneously queried ∼3000 mutant strains for their impact on the splicing efficiency of two endogenous pre-mRNAs. A total of 61 nonessential genes were identified whose deletions resulted in defects in pre-mRNA splicing; enriched among these were factors encoding known or predicted components of the spliceosome. Included among the candidates identified here are genes with well-characterized roles in other RNA-processing pathways, including heterochromatic silencing and 3ʹ end processing. Splicing-sensitive microarrays confirm broad splicing defects for many of these factors, revealing novel functional connections between these pathways. PMID:27172183

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2013 CFR

2013-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2012 CFR

2012-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2011 CFR

2011-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

40 CFR 158.2110 - Microbial pesticides data requirements.

Code of Federal Regulations, 2014 CFR

2014-07-01

...: genetic engineering techniques used; the identity of the inserted or deleted gene segment (base sequence... evaluate genetic stability and exchange; and selected Tier II environmental expression and toxicology tests. ...

Genetic Diversity of the Q Fever Agent, Coxiella burnetii, Assessed by Microarray-Based Whole-Genome Comparisons†

PubMed Central

Beare, Paul A.; Samuel, James E.; Howe, Dale; Virtaneva, Kimmo; Porcella, Stephen F.; Heinzen, Robert A.

2006-01-01

Coxiella burnetii, a gram-negative obligate intracellular bacterium, causes human Q fever and is considered a potential agent of bioterrorism. Distinct genomic groups of C. burnetii are revealed by restriction fragment-length polymorphisms (RFLP). Here we comprehensively define the genetic diversity of C. burnetii by hybridizing the genomes of 20 RFLP-grouped and four ungrouped isolates from disparate sources to a high-density custom Affymetrix GeneChip containing all open reading frames (ORFs) of the Nine Mile phase I (NMI) reference isolate. We confirmed the relatedness of RFLP-grouped isolates and showed that two ungrouped isolates represent distinct genomic groups. Isolates contained up to 20 genomic polymorphisms consisting of 1 to 18 ORFs each. These were mostly complete ORF deletions, although partial deletions, point mutations, and insertions were also identified. A total of 139 chromosomal and plasmid ORFs were polymorphic among all C. burnetii isolates, representing ca. 7% of the NMI coding capacity. Approximately 67% of all deleted ORFs were hypothetical, while 9% were annotated in NMI as nonfunctional (e.g., frameshifted). The remaining deleted ORFs were associated with diverse cellular functions. The only deletions associated with isogenic NMI variants of attenuated virulence were previously described large deletions containing genes involved in lipopolysaccharide (LPS) biosynthesis, suggesting that these polymorphisms alone are responsible for the lower virulence of these variants. Interestingly, a variant of the Australia QD isolate producing truncated LPS had no detectable deletions, indicating LPS truncation can occur via small genetic changes. Our results provide new insight into the genetic diversity and virulence potential of Coxiella species. PMID:16547017

Landscape of Insertion Polymorphisms in the Human Genome

PubMed Central

Onozawa, Masahiro; Goldberg, Liat; Aplan, Peter D.

2015-01-01

Nucleotide substitutions, small (<50 bp) insertions or deletions (indels), and large (>50 bp) deletions are well-known causes of genetic variation within the human genome. We recently reported a previously unrecognized form of polymorphic insertions, termed templated sequence insertion polymorphism (TSIP), in which the inserted sequence was templated from a distant genomic region, and was inserted in the genome through reverse transcription of an RNA intermediate. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; class 1 TSIPs show target site duplication, polyadenylation, and preference for insertion at a 5′-TTTT/A-3′ sequence, suggesting a LINE-1 based insertion mechanism, whereas class 2 TSIPs show features consistent with repair of a DNA double strand break by nonhomologous end joining. To gain a more complete picture of TSIPs throughout the human population, we evaluated whole-genome sequence from 52 individuals, and identified 171 TSIPs. Most individuals had 25–30 TSIPs, and common (present in >20% of individuals) TSIPs were found in individuals throughout the world, whereas rare TSIPs tended to cluster in specific geographic regions. The number of rare TSIPs was greater than the number of common TSIPs, suggesting that TSIP generation is an ongoing process. Intriguingly, mitochondrial sequences were a frequent template for class 2 insertions, used more commonly than any nuclear chromosome. Similar to single nucleotide polymorphisms and indels, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases, and can be useful in tracking historical migration of populations. PMID:25745018

Genomic alterations in Warthin tumors of the parotid gland.

PubMed

Wemmert, Silke; Willnecker, Vivienne; Sauter, Birgit; Schuh, Sebastian; Brunner, Christian; Bohle, Rainer Maria; Urbschat, Steffi; Schick, Bernhard

2014-04-01

Despite the fact that Warthin tumors are the second most common type of benign salivary gland tumors, information regarding genetic alterations is extremely limited, and the tumorigenesis of these tumors has not been elucidated. The present results of the largest series of 30 tumors analyzed by comparative genomic hybridization (CGH) to date confirmed previous genetic findings and identified significant new candidate regions. The most commonly observed alterations were deletions of the short arm of chromosome 8, followed by deletions on 9p. Further representative changes were deletions on 16p and 22q with the minimal overlapping region at 16p12p13.1 and 22q12.1q12.3. Moreover, we indicated two different patterns of chromosomal aberrations. One group harbors deletions on 8p partly apparent with deletions on 9q, 11q 15q, 16p and 22. The second group shows gains on 22, partly apparent with gains on 1p and 20q and deletions on 9p. This leads to the assumption that Warthin tumors, in particular those with a high number of alterations, can be divided into two different genetic groups based on the pattern of numerical chromosomal aberrations. Further studies should address whether these subgroups also reflect a different clinical presentation.

Pfhrp2-Deleted Plasmodium falciparum Parasites in the Democratic Republic of the Congo: A National Cross-sectional Survey.

PubMed

Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R

2017-07-01

Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Reverse Genetics for Mammalian Orthoreovirus.

PubMed

Stuart, Johnasha D; Phillips, Matthew B; Boehme, Karl W

2017-01-01

Reverse genetics allows introduction of specific alterations into a viral genome. Studies performed with mutant viruses generated using reverse genetics approaches have contributed immeasurably to our understanding of viral replication and pathogenesis, and also have led to development of novel vaccines and virus-based vectors. Here, we describe the reverse genetics system that allows for production and recovery of mammalian orthoreovirus, a double-stranded (ds) RNA virus, from plasmids that encode the viral genome.

The relationship between compulsive behaviour and academic achievement across the three genetic subtypes of Prader-Willi syndrome.

PubMed

Zarcone, J; Napolitano, D; Peterson, C; Breidbord, J; Ferraioli, S; Caruso-Anderson, M; Holsen, L; Butler, M G; Thompson, T

2007-06-01

Prader-Willi syndrome (PWS) is a genetic syndrome associated with several physical, cognitive and behavioural characteristics. For many individuals with this syndrome, compulsive behaviour is often noted in both food and non-food situations. The focus of this paper is on the non-food-related compulsions in individuals with PWS and comparing differences across the three genetic subtypes of the syndrome. Compulsive behaviours in 73 people with PWS were assessed using the Yale-Brown Obsessive Compulsive Scale and the Compulsive Behavior Checklist. Compulsive behaviour and its relation to IQ and academic achievement also were evaluated. Phenotypic differences were characterized for the three most common genetic subtypes of the disorder: 16 individuals with the long Type I (TI) 15q deletion, 26 individuals with the short Type II (TII) 15q deletion and 31 individuals with maternal disomy 15. There appeared to be important differences between the two deletion subtypes. Specifically, individuals with the TI deletion had more compulsions regarding personal cleanliness (i.e. excessive bathing/grooming), and their compulsions were more difficult to interrupt and interfered with social activities more than the other subtypes. Individuals with the TII deletion were more likely to have compulsions related to specific academic areas (i.e. rereading, erasing answers and counting objects or numbers). These findings may help clinicians and researchers identify possible intervention strategies and supports based on the behavioural phenotype associated with genetic subtype in individuals with PWS.

Unique and atypical deletions in Prader–Willi syndrome reveal distinct phenotypes

PubMed Central

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-01-01

Prader–Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1–BP3 and BP2–BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions. PMID:22045295

Unique and atypical deletions in Prader-Willi syndrome reveal distinct phenotypes.

PubMed

Kim, Soo-Jeong; Miller, Jennifer L; Kuipers, Paul J; German, Jennifer Ruth; Beaudet, Arthur L; Sahoo, Trilochan; Driscoll, Daniel J

2012-03-01

Prader-Willi syndrome (PWS) is a multisystem, contiguous gene disorder caused by an absence of paternally expressed genes within the 15q11.2-q13 region via one of the three main genetic mechanisms: deletion of the paternally inherited 15q11.2-q13 region, maternal uniparental disomy and imprinting defect. The deletion class is typically subdivided into Type 1 and Type 2 based on their proximal breakpoints (BP1-BP3 and BP2-BP3, respectively). Despite PWS being a well-characterized genetic disorder the role of the specific genes contributing to various aspects of the phenotype are not well understood. Methylation-specific multiplex ligation-dependent probe amplification (MS-MLPA) is a recently developed technique that detects copy number changes and aberrant DNA methylation. In this study, we initially applied MS-MLPA to elucidate the deletion subtypes of 88 subjects. In our cohort, 32 had a Type 1 and 49 had a Type 2 deletion. The remaining seven subjects had unique or atypical deletions that were either smaller (n=5) or larger (n=2) than typically described and were further characterized by array-based comparative genome hybridization. In two subjects both the PWS region (15q11.2) and the newly described 15q13.3 microdeletion syndrome region were deleted. The subjects with a unique or an atypical deletion revealed distinct phenotypic features. In conclusion, unique or atypical deletions were found in ∼8% of the deletion subjects with PWS in our cohort. These novel deletions provide further insight into the potential role of several of the genes within the 15q11.2 and the 15q13.3 regions.

Prenatal diagnosis of a de novo 9p terminal chromosomal deletion in a fetus with major congenital anomalies.

PubMed

Hou, Wen-Chien; Chen, Chih-Ping; Hwang, Kwei-Shuai; Chen, Ying-Chieh; Lai, Yu-Ju; Tien, Chau-Yang; Su, Her-Young

2014-12-01

We describe a prenatal ultrasonography diagnosis of omphalocele and symbrachydactyly in a fetus and review the literature on prenatal diagnosis of 9p terminal chromosomal deletions. A 31-year-old woman (gravida 3, para 1) was referred for genetic counseling because a fetal omphalocele had been detected. Prenatal ultrasonography at 17+ weeks of gestational age revealed a singleton female fetus with biometry equivalent to 18 weeks with an omphalocele. In addition, symbrachydactyly was also noted in the right arm; the wrist bones as well as the metacarpals were missing. A chromosomal study was arranged for a congenital anomaly involving omphalocele. We obtained Giemsa-banded chromosomes from fetal tissue cells, and an abnormal male karyotype with a terminal deletion of the short arm of chromosome 9 at band 9p13 was noted. After delivery, the fetus showed omphalocele, symbrachydactyly, trigonocephaly, sex reversal, a long philtrum, low-set ears, telecanthus, and a frontal prominence. Prenatal diagnosis of abnormal ultrasound findings with omphalocele and symbrachydactyly should include the differential diagnosis of a chromosome 9p deletion. Copyright © 2014. Published by Elsevier B.V.

CRISPR: a Versatile Tool for Both Forward and Reverse Genetics Research

PubMed Central

Gurumurthy, Channabasavaiah B.; Grati, M'hamed; Ohtsuka, Masato; Schilit, Samantha L.P.; Quadros, Rolen M.; Liu, Xue Zhong

2016-01-01

Human genetics research employs the two opposing approaches of forward and reverse genetics. While forward genetics identifies and links a mutation to an observed disease etiology, reverse genetics induces mutations in model organisms to study their role in disease. In most cases, causality for mutations identified by forward genetics is confirmed by reverse genetics through the development of genetically engineered animal models and an assessment of whether the model can recapitulate the disease. While many technological advances have helped improve these approaches, some gaps still remain. CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated) system, which has emerged as a revolutionary genetic engineering tool, holds great promise for closing such gaps. By combining the benefits of forward and reverse genetics, it has dramatically expedited human genetics research. We provide a perspective on the power of CRISPR-based forward and reverse genetics tools in human genetics and discuss its applications using some disease examples. PMID:27384229

A CRISPR Cas9-based gene drive platform for genetic interaction analysis in Candida albicans

PubMed Central

Shapiro, Rebecca S.; Chavez, Alejandro; Porter, Caroline B. M.; Hamblin, Meagan; Kaas, Christian S.; DiCarlo, James E.; Zeng, Guisheng; Xu, Xiaoli; Revtovich, Alexey V.; Kirienko, Natalia V.; Wang, Yue; Church, George M.; Collins, James J.

2018-01-01

Candida albicans is the leading cause of fungal infections; yet, complex genetic interaction analysis remains cumbersome in this diploid pathogen. Here, we developed a CRISPR-Cas9-based ‘gene drive array’ (GDA) platform to facilitate efficient genetic analysis in C. albicans. In our system, a modified DNA donor molecule acts as a selfish genetic element, replaces the targeted site, and propagates to replace additional wild-type loci. Using mating-competent C. albicans haploids, each carrying a different gene drive disabling a gene of interest, we are able to create diploid strains that are homozygous double-deletion mutants. We generate double-gene deletion libraries to demonstrate this technology, targeting antifungal efflux and biofilm adhesion factors. We screen these libraries to identify virulence regulators and determine how genetic networks shift under diverse conditions. This platform transforms our ability to perform genetic interaction analysis in C. albicans and is readily extended to other fungal pathogens. PMID:29062088

Metabolic Dysfunction Consistent with Premature Aging Results from Deletion of Pim Kinases

PubMed Central

Din, Shabana; Konstandin, Mathias H; Johnson, Bevan; Emathinger, Jacqueline; Völkers, Mirko; Toko, Haruhiro; Collins, Brett; Ormachea, Lucy; Samse, Kaitlen; Kubli, Dieter A; De La Torre, Andrea; Kraft, Andrew S; Gustafsson, Asa B; Kelly, Daniel P; Sussman, Mark A

2014-01-01

Rationale The senescent cardiac phenotype is accompanied by changes in mitochondrial function and biogenesis causing impairment in energy provision. The relationship between myocardial senescence and Pim kinases deserves attention since Pim-1 kinase is cardioprotective, in part, by preservation of mitochondrial integrity. Study of the pathological effects resulting from genetic deletion of all Pim kinase family members could provide important insight regarding cardiac mitochondrial biology and the aging phenotype. Objective Demonstrate myocardial senescence is promoted by loss of Pim leading to premature aging and aberrant mitochondrial function. Methods and Results Cardiac myocyte senescence was evident at three months of age in Pim Triple KnockOut (PTKO) mice, where all three isoforms of Pim kinase family members are genetically deleted. Cellular hypertrophic remodeling and fetal gene program activation was followed by heart failure at six months in PTKO mice. Metabolic dysfunction is an underlying cause of cardiac senescence and instigates a decline in cardiac function. Altered mitochondrial morphology is evident consequential to Pim deletion together with decreased ATP levels and increased phosphorylated AMPK, exposing an energy deficiency in PTKO mice. Expression of the genes encoding master regulators of mitochondrial biogenesis, PPARγ coactivator-1 (PGC-1) α and β were diminished in PTKO hearts, as were downstream targets included in mitochondrial energy transduction, including fatty acid oxidation. Reversal of the dysregulated metabolic phenotype was observed by overexpressing c-Myc, a downstream target of Pim kinases. Conclusion Pim kinases prevent premature cardiac aging and maintain a healthy pool of functional mitochondria leading to efficient cellular energetics. PMID:24916111

Matrix metalloproteinase-9 deletion rescues auditory evoked potential habituation deficit in a mouse model of Fragile X Syndrome.

PubMed

Lovelace, Jonathan W; Wen, Teresa H; Reinhard, Sarah; Hsu, Mike S; Sidhu, Harpreet; Ethell, Iryna M; Binder, Devin K; Razak, Khaleel A

2016-05-01

Sensory processing deficits are common in autism spectrum disorders, but the underlying mechanisms are unclear. Fragile X Syndrome (FXS) is a leading genetic cause of intellectual disability and autism. Electrophysiological responses in humans with FXS show reduced habituation with sound repetition and this deficit may underlie auditory hypersensitivity in FXS. Our previous study in Fmr1 knockout (KO) mice revealed an unusually long state of increased sound-driven excitability in auditory cortical neurons suggesting that cortical responses to repeated sounds may exhibit abnormal habituation as in humans with FXS. Here, we tested this prediction by comparing cortical event related potentials (ERP) recorded from wildtype (WT) and Fmr1 KO mice. We report a repetition-rate dependent reduction in habituation of N1 amplitude in Fmr1 KO mice and show that matrix metalloproteinase-9 (MMP-9), one of the known FMRP targets, contributes to the reduced ERP habituation. Our studies demonstrate a significant up-regulation of MMP-9 levels in the auditory cortex of adult Fmr1 KO mice, whereas a genetic deletion of Mmp-9 reverses ERP habituation deficits in Fmr1 KO mice. Although the N1 amplitude of Mmp-9/Fmr1 DKO recordings was larger than WT and KO recordings, the habituation of ERPs in Mmp-9/Fmr1 DKO mice is similar to WT mice implicating MMP-9 as a potential target for reversing sensory processing deficits in FXS. Together these data establish ERP habituation as a translation relevant, physiological pre-clinical marker of auditory processing deficits in FXS and suggest that abnormal MMP-9 regulation is a mechanism underlying auditory hypersensitivity in FXS. Fragile X Syndrome (FXS) is the leading known genetic cause of autism spectrum disorders. Individuals with FXS show symptoms of auditory hypersensitivity. These symptoms may arise due to sustained neural responses to repeated sounds, but the underlying mechanisms remain unclear. For the first time, this study shows deficits in habituation of neural responses to repeated sounds in the Fmr1 KO mice as seen in humans with FXS. We also report an abnormally high level of matrix metalloprotease-9 (MMP-9) in the auditory cortex of Fmr1 KO mice and that deletion of Mmp-9 from Fmr1 KO mice reverses habituation deficits. These data provide a translation relevant electrophysiological biomarker for sensory deficits in FXS and implicate MMP-9 as a target for drug discovery. Copyright © 2016 Elsevier Inc. All rights reserved.

Functional Genomics Using the Saccharomyces cerevisiae Yeast Deletion Collections.

PubMed

Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

2016-09-01

Constructed by a consortium of 16 laboratories, the Saccharomyces genome-wide deletion collections have, for the past decade, provided a powerful, rapid, and inexpensive approach for functional profiling of the yeast genome. Loss-of-function deletion mutants were systematically created using a polymerase chain reaction (PCR)-based gene deletion strategy to generate a start-to-stop codon replacement of each open reading frame by homologous recombination. Each strain carries two molecular barcodes that serve as unique strain identifiers, enabling their growth to be analyzed in parallel and the fitness contribution of each gene to be quantitatively assessed by hybridization to high-density oligonucleotide arrays or through the use of next-generation sequencing technologies. Functional profiling of the deletion collections, using either strain-by-strain or parallel assays, provides an unbiased approach to systematically survey the yeast genome. The Saccharomyces yeast deletion collections have proved immensely powerful in contributing to the understanding of gene function, including functional relationships between genes and genetic pathways in response to diverse genetic and environmental perturbations. © 2016 Cold Spring Harbor Laboratory Press.

Characterizing cognitive control abilities in children with 16p11.2 deletion using adaptive 'video game' technology: a pilot study.

PubMed

Anguera, J A; Brandes-Aitken, A N; Rolle, C E; Skinner, S N; Desai, S S; Bower, J D; Martucci, W E; Chung, W K; Sherr, E H; Marco, E J

2016-09-20

Assessing cognitive abilities in children is challenging for two primary reasons: lack of testing engagement can lead to low testing sensitivity and inherent performance variability. Here we sought to explore whether an engaging, adaptive digital cognitive platform built to look and feel like a video game would reliably measure attention-based abilities in children with and without neurodevelopmental disabilities related to a known genetic condition, 16p11.2 deletion. We assessed 20 children with 16p11.2 deletion, a genetic variation implicated in attention deficit/hyperactivity disorder and autism, as well as 16 siblings without the deletion and 75 neurotypical age-matched children. Deletion carriers showed significantly slower response times and greater response variability when compared with all non-carriers; by comparison, traditional non-adaptive selective attention assessments were unable to discriminate group differences. This phenotypic characterization highlights the potential power of administering tools that integrate adaptive psychophysical mechanics into video-game-style mechanics to achieve robust, reliable measurements.

Targeted Gene Deletion in Cordyceps militaris Using the Split-Marker Approach.

PubMed

Lou, HaiWei; Ye, ZhiWei; Yun, Fan; Lin, JunFang; Guo, LiQiong; Chen, BaiXiong; Mu, ZhiXian

2018-05-01

The macrofungus Cordyceps militaris contains many kinds of bioactive ingredients that are regulated by functional genes, but the functions of many genes in C. militaris are still unknown. In this study, to improve the frequency of homologous integration, a genetic transformation system based on a split-marker approach was developed for the first time in C. militaris to knock out a gene encoding a terpenoid synthase (Tns). The linear and split-marker deletion cassettes were constructed and introduced into C. militaris protoplasts by PEG-mediated transformation. The transformation of split-marker fragments resulted in a higher efficiency of targeted gene disruption than the transformation of linear deletion cassettes did. The color phenotype of the Tns gene deletion mutants was different from that of wild-type C. militaris. Moreover, a PEG-mediated protoplast transformation system was established, and stable genetic transformants were obtained. This method of targeted gene deletion represents an important tool for investigating the role of C. militaris genes.

Linguistic and Psychomotor Development in Children with Chromosome 14 Deletions

ERIC Educational Resources Information Center

Zampini, Laura; D'Odorico, Laura; Zanchi, Paola; Zollino, Marcella; Neri, Giovanni

2012-01-01

The present study focussed on a specific type of rare genetic condition: chromosome 14 deletions. Children with this genetic condition often show developmental delays and brain and neurological problems, although the type and severity of symptoms varies depending on the size and location of the deleted genetic material. The specific aim of the…

Whole-exome sequencing and digital PCR identified a novel compound heterozygous mutation in the NPHP1 gene in a case of Joubert syndrome and related disorders.

PubMed

Koyama, Shingo; Sato, Hidenori; Wada, Manabu; Kawanami, Toru; Emi, Mitsuru; Kato, Takeo

2017-03-27

Joubert syndrome and related disorders (JSRD) is a clinically and genetically heterogeneous condition with autosomal recessive or X-linked inheritance, which share a distinctive neuroradiological hallmark, the so-called molar tooth sign. JSRD is classified into six clinical subtypes based on associated variable multiorgan involvement. To date, 21 causative genes have been identified in JSRD, which makes genetic diagnosis difficult. We report here a case of a 28-year-old Japanese woman diagnosed with JS with oculorenal defects with a novel compound heterozygous mutation (p.Ser219*/deletion) in the NPHP1 gene. Whole-exome sequencing (WES) of the patient identified the novel nonsense mutation in an apparently homozygous state. However, it was absent in her mother and heterozygous in her father. A read depth-based copy number variation (CNV) detection algorithm using WES data of the family predicted a large heterozygous deletion mutation in the patient and her mother, which was validated by digital polymerase chain reaction, indicating that the patient was compound heterozygous for the paternal nonsense mutation and the maternal deletion mutation spanning the site of the single nucleotide change. It should be noted that analytical pipelines that focus purely on sequence information cannot distinguish homozygosity from hemizygosity because of its inability to detect large deletions. The ability to detect CNVs in addition to single nucleotide variants and small insertion/deletions makes WES an attractive diagnostic tool for genetically heterogeneous disorders.

Identification of the Mechanisms Causing Reversion to Virulence in an Attenuated SARS-CoV for the Design of a Genetically Stable Vaccine.

PubMed

Jimenez-Guardeño, Jose M; Regla-Nava, Jose A; Nieto-Torres, Jose L; DeDiego, Marta L; Castaño-Rodriguez, Carlos; Fernandez-Delgado, Raul; Perlman, Stanley; Enjuanes, Luis

2015-10-01

A SARS-CoV lacking the full-length E gene (SARS-CoV-∆E) was attenuated and an effective vaccine. Here, we show that this mutant virus regained fitness after serial passages in cell culture or in vivo, resulting in the partial duplication of the membrane gene or in the insertion of a new sequence in gene 8a, respectively. The chimeric proteins generated in cell culture increased virus fitness in vitro but remained attenuated in mice. In contrast, during SARS-CoV-∆E passage in mice, the virus incorporated a mutated variant of 8a protein, resulting in reversion to a virulent phenotype. When the full-length E protein was deleted or its PDZ-binding motif (PBM) was mutated, the revertant viruses either incorporated a novel chimeric protein with a PBM or restored the sequence of the PBM on the E protein, respectively. Similarly, after passage in mice, SARS-CoV-∆E protein 8a mutated, to now encode a PBM, and also regained virulence. These data indicated that the virus requires a PBM on a transmembrane protein to compensate for removal of this motif from the E protein. To increase the genetic stability of the vaccine candidate, we introduced small attenuating deletions in E gene that did not affect the endogenous PBM, preventing the incorporation of novel chimeric proteins in the virus genome. In addition, to increase vaccine biosafety, we introduced additional attenuating mutations into the nsp1 protein. Deletions in the carboxy-terminal region of nsp1 protein led to higher host interferon responses and virus attenuation. Recombinant viruses including attenuating mutations in E and nsp1 genes maintained their attenuation after passage in vitro and in vivo. Further, these viruses fully protected mice against challenge with the lethal parental virus, and are therefore safe and stable vaccine candidates for protection against SARS-CoV.

Identification of the Mechanisms Causing Reversion to Virulence in an Attenuated SARS-CoV for the Design of a Genetically Stable Vaccine

PubMed Central

Nieto-Torres, Jose L.; DeDiego, Marta L.; Castaño-Rodriguez, Carlos; Fernandez-Delgado, Raul; Perlman, Stanley; Enjuanes, Luis

2015-01-01

A SARS-CoV lacking the full-length E gene (SARS-CoV-∆E) was attenuated and an effective vaccine. Here, we show that this mutant virus regained fitness after serial passages in cell culture or in vivo, resulting in the partial duplication of the membrane gene or in the insertion of a new sequence in gene 8a, respectively. The chimeric proteins generated in cell culture increased virus fitness in vitro but remained attenuated in mice. In contrast, during SARS-CoV-∆E passage in mice, the virus incorporated a mutated variant of 8a protein, resulting in reversion to a virulent phenotype. When the full-length E protein was deleted or its PDZ-binding motif (PBM) was mutated, the revertant viruses either incorporated a novel chimeric protein with a PBM or restored the sequence of the PBM on the E protein, respectively. Similarly, after passage in mice, SARS-CoV-∆E protein 8a mutated, to now encode a PBM, and also regained virulence. These data indicated that the virus requires a PBM on a transmembrane protein to compensate for removal of this motif from the E protein. To increase the genetic stability of the vaccine candidate, we introduced small attenuating deletions in E gene that did not affect the endogenous PBM, preventing the incorporation of novel chimeric proteins in the virus genome. In addition, to increase vaccine biosafety, we introduced additional attenuating mutations into the nsp1 protein. Deletions in the carboxy-terminal region of nsp1 protein led to higher host interferon responses and virus attenuation. Recombinant viruses including attenuating mutations in E and nsp1 genes maintained their attenuation after passage in vitro and in vivo. Further, these viruses fully protected mice against challenge with the lethal parental virus, and are therefore safe and stable vaccine candidates for protection against SARS-CoV. PMID:26513244

High resolution melting: improvements in the genetic diagnosis of hypertrophic cardiomyopathy in a Portuguese cohort

PubMed Central

2012-01-01

Background Hypertrophic Cardiomyopathy (HCM) is a complex myocardial disorder with a recognized genetic heterogeneity. The elevated number of genes and mutations involved in HCM limits a gene-based diagnosis that should be considered of most importance for basic research and clinical medicine. Methodology In this report, we evaluated High Resolution Melting (HRM) robustness, regarding HCM genetic testing, by means of analyzing 28 HCM-associated genes, including the most frequent 4 HCM-associated sarcomere genes, as well as 24 genes with lower reported HCM-phenotype association. We analyzed 80 Portuguese individuals with clinical phenotype of HCM allowing simultaneously a better characterization of this disease in the Portuguese population. Results HRM technology allowed us to identify 60 mutated alleles in 72 HCM patients: 49 missense mutations, 3 nonsense mutations, one 1-bp deletion, one 5-bp deletion, one in frame 3-bp deletion, one insertion/deletion, 3 splice mutations, one 5'UTR mutation in MYH7, MYBPC3, TNNT2, TNNI3, CSRP3, MYH6 and MYL2 genes. Significantly 22 are novel gene mutations. Conclusions HRM was proven to be a technique with high sensitivity and a low false positive ratio allowing a rapid, innovative and low cost genotyping of HCM. In a short return, HRM as a gene scanning technique could be a cost-effective gene-based diagnosis for an accurate HCM genetic diagnosis and hopefully providing new insights into genotype/phenotype correlations. PMID:22429680

Establishment of a Cre recombinase based mutagenesis protocol for markerless gene deletion in Streptococcus suis.

PubMed

Koczula, A; Willenborg, J; Bertram, R; Takamatsu, D; Valentin-Weigand, P; Goethe, R

2014-12-01

The lack of knowledge about pathogenicity mechanisms of Streptococcus (S.) suis is, at least partially, attributed to limited methods for its genetic manipulation. Here, we established a Cre-lox based recombination system for markerless gene deletions in S. suis serotype 2 with high selective pressure and without undesired side effects. Copyright © 2014 Elsevier B.V. All rights reserved.

Mutation-based learning to improve student autonomy and scientific inquiry skills in a large genetics laboratory course.

PubMed

Wu, Jinlu

2013-01-01

Laboratory education can play a vital role in developing a learner's autonomy and scientific inquiry skills. In an innovative, mutation-based learning (MBL) approach, students were instructed to redesign a teacher-designed standard experimental protocol by a "mutation" method in a molecular genetics laboratory course. Students could choose to delete, add, reverse, or replace certain steps of the standard protocol to explore questions of interest to them in a given experimental scenario. They wrote experimental proposals to address their rationales and hypotheses for the "mutations"; conducted experiments in parallel, according to both standard and mutated protocols; and then compared and analyzed results to write individual lab reports. Various autonomy-supportive measures were provided in the entire experimental process. Analyses of student work and feedback suggest that students using the MBL approach 1) spend more time discussing experiments, 2) use more scientific inquiry skills, and 3) find the increased autonomy afforded by MBL more enjoyable than do students following regimented instructions in a conventional "cookbook"-style laboratory. Furthermore, the MBL approach does not incur an obvious increase in labor and financial costs, which makes it feasible for easy adaptation and implementation in a large class.

A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1

PubMed Central

de Berardinis, Véronique; Vallenet, David; Castelli, Vanina; Besnard, Marielle; Pinet, Agnès; Cruaud, Corinne; Samair, Sumitta; Lechaplais, Christophe; Gyapay, Gabor; Richez, Céline; Durot, Maxime; Kreimeyer, Annett; Le Fèvre, François; Schächter, Vincent; Pezo, Valérie; Döring, Volker; Scarpelli, Claude; Médigue, Claudine; Cohen, Georges N; Marlière, Philippe; Salanoubat, Marcel; Weissenbach, Jean

2008-01-01

We have constructed a collection of single-gene deletion mutants for all dispensable genes of the soil bacterium Acinetobacter baylyi ADP1. A total of 2594 deletion mutants were obtained, whereas 499 (16%) were not, and are therefore candidate essential genes for life on minimal medium. This essentiality data set is 88% consistent with the Escherichia coli data set inferred from the Keio mutant collection profiled for growth on minimal medium, while 80% of the orthologous genes described as essential in Pseudomonas aeruginosa are also essential in ADP1. Several strategies were undertaken to investigate ADP1 metabolism by (1) searching for discrepancies between our essentiality data and current metabolic knowledge, (2) comparing this essentiality data set to those from other organisms, (3) systematic phenotyping of the mutant collection on a variety of carbon sources (quinate, 2-3 butanediol, glucose, etc.). This collection provides a new resource for the study of gene function by forward and reverse genetic approaches and constitutes a robust experimental data source for systems biology approaches. PMID:18319726

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Genetic Mapping of Brain Plasticity Across Development in Williams Syndrome: ERP Markers of Face and Language Processing

PubMed Central

Mills, D. L.; Dai, L.; Fishman, I.; Yam, A.; Appelbaum, L. G.; Galaburda, A.; Bellugi, U.; Korenberg, J. R.

2014-01-01

In Williams Syndrome (WS), a known genetic deletion results in atypical brain function with strengths in face and language processing. We examined how genetic influences on brain activity change with development. In three studies, ERPs from large samples of children, adolescents, and adults with the full genetic deletion for WS were compared to typically developing controls, and two adults with partial deletions for WS. Studies 1 and 2 identified ERP markers of brain plasticity in WS across development. Study 3 suggested that in adults with partial deletions for WS, specific genes may be differentially implicated in face and language processing. PMID:24219698

Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

PubMed Central

Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

2017-01-01

Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

The SPINK gene family and celiac disease susceptibility.

PubMed

Wapenaar, Martin C; Monsuur, Alienke J; Poell, Jos; van 't Slot, Ruben; Meijer, Jos W R; Meijer, Gerrit A; Mulder, Chris J; Mearin, Maria Luisa; Wijmenga, Cisca

2007-05-01

The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was determined for all four SPINK genes by quantitative reverse-transcription polymerase chain reaction in duodenal biopsy samples from untreated (n=15) and diet-treated patients (n=31) and controls (n=16). Genetic association of the four SPINK genes was tested within a total of 18 haplotype tagging SNPs, one coding SNP, 310 patients, and 180 controls. The SPINK4 study cohort was further expanded to include 479 CD cases and 540 controls. SPINK4 DNA sequence analysis was performed on six members of a multigeneration CD family to detect possible point mutations or deletions. SPINK4 showed differential gene expression, which was at its highest in untreated patients and dropped sharply upon commencement of a gluten-free diet. Genetic association tests for all four SPINK genes were negative, including SPINK4 in the extended case/control cohort. No SPINK4 mutations or deletions were observed in the multigeneration CD family with linkage to chromosome 9p21-13 nor was the coding SNP disease-specific. SPINK4 exhibits CD pathology-related differential gene expression, likely derived from altered goblet cell activity. All of the four SPINK genes tested do not contribute to the genetic risk for CD in the Dutch population.

Cri du Chat syndrome

PubMed Central

Cerruti Mainardi, Paola

2006-01-01

The Cri du Chat syndrome (CdCS) is a genetic disease resulting from a deletion of variable size occurring on the short arm of chromosome 5 (5p-). The incidence ranges from 1:15,000 to 1:50,000 live-born infants. The main clinical features are a high-pitched monochromatic cry, microcephaly, broad nasal bridge, epicanthal folds, micrognathia, abnormal dermatoglyphics, and severe psychomotor and mental retardation. Malformations, although not very frequent, may be present: cardiac, neurological and renal abnormalities, preauricular tags, syndactyly, hypospadias, and cryptorchidism. Molecular cytogenetic analysis has allowed a cytogenetic and phenotypic map of 5p to be defined, even if results from the studies reported up to now are not completely in agreement. Genotype-phenotype correlation studies showed a clinical and cytogenetic variability. The identification of phenotypic subsets associated with a specific size and type of deletion is of diagnostic and prognostic relevance. Specific growth and psychomotor development charts have been established. Two genes, Semaphorin F (SEMAF) and δ-catenin (CTNND2), which have been mapped to the "critical regions", are potentially involved in cerebral development and their deletion may be associated with mental retardation in CdCS patients. Deletion of the telomerase reverse transcriptase (hTERT) gene, localised to 5p15.33, could contribute to the phenotypic changes in CdCS. The critical regions were recently refined by using array comparative genomic hybridisation. The cat-like cry critical region was further narrowed using quantitative polymerase chain reaction (PCR) and three candidate genes were characterised in this region. The diagnosis is based on typical clinical manifestations. Karyotype analysis and, in doubtful cases, FISH analysis will confirm the diagnosis. There is no specific therapy for CdCS but early rehabilitative and educational interventions improve the prognosis and considerable progress has been made in the social adjustment of CdCS patients. PMID:16953888

Characterizing cognitive control abilities in children with 16p11.2 deletion using adaptive ‘video game' technology: a pilot study

PubMed Central

Anguera, J A; Brandes-Aitken, A N; Rolle, C E; Skinner, S N; Desai, S S; Bower, J D; Martucci, W E; Chung, W K; Sherr, E H; Marco, E J

2016-01-01

Assessing cognitive abilities in children is challenging for two primary reasons: lack of testing engagement can lead to low testing sensitivity and inherent performance variability. Here we sought to explore whether an engaging, adaptive digital cognitive platform built to look and feel like a video game would reliably measure attention-based abilities in children with and without neurodevelopmental disabilities related to a known genetic condition, 16p11.2 deletion. We assessed 20 children with 16p11.2 deletion, a genetic variation implicated in attention deficit/hyperactivity disorder and autism, as well as 16 siblings without the deletion and 75 neurotypical age-matched children. Deletion carriers showed significantly slower response times and greater response variability when compared with all non-carriers; by comparison, traditional non-adaptive selective attention assessments were unable to discriminate group differences. This phenotypic characterization highlights the potential power of administering tools that integrate adaptive psychophysical mechanics into video-game-style mechanics to achieve robust, reliable measurements. PMID:27648915

B-Type Natriuretic Peptide Deletion Leads to Progressive Hypertension, Associated Organ Damage, and Reduced Survival: Novel Model for Human Hypertension.

PubMed

Holditch, Sara J; Schreiber, Claire A; Nini, Ryan; Tonne, Jason M; Peng, Kah-Whye; Geurts, Aron; Jacob, Howard J; Burnett, John C; Cataliotti, Alessandro; Ikeda, Yasuhiro

2015-07-01

Altered myocardial structure and function, secondary to chronically elevated blood pressure, are leading causes of heart failure and death. B-type natriuretic peptide (BNP), a guanylyl cyclase A agonist, is a cardiac hormone integral to cardiovascular regulation. Studies have demonstrated a causal relationship between reduced production or impaired BNP release and the development of human hypertension. However, the consequences of BNP insufficiency on blood pressure and hypertension-associated complications remain poorly understood. Therefore, the goal of this study was to create and characterize a novel model of BNP deficiency to investigate the effects of BNP absence on cardiac and renal structure, function, and survival. Genetic BNP deletion was generated in Dahl salt-sensitive rats. Compared with age-matched controls, BNP knockout rats demonstrated adult-onset hypertension. Increased left ventricular mass with hypertrophy and substantially augmented hypertrophy signaling pathway genes, developed in young adult knockout rats, which preceded hypertension. Prolonged hypertension led to increased cardiac stiffness, cardiac fibrosis, and thrombi formation. Significant elongation of the QT interval was detected at 9 months in knockout rats. Progressive nephropathy was also noted with proteinuria, fibrosis, and glomerular alterations in BNP knockout rats. End-organ damage contributed to a significant decline in overall survival. Systemic BNP overexpression reversed the phenotype of genetic BNP deletion. Our results demonstrate the critical role of BNP defect in the development of systemic hypertension and associated end-organ damage in adulthood. © 2015 American Heart Association, Inc.

Genetics Home Reference: piebaldism

MedlinePlus

... and deletions of the KIT (steel factor receptor) gene in human piebaldism. Am J Hum Genet. 1995 Jan;56( ... Sánchez-García I. Deletion of the SLUG (SNAI2) gene results in human piebaldism. Am J Med Genet A. 2003 Oct ...

A novel reverse genetics system for production of infectious West Nile virus using homologous recombination in mammalian cells.

PubMed

Kobayashi, Shintaro; Yoshii, Kentaro; Hirano, Minato; Muto, Memi; Kariwa, Hiroaki

2017-02-01

Reverse genetics systems facilitate investigation of many aspects of the life cycle and pathogenesis of viruses. However, genetic instability in Escherichia coli has hampered development of a reverse genetics system for West Nile virus (WNV). In this study, we developed a novel reverse genetics system for WNV based on homologous recombination in mammalian cells. Introduction of the DNA fragment coding for the WNV structural protein together with a DNA-based replicon resulted in the release of infectious WNV. The growth rate and plaque size of the recombinant virus were almost identical to those of the parent WNV. Furthermore, chimeric WNV was produced by introducing the DNA fragment coding for the structural protein and replicon plasmid derived from various strains. Here, we report development of a novel system that will facilitate research into WNV infection. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloned cDNA of A/swine/Iowa/15/1930 internal genes as a candidate backbone for reverse genetics vaccine against influenza A viruses

PubMed Central

Lekcharoensuk, Porntippa; Wiriyarat, Witthawat; Petcharat, Nuntawan; Lekcharoensuk, Chalermpol; Auewarakul, Prasert; Richt, Juergen A

2012-01-01

Reverse genetics viruses for influenza vaccine production usually utilize the internal genes of the egg-adapted A/Puerto Rico/8/34 (PR8) strain. This egg-adapted strain provides high production yield in embryonated eggs but does not necessarily give the best yield in mammalian cell culture. In order to generate a reverse genetics viral backbone that is well-adapted to high growth in mammalian cell culture, a swine influenza isolate (A/swine/Iowa/15/30 (H1N1) (rg1930) that was shown to give high yield in Madin-Darby Canine Kidney (MDCK) cells was used as the internal gene donor for reverse genetics plasmids. In this report, the internal genes from rg1930 were used for construction of reverse genetics viruses carrying a cleavage site-modified hemagglutinin (HA) gene and neuraminidase (NA) gene from a highly pathogenic H5N1 virus. The resulting virus (rg1930H5N1) was low pathogenic in vivo. Inactivated rg1930H5N1 vaccine completely protected chickens from morbidity and mortality after challenge with highly pathogenic H5N1. Protective immunity was obtained when chickens were immunized with an inactivated vaccine consisting of at least 29 HA units of the rg1930H5N1 virus. In comparison to the PR8-based reverse genetics viruses carrying the same HA and NA genes from an H5N1 virus, rg1930 based viruses yielded higher viral titers in MDCK and Vero cells. In addition, the reverse genetics derived H3N2 and H5N2 viruses with the rg1930 backbone replicated in MDCK cells better than the cognate viruses with the rgPR8 backbone. It is concluded that this newly established reverse genetics backbone system could serve as a candidate for a master donor strain for development of inactivated influenza vaccines in cell-based systems. PMID:22230579

Development of a Blocking ELISA Using a Monoclonal Antibody to a Dominant Epitope in Non-Structural Protein 3A of Foot-and-Mouth Disease Virus, as a Matching Test for a Negative-Marker Vaccine.

PubMed

Fu, Yuanfang; Li, Pinghua; Cao, Yimei; Wang, Na; Sun, Pu; Shi, Qian; Ji, Xincheng; Bao, Huifang; Li, Dong; Chen, Yingli; Bai, Xingwen; Ma, Xueqing; Zhang, Jing; Lu, Zengjun; Liu, Zaixin

2017-01-01

Foot-and-mouth disease (FMD) is a devastating animal disease. Strategies for differentiation of infected from vaccinated animals (DIVA) remain very important for controlling disease. Development of an epitope-deleted marker vaccine and accompanying diagnostic method will improve the efficiency of DIVA. Here, a monoclonal antibody (Mab) was found to recognize a conserved "AEKNPLE" epitope spanning amino acids 109-115 of non-structural protein (NSP) 3A of foot-and-mouth disease virus (FMDV; O/Tibet/CHA/99 strain), which could be deleted by a reverse-genetic procedure. In addition, a blocking ELISA was developed based on this Mab against NSP 3A, which could serve as a matching test for a negative-marker vaccine. The criterion of this blocking ELISA was determined by detecting panels of sera from different origins. The serum samples with a percentage inhibition (PI) equal or greater than 50% were considered to be from infected animals, and those with <50% PI were considered to be from non-infected animals. This test showed similar performance when compared with other 2 blocking ELISAs based on an anti-NSP 3B Mab. This is the first report of the DIVA test for an NSP antibody based on an Mab against the conserved and predominant "AEKNPLE" epitope in NSP 3A of FMDV.

Genetic Modifiers of the Physical Malformations in Velo-Cardio-Facial Syndrome/DiGeorge Syndrome

ERIC Educational Resources Information Center

Aggarwal, Vimla S.; Morrow, Bernice E.

2008-01-01

Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid, and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that "Tbx1", a…

Gene Editing and Gene-Based Therapeutics for Cardiomyopathies.

PubMed

Ohiri, Joyce C; McNally, Elizabeth M

2018-04-01

With an increasing understanding of genetic defects leading to cardiomyopathy, focus is shifting to correcting these underlying genetic defects. One approach involves treating mutant RNA through antisense oligonucleotides; the first drug has received regulatory approval to treat specific mutations associated with Duchenne muscular dystrophy. Gene editing is being evaluated in the preclinical setting. For inherited cardiomyopathies, genetic correction strategies require tight specificity for the mutant allele. Gene-editing methods are being tested to create deletions that may be useful to restore protein expression by through the bypass of mutations that restore protein production. Site-specific gene editing, which is required to correct many point mutations, is a less efficient process than inducing deletions. Copyright © 2017 Elsevier Inc. All rights reserved.

Infection and Transmission of Rift Valley Fever Viruses Lacking the NSs and/or NSm Genes in Mosquitoes: Potential Role for NSm in Mosquito Infection

PubMed Central

Crabtree, Mary B.; Kent Crockett, Rebekah J.; Bird, Brian H.; Nichol, Stuart T.; Erickson, Bobbie Rae; Biggerstaff, Brad J.; Horiuchi, Kalanthe; Miller, Barry R.

2012-01-01

Background Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Methodology and Principal Findings Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. Conclusions/Significance In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes. PMID:22563517

Infection and transmission of Rift Valley fever viruses lacking the NSs and/or NSm genes in mosquitoes: potential role for NSm in mosquito infection.

PubMed

Crabtree, Mary B; Kent Crockett, Rebekah J; Bird, Brian H; Nichol, Stuart T; Erickson, Bobbie Rae; Biggerstaff, Brad J; Horiuchi, Kalanthe; Miller, Barry R

2012-01-01

Rift Valley fever virus is an arthropod-borne human and animal pathogen responsible for large outbreaks of acute and febrile illness throughout Africa and the Arabian Peninsula. Reverse genetics technology has been used to develop deletion mutants of the virus that lack the NSs and/or NSm virulence genes and have been shown to be stable, immunogenic and protective against Rift Valley fever virus infection in animals. We assessed the potential for these deletion mutant viruses to infect and be transmitted by Aedes mosquitoes, which are the principal vectors for maintenance of the virus in nature and emergence of virus initiating disease outbreaks, and by Culex mosquitoes which are important amplification vectors. Aedes aegypti and Culex quinquefasciatus mosquitoes were fed bloodmeals containing the deletion mutant viruses. Two weeks post-exposure mosquitoes were assayed for infection, dissemination, and transmission. In Ae. aegypti, infection and transmission rates of the NSs deletion virus were similar to wild type virus while dissemination rates were significantly reduced. Infection and dissemination rates for the NSm deletion virus were lower compared to wild type. Virus lacking both NSs and NSm failed to infect Ae. aegypti. In Cx. quinquefasciatus, infection rates for viruses lacking NSm or both NSs and NSm were lower than for wild type virus. In both species, deletion of NSm or both NSs and NSm reduced the infection and transmission potential of the virus. Deletion of both NSs and NSm resulted in the highest level of attenuation of virus replication. Deletion of NSm alone was sufficient to nearly abolish infection in Aedes aegypti mosquitoes, indicating an important role for this protein. The double deleted viruses represent an ideal vaccine profile in terms of environmental containment due to lack of ability to efficiently infect and be transmitted by mosquitoes.

Mutational analysis of the reverse transcriptase and ribonuclease H domains of the human foamy virus.

PubMed Central

Kögel, D; Aboud, M; Flügel, R M

1995-01-01

Human foamy or spuma virus (HFV) codes for a distinct set of pol gen products. To determine the minimal requirements for the HFV enzymatic activities, defined residues of the reverse transcriptase (RT) and ribo-nuclease H (RNase H) domain of the HFV pol gene were mutated by site-specific PCR mutagenesis. The mutant gene products were bacterially expressed, purified by Ni2+ chelate affinity chromatography and characterised by Western blotting. The enzymatic activities of the individual recombinant HFV pol mutant proteins were characterised by the situ RT, RNase H and RNase H assays. Two substitution mutants reached RT activity levels higher than that of the intact recombinant HFV RT-RH-His. When the catalytically essential D508 was substituted by A508, 5% of RNase H activity was retained while DNA polymerase activity increased 2-fold. A deletion of 11 amino acid residues in the hinge region completely abolished DNA polymerase while RNase H activity decreased 2-fold. A deletion mutant in the C-terminal RH domain showed no RNase H but retained RNase H activity indicating that the activities are genetically separable. The combined data reveal that the HFV DNA polymerase and RNase H activities are interdependent. Images PMID:7544460

Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

PubMed Central

Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

2018-01-01

Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

Generation of recombinant rotaviruses expressing fluorescent proteins using an optimized reverse genetics system.

PubMed

Komoto, Satoshi; Fukuda, Saori; Ide, Tomihiko; Ito, Naoto; Sugiyama, Makoto; Yoshikawa, Tetsushi; Murata, Takayuki; Taniguchi, Koki

2018-04-18

An entirely plasmid-based reverse genetics system for rotaviruses was established very recently. We improved the reverse genetics system to generate recombinant rotavirus by transfecting only 11 cDNA plasmids for its 11 gene segments under the condition of increasing the ratio of the cDNA plasmids for NSP2 and NSP5 genes. Utilizing this highly efficient system, we then engineered infectious recombinant rotaviruses expressing bioluminescent (NanoLuc luciferase) and fluorescent (EGFP and mCherry) reporters. These recombinant rotaviruses expressing reporters remained genetically stable during serial passages. Our reverse genetics approach and recombinant rotaviruses carrying reporter genes will be great additions to the tool kit for studying the molecular virology of rotavirus, and for developing future next-generation vaccines and expression vectors. IMPORTANCE Rotavirus is one of the most important pathogens causing severe gastroenteritis in young children worldwide. In this paper, we describe a robust and simple reverse genetics system based on only rotavirus cDNAs, and its application for engineering infectious recombinant rotaviruses harboring bioluminescent (NanoLuc) and fluorescent (EGFP and mCherry) protein genes. This highly efficient reverse genetics system and recombinant RVAs expressing reporters could be powerful tools for the study of different aspects of rotavirus replication. Furthermore, they may be useful for next-generation vaccine production for this medically important virus. Copyright © 2018 American Society for Microbiology.

Genetic association study identifies a functional CNV in the WWOX gene contributes to the risk of intracranial aneurysms.

PubMed

Fan, Jin; Sun, Wen; Lin, Min; Yu, Ke; Wang, Jian; Duan, Dan; Zheng, Bo; Yang, Zhenghui; Wang, Qingsong

2016-03-29

Intracranial aneurysms (IAs) accounts for 85% of hemorrhagic stroke. Genetic factors have been known to play an important role in the development of IAs. A functional CNV (CNV-67048) of human WW domain-containing oxidoreductase (WWOX), which has been identified as a tumor suppressor gene in multiple cancers, was identified to be associated with gliomas risk previously. Here, we hypothesized that the CNV-67048 could also affect susceptibility of IAs. Based on a two-stage, case- control study with a total of 976 patients of IAs and 1,200 matched healthy controls, we found the effect size for per copy deletion was 1.35 (95% CI = 1.16-1.57; Ptrend = 1.18 × 10-4). Compared with the individuals having no deletion, significantly higher risk of IAs was detected for both subjects carrying 1 copy deletion (OR = 1.24, 95% CI = 1.02-1.52) and subjects carrying 2 copy deletion (OR = 1.77, 95% CI = 1.24-2.53). Real-time PCR was used to confirm the abnormal expression of WWOX in tissues of IA patients and influence of genotypes of CNV-67048. The expression level of WWOX in IA tissues was significantly lower than that in corresponding normal tissues (P = 0.004), and the deletion genotypes of CNV-67048 have lower WWOX mRNA levels in both tumor tissues and border tissues (P < 0.01). Our data suggests that the deletion genotypes of CNV-67048 in WWOX predispose their carriers to IAs, which might be a genetic biomarker to predict risk of IAs in Chinese.

MERS coronaviruses from camels in Africa exhibit region-dependent genetic diversity.

PubMed

Chu, Daniel K W; Hui, Kenrie P Y; Perera, Ranawaka A P M; Miguel, Eve; Niemeyer, Daniela; Zhao, Jincun; Channappanavar, Rudragouda; Dudas, Gytis; Oladipo, Jamiu O; Traoré, Amadou; Fassi-Fihri, Ouafaa; Ali, Abraham; Demissié, Getnet F; Muth, Doreen; Chan, Michael C W; Nicholls, John M; Meyerholz, David K; Kuranga, Sulyman A; Mamo, Gezahegne; Zhou, Ziqi; So, Ray T Y; Hemida, Maged G; Webby, Richard J; Roger, Francois; Rambaut, Andrew; Poon, Leo L M; Perlman, Stanley; Drosten, Christian; Chevalier, Veronique; Peiris, Malik

2018-03-20

Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa as well as in the Arabian Peninsula, zoonotic disease appears confined to the Arabian Peninsula. MERS-CoVs from Africa have hitherto been poorly studied. We genetically and phenotypically characterized MERS-CoV from dromedaries sampled in Morocco, Burkina Faso, Nigeria, and Ethiopia. Viruses from Africa (clade C) are phylogenetically distinct from contemporary viruses from the Arabian Peninsula (clades A and B) but remain antigenically similar in microneutralization tests. Viruses from West (Nigeria, Burkina Faso) and North (Morocco) Africa form a subclade, C1, that shares clade-defining genetic signatures including deletions in the accessory gene ORF4b Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung. BF785 replicated to lower titer in lungs of human DPP4-transduced mice. A reverse genetics-derived recombinant MERS-CoV (EMC) lacking ORF4b elicited higher type I and III IFN responses than the isogenic EMC virus in Calu-3 cells. However, ORF4b deletions may not be the major determinant of the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to zoonotic potential. There is an urgent need for studies of MERS-CoV at the animal-human interface. Copyright © 2018 the Author(s). Published by PNAS.

Matrix metalloproteinase-9 deletion rescues auditory evoked potential habituation deficit in a mouse model of Fragile X Syndrome

PubMed Central

Lovelace, Jonathan W.; Wen, Teresa H.; Reinhard, Sarah; Hsu, Mike S.; Sidhu, Harpreet; Ethell, Iryna M.; Binder, Devin K.; Razak, Khaleel A.

2016-01-01

Sensory processing deficits are common in autism spectrum disorders, but the underlying mechanisms are unclear. Fragile X Syndrome (FXS) is a leading genetic cause of intellectual disability and autism. Electrophysiological responses in humans with FXS show reduced habituation with sound repetition and this deficit may underlie auditory hypersensitivity in FXS. Our previous study in Fmr1 knockout (KO) mice revealed an unusually long state of increased sound-driven excitability in auditory cortical neurons suggesting that cortical responses to repeated sounds may exhibit abnormal habituation as in humans with FXS. Here, we tested this prediction by comparing cortical event related potentials (ERP) recorded from wildtype (WT) and Fmr1 KO mice. We report a repetition-rate dependent reduction in habituation of N1 amplitude in Fmr1 KO mice and show that matrix metalloproteinase −9 (MMP-9), one of the known FMRP targets, contributes to the reduced ERP habituation. Our studies demonstrate a significant up-regulation of MMP-9 levels in the auditory cortex of adult Fmr1 KO mice, whereas a genetic deletion of Mmp-9 reverses ERP habituation deficits in Fmr1 KO mice. Although the N1 amplitude of Mmp-9/Fmr1 DKO recordings was larger than WT and KO recordings, the habituation of ERPs in Mmp-9/Fmr1 DKO mice is similar to WT mice implicating MMP-9 as a potential target for reversing sensory processing deficits in FXS. Together these data establish ERP habituation as a translation relevant, physiological pre-clinical marker of auditory processing deficits in FXS and suggest that abnormal MMP-9 regulation is a mechanism underlying auditory hypersensitivity in FXS. PMID:26850918

Strains and stressors: an analysis of touchscreen learning in genetically diverse mouse strains.

PubMed

Graybeal, Carolyn; Bachu, Munisa; Mozhui, Khyobeni; Saksida, Lisa M; Bussey, Timothy J; Sagalyn, Erica; Williams, Robert W; Holmes, Andrew

2014-01-01

Touchscreen-based systems are growing in popularity as a tractable, translational approach for studying learning and cognition in rodents. However, while mouse strains are well known to differ in learning across various settings, performance variation between strains in touchscreen learning has not been well described. The selection of appropriate genetic strains and backgrounds is critical to the design of touchscreen-based studies and provides a basis for elucidating genetic factors moderating behavior. Here we provide a quantitative foundation for visual discrimination and reversal learning using touchscreen assays across a total of 35 genotypes. We found significant differences in operant performance and learning, including faster reversal learning in DBA/2J compared to C57BL/6J mice. We then assessed DBA/2J and C57BL/6J for differential sensitivity to an environmental insult by testing for alterations in reversal learning following exposure to repeated swim stress. Stress facilitated reversal learning (selectively during the late stage of reversal) in C57BL/6J, but did not affect learning in DBA/2J. To dissect genetic factors underlying these differences, we phenotyped a family of 27 BXD strains generated by crossing C57BL/6J and DBA/2J. There was marked variation in discrimination, reversal and extinction learning across the BXD strains, suggesting this task may be useful for identifying underlying genetic differences. Moreover, different measures of touchscreen learning were only modestly correlated in the BXD strains, indicating that these processes are comparatively independent at both genetic and phenotypic levels. Finally, we examined the behavioral structure of learning via principal component analysis of the current data, plus an archival dataset, totaling 765 mice. This revealed 5 independent factors suggestive of "reversal learning," "motivation-related late reversal learning," "discrimination learning," "speed to respond," and "motivation during discrimination." Together, these findings provide a valuable reference to inform the choice of strains and genetic backgrounds in future studies using touchscreen-based tasks.

Characterization of hemizygous deletions in Citrus using array-Comparative Genomic Hybridization and microsynteny comparisons with the poplar genome

PubMed Central

Ríos, Gabino; Naranjo, Miguel A; Iglesias, Domingo J; Ruiz-Rivero, Omar; Geraud, Marion; Usach, Antonio; Talón, Manuel

2008-01-01

Background Many fruit-tree species, including relevant Citrus spp varieties exhibit a reproductive biology that impairs breeding and strongly constrains genetic improvements. In citrus, juvenility increases the generation time while sexual sterility, inbreeding depression and self-incompatibility prevent the production of homozygous cultivars. Genomic technology may provide citrus researchers with a new set of tools to address these various restrictions. In this work, we report a valuable genomics-based protocol for the structural analysis of deletion mutations on an heterozygous background. Results Two independent fast neutron mutants of self-incompatible clementine (Citrus clementina Hort. Ex Tan. cv. Clemenules) were the subject of the study. Both mutants, named 39B3 and 39E7, were expected to carry DNA deletions in hemizygous dosage. Array-based Comparative Genomic Hybridization (array-CGH) using a Citrus cDNA microarray allowed the identification of underrepresented genes in these two mutants. Subsequent comparison of citrus deleted genes with annotated plant genomes, especially poplar, made possible to predict the presence of a large deletion in 39B3 of about 700 kb and at least two deletions of approximately 100 and 500 kb in 39E7. The deletion in 39B3 was further characterized by PCR on available Citrus BACs, which helped us to build a partial physical map of the deletion. Among the deleted genes, ClpC-like gene coding for a putative subunit of a multifunctional chloroplastic protease involved in the regulation of chlorophyll b synthesis was directly related to the mutated phenotype since the mutant showed a reduced chlorophyll a/b ratio in green tissues. Conclusion In this work, we report the use of array-CGH for the successful identification of genes included in a hemizygous deletion induced by fast neutron irradiation on Citrus clementina. The study of gene content and order into the 39B3 deletion also led to the unexpected conclusion that microsynteny and local gene colinearity in this species were higher with Populus trichocarpa than with the phylogenetically closer Arabidopsis thaliana. This work corroborates the potential of Citrus genomic resources to assist mutagenesis-based approaches for functional genetics, structural studies and comparative genomics, and hence to facilitate citrus variety improvement. PMID:18691431

Mutation-Based Learning to Improve Student Autonomy and Scientific Inquiry Skills in a Large Genetics Laboratory Course

PubMed Central

Wu, Jinlu

2013-01-01

Laboratory education can play a vital role in developing a learner's autonomy and scientific inquiry skills. In an innovative, mutation-based learning (MBL) approach, students were instructed to redesign a teacher-designed standard experimental protocol by a “mutation” method in a molecular genetics laboratory course. Students could choose to delete, add, reverse, or replace certain steps of the standard protocol to explore questions of interest to them in a given experimental scenario. They wrote experimental proposals to address their rationales and hypotheses for the “mutations”; conducted experiments in parallel, according to both standard and mutated protocols; and then compared and analyzed results to write individual lab reports. Various autonomy-supportive measures were provided in the entire experimental process. Analyses of student work and feedback suggest that students using the MBL approach 1) spend more time discussing experiments, 2) use more scientific inquiry skills, and 3) find the increased autonomy afforded by MBL more enjoyable than do students following regimented instructions in a conventional “cookbook”-style laboratory. Furthermore, the MBL approach does not incur an obvious increase in labor and financial costs, which makes it feasible for easy adaptation and implementation in a large class. PMID:24006394

Genome-wide survey of artificial mutations induced by ethyl methanesulfonate and gamma rays in tomato.

PubMed

Shirasawa, Kenta; Hirakawa, Hideki; Nunome, Tsukasa; Tabata, Satoshi; Isobe, Sachiko

2016-01-01

Genome-wide mutations induced by ethyl methanesulfonate (EMS) and gamma irradiation in the tomato Micro-Tom genome were identified by a whole-genome shotgun sequencing analysis to estimate the spectrum and distribution of whole-genome DNA mutations and the frequency of deleterious mutations. A total of ~370 Gb of paired-end reads for four EMS-induced mutants and three gamma-ray-irradiated lines as well as a wild-type line were obtained by next-generation sequencing technology. Using bioinformatics analyses, we identified 5920 induced single nucleotide variations and insertion/deletion (indel) mutations. The predominant mutations in the EMS mutants were C/G to T/A transitions, while in the gamma-ray mutants, C/G to T/A transitions, A/T to T/A transversions, A/T to G/C transitions and deletion mutations were equally common. Biases in the base composition flanking mutations differed between the mutagenesis types. Regarding the effects of the mutations on gene function, >90% of the mutations were located in intergenic regions, and only 0.2% were deleterious. In addition, we detected 1,140,687 spontaneous single nucleotide polymorphisms and indel polymorphisms in wild-type Micro-Tom lines. We also found copy number variation, deletions and insertions of chromosomal segments in both the mutant and wild-type lines. The results provide helpful information not only for mutation research, but also for mutant screening methodology with reverse-genetic approaches. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

[Genetic Characteristics of Type 2 Vaccine-derived Poliovirus in Shanxi Province (China) in 2014].

PubMed

Yan, Dongrei; Li, Xiaolei; Zhang, Yong; Yang, Jianfang; Zhu, Shuangli; Wang, Dongyan; Zhang, Chuangye; Zhu, Hui; Xu, Wenbo

2015-03-01

The World Health Organization redefined the type 2 vaccine-derived poliovirus (VDPV) in 2010. To study the genetic characteristics and evolution of type 2 VDPV under this new definition, we conducted genome sequencing and analyses of type 2 VDPVs isolated from one patient with acute flaccid paralysis in Shanxi province (China) in 2014. Nucleotide sequencing revealed that the full-length of type 2 VDPV is 7439 bases encoding 2207 amino acids with no insertion or deletion of nucleotides compared with Sabin2. One nucleotide substitution identified as a key determinant of the attenuated phenotype of the Sabin 2 strain (A-G reversion at nucleotide nt 481 in the 5-end of the untranslated region) had reverted in the Shanxi type 2 VDPV. The other known key determinant of the attenuated phenotype of the Sabin 2 strain (U-->C reversion at nt2909 in the VP1 coding region that caused a Ile143Thr substitution in VP1) had not reverted in the Shanxi VDPV. The Shanxi type 2 VDPV was S2/S1 recombinant, the crossover site of which mapped to the 3-end of the 3D region (between nt 6247 and nt 6281). A phylogentic tree based on the VP1 coding region showed that evolution of the Shanxi type 2 VDPV was independent of other type 2 VDPVs detected worldwide. We estimated that the strain circulated for approximately = 11 months in the population according to the known evolution rate. The present study confirmed that the Chinese Polio Laboratory Network could discover the VDPV promptly and that it played an important part in maintenance of a polio-free China.

Supporting Children with Genetic Syndromes in the Classroom: The Example of 22q Deletion Syndrome

ERIC Educational Resources Information Center

Reilly, Colin; Stedman, Lindsey

2013-01-01

An increasing number of children are likely to have a known genetic cause for their special educational needs. One such genetic condition is 22q11.2 deletion syndrome (22qDS), a genetic syndrome associated with early speech and language difficulties, global and specific cognitive impairments, difficulties with attention and difficulties with…

Memory in Intellectually Matched Groups of Young Participants with 22q11.2 Deletion Syndrome and Those with Schizophrenia

ERIC Educational Resources Information Center

Kravariti, Eugenia; Jacobson, Clare; Morris, Robin; Frangou, Sophia; Murray, Robin M.; Tsakanikos, Elias; Habel, Alex; Shearer, Jo

2010-01-01

The 22q11.2 deletion syndrome (22qDS) and schizophrenia have genetic and neuropsychological similarities, but are likely to differ in memory profile. Confirming differences in memory function between the two disorders, and identifying their genetic determinants, can help to define genetic subtypes in both syndromes, identify genetic risk factors…

An efficient and rapid influenza gene cloning strategy for reverse genetics system.

PubMed

Shao, Hongxia; Fan, Zhonglei; Wan, Zhimin; Tian, Xiaoyan; Chen, Hongjun; Perez, Daniel R; Qin, Aijian; Ye, Jianqiang

2015-09-15

Influenza reverse genetics plays vital roles in understanding influenza molecular characteristics and vaccine development. However, current influenza reverse genetics heavily depends on restriction enzyme and ligation for gene cloning. The traditional cloning process of influenza eight fragments for virus rescuing generally requires considerable work. To simplify and increase the pace of gene cloning for influenza reverse genetics system, we developed a rapid restriction enzyme-free ExnaseTM II-based in vitro recombination approach for influenza gene cloning. We used this strategy rapidly and successfully to clone influenza eight genes both from viruses PR8 and H9N2 for virus rescuing. Our data demonstrate that the strategy developed here can accelerate the process of influenza gene cloning into reverse genetics system, and shows high potential for applications in both influenza basic and applied research. Copyright © 2015 Elsevier B.V. All rights reserved.

Insulin restores neuronal nitric oxide synthase expression and function that is lost in diabetic gastropathy

PubMed Central

Watkins, Crystal C.; Sawa, Akira; Jaffrey, Samie; Blackshaw, Seth; Barrow, Roxanne K.; Snyder, Solomon H.; Ferris, Christopher D.

2000-01-01

Gastrointestinal dysfunction is common in diabetic patients. In genetic (nonobese diabetic) and toxin-elicited (streptozotocin) models of diabetes in mice, we demonstrate defects in gastric emptying and nonadrenergic, noncholinergic relaxation of pyloric muscle, which resemble defects in mice harboring a deletion of the neuronal nitric oxide synthase gene (nNOS). The diabetic mice manifest pronounced reduction in pyloric nNOS protein and mRNA. The decline of nNOS in diabetic mice does not result from loss of myenteric neurons. nNOS expression and pyloric function are restored to normal levels by insulin treatment. Thus diabetic gastropathy in mice reflects an insulin-sensitive reversible loss of nNOS. In diabetic animals, delayed gastric emptying can be reversed with a phosphodiesterase inhibitor, sildenafil. These findings have implications for novel therapeutic approaches and may clarify the etiology of diabetic gastropathy. PMID:10930440

Next generation sequencing identifies abnormal Y chromosome and candidate causal variants in premature ovarian failure patients.

PubMed

Lee, Yujung; Kim, Changshin; Park, YoungJoon; Pyun, Jung-A; Kwack, KyuBum

2016-12-01

Premature ovarian failure (POF) is characterized by heterogeneous genetic causes such as chromosomal abnormalities and variants in causal genes. Recently, development of techniques made next generation sequencing (NGS) possible to detect genome wide variants including chromosomal abnormalities. Among 37 Korean POF patients, XY karyotype with distal part deletions of Y chromosome, Yp11.32-31 and Yp12 end part, was observed in two patients through NGS. Six deleterious variants in POF genes were also detected which might explain the pathogenesis of POF with abnormalities in the sex chromosomes. Additionally, the two POF patients had no mutation in SRY but three non-synonymous variants were detected in genes regarding sex reversal. These findings suggest candidate causes of POF and sex reversal and show the propriety of NGS to approach the heterogeneous pathogenesis of POF. Copyright © 2016 Elsevier Inc. All rights reserved.

Generation of obese rat model by transcription activator-like effector nucleases targeting the leptin receptor gene.

PubMed

Chen, Yuting; Lu, Wenqing; Gao, Na; Long, Yi; Shao, Yanjiao; Liu, Meizhen; Chen, Huaqing; Ye, Shixin; Ma, Xueyun; Liu, Mingyao; Li, Dali

2017-02-01

The laboratory rat is a valuable mammalian model organism for basic research and drug discovery. Here we demonstrate an efficient methodology by applying transcription activator-like effector nucleases (TALENs) technology to generate Leptin receptor (Lepr) knockout rats on the Sprague Dawley (SD) genetic background. Through direct injection of in vitro transcribed mRNA of TALEN pairs into SD rat zygotes, somatic mutations were induced in two of three resulting pups. One of the founders carrying bi-allelic mutation exhibited early onset of obesity and infertility. The other founder carried a chimeric mutation which was efficiently transmitted to the progenies. Through phenotyping of the resulting three lines of rats bearing distinct mutations in the Lepr locus, we found that the strains with a frame-shifted or premature stop codon mutation led to obesity and metabolic disorders. However, no obvious defect was observed in a strain with an in-frame 57 bp deletion in the extracellular domain of Lepr. This suggests the deleted amino acids do not significantly affect Lepr structure and function. This is the first report of generating the Lepr mutant obese rat model in SD strain through a reverse genetic approach. This suggests that TALEN is an efficient and powerful gene editing technology for the generation of disease models.

Cloned cDNA of A/swine/Iowa/15/1930 internal genes as a candidate backbone for reverse genetics vaccine against influenza A viruses.

PubMed

Lekcharoensuk, Porntippa; Wiriyarat, Witthawat; Petcharat, Nantawan; Lekcharoensuk, Chalermpol; Auewarakul, Prasert; Richt, Juergen A

2012-02-14

Reverse genetics viruses for influenza vaccine production usually utilize the internal genes of the egg-adapted A/Puerto Rico/8/34 (PR8) strain. This egg-adapted strain provides high production yield in embryonated eggs but does not necessarily give the best yield in mammalian cell culture. In order to generate a reverse genetics viral backbone that is well-adapted to high growth in mammalian cell culture, a swine influenza isolate A/swine/Iowa/15/30 (H1N1) (rg1930) that was shown to give high yield in Madin-Darby canine kidney (MDCK) cells was used as the internal gene donor for reverse genetics plasmids. In this report, the internal genes from rg1930 were used for construction of reverse genetics viruses carrying a cleavage site-modified hemagglutinin (HA) gene and neuraminidase (NA) gene from a highly pathogenic H5N1 virus. The resulting virus (rg1930H5N1) was low pathogenic in vivo. Inactivated rg1930H5N1 vaccine completely protected chickens from morbidity and mortality after challenge with highly pathogenic H5N1. Protective immunity was obtained when chickens were immunized with an inactivated vaccine consisting of at least 2(9) HA units of the rg1930H5N1 virus. In comparison to the PR8-based reverse genetics viruses carrying the same HA and NA genes from an H5N1 virus, rg1930 based viruses yielded higher viral titers in MDCK and Vero cells. In addition, the reverse genetics derived H3N2 and H5N2 viruses with the rg1930 backbone replicated in MDCK cells better than the cognate viruses with the rgPR8 backbone. It is concluded that this newly established reverse genetics backbone system could serve as a candidate for a master donor strain for development of inactivated influenza vaccines in cell-based systems. Copyright © 2011 Elsevier Ltd. All rights reserved.

TPH2 polymorphisms and expression in Prader-Willi syndrome subjects with differing genetic subtypes.

PubMed

Henkhaus, Rebecca S; Bittel, Douglas C; Butler, Merlin G

2010-09-01

Prader-Willi syndrome (PWS) is a genetic imprinting disease that causes developmental and behavioral disturbances resulting from loss of expression of genes from the paternal chromosome 15q11-q13 region. In about 70% of subjects, this portion of the paternal chromosome is deleted, while 25% have two copies of the maternal chromosome 15, or uniparental maternal disomy (UPD; the remaining subjects have imprinting center defects. There are several documented physical and behavioral differences between the two major PWS genetic subtypes (deletion and UPD) indicating the genetic subtype plays a role in clinical presentation. Serotonin is known to be disturbed in PWS and affects both eating behavior and compulsion, which are reported to be abnormal in PWS. We investigated the tryptophan hydroxylase gene (TPH2), the rate-limiting enzyme in the production of brain serotonin, by analyzing three different TPH2 gene polymorphisms, transcript expression, and correlation with PWS genetic subtype. DNA and RNA from lymphoblastoid cell lines derived from 12 PWS and 12 comparison subjects were used for the determination of genetic subtype, TPH2 polymorphisms and quantitative RT-PCR analysis. A similar frequency of TPH2 polymorphisms was seen in the PWS and comparison subjects with PWS deletion subjects showing increased expression with one or more TPH2 polymorphism. Both PWS deletion and PWS UPD subjects had significantly lower TPH2 expression than control subjects and PWS deletion subjects had significantly lower TPH2 expression compared with PWS UPD subjects. PWS subjects with 15q11-q13 deletions had lower TPH2 expression compared with PWS UPD or control subjects, requiring replication and further studies to identify the cause including identification of disturbed gene interactions resulting from the deletion process.

Genetically Validated Drug Targets in Leishmania: Current Knowledge and Future Prospects.

PubMed

Jones, Nathaniel G; Catta-Preta, Carolina M C; Lima, Ana Paula C A; Mottram, Jeremy C

2018-04-13

There has been a very limited number of high-throughput screening campaigns carried out with Leishmania drug targets. In part, this is due to the small number of suitable target genes that have been shown by genetic or chemical methods to be essential for the parasite. In this perspective, we discuss the state of genetic target validation in the field of Leishmania research and review the 200 Leishmania genes and 36 Trypanosoma cruzi genes for which gene deletion attempts have been made since the first published case in 1990. We define a quality score for the different genetic deletion techniques that can be used to identify potential drug targets. We also discuss how the advances in genome-scale gene disruption techniques have been used to assist target-based and phenotypic-based drug development in other parasitic protozoa and why Leishmania has lacked a similar approach so far. The prospects for this scale of work are considered in the context of the application of CRISPR/Cas9 gene editing as a useful tool in Leishmania.

GluN2B in corticostriatal circuits governs choice learning and choice shifting

PubMed Central

Brigman, Jonathan L.; Daut, Rachel; Wright, Tara; Gunduz-Cinar, Ozge; Graybeal, Carolyn; Davis, Margaret I.; Jiang, Zhihong; Saksida, Lisa; Jinde, Seiichiro; Pease, Matthew; Bussey, Timothy J.; Lovinger, David M.; Nakazawa, Kazu; Holmes, Andrew

2013-01-01

A choice that reliably produces a preferred outcome can be automated to liberate cognitive resources for other tasks. Should an outcome become less desirable, behavior must adapt in parallel or become perseverative. Corticostriatal systems are known to mediate choice learning and flexibility, but the molecular mechanisms subserving the instantiation of these processes are not well understood. We integrated mouse behavioral, immunocytochemical, in vivo electrophysiological, genetic, and pharmacological approaches to study choice. We found that the dorsal striatum (DS) was increasingly activated with choice learning, whereas reversal of learned choice engaged prefrontal regions. In vivo, DS neurons showed activity associated with reward anticipation and receipt that emerged with learning and relearning. Corticostriatal or striatal GluN2B gene deletion, or DS-restricted GluN2B antagonism, impaired choice learning, whereas cortical GluN2B deletion or OFC GluN2B antagonism impaired shifting. Our convergent data demonstrate how corticostriatal GluN2B circuits govern the ability to learn and shift choice behavior. PMID:23831965

Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

PubMed

Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

2011-11-01

Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

Pharmacological Inhibition of Poly(ADP-Ribose) Polymerases Improves Fitness and Mitochondrial Function in Skeletal Muscle

PubMed Central

Pirinen, Eija; Canto, Carles; Jo, Young-Suk; Morato, Laia; Zhang, Hongbo; Menzies, Keir; Williams, Evan G.; Mouchiroud, Laurent; Moullan, Norman; Hagberg, Carolina; Li, Wei; Timmers, Silvie; Imhof, Ralph; Verbeek, Jef; Pujol, Aurora; van Loon, Barbara; Viscomi, Carlo; Zeviani, Massimo; Schrauwen, Patrick; Sauve, Anthony; Schoonjans, Kristina; Auwerx, Johan

2014-01-01

SUMMARY We previously demonstrated that the deletion of the poly(ADP-ribose)polymerase (Parp)-1 gene in mice enhances oxidative metabolism, thereby protecting against diet-induced obesity. However, the therapeutic use of PARP inhibitors to enhance mitochondrial function remains to be explored. Here, we show tight negative correlation between Parp-1 expression and energy expenditure in heterogeneous mouse populations, indicating that variations in PARP-1 activity have an impact on metabolic homeostasis. Notably, these genetic correlations can be translated into pharmacological applications. Long-term treatment with PARP inhibitors enhances fitness in mice by increasing the abundance of mitochondrial respiratory complexes and boosting mitochondrial respiratory capacity. Furthermore, PARP inhibitors reverse mitochondrial defects in primary myotubes of obese humans and attenuate genetic defects of mitochondrial metabolism in human fibroblasts and C. elegans. Overall, our work validates in worm, mouse and human models that PARP inhibition may be used to treat both genetic and acquired muscle dysfunction linked to defective mitochondrial function. PMID:24814482

Law-medicine interfacing: patenting of human genes and mutations.

PubMed

Fialho, Arsenio M; Chakrabarty, Ananda M

2011-08-01

Mutations, Single Nucleotide Polymorphisms (SNPs), deletions and genetic rearrangements in specific genes in the human genome account for not only our physical characteristics and behavior, but can lead to many in-born and acquired diseases. Such changes in the genome can also predispose people to cancers, as well as significantly affect the metabolism and efficacy of many drugs, resulting in some cases in acute toxicity to the drug. The testing of the presence of such genetic mutations and rearrangements is of great practical and commercial value, leading many of these genes and their mutations/deletions and genetic rearrangements to be patented. A recent decision by a judge in the Federal District Court in the Southern District of New York, has created major uncertainties, based on the revocation of BRCA1 and BRCA2 gene patents, in the eligibility of all human and presumably other gene patents. This article argues that while patents on BRCA1 and BRCA2 genes could be challenged based on a lack of utility, the patenting of the mutations and genetic rearrangements is of great importance to further development and commercialization of genetic tests that can save human lives and prevent suffering, and should be allowed.

In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology.

PubMed

Fazli, Mustafa; Harrison, Joe J; Gambino, Michela; Givskov, Michael; Tolker-Nielsen, Tim

2015-06-01

Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

In-Frame and Unmarked Gene Deletions in Burkholderia cenocepacia via an Allelic Exchange System Compatible with Gateway Technology

PubMed Central

Fazli, Mustafa; Harrison, Joe J.; Gambino, Michela; Givskov, Michael

2015-01-01

Burkholderia cenocepacia is an emerging opportunistic pathogen causing life-threatening infections in immunocompromised individuals and in patients with cystic fibrosis, which are often difficult, if not impossible, to treat. Understanding the genetic basis of virulence in this emerging pathogen is important for the development of novel treatment regimes. Generation of deletion mutations in genes predicted to encode virulence determinants is fundamental to investigating the mechanisms of pathogenesis. However, there is a lack of appropriate selectable and counterselectable markers for use in B. cenocepacia, making its genetic manipulation problematic. Here we describe a Gateway-compatible allelic exchange system based on the counterselectable pheS gene and the I-SceI homing endonuclease. This system provides efficiency in cloning homology regions of target genes and allows the generation of precise and unmarked gene deletions in B. cenocepacia. As a proof of concept, we demonstrate its utility by deleting the Bcam1349 gene, encoding a cyclic di-GMP (c-di-GMP)-responsive regulator protein important for biofilm formation. PMID:25795676

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2014-01-07

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Marburg Virus Reverse Genetics Systems

PubMed Central

Schmidt, Kristina Maria; Mühlberger, Elke

2016-01-01

The highly pathogenic Marburg virus (MARV) is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems. PMID:27338448

Marburg Virus Reverse Genetics Systems.

PubMed

Schmidt, Kristina Maria; Mühlberger, Elke

2016-06-22

The highly pathogenic Marburg virus (MARV) is a member of the Filoviridae family and belongs to the group of nonsegmented negative-strand RNA viruses. Reverse genetics systems established for MARV have been used to study various aspects of the viral replication cycle, analyze host responses, image viral infection, and screen for antivirals. This article provides an overview of the currently established MARV reverse genetic systems based on minigenomes, infectious virus-like particles and full-length clones, and the research that has been conducted using these systems.

Myxococcus xanthus Swarms Are Driven by Growth and Regulated by a Pacemaker ▿

PubMed Central

Kaiser, Dale; Warrick, Hans

2011-01-01

The principal social activity of Myxococcus xanthus is to organize a dynamic multicellular structure, known as a swarm. Although its cell density is high, the swarm can grow and expand rapidly. Within the swarm, the individual rod-shaped cells are constantly moving, transiently interacting with one another, and independently reversing their gliding direction. Periodic reversal is, in fact, essential for creating a swarm, and the reversal frequency controls the rate of swarm expansion. Chemotaxis toward nutrient has been thought to drive swarming, but here the nature of swarm growth and the impact of genetic deletions of members of the Frz family of proteins suggest otherwise. We find that three cytoplasmic Frz proteins, FrzCD, FrzF, and FrzE, constitute a cyclic pathway that sets the reversal frequency. Within each cell these three proteins appear to be connected in a negative-feedback loop that produces oscillations whose frequencies are finely tuned by methylation and by phosphorylation. This oscillator, in turn, drives MglAB, a small G-protein switch, to oscillate between its GTP- and GDP-bound states that ultimately determine when the cell moves forward or backward. The periodic reversal of interacting rod-shaped cells promotes their alignment. Swarm organization ensures that each cell can move without blocking the movement of others. PMID:21856842

Genetic diagnosis of Duchenne and Becker muscular dystrophy using multiplex ligation-dependent probe amplification in Rwandan patients.

PubMed

Uwineza, Annette; Hitayezu, Janvier; Murorunkwere, Seraphine; Ndinkabandi, Janvier; Kalala Malu, Celestin Kaputu; Caberg, Jean Hubert; Dideberg, Vinciane; Bours, Vincent; Mutesa, Leon

2014-04-01

Duchenne and Becker muscular dystrophies are the most common clinical forms of muscular dystrophies. They are genetically X-linked diseases caused by a mutation in the dystrophin (DMD) gene. A genetic diagnosis was carried out in six Rwandan patients presenting a phenotype of Duchenne and Becker muscular dystrophies and six asymptomatic female carrier relatives using multiplex ligation-dependent probe amplification (MLPA). Our results revealed deletion of the exons 48-51 in one patient, an inherited deletion of the exons 8-21 in two brothers and a de novo deletion of the exons 46-50 in the fourth patient. No copy number variation was found in two patients. Only one female carrier presented exon deletion in the DMD gene. This is the first cohort of genetic analysis in Rwandan patients affected by Duchenne and Becker muscular dystrophies. This report confirmed that MLPA assay can be easily implemented in low-income countries.

Copy number abnormality of acute lymphoblastic leukemia cell lines based on their genetic subtypes.

PubMed

Tomoyasu, Chihiro; Imamura, Toshihiko; Tomii, Toshihiro; Yano, Mio; Asai, Daisuke; Goto, Hiroaki; Shimada, Akira; Sanada, Masashi; Iwamoto, Shotaro; Takita, Junko; Minegishi, Masayoshi; Inukai, Takeshi; Sugita, Kanji; Hosoi, Hajime

2018-05-21

In this study, we performed genetic analysis of 83 B cell precursor acute lymphoblastic leukemia (B-ALL) cell lines. First, we performed multiplex ligation-dependent probe amplification analysis to identify copy number abnormalities (CNAs) in eight genes associated with B-ALL according to genetic subtype. In Ph + B-ALL cell lines, the frequencies of IKZF1, CDKN2A/2B, BTG1, and PAX5 deletion were significantly higher than those in Ph - B-ALL cell lines. The frequency of CDKN2A/2B deletion in KMT2A rearranged cell lines was significantly lower than that in non-KMT2A rearranged cell lines. These findings suggest that CNAs are correlated with genetic subtype in B-ALL cell lines. In addition, we determined that three B-other ALL cell lines had IKZF1 deletions (YCUB-5, KOPN49, and KOPN75); we therefore performed comprehensive genetic analysis of these cell lines. YCUB-5, KOPN49, and KOPN75 had P2RY8-CRLF2, IgH-CRLF2, and PAX5-ETV6 fusions, respectively. Moreover, targeted capture sequencing revealed that YCUB-5 had JAK2 R683I and KRAS G12D, and KOPN49 had JAK2 R683G and KRAS G13D mutations. These data may contribute to progress in the field of leukemia research.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2013-05-14

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2017-09-12

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet [Kingsport, TN; Koivuranta, Kari [Helsinki, FI; Penttila, Merja [Helsinki, FI; Ilmen, Marja [Helsinki, FI; Suominen, Pirkko [Maple Grove, MN; Aristidou, Aristos [Maple Grove, MN; Miller, Christopher Kenneth [Cottage Grove, MN; Olson, Stacey [St. Bonifacius, MN; Ruohonen, Laura [Helsinki, FI

2011-05-17

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications', include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Genetically modified yeast species, and fermentation processes using genetically modified yeast

DOEpatents

Rajgarhia, Vineet; Koivuranta, Kari; Penttila, Merja; Ilmen, Marja; Suominen, Pirkko; Aristidou, Aristos; Miller, Christopher Kenneth; Olson, Stacey; Ruohonen, Laura

2016-08-09

Yeast cells are transformed with an exogenous xylose isomerase gene. Additional genetic modifications enhance the ability of the transformed cells to ferment xylose to ethanol or other desired fermentation products. Those modifications include deletion of non-specific or specific aldose reductase gene(s), deletion of xylitol dehydrogenase gene(s) and/or overexpression of xylulokinase.

Strains and Stressors: An Analysis of Touchscreen Learning in Genetically Diverse Mouse Strains

PubMed Central

Graybeal, Carolyn; Bachu, Munisa; Mozhui, Khyobeni; Saksida, Lisa M.; Bussey, Timothy J.; Sagalyn, Erica; Williams, Robert W.; Holmes, Andrew

2014-01-01

Touchscreen-based systems are growing in popularity as a tractable, translational approach for studying learning and cognition in rodents. However, while mouse strains are well known to differ in learning across various settings, performance variation between strains in touchscreen learning has not been well described. The selection of appropriate genetic strains and backgrounds is critical to the design of touchscreen-based studies and provides a basis for elucidating genetic factors moderating behavior. Here we provide a quantitative foundation for visual discrimination and reversal learning using touchscreen assays across a total of 35 genotypes. We found significant differences in operant performance and learning, including faster reversal learning in DBA/2J compared to C57BL/6J mice. We then assessed DBA/2J and C57BL/6J for differential sensitivity to an environmental insult by testing for alterations in reversal learning following exposure to repeated swim stress. Stress facilitated reversal learning (selectively during the late stage of reversal) in C57BL/6J, but did not affect learning in DBA/2J. To dissect genetic factors underlying these differences, we phenotyped a family of 27 BXD strains generated by crossing C57BL/6J and DBA/2J. There was marked variation in discrimination, reversal and extinction learning across the BXD strains, suggesting this task may be useful for identifying underlying genetic differences. Moreover, different measures of touchscreen learning were only modestly correlated in the BXD strains, indicating that these processes are comparatively independent at both genetic and phenotypic levels. Finally, we examined the behavioral structure of learning via principal component analysis of the current data, plus an archival dataset, totaling 765 mice. This revealed 5 independent factors suggestive of “reversal learning,” “motivation-related late reversal learning,” “discrimination learning,” “speed to respond,” and “motivation during discrimination.” Together, these findings provide a valuable reference to inform the choice of strains and genetic backgrounds in future studies using touchscreen-based tasks. PMID:24586288

[MLPA technique--principles and use in practice].

PubMed

Rusu, Cristina; Sireteanu, Adriana; Puiu, Maria; Skrypnyk, Cristina; Tomescu, E; Csep, Katalin; Creţ, Victoria; Barbarii, Ligia

2007-01-01

MLPA (Multiplex Ligation-dependent Probe Amplification) is a recently introduced method, based on PCR principle, useful for the detection of different genetic abnormalities (aneuploidies, gene deletions/duplications, subtelomeric rearrangements, methylation status etc). The technique is simple, reliable and cheap. We present this method to discuss its importance for a modern genetic service and to underline its multiple advantages.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

Characterization of highly efficient heavy-ion mutagenesis in Arabidopsis thaliana.

PubMed

Kazama, Yusuke; Hirano, Tomonari; Saito, Hiroyuki; Liu, Yang; Ohbu, Sumie; Hayashi, Yoriko; Abe, Tomoko

2011-11-15

Heavy-ion mutagenesis is recognised as a powerful technology to generate new mutants, especially in higher plants. Heavy-ion beams show high linear energy transfer (LET) and thus more effectively induce DNA double-strand breaks than other mutagenic techniques. Previously, we determined the most effective heavy-ion LET (LETmax: 30.0 keV μm(-1)) for Arabidopsis mutagenesis by analysing the effect of LET on mutation induction. However, the molecular structure of mutated DNA induced by heavy ions with LETmax remains unclear. Knowledge of the structure of mutated DNA will contribute to the effective exploitation of heavy-ion beam mutagenesis. Dry Arabidopsis thaliana seeds were irradiated with carbon (C) ions with LETmax at a dose of 400 Gy and with LET of 22.5 keV μm(-1) at doses of 250 Gy or 450 Gy. The effects on mutation frequency and alteration of DNA structure were compared. To characterise the structure of mutated DNA, we screened the well-characterised mutants elongated hypocotyls (hy) and glabrous (gl) and identified mutated DNA among the resulting mutants by high-resolution melting curve, PCR and sequencing analyses. The mutation frequency induced by C ions with LETmax was two-fold higher than that with 22.5 keV μm(-1) and similar to the mutation frequency previously induced by ethyl methane sulfonate. We identified the structure of 22 mutated DNAs. Over 80% of the mutations caused by C ions with both LETs were base substitutions or deletions/insertions of less than 100 bp. The other mutations involved large rearrangements. The C ions with LETmax showed high mutation efficiency and predominantly induced base substitutions or small deletions/insertions, most of which were null mutations. These small alterations can be determined by single-nucleotide polymorphism (SNP) detection systems. Therefore, C ions with LETmax might be useful as a highly efficient reverse genetic system in conjunction with SNP detection systems, and will be beneficial for forward genetics and plant breeding.

A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: towards category theory-like systematization of molecular/genetic biology.

PubMed

Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun

2014-05-07

Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation 'Dj' corresponding to a DNA sequence but based on the five-letter base set; also, 'Dj's are expressed graphically. Insertions and deletions of a series of letters 'E' are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by 'Dj◦B(j→k) = Dk' (or 'Rj◦B(j→k) = Rk'). Based on the operations of this group, two types of groups-a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases-are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical "central dogma" via a category theory-like way is presented for future developments. Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing "central dogma" for future molecular/genetic biology remains to be explored.

A Genetic System for Clostridium ljungdahlii: a Chassis for Autotrophic Production of Biocommodities and a Model Homoacetogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leang, C; Ueki, T; Nevin, KP

Methods for genetic manipulation of Clostridium ljungdahlii are of interest because of the potential for production of fuels and other biocommodities from carbon dioxide via microbial electrosynthesis or more traditional modes of autotrophy with hydrogen or carbon monoxide as the electron donor. Furthermore, acetogenesis plays an important role in the global carbon cycle. Gene deletion strategies required for physiological studies of C. ljungdahlii have not previously been demonstrated. An electroporation procedure for introducing plasmids was optimized, and four different replicative origins for plasmid propagation in C. ljungdahlii were identified. Chromosomal gene deletion via double-crossover homologous recombination with a suicide vectormore » was demonstrated initially with deletion of the gene for FliA, a putative sigma factor involved in flagellar biogenesis and motility in C. ljungdahlii. Deletion of fliA yielded a strain that lacked flagella and was not motile. To evaluate the potential utility of gene deletions for functional genomic studies and to redirect carbon and electron flow, the genes for the putative bifunctional aldehyde/alcohol dehydrogenases, adhE1 and adhE2, were deleted individually or together. Deletion of adhE1, but not adhE2, diminished ethanol production with a corresponding carbon recovery in acetate. The double deletion mutant had a phenotype similar to that of the adhE1-deficient strain. Expression of adhE1 in trans partially restored the capacity for ethanol production. These results demonstrate the feasibility of genetic investigations of acetogen physiology and the potential for genetic manipulation of C. ljungdahlii to optimize autotrophic biocommodity production.« less

An episomal vector-based CRISPR/Cas9 system for highly efficient gene knockout in human pluripotent stem cells.

PubMed

Xie, Yifang; Wang, Daqi; Lan, Feng; Wei, Gang; Ni, Ting; Chai, Renjie; Liu, Dong; Hu, Shijun; Li, Mingqing; Li, Dajin; Wang, Hongyan; Wang, Yongming

2017-05-24

Human pluripotent stem cells (hPSCs) represent a unique opportunity for understanding the molecular mechanisms underlying complex traits and diseases. CRISPR/Cas9 is a powerful tool to introduce genetic mutations into the hPSCs for loss-of-function studies. Here, we developed an episomal vector-based CRISPR/Cas9 system, which we called epiCRISPR, for highly efficient gene knockout in hPSCs. The epiCRISPR system enables generation of up to 100% Insertion/Deletion (indel) rates. In addition, the epiCRISPR system enables efficient double-gene knockout and genomic deletion. To minimize off-target cleavage, we combined the episomal vector technology with double-nicking strategy and recent developed high fidelity Cas9. Thus the epiCRISPR system offers a highly efficient platform for genetic analysis in hPSCs.

22q11.2 deletion carriers and schizophrenia-associated novel variants.

PubMed

Balan, S; Iwayama, Y; Toyota, T; Toyoshima, M; Maekawa, M; Yoshikawa, T

2014-01-01

The penetrance of schizophrenia risk in carriers of the 22q11.2 deletion is high but incomplete, suggesting the possibility of additional genetic defects. We performed whole exome sequencing on two individuals with 22q11.2 deletion, one with schizophrenia and the other who was psychosis-free. The results revealed novel genetic variants related to neuronal function exclusively in the person with schizophrenia (frameshift: KAT8, APOH and SNX31; nonsense: EFCAB11 and CLVS2). This study paves the way towards a more complete understanding of variant dose and genetic architecture in schizophrenia.

Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Sangjo; Lee, Minho; Chang, Hyeshik

Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defectmore » measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)« less

Marker vaccine potential of foot-and-mouth disease virus with large deletion in the non-structural proteins 3A and 3B.

PubMed

Biswal, Jitendra K; Subramaniam, Saravanan; Ranjan, Rajeev; Sharma, Gaurav K; Misri, Jyoti; Pattnaik, Bramhadev

2015-11-01

Foot-and-mouth disease (FMD) is a highly contagious, economically important disease of transboundary importance. Regular vaccination with chemically inactivated FMD vaccine is the major means of controlling the disease in endemic countries like India. However, the traditional inactivated vaccines may sometimes contain traces of FMD viral (FMDV) non-structural protein (NSP), therefore, interfering with the NSP-based serological discrimination between infected and vaccinated animals. The availability of marker vaccine for differentiating FMD infected from vaccinated animals (DIVA) would be crucial for the control and subsequent eradication of FMD in India. In this study, we constructed a negative marker FMDV serotype O virus (vaccine strain O IND R2/1975), containing dual deletions of amino acid residues 93-143 and 10-37 in the non-structural proteins 3A and 3B, respectively through reverse genetics approach. The negative marker virus exhibited similar growth kinetics and plaque morphology in cell culture as compared to the wild type virus. In addition, we also developed and evaluated an indirect ELISA (I-ELISA) targeted to the deleted 3AB NSP region (truncated 3AB) which could be used as a companion differential diagnostic assay. The diagnostic sensitivity and specificity of the truncated 3AB I-ELISA were found to be 95.5% and 96%, respectively. The results from this study suggest that the availability negative marker virus and companion diagnostic assay could open a promising new avenue for the application of DIVA compatible marker vaccine for the control of FMD in India. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

HDAC3 Is a Critical Negative Regulator of Long-Term Memory Formation

PubMed Central

McQuown, Susan C.; Barrett, Ruth M.; Matheos, Dina P.; Post, Rebecca J.; Rogge, George A.; Alenghat, Theresa; Mullican, Shannon E.; Jones, Steven; Rusche, James R.; Lazar, Mitchell A.; Wood, Marcelo A.

2011-01-01

Gene expression is dynamically regulated by chromatin modifications on histone tails, such as acetylation. In general, histone acetylation promotes transcription, whereas histone deacetylation negatively regulates transcription. The interplay between histone acetyl-transerases and histone deacetylases (HDACs) is pivotal for the regulation of gene expression required for long-term memory processes. Currently, very little is known about the role of individual HDACs in learning and memory. We examined the role of HDAC3 in long-term memory using a combined genetic and pharmacologic approach. We used HDAC3–FLOX genetically modified mice in combination with adeno-associated virus-expressing Cre recombinase to generate focal homozygous deletions of Hdac3 in area CA1 of the dorsal hippocampus. To complement this approach, we also used a selective inhibitor of HDAC3, RGFP136 [N-(6-(2-amino-4-fluorophenylamino)-6-oxohexyl)-4-methylbenzamide]. Immunohistochemistry showed that focal deletion or intrahippocampal delivery of RGFP136 resulted in increased histone acetylation. Both the focal deletion of HDAC3 as well as HDAC3 inhibition via RGFP136 significantly enhanced long-term memory in a persistent manner. Next we examined expression of genes implicated in long-term memory from dorsal hippocampal punches using quantitative reverse transcription-PCR. Expression of nuclear receptor subfamily 4 group A, member 2 (Nr4a2) and c-fos was significantly increased in the hippocampus of HDAC3–FLOX mice compared with wild-type controls. Memory enhancements observed in HDAC3–FLOX mice were abolished by intrahippocampal delivery of Nr4a2 small interfering RNA, suggesting a mechanism by which HDAC3 negatively regulates memory formation. Together, these findings demonstrate a critical role for HDAC3 in the molecular mechanisms underlying long-term memory formation. PMID:21228185

Prader-Willi syndrome: intellectual abilities and behavioural features by genetic subtype.

PubMed

Milner, Katja M; Craig, Ellen E; Thompson, Russell J; Veltman, Marijcke W M; Thomas, N Simon; Roberts, Sian; Bellamy, Margaret; Curran, Sarah R; Sporikou, Caroline M J; Bolton, Patrick F

2005-10-01

Studies of chromosome 15 abnormality have implicated over-expression of paternally imprinted genes in the 15q11-13 region in the aetiology of autism. To test this hypothesis we compared individuals with Prader-Willi syndrome (PWS) due to uniparental disomy (UPD--where paternally imprinted genes are over-expressed) to individuals with the 15q11-13 deletion form of the syndrome (where paternally imprinted genes are not over-expressed). We also tested reports that PWS cases due to the larger type I (TI) form of deletion show differences to cases with the smaller type II (TII) deletion. Ninety-six individuals with PWS were recruited from genetic centres and the PWS association. Forty-nine individuals were confirmed as having maternal UPD of chromosome 15 and were age and sex matched to 47 individuals with a deletion involving 15q11-13 (32 had the shorter (T II) deletion, and 14 had the longer (TI) deletion). Behavioural assessments were carried out blind to genetic status, using the Autism Diagnostic Observation Schedule (ADOS), the Autism Diagnostic Interview (ADI), the Autism Screening Questionnaire (ASQ), the Children's Yale-Brown Obsessive-Compulsive Scale (CY-BOCS), the Vineland Adaptive Behaviour Scales (VABS), and measurements of intellectual ability, including the Wechsler and Mullen Scales and Raven's Matrices. UPD cases exhibited significantly more autistic-like impairments in reciprocal social interaction on questionnaire, interview and standardised observational measures. Comparison of TI and TII deletion cases revealed few differences, but ability levels tended to be lower in the TI deletion cases. Findings from a large study comparing deletion and UPD forms of Prader-Willi syndrome were consistent with other evidence in indicating that paternally imprinted genes in the 15q11-13 region constitute a genetic risk factor for aspects of autistic symptomatology. These genes may therefore play a role in the aetiology of autism. By contrast with another report, there was no clear-cut relationship between the size of the deletion and the form of cognitive and behavioural phenotype.

Saccharomyces cerevisiae Msh2-Msh3 acts in repair of base-base mispairs.

PubMed

Harrington, Jill M; Kolodner, Richard D

2007-09-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding.

Saccharomyces cerevisiae Msh2-Msh3 Acts in Repair of Base-Base Mispairs▿ †

PubMed Central

Harrington, Jill M.; Kolodner, Richard D.

2007-01-01

DNA mismatch repair is thought to act through two subpathways involving the recognition of base-base and insertion/deletion mispairs by the Msh2-Msh6 heterodimer and the recognition of insertion/deletion mispairs by the Msh2-Msh3 heterodimer. Here, through genetic and biochemical approaches, we describe a previously unidentified role of the Msh2-Msh3 heterodimer in the recognition of base-base mispairs and the suppression of homology-mediated duplication and deletion mutations. Saccharomyces cerevisiae msh3 mutants did not show an increase in the rate of base substitution mutations by the CAN1 forward mutation assay compared to the rate for the wild type but did show an altered spectrum of base substitution mutations, including an increased accumulation of base pair changes from GC to CG and from AT to TA; msh3 mutants also accumulated homology-mediated duplication and deletion mutations. The mutation spectrum of mlh3 mutants paralleled that of msh3 mutants, suggesting that the Mlh1-Mlh3 heterodimer may also play a role in the repair of base-base mispairs and in the suppression of homology-mediated duplication and deletion mutations. Mispair binding analysis with purified Msh2-Msh3 and DNA substrates derived from CAN1 sequences found to be mutated in vivo demonstrated that Msh2-Msh3 exhibited robust binding to specific base-base mispairs that was consistent with functional mispair binding. PMID:17636021

A study of the influence of different genotypes on the physical and behavioral phenotypes of children and adults ascertained clinically as having PWS.

PubMed

Webb, T; Whittington, J; Clarke, D; Boer, H; Butler, J; Holland, A

2002-10-01

A population-based cohort of people with a clinical diagnosis of Prader-Willi syndrome (PWS) was genetically assessed using molecular diagnostic methods and subsequently divided into the following genetic subtypes involving chromosome 15: 'deletion', 'disomy' and genetically negative (referred to as 'PWS-like'). The physical and behavioral characteristics of the three groups were compared in order to evaluate the unique characteristics of the phenotype resulting from loss of expression of imprinted genes at 15q11q13 (PWS vs. PWS-like cases), the possible effect of either haploid insufficiency of non-imprinted genes (deletion cases), or gain of function of imprinted genes (disomy cases) located within the PWS critical region at 15q11q13. In this study, the main differences between probands with either a deletion or disomy are considered, and the possible involvement of contributing genes discussed. The differences within the PWS group proved difficult to quantify. It would appear that haploid insufficiency or gain of function are more subtle contributors than gender-specific genomic imprinting in the production of the PWS phenotype.

[Influence of molecular-genetic factors on prognosis in patients with oligodendroglial tumors].

PubMed

Absaliamova, O V; Korshunov, A G; Loshakov, V A; Kobiakov, G L; Golanov, A V; Urakov, S V; Amanov, R D; Lichinitser, M R

2009-01-01

Previous studies demonstrated that patients with oligodendroglial tumors (OT) have longer overall and recurrence free survival than patients with other glial tumors of the same grade. Recent investigations showed high influence of genetic alterations on patients' outcome: overall and recurrence free survival increased in the case of presence 1p19q deletion and decreased in the presence of 9p or 10q deletion and/or EGFR amplification. In the series of 241 cases (107 male, 134 female patients, median age -- 38 years, (16-73)) we analyzed the impact of histology, tumor grade and genetic alterations on time to tumor progression (TTP). All patients underwent surgical resection of tumor or biopsy from 2000 to 2005. 70 patterns (oligodendroglioma (O) -- 13 cases, oligoastrocytoma (OA) -- 13, anaplastic oligodendroglioma (AO) -- 30, anaplastic oligoastrocytoma (AOA) -- 14) were assessed by fluorescent in situ hybridization. Median follow up was 24 months. The type of tumor (pure or mixed) didn't influence survival. TTP of patients with grade II and grade III tumors was 37.7 and 48.2 months, respectively (p = 0.035). Deletion 1p19q was noted in 34 (49%) cases. In pure O codeletion 1p19q was detected more frequently (in O -- 75%, in AO -- 56%) than in mixed tumors (in OA -- 31%, in AOA -- 35%). Deletions 9p, 10q and EGFR amplification were noted in 5, 6 and 4 cases, respectively. None of the tumors with 1pl9q deletion had other genetic alterations. Thus, we generated three prognostic groups: A -- deletion 1p19q; B -- balanced chromosomal profile; C -- deletion 9p. Median TTP in groups A, B and C was 46.6, 25.3 and 6.4 months, respectively (p < 0.001). The percentage of OT with 1p19q codeletion was lower than in previous studies. Pure O more frequently had 1p19q deletion than mixed tumors. Genetic alterations predict outcome stronger than histological criteria.

A novel KCNQ4 one-base deletion in a large pedigree with hearing loss: implication for the genotype-phenotype correlation.

PubMed

Kamada, Fumiaki; Kure, Shigeo; Kudo, Takayuki; Suzuki, Yoichi; Oshima, Takeshi; Ichinohe, Akiko; Kojima, Kanako; Niihori, Tetsuya; Kanno, Junko; Narumi, Yoko; Narisawa, Ayumi; Kato, Kumi; Aoki, Yoko; Ikeda, Katsuhisa; Kobayashi, Toshimitsu; Matsubara, Yoichi

2006-01-01

Autosomal-dominant, nonsyndromic hearing impairment is clinically and genetically heterogeneous. We encountered a large Japanese pedigree in which nonsyndromic hearing loss was inherited in an autosomal-dominant fashion. A genome-wide linkage study indicated linkage to the DFNA2 locus on chromosome 1p34. Mutational analysis of KCNQ4 encoding a potassium channel revealed a novel one-base deletion in exon 1, c.211delC, which generated a profoundly truncated protein without transmembrane domains (p.Q71fsX138). Previously, six missense mutations and one 13-base deletion, c.211_223del, had been reported in KCNQ4. Patients with the KCNQ4 missense mutations had younger-onset and more profound hearing loss than patients with the 211_223del mutation. In our current study, 12 individuals with the c.211delC mutation manifested late-onset and pure high-frequency hearing loss. Our results support the genotype-phenotype correlation that the KCNQ4 deletions are associated with later-onset and milder hearing impairment than the missense mutations. The phenotypic difference may be caused by the difference in pathogenic mechanisms: haploinsufficiency in deletions and dominant-negative effect in missense mutations.

Non-aflatoxigenicity of commercial Aspergillus oryzae strains due to genetic defects compared to aflatoxigenic Aspergillus flavus.

PubMed

Tao, Lin; Chung, Soo Hyun

2014-08-01

Aspergillus oryzae is generally recognized as safe, but it is closely related to A. flavus in morphology and genetic characteristics. In this study, we tested the aflatoxigenicity and genetic analysis of nine commercial A. oryzae strains that were used in Korean soybean fermented products. Cultural and HPLC analyses showed that none of the commercial strains produced detectable amount of aflatoxins. According to the molecular analysis of 17 genes in the aflatoxin (AF) biosynthetic pathway, the commercial strains could be classified into three groups. The group I strains contained all the 17 AF biosynthetic genes tested in this study; the group II strains deleted nine AF biosynthetic genes and possessed eight genes, including aflG, aflI, aflK, aflL, aflM, aflO, aflP, and aflQ; the group III strains only had six AF biosynthetic genes, including aflG, aflI, aflK, aflO, aflP, and aflQ. With the reverse transcription polymerase chain reaction, the group I A. oryzae strains showed no expression of aflG, aflQ and/or aflM genes, which resulted in the lack of AF-producing ability. Group II and group III strains could not produce AF owing to the deletion of more than half of the AF biosynthetic genes. In addition, the sequence data of polyketide synthase A (pksA) of group I strains of A. oryzae showed that there were three point mutations (two silent mutations and one missense mutation) compared with aflatoxigenic A. flavus used as the positive control in this study.

[Analysis of genetics mechanism for the phenotypic diversity in a patient carrying a rare ring chromosome 9].

PubMed

Qin, Shengfang; Wang, Xueyan; Li, Yunxing; Wei, Ping; Chen, Chun; Zeng, Lan

2016-02-01

To explore the genetics mechanism for the phenotypic variability in a patient carrying a rare ring chromosome 9. The karyotype of the patient was analyzed with cytogenetics method. Presence of sex chromosome was confirmed with fluorescence in situ hybridization. The SRY gene was subjected to PCR amplification and direct sequencing. Potential deletion and duplication were detected with array-based comparative genomic hybridization (array-CGH). The karyotype of the patient has comprised 6 types of cell lines containing a ring chromosome 9. The SRY gene sequence was normal. By array-CGH, the patient has carried a hemizygous deletion at 9p24.3-p23 (174 201-9 721 761) encompassing 30 genes from Online Mendelian Inheritance in Man. The phenotypic variability of the 9p deletion syndrome in conjunct with ring chromosome 9 may be attributable to multiple factors including loss of chromosomal material, insufficient dosage of genes, instability of ring chromosome, and pattern of inheritance.

Biotechnological applications of mobile group II introns and their reverse transcriptases: gene targeting, RNA-seq, and non-coding RNA analysis.

PubMed

Enyeart, Peter J; Mohr, Georg; Ellington, Andrew D; Lambowitz, Alan M

2014-01-13

Mobile group II introns are bacterial retrotransposons that combine the activities of an autocatalytic intron RNA (a ribozyme) and an intron-encoded reverse transcriptase to insert site-specifically into DNA. They recognize DNA target sites largely by base pairing of sequences within the intron RNA and achieve high DNA target specificity by using the ribozyme active site to couple correct base pairing to RNA-catalyzed intron integration. Algorithms have been developed to program the DNA target site specificity of several mobile group II introns, allowing them to be made into 'targetrons.' Targetrons function for gene targeting in a wide variety of bacteria and typically integrate at efficiencies high enough to be screened easily by colony PCR, without the need for selectable markers. Targetrons have found wide application in microbiological research, enabling gene targeting and genetic engineering of bacteria that had been intractable to other methods. Recently, a thermostable targetron has been developed for use in bacterial thermophiles, and new methods have been developed for using targetrons to position recombinase recognition sites, enabling large-scale genome-editing operations, such as deletions, inversions, insertions, and 'cut-and-pastes' (that is, translocation of large DNA segments), in a wide range of bacteria at high efficiency. Using targetrons in eukaryotes presents challenges due to the difficulties of nuclear localization and sub-optimal magnesium concentrations, although supplementation with magnesium can increase integration efficiency, and directed evolution is being employed to overcome these barriers. Finally, spurred by new methods for expressing group II intron reverse transcriptases that yield large amounts of highly active protein, thermostable group II intron reverse transcriptases from bacterial thermophiles are being used as research tools for a variety of applications, including qRT-PCR and next-generation RNA sequencing (RNA-seq). The high processivity and fidelity of group II intron reverse transcriptases along with their novel template-switching activity, which can directly link RNA-seq adaptor sequences to cDNAs during reverse transcription, open new approaches for RNA-seq and the identification and profiling of non-coding RNAs, with potentially wide applications in research and biotechnology.

CD200/BTLA deletions in pediatric precursor B-cell acute lymphoblastic leukemia treated according to the EORTC-CLG 58951 protocol

PubMed Central

Ghazavi, Farzaneh; Clappier, Emmanuelle; Lammens, Tim; Suciu, Stefan; Caye, Aurélie; Zegrari, Samira; Bakkus, Marleen; Grardel, Nathalie; Benoit, Yves; Bertrand, Yves; Minckes, Odile; Costa, Vitor; Ferster, Alina; Mazingue, Françoise; Plat, Geneviève; Plouvier, Emmanuel; Poirée, Marilyne; Uyttebroeck, Anne; van der Werff-ten Bosch, Jutte; Yakouben, Karima; Helsmoortel, Hetty; Meul, Magali; Van Roy, Nadine; Philippé, Jan; Speleman, Frank; Cavé, Hélène; Van Vlierberghe, Pieter; De Moerloose, Barbara

2015-01-01

DNA copy number analysis has been instrumental for the identification of genetic alterations in B-cell precursor acute lymphoblastic leukemia. Notably, some of these genetic defects have been associated with poor treatment outcome and might be relevant for future risk stratification. In this study, we characterized recurrent deletions of CD200 and BTLA genes, mediated by recombination-activating genes, and used breakpoint-specific polymerase chain reaction assay to screen a cohort of 1154 cases of B-cell precursor acute lymphoblastic leukemia uniformly treated according to the EORTC-CLG 58951 protocol. CD200/BTLA deletions were identified in 56 of the patients (4.8%) and were associated with an inferior 8-year event free survival in this treatment protocol [70.2% ± 1.2% for patients with deletions versus 83.5% ± 6.4% for non-deleted cases (hazard ratio 2.02; 95% confidence interval 1.23–3.32; P=0.005)]. Genetically, CD200/BTLA deletions were strongly associated with ETV6-RUNX1-positive leukemias (P<0.0001), but were also identified in patients who did not have any genetic abnormality that is currently used for risk stratification. Within the latter population of patients, the presence of CD200/BTLA deletions was associated with inferior event-free survival and overall survival. Moreover, the multivariate Cox model indicated that these deletions had independent prognostic impact on event-free survival when adjusting for conventional risk criteria. All together, these findings further underscore the rationale for copy number profiling as an important tool for risk stratification in human B-cell precursor acute lymphoblastic leukemia. This trial was registered at www.ClinicalTrials.gov as #NCT00003728. PMID:26137961

CD200/BTLA deletions in pediatric precursor B-cell acute lymphoblastic leukemia treated according to the EORTC-CLG 58951 protocol.

PubMed

Ghazavi, Farzaneh; Clappier, Emmanuelle; Lammens, Tim; Suciu, Stefan; Caye, Aurélie; Zegrari, Samira; Bakkus, Marleen; Grardel, Nathalie; Benoit, Yves; Bertrand, Yves; Minckes, Odile; Costa, Vitor; Ferster, Alina; Mazingue, Françoise; Plat, Geneviève; Plouvier, Emmanuel; Poirée, Marilyne; Uyttebroeck, Anne; van der Werff-Ten Bosch, Jutte; Yakouben, Karima; Helsmoortel, Hetty; Meul, Magali; Van Roy, Nadine; Philippé, Jan; Speleman, Frank; Cavé, Hélène; Van Vlierberghe, Pieter; De Moerloose, Barbara

2015-10-01

DNA copy number analysis has been instrumental for the identification of genetic alterations in B-cell precursor acute lymphoblastic leukemia. Notably, some of these genetic defects have been associated with poor treatment outcome and might be relevant for future risk stratification. In this study, we characterized recurrent deletions of CD200 and BTLA genes, mediated by recombination-activating genes, and used breakpoint-specific polymerase chain reaction assay to screen a cohort of 1154 cases of B-cell precursor acute lymphoblastic leukemia uniformly treated according to the EORTC-CLG 58951 protocol. CD200/BTLA deletions were identified in 56 of the patients (4.8%) and were associated with an inferior 8-year event free survival in this treatment protocol [70.2% ± 1.2% for patients with deletions versus 83.5% ± 6.4% for non-deleted cases (hazard ratio 2.02; 95% confidence interval 1.23-3.32; P=0.005)]. Genetically, CD200/BTLA deletions were strongly associated with ETV6-RUNX1-positive leukemias (P<0.0001), but were also identified in patients who did not have any genetic abnormality that is currently used for risk stratification. Within the latter population of patients, the presence of CD200/BTLA deletions was associated with inferior event-free survival and overall survival. Moreover, the multivariate Cox model indicated that these deletions had independent prognostic impact on event-free survival when adjusting for conventional risk criteria. All together, these findings further underscore the rationale for copy number profiling as an important tool for risk stratification in human B-cell precursor acute lymphoblastic leukemia. This trial was registered at www.ClinicalTrials.gov as #NCT00003728. Copyright© Ferrata Storti Foundation.

Genetic studies of Prader-Willi patients provide evidence for conservation of genomic architecture in proximal chromosome 15q.

PubMed

Hou, Aihua; Lin, Shuan-Pei; Ho, Shi Yun; Chen, Chi-Fung Jennifer; Lin, Hsiang-Yu; Chen, Yen-Juin; Huang, Chi-Yu; Chiu, Huei-Ching; Chuang, Chih-Kuang; Chen, Ken-Shiung

2011-03-01

Prader-Willi syndrome (PWS) is a neurogenetic disorder associated with recurrent genomic recombination involving low copy repeats (LCRs) located in the human chromosome 15q11-q13. Previous studies of PWS patients from Asia suggested that there is a higher incidence of deletion and lower incidence of maternal uniparental disomy (mUPD) compared to that of Western populations. In this report, we present genetic etiology of 28 PWS patients from Taiwan. Consistent with the genetic etiology findings from Western populations, the type II deletion appears to be the most common deletion subtype. Furthermore, the ratio of the two most common deletion subtypes and the ratio of the maternal heterodisomy to isodisomy cases observed from this study are in agreement with previous findings from Western populations. In addition, we identified and further mapped the deletion breakpoints in two patients with atypical deletions using array CGH (comparative genomic hybridization). Despite the relatively small numbers of patients in each subgroup, our findings suggest that the genomic architecture responsible for the recurrent recombination in PWS is conserved in Taiwanese of the Han Chinese heritage and Western populations, thereby predisposing chromosome 15q11-q13 to a similar risk of rearrangements. © 2010 The Authors Annals of Human Genetics © 2010 Blackwell Publishing Ltd/University College London.

Virulence Phenotypes of Legionella pneumophila Associated with Noncoding RNA lpr0035

PubMed Central

Jayakumar, Deepak; Early, Julie V.

2012-01-01

The Philadelphia-1 strain of Legionella pneumophila, the causative organism of Legionnaires' disease, contains a recently discovered noncoding RNA, lpr0035. lpr0035 straddles the 5′ chromosomal junction of a 45-kbp mobile genetic element, pLP45, which can exist as an episome or integrated in the bacterial chromosome. A 121-bp deletion was introduced in strain JR32, a Philadelphia-1 derivative. The deletion inactivated lpr0035, removed the 49-bp direct repeat at the 5′ junction of pLP45, and locked pLP45 in the chromosome. Intracellular multiplication of the deletion mutant was decreased by nearly 3 orders of magnitude in Acanthamoeba castellanii amoebae and nearly 2 orders of magnitude in J774 mouse macrophages. Entry of the deletion mutant into amoebae and macrophages was decreased by >70%. The level of entry in both hosts was restored to that in strain JR32 by plasmid copies of two open reading frames immediately downstream of the 5′ junction and plasmid lpr0035 driven by its endogenous promoter. When induced from a tac promoter, plasmid lpr0035 completely reversed the intracellular multiplication defect in macrophages but was without effect in amoebae. These data are the first evidence of a role for noncoding RNA lpr0035, which has homologs in six other Legionella genomes, in entry of L. pneumophila into amoebae and macrophages and in host-specific intracellular multiplication. The data also demonstrate that deletion of a direct-repeat sequence restricts the mobility of pLP45 and is a means of studying the role of pLP45 mobility in Legionella virulence phenotypes. PMID:22966048

Procainamide Is a Specific Inhibitor of DNA Methyltransferase 1*

PubMed Central

Lee, Byron H.; Yegnasubramanian, Srinivasan; Lin, Xiaohui; Nelson, William G.

2007-01-01

CpG island hypermethylation occurs in most cases of cancer, typically resulting in the transcriptional silencing of critical cancer genes. Procainamide has been shown to inhibit DNA methyltransferase activity and reactivate silenced gene expression in cancer cells by reversing CpG island hypermethylation. We report here that procainamide specifically inhibits the hemimethylase activity of DNA methyltransferase 1 (DNMT1), the mammalian enzyme thought to be responsible for maintaining DNA methylation patterns during replication. At micromolar concentrations, procainamide was found to be a partial competitive inhibitor of DNMT1, reducing the affinity of the enzyme for its two substrates, hemimethylated DNA and S-adenosyl-l-methionine. By doing so, procainamide significantly decreased the processivity of DNMT1 on hemimethylated DNA. Procainamide was not a potent inhibitor of the de novo methyltransferases DNMT3a and DNMT3b2. As further evidence of the specificity of procainamide for DNMT1, procainamide failed to lower genomic 5-methyl-2′-deoxycytidine levels in HCT116 colorectal cancer cells when DNMT1 was genetically deleted but significantly reduced genomic 5-methyl-2′-deoxycyti-dine content in parental HCT116 cells and in HCT116 cells where DNMT3b was genetically deleted. Because many reports have strongly linked DNMT1 with epigenetic alterations in carcinogenesis, procainamide may be a useful drug in the prevention of cancer. PMID:16230360

Genetic Alterations of RDINK4/ARF Enhancer in Human Cancer Cells

PubMed Central

Li, Junan; Knobloch, Thomas J.; Poi, Ming J.; Zhang, Zhaoxia; Davis, Andrew T.; Muscarella, Peter; Weghorst, Christopher M.

2017-01-01

Recent identification of an enhancer element, RDINK4/ARF (RD), in the prominent INK4/ARF locus provides a novel mechanism to simultaneously regulate the transcription of p15INK4B (p15), p14ARF, and p16INK4A (p16) tumor suppressor genes. While genetic inactivation of p15, p14ARF, and p16 in human tumors has been extensively studied, little is known about genetic alterations of RD and its impact on p15, p14ARF, and p16 in human cancer. The purpose of this study was to investigate the potential existence of genetic alterations of RD in human cancer cells. DNAs extracted from 17 different cancer cell lines and 31 primary pheochromocytoma tumors were analyzed for deletion and mutation of RD using qPCR and direct DNA sequencing. We found that RD was deleted in human cancer cell lines and pheochromocytoma tumors at frequencies of 41.2% (7/17) and 13.0% (4/31), respectively. While some of these RD deletion events occurred along with deletions of the entire INK4/ARF locus, other RD deletion events were independent of genetic alterations in p15, p14ARF, and p16. Furthermore, the status of RD was poorly associated with the expression of p15, p14ARF, and p16 in tested cancer cell lines and tumors. This study demonstrates for the first time that deletion of the RD enhancer is a prevalent event in human cancer cells. Its implication in carcinogenesis remains to be further explored. PMID:23065809

Role of a Ferredoxin Gene Cotranscribed with the nifHDK Operon in N2 Fixation and Nitrogenase “Switch-Off” of Azoarcus sp. Strain BH72

PubMed Central

Egener, Tanja; Martin, Dietmar E.; Sarkar, Abhijit; Reinhold-Hurek, Barbara

2001-01-01

The endophytic diazotroph Azoarcus sp. strain BH72 is capable of infecting rice roots and of expressing the nitrogenase (nif) genes there. In order to study the genetic background for nitrogen fixation in strain BH72, the structural genes of nitrogenase (nifHDK) were cloned and sequenced. The sequence analysis revealed an unusual gene organization: downstream of nifHDK, a ferredoxin gene (fdxN; 59% amino acid sequence identity to R. capsulatus FdxN) and open reading frames showing 52 and 36% amino acid sequence identity to nifY of Pseudomonas stutzeri A15 and ORF1 of Azotobacter vinelandii were located. Northern blot analysis, reverse transcriptase PCR and primer extension analysis revealed that these six genes are located on one transcript transcribed from a ς54-type promoter. Shorter transcripts sequentially missing genes of the 3′ part of the full-length mRNA were more abundantly detected. Mutational analyses suggested that FdxN is an important but not the essential electron donor for dinitrogenase reductase. An in-frame deletion of fdxN resulted in reduced growth rates (59% ± 9%) and nitrogenase activities (81%) in nitrogen-fixing pure cultures in comparison to the wild type. Nitrogenase activity was fully complemented in an fdxN mutant which carried a nifH promoter-driven fdxN gene in trans. Also, in coculture with the ascomycete Acremonium alternatum, where strain BH72 develops intracytoplasmic membrane stacks, the nitrogenase activity in the fdxN deletion mutant was decreased to 56% of the wild-type level. Surprisingly, the fdxN deletion also had an effect on the rapid “switch-off” of nitrogenase activity in response to ammonium. Wild-type strain BH72 and the deletion mutant complemented with fdxN in trans showed a rapid reversible inactivation of acetylene reduction, while the deletion mutant did not cease to reduce acetylene. In concordance with the hypothesis that changes in the redox state of NifH or electron flux towards nitrogenase may be involved in the mechanism of physiological nitrogenase switch-off, our results suggest that the ferredoxin may be a component involved in this process. PMID:11371540

Genetic differentiation and forensic efficiency evaluation for Chinese Salar ethnic minority based on a 5-dye multiplex insertion and deletion panel.

PubMed

Ma, Ruilin; Shen, Chunmei; Wei, Yuanyuan; Jin, Xiaoye; Guo, Yuxin; Mu, Yuling; Sun, Siqi; Chen, Chong; Cui, Wei; Wei, Zhaoming; Lian, Zhenmin

2018-06-20

The present study investigated the genetic diversities of 30 autosomal insertion and deletion (InDel) loci of Investigator DIPplex kit (Qiagen) in Chinese Salar ethnic minority and explored the genetic relationships between the studied Salar group and other populations. The allelic frequencies of deletion alleles at the 30 InDel loci were in the range of 0.1739 (HLD64) to 0.8478 (HLD39). The discrimination power, polymorphism information content and probability of exclusion ranged from 0.4101 (HLD39) to 0.6447 (HLD136), 0.2247 (HLD39) to 0.3750 (HLD92) and 0.0400 (HLD39) to 0.2806 (HLD92), respectively. The observed and expected heterozygosity were in the range of 0.2348 (HLD39) to 0.5913 (HLD92), and 0.2580 (HLD39) to 0.5000 (HLD92), respectively. The cumulative discrimination power and probability of exclusion of the 30 loci reached 0.999999999993418 and 0.99039, respectively. The results of population genetic differentiation comparisons revealed that Salar group had similar allele distributions with Qinghai Tibetan, Xibe and Yi groups. Population Bayesian cluster analysis showed that there were similar ancestry components between Salar group and most Chinese populations. Besides, the principal components analysis and phylogenetic reconstructions further indicated that Salar group had intimate genetic relationships with Qinghai Tibetan and Xibe groups. In short, the results of the current studies indicated the genetic distributions of the 30 InDel loci in Salar group were relatively high genetic polymorphisms, which could be used in forensic individual identifications and as a supplementary tool for complex paternity testing. Copyright © 2018 Elsevier B.V. All rights reserved.

Disinfection by-products exposure and intra-uterine growth restriction: Do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced foetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. Copyright © 2016 Elsevier Ltd. All rights reserved.

Disinfection by-products exposure and intra-uterine growth restriction: do genetic polymorphisms of CYP2E1or deletion of GSTM1 or GSTT1 modify the association?

PubMed Central

Levallois, Patrick; Giguère, Yves; Nguile-Makao, Molière; Rodriguez, Manuel; Campagna, Céline; Tardif, Robert; Bureau, Alexandre

2016-01-01

Background Exposure to disinfection by-products (DBPs) during pregnancy was associated with reduced fetal growth. Genetic susceptibility might play a role, especially for genes encoding for the Cytochrome P450 (CYP2E1) and Glutathione S-Transferase (GST) enzymes, involved in metabolism and activation of DBPs. Few epidemiological studies evaluated these gene-environment interactions and their results were never replicated. Objective This study aims to examine interactions between trihalomethanes (THM) or haloacetic acids (HAA) exposure and genetic polymorphisms on small for gestational age (SGA) neonates by investigating single nucleotide polymorphisms (SNPs) in CYP2E1 gene and GSTM1 and GSTT1 deletions in mothers-children pairs. Methods A population-based case-control study of 1549 mothers and 1455 children was conducted on SGA and THM/HAA exposure. DNA was extracted from blood or saliva cells. Targeted SNPs and deletions were genotyped. Statistical interaction between SNPs/deletions and THMs or HAAs in utero exposure with regard to SGA occurrence was evaluated by unconditional logistic regression with control of potential confounders. Results Previously reported positive modification of the effect of THM uterine exposure by mothers or newborns CYP2E1 rs3813867 C allele or GSTM1 deletion was not replicated. However interactions with CYP2E1 rs117618383 and rs2515641 were observed but were not statistically significant after correction for multiple testing. Conclusions Previous positive interactions between THMs exposure and CYP2E1 and GSTM1 were not replicated but interactions with other CYP2E1 polymorphisms are reported. PMID:27107227

Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy.

PubMed

Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo; Xu, Ge-Zhi

2017-01-01

Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. We identified two novel heterozygous deletion mutations [ LRP5 , c.4053 DelC (p.Ile1351IlefsX88); TSPAN12 , EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype-phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling.

Targeted next-generation sequencing analysis identifies novel mutations in families with severe familial exudative vitreoretinopathy

PubMed Central

Huang, Xiao-Yan; Zhuang, Hong; Wu, Ji-Hong; Li, Jian-Kang; Hu, Fang-Yuan; Zheng, Yu; Tellier, Laurent Christian Asker M.; Zhang, Sheng-Hai; Gao, Feng-Juan; Zhang, Jian-Guo

2017-01-01

Purpose Familial exudative vitreoretinopathy (FEVR) is a genetically and clinically heterogeneous disease, characterized by failure of vascular development of the peripheral retina. The symptoms of FEVR vary widely among patients in the same family, and even between the two eyes of a given patient. This study was designed to identify the genetic defect in a patient cohort of ten Chinese families with a definitive diagnosis of FEVR. Methods To identify the causative gene, next-generation sequencing (NGS)-based target capture sequencing was performed. Segregation analysis of the candidate variant was performed in additional family members by using Sanger sequencing and quantitative real-time PCR (QPCR). Results Of the cohort of ten FEVR families, six pathogenic variants were identified, including four novel and two known heterozygous mutations. Of the variants identified, four were missense variants, and two were novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del]. The two novel heterozygous deletion mutations were not observed in the control subjects and could give rise to a relatively severe FEVR phenotype, which could be explained by the protein function prediction. Conclusions We identified two novel heterozygous deletion mutations [LRP5, c.4053 DelC (p.Ile1351IlefsX88); TSPAN12, EX8Del] using targeted NGS as a causative mutation for FEVR. These genetic deletion variations exhibit a severe form of FEVR, with tractional retinal detachments compared with other known point mutations. The data further enrich the mutation spectrum of FEVR and enhance our understanding of genotype–phenotype correlations to provide useful information for disease diagnosis, prognosis, and effective genetic counseling. PMID:28867931

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

Genetics Home Reference: distal 18q deletion syndrome

MedlinePlus

... Veltman JA, van Ravenswaaij-Arts CM. Genotype-phenotype mapping of chromosome 18q deletions by high-resolution array ... L, Pihko H. 18q deletions: clinical, molecular, and brain MRI findings of 14 individuals. Am J Med ...

Islet xenotransplantation from genetically engineered pigs.

PubMed

Nagaraju, Santosh; Bottino, Rita; Wijkstrom, Martin; Hara, Hidetaka; Trucco, Massimo; Cooper, David K C

2013-12-01

Pigs have emerged as potential sources of islets for clinical transplantation. Wild-type porcine islets (adult and neonatal) transplanted into the portal vein have successfully reversed diabetes in nonhuman primates. However, there is a rapid loss of the transplanted islets on exposure to blood, known as the instant blood-mediated inflammatory reaction (IBMIR), as well as a T-cell response that leads to rejection of the graft. Genetically modified pig islets offer a number of potential advantages, particularly with regard to reducing the IBMIR-related graft loss and protecting the islets from the primate immune response. Emerging data indicate that transgenes specifically targeted to pig β cells using an insulin promoter (in order to maximize target tissue expression while limiting host effects) can be achieved without significant effects on the pig's glucose metabolism. Experience with the transplantation of islets from genetically engineered pigs into nonhuman primates is steadily increasing, and has involved the deletion of pig antigenic targets to reduce the primate humoral response, the expression of transgenes for human complement-regulatory and coagulation-regulatory proteins, and manipulations to reduce the effect of the T-cell response. There is increasing evidence of the advantages of using genetically engineered pigs as sources of islets for future clinical trials.

Siblings with opposite chromosome constitutions, dup(2q)/del(7q) and del(2q)/dup(7q).

PubMed

Shim, Sung Han; Shim, Jae Sun; Min, Kyunghoon; Lee, Hee Song; Park, Ji Eun; Park, Sang Hee; Hwang, Euna; Kim, Minyoung

2014-01-15

Chromosome 7q36 microdeletion syndrome is a rare genomic disorder characterized by underdevelopment of the brain, microcephaly, anomalies of the sex organs, and language problems. Developmental delay, intellectual disability, autistic spectrum disorders, BDMR syndrome, and unusual facial morphology are the key features of the chromosome 2q37 microdeletion syndrome. A genetic screening for two brothers with global developmental delay using high-resolution chromosomal analysis and subtelomeric multiplex ligation-dependent probe amplification revealed subtelomeric rearrangements on the same sites of 2q37.2 and 7q35, with reversed deletion and duplication. Both of them showed dysmorphic facial features, severe disability of physical and intellectual development, and abnormal genitalia with differential abnormalities in their phenotypes. The family did not have abnormal genetic phenotypes. According to the genetic analysis of their parents, adjacent-1 segregation from their mother's was suggested as a mechanism of their gene mutation. By comparing the phenotypes of our patients with previous reports on similar patients, we tried to obtain the information of related genes and their chromosomal locations. © 2013.

The behavioural consequences of sex reversal in dragons

PubMed Central

Li, Hong; Holleley, Clare E.; Elphick, Melanie; Georges, Arthur

2016-01-01

Sex differences in morphology, physiology, and behaviour are caused by sex-linked genes, as well as by circulating sex-steroid levels. Thus, a shift from genotypic to environmental sex determination may create an organism that exhibits a mixture of male-like and female-like traits. We studied a lizard species (Central Bearded Dragon, Pogona vitticeps), in which the high-temperature incubation of eggs transforms genetically male individuals into functional females. Although they are reproductively female, sex-reversed dragons (individuals with ZZ genotype reversed to female phenotype) resemble genetic males rather than females in morphology (relative tail length), general behaviour (boldness and activity level), and thermoregulatory tactics. Indeed, sex-reversed ‘females’ are more male-like in some behavioural traits than are genetic males. This novel phenotype may impose strong selection on the frequency of sex reversal within natural populations, facilitating rapid shifts in sex-determining systems. A single period of high incubation temperatures (generating thermally induced sex reversal) can produce functionally female individuals with male-like (or novel) traits that enhance individual fitness, allowing the new temperature-dependent sex-determining system to rapidly replace the previous genetically based one.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

PubMed

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Development of a Markerless Genetic Exchange System in Desulfovibrio vulgaris Hildenborough and Its Use in Generating a Strain with Increased Transformation Efficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keller, Kimberly L.; Bender, Kelly S.; Wall, Judy D.

2009-07-21

In recent years, the genetic manipulation of the sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough has seen enormous progress. In spite of this progress, the current marker exchange deletion method does not allow for easy selection of multiple sequential gene deletions in a single strain because of the limited number of selectable markers available in D. vulgaris. To broaden the repertoire of genetic tools for manipulation, an in-frame, markerless deletion system has been developed. The counterselectable marker that makes this deletion system possible is the pyrimidine salvage enzyme, uracil phosphoribosyltransferase, encoded by upp. In wild-type D. vulgaris, growth was shown to bemore » inhibited by the toxic pyrimidine analog 5-fluorouracil (5-FU); whereas, a mutant bearing a deletion of the upp gene was resistant to 5-FU. When a plasmid containing the wild-type upp gene expressed constitutively from the aph(3')-II promoter (promoter for the kanamycin resistance gene in Tn5) was introduced into the upp deletion strain, sensitivity to 5-FU was restored. This observation allowed us to develop a two-step integration and excision strategy for the deletion of genes of interest. Since this inframe deletion strategy does not retain an antibiotic cassette, multiple deletions can be generated in a single strain without the accumulation of genes conferring antibiotic resistances. We used this strategy to generate a deletion strain lacking the endonuclease (hsdR, DVU1703) of a type I restriction-modification system, that we designated JW7035. The transformation efficiency of the JW7035 strain was found to be 100 to 1000 times greater than that of the wild-type strain when stable plasmids were introduced via electroporation.« less

Meta-analysis confirms the LCE3C_LCE3B deletion as a risk factor for psoriasis in several ethnic groups and finds interaction with HLA-Cw6

PubMed Central

Riveira-Munoz, Eva; He, Su-Min; Escaramís, Georgia; Stuart, Philip E; Hüffmeier, Ulrike; Lee, Catherine; Kirby, Brian; Oka, Akira; Giardina, Emiliano; Liao, Wilson; Bergboer, Judith; Kainu, Kati; de Cid, Rafael; Munkhbat, Batmunkh; Zeeuwen, Patrick L J M; Armour, John A L; Poon, Annie; Mabuchi, Tomotaka; Ozawa, Akira; Zawirska, Agnieszka; Burden, David A; Barker, Jonathan N; Capon, Francesca; Traupe, Heiko; Sun, Liang-Dan; Cui, Yong; Yin, Xian-Yong; Chen, Gang; Lim, Henry; Nair, Rajan; Voorhess, John; Tejasvi, Trilokraj; Pujol, Ramón; Munkhtuvshin, Namid; Fischer, Judith; Kere, Juha; Schalkwijk, Joost; Bowcock, Anne; Kwok, Pui-Yan; Novelli, Giuseppe; Inoko, Hidetoshi; Ryan, Anthony W; Trembath, Richard C; Reis, André; Zhang, Xue-Jun; Elder, James T; Estivill, Xavier

2012-01-01

A multicenter meta-analysis including data from 9389 psoriasis patients and 9477 control subjects was performed to investigate the contribution of the deletion of genes LCE3C and LCE3B, involved in skin barrier defense, to psoriasis susceptibility in different populations. The study confirms that the deletion of LCE3C and LCE3B is a common genetic factor for susceptibility to psoriasis in European populations [OROverall = 1.21 (1.15–1.27)], and for the first time directly demonstrated the deletion's association with psoriasis in [Chinese OR = 1.27 (1.16–1.34); Mongolian OR = 2.08 (1.44–2.99)] populations. The analysis of the HLA-Cw6 locus showed significant differences in the epistatic interaction with the LCE3C and LCE3B deletion in at least some European populations, indicating epistatic effects between these two major genetic contributors to psoriasis. The study highlights the value of examining genetic risk factors in multiple populations to identify genetic interactions, and indicates the need of further studies to understand the interaction of the skin barrier and the immune system in susceptibility to psoriasis. PMID:21107349

Cytogenetic and molecular characterization of 57 individuals with the Parder-Willi syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butler, M.G.; Forrest, K.B.; Miller, L.K.

Prader-Willi syndrome (PWS) is characterized by hypotonia, early childhood obesity, mental deficiency, hypogonadism and an interstitial deletion of 15q11q13 of paternal origin in 50-70% of patients. The remaining patients have either submicroscopic deletions, maternal disomy or other anomalies of chromosome 15. We have undertaken cytogenetic and molecular genetic studies of 57 individuals presenting with features consistent with PWS (28 males and 29 females; age range of 3 months to 38 years), 25 with recognizable 15q11q13 deletions (44%), 28 with normal appearing chromosomes (49%), and four patients with other chromosome 15 anomalies (7%). High resolution chromosome analysis and PCR amplification weremore » performed utilizing 17 STRs from 15q11q13 region, quantitative Southern hybridization using seven 15q11q13 probes, and fluorescence in situ hybridization (FISH) using four 15q11q13 probes (4-3R, SNRPN, 3-21, and GABRB3). The cytogenetic deletion was paternal in all PWS families studied but the deletion varied in size in 10 patients. Parental DNA studies from 20 of 28 non-deletion patients showed maternal disomy in 7 patients and biparental inheritance in 13 non-deletion patients. In order to evaluate for submicroscopic deletions, PCR amplification with several loci in the area of the PWS minimal critical region, FISH using SNRPN and quantitative hybridization using a PCR product generated from primers of exons E and H of the SNRPN gene were undertaken on the non-deletion patients. Quantitative hybridization and FISH using SNRPN from 3 of 11 non-deletion patients (excluding maternal disomy cases) showed a submicroscopic deletion. One of these patients also showed a paternal deletion of D15S128 and MN1. We furthur support the use of both cytogenetic and molecular genetic methods for determining the genetic status of PWS patients.« less

Overexpression and deletion of phospholipid transfer protein reduce HDL mass and cholesterol efflux capacity but not macrophage reverse cholesterol transport[S

PubMed Central

Kuwano, Takashi; Bi, Xin; Cipollari, Eleonora; Yasuda, Tomoyuki; Lagor, William R.; Szapary, Hannah J.; Tohyama, Junichiro; Millar, John S.; Billheimer, Jeffrey T.; Lyssenko, Nicholas N.; Rader, Daniel J.

2017-01-01

Phospholipid transfer protein (PLTP) may affect macrophage reverse cholesterol transport (mRCT) through its role in the metabolism of HDL. Ex vivo cholesterol efflux capacity and in vivo mRCT were assessed in PLTP deletion and PLTP overexpression mice. PLTP deletion mice had reduced HDL mass and cholesterol efflux capacity, but unchanged in vivo mRCT. To directly compare the effects of PLTP overexpression and deletion on mRCT, human PLTP was overexpressed in the liver of wild-type animals using an adeno-associated viral (AAV) vector, and control and PLTP deletion animals were injected with AAV-null. PLTP overexpression and deletion reduced plasma HDL mass and cholesterol efflux capacity. Both substantially decreased ABCA1-independent cholesterol efflux, whereas ABCA1-dependent cholesterol efflux remained the same or increased, even though preβ HDL levels were lower. Neither PLTP overexpression nor deletion affected excretion of macrophage-derived radiocholesterol in the in vivo mRCT assay. The ex vivo and in vivo assays were modified to gauge the rate of cholesterol efflux from macrophages to plasma. PLTP activity did not affect this metric. Thus, deviations in PLTP activity from the wild-type level reduce HDL mass and ex vivo cholesterol efflux capacity, but not the rate of macrophage cholesterol efflux to plasma or in vivo mRCT. PMID:28137768

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis

PubMed Central

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-01-01

Background Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, ~4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. Results As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. Conclusion We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s). PMID:19055778

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis.

PubMed

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-12-03

Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, approximately 4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s).

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

FitSearch: a robust way to interpret a yeast fitness profile in terms of drug's mode-of-action.

PubMed

Lee, Minho; Han, Sangjo; Chang, Hyeshik; Kwak, Youn-Sig; Weller, David M; Kim, Dongsup

2013-01-01

Yeast deletion-mutant collections have been successfully used to infer the mode-of-action of drugs especially by profiling chemical-genetic and genetic-genetic interactions on a genome-wide scale. Although tens of thousands of those profiles are publicly available, a lack of an accurate method for mining such data has been a major bottleneck for more widespread use of these useful resources. For general usage of those public resources, we designed FitRankDB as a general repository of fitness profiles, and developed a new search algorithm, FitSearch, for identifying the profiles that have a high similarity score with statistical significance for a given fitness profile. We demonstrated that our new repository and algorithm are highly beneficial to researchers who attempting to make hypotheses based on unknown modes-of-action of bioactive compounds, regardless of the types of experiments that have been performed using yeast deletion-mutant collection in various types of different measurement platforms, especially non-chip-based platforms. We showed that our new database and algorithm are useful when attempting to construct a hypothesis regarding the unknown function of a bioactive compound through small-scale experiments with a yeast deletion collection in a platform independent manner. The FitRankDB and FitSearch enhance the ease of searching public yeast fitness profiles and obtaining insights into unknown mechanisms of action of drugs. FitSearch is freely available at http://fitsearch.kaist.ac.kr.

FitSearch: a robust way to interpret a yeast fitness profile in terms of drug's mode-of-action

PubMed Central

2013-01-01

Background Yeast deletion-mutant collections have been successfully used to infer the mode-of-action of drugs especially by profiling chemical-genetic and genetic-genetic interactions on a genome-wide scale. Although tens of thousands of those profiles are publicly available, a lack of an accurate method for mining such data has been a major bottleneck for more widespread use of these useful resources. Results For general usage of those public resources, we designed FitRankDB as a general repository of fitness profiles, and developed a new search algorithm, FitSearch, for identifying the profiles that have a high similarity score with statistical significance for a given fitness profile. We demonstrated that our new repository and algorithm are highly beneficial to researchers who attempting to make hypotheses based on unknown modes-of-action of bioactive compounds, regardless of the types of experiments that have been performed using yeast deletion-mutant collection in various types of different measurement platforms, especially non-chip-based platforms. Conclusions We showed that our new database and algorithm are useful when attempting to construct a hypothesis regarding the unknown function of a bioactive compound through small-scale experiments with a yeast deletion collection in a platform independent manner. The FitRankDB and FitSearch enhance the ease of searching public yeast fitness profiles and obtaining insights into unknown mechanisms of action of drugs. FitSearch is freely available at http://fitsearch.kaist.ac.kr. PMID:23368702

Genetic Counseling for the 22q11.2 Deletion

ERIC Educational Resources Information Center

McDonald-McGinn, Donna M.; Zackai, Elaine H.

2008-01-01

Because of advances in palliative medical care, children with the 22q11.2 deletion syndrome are surviving into adulthood. An increase in reproductive fitness will likely follow necessitating enhanced access to genetic counseling for these patients and their families. Primary care physicians/obstetric practitioners are in a unique position to…

A symmetry model for genetic coding via a wallpaper group composed of the traditional four bases and an imaginary base E: Towards category theory-like systematization of molecular/genetic biology

PubMed Central

2014-01-01

Background Previously, we suggested prototypal models that describe some clinical states based on group postulates. Here, we demonstrate a group/category theory-like model for molecular/genetic biology as an alternative application of our previous model. Specifically, we focus on deoxyribonucleic acid (DNA) base sequences. Results We construct a wallpaper pattern based on a five-letter cruciform motif with letters C, A, T, G, and E. Whereas the first four letters represent the standard DNA bases, the fifth is introduced for ease in formulating group operations that reproduce insertions and deletions of DNA base sequences. A basic group Z5 = {r, u, d, l, n} of operations is defined for the wallpaper pattern, with which a sequence of points can be generated corresponding to changes of a base in a DNA sequence by following the orbit of a point of the pattern under operations in group Z5. Other manipulations of DNA sequence can be treated using a vector-like notation ‘Dj’ corresponding to a DNA sequence but based on the five-letter base set; also, ‘Dj’s are expressed graphically. Insertions and deletions of a series of letters ‘E’ are admitted to assist in describing DNA recombination. Likewise, a vector-like notation Rj can be constructed for sequences of ribonucleic acid (RNA). The wallpaper group B = {Z5×∞, ●} (an ∞-fold Cartesian product of Z5) acts on Dj (or Rj) yielding changes to Dj (or Rj) denoted by ‘Dj◦B(j→k) = Dk’ (or ‘Rj◦B(j→k) = Rk’). Based on the operations of this group, two types of groups—a modulo 5 linear group and a rotational group over the Gaussian plane, acting on the five bases—are linked as parts of the wallpaper group for broader applications. As a result, changes, insertions/deletions and DNA (RNA) recombination (partial/total conversion) are described. As an exploratory study, a notation for the canonical “central dogma” via a category theory-like way is presented for future developments. Conclusions Despite the large incompleteness of our methodology, there is fertile ground to consider a symmetry model for genetic coding based on our specific wallpaper group. A more integrated formulation containing “central dogma” for future molecular/genetic biology remains to be explored. PMID:24885369

Genetic subtype differences in neural circuitry of food motivation in Prader-Willi syndrome.

PubMed

Holsen, L M; Zarcone, J R; Chambers, R; Butler, M G; Bittel, D C; Brooks, W M; Thompson, T I; Savage, C R

2009-02-01

Differences in behavioral phenotypes between the two most common subtypes of Prader-Willi syndrome (PWS) (chromosome 15q deletions and maternal uniparental disomy 15 (UPD) indicate that distinct neural networks may be affected. Though both subtypes display hyperphagia, the deletion subgroup shows reduced behavioral inhibition around food, whereas those with UPD are generally more able to maintain cognitive control over food intake impulses. To examine the neural basis of phenotypic differences to better understand relationships between genetic subtypes and behavioral outcomes. We predicted greater food motivation circuitry activity in the deletion subtype and greater activity in higher order cognitive regions in the UPD group, especially after eating. Nine individuals with PWS due to UPD and nine individuals with PWS due to (type 2) deletion, matched for age, gender and body mass index, underwent functional magnetic resonance imaging (fMRI) while viewing food images during two food motivation states: one before (pre-meal) and one after (post-meal) eating a standardized 500 kcal meal. Both PWS subgroups showed greater activity in response to food pre- and post-meal compared with the healthy-weight group. Compared with UPD, the deletion subtype showed increased food motivation network activation both pre- and post-meal, especially in the medial prefrontal cortex (mPFC) and amygdala. In contrast, the UPD group showed greater activation than the deletion subtype post-meal in the dorsolateral prefrontal cortex (DLPFC) and parahippocampal gyrus (PHG). These preliminary findings are the first functional neuroimaging findings to support divergent neural mechanisms associated with behavioral phenotypes in genetic subtypes of PWS. Results are discussed within the framework of genetic mechanisms such as haploinsufficiency and gene dosage effects and their differential influence on deletion and UPD subtypes, respectively.

Population genetic structure analysis and forensic evaluation of Xinjiang Uigur ethnic group on genomic deletion and insertion polymorphisms.

PubMed

Mei, Ting; Shen, Chun-Mei; Liu, Yao-Shun; Meng, Hao-Tian; Zhang, Yu-Dang; Guo, Yu-Xin; Dong, Qian; Wang, Xin-Xin; Yan, Jiang-Wei; Zhu, Bo-Feng; Zhang, Li-Ping

2016-01-01

The Uigur ethnic minority is the largest ethnic group in the Xinjiang Uygur Autonomous Region of China, and valuable resource for the study of ethnogeny. The objective of this study was to estimate the genetic diversities and forensic parameters of 30 insertion-deletion loci in Uigur ethnic group from Xinjiang Uigur Autonomous Region of China and to analyze the genetic relationships between Xinjiang Uigur group and other previously published groups based on population data of these loci. All the tested loci were conformed to Hardy-Weinberg equilibrium after Bonferroni correction. The observed and expected heterozygosity ranged from 0.3750 to 0.5515; and 0.4057 to 0.5037, respectively. The combined power of discrimination and probability of exclusion in the group were 0.99999999999940 and 0.9963, respectively. We analyzed the D A distance, interpopulation differentiations and population structure, conducted principal component analysis and neighbor-joining tree based on our studied group and 21 reference groups. The present results indicated that the studied Xinjiang Uigur group (represented our samples from the whole territory of Xinjiang Uigur Autonomous Region) had a close relationships with Urumchi Uigur (represented previously reported samples from Urumchi of Xinjiang) and Kazak groups. The present study may provide novel biological information for the study of population genetics, and can also increase our understanding of the genetic relationships between Xinjiang Uigur group and other groups.

A Blind Reversible Robust Watermarking Scheme for Relational Databases

PubMed Central

Chang, Chin-Chen; Nguyen, Thai-Son; Lin, Chia-Chen

2013-01-01

Protecting the ownership and controlling the copies of digital data have become very important issues in Internet-based applications. Reversible watermark technology allows the distortion-free recovery of relational databases after the embedded watermark data are detected or verified. In this paper, we propose a new, blind, reversible, robust watermarking scheme that can be used to provide proof of ownership for the owner of a relational database. In the proposed scheme, a reversible data-embedding algorithm, which is referred to as “histogram shifting of adjacent pixel difference” (APD), is used to obtain reversibility. The proposed scheme can detect successfully 100% of the embedded watermark data, even if as much as 80% of the watermarked relational database is altered. Our extensive analysis and experimental results show that the proposed scheme is robust against a variety of data attacks, for example, alteration attacks, deletion attacks, mix-match attacks, and sorting attacks. PMID:24223033

A blind reversible robust watermarking scheme for relational databases.

PubMed

Chang, Chin-Chen; Nguyen, Thai-Son; Lin, Chia-Chen

2013-01-01

Protecting the ownership and controlling the copies of digital data have become very important issues in Internet-based applications. Reversible watermark technology allows the distortion-free recovery of relational databases after the embedded watermark data are detected or verified. In this paper, we propose a new, blind, reversible, robust watermarking scheme that can be used to provide proof of ownership for the owner of a relational database. In the proposed scheme, a reversible data-embedding algorithm, which is referred to as "histogram shifting of adjacent pixel difference" (APD), is used to obtain reversibility. The proposed scheme can detect successfully 100% of the embedded watermark data, even if as much as 80% of the watermarked relational database is altered. Our extensive analysis and experimental results show that the proposed scheme is robust against a variety of data attacks, for example, alteration attacks, deletion attacks, mix-match attacks, and sorting attacks.

Chromosome-specific staining to detect genetic rearrangements associated with chromosome 3 and/or chromosome 17

DOEpatents

Gray, Joe W.; Pinkel, Daniel; Kallioniemi, Olli-Pekka; Kallioniemi, Anne; Sakamoto, Masaru

2009-10-06

Methods and compositions for staining based upon nucleic acid sequence that employ nudeic nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML), retinoblastoma, ovarian and uterine cancers, and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

Identification of rare and novel deletions that cause (δβ)0-thalassaemia and hereditary persistence of foetal haemoglobin in Indian population.

PubMed

Mayuranathan, Thiyagaraj; Rayabaram, Janakiram; Das, Reena; Arora, Neeraj; Edison, Eunice S; Chandy, Mammen; Srivastava, Alok; Velayudhan, Shaji R

2014-06-01

Hereditary persistence of foetal haemoglobin (HPFH) and (δβ)(0) -thalassaemia are conditions caused by large deletions that involve δ- and β-globin genes in the β-globin cluster, and they are characterized by increased haemoglobin (HbF) levels in adults. Significant phenotypic diversity is observed between the different mutations that cause these conditions. Molecular characterization of these deletions is important for accurate molecular diagnosis, and they will also provide the information on the cis-acting genetic regulatory elements present in the β-globin cluster. We performed gap-PCR, multiplex ligation-dependent probe amplification (MLPA), quantitative fluorescent multiplex PCR (QF-MPCR) and DNA sequencing to detect and characterize the deletions in the β-globin cluster. We characterized six different deletions resulting in (δβ)(0) -thalassaemia or HPFH in 51 unrelated families. With the help of multiple genetic tools, we performed comprehensive genetic analysis of HPFH and (δβ)(0) -thalassaemia in Indian population and could define the molecular basis of these conditions in this population. We also identified two novel HPFH mutations, 49.98 kb (HPFH-9) and 86.7 kb (HPFH-10) deletions, in this population. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Copy Number Variation in Fungi and Its Implications for Wine Yeast Genetic Diversity and Adaptation

PubMed Central

Steenwyk, Jacob L.; Rokas, Antonis

2018-01-01

In recent years, copy number (CN) variation has emerged as a new and significant source of genetic polymorphisms contributing to the phenotypic diversity of populations. CN variants are defined as genetic loci that, due to duplication and deletion, vary in their number of copies across individuals in a population. CN variants range in size from 50 base pairs to whole chromosomes, can influence gene activity, and are associated with a wide range of phenotypes in diverse organisms, including the budding yeast Saccharomyces cerevisiae. In this review, we introduce CN variation, discuss the genetic and molecular mechanisms implicated in its generation, how they can contribute to genetic and phenotypic diversity in fungal populations, and consider how CN variants may influence wine yeast adaptation in fermentation-related processes. In particular, we focus on reviewing recent work investigating the contribution of changes in CN of fermentation-related genes in yeast wine strains and offer notable illustrations of such changes, including the high levels of CN variation among the CUP genes, which confer resistance to copper, a metal with fungicidal properties, and the preferential deletion and duplication of the MAL1 and MAL3 loci, respectively, which are responsible for metabolizing maltose and sucrose. Based on the available data, we propose that CN variation is a substantial dimension of yeast genetic diversity that occurs largely independent of single nucleotide polymorphisms. As such, CN variation harbors considerable potential for understanding and manipulating yeast strains in the wine fermentation environment and beyond. PMID:29520259

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

Japanese Wolves are Genetically Divided into Two Groups Based on an 8-Nucleotide Insertion/Deletion within the mtDNA Control Region.

PubMed

Ishiguro, Naotaka; Inoshima, Yasuo; Yanai, Tokuma; Sasaki, Motoki; Matsui, Akira; Kikuchi, Hiroki; Maruyama, Masashi; Hongo, Hitomi; Vostretsov, Yuri E; Gasilin, Viatcheslav; Kosintsev, Pavel A; Quanjia, Chen; Chunxue, Wang

2016-02-01

The mitochondrial DNA (mtDNA) control region (198- to 598-bp) of four ancient Canis specimens (two Canis mandibles, a cranium, and a first phalanx) was examined, and each specimen was genetically identified as Japanese wolf. Two unique nucleotide substitutions, the 78-C insertion and the 482-G deletion, both of which are specific for Japanese wolf, were observed in each sample. Based on the mtDNA sequences analyzed, these four specimens and 10 additional Japanese wolf samples could be classified into two groups- Group A (10 samples) and Group B (4 samples)-which contain or lack an 8-bp insertion/deletion (indel), respectively. Interestingly, three dogs (Akita-b, Kishu 25, and S-husky 102) that each contained Japanese wolf-specific features were also classified into Group A or B based on the 8-bp indel. To determine the origin or ancestor of the Japanese wolf, mtDNA control regions of ancient continental Canis specimens were examined; 84 specimens were from Russia, and 29 were from China. However, none of these 113 specimens contained Japanese wolf-specific sequences. Moreover, none of 426 Japanese modern hunting dogs examined contained these Japanese wolf-specific mtDNA sequences. The mtDNA control region sequences of Groups A and B appeared to be unique to grey wolf and dog populations.

Reverse Genetics Approaches for the Development of Influenza Vaccines

PubMed Central

Nogales, Aitor; Martínez-Sobrido, Luis

2016-01-01

Influenza viruses cause annual seasonal epidemics and occasional pandemics of human respiratory disease. Influenza virus infections represent a serious public health and economic problem, which are most effectively prevented through vaccination. However, influenza viruses undergo continual antigenic variation, which requires either the annual reformulation of seasonal influenza vaccines or the rapid generation of vaccines against potential pandemic virus strains. The segmented nature of influenza virus allows for the reassortment between two or more viruses within a co-infected cell, and this characteristic has also been harnessed in the laboratory to generate reassortant viruses for their use as either inactivated or live-attenuated influenza vaccines. With the implementation of plasmid-based reverse genetics techniques, it is now possible to engineer recombinant influenza viruses entirely from full-length complementary DNA copies of the viral genome by transfection of susceptible cells. These reverse genetics systems have provided investigators with novel and powerful approaches to answer important questions about the biology of influenza viruses, including the function of viral proteins, their interaction with cellular host factors and the mechanisms of influenza virus transmission and pathogenesis. In addition, reverse genetics techniques have allowed the generation of recombinant influenza viruses, providing a powerful technology to develop both inactivated and live-attenuated influenza vaccines. In this review, we will summarize the current knowledge of state-of-the-art, plasmid-based, influenza reverse genetics approaches and their implementation to provide rapid, convenient, safe and more effective influenza inactivated or live-attenuated vaccines. PMID:28025504

Characterization of an Equine α-S2-Casein Variant Due to a 1.3 kb Deletion Spanning Two Coding Exons

PubMed Central

Brinkmann, Julia; Koudelka, Tomas; Keppler, Julia K.; Tholey, Andreas; Schwarz, Karin; Thaller, Georg; Tetens, Jens

2015-01-01

The production and consumption of mare’s milk in Europe has gained importance, mainly based on positive health effects and a lower allergenic potential as compared to cows’ milk. The allergenicity of milk is to a certain extent affected by different genetic variants. In classical dairy species, much research has been conducted into the genetic variability of milk proteins, but the knowledge in horses is scarce. Here, we characterize two major forms of equine αS2-casein arising from genomic 1.3 kb in-frame deletion involving two coding exons, one of which represents an equid specific duplication. Findings at the DNA-level have been verified by cDNA sequencing from horse milk of mares with different genotypes. At the protein-level, we were able to show by SDS-page and in-gel digestion with subsequent LC-MS analysis that both proteins are actually expressed. The comparison with published sequences of other equids revealed that the deletion has probably occurred before the ancestor of present-day asses and zebras diverged from the horse lineage. PMID:26444874

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Regulation of Saccharomyces cerevisiae genetic engineering on the production of acetate esters and higher alcohols during Chinese Baijiu fermentation.

PubMed

Li, Wei; Wang, Jian-Hui; Zhang, Cui-Ying; Ma, Hong-Xia; Xiao, Dong-Guang

2017-06-01

Acetate esters and higher alcohols greatly influence the quality and flavor profiles of Chinese Baijiu (Chinese liquor). Various mutants have been constructed to investigate the interactions of ATF1 overexpression, IAH1 deletion, and BAT2 deletion on the production of acetate esters and higher alcohols. The results showed that the overexpression of ATF1 under the control of the PGK1 promoter with BAT2 and IAH1 double-gene deletion led to a higher production of acetate esters and a lower production of higher alcohols than the overexpression of ATF1 with IAH1 deletion or overexpression of ATF1 with BAT2 deletion. Moreover, deletion of IAH1 in ATF1 overexpression strains effectively increased the production of isobutyl acetate and isoamyl acetate by reducing the hydrolysis of acetate esters. The decline in the production of higher alcohol by the ATF1 overexpression strains with BAT2 deletion is due to the interaction of ATF1 overexpression and BAT2 deletion. Mutants with varying abilities of producing acetate esters and higher alcohols were developed by genetic engineering. These strains have great potential for industrial application.

Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases

PubMed Central

Feschenko, Vladimir V.; Rajman, Luis A.; Lovett, Susan T.

2003-01-01

Rearrangements between tandemly repeated DNA sequences are a common source of genetic instability. Such rearrangements underlie several human genetic diseases. In many organisms, the mismatch-repair (MMR) system functions to stabilize repeats when the repeat unit is short or when sequence imperfections are present between the repeats. We show here that the action of single-stranded DNA (ssDNA) exonucleases plays an additional, important role in stabilizing tandem repeats, independent of their role in MMR. For perfect repeats of ≈100 bp in Escherichia coli that are not susceptible to MMR, exonuclease (Exo)-I, ExoX, and RecJ exonuclease redundantly inhibit deletion. Our data suggest that >90% of potential deletion events are avoided by the combined action of these three exonucleases. Imperfect tandem repeats, less prone to rearrangements, are stabilized by both the MMR-pathway and ssDNA-specific exonucleases. For 100-bp repeats containing four mispairs, ExoI alone aborts most deletion events, even in the presence of a functional MMR system. By genetic analysis, we show that the inhibitory effect of ssDNA exonucleases on deletion formation is independent of the MutS and UvrD proteins. Exonuclease degradation of DNA displaced during the deletion process may abort slipped misalignment. Exonuclease action is therefore a significant force in genetic stabilization of many forms of repetitive DNA. PMID:12538867

Benzo(a)pyrene and X-rays induce reversions of the pink-eyed unstable mutation in the retinal pigment epithelium of mice.

PubMed

Bishop, A J; Kosaras, B; Sidman, R L; Schiestl, R H

2000-12-20

The pink-eyed unstable (p(un)) mutation is the result of a 70kb tandem duplication within the murine p gene. Homologous deletion/recombination of the locus to wild-type occurs spontaneously in embryos and results in pigmented spots in the fur and eye that persist for life. Such deletion events are also inducible by a variety of DNA damaging agents, as we have observed previously with the fur spot assay. Here, we describe the use of the retinal pigment epithelium (RPE) of the eye to detect reversion events induced with two differently acting agents. Benzo(a)pyrene (B(a)P) induces a high frequency, and X-ray exposure a more modest increase, of p(un) reversion in both the fur and the eye. The eye-spot assay requires fewer mice for significant results than the fur spot assay. Previous work had elucidated the cell proliferation pattern in the RPE and a position effect variegation phenotype in the pattern of p(un) reversions, which we have confirmed. Acute exposure to B(a)P or X-rays resulted in an increased frequency of reversion events. The majority of the spontaneous reversions lie toward the periphery of the RPE whereas induced events are found more centrally, closer to the optic nerve head. The induced distribution corresponds to the major sites of cell proliferation in the RPE at the time of exposure, and further advocates the proposal that dividing cells are at highest risk to develop deletions.

Host plant-dependent phenotypic reversion of Ralstonia solanacearum from non-pathogenic to pathogenic forms via alterations in the phcA gene.

PubMed

Poussier, Stéphane; Thoquet, Philippe; Trigalet-Demery, Danièle; Barthet, Séverine; Meyer, Damien; Arlat, Matthieu; Trigalet, André

2003-08-01

Ralstonia solanacearum is a plant pathogenic bacterium that undergoes a spontaneous phenotypic conversion (PC) from a wild-type pathogenic to a non-pathogenic form. PC is often associated with mutations in phcA, which is a key virulence regulatory gene. Until now, reversion to the wild-type pathogenic form has not been observed for PC variants and the biological significance of PC has been questioned. In this study, we characterized various alterations in phcA (eight IS element insertions, three tandem duplications, seven deletions and a base substitution) in 19 PC mutants from the model strain GMI1000. In five of these variants, reversion to the pathogenic form was observed in planta, while no reversion was ever noticed in vitro whatever culture media used. However, reversion was observed for a 64 bp tandem duplication in vitro in the presence of tomato root exudate. This is the first report showing a complete cycle of phenotypic conversion/reversion in a plant pathogenic bacterium.

Large mitochondrial DNA deletion in an infant with addison disease.

PubMed

Duran, Gloria P; Martinez-Aguayo, A; Poggi, H; Lagos, M; Gutierrez, D; Harris, P R

2012-01-01

Mitochondrial diseases are a group of disorders caused by mutations in nuclear DNA or mitochondrial DNA, usually involving multiple organ systems. Primary adrenal insufficiency due to mitochondrial disease is extremely infrequent and has been reported in association with mitochondrial DNA deletion syndromes such as Kearns-Sayre syndrome. To report a 3-year-old boy with Addison disease, congenital glaucoma, chronic pancreatitis, and mitochondrial myopathy due to large mitochondrial DNA deletion. Molecular analysis of mitochondrial DNA samples obtained from peripheral blood, oral mucosa, and muscle tissue. A novel large mitochondrial DNA deletion of 7,372bp was identified involving almost all genes on the big arch of mtDNA. This case reaffirms the association of adrenal insufficiency and mitochondrial DNA deletions and presents new evidence that glaucoma is another manifestation of mitochondrial diseases. Due to the genetic and clinical heterogeneity of mitochondrial disorders, molecular analysis is crucial to confirm diagnosis and to allow accurate genetic counseling.

Relationship of sleep abnormalities to patient genotypes in Prader-Willi syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vgontzas, A.N.; Kales, A.; Bixler, E.O.

To assess whether sleep abnormalities are related to the genetic abnormalities in Prader-Willi Syndrome (PWS), we performed polysomnographic studies (nighttime and daytime) and determined the chromosome 15 genotypes in eight patients with PWS. Four patients demonstrated sleep onset REM periods (SOREM), and five met the objective polysomnographic criteria for severe or moderate excessive daytime sleepiness (EDS). Three of the four patients with SOREM displayed a paternally derived deletion of chromosome 15q11-q13, whereas the fourth exhibited maternal uniparental heterodisomy in this chromosomal region (UPD). Two of the four patients that did not display SOREM carried paternally derived deletions; the remaining twomore » demonstrated UPD. Four of the five patients with EDS displayed paternal deletions, and the fifth exhibited UPD. One of three patients without evidence of EDS demonstrated paternal deletion; the remaining two showed UPD. Although neither EDS nor SOREM was not consistently associated with a specific genetic abnormality, these phenotypes may be more common in patients with paternal deletions than in those with UPD. Sleep abnormalities in PWS cannot be explained by a single genetic model. 32 refs., 1 tab.« less

Caregiver and Adult Patient Perspectives on the Importance of a Diagnosis of 22q11.2 Deletion Syndrome

ERIC Educational Resources Information Center

Costain, G.; Chow, E. W. C.; Ray, P. N.; Bassett, A. S.

2012-01-01

Background: Recent advances in genetics are particularly relevant in the field of intellectual disability (ID), where sub-microscopic deletions or duplications of genetic material are increasingly implicated as known or suspected causal factors. Data-driven reports on the impact of providing an aetiological explanation in ID are needed to help…

Substance P is a determinant of lethality in diet-induced hemorrhagic pancreatitis in mice.

PubMed

Maa, J; Grady, E F; Yoshimi, S K; Drasin, T E; Kim, E H; Hutter, M M; Bunnett, N W; Kirkwood, K S

2000-08-01

The neuropeptide substance P (SP) induces plasma extravasation and neutrophil infiltration by activating the neurokinin 1-receptor (NK1-R). SP-induced neurogenic inflammation is terminated by the cell surface enzyme neutral endopeptidase (NEP), which degrades SP. We determined whether genetic deletion of the NK1-R reduces mortality and, conversely, whether genetic deletion of NEP increases mortality in a lethal model of hemorrhagic pancreatitis. Necrotizing pancreatitis was induced by feeding mice a diet deficient in choline and supplemented with ethionine. We determined the length of survival, the severity of pancreatitis (by measuring the neutrophil enzyme myeloperoxidase [MPO] and by histologic evaluation), and the severity of pancreatitis-associated lung injury (lung MPO and histology) in NK1-R (+/+)/(-/-) and NEP (+/+)/(-/-) mice. Genetic deletion of the NK1-R significantly improved survival (100% vs 8% at 120 hours, P <.001) and reduced pancreatic MPO and acinar cell necrosis. Conversely, genetic deletion of NEP significantly worsened survival (0% vs 90% at 120 hours, P <.001) and exacerbated pancreatic MPO and pancreatitis-associated lung injury. Substance P is an important determinant of lethality in this model of necrotizing pancreatitis. Defects in NEP expression could lead to uncontrolled inflammation.

Specialized Genetic Recombination Systems in Bacteria: Their Involvement in Gene Expression and Evolution,

DTIC Science & Technology

1980-01-01

genetics (Hayes 1968). This marvelous process is important in providing us with the breadth of phenotypic diversity that one sees within a single plant or...separate overall pro- cesses, but may share common components of DNA metabolism, such as winding/unwinding enzymes, ligase, polymerases , various nucle...incorpuoted DNA segmnent are re- paired by DNA polymerase and ligase. Any diffoernces (base mispairing’S, nil- cleotide additions or deletions) between

Recurrent Deletions of Puroindoline Genes at the Grain Hardness Locus in Four Independent Lineages of Polyploid Wheat1[W][OA

PubMed Central

Li, Wanlong; Huang, Li; Gill, Bikram S.

2008-01-01

Polyploidy is known to induce numerous genetic and epigenetic changes but little is known about their physiological bases. In wheat, grain texture is mainly determined by the Hardness (Ha) locus consisting of genes Puroindoline a (Pina) and b (Pinb). These genes are conserved in diploid progenitors but were deleted from the A and B genomes of tetraploid Triticum turgidum (AB). We now report the recurrent deletions of Pina-Pinb in other lineages of polyploid wheat. We analyzed the Ha haplotype structure in 90 diploid and 300 polyploid accessions of Triticum and Aegilops spp. Pin genes were conserved in all diploid species and deletion haplotypes were detected in all polyploid Triticum and most of the polyploid Aegilops spp. Two Pina-Pinb deletion haplotypes were found in hexaploid wheat (Triticum aestivum; ABD). Pina and Pinb were eliminated from the G genome, but maintained in the A genome of tetraploid Triticum timopheevii (AG). Subsequently, Pina and Pinb were deleted from the A genome but retained in the Am genome of hexaploid Triticum zhukovskyi (AmAG). Comparison of deletion breakpoints demonstrated that the Pina-Pinb deletion occurred independently and recurrently in the four polyploid wheat species. The implications of Pina-Pinb deletions for polyploid-driven evolution of gene and genome and its possible physiological significance are discussed. PMID:18024553

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

PubMed Central

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Laser desorption mass spectrometry for molecular diagnosis

NASA Astrophysics Data System (ADS)

Chen, C. H. Winston; Taranenko, N. I.; Zhu, Y. F.; Allman, S. L.; Tang, K.; Matteson, K. J.; Chang, L. Y.; Chung, C. N.; Martin, Steve; Haff, Lawrence

1996-04-01

Laser desorption mass spectrometry has been used for molecular diagnosis of cystic fibrosis. Both 3-base deletion and single-base point mutation have been successfully detected by clinical samples. This new detection method can possibly speed up the diagnosis by one order of magnitude in the future. It may become a new biotechnology technique for population screening of genetic disease.

NMDA receptor agonists reverse impaired psychomotor and cognitive functions associated with hippocampal Hbegf-deficiency in mice.

PubMed

Sasaki, Keita; Omotuyi, Olaposi Idowu; Ueda, Mutsumi; Shinohara, Kazuyuki; Ueda, Hiroshi

2015-12-04

Structural and functional changes of the hippocampus are correlated with psychiatric disorders and cognitive dysfunctions. Genetic deletion of heparin-binding epidermal growth factor-like growth factor (HB-EGF), which is predominantly expressed in cortex and hippocampus, also causes similar psychiatric and cognitive dysfunctions, accompanying down-regulated NMDA receptor signaling. However, little is known of such dysfunctions in hippocampus-specific Hbegf cKO mice. We successfully developed hippocampus-specific cKO mice by crossbreeding floxed Hbegf and Gng7-Cre knock-in mice, as Gng7 promoter-driven Cre is highly expressed in hippocampal neurons as well as striatal medium spiny neurons. In mice lacking hippocampus Hbegf gene, there was a decreased neurogenesis in the subgranular zone (SGZ) of the dentate gyrus as well as down-regulation of PSD-95/NMDA-receptor-NR1/NR2B subunits and related NMDA receptor signaling. Psychiatric, social-behavioral and cognitive abnormalities were also observed in hippocampal cKO mice. Interestingly, D-cycloserine and nefiracetam, positive allosteric modulators (PAMs) of NMDA receptor reversed the apparent reduction in NMDA receptor signaling and most behavioral abnormalities. Furthermore, decreased SGZ neurogenesis in hippocampal cKO mice was reversed by nefiracetam. The present study demonstrates that PAMs of NMDA receptor have pharmacotherapeutic potentials to reverse down-regulated NMDA receptor signaling, neuro-socio-cognitive abnormalities and decreased neurogenesis in hippocampal cKO mice.

Deletion of nfnAB in Thermoanaerobacterium saccharolyticum and Its Effect on Metabolism

DOE PAGES

Lo, Jonathan; Zheng, Tianyong; Olson, Daniel G.; ...

2015-06-29

NfnAB catalyzes the reversible transfer of electrons from reduced ferredoxin and NADH to 2 NADP +. The NfnAB complex has been hypothesized to be the main enzyme for ferredoxin oxidization in strains of Thermoanaerobacterium saccharolyticum engineered for increased ethanol production. NfnAB complex activity was detectable in crude cell extracts of T. saccharolyticum. In this paper, activity was also detected using activity staining of native PAGE gels. The nfnAB gene was deleted in different strains of T. saccharolyticum to determine its effect on end product formation. In wild-type T. saccharolyticum, deletion of nfnAB resulted in a 46% increase in H 2more » formation but otherwise little change in other fermentation products. In two engineered strains with 80% theoretical ethanol yield, loss of nfnAB caused two different responses: in one strain, ethanol yield decreased to about 30% of the theoretical value, while another strain had no change in ethanol yield. Biochemical analysis of cell extracts showed that the ΔnfnAB strain with decreased ethanol yield had NADPH-linked alcohol dehydrogenase (ADH) activity, while the ΔnfnAB strain with unchanged ethanol yield had NADH-linked ADH activity. Deletion of nfnAB caused loss of NADPH-linked ferredoxin oxidoreductase activity in all cell extracts. Significant NADH-linked ferredoxin oxidoreductase activity was seen in all cell extracts, including those that had lost nfnAB. This suggests that there is an unidentified NADH:ferredoxin oxidoreductase (distinct from nfnAB) playing a role in ethanol formation. The NfnAB complex plays a key role in generating NADPH in a strain that had become reliant on NADPH-ADH activity. Importance: Thermophilic anaerobes that can convert biomass-derived sugars into ethanol have been investigated as candidates for biofuel formation. Many anaerobes have been genetically engineered to increase biofuel formation; however, key aspects of metabolism remain unknown and poorly understood. One example is the mechanism for ferredoxin oxidation and transfer of electrons to NAD(P) +. The electron-bifurcating enzyme complex NfnAB is known to catalyze the reversible transfer of electrons from reduced ferredoxin and NADH to 2 NADP + and is thought to play key roles linking NAD(P)(H) metabolism with ferredoxin metabolism. Finally, we report the first deletion of nfnAB and demonstrate a role for NfnAB in metabolism and ethanol formation in Thermoanaerobacterium saccharolyticum and show that this may be an important feature among other thermophilic ethanologenic anaerobes.« less

der(11)t(11;17): a distinct cytogenetic pathway of advanced stage neuroblastoma (NBL) - detected by spectral karyotyping (SKY).

PubMed

Stark, Batia; Jeison, Marta; Glaser-Gabay, Leticia; Bar-Am, Irit; Mardoukh, Jacques; Ash, Shifra; Atias, Dina; Stein, Jerry; Zaizov, Rina; Yaniv, Isaac

2003-07-18

Conventional cytogenetic, molecular cytogenic and genetic methods disclosed a broad spectrum of genetic abnormalities leading to gain and loss of chromosomal segments in advanced stage neuroblastoma (NBL). Specific correlation between the genetic findings could delineate distinct genetic pathways, of which the biology and prognostic significance is as yet undetermined. Using spectral karyotyping (SKY) and fluorescence in situ hybridization (FISH) on metaphases from 16 patients with advanced stage NBL, it was possible to explore the whole spectrum of rearrangement within complex karyotypes and to detect hidden recurrent translocations. All translocations were unbalanced. The most prevalent recurrent unbalanced translocations resulted in 17q gain in 12 patients (75%), 11q loss in nine patients (56%), and 1p deletion/imbalance in eight patients (50%). The most frequent recurrent translocation was der(11)t(11;17) in six patients. Three cytogenetic pathways could be delineated. The first, with six patients, was characterized by the unbalanced translocation der(11)t(11;17), detected only by SKY, resulting in the concomitant 17q gain and 11q loss. No MYCN amplification or 1p deletion (except one patient with 1p imbalance) were found, while 3p deletion, and complex karyotypes were common. The second subgroup, with four patients, had 17q gain and 1p deletion, and in two patients 11q loss, that was apparent only by FISH. 1p deletion occurred through der(1)t(1;17) or del(1p). The third subgroup of four patients was characterized by MYCN amplification with 17q gain and 1p deletion, very rarely with 11q loss (one patient) through a translocation with a non-17q partner. The SKY subclassifications were in accordance with the findings reported by molecular genetic techniques, and may indicate that distinct oncogenes and suppressor genes are involved in the der(11)t(11;17) pathway of advanced stage NBL.

Clinical and genetic features of dyskeratosis congenita, cryptic dyskeratosis congenita, and Hoyeraal-Hreidarsson syndrome in Japan.

PubMed

Yamaguchi, Hiroki; Sakaguchi, Hirotoshi; Yoshida, Kenichi; Yabe, Miharu; Yabe, Hiromasa; Okuno, Yusuke; Muramatsu, Hideki; Takahashi, Yoshiyuki; Yui, Shunsuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Inokuchi, Koiti; Ito, Etsuro; Ogawa, Seishi; Kojima, Seiji

2015-11-01

Dyskeratosis congenita (DKC) is an inherited bone marrow failure (BMF) syndrome typified by reticulated skin pigmentation, nail dystrophy, and mucosal leukoplakia. Hoyeraal-Hreidarsson syndrome (HHS) is considered to be a severe form of DKC. Unconventional forms of DKC, which develop slowly in adulthood but without the physical anomalies characteristic of DKC (cryptic DKC), have been reported. Clinical and genetic features of DKC have been investigated in Caucasian, Black, and Hispanic populations, but not in Asian populations. The present study aimed to determine the clinical and genetic features of DKC, HHS, and cryptic DKC among Japanese patients. We analyzed 16 patients diagnosed with DKC, three patients with HHS, and 15 patients with cryptic DKC. We found that platelet count was significantly more depressed than neutrophil count or hemoglobin value in DKC patients, and identified DKC patients with large deletions in the telomerase reverse transcriptase and cryptic DKC patients with RTEL1 mutations on both alleles. This led to some patients previously considered to have unclassifiable BMF being diagnosed with cDKC through identification of new gene mutations. It thus seems important from a clinical viewpoint to re-examine the clinical characteristics, frequency of genetic mutations, and treatment efficacy in DKC, HHS, and cDKC.

Understanding Intellectual Disability through Rasopathies

PubMed Central

Alvaro, San Martín; Rafael, Pagani Mario

2014-01-01

Intellectual disability, commonly known as mental retardation in the International Classification of Disease from World Health Organization, is the term that describes an intellectual and adaptive cognitive disability that begins in early life during the developmental period. Currently the term intellectual disability is the preferred one. Although our understanding of the physiological basis of learning and learning disability is poor, a general idea is that such condition is quite permanent. However, investigations in animal models suggest that learning disability can be functional in nature and as such reversible through pharmacology or appropriate learning paradigms. A fraction of the cases of intellectual disability is caused by point mutations or deletions in genes that encode for proteins of the RAS/MAP Kinase signaling pathway known as RASopathies. Here we examined the current understanding of the molecular mechanisms involved in this group of genetic disorders focusing in studies which provide evidence that intellectual disability is potentially treatable and curable. The evidence presented supports the idea that with the appropriate understanding of the molecular mechanisms involved, intellectual disability could be treated pharmacologically and perhaps through specific mechanistic-based teaching strategies. PMID:24859216

Understanding intellectual disability through RASopathies.

PubMed

San Martín, Alvaro; Pagani, Mario Rafael

2014-01-01

Intellectual disability, commonly known as mental retardation in the International Classification of Disease from World Health Organization, is the term that describes an intellectual and adaptive cognitive disability that begins in early life during the developmental period. Currently the term intellectual disability is the preferred one. Although our understanding of the physiological basis of learning and learning disability is poor, a general idea is that such condition is quite permanent. However, investigations in animal models suggest that learning disability can be functional in nature and as such reversible through pharmacology or appropriate learning paradigms. A fraction of the cases of intellectual disability is caused by point mutations or deletions in genes that encode for proteins of the RAS/MAP kinase signaling pathway known as RASopathies. Here we examined the current understanding of the molecular mechanisms involved in this group of genetic disorders focusing in studies which provide evidence that intellectual disability is potentially treatable and curable. The evidence presented supports the idea that with the appropriate understanding of the molecular mechanisms involved, intellectual disability could be treated pharmacologically and perhaps through specific mechanistic-based teaching strategies. Copyright © 2014 Elsevier Ltd. All rights reserved.

FoxO1 integrates direct and indirect effects of insulin on hepatic glucose production and glucose utilization

PubMed Central

O-Sullivan, InSug; Zhang, Wenwei; Wasserman, David H.; Liew, Chong Wee; Liu, Jonathan; Paik, Jihye; DePinho, Ronald A.; Stolz, Donna Beer; Kahn, C. Ronald; Schwartz, Michael W.; Unterman, Terry G.

2016-01-01

FoxO proteins are major targets of insulin action. To better define the role of FoxO1 in mediating insulin effects in the liver, we generated liver-specific insulin receptor knockout (LIRKO) and IR/FoxO1 double knockout (LIRFKO) mice. Here we show that LIRKO mice are severely insulin resistant based on glucose, insulin and C-peptide levels, and glucose and insulin tolerance tests, and genetic deletion of hepatic FoxO1 reverses these effects. 13C-glucose and insulin clamp studies indicate that regulation of both hepatic glucose production (HGP) and glucose utilization is impaired in LIRKO mice, and these defects are also restored in LIRFKO mice corresponding to changes in gene expression. We conclude that (1) inhibition of FoxO1 is critical for both direct (hepatic) and indirect effects of insulin on HGP and utilization, and (2) extrahepatic effects of insulin are sufficient to maintain normal whole-body and hepatic glucose metabolism when liver FoxO1 activity is disrupted. PMID:25963540

Differences in behavioural phenotype between parental deletion and maternal uniparental disomy in Prader-Willi syndrome: an ERP study.

PubMed

Stauder, Johannes E A; Boer, Harm; Gerits, Rolf H A; Tummers, Anke; Whittington, Joyce; Curfs, Leopold M G

2005-06-01

Paternal deletion and maternal uniparental disomy are the principal genetic subtypes associated with Prader-Willi syndrome (PWS). Recent clinical findings suggest differences in phenotype between these subtypes. The present experimental study addresses this issue using a cognitive psycho-physiological setup. Behaviour and event-related brain activity (ERP) was recorded by a continuous performance response inhibition task (CPT-AX) in adults with paternal deletion PWS (n=11), maternal uniparental disomy PWS (n=11) and normal controls (n=11). The dependent behavioural variables of the CPT-AX task were reaction time and correct scores. For the ERPs the N200 and P300 components were included which are related to early modality-specific inhibition and late general inhibition, respectively. The disomy group had fewer correct scores and increased reaction times as compared to the CPT-AX task than the control and deletion group. Both PWS subgroups differed significantly from the control group for the N200 amplitude. Only the control group showed the typical task modulation for the N200 amplitude. The amplitude of the P300 component was considerably smaller in the uniparental disomy group than in the deletion and control groups. The ERP results suggest that early modality specific inhibition is impaired in both PWS genetic subtypes. Late general inhibition is impaired in the uniparental disomy group only. Thus, although the ERP data suggests a common impairment in early visual inhibition processing, uniparental disomy and parental deletion genetic PWS subtypes clearly differ in their behavioural and brain activation phenotypes. The present study is the first experimental demonstration which explains the two principal genetic mechanisms that hinder the expression of the genes at 15q11-q13g in PWS result in different behavioural phenotype.

Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

PubMed Central

Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

2014-01-01

A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

[Analysis of hematological phenotype and genotype of 23 patients from Guangdong with co-inherited hemoglobin Hb Westmead and β-thalassemia].

PubMed

Yan, Miansheng; Gan, Xin; Liu, Min; Huang, Bin; Zhong, Liangying

2016-10-01

To analyze the genotype-phenotype correlation among carriers from Guangdong with co-inherited hemoglobin Hb Westmead (HbWS) and β-thalassemia. Twenty three patients (including 9 males and 14 females, aged 1-53 year old) were diagnosed by hematological analysis and genetic testing. Complete blood cell count and hemoglobin electrophoresis analysis were performed on a XE4000i automatic hemocyte analyzer. Hb, HbF and HbA2 were tested by high performance liquid chromatography (HPLC). Gap-PCR was adopted to detect three common thalassemia deletions. Reverse dot-blotting (RDB) assay was applied for detecting three common non-deletional α2 gene mutations and β-thalassemia. Among the 23 patients, 12 showed anemia, among whom 9 had mild anemia and 3 had moderate anemia. The lowest Hb was 68 g/L, and both mean corpuscular volume and mean corpuscular hemoglobin were lower than average, while HbA2 was higher than 3.5%. Genetic analysis confirmed that 5 cases had αWS-α/α-α, β CD654/β N (21.7%), 4 had α WS-α/α-α, β CD41-42/β N (17.4%), 5 had α WS-α/α-α, β CD17/β N (21.7%), 4 had α WS-α/α-α, β CD28/β N (17.4%), 1 had α WS-α/α-α, β CD71-72/β N (4.3%), 1 had αWS-α/α-α, β CD27-28/β N (4.3%), 1 had α WS-α/α-α, β CD41-42/β CD17 (4.3%), 2 had a concomitant β-thalassemia heterozygosity and -α 3.7 deletion. Patients with co-existing Hb WS and other β-thalassemia trait may show variable clinical features. Such compound heterozygotes are usually misdiagnosed during screening by hemoglobin electrophoresis, accurate diagnose should be attained by molecular diagnosis.

The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines.

PubMed

Kristensen, Tatjana P; Maria Cherian, Reeja; Gray, Fiona C; MacNeill, Stuart A

2014-01-01

The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies.

In vivo DNA deletion assay to detect environmental and genetic predisposition to cancer.

PubMed

Reliene, Ramune; Bishop, Alexander J R; Aubrecht, Jiri; Schiestl, Robert H

2004-01-01

Large-scale genomic rearrangements such as DNA deletions play a role in the etiology of cancer. The frequency of DNA deletions can be elevated by exposure to carcinogens or by mutations in genes involved in the maintenance of genomic integrity. The in vivo DNA deletion assay allows a visual detection of deletion events within the pink-eyed unstable (pun) locus in developing mouse embryos. A deletion of one copy of a duplicated 70-kb DNA fragment within the pun locus restores the pink-eyed dilute (p) gene, which encodes a protein responsible for the assembly of a black color melanin complex. Deletion events occurring in premelanocytes cause visible black patches (fur-spots) on the light gray fur of offspring and black pigmented cells (eye-spots) on the unpigmented retinal pigment epithelium (RPE). In the fur-spot assay, 10-d-old pups are observed for black spots on the fur. In the eye-spot assay, mice are sacrificed at d 20, eyes are removed, and the wholemount RPE slides are prepared for eye-spot analysis. The frequency, size, and position relative to the optic nerve of the eye-spots are determined. This assay can be used to study the effect of environmental chemicals and physical agents as well as the genetic control of DNA deletions in vivo.

Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

PubMed

Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

2018-06-04

Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

Bacterial genome reduction using the progressive clustering of deletions via yeast sexual cycling

DOE PAGES

Suzuki, Yo; Assad-Garcia, Nacyra; Kostylev, Maxim; ...

2015-02-05

The availability of genetically tractable organisms with simple genomes is critical for the rapid, systems-level understanding of basic biological processes. Mycoplasma bacteria, with the smallest known genomes among free-living cellular organisms, are ideal models for this purpose, but the natural versions of these cells have genome complexities still too great to offer a comprehensive view of a fundamental life form. Here in this paper we describe an efficient method for reducing genomes from these organisms by identifying individually deletable regions using transposon mutagenesis and progressively clustering deleted genomic segments using meiotic recombination between the bacterial genomes harbored in yeast. Mycoplasmalmore » genomes subjected to this process and transplanted into recipient cells yielded two mycoplasma strains. The first simultaneously lacked eight singly deletable regions of the genome, representing a total of 91 genes and ~10%of the original genome. The second strain lacked seven of the eight regions, representing 84 genes. Growth assay data revealed an absence of genetic interactions among the 91 genes under tested conditions. Despite predicted effects of the deletions on sugar metabolism and the proteome, growth rates were unaffected by the gene deletions in the seven-deletion strain. These results support the feasibility of using single-gene disruption data to design and construct viable genomes lacking multiple genes, paving the way toward genome minimization. The progressive clustering method is expected to be effective for the reorganization of any mega-sized DNA molecules cloned in yeast, facilitating the construction of designer genomes in microbes as well as genomic fragments for genetic engineering of higher eukaryotes.« less

Bacterial genome reduction using the progressive clustering of deletions via yeast sexual cycling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Yo; Assad-Garcia, Nacyra; Kostylev, Maxim

The availability of genetically tractable organisms with simple genomes is critical for the rapid, systems-level understanding of basic biological processes. Mycoplasma bacteria, with the smallest known genomes among free-living cellular organisms, are ideal models for this purpose, but the natural versions of these cells have genome complexities still too great to offer a comprehensive view of a fundamental life form. Here in this paper we describe an efficient method for reducing genomes from these organisms by identifying individually deletable regions using transposon mutagenesis and progressively clustering deleted genomic segments using meiotic recombination between the bacterial genomes harbored in yeast. Mycoplasmalmore » genomes subjected to this process and transplanted into recipient cells yielded two mycoplasma strains. The first simultaneously lacked eight singly deletable regions of the genome, representing a total of 91 genes and ~10%of the original genome. The second strain lacked seven of the eight regions, representing 84 genes. Growth assay data revealed an absence of genetic interactions among the 91 genes under tested conditions. Despite predicted effects of the deletions on sugar metabolism and the proteome, growth rates were unaffected by the gene deletions in the seven-deletion strain. These results support the feasibility of using single-gene disruption data to design and construct viable genomes lacking multiple genes, paving the way toward genome minimization. The progressive clustering method is expected to be effective for the reorganization of any mega-sized DNA molecules cloned in yeast, facilitating the construction of designer genomes in microbes as well as genomic fragments for genetic engineering of higher eukaryotes.« less

ADRA2B Deletion Variant Influences Time-Dependent Effects of Pre-Learning Stress on Long-Term Memory

PubMed Central

Zoladz, Phillip R.; Dailey, Alison M.; Nagle, Hannah E.; Fiely, Miranda K.; Mosley, Brianne E.; Brown, Callie M.; Duffy, Tessa J.; Scharf, Amanda R.; Earley, McKenna B.; Rorabaugh, Boyd R.

2017-01-01

Extensive work over the past few decades has shown that certain genetic variations interact with life events to confer increased susceptibility for the development of psychological disorders. The deletion variant of the ADRA2B gene, which has been associated with enhanced emotional memory and heightened amygdala responses to emotional stimuli, might confer increased susceptibility for the development of post-traumatic stress disorder (PTSD) or related phenotypes by increasing the likelihood of traumatic memory formation. Thus, we examined whether this genetic variant would predict stress effects on learning and memory in a non-clinical sample. Two hundred and thirty-five individuals were exposed to the socially evaluated cold pressor test or a control condition immediately or 30 min prior to learning a list of words that varied in emotional valence and arousal level. Participants’ memory for the words was tested immediately (recall) and 24 h after learning (recall and recognition), and saliva samples were collected to genotype participants for the ADRA2B deletion variant. Results showed that stress administered immediately before learning selectively enhanced long-term recall in deletion carriers. Stress administered 30 min before learning impaired recognition memory in male deletion carriers, while enhancing recognition memory in female deletion carriers. These findings provide additional evidence to support the idea that ADRA2B deletion variant carriers retain a sensitized stress response system, which results in amplified effects of stress on learning and memory. The accumulating evidence regarding this genetic variant implicates it as a susceptibility factor for traumatic memory formation and PTSD-related phenotypes. PMID:28254464

Insertion and deletion mutagenesis of the human cytomegalovirus genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spaete, R.R.; Mocarski, E.S.

1987-10-01

Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

Reverse-engineering the genetic circuitry of a cancer cell with predicted intervention in chronic lymphocytic leukemia.

PubMed

Vallat, Laurent; Kemper, Corey A; Jung, Nicolas; Maumy-Bertrand, Myriam; Bertrand, Frédéric; Meyer, Nicolas; Pocheville, Arnaud; Fisher, John W; Gribben, John G; Bahram, Seiamak

2013-01-08

Cellular behavior is sustained by genetic programs that are progressively disrupted in pathological conditions--notably, cancer. High-throughput gene expression profiling has been used to infer statistical models describing these cellular programs, and development is now needed to guide orientated modulation of these systems. Here we develop a regression-based model to reverse-engineer a temporal genetic program, based on relevant patterns of gene expression after cell stimulation. This method integrates the temporal dimension of biological rewiring of genetic programs and enables the prediction of the effect of targeted gene disruption at the system level. We tested the performance accuracy of this model on synthetic data before reverse-engineering the response of primary cancer cells to a proliferative (protumorigenic) stimulation in a multistate leukemia biological model (i.e., chronic lymphocytic leukemia). To validate the ability of our method to predict the effects of gene modulation on the global program, we performed an intervention experiment on a targeted gene. Comparison of the predicted and observed gene expression changes demonstrates the possibility of predicting the effects of a perturbation in a gene regulatory network, a first step toward an orientated intervention in a cancer cell genetic program.

The thioredoxin TRX-1 regulates adult lifespan extension induced by dietary restriction in Caenorhabditis elegans.

PubMed

Fierro-González, Juan Carlos; González-Barrios, María; Miranda-Vizuete, Antonio; Swoboda, Peter

2011-03-18

Dietary restriction (DR) is the only environmental intervention known to extend adult lifespan in a wide variety of animal models. However, the genetic and cellular events that mediate the anti-aging programs induced by DR remain elusive. Here, we used the nematode Caenorhabditis elegans to provide the first in vivo evidence that a thioredoxin (TRX-1) regulates adult lifespan extension induced by DR. We found that deletion of the gene trx-1 completely suppressed the lifespan extension caused by mutation of eat-2, a genetic surrogate of DR in the worm. However, trx-1 deletion only partially suppressed the long lifespan caused by mutation of the insulin-like receptor gene daf-2 or by mutation of the sensory cilia gene osm-5. A trx-1::GFP translational fusion expressed from its own promoter in ASJ neurons (Ptrx-1::trx-1::GFP) rescued the trx-1 deletion-mediated suppression of the lifespan extension caused by mutation of eat-2. This rescue was not observed when trx-1::GFP was expressed from the ges-1 promoter in the intestine. In addition, overexpression of Ptrx-1::trx-1::GFP extended lifespan in wild type, but not in eat-2 mutants. trx-1 deletion almost completely suppressed the lifespan extension induced by dietary deprivation (DD), a non-genetic, nutrient-based model of DR in the worm. Moreover, DD upregulated the expression of a trx-1 promoter-driven GFP reporter gene (Ptrx-1::GFP) in ASJ neurons of aging adults, but not that of control Pgpa-9::GFP (which is also expressed in ASJ neurons). We propose that DR activates TRX-1 in ASJ neurons during aging, which in turn triggers TRX-1-dependent mechanisms to extend adult lifespan in the worm. Copyright © 2011 Elsevier Inc. All rights reserved.

Targeting skeletal endothelium to ameliorate bone loss.

PubMed

Xu, Ren; Yallowitz, Alisha; Qin, An; Wu, Zhuhao; Shin, Dong Yeon; Kim, Jung-Min; Debnath, Shawon; Ji, Gang; Bostrom, Mathias P; Yang, Xu; Zhang, Chao; Dong, Han; Kermani, Pouneh; Lalani, Sarfaraz; Li, Na; Liu, Yifang; Poulos, Michael G; Wach, Amanda; Zhang, Yi; Inoue, Kazuki; Di Lorenzo, Annarita; Zhao, Baohong; Butler, Jason M; Shim, Jae-Hyuck; Glimcher, Laurie H; Greenblatt, Matthew B

2018-06-01

Recent studies have identified a specialized subset of CD31 hi endomucin hi (CD31 hi EMCN hi ) vascular endothelium that positively regulates bone formation. However, it remains unclear how CD31 hi EMCN hi endothelium levels are coupled to anabolic bone formation. Mice with an osteoblast-specific deletion of Shn3, which have markedly elevated bone formation, demonstrated an increase in CD31 hi EMCN hi endothelium. Transcriptomic analysis identified SLIT3 as an osteoblast-derived, SHN3-regulated proangiogenic factor. Genetic deletion of Slit3 reduced skeletal CD31 hi EMCN hi endothelium, resulted in low bone mass because of impaired bone formation and partially reversed the high bone mass phenotype of Shn3 -/- mice. This coupling between osteoblasts and CD31 hi EMCN hi endothelium is essential for bone healing, as shown by defective fracture repair in SLIT3-mutant mice and enhanced fracture repair in SHN3-mutant mice. Finally, administration of recombinant SLIT3 both enhanced bone fracture healing and counteracted bone loss in a mouse model of postmenopausal osteoporosis. Thus, drugs that target the SLIT3 pathway may represent a new approach for vascular-targeted osteoanabolic therapy to treat bone loss.

UCP1 deficiency causes brown fat respiratory chain depletion and sensitizes mitochondria to calcium overload-induced dysfunction.

PubMed

Kazak, Lawrence; Chouchani, Edward T; Stavrovskaya, Irina G; Lu, Gina Z; Jedrychowski, Mark P; Egan, Daniel F; Kumari, Manju; Kong, Xingxing; Erickson, Brian K; Szpyt, John; Rosen, Evan D; Murphy, Michael P; Kristal, Bruce S; Gygi, Steven P; Spiegelman, Bruce M

2017-07-25

Brown adipose tissue (BAT) mitochondria exhibit high oxidative capacity and abundant expression of both electron transport chain components and uncoupling protein 1 (UCP1). UCP1 dissipates the mitochondrial proton motive force (Δp) generated by the respiratory chain and increases thermogenesis. Here we find that in mice genetically lacking UCP1, cold-induced activation of metabolism triggers innate immune signaling and markers of cell death in BAT. Moreover, global proteomic analysis reveals that this cascade induced by UCP1 deletion is associated with a dramatic reduction in electron transport chain abundance. UCP1-deficient BAT mitochondria exhibit reduced mitochondrial calcium buffering capacity and are highly sensitive to mitochondrial permeability transition induced by reactive oxygen species (ROS) and calcium overload. This dysfunction depends on ROS production by reverse electron transport through mitochondrial complex I, and can be rescued by inhibition of electron transfer through complex I or pharmacologic depletion of ROS levels. Our findings indicate that the interscapular BAT of Ucp1 knockout mice exhibits mitochondrial disruptions that extend well beyond the deletion of UCP1 itself. This finding should be carefully considered when using this mouse model to examine the role of UCP1 in physiology.

A 1q42 Deletion Involving DISC1, DISC2, and TSNAX in an Autism Spectrum Disorder

PubMed Central

Williams, Jaime M.; Beck, Tyler F.; Pearson, David M.; Proud, Monica B.; Cheung, Sau Wai; Scott, Daryl A.

2010-01-01

Individuals with autism spectrum disorders have impairments in social, communicative, and behavior development that are often accompanied by abnormalities in cognitive functioning, learning, attention, and sensory processing. In this report, we describe a 3-year-old male child with an autism spectrum disorder who carries a 2Mb deletion of chromosome 1q42. Array comparative genome hybridization revealed that this deletion involves at least three genes—DISC1, DISC2, and TSNAX—which have been found to be associated with neuropsychiatric disorders and are likely to play key roles in normal CNS development. Further studies revealed that the deletion was inherited from his unaffected mother. This suggests that other genetic and/or environmental factors, some of which may be sex specific, may modify the phenotypic effects of this deletion. While this case provides evidence for the potential role of DISC1, DISC2, and TSNAX in the development of autism spectrum disorders, it is equally clear that caution must be taken when providing families with prognostic information and genetic counseling regarding such deletions. PMID:19606485

Inheritance of thelytoky in the honey bee Apis mellifera capensis

PubMed Central

Chapman, N C; Beekman, M; Allsopp, M H; Rinderer, T E; Lim, J; Oxley, P R; Oldroyd, B P

2015-01-01

Asexual reproduction via thelytokous parthenogenesis is widespread in the Hymenoptera, but its genetic underpinnings have been described only twice. In the wasp Lysiphlebus fabarum and the Cape honey bee Apis mellifera capensis the origin of thelytoky have each been traced to a single recessive locus. In the Cape honey bee it has been argued that thelytoky (th) controls the thelytoky phenotype and that a deletion of 9 bp in the flanking intron downstream of exon 5 (tae) of the gemini gene switches parthenogenesis from arrhenotoky to thelytoky. To further explore the mode of inheritance of thelytoky, we generated reciprocal backcrosses between thelytokous A. m. capensis and the arrhenotokous A. m. scutellata. Ten genetic markers were used to identify 108 thelytokously produced offspring and 225 arrhenotokously produced offspring from 14 colonies. Patterns of appearance of thelytokous parthenogenesis were inconsistent with a single locus, either th or tae, controlling thelytoky. We further show that the 9 bp deletion is present in the arrhenotokous A. m. scutellata population in South Africa, in A. m. intermissa in Morocco and in Africanized bees from Brazil and Texas, USA, where thelytoky has not been reported. Thus the 9 bp deletion cannot be the cause of thelytoky. Further, we found two novel tae alleles. One contains the previously described 9 bp deletion and an additional deletion of 7 bp nearby. The second carries a single base insertion with respect to the wild type. Our data are consistent with the putative th locus increasing reproductive capacity. PMID:25585920

Reversal of Physiological Deficits Caused by Diminished Levels of Peptidylglycine α-Amidating Monooxygenase by Dietary Copper

PubMed Central

Bousquet-Moore, D.; Ma, X. M.; Nillni, E. A.; Czyzyk, T. A.; Pintar, J. E.; Eipper, B. A.; Mains, R. E.

2009-01-01

Amidated peptides are critically involved in many physiological functions. Genetic deletion of peptidylglycine α-amidating monooxygenase (PAM), the only enzyme that can synthesize these peptides, is embryonically lethal. The goal of the present study was the identification of physiological functions impaired by haploinsufficiency of PAM. Regulation of the hypothalamic-pituitary-thyroid axis and body temperature, functions requiring contributions from multiple amidated peptides, were selected for evaluation. Based on serum T4 and pituitary TSH-β mRNA levels, mice heterozygous for PAM (PAM+/−) were euthyroid at baseline. Feedback within the hypothalamic-pituitary-thyroid axis was impaired in PAM+/− mice made hypothyroid using a low iodine/propylthiouracil diet. Despite their normal endocrine response to cold, PAM+/− mice were unable to maintain body temperature as well as wild-type littermates when kept in a 4 C environment. When provided with additional dietary copper, PAM+/− mice maintained body temperature as well as wild-type mice. Pharmacological activation of vasoconstriction or shivering also allowed PAM+/− mice to maintain body temperature. Cold-induced vasoconstriction was deficient in PAM+/− mice. This deficit was eliminated in PAM+/− mice receiving a diet with supplemental copper. These results suggest that dietary deficiency of copper, coupled with genetic deficits in PAM, could result in physiological deficits in humans. PMID:19022883

Whole-gene CFTR sequencing combined with digital RT-PCR improves genetic diagnosis of cystic fibrosis.

PubMed

Straniero, Letizia; Soldà, Giulia; Costantino, Lucy; Seia, Manuela; Melotti, Paola; Colombo, Carla; Asselta, Rosanna; Duga, Stefano

2016-12-01

Despite extensive screening, 1-5% of cystic fibrosis (CF) patients lack a definite molecular diagnosis. Next-generation sequencing (NGS) is making affordable genetic testing based on the identification of variants in extended genomic regions. In this frame, we analyzed 23 CF patients and one carrier by whole-gene CFTR resequencing: 4 were previously characterized and served as controls; 17 were cases lacking a complete diagnosis after a full conventional CFTR screening; 3 were consecutive subjects referring to our centers, not previously submitted to any screening. We also included in the custom NGS design the coding portions of the SCNN1A, SCNN1B and SCNN1G genes, encoding the subunits of the sodium channel ENaC, which were found to be mutated in CF-like patients. Besides 2 novel SCNN1B missense mutations, we identified 22 previously-known CFTR mutations, including 2 large deletions (whose breakpoints were precisely mapped), and novel deep-intronic variants, whose role on splicing was excluded by ex-vivo analyses. Finally, for 2 patients, compound heterozygotes for a CFTR mutation and the intron-9c.1210-34TG [11-12] T 5 allele-known to be associated with decreased CFTR mRNA levels-the molecular diagnosis was implemented by measuring the residual level of wild-type transcript by digital reverse transcription polymerase chain reaction performed on RNA extracted from nasal brushing.

A Long Terminal Repeat-Containing Retrotransposon of Schizosaccharomyces pombe Expresses a Gag-Like Protein That Assembles into Virus-Like Particles Which Mediate Reverse Transcription

PubMed Central

Teysset, Laure; Dang, Van-Dinh; Kim, Min Kyung; Levin, Henry L.

2003-01-01

The Tf1 element of Schizosaccharomyces pombe is a long terminal repeat-containing retrotransposon that encodes functional protease, reverse transcriptase, and integrase proteins. Although these proteins are known to be necessary for protein processing, reverse transcription, and integration, respectively, the function of the protein thought to be Gag has not been determined. We present here the first electron microscopy of Tf1 particles. We tested whether the putative Gag of Tf1 was required for particle formation, packaging of RNA, and reverse transcription. We generated deletions of 10 amino acids in each of the four hydrophilic domains of the protein and found that all four mutations reduced transposition activity. The N-terminal deletion removed a nuclear localization signal and inhibited nuclear import of the transposon. The two mutations in the center of Gag destabilized the protein and resulted in no virus-like particles. The C-terminal deletion caused a defect in RNA packaging and, as a result, low levels of cDNA. The electron microscopy of cells expressing a truncated Tf1 showed that Gag alone was sufficient for the formation of virus-like particles. Taken together, these results indicate that Tf1 encodes a Gag protein that is a functional equivalent of the Gag proteins of retroviruses. PMID:12692246

A tropical Atlantic species of Melibe Rang, 1829 (Mollusca, Nudibranchia, Tethyiidae)

PubMed Central

Espinoza, Erika; DuPont, Anne; Valdés, Ángel

2013-01-01

Abstract A new species of Melibe is described based on two specimens collected in Florida. This new species is well differentiated morphologically and genetically from other species of Melibe studied to date. The four residue deletions in the cytochrome c oxidase subunit 1 protein found in all previously sequenced tropical species of Melibe sequenced (and Melibe rosea) are also present in this new species. These deletions do not appear to affect important structural components of this protein but might have fitness implications. This paper provides the first confirmed record of Melibe in the tropical western Atlantic Ocean. PMID:23878514

[Molecular mechanisms in sex determination: from gene regulation to pathology].

PubMed

Ravel, C; Chantot-Bastaraud, S; Siffroi, J-P

2004-01-01

Testis determination is the complex process by which the bipotential gonad becomes a normal testis during embryo development. As a consequence, this process leads to sexual differentiation corresponding to the masculinization of both genital track and external genitalia. The whole phenomenon is under genetic control and is particularly driven by the presence of the Y chromosome and by the SRY gene, which acts as the key initiator of the early steps of testis determination. However, many other autosomal genes, present in both males and females, are expressed during testis formation in a gene activation pathway, which is far to be totally elucidated. All these genes act in a dosage-sensitive manner by which quantitative gene abnormalities, due to chromosomal deletions, duplications or mosaicism, may lead to testis determination failure and sex reversal.

Limb Girdle Muscular Dystrophy Type 2E Due to a Novel Large Deletion in SGCB Gene.

PubMed

Ghafouri-Fard, Soudeh; Hashemi-Gorji, Feyzollah; Fardaei, Majid; Miryounesi, Mohammad

2017-01-01

Autosomal recessive limb-girdle muscular dystrophies (LGMD type 2) are a group of clinically and genetically heterogeneous diseases with the main characteristics of weakness and wasting of the pelvic and shoulder girdle muscles. Among them are sarcoglycanopathies caused by mutations in at least four genes named SGCA, SGCB, SGCG and SGCD. Here we report a consanguineous Iranian family with two children affected with LGMD type 2E. Mutation analysis revealed a novel homozygous exon 2 deletion of SGCB gene in the patients with the parents being heterozygous for this deletion. This result presents a novel underlying genetic mechanism for LGMD type 2E.

Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

PubMed

Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

2016-04-01

The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

A critical analysis of disease-associated DNA polymorphisms in the genes of cattle, goat, sheep, and pig

PubMed Central

Ibeagha-Awemu, Eveline M.; Kgwatalala, Patrick; Ibeagha, Aloysius E.

2008-01-01

Genetic variations through their effects on gene expression and protein function underlie disease susceptibility in farm animal species. The variations are in the form of single nucleotide polymorphisms, deletions/insertions of nucleotides or whole genes, gene or whole chromosomal rearrangements, gene duplications, and copy number polymorphisms or variants. They exert varying degrees of effects on gene action, such as substitution of an amino acid for another, shift in reading frame and premature termination of translation, and complete deletion of entire exon(s) or gene(s) in diseased individuals. These factors influence gene function by affecting mRNA splicing pattern or by altering/eliminating protein function. Elucidating the genetic bases of diseases under the control of many genes is very challenging, and it is compounded by several factors, including host × pathogen × environment interactions. In this review, the genetic variations that underlie several diseases of livestock (under monogenic and polygenic control) are analyzed. Also, factors hampering research efforts toward identification of genetic influences on animal disease identification and control are highlighted. A better understanding of the factors analyzed could be better harnessed to effectively identify and control, genetically, livestock diseases. Finally, genetic control of animal diseases can reduce the costs associated with diseases, improve animal welfare, and provide healthy animal products to consumers, and should be given more attention. PMID:18350334

De novo deletion of chromosome 11q12.3 in monozygotic twins affected by Poland Syndrome.

PubMed

Vaccari, Carlotta Maria; Romanini, Maria Victoria; Musante, Ilaria; Tassano, Elisa; Gimelli, Stefania; Divizia, Maria Teresa; Torre, Michele; Morovic, Carmen Gloria; Lerone, Margherita; Ravazzolo, Roberto; Puliti, Aldamaria

2014-05-30

Poland Syndrome (PS) is a rare disorder characterized by hypoplasia/aplasia of the pectoralis major muscle, variably associated with thoracic and upper limb anomalies. Familial recurrence has been reported indicating that PS could have a genetic basis, though the genetic mechanisms underlying PS development are still unknown. Here we describe a couple of monozygotic (MZ) twin girls, both presenting with Poland Syndrome. They carry a de novo heterozygous 126 Kbp deletion at chromosome 11q12.3 involving 5 genes, four of which, namely HRASLS5, RARRES3, HRASLS2, and PLA2G16, encode proteins that regulate cellular growth, differentiation, and apoptosis, mainly through Ras-mediated signaling pathways. Phenotype concordance between the monozygotic twin probands provides evidence supporting the genetic control of PS. As genes controlling cell growth and differentiation may be related to morphological defects originating during development, we postulate that the observed chromosome deletion could be causative of the phenotype observed in the twin girls and the deleted genes could play a role in PS development.

A reverse engineering algorithm for neural networks, applied to the subthalamopallidal network of basal ganglia.

PubMed

Floares, Alexandru George

2008-01-01

Modeling neural networks with ordinary differential equations systems is a sensible approach, but also very difficult. This paper describes a new algorithm based on linear genetic programming which can be used to reverse engineer neural networks. The RODES algorithm automatically discovers the structure of the network, including neural connections, their signs and strengths, estimates its parameters, and can even be used to identify the biophysical mechanisms involved. The algorithm is tested on simulated time series data, generated using a realistic model of the subthalamopallidal network of basal ganglia. The resulting ODE system is highly accurate, and results are obtained in a matter of minutes. This is because the problem of reverse engineering a system of coupled differential equations is reduced to one of reverse engineering individual algebraic equations. The algorithm allows the incorporation of common domain knowledge to restrict the solution space. To our knowledge, this is the first time a realistic reverse engineering algorithm based on linear genetic programming has been applied to neural networks.

Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.

PubMed

Cox-Paulson, Elisabeth A; Grana, Theresa M; Harris, Michelle A; Batzli, Janet M

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms.

Studying Human Disease Genes in Caenorhabditis elegans: A Molecular Genetics Laboratory Project

PubMed Central

Cox-Paulson, Elisabeth A.; Grana, Theresa M.; Harris, Michelle A.; Batzli, Janet M.

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms. PMID:22665589

Hereditary neuropathy with liability to pressure palsy: two cases of difficult diagnosis.

PubMed

Beydoun, Said R; Cho, Justin

2013-09-01

Hereditary neuropathy with liability to pressure palsies (HNPP) is an inherited autosomal dominant disorder that causes a polyneuropathy with predisposition for involvement at sites of compression and is often underdiagnosed or misdiagnosed due to its heterogeneity in clinical and electrophysiological presentation. We report 2 cases of HNPP, which were initially diagnosed and treated as either an acquired demyelinating disorder or alternative inherited demyelinating disorder. Thorough evaluation of repeat electrodiagnostic studies and genetic testing confirmed the diagnosis of HNPP in both cases. One case showed the classic peripheral myelin protein 22 (PMP22) deletion and the other case showed a previously reported single base pair deletion at Leu145 causing a frameshift mutation at the PMP22 gene. These cases underscore the difficulty of diagnosing HNPP, because of the variations in clinical and electrophysiological findings and reinforce the importance of a combination high index of clinical suspicion, electrodiagnostic testing, and genetic testing to make the diagnosis.

SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

PubMed

Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

2007-11-01

Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

Alpha 2B adrenoceptor genotype moderates effect of reboxetine on negative emotional memory bias in healthy volunteers.

PubMed

Gibbs, Ayana A; Bautista, Carla E; Mowlem, Florence D; Naudts, Kris H; Duka, Theodora

2013-10-23

Evidence suggests that emotional memory plays a role in the pathophysiology of depression/anxiety disorders. Noradrenaline crucially modulates emotional memory. Genetic variants involved in noradrenergic signaling contribute to individual differences in emotional memory and vulnerability to psychopathology. A functional deletion polymorphism in the α-2B adrenoceptor gene (ADRA2B) has been linked to emotional memory and post-traumatic stress disorder. The noradrenaline reuptake inhibitor reboxetine attenuates enhanced memory for negative stimuli in healthy and depressed individuals. We examined whether the effect of reboxetine on emotional memory in healthy individuals would be moderated by ADRA2B genotype. ADRA2B deletion carriers demonstrated enhanced emotional memory for negative stimuli compared with deletion noncarriers, consistent with prior studies. Reboxetine attenuated enhanced memory for negative stimuli in deletion noncarriers but had no significant effect in deletion carriers. This is the first demonstration of genetic variation influencing antidepressant drug effects on emotional processing in healthy humans.

Construction of a 780-kb PAC, BAC, and cosmid contig encompassing the minimal critical deletion involved in B cell lymphocytic leukemia at 13q14.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bouyge-Moreau, I.; Rondeau, G.; Andre, M.T.

A putative tumor suppressor gene involved in B cell chronic lymphocytic leukemia (B-CLL) was mapped to human chromosome 13q14.3 close to the genetic markers D13S25 and D13S319. We constructed a 780-kb-long contig composed of cosmids, bacterial artificial chromosomes, and bacteriophage PI-derived artificial chromosomes that provides essential information and tools for the positional cloning of this gene. The contig contains both flanking markers as well as several additional genetic markers, three ESTs, and one potential CpG island. In addition, using one B-CLL patient, we characterized a small internal deleted region of 550 kb. Comparing this deletion with other recently published deletionsmore » narrows the minimally deleted area to less than 100 kb in our physical map. This deletion core region should contain all or part of the disrupted in B cell malignancies tumor suppressor gene. 27 refs., 3 figs.« less

Copy number variations in Saudi family with intellectual disability and epilepsy.

PubMed

Naseer, Muhammad I; Chaudhary, Adeel G; Rasool, Mahmood; Kalamegam, Gauthaman; Ashgan, Fai T; Assidi, Mourad; Ahmed, Farid; Ansari, Shakeel A; Zaidi, Syed Kashif; Jan, Mohammed M; Al-Qahtani, Mohammad H

2016-10-17

Epilepsy is genetically complex but common brain disorder of the world affecting millions of people with almost of all age groups. Novel Copy number variations (CNVs) are considered as important reason for the numerous neurodevelopmental disorders along with intellectual disability and epilepsy. DNA array based studies contribute to explain a more severe clinical presentation of the disease but interoperation of many detected CNVs are still challenging. In order to study novel CNVs with epilepsy related genes in Saudi family with six affected and two normal individuals with several forms of epileptic seizures, intellectual disability (ID), and minor dysmorphism, we performed the high density whole genome Agilent sure print G3 Hmn CGH 2x 400 K array-CGH chips analysis. Our results showed de novo deletions, duplications and deletion plus duplication on differential chromosomal regions in the affected individuals that were not shown in the normal fathe and normal kids by using Agilent CytoGenomics 3.0.6.6 softwear. Copy number gain were observed in the chromosome 1, 16 and 22 with LCE3C, HPR, GSTT2, GSTTP2, DDT and DDTL genes respectively whereas the deletions observed in the chromosomal regions 8p23-p21 (4303127-4337759) and the potential gene in this region is CSMD1 (OMIM: 612279). Moreover, the array CGH results deletions and duplication were also validated by using primer design of deleted regions utilizing the flanked SNPs using simple PCR and also by using quantitative real time PCR. We found some of the de novo deletions and duplication in our study in Saudi family with intellectual disability and epilepsy. Our results suggest that array-CGH should be used as a first line of genetic test for epilepsy except there is a strong indication for a monogenic syndrome. The advanced high through put array-CGH technique used in this study aim to collect the data base and to identify new mechanisms describing epileptic disorder, may help to improve the clinical management of individual cases in decreasing the burden of epilepsy in Saudi Arabia.

Large-scale mapping of cortical alterations in 22q11.2 deletion syndrome: Convergence with idiopathic psychosis and effects of deletion size.

PubMed

Sun, Daqiang; Ching, Christopher R K; Lin, Amy; Forsyth, Jennifer K; Kushan, Leila; Vajdi, Ariana; Jalbrzikowski, Maria; Hansen, Laura; Villalon-Reina, Julio E; Qu, Xiaoping; Jonas, Rachel K; van Amelsvoort, Therese; Bakker, Geor; Kates, Wendy R; Antshel, Kevin M; Fremont, Wanda; Campbell, Linda E; McCabe, Kathryn L; Daly, Eileen; Gudbrandsen, Maria; Murphy, Clodagh M; Murphy, Declan; Craig, Michael; Vorstman, Jacob; Fiksinski, Ania; Koops, Sanne; Ruparel, Kosha; Roalf, David R; Gur, Raquel E; Schmitt, J Eric; Simon, Tony J; Goodrich-Hunsaker, Naomi J; Durdle, Courtney A; Bassett, Anne S; Chow, Eva W C; Butcher, Nancy J; Vila-Rodriguez, Fidel; Doherty, Joanne; Cunningham, Adam; van den Bree, Marianne B M; Linden, David E J; Moss, Hayley; Owen, Michael J; Murphy, Kieran C; McDonald-McGinn, Donna M; Emanuel, Beverly; van Erp, Theo G M; Turner, Jessica A; Thompson, Paul M; Bearden, Carrie E

2018-06-13

The 22q11.2 deletion (22q11DS) is a common chromosomal microdeletion and a potent risk factor for psychotic illness. Prior studies reported widespread cortical changes in 22q11DS, but were generally underpowered to characterize neuroanatomic abnormalities associated with psychosis in 22q11DS, and/or neuroanatomic effects of variability in deletion size. To address these issues, we developed the ENIGMA (Enhancing Neuro Imaging Genetics Through Meta-Analysis) 22q11.2 Working Group, representing the largest analysis of brain structural alterations in 22q11DS to date. The imaging data were collected from 10 centers worldwide, including 474 subjects with 22q11DS (age = 18.2 ± 8.6; 46.9% female) and 315 typically developing, matched controls (age = 18.0 ± 9.2; 45.9% female). Compared to controls, 22q11DS individuals showed thicker cortical gray matter overall (left/right hemispheres: Cohen's d = 0.61/0.65), but focal thickness reduction in temporal and cingulate cortex. Cortical surface area (SA), however, showed pervasive reductions in 22q11DS (left/right hemispheres: d = -1.01/-1.02). 22q11DS cases vs. controls were classified with 93.8% accuracy based on these neuroanatomic patterns. Comparison of 22q11DS-psychosis to idiopathic schizophrenia (ENIGMA-Schizophrenia Working Group) revealed significant convergence of affected brain regions, particularly in fronto-temporal cortex. Finally, cortical SA was significantly greater in 22q11DS cases with smaller 1.5 Mb deletions, relative to those with typical 3 Mb deletions. We found a robust neuroanatomic signature of 22q11DS, and the first evidence that deletion size impacts brain structure. Psychotic illness in this highly penetrant deletion was associated with similar neuroanatomic abnormalities to idiopathic schizophrenia. These consistent cross-site findings highlight the homogeneity of this single genetic etiology, and support the suitability of 22q11DS as a biological model of schizophrenia.

Spectra of spontaneous frameshift mutations at the hisD3052 allele of Salmonella typhimurium in four DNA repair backgrounds.

PubMed Central

DeMarini, D M; Shelton, M L; Abu-Shakra, A; Szakmary, A; Levine, J G

1998-01-01

To characterize the hisD3052 -1 frameshift allele of Salmonella typhimurium, we analyzed approximately 6000 spontaneous revertants (rev) for a 2-base deletion hotspot within the sequence (CG)4, and we sequenced approximately 500 nonhotspot rev. The reversion target is a minimum of 76 bases (nucleotides 843-918) that code for amino acids within a nonconserved region of the histidinol dehydrogenase protein. Only 0.4-3.9% were true rev. Of the following classes, 182 unique second-site mutations were identified: hotspot, complex frameshifts requiring DeltauvrB + pKM101 (TA98-specific) or not (concerted), 1-base insertions, duplications, and nonhotspot deletions. The percentages of hotspot mutations were 13.8% in TA1978 (wild type), 24.5% in UTH8413 (pKM101), 31.6% in TA1538 (DeltauvrB), and 41.0% in TA98 (DeltauvrB, pKM101). The DeltauvrB allele decreased by three times the mutant frequency (MF, rev/10(8) survivors) of duplications and increased by about two times the MF of deletions. Separately, the DeltauvrB allele or pKM101 plasmid increased by two to three times the MF of hotspot mutations; combined, they increased this MF by five times. The percentage of 1-base insertions was not influenced by either DeltauvrB or pKM101. Hotspot deletions and TA98-specific complex frameshifts are inducible by some mutagens; concerted complex frameshifts and 1-base insertions are not; and there is little evidence for mutagen-induced duplications and nonhotspot deletions. Except for the base substitutions in TA98-specific complex frameshifts, all spontaneous mutations of the hisD3052 allele are likely templated. The mechanisms may involve (1) the potential of direct and inverted repeats to undergo slippage and misalignment and to form quasi-palindromes and (2) the interaction of these sequences with DNA replication and repair proteins. PMID:9584083

Progressive but Previously Untreated CLL Patients with Greater Array CGH Complexity Exhibit a Less Durable Response to Chemoimmunotherapy

PubMed Central

Kay, Neil E.; Eckel-Passow, Jeanette E.; Braggio, Esteban; VanWier, Scott; Shanafelt, Tait D.; Van Dyke, Daniel L.; Jelinek, Diane F.; Tschumper, Renee C.; Kipps, Thomas; Byrd, John C.; Fonseca, Rafael

2010-01-01

To better understand the implications of genomic instability and outcome in B-cell CLL, we sought to address genomic complexity as a predictor of chemosensitivity and ultimately clinical outcome in this disease. We employed array-based comparative genomic hybridization (aCGH), using a one-million probe array and identified gains and losses of genetic material in 48 patients treated on a chemoimmunotherapy (CIT) clinical trial. We identified chromosomal gain or loss in ≥6% of the patients on chromosomes 3, 8, 9, 10, 11, 12, 13, 14 and 17. Higher genomic complexity, as a mechanism favoring clonal selection, was associated with shorter progression-free survival and predicted a poor response to treatment. Of interest, CLL cases with loss of p53 surveillance showed more complex genomic features and were found both in patients with a 17p13.1 deletion and in the more favorable genetic subtype characterized by the presence of 13q14.1 deletion. This aCGH study adds information on the association between inferior trial response and increasing genetic complexity as CLL progresses. PMID:21156228

Rhabdoid glioblastoma is distinguishable from classical glioblastoma by cytogenetics and molecular genetics.

PubMed

Byeon, Sun-Ju; Cho, Hwa Jin; Baek, Hae Woon; Park, Chul-Kee; Choi, Seung-Hong; Kim, Se-Hoon; Kim, Hee Kyung; Park, Sung-Hye

2014-03-01

The clinicopathologic and molecular genetic features of 5 cases of rhabdoid glioblastoma, an extremely rare variant of glioblastoma that tends to affect patients at a young age, were investigated by immunohistochemical analysis and focused molecular genetic studies including array-based comparative genomic hybridization. All 5 cases had supratentorial tumors that immunohistochemical analysis revealed to be robustly positive for epithelial membrane antigen, vimentin, p53, and PDGFRα (platelet-derived growth factor receptor, alpha polypeptide) but only focally positive for glial fibrillary acidic protein. Although complete retention of SMARCB1 (INI1) was observed in all 5 cases, epidermal growth factor receptor (EGFR) amplification, PTEN (phosphatase and tensin homolog) loss, homozygous deletion of cyclin-dependent kinase inhibitor 2A, 1p/19q codeletion, and isocitrate dehydrogenase 1 R132/IDH2 R172 mutation were not observed in any case, although a high level of EGFR polysomy was detected in 1 recurrent tumor. Although c-MET (MET protein) expression was focal but robustly positive in 3 cases, met proto-oncogene (MET) fluorescence in situ hybridization revealed low polysomy but not MET amplification. MGMT (O-6-methylguanine-DNA methyl-40 transferase) methylation-specific polymerase chain reaction revealed MGMT methylation in only 1 case. Furthermore, array-based comparative genomic hybridization revealed gain of chromosome 7 and loss of 1p, 6, 8p, 11, 13q, and 18q but no deletion of chromosome 22. In contrast to the classical subtype of primary glioblastoma, the cases studied here were characterized by the absence of EGFR amplification, PTEN loss, and 9p homozygous deletion and overexpression of p53, PDGFRα, and c-MET, suggesting that they can be classified as the proneural or mesenchymal subtype of glioblastoma and benefit from intensive therapy that includes temozolomide. Copyright © 2014 Elsevier Inc. All rights reserved.

Genetics Home Reference: 17q12 deletion syndrome

MedlinePlus

... spectrum disorder (which affects social interaction and communication), schizophrenia , anxiety, and bipolar disorder . Less commonly, 17q12 deletion ... Encyclopedia: Autism Spectrum Disorder Encyclopedia: Bipolar Disorder Encyclopedia: ... Topic: Developmental Disabilities Health Topic: Diabetes Health ...

Fluorescence in situ hybridization for the diagnosis of NPHP1 deletion-related nephronophthisis on renal biopsy.

PubMed

Larsen, Christopher P; Bonsib, Stephen M; Beggs, Marjorie L; Wilson, Jon D

2018-06-24

Nephronophthisis is an autosomal recessive tubulointerstitial nephropathy that is a leading genetic etiology of end stage renal disease in children and young adults. Approximately 60% of patients with a known genetic etiology of nephronophthisis are due to homozygous deletion of the NPHP1 gene. We identified a total of 45 renal biopsies from young patients with chronic kidney disease of undetermined etiology and analyzed them for the possibility of nephronophthisis due to NPHP1 deletion using interphase fluorescence in situ hybridization and/or polymerase chain reaction. Homozygous NPHP1 deletion was identified in nine patients (20%). In cases with adequate tissue, both assays were performed and showed 100% agreement. Blinded histopathologic analysis was then performed and identified six lesions that were significantly more common in biopsies from patients with NPHP1 deletion-proven nephronophthisis than chronic kidney injury of other known etiologies. Many of the classically described nephronophthisis biopsy lesions such as tubular basement membrane duplication, presence of cysts, and mononuclear interstitial inflammation were not significantly associated with this disease when compared with biopsies from patients with chronic kidney injury due to other etiologies. There were, however, morphologic lesions that were strongly associated with NPHP1 deletion including tubular abnormalities such as diverticulum, florets, and macula densa-like change as well as interstitial Tamm-Horsfall aggregates, periglomerular fibrosis, and the absence of arteriosclerosis. Awareness of the histopathologic pattern of injury in nephronophthisis combined with testing for NPHP1 deletion enables renal pathologists to provide a definitive pathologic and genetic diagnosis in a subset of patients with this disease. Copyright © 2018. Published by Elsevier Inc.

The BIM deletion polymorphism: A paradigm of a permissive interaction between germline and acquired TKI resistance factors in chronic myeloid leukemia.

PubMed

Ko, Tun Kiat; Chin, Hui San; Chuah, Charles T H; Huang, John W J; Ng, King-Pan; Khaw, Seong Lin; Huang, David C S; Ong, S Tiong

2016-01-19

Both germline polymorphisms and tumor-specific genetic alterations can determine the response of a cancer to a given therapy. We previously reported a germline deletion polymorphism in the BIM gene that was sufficient to mediate intrinsic resistance to tyrosine kinase inhibitors (TKI) in chronic myeloid leukemia (CML), as well as other cancers [1]. The deletion polymorphism favored the generation of BIM splice forms lacking the pro-apoptotic BH3 domain, conferring a relative resistance to the TKI imatinib (IM). However, CML patients with the BIM deletion polymorphism developed both partial and complete IM resistance. To understand the mechanisms underlying the latter, we grew CML cells either with or without the BIM deletion polymorphism in increasing IM concentrations. Under these conditions, the BIM deletion polymorphism enhanced the emergence of populations with complete IM resistance, mimicking the situation in patients. Importantly, the combined use of TKIs with the BH3 mimetic ABT-737 overcame the BCR-ABL1-dependent and -independent resistance mechanisms found in these cells. Our results illustrate the interplay between germline and acquired genetic factors in confering TKI resistance, and suggest a therapeutic strategy for patients with complete TKI resistance associated with the BIM deletion polymorphism.

A Highly Thermostable Kanamycin Resistance Marker Expands the Tool Kit for Genetic Manipulation of Caldicellulosiruptor bescii

PubMed Central

Lipscomb, Gina L.; Conway, Jonathan M.; Blumer-Schuette, Sara E.; Kelly, Robert M.

2016-01-01

ABSTRACT Caldicellulosiruptor bescii, an anaerobic Gram-positive bacterium with an optimal growth temperature of 78°C, is the most thermophilic cellulose degrader known. It is of great biotechnological interest, as it efficiently deconstructs nonpretreated lignocellulosic plant biomass. Currently, its genetic manipulation relies on a mutant uracil auxotrophic background strain that contains a random deletion in the pyrF genome region. The pyrF gene serves as a genetic marker to select for uracil prototrophy, and it can also be counterselected for loss via resistance to the compound 5-fluoroorotic acid (5-FOA). To expand the C. bescii genetic tool kit, kanamycin resistance was developed as a selection for genetic manipulation. A codon-optimized version of the highly thermostable kanamycin resistance gene (named Cbhtk) allowed the use of kanamycin selection to obtain transformants of either replicating or integrating vector constructs in C. bescii. These strains showed resistance to kanamycin at concentrations >50 μg · ml−1, whereas wild-type C. bescii was sensitive to kanamycin at 10 μg · ml−1. In addition, placement of the Cbhtk marker between homologous recombination regions in an integrating vector allowed direct selection of a chromosomal mutation using both kanamycin and 5-FOA. Furthermore, the use of kanamycin selection enabled the targeted deletion of the pyrE gene in wild-type C. bescii, generating a uracil auxotrophic genetic background strain resistant to 5-FOA. The pyrE gene functioned as a counterselectable marker, like pyrF, and was used together with Cbhtk in the ΔpyrE background strain to delete genes encoding lactate dehydrogenase and the CbeI restriction enzyme. IMPORTANCE Caldicellulosiruptor bescii is a thermophilic anaerobic bacterium with an optimal growth temperature of 78°C, and it has the ability to efficiently deconstruct nonpretreated lignocellulosic plant biomass. It is, therefore, of biotechnological interest for genetic engineering applications geared toward biofuel production. The current genetic system used with C. bescii is based upon only a single selection strategy, and this uses the gene involved in a primary biosynthetic pathway. There are many advantages with an additional genetic selection using an antibiotic. This presents a challenge for thermophilic microorganisms, as only a limited number of antibiotics are stable above 50°C, and a thermostable version of the enzyme conferring antibiotic resistance must be obtained. In this work, we have developed a selection system for C. bescii using the antibiotic kanamycin and have shown that, in combination with the biosynthetic gene marker, it can be used to efficiently delete genes in this organism. PMID:27208106

[Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

PubMed

Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

2016-08-01

To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia 1.

Genome-wide analysis of mutations in mutant lineages selected following fast-neutron irradiation mutagenesis of Arabidopsis thaliana

PubMed Central

Belfield, Eric J.; Gan, Xiangchao; Mithani, Aziz; Brown, Carly; Jiang, Caifu; Franklin, Keara; Alvey, Elizabeth; Wibowo, Anjar; Jung, Marko; Bailey, Kit; Kalwani, Sharan; Ragoussis, Jiannis; Mott, Richard; Harberd, Nicholas P.

2012-01-01

Ionizing radiation has long been known to induce heritable mutagenic change in DNA sequence. However, the genome-wide effect of radiation is not well understood. Here we report the molecular properties and frequency of mutations in phenotypically selected mutant lines isolated following exposure of the genetic model flowering plant Arabidopsis thaliana to fast neutrons (FNs). Previous studies suggested that FNs predominantly induce deletions longer than a kilobase in A. thaliana. However, we found a higher frequency of single base substitution than deletion mutations. While the overall frequency and molecular spectrum of fast-neutron (FN)–induced single base substitutions differed substantially from those of “background” mutations arising spontaneously in laboratory-grown plants, G:C>A:T transitions were favored in both. We found that FN-induced G:C>A:T transitions were concentrated at pyrimidine dinucleotide sites, suggesting that FNs promote the formation of mutational covalent linkages between adjacent pyrimidine residues. In addition, we found that FNs induced more single base than large deletions, and that these single base deletions were possibly caused by replication slippage. Our observations provide an initial picture of the genome-wide molecular profile of mutations induced in A. thaliana by FN irradiation and are particularly informative of the nature and extent of genome-wide mutation in lines selected on the basis of mutant phenotypes from FN-mutagenized A. thaliana populations. PMID:22499668

Discrimination learning and attentional set formation in a mouse model of Fragile X.

PubMed

Casten, Kimberly S; Gray, Annette C; Burwell, Rebecca D

2011-06-01

Fragile X Syndrome is the most prevalent genetic cause of mental retardation. Selective deficits in executive function, including inhibitory control and attention, are core features of the disorder. In humans, Fragile X results from a trinucleotide repeat in the Fmr1 gene that renders it functionally silent and has been modeled in mice by targeted deletion of the Fmr1 gene. Fmr1 knockout (KO) mice recapitulate many features of Fragile X syndrome, but evidence for deficits in executive function is inconsistent. To address this issue, we trained wild-type and Fmr1 KO mice on an experimental paradigm that assesses attentional set-shifting. Mice learned to discriminate between stimuli differing in two of three perceptual dimensions. Successful discrimination required attending only to the relevant dimension, while ignoring irrelevant dimensions. Mice were trained on three discriminations in the same perceptual dimension, each followed by a reversal. This procedure normally results in the formation of an attentional set to the relevant dimension. Mice were then required to shift attention and discriminate based on a previously irrelevant perceptual dimension. Wild-type mice exhibited the increase in trials to criterion expected when shifting attention from one perceptual dimension to another. In contrast, the Fmr1 KO group failed to show the expected increase, suggesting impairment in forming an attentional set. Fmr1 KO mice also exhibited a general impairment in learning discriminations and reversals. This is the first demonstration that Fmr1 KO mice show a deficit in attentional set formation.

Interstitial deletion in the long arms of chromosome 1: 46,XY,del(1)(pter leads to q22::q25 leads to qter).

PubMed Central

de Pablo, C E; García Sagredo, J M; Ferro, M T; Ferrando, P; San Román, C

1980-01-01

A child was brought to us with multiple anomalies. On examination we found an interstitial deletion in the long arms of chromosome 1. We studied genetic and chromosome markers, comparing our clinical and cytogenetic findings with other reported cases of chromosome 1 interstitial deletion. Images PMID:6937620

Cardiac Defects and Results of Cardiac Surgery in 22q11.2 Deletion Syndrome

ERIC Educational Resources Information Center

Carotti, Adriano; Digilio, Maria Cristina; Piacentini, Gerardo; Saffirio, Claudia; Di Donato, Roberto M.; Marino, Bruno

2008-01-01

Specific types and subtypes of cardiac defects have been described in children with 22q11.2 deletion syndrome as well as in other genetic syndromes. The conotruncal heart defects occurring in patients with 22q11.2 deletion syndrome include tetralogy of Fallot, pulmonary atresia with ventricular septal defect, truncus arteriosus, interrupted aortic…

Effects of ion beam irradiation on size of mutant sector and genetic damage in Arabidopsis

NASA Astrophysics Data System (ADS)

Hase, Yoshihiro; Nozawa, Shigeki; Narumi, Issay; Oono, Yutaka

2017-01-01

Size of mutant sector and genetic damage were evaluated in Arabidopsis to further our understanding of effective ion beam use in plant mutation breeding. Arabidopsis seeds, heterozygous for the GLABRA1 (GL1) gene (GL1/gl1-1), were irradiated with 15.8 MeV/u neon ions (mean linear energy transfer (LET): 352 keV/μm), 17.3 MeV/u carbon ions (113 keV/μm), or 60Co gamma rays. The frequency and size of glabrous sectors generated because of inactivation of the GL1 allele were examined. The frequency and overall size of large deletions were evaluated based on the loss of heterozygosity of DNA markers using DNA isolated from glabrous tissue. Irrespective of the radiation properties, plants with mutant sectors were obtained at similar frequencies at the same effective dosage necessary for survival reduction. Ion beams tended to induce larger mutant sectors than gamma rays. The frequency of large deletions (>several kbp) increased as the LET value increased, with chromosome regions larger than 100 kbp lost in most large deletions. The distorted segregation ratio of glabrous plants in the progenies of irradiated GL1/gl1-1 plants suggested frequent occurrence of chromosome rearrangement, especially those subjected to neon ions. Exposure to ion beams with moderate LET values (30-110 keV/μm) is thought effective for inducing mutant sectors without causing extensive genetic damage.

[Clinical and genetic study of an infant with Alagille syndrome: identification of a novel chromosomal interstitial deletion including JAG1 gene].

PubMed

Li, Hua; Liu, Jia-Jia; Deng, Mei; Guo, Li; Cheng, Ying; Song, Yuan-Zong

2017-10-01

Alagille syndrome (ALGS) is an autosomal dominant disease affecting multiple systems including the liver, heart, skeleton, eyes, kidneys and face. This paper reports the clinical and genetic features of an infant with this disease. A 3-month-and-10-day-old female infant was referred to the hospital with jaundiced skin and sclera for 3 months. Physical examination revealed wide forehead and micromandible. A systolic murmur of grade 3-4/6 was heard between the 2th and 3th intercostal spaces on the left side of the sternum. The abdomen was distended, and the liver palpable 3 cm under the right subcostal margin with a medium texture. Serum biochemistry analysis revealed abnormal liver function indices, with markedly elevated bilirubin (predominantly direct bilirubin), total bile acids (TBA) and gamma-glutamyl transpeptidase (GGT). Atrial septal defect and pulmonary stenosis were detected on echocardiography. Next generation sequencing detected entire deletion of the JAG1 gene, and then chromosomal microarray analysis revealed a novel interstitial deletion of 3.0 Mb in size on chr20p12.3p12.2, involving JAG1 gene. The child had special facial features, heart malformations, and cholestasis, and based on the genetic findings, ALGS was definitively diagnosed. Thereafter, symptomatic and supportive treatment was introduced. Thus far, the infant had been followed up till his age of 11 months. The hyperbilirubinemia got improved, but GGT and TBA were persistently elevated, and the long-term outcome needs to be observed. This study extended the JAG1 mutation spectrum, and provided laboratory evidences for the diagnosis and treatment of the patient, and for the genetic counseling and prenatal diagnosis in the family.

An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

PubMed Central

Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

2007-01-01

Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

Double Hits in Schizophrenia.

PubMed

Vorstman, Jacob A S; Olde Loohuis, Loes M; Kahn, René S; Ophoff, Roel A

2018-05-14

The co-occurrence of a Copy Number Variant (CNV) and a functional variant on the other allele may be a relevant genetic mechanism in schizophrenia. We hypothesized that the cumulative burden of such double hits - in particular those composed of a deletion and a coding single nucleotide variation (SNV) - is increased in patients with schizophrenia.We combined CNV data with coding variants data in 795 patients with schizophrenia and 474 controls. To limit false CNV-detection, only CNVs called only by two algorithms we included. CNV-affected genes were subsequently examined for coding SNVs, which we termed "CNV-SNVs". Correcting for total queried sequence, we assessed the CNV-SNV-burden and the combined predicted deleterious effect. We estimated p-values by permutation of the phenotype.We detected 105 CNV-SNVs; 67 in duplicated and 38 in deleted genic sequence. While the difference in CNV-SNVs rates was not significant, the combined deleteriousness inferred by CNV-SNVs in deleted sequence was almost fourfold higher in cases compared to controls (nominal p = 0.009). This effect may be driven by a higher number of CNV-SNVs and/or by a higher degree of predicted deleteriousness of CNV-SNVs. No such effect was observed for duplications.We provide early evidence that deletions co-occurring with a functional variant may be relevant, albeit of modest impact, for the genetic etiology of schizophrenia. Large-scale consortium studies are required to validate our findings. Sequence-based analyses would provide the best resolution for detection of CNVs as well as coding variants genome-wide.

Efficiently hiding sensitive itemsets with transaction deletion based on genetic algorithms.

PubMed

Lin, Chun-Wei; Zhang, Binbin; Yang, Kuo-Tung; Hong, Tzung-Pei

2014-01-01

Data mining is used to mine meaningful and useful information or knowledge from a very large database. Some secure or private information can be discovered by data mining techniques, thus resulting in an inherent risk of threats to privacy. Privacy-preserving data mining (PPDM) has thus arisen in recent years to sanitize the original database for hiding sensitive information, which can be concerned as an NP-hard problem in sanitization process. In this paper, a compact prelarge GA-based (cpGA2DT) algorithm to delete transactions for hiding sensitive itemsets is thus proposed. It solves the limitations of the evolutionary process by adopting both the compact GA-based (cGA) mechanism and the prelarge concept. A flexible fitness function with three adjustable weights is thus designed to find the appropriate transactions to be deleted in order to hide sensitive itemsets with minimal side effects of hiding failure, missing cost, and artificial cost. Experiments are conducted to show the performance of the proposed cpGA2DT algorithm compared to the simple GA-based (sGA2DT) algorithm and the greedy approach in terms of execution time and three side effects.

Top1 May Do More Than Relax DNA | Center for Cancer Research

Cancer.gov

Topoisomerase 1 (Top1) is an enzyme with a well known role in relaxing DNA supercoils by making reversible nicks in DNA. The ribonuclease (RNase) H class of enzymes is equally well known for removing ribonucleotides from hybrid duplex DNA when they are misincorporated during DNA replication. Recently, Shar-yin Huang, Ph.D., and Yves Pommier, M.D., Ph.D., in CCR’s Laboratory of Molecular Pharmacology teamed up with Sue Jinks-Robertson of Duke University’s Department of Molecular Genetics and Microbiology and Thomas Kunkel of the NIEHS, NIH to show that in yeast, Top1 can act like the RNase H class enzymes and convert misincorporated single ribonucleotides into irreversible single-strand breaks, an activity that produces deletion mutations.  They reported this discovery in Science.

Novel features of 3q29 deletion syndrome: Results from the 3q29 registry

PubMed Central

Glassford, Megan R.; Rosenfeld, Jill A.; Freedman, Alexa A.; Zwick, Michael E.

2016-01-01

3q29 deletion syndrome is caused by a recurrent, typically de novo heterozygous 1.6 Mb deletion, but because incidence of the deletion is rare (1 in 30,000 births) the phenotype is not well described. To characterize the range of phenotypic manifestations associated with 3q29 deletion syndrome, we have developed an online registry (3q29deletion.org) for ascertainment of study subjects and phenotypic data collection via Internet‐based survey instruments. We report here on data collected during the first 18 months of registry operation, from 44 patients. This is the largest cohort of 3q29 deletion carriers ever assembled and surveyed in a systematic way. Our data reveal that 28% of registry participants report neuropsychiatric phenotypes, including anxiety disorder, panic attacks, depression, bipolar disorder, and schizophrenia. Other novel findings include a high prevalence (64%) of feeding problems in infancy and reduced weight at birth for 3q29 deletion carriers (average reduction 13.9 oz (394 g), adjusted for gestational age and sex, P = 6.5e‐07). We further report on the frequency of heart defects, autism, recurrent ear infections, gastrointestinal phenotypes, and dental phenotypes, among others. We also report on the expected timing of delayed developmental milestones. This is the most comprehensive description of the 3q29 deletion phenotype to date. These results are clinically actionable toward improving patient care for 3q29 deletion carriers, and can guide the expectations of physicians and parents. These data also demonstrate the value of patient‐reported outcomes to reveal the full phenotypic spectrum of rare genomic disorders. © 2016 The Authors. American Journal of Medical Genetics Part A Published by Wiley Periodicals, Inc. PMID:26738761

Independent De Novo 22q11.2 Deletions in First Cousins With DiGeorge/Velocardiofacial Syndrome

PubMed Central

Saitta, Sulagna C.; Harris, Stacy E.; McDonald-McGinn, Donna M.; Emanuel, Beverly S.; Tonnesen, Melissa K.; Zackai, Elaine H.; Seitz, Suzanne C.; Driscoll, Deborah A.

2010-01-01

Deletions of chromosome 22q11.2 are found in the vast majority of patients with DiGeorge/velocardiofacial syndrome (DGS/VCFS). This most frequent microdeletion syndrome is estimated to occur in 1 in 4,000 live births. The majority of deletions are de novo, with 10% or less inherited from an affected parent. Here, we report two separate families with recurrence of a 22q11.2 deletion in first cousins. In each family, unaffected siblings (brother and sister) had an affected child. Fluorescence in situ hybridization (FISH) studies of the parents of each affected child were normal and hence, relatives were not considered at an increased risk for recurrence in another pregnancy. We used highly polymorphic microsatellite repeat markers from within 22q11.2 to determine the parental origin of each cousin’s deletion and to assess whether parental germline mosaicism for the 22q11.2 deletion might be a factor in these cases. This analysis confirmed that in each case, the deletion occurred on a chromosome 22 derived from unrelated parents, consistent with independent de novo deletion events. Thus, we concluded that germline mosaicism as the underlying mechanism for affected cousins in these families was unlikely. Our findings underscore the high frequency with which the 22q11.2 deletion occurs in the general population and demonstrate the important role that PCR-based parental origin determination can have in recurrence risk counselling. Furthermore, relatives of affected individuals may benefit from genetic counselling and consider prenatal testing for the 22q11.2 deletion in future pregnancies, despite a low recurrence risk. PMID:14708107

Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

PubMed

Möller, M; Hellberg, Å; Olsson, M L

2018-02-01

ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

Reversible mechano-electrochemical writing of metallic nanostructures with the tip of an atomic force microscope.

PubMed

Obermair, Christian; Kress, Marina; Wagner, Andreas; Schimmel, Thomas

2012-01-01

We recently introduced a method that allows the controlled deposition of nanoscale metallic patterns at defined locations using the tip of an atomic force microscope (AFM) as a "mechano-electrochemical pen", locally activating a passivated substrate surface for site-selective electrochemical deposition. Here, we demonstrate the reversibility of this process and study the long-term stability of the resulting metallic structures. The remarkable stability for more than 1.5 years under ambient air without any observable changes can be attributed to self-passivation. After AFM-activated electrochemical deposition of copper nanostructures on a polycrystalline gold film and subsequent AFM imaging, the copper nanostructures could be dissolved by reversing the electrochemical potential. Subsequent AFM-tip-activated deposition of different copper nanostructures at the same location where the previous structures were deleted, shows that there is no observable memory effect, i.e., no effect of the previous writing process on the subsequent writing process. Thus, the four processes required for reversible information storage, "write", "read", "delete" and "re-write", were successfully demonstrated on the nanometer scale.

Susceptibility of proliferating cells to benzo[a]pyrene-induced homologous recombination in mice.

PubMed

Bishop, A J; Kosaras, B; Carls, N; Sidman, R L; Schiestl, R H

2001-04-01

The pink-eyed unstable mutation, p(un), is the result of a 70 kb tandem duplication within the murine pink-eyed, p, gene. Deletion of one copy of the duplicated region by homologous deletion/recombination occurs spontaneously in embryos and results in pigmented spots in the fur and eye. Such deletion events are inducible by a variety of DNA damaging agents, as we have observed previously with both fur- and eye-spot assays. Here we describe a study of the effect of exposure to benzo[a]pyrene (B[a]P) at different times of development on reversion induction in the eye. Previously we, among others, have reported that the retinal pigment epithelium (RPE) displays a position effect variegation phenotype in the pattern of pink-eyed unstable reversions. Following an acute exposure to B[a]P or X-rays on the tenth day of gestation an increased frequency of reversion events was detected in a distinct region of the adult RPE. Examining exposure at different times of eye development reveals that both B[a]P and X-rays result in an increased frequency of reversion events, though the increase was only significant following B[a]P exposure, similar to our previous report limited to exposure on the tenth day of gestation. Examination of B[a]P-exposed RPE in the present study revealed distinct regions where the induced events lie and that the positions of these regions are found at increasing distances from the optic nerve the later the time of exposure. This position effect directly reflects the previously observed developmental pattern of the RPE, namely that cells in the regions most distal from the optic nerve are proliferating most vigorously. The numbers and positions of RPE cells displaying the transformed (pigmented) phenotype strongly advocate the proposal that dividing cells are at highest risk to deletions induced by carcinogens.

Genetics Home Reference: 16p11.2 deletion syndrome

MedlinePlus

... Schuurs-Hoeijmakers JH, van Haeringen A, Fransen van de Putte DE, Anderlid BM, Lundin J, Lapunzina P, Pérez Jurado ... Marshall CR, Scherer SW. Phenotypic spectrum associated with de novo and inherited deletions and duplications at 16p11. ...

An Indel Polymorphism in the MtnA 3' Untranslated Region Is Associated with Gene Expression Variation and Local Adaptation in Drosophila melanogaster

PubMed Central

Glaser-Schmitt, Amanda; Duchen, Pablo; Parsch, John

2016-01-01

Insertions and deletions (indels) are a major source of genetic variation within species and may result in functional changes to coding or regulatory sequences. In this study we report that an indel polymorphism in the 3’ untranslated region (UTR) of the metallothionein gene MtnA is associated with gene expression variation in natural populations of Drosophila melanogaster. A derived allele of MtnA with a 49-bp deletion in the 3' UTR segregates at high frequency in populations outside of sub-Saharan Africa. The frequency of the deletion increases with latitude across multiple continents and approaches 100% in northern Europe. Flies with the deletion have more than 4-fold higher MtnA expression than flies with the ancestral sequence. Using reporter gene constructs in transgenic flies, we show that the 3' UTR deletion significantly contributes to the observed expression difference. Population genetic analyses uncovered signatures of a selective sweep in the MtnA region within populations from northern Europe. We also find that the 3’ UTR deletion is associated with increased oxidative stress tolerance. These results suggest that the 3' UTR deletion has been a target of selection for its ability to confer increased levels of MtnA expression in northern European populations, likely due to a local adaptive advantage of increased oxidative stress tolerance. PMID:27120580

Breast Cancer in Three Dimensions: Revealing Telomere Dysfunction in Breast Cancer

DTIC Science & Technology

2006-09-01

suppressor PTEN and the glypican 3 (GPC3) gene in patients diagnosed with Proteus syndrome . Am J Med Genet, 1: 123-7, 2004. 101. Oros KK, Ghadirian...characterization of the spectrum of genomic deletions in the mismatch repair genes MSH2, MLH1, MSH6, and PMS2 responsible for hereditary nonpolyposis colorectal...Distinct patterns of Germ-Line Deletions in MLH1 and MLH2 : the Implication of Alu Repetitive Element in the genetic etiology of Lynch Syndrome

The thioredoxin TRX-1 regulates adult lifespan extension induced by dietary restriction in Caenorhabditis elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fierro-Gonzalez, Juan Carlos; Gonzalez-Barrios, Maria; Miranda-Vizuete, Antonio, E-mail: amirviz@upo.es

Highlights: {yields} First in vivo data for thioredoxin in dietary-restriction-(DR)-induced longevity. {yields} Thioredoxin (trx-1) loss suppresses longevity of eat-2 mutant, a genetic DR model. {yields} trx-1 overexpression extends wild-type longevity, but not that of eat-2 mutant. {yields} Longevity by dietary deprivation (DD), a non-genetic DR model, requires trx-1. {yields} trx-1 expression in ASJ neurons of aging adults is increased in response to DD. -- Abstract: Dietary restriction (DR) is the only environmental intervention known to extend adult lifespan in a wide variety of animal models. However, the genetic and cellular events that mediate the anti-aging programs induced by DR remainmore » elusive. Here, we used the nematode Caenorhabditis elegans to provide the first in vivo evidence that a thioredoxin (TRX-1) regulates adult lifespan extension induced by DR. We found that deletion of the gene trx-1 completely suppressed the lifespan extension caused by mutation of eat-2, a genetic surrogate of DR in the worm. However, trx-1 deletion only partially suppressed the long lifespan caused by mutation of the insulin-like receptor gene daf-2 or by mutation of the sensory cilia gene osm-5. A trx-1::GFP translational fusion expressed from its own promoter in ASJ neurons (Ptrx-1::trx-1::GFP) rescued the trx-1 deletion-mediated suppression of the lifespan extension caused by mutation of eat-2. This rescue was not observed when trx-1::GFP was expressed from the ges-1 promoter in the intestine. In addition, overexpression of Ptrx-1::trx-1::GFP extended lifespan in wild type, but not in eat-2 mutants. trx-1 deletion almost completely suppressed the lifespan extension induced by dietary deprivation (DD), a non-genetic, nutrient-based model of DR in the worm. Moreover, DD upregulated the expression of a trx-1 promoter-driven GFP reporter gene (Ptrx-1::GFP) in ASJ neurons of aging adults, but not that of control Pgpa-9::GFP (which is also expressed in ASJ neurons). We propose that DR activates TRX-1 in ASJ neurons during aging, which in turn triggers TRX-1-dependent mechanisms to extend adult lifespan in the worm.« less

A Catalog of Genes Homozygously Deleted in Human Lung Cancer and the Candidacy of PTPRD as a Tumor Suppressor Gene

PubMed Central

Kohno, Takashi; Otsuka, Ayaka; Girard, Luc; Sato, Masanori; Iwakawa, Reika; Ogiwara, Hideaki; Sanchez-Cespedes, Montse; Minna, John D.; Yokota, Jun

2010-01-01

A total of 176 genes homozygously deleted in human lung cancer were identified by DNA array-based whole genome scanning of 52 lung cancer cell lines and subsequent genomic PCR in 74 cell lines, including the 52 cell lines scanned. One or more exons of these genes were homozygously deleted in one (1%) to 20 (27%) cell lines. These genes included known tumor suppressor genes, e.g., CDKN2A/p16, RB1, and SMAD4, and candidate tumor suppressor genes whose hemizygous or homozygous deletions were reported in several types of human cancers, such as FHIT, KEAP1, and LRP1B/LRP-DIP. CDKN2A/p16 and p14ARF located in 9p21 were most frequently deleted (20/74, 27%). The PTPRD gene was most frequently deleted (8/74, 11%) among genes mapping to regions other than 9p21. Somatic mutations, including a nonsense mutation, of the PTPRD gene were detected in 8/74 (11%) of cell lines and 4/95 (4%) of surgical specimens of lung cancer. Reduced PTPRD expression was observed in the majority (>80%) of cell lines and surgical specimens of lung cancer. Therefore, PTPRD is a candidate tumor suppressor gene in lung cancer. Microarray-based expression profiling of 19 lung cancer cell lines also indicated that some of the 176 genes, such as KANK and ADAMTS1, are preferentially inactivated by epigenetic alterations. Genetic/epigenetic as well as functional studies of these 176 genes will increase our understanding of molecular mechanisms behind lung carcinogenesis. PMID:20073072

Assessing interethnic admixture using an X-linked insertion-deletion multiplex.

PubMed

Ribeiro-Rodrigues, Elzemar Martins; dos Santos, Ney Pereira Carneiro; dos Santos, Andrea Kely Campos Ribeiro; Pereira, Rui; Amorim, António; Gusmão, Leonor; Zago, Marco Antonio; dos Santos, Sidney Emanuel Batista

2009-01-01

In this study, a PCR multiplex was optimized, allowing the simultaneous analysis of 13 X-chromosome Insertion/deletion polymorphisms (INDELs). Genetic variation observed in Africans, Europeans, and Native Americans reveals high inter-population variability. The estimated proportions of X-chromosomes in an admixed population from the Brazilian Amazon region show a predominant Amerindian contribution (approximately 41%), followed by European (approximately 32%) and African (approximately 27%) contributions. The proportion of Amerindian contribution based on X-linked data is similar to the expected value based on mtDNA and Y-chromosome information. The accuracy for assessing interethnic admixture, and the high differentiation between African, European, and Native American populations, demonstrates the suitability of this INDEL set to measure ancestry proportions in three-hybrid populations, as it is the case of Latin American populations.

Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braun, A.; Ambach, H.; Kammerer, S.

Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-bindingmore » domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.« less

Genetic Manipulation of Palmitoylethanolamide Production and Inactivation in Saccharomyces cerevisiae

PubMed Central

Muccioli, Giulio G.; Sia, Angela; Muchowski, Paul J.; Stella, Nephi

2009-01-01

Background Lipids can act as signaling molecules, activating intracellular and membrane-associated receptors to regulate physiological functions. To understand how a newly discovered signaling lipid functions, it is necessary to identify and characterize the enzymes involved in their production and inactivation. The signaling lipid N-palmitoylethanolamine (PEA) is known to activate intracellular and membrane-associated receptors and regulate physiological functions, but little is known about the enzymes involved in its production and inactivation. Principal Findings Here we show that Saccharomyces cerevisiae produce and inactivate PEA, suggesting that genetic manipulations of this lower eukaryote may be used to identify the enzymes involved in PEA metabolism. Accordingly, using single gene deletion mutants, we identified yeast genes that control PEA metabolism, including SPO14 (a yeast homologue of the mammalian phospholipase D) that controls PEA production and YJU3 (a yeast homologue of the mammalian monoacylglycerol lipase) that controls PEA inactivation. We also found that PEA metabolism is affected by heterologous expression of two mammalian proteins involved in neurodegenerative diseases, namely huntingtin and α-synuclein. Significance Together these findings show that forward and reverse genetics in S. cerevisiae can be used to identify proteins involved in PEA production and inactivation, and suggest that mutated proteins causing neurodegenerative diseases might affect the metabolism of this important signaling lipid. PMID:19529773

Whole-genome resequencing identifies the molecular genetic cause for the absence of a Gy5 glycinin protein in soybean PI 603408

USDA-ARS?s Scientific Manuscript database

During ongoing proteomic analysis of the soybean (Glycine max (L.) Merr) germplasm collection, PI 603408 was identified as a landrace whose seeds lack accumulation of one of the major seed storage glycinin protein subunits. Whole genomic resequencing was used to identify a two-base deletion affectin...

Building of Reusable Reverse Logistics Model and its Optimization Considering the Decision of Backorder or Next Arrival of Goods

NASA Astrophysics Data System (ADS)

Lee, Jeong-Eun; Gen, Mitsuo; Rhee, Kyong-Gu; Lee, Hee-Hyol

This paper deals with the building of the reusable reverse logistics model considering the decision of the backorder or the next arrival of goods. The optimization method to minimize the transportation cost and to minimize the volume of the backorder or the next arrival of goods occurred by the Just in Time delivery of the final delivery stage between the manufacturer and the processing center is proposed. Through the optimization algorithms using the priority-based genetic algorithm and the hybrid genetic algorithm, the sub-optimal delivery routes are determined. Based on the case study of a distilling and sale company in Busan in Korea, the new model of the reusable reverse logistics of empty bottles is built and the effectiveness of the proposed method is verified.

Genetic algorithms as global random search methods

NASA Technical Reports Server (NTRS)

Peck, Charles C.; Dhawan, Atam P.

1995-01-01

Genetic algorithm behavior is described in terms of the construction and evolution of the sampling distributions over the space of candidate solutions. This novel perspective is motivated by analysis indicating that the schema theory is inadequate for completely and properly explaining genetic algorithm behavior. Based on the proposed theory, it is argued that the similarities of candidate solutions should be exploited directly, rather than encoding candidate solutions and then exploiting their similarities. Proportional selection is characterized as a global search operator, and recombination is characterized as the search process that exploits similarities. Sequential algorithms and many deletion methods are also analyzed. It is shown that by properly constraining the search breadth of recombination operators, convergence of genetic algorithms to a global optimum can be ensured.

Genetic algorithms as global random search methods

NASA Technical Reports Server (NTRS)

Peck, Charles C.; Dhawan, Atam P.

1995-01-01

Genetic algorithm behavior is described in terms of the construction and evolution of the sampling distributions over the space of candidate solutions. This novel perspective is motivated by analysis indicating that that schema theory is inadequate for completely and properly explaining genetic algorithm behavior. Based on the proposed theory, it is argued that the similarities of candidate solutions should be exploited directly, rather than encoding candidate solution and then exploiting their similarities. Proportional selection is characterized as a global search operator, and recombination is characterized as the search process that exploits similarities. Sequential algorithms and many deletion methods are also analyzed. It is shown that by properly constraining the search breadth of recombination operators, convergence of genetic algorithms to a global optimum can be ensured.

Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

PubMed Central

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

2013-01-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

Intronic deletions in the SLC34A3 gene: a cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria.

PubMed

Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R; Gray, Amie K; Baluarte, H Jorge; Econs, Michael J

2014-02-01

Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6-1/2-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24-hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH), and elevated 1,25(OH)2D. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440-1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. © 2013.

Image-based computational quantification and visualization of genetic alterations and tumour heterogeneity

PubMed Central

Zhong, Qing; Rüschoff, Jan H.; Guo, Tiannan; Gabrani, Maria; Schüffler, Peter J.; Rechsteiner, Markus; Liu, Yansheng; Fuchs, Thomas J.; Rupp, Niels J.; Fankhauser, Christian; Buhmann, Joachim M.; Perner, Sven; Poyet, Cédric; Blattner, Miriam; Soldini, Davide; Moch, Holger; Rubin, Mark A.; Noske, Aurelia; Rüschoff, Josef; Haffner, Michael C.; Jochum, Wolfram; Wild, Peter J.

2016-01-01

Recent large-scale genome analyses of human tissue samples have uncovered a high degree of genetic alterations and tumour heterogeneity in most tumour entities, independent of morphological phenotypes and histopathological characteristics. Assessment of genetic copy-number variation (CNV) and tumour heterogeneity by fluorescence in situ hybridization (ISH) provides additional tissue morphology at single-cell resolution, but it is labour intensive with limited throughput and high inter-observer variability. We present an integrative method combining bright-field dual-colour chromogenic and silver ISH assays with an image-based computational workflow (ISHProfiler), for accurate detection of molecular signals, high-throughput evaluation of CNV, expressive visualization of multi-level heterogeneity (cellular, inter- and intra-tumour heterogeneity), and objective quantification of heterogeneous genetic deletions (PTEN) and amplifications (19q12, HER2) in diverse human tumours (prostate, endometrial, ovarian and gastric), using various tissue sizes and different scanners, with unprecedented throughput and reproducibility. PMID:27052161

Image-based computational quantification and visualization of genetic alterations and tumour heterogeneity.

PubMed

Zhong, Qing; Rüschoff, Jan H; Guo, Tiannan; Gabrani, Maria; Schüffler, Peter J; Rechsteiner, Markus; Liu, Yansheng; Fuchs, Thomas J; Rupp, Niels J; Fankhauser, Christian; Buhmann, Joachim M; Perner, Sven; Poyet, Cédric; Blattner, Miriam; Soldini, Davide; Moch, Holger; Rubin, Mark A; Noske, Aurelia; Rüschoff, Josef; Haffner, Michael C; Jochum, Wolfram; Wild, Peter J

2016-04-07

Recent large-scale genome analyses of human tissue samples have uncovered a high degree of genetic alterations and tumour heterogeneity in most tumour entities, independent of morphological phenotypes and histopathological characteristics. Assessment of genetic copy-number variation (CNV) and tumour heterogeneity by fluorescence in situ hybridization (ISH) provides additional tissue morphology at single-cell resolution, but it is labour intensive with limited throughput and high inter-observer variability. We present an integrative method combining bright-field dual-colour chromogenic and silver ISH assays with an image-based computational workflow (ISHProfiler), for accurate detection of molecular signals, high-throughput evaluation of CNV, expressive visualization of multi-level heterogeneity (cellular, inter- and intra-tumour heterogeneity), and objective quantification of heterogeneous genetic deletions (PTEN) and amplifications (19q12, HER2) in diverse human tumours (prostate, endometrial, ovarian and gastric), using various tissue sizes and different scanners, with unprecedented throughput and reproducibility.

UCP1 deficiency causes brown fat respiratory chain depletion and sensitizes mitochondria to calcium overload-induced dysfunction

PubMed Central

Kazak, Lawrence; Chouchani, Edward T.; Stavrovskaya, Irina G.; Lu, Gina Z.; Jedrychowski, Mark P.; Egan, Daniel F.; Kumari, Manju; Kong, Xingxing; Erickson, Brian K.; Szpyt, John; Rosen, Evan D.; Murphy, Michael P.; Kristal, Bruce S.; Gygi, Steven P.; Spiegelman, Bruce M.

2017-01-01

Brown adipose tissue (BAT) mitochondria exhibit high oxidative capacity and abundant expression of both electron transport chain components and uncoupling protein 1 (UCP1). UCP1 dissipates the mitochondrial proton motive force (Δp) generated by the respiratory chain and increases thermogenesis. Here we find that in mice genetically lacking UCP1, cold-induced activation of metabolism triggers innate immune signaling and markers of cell death in BAT. Moreover, global proteomic analysis reveals that this cascade induced by UCP1 deletion is associated with a dramatic reduction in electron transport chain abundance. UCP1-deficient BAT mitochondria exhibit reduced mitochondrial calcium buffering capacity and are highly sensitive to mitochondrial permeability transition induced by reactive oxygen species (ROS) and calcium overload. This dysfunction depends on ROS production by reverse electron transport through mitochondrial complex I, and can be rescued by inhibition of electron transfer through complex I or pharmacologic depletion of ROS levels. Our findings indicate that the interscapular BAT of Ucp1 knockout mice exhibits mitochondrial disruptions that extend well beyond the deletion of UCP1 itself. This finding should be carefully considered when using this mouse model to examine the role of UCP1 in physiology. PMID:28630339

Array comparative genome hybridization in patients with developmental delay: two example cases.

PubMed

Hancarova, Miroslava; Drabova, Jana; Zmitkova, Zuzana; Vlckova, Marketa; Hedvicakova, Petra; Novotna, Drahuse; Vlckova, Zdenka; Vejvalkova, Sarka; Marikova, Tatana; Sedlacek, Zdenek

2012-02-15

Developmental delay is often a predictor of mental retardation (MR) or autism, two relatively frequent developmental disorders severely affecting intellectual and social functioning. The causes of these conditions remain unknown in most patients. They have a strong genetic component, but the specific genetic defects can only be identified in a fraction of patients. Recent developments in genomics supported the establishment of the causal link between copy number variants in the genomes of some patients and their affection. One of the techniques suitable for this analysis is array comparative genome hybridization, which can be used both for detailed mapping of chromosome rearrangements identified by classical cytogenetics and for the identification of novel submicroscopic gains or losses of genetic material. We illustrate the power of this approach in two patients. Patient 1 had a cytogenetically visible deletion of chromosome X and the molecular analysis was used to specify the gene content of the deletion and the prognosis of the child. Patient 2 had a seemingly normal karyotype and the analysis revealed a small recurrent deletion of chromosome 1 likely to be responsible for his phenotype. However, the genetic dissection of MR and autism is complicated by high heterogeneity of the genetic aberrations among patients and by broad variability of phenotypic effects of individual genetic defects. Copyright © 2010 Elsevier B.V. All rights reserved.

Plasticity of genetic interactions in metabolic networks of yeast.

PubMed

Harrison, Richard; Papp, Balázs; Pál, Csaba; Oliver, Stephen G; Delneri, Daniela

2007-02-13

Why are most genes dispensable? The impact of gene deletions may depend on the environment (plasticity), the presence of compensatory mechanisms (mutational robustness), or both. Here, we analyze the interaction between these two forces by exploring the condition-dependence of synthetic genetic interactions that define redundant functions and alternative pathways. We performed systems-level flux balance analysis of the yeast (Saccharomyces cerevisiae) metabolic network to identify genetic interactions and then tested the model's predictions with in vivo gene-deletion studies. We found that the majority of synthetic genetic interactions are restricted to certain environmental conditions, partly because of the lack of compensation under some (but not all) nutrient conditions. Moreover, the phylogenetic cooccurrence of synthetically interacting pairs is not significantly different from random expectation. These findings suggest that these gene pairs have at least partially independent functions, and, hence, compensation is only a byproduct of their evolutionary history. Experimental analyses that used multiple gene deletion strains not only confirmed predictions of the model but also showed that investigation of false predictions may both improve functional annotation within the model and also lead to the discovery of higher-order genetic interactions. Our work supports the view that functional redundancy may be more apparent than real, and it offers a unified framework for the evolution of environmental adaptation and mutational robustness.

New syndromic form of benign hereditary chorea is associated with a deletion of TITF-1 and PAX-9 contiguous genes.

PubMed

Devos, David; Vuillaume, Isabelle; de Becdelievre, Alix; de Martinville, Berengère; Dhaenens, Claire-Marie; Cuvellier, Jean-Christophe; Cuisset, Jean-Marie; Vallée, Louis; Lemaitre, Marie-Pierre; Bourteel, Hélène; Hachulla, Eric; Wallaert, Benoit; Destée, Alain; Defebvre, Luc; Sablonnière, Bernard

2006-12-01

Benign hereditary chorea is a rare autosomal dominant disorder presenting with a childhood-onset and slowly progressive chorea. The objective of this study was to describe the clinical and genetic features of 3 patients who developed childhood-onset chorea. Three affected patients from three generations of a family with benign hereditary chorea associated with a multisystemic disorder of the basal ganglia, thyroid, lungs, salivary glands, bowels, and teeth. The TITF-1 gene was screened by microsatellite analysis, gene sequencing, and fluorescence in situ hybridization. Genetic analysis revealed a novel 0.9-Mb deletion on chromosome 14, which includes the TITF-1 and PAX9 genes. We have identified a novel deletion responsible for a new syndrome of benign hereditary chorea, including symptoms of brain-thyroid-lung syndrome associated with bowels, salivary glands, and teeth disorders. Associated signs, sometimes of slight expression, remain of high interest for the clinical and genetic diagnosis of benign hereditary chorea. Copyright 2006 Movement Disorder Society.

Genetic Dosage Compensation in a Family with Velo-cardio-facial/DiGeorge/22q11.2 Deletion Syndrome

PubMed Central

Alkalay, Avishai A.; Guo, Tingwei; Montagna, Cristina; Digilio, M. Cristina; Marino, Bruno; Dallapiccola, Bruno; Morrow, Bernice

2014-01-01

Cytogenetic studies of a male child carrying the 22q11.2 deletion common in patients with velo-cardio-facial/DiGeorge syndrome revealed an unexpected rearrangement of the 22q11.2 region in his normal appearing mother. The mother carries a 3 Mb deletion on one copy and a reciprocal, similar sized duplication on the other copy of chromosome 22q11.2 as revealed by fluorescence in situ hybridization and array comparative genome hybridization analysis. The most parsimonious mechanism for the rearrangement is a mitotic non-allelic homologous recombination event in a cell in the early embryo soon after fertilization. The normal phenotype of the mother can be explained by the theory of genetic dosage compensation. This is the second documented case of such an event for this or any genomic disorder. This finding helps to reinforce this phenomenon in a human model, and has significant implications for genetic counseling of future children. PMID:21337693

Pearson marrow pancreas syndrome in patients suspected to have Diamond-Blackfan anemia.

PubMed

Gagne, Katelyn E; Ghazvinian, Roxanne; Yuan, Daniel; Zon, Rebecca L; Storm, Kelsie; Mazur-Popinska, Magdalena; Andolina, Laura; Bubala, Halina; Golebiowska, Sydonia; Higman, Meghan A; Kalwak, Krzysztof; Kurre, Peter; Matysiak, Michal; Niewiadomska, Edyta; Pels, Salley; Petruzzi, Mary Jane; Pobudejska-Pieniazek, Aneta; Szczepanski, Tomasz; Fleming, Mark D; Gazda, Hanna T; Agarwal, Suneet

2014-07-17

Pearson marrow pancreas syndrome (PS) is a multisystem disorder caused by mitochondrial DNA (mtDNA) deletions. Diamond-Blackfan anemia (DBA) is a congenital hypoproliferative anemia in which mutations in ribosomal protein genes and GATA1 have been implicated. Both syndromes share several features including early onset of severe anemia, variable nonhematologic manifestations, sporadic genetic occurrence, and occasional spontaneous hematologic improvement. Because of the overlapping features and relative rarity of PS, we hypothesized that some patients in whom the leading clinical diagnosis is DBA actually have PS. Here, we evaluated patient DNA samples submitted for DBA genetic studies and found that 8 (4.6%) of 173 genetically uncharacterized patients contained large mtDNA deletions. Only 2 (25%) of the patients had been diagnosed with PS on clinical grounds subsequent to sample submission. We conclude that PS can be overlooked, and that mtDNA deletion testing should be performed in the diagnostic evaluation of patients with congenital anemia. © 2014 by The American Society of Hematology.

Impact of Mutation Type and Amplicon Characteristics on Genetic Diversity Measures Generated Using a High-Resolution Melting Diversity Assay

PubMed Central

Cousins, Matthew M.; Donnell, Deborah; Eshleman, Susan H.

2013-01-01

We adapted high-resolution melting (HRM) technology to measure genetic diversity without sequencing. Diversity is measured as a single numeric HRM score. Herein, we determined the impact of mutation types and amplicon characteristics on HRM diversity scores. Plasmids were generated with single-base changes, insertions, and deletions. Different primer sets were used to vary the position of mutations within amplicons. Plasmids and plasmid mixtures were analyzed to determine the impact of mutation type, position, and concentration on HRM scores. The impact of amplicon length and G/C content on HRM scores was also evaluated. Different mutation types affected HRM scores to varying degrees (1-bp deletion < 1-bp change < 3-bp insertion < 9-bp insertion). The impact of mutations on HRM scores was influenced by amplicon length and the position of the mutation within the amplicon. Mutations were detected at concentrations of 5% to 95%, with the greatest impact at 50%. The G/C content altered melting temperature values of amplicons but had no impact on HRM scores. These data are relevant to the design of assays that measure genetic diversity using HRM technology. PMID:23178437

Clinical and genetic spectrum of Birt–Hogg–Dubé syndrome patients in whom pneumothorax and/or multiple lung cysts are the presenting feature

PubMed Central

Kunogi, Makiko; Kurihara, Masatoshi; Ikegami, Takako Shigihara; Kobayashi, Toshiyuki; Shindo, Noriko; Kumasaka, Toshio; Gunji, Yoko; Kikkawa, Mika; Iwakami, Shin-ichiro; Hino, Okio; Takahashi, Kazuhisa

2010-01-01

Background Birt–Hogg–Dubé syndrome (BHDS) is an inherited autosomal genodermatosis characterised by fibrofolliculomas of the skin, renal tumours and multiple lung cysts. Genetic studies have disclosed that the clinical picture as well as responsible germline FLCN mutations are diverse. Objectives BHDS may be caused by a germline deletion which cannot be detected by a conventional genetic approach. Real-time quantitative polymerase chain reaction (qPCR) may be able to identify such a mutation and thus provide us with a more accurate clinical picture of BHDS. Methods This study analysed 36 patients with multiple lung cysts of undetermined causes. Denaturing high performance liquid chromatography (DHPLC) was applied for mutation screening. If no abnormality was detected by DHPLC, the amount of each FLCN exon in genome was quantified by qPCR. Results An FLCN germline mutation was found in 23 (63.9%) of the 36 patients by DHPLC and direct sequencing (13 unique small nucleotide alterations which included 11 novel mutations). A large genomic deletion was identified in two of the remaining 13 patients by qPCR (one patient with exon 14 deletion and one patient with a deletion encompassing exons 9 to 14). Mutations including genomic deletions were most frequently identified in the 3′-end of the FLCN gene including exons 12 and 13 (13/25=52.0%). The BHDS patients whose multiple cysts prompted the diagnosis in this study showed a very low incidence of skin and renal involvement. Conclusions BHDS is due to large deletions as well as small nucleotide alterations. Racial differences may occur between Japanese and patients of European decent in terms of FLCN mutations and clinical manifestations. PMID:20413710

Segregation of a spontaneous Klrd1 (CD94) mutation in DBA/2 mouse substrains.

PubMed

Shin, Dai-Lun; Pandey, Ashutosh K; Ziebarth, Jesse Dylan; Mulligan, Megan K; Williams, Robert W; Geffers, Robert; Hatesuer, Bastian; Schughart, Klaus; Wilk, Esther

2014-12-17

Current model DBA/2J (D2J) mice lack CD94 expression due to a deletion spanning the last coding exon of the Klrd1 gene that occurred in the mid- to late 1980s. In contrast, DBA/2JRj (D2Rj) mice, crosses derived from DBA/2J before 1984, and C57BL/6J (B6) mice lack the deletion and have normal CD94 expression. For example, BXD lines (BXD1-32) generated in the 1970s by crossing B6 and D2J do not segregate for the exonic deletion and have high expression, whereas BXD lines 33 and greater were generated after 1990 are segregating for the deletion and have highly variable Klrd1 expression. We performed quantitative trait locus analysis of Klrd1 expression by using BXD lines with different generation times and found that the expression difference in Klrd1 in the later BXD set is driven by a strong cis-acting expression quantitative trait locus. Although the Klrd1/CD94 locus is essential for mousepox resistance, the genetic variation among D2 substrains and the later set of BXD strains is not associated with susceptibility to the Influenza A virus PR8 strain. Substrains with nearly identical genetic backgrounds that are segregating functional variants such as the Klrd1 deletion are useful genetic tools to investigate biological function. Copyright © 2015 Shin et al.

Segregation of a Spontaneous Klrd1 (CD94) Mutation in DBA/2 Mouse Substrains

PubMed Central

Shin, Dai-Lun; Pandey, Ashutosh K.; Ziebarth, Jesse Dylan; Mulligan, Megan K.; Williams, Robert W.; Geffers, Robert; Hatesuer, Bastian; Schughart, Klaus; Wilk, Esther

2014-01-01

Current model DBA/2J (D2J) mice lack CD94 expression due to a deletion spanning the last coding exon of the Klrd1 gene that occurred in the mid- to late 1980s. In contrast, DBA/2JRj (D2Rj) mice, crosses derived from DBA/2J before 1984, and C57BL/6J (B6) mice lack the deletion and have normal CD94 expression. For example, BXD lines (BXD1–32) generated in the 1970s by crossing B6 and D2J do not segregate for the exonic deletion and have high expression, whereas BXD lines 33 and greater were generated after 1990 are segregating for the deletion and have highly variable Klrd1 expression. We performed quantitative trait locus analysis of Klrd1 expression by using BXD lines with different generation times and found that the expression difference in Klrd1 in the later BXD set is driven by a strong cis-acting expression quantitative trait locus. Although the Klrd1/CD94 locus is essential for mousepox resistance, the genetic variation among D2 substrains and the later set of BXD strains is not associated with susceptibility to the Influenza A virus PR8 strain. Substrains with nearly identical genetic backgrounds that are segregating functional variants such as the Klrd1 deletion are useful genetic tools to investigate biological function. PMID:25520036

Friendly fire: redirecting herpes simplex virus-1 for therapeutic applications.

PubMed

Advani, S J; Weichselbaum, R R; Whitley, R J; Roizman, B

2002-09-01

Herpes simplex virus-1 (HSV-1) is a relatively large double-stranded DNA virus encoding at least 89 proteins with well characterized disease pathology. An understanding of the functions of viral proteins together with the ability to genetically engineer specific viral mutants has led to the development of attenuated HSV-1 for gene therapy. This review highlights the progress in creating attenuated genetically engineered HSV-1 mutants that are either replication competent (viral non-essential gene deleted) or replication defective (viral essential gene deleted). The choice between a replication-competent or -defective virus is based on the end-goal of the therapeutic intervention. Replication-competent HSV-1 mutants have primarily been employed as antitumor oncolytic viruses, with the lytic nature of the virus harnessed to destroy tumor cells selectively. In replacement gene therapy, replication-defective viruses have been utilized as delivery vectors. The advantages of HSV-1 vectors are that they infect quiescent and dividing cells efficiently and can encode for relatively large transgenes.

SANDO syndrome in a cohort of 107 patients with CPEO and mitochondrial DNA deletions.

PubMed

Hanisch, Frank; Kornhuber, Malte; Alston, Charlotte L; Taylor, Robert W; Deschauer, Marcus; Zierz, Stephan

2015-06-01

The sensory ataxic neuropathy with dysarthria and ophthalmoparesis (SANDO) syndrome is a subgroup of mitochondrial chronic progressive external ophthalmoplegia (CPEO)-plus disorders associated with multiple mitochondrial DNA (mtDNA) deletions. There is no systematic survey on SANDO in patients with CPEO with either single or multiple large-scale mtDNA deletions. In this retrospective analysis, we characterised the frequency, the genetic and clinical phenotype of 107 index patients with mitochondrial CPEO (n=66 patients with single and n=41 patients with multiple mtDNA deletions) and assessed these for clinical evidence of a SANDO phenotype. Patients with multiple mtDNA deletions were additionally screened for mutations in the nuclear-encoded POLG, SLC25A4, PEO1 and RRM2B genes. The clinical, histological and genetic data of 11 patients with SANDO were further analysed. None of the 66 patients with single, large-scale mtDNA deletions fulfilled the clinical criteria of SANDO syndrome. In contrast, 9 of 41 patients (22%) with multiple mtDNA deletions and two additional family members fulfilled the clinical criteria for SANDO. Within this subgroup, multiple mtDNA deletions were associated with the following nuclear mutations: POLG (n=6), PEO1 (n=2), unidentified (n=2). The combination of sensory ataxic neuropathy with ophthalmoparesis (SANO) was observed in 70% of patients with multiple mtDNA deletions but only in 4% with single deletions. The combination of CPEO and sensory ataxic neuropathy (SANO, incomplete SANDO) was found in 43% of patients with multiple mtDNA deletions but not in patients with single deletions. The SANDO syndrome seems to indicate a cluster of symptoms within the wide range of multisystemic symptoms associated with mitochondrial CPEO. SANO seems to be the most frequent phenotype associated with multiple mtDNA deletions in our cohort but not or is rarely associated with single, large-scale mtDNA deletions. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Behavioral differences among subjects with Prader-Willi syndrome and type I or type II deletion and maternal disomy.

PubMed

Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Talebizadeh, Zohreh; Thompson, Travis

2004-03-01

To determine whether phenotypic differences exist among individuals with Prader-Willi syndrome with either type I or type II deletions of chromosome 15 or maternal disomy 15 leading to a better understanding of cause and pathophysiology of this classical genetic syndrome. We analyzed clinical, anthropometric, and behavioral data in 12 individuals (5 men, 7 women; mean age: 25.9 +/- 8.8 years) with PWS and a type I (TI) deletion, 14 individuals (6 men, 8 women; mean age: 19.6 +/- 6.5 years) with PWS and a type II (TII) deletion, and 21 individuals (10 men, 11 women; mean age: 23.6 +/- 9.2 years) with PWS and maternal disomy 15 (UPD). The deletion type was determined by genotyping of DNA markers between proximal chromosome 15 breakpoints BP1 and BP2. TI deletions are approximately 500 kb larger than TII deletions. Several validated psychological and behavioral tests were used to assess phenotypic characteristics of individuals with PWS representing the 3 genetic subtypes. Significant differences were found between the 2 deletion groups and those with UPD in multiple psychological and behavioral tests, but no differences were observed in other clinical or anthropometric data studied. Adaptive behavior scores were generally worse in individuals with PWS and the TI deletion, and specific obsessive-compulsive behaviors were more evident in the TI individuals compared with those with UPD. Individuals with PWS with TI deletions also had poorer reading and math skills as well as visual-motor integration. Our study indicates that individuals with TI deletion generally have more behavioral and psychological problems than individuals with the TII deletion or UPD. Four recently identified genes have been identified in the chromosome region between BP1 and BP2 with 1 of the genes (NIPA-1) expressed in mouse brain tissue but not thought to be imprinted. It may be important for brain development or function. These genes are deleted in individuals with TI deletion and are implicated in compulsive behavior and lower intellectual ability in individuals with TI versus TII.

Novel Sfp1 Transcriptional Regulation of Saccharomyces cerevisiae Gene Expression Changes During Spaceflight

NASA Astrophysics Data System (ADS)

Coleman, Chasity B.; Allen, Patricia L.; Rupert, Mark; Goulart, Carla; Hoehn, Alexander; Stodieck, Louis S.; Hammond, Timothy G.

2008-12-01

This study identifies transcriptional regulation of stress response element (STRE) genes in space in the model eukaryotic organism, Saccharomyces cerevisiae. To determine transcription-factor dependence, gene expression changes in space were examined in strains bearing green fluorescent protein tagged (GFP-tagged) reporters for YIL052C (Sfp1 dependent with stress), YST-2 (Sfp1/Rap1 dependent with stress), or SSA4 (Msn4 dependent with stress), along with strains of SSA4-GFP and YIL052C-GFP with individual deletions of the Msn4 or Sfp1. When compared to parallel ground controls, spaceflight induces significant gene expression changes in SSA4 (35% decrease) and YIL052C (45% decrease), while expression of YST-2 (0.08% decrease) did not change. In space, deletion of Sfp1 reversed the SSA4 gene expression effect (0.00% change), but Msn4 deletion yielded a similar decrease in SSA4 expression (34% change), which indicates that SSA4 gene expression is dependent on the Sfp1 transcription factor in space, unlike other stresses. For YIL052C, deletion of Sfp1 reversed the effect (0.01% change), and the Msn4 deletion maintained the decrease in expression (30% change), which indicates that expression of YIL052C is also dependent on Sfp1 in space. Spaceflight has selective and specific effects on SSA4 and YIL052C gene expression, indicated by novel dependence on Sfp1.

AB020. Chromosome rearrangement in patients with 46,XY disorders of sex development

PubMed Central

Vu, Dung Chi; Nguyen, Khanh Ngoc; Can, Ngoc Bich; Bui, Thao Phuong; Fukami, Maki

2017-01-01

Background Disorders of sex development (DSD) is defined by congenital conditions in which development of chromosomal, gonadal, or anatomical sex is atypical. Causative mutations have not been identified in more than 50% 46,XY DSD cases. We aimed to identify chromosomal rearrangement in the development of 46,XY DSD in Vietnamese patients. Methods Case series report including clinical presentations and data from array-based comparative genomic hybridization analysis for six genetic males with genital abnormalities combines with mental disability and other congenital anomalies. Results Heterozygous submicroscopic deletions and/or duplications were identified in six cases. A 7.2 Mb terminal deletion at chromosome 9 including deletion of DMRT1 gene and a 2.7 Mb terminal duplication at chromosome 17 were detected in case 1 that presented with prematurity, dysmorphism and ambiguous genitalia. A terminal deletion affects DMRT1-3 at 9p22-23 was identified in case 2 with ambiguous genitalia, mental disability and dysmorphism. An 18 Mb terminal duplication at chromosome 5 was detected in case 3 with DSD, growth retardation, microcephaly and dysmorphism, ptosis, ventricular septal defect and craniosynostosis. An interstitial deletion including deletions of WT1, PAX6, and PRRG4 genes at chromosome 11 was detected in case 4 with WAGR syndrome. A terminal duplication at chromosome 7 was detected in case 5 with DSD, severe hypospadias, small phallus size (1 cm at 3 years of age), and no testis found clinically. A 5 Mb terminal deletion at chromosome 4 and a 6 Mb terminal duplication of chromosome 16 were detected in case 6 with severe motor-mental retardation, microcephaly (head circumference −3.5 SD), micrognathia, and DSD. Conclusions The results indicate that chromosomal rearrangements constitute an important part of the molecular bases of 46,XY DSD and that submicroscopic deletions and/or duplication can lead to various types of 46,XY DSD combined with other congenital anomalies and/or mental disability.

Chronic Desipramine Treatment Rescues Depression-Related, Social and Cognitive Deficits in Engrailed-2 Knockout Mice

PubMed Central

Brielmaier, Jennifer; Senerth, Julia M.; Silverman, Jill L.; Matteson, Paul G.; Millonig, James H.; DiCicco-Bloom, Emanuel; Crawley, Jacqueline N.

2014-01-01

Engrailed-2 (En2) is a homeobox transcription factor that regulates neurodevelopmental processes including neuronal connectivity and elaboration of monoaminergic neurons in the ventral hindbrain. We previously reported abnormalities in brain noradrenergic concentrations in En2 null mutant mice that were accompanied by increased immobility in the forced swim test, relevant to depression. An EN2 genetic polymorphism has been associated with autism spectrum disorders (ASD), and mice with a deletion in En2 display social abnormalities and cognitive deficits that may be relevant to multiple neuropsychiatric conditions. The present study evaluated the ability of chronic treatment with desipramine (DMI), a selective norepinephrine reuptake inhibitor and classical antidepressant, to reverse behavioral abnormalities in En2 −/− mice. DMI treatment significantly reduced immobility in the tail suspension and forced swim tests, restored sociability in the three-chambered social approach task, and reversed impairments in contextual fear conditioning in En2 −/− mice. Our findings indicate that modulation of brain noradrenergic systems rescues the depression-related phenotype in En2 −/− mice and suggest new roles for norepinephrine in the pathophysiology of the social and cognitive deficits seen in neuropsychiatric disorders such as autism or schizophrenia. PMID:24730055

A Simple and Universal System for Gene Manipulation in Aspergillus fumigatus: In Vitro-Assembled Cas9-Guide RNA Ribonucleoproteins Coupled with Microhomology Repair Templates.

PubMed

Al Abdallah, Qusai; Ge, Wenbo; Fortwendel, Jarrod R

2017-01-01

CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 is a novel genome-editing system that has been successfully established in Aspergillus fumigatus . However, the current state of the technology relies heavily on DNA-based expression cassettes for delivering Cas9 and the guide RNA (gRNA) to the cell. Therefore, the power of the technology is limited to strains that are engineered to express Cas9 and gRNA. To overcome such limitations, we developed a simple and universal CRISPR-Cas9 system for gene deletion that works across different genetic backgrounds of A. fumigatus . The system employs in vitro assembly of dual Cas9 ribonucleoproteins (RNPs) for targeted gene deletion. Additionally, our CRISPR-Cas9 system utilizes 35 to 50 bp of flanking regions for mediating homologous recombination at Cas9 double-strand breaks (DSBs). As a proof of concept, we first tested our system in the Δ akuB (Δ akuB ku80 ) laboratory strain and generated high rates (97%) of gene deletion using 2 µg of the repair template flanked by homology regions as short as 35 bp. Next, we inspected the portability of our system across other genetic backgrounds of A. fumigatus , namely, the wild-type strain Af293 and a clinical isolate, A. fumigatus DI15-102. In the Af293 strain, 2 µg of the repair template flanked by 35 and 50 bp of homology resulted in highly efficient gene deletion (46% and 74%, respectively) in comparison to classical gene replacement systems. Similar deletion efficiencies were also obtained in the clinical isolate DI15-102. Taken together, our data show that in vitro -assembled Cas9 RNPs coupled with microhomology repair templates are an efficient and universal system for gene manipulation in A. fumigatus . IMPORTANCE Tackling the multifactorial nature of virulence and antifungal drug resistance in A. fumigatus requires the mechanistic interrogation of a multitude of genes, sometimes across multiple genetic backgrounds. Classical fungal gene replacement systems can be laborious and time-consuming and, in wild-type isolates, are impeded by low rates of homologous recombination. Our simple and universal CRISPR-Cas9 system for gene manipulation generates efficient gene targeting across different genetic backgrounds of A. fumigatus . We anticipate that our system will simplify genome editing in A. fumigatus , allowing for the generation of single- and multigene knockout libraries. In addition, our system will facilitate the delineation of virulence factors and antifungal drug resistance genes in different genetic backgrounds of A. fumigatus .

A Deletion Variant of the α2b-Adrenoceptor Modulates the Stress-Induced Shift from "Cognitive" to "Habit" Memory.

PubMed

Wirz, Lisa; Wacker, Jan; Felten, Andrea; Reuter, Martin; Schwabe, Lars

2017-02-22

Stress induces a shift from hippocampus-based "cognitive" toward dorsal striatum-based "habitual" learning and memory. This shift is thought to have important implications for stress-related psychopathologies, including post-traumatic stress disorder (PTSD). However, there is large individual variability in the stress-induced bias toward habit memory, and the factors underlying this variability are completely unknown. Here we hypothesized that a functional deletion variant of the gene encoding the α2b-adrenoceptor ( ADRA2B ), which has been linked to emotional memory processes and increased PTSD risk, modulates the stress-induced shift from cognitive toward habit memory. In two independent experimental studies, healthy humans were genotyped for the ADRA2B deletion variant. After a stress or control manipulation, participants completed a dual-solution learning task while electroencephalographic (Study I) or fMRI measurements (Study II) were taken. Carriers compared with noncarriers of the ADRA2B deletion variant exhibited a significantly reduced bias toward habit memory after stress. fMRI results indicated that, whereas noncarriers of the ADRA2B deletion variant showed increased functional connectivity between amygdala and putamen after stress, this increase in connectivity was absent in carriers of the deletion variant, who instead showed overall enhanced connectivity between amygdala and entorhinal cortex. Our results indicate that a common genetic variation of the noradrenergic system modulates the impact of stress on the balance between cognitive and habitual memory systems, most likely via altered amygdala orchestration of these systems. SIGNIFICANCE STATEMENT Stressful events have a powerful effect on human learning and memory. Specifically, accumulating evidence suggests that stress favors more rigid dorsal striatum-dependent habit memory, at the expense of flexible hippocampus-dependent cognitive memory. Although this shift may have important implications for understanding mental disorders, such as post-traumatic stress disorder, little is known about the source of individual differences in the sensitivity for the stress-induced bias toward habit memory. We report here that a common genetic variation of the noradrenergic system, a known risk factor for post-traumatic stress disorder, modulates the stress-induced shift from cognitive to habit memory, most likely through altered crosstalk between the hippocampus and dorsal striatum with the amygdala, a key structure in emotional memory. Copyright © 2017 the authors 0270-6474/17/372149-12$15.00/0.

Generation of mutant Uukuniemi viruses lacking the nonstructural protein NSs by reverse genetics indicates that NSs is a weak interferon antagonist.

PubMed

Rezelj, Veronica V; Överby, Anna K; Elliott, Richard M

2015-05-01

Uukuniemi virus (UUKV) is a tick-borne member of the Phlebovirus genus (family Bunyaviridae) and has been widely used as a safe laboratory model to study aspects of bunyavirus replication. Recently, a number of new tick-borne phleboviruses have been discovered, some of which, like severe fever with thrombocytopenia syndrome virus and Heartland virus, are highly pathogenic in humans. UUKV could now serve as a useful comparator to understand the molecular basis for the different pathogenicities of these related viruses. We established a reverse-genetics system to recover UUKV entirely from cDNA clones. We generated two recombinant viruses, one in which the nonstructural protein NSs open reading frame was deleted from the S segment and one in which the NSs gene was replaced with green fluorescent protein (GFP), allowing convenient visualization of viral infection. We show that the UUKV NSs protein acts as a weak interferon antagonist in human cells but that it is unable to completely counteract the interferon response, which could serve as an explanation for its inability to cause disease in humans. Uukuniemi virus (UUKV) is a tick-borne phlebovirus that is apathogenic for humans and has been used as a convenient model to investigate aspects of phlebovirus replication. Recently, new tick-borne phleboviruses have emerged, such as severe fever with thrombocytopenia syndrome virus in China and Heartland virus in the United States, that are highly pathogenic, and UUKV will now serve as a comparator to aid in the understanding of the molecular basis for the virulence of these new viruses. To help such investigations, we have developed a reverse-genetics system for UUKV that permits manipulation of the viral genome. We generated viruses lacking the nonstructural protein NSs and show that UUKV NSs is a weak interferon antagonist. In addition, we created a virus that expresses GFP and thus allows convenient monitoring of virus replication. These new tools represent a significant advance in the study of tick-borne phleboviruses. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Analysis of repeat-mediated deletions in the mitochondrial genome of Saccharomyces cerevisiae.

PubMed

Phadnis, Naina; Sia, Rey A; Sia, Elaine A

2005-12-01

Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions.

Analysis of Repeat-Mediated Deletions in the Mitochondrial Genome of Saccharomyces cerevisiae

PubMed Central

Phadnis, Naina; Sia, Rey A.; Sia, Elaine A.

2005-01-01

Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions. PMID:16157666

Prader-Willi syndrome: genetic tests and clinical findings.

PubMed

Fridman, C; Varela, M C; Kok, F; Setian, N; Koiffmann, C P

2000-01-01

Here we describe the genetic studies performed in 53 patients with the suspected diagnosis of Prader-Willi syndrome (PWS). PWS is characterized by neonatal hypotonia, hypogonadism, delayed psychomotor development, hyperphagia, obesity, short stature, small hands and feet, learning disabilities, and obsessive-compulsive behavior. Through the methylation analysis of the SNRPN gene, microsatellite studies of loci mapped within and outside the PWS/AS region, and fluorescence in situ hybridization (FISH) study, we confirmed the diagnosis in 35 patients: 27 with a paternal deletion, and 8 with maternal uniparental disomy (UPD). The clinical comparisons between deleted and UPD patients indicated that there were no major phenotype differences, except for a lower birth length observed in the UPD children. Our sample was composed of more girls than boys; UPD patients were diagnosed earlier than the deleted cohort (2(10/12) s. 7(9/12) years); and, in the deleted group, the boys were diagnosed earlier than the girls (5(2/12) vs. 7(8/12) years, respectively).

Testis development requires the repression of Wnt4 by Fgf signaling

PubMed Central

Jameson, Samantha A.; Lin, Yi-Tzu; Capel, Blanche

2013-01-01

The bipotential gonad expresses genes associated with both the male and female pathways. Adoption of the male testicular fate is associated with the repression of many female genes including Wnt4. However, the importance of repression of Wnt4 to the establishment of male development was not previously determined. Deletion of either Fgf9 or Fgfr2 in an XY gonad resulted in up-regulation of Wnt4 and male-to-female sex reversal. We investigated whether the deletion if Wnt4 could rescue sex reversal in Fgf9 and Fgfr2 mutants. XY Fgf9/Wnt4 and Fgfr2/Wnt4 double mutants developed testes with male somatic and germ cells present, suggesting that the primary role of Fgf signaling is the repression of female-promoting genes. Thus, the decision to adopt the male fate is based not only on whether male genes, such as Sox9, are expressed, but also on the active repression of female genes, such as Wnt4. Because loss of Wnt4 results in the up-regulation of Fgf9, we also tested the possibility that derepression of Fgf9 was responsible for the aspects of male development observed in XX Wnt4 mutants. However, we found that the relationship between these two signaling factors is not symmetric: loss of Fgf9 in XX Wnt4−/− gonads does not rescue their partial female-to-male sex-reversal. PMID:22705479

Aberrant interchromosomal exchanges are the predominant cause of the 22q11.2 deletion

PubMed Central

Saitta, Sulagna C.; Harris, Stacy E.; Gaeth, Ann P.; Driscoll, Deborah A.; McDonald-McGinn, Donna M.; Maisenbacher, Melissa K.; Yersak, Jill M.; Chakraborty, Prabir K.; Hacker, April M.; Zackai, Elaine H.; Ashley, Terry; Emanuel, Beverly S.

2010-01-01

Chromosome 22q11.2 deletions are found in almost 90% of patients with DiGeorge/velocardiofacial syndrome (DGS/VCFS). Large, chromosome-specific low copy repeats (LCRs), flanking and within the deletion interval, are presumed to lead to misalignment and aberrant recombination in meiosis resulting in this frequent microdeletion syndrome. We traced the grandparental origin of regions flanking de novo 3 Mb deletions in 20 informative three-generation families. Haplotype reconstruction showed an unexpectedly high number of proximal interchromosomal exchanges between homologs, occurring in 19/20 families. Instead, the normal chromosome 22 in these probands showed interchromosomal exchanges in 2/15 informative meioses, a rate consistent with the genetic distance. Meiotic exchanges, visualized as MLH1 foci, localize to the distal long arm of chromosome 22 in 75% of human spermatocytes tested, also reflecting the genetic map. Additionally, we found no effect of proband gender or parental age on the crossover frequency. Parental origin studies in 65 de novo 3 Mb deletions (including these 20 patients) demonstrated no bias. Unlike Williams syndrome, we found no chromosomal inversions flanked by LCRs in 22 sets of parents of 22q11 deleted patients, or in eight non-deleted patients with a DGS/VCFS phenotype using FISH. Our data are consistent with significant aberrant interchromosomal exchange events during meiosis I in the proximal region of the affected chromosome 22 as the likely etiology for the deletion. This type of exchange occurs more often than is described for deletions of chromosomes 7q11, 15q11, 17p11 and 17q11, implying a difference in the meiotic behavior of chromosome 22. PMID:14681306

G6PD Deficiency and Hemoglobinopathies: Molecular Epidemiological Characteristics and Healthy Effects on Malaria Endemic Bioko Island, Equatorial Guinea

PubMed Central

Lin, Min; Yang, Li Ye; Xie, Dong De; Chen, Jiang Tao; Nguba, Santiago-m Monte; Ehapo, Carlos Sala; Zhan, Xiao Fen; Eyi, Juan Urbano Monsuy; Matesa, Rocio Apicante; Obono, Maximo Miko Ondo; Yang, Hui; Yang, Hui Tian; Cheng, Ji Dong

2015-01-01

Background Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobinopathies were the inherited conditions found mostly in African. However, few epidemiological data of these disorders was reported in Equatorial Guinea (EQG). This study aimed to assess the prevalence and healthy effects of G6PD deficiency and hemoglobinopathies among the people on malaria endemic Bioko Island, EQG. Materials and Methods Blood samples from 4,144 unrelated subjects were analyzed for G6PD deficieny by fluorescence spot test (FST), high-resolution melting assay and PCR-DNA sequencing. In addition, 1,186 samples were randomly selected from the 4,144 subjects for detection of hemoglobin S (HbS), HbC, and α-thalassemia deletion by complete blood count, PCR-DNA sequencing and reverse dot blot (RDB). Results The prevalence of malaria and anemia was 12.6% (522/4,144) and 32.8% (389/1,186), respectively. Overall, 8.7% subjects (359/4,144) were G6PD-deficient by FST, including 9.0% (249/2,758) males and 7.9% (110/1,386) females. Among the 359 G6PD-deficient individuals molecularly studied, the G6PD A- (G202A/A376G) were detected in 356 cases (99.2%), G6PD Betica (T968C/A376G) in 3 cases. Among the 1,186 subjects, 201 cases were HbS heterozygotes, 35 cases were HbC heterozygotes, and 2 cases were HbCS double heterozygotes; 452 cases showed heterozygous α-thalassemia 3.7 kb deletion (-α3.7 kb deletion) and 85 homozygous - α3.7 kb deletion. The overall allele frequencies were HbS 17.1% (203/1186); HbC, 3.1% (37/1186); and –α3.7 kb deletion 52.4% (622/1186), respectively. Conclusions High G6PD deficiency in this population indicate that diagnosis and management of G6PD deficiency is necessary on Bioko Island. Obligatory newborn screening, prenatal screening and counseling for these genetic disorders, especially HbS, are needed on the island. PMID:25915902

G6PD Deficiency and Hemoglobinopathies: Molecular Epidemiological Characteristics and Healthy Effects on Malaria Endemic Bioko Island, Equatorial Guinea.

PubMed

Lin, Min; Yang, Li Ye; Xie, Dong De; Chen, Jiang Tao; Nguba, Santiago-m Monte; Ehapo, Carlos Sala; Zhan, Xiao Fen; Eyi, Juan Urbano Monsuy; Matesa, Rocio Apicante; Obono, Maximo Miko Ondo; Yang, Hui; Yang, Hui Tian; Cheng, Ji Dong

2015-01-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency and hemoglobinopathies were the inherited conditions found mostly in African. However, few epidemiological data of these disorders was reported in Equatorial Guinea (EQG). This study aimed to assess the prevalence and healthy effects of G6PD deficiency and hemoglobinopathies among the people on malaria endemic Bioko Island, EQG. Blood samples from 4,144 unrelated subjects were analyzed for G6PD deficiency by fluorescence spot test (FST), high-resolution melting assay and PCR-DNA sequencing. In addition, 1,186 samples were randomly selected from the 4,144 subjects for detection of hemoglobin S (HbS), HbC, and α-thalassemia deletion by complete blood count, PCR-DNA sequencing and reverse dot blot (RDB). The prevalence of malaria and anemia was 12.6% (522/4,144) and 32.8% (389/1,186), respectively. Overall, 8.7% subjects (359/4,144) were G6PD-deficient by FST, including 9.0% (249/2,758) males and 7.9% (110/1,386) females. Among the 359 G6PD-deficient individuals molecularly studied, the G6PD A- (G202A/A376G) were detected in 356 cases (99.2%), G6PD Betica (T968C/A376G) in 3 cases. Among the 1,186 subjects, 201 cases were HbS heterozygotes, 35 cases were HbC heterozygotes, and 2 cases were HbCS double heterozygotes; 452 cases showed heterozygous α-thalassemia 3.7 kb deletion (-α3.7 kb deletion) and 85 homozygous - α3.7 kb deletion. The overall allele frequencies were HbS 17.1% (203/1186); HbC, 3.1% (37/1186); and -α3.7 kb deletion 52.4% (622/1186), respectively. High G6PD deficiency in this population indicate that diagnosis and management of G6PD deficiency is necessary on Bioko Island. Obligatory newborn screening, prenatal screening and counseling for these genetic disorders, especially HbS, are needed on the island.

Nipah Virus Matrix Protein Influences Fusogenicity and Is Essential for Particle Infectivity and Stability.

PubMed

Dietzel, Erik; Kolesnikova, Larissa; Sawatsky, Bevan; Heiner, Anja; Weis, Michael; Kobinger, Gary P; Becker, Stephan; von Messling, Veronika; Maisner, Andrea

2015-12-16

Nipah virus (NiV) causes fatal encephalitic infections in humans. To characterize the role of the matrix (M) protein in the viral life cycle, we generated a reverse genetics system based on NiV strain Malaysia. Using an enhanced green fluorescent protein (eGFP)-expressing M protein-deleted NiV, we observed a slightly increased cell-cell fusion, slow replication kinetics, and significantly reduced peak titers compared to the parental virus. While increased amounts of viral proteins were found in the supernatant of cells infected with M-deleted NiV, the infectivity-to-particle ratio was more than 100-fold reduced, and the particles were less thermostable and of more irregular morphology. Taken together, our data demonstrate that the M protein is not absolutely required for the production of cell-free NiV but is necessary for proper assembly and release of stable infectious NiV particles. Henipaviruses cause a severe disease with high mortality in human patients. Therefore, these viruses can be studied only in biosafety level 4 (BSL-4) laboratories, making it more challenging to characterize their life cycle. Here we investigated the role of the Nipah virus matrix protein in virus-mediated cell-cell fusion and in the formation and release of newly produced particles. We found that even though low levels of infectious viruses are produced in the absence of the matrix protein, it is required for the release of highly infectious and stable particles. Fusogenicity of matrixless viruses was slightly enhanced, further demonstrating the critical role of this protein in different steps of Nipah virus spread. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Genetic Characterisation of Plasmodium falciparum Isolates with Deletion of the pfhrp2 and/or pfhrp3 Genes in Colombia: The Amazon Region, a Challenge for Malaria Diagnosis and Control

PubMed Central

Dorado, Erika Jimena; Okoth, Sheila Akinyi; Montenegro, Lidia Madeline; Diaz, Gustavo; Barnwell, John W.; Udhayakumar, Venkatachalam; Murillo Solano, Claribel

2016-01-01

Most Plasmodium falciparum-detecting rapid diagnostic tests (RDTs) target histidine-rich protein 2 (PfHRP2). However, P. falciparum isolates with deletion of the pfhrp2 gene and its homolog gene, pfhrp3, have been detected. We carried out an extensive investigation on 365 P. falciparum dried blood samples collected from seven P. falciparum endemic sites in Colombia between 2003 and 2012 to genetically characterise and geographically map pfhrp2- and/or pfhrp3-negative P. falciparum parasites in the country. We found a high proportion of pfhrp2-negative parasites only in Amazonas (15/39; 38.5%), and these parasites were also pfhrp3-negative. These parasites were collected between 2008 and 2009 in Amazonas, while pfhrp3-negative parasites (157/365, 43%) were found in all the sites and from each of the sample collection years evaluated (2003 to 2012). We also found that all pfhrp2- and/or pfhrp3-negative parasites were also negative for one or both flanking genes. Six sub-population clusters were established with 93.3% (14/15) of the pfhrp2-negative parasites grouped in the same cluster and sharing the same haplotype. This haplotype corresponded with the genetic lineage BV1, a multidrug resistant strain that caused two outbreaks reported in Peru between 2010 and 2013. We found this BV1 lineage in the Colombian Amazon as early as 2006. Two new clonal lineages were identified in these parasites from Colombia: the genetic lineages EV1 and F. PfHRP2 sequence analysis revealed high genetic diversity at the amino acid level, with 17 unique sequences identified among 53 PfHRP2 sequences analysed. The use of PfHRP2-based RDTs is not recommended in Amazonas because of the high proportion of parasites with pfhrp2 deletion (38.5%), and implementation of new strategies for malaria diagnosis and control in Amazonas must be prioritised. Moreover, studies to monitor and genetically characterise pfhrp2-negative P. falciparum parasites in the Americas are warranted, given the extensive human migration occurring in the region. PMID:27636709

Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.

PubMed Central

Hu, W S; Bowman, E H; Delviks, K A; Pathak, V K

1997-01-01

Homologous recombination and deletions occur during retroviral replication when reverse transcriptase switches templates. While recombination occurs solely by intermolecular template switching (between copackaged RNAs), deletions can occur by an intermolecular or an intramolecular template switch (within the same RNA). To directly compare the rates of intramolecular and intermolecular template switching, two spleen necrosis virus-based vectors were constructed. Each vector contained a 110-bp direct repeat that was previously shown to delete at a high rate. The 110-bp direct repeat was flanked by two different sets of restriction site markers. These vectors were used to form heterozygotic virions containing RNAs of each parental vector, from which recombinant viruses were generated. By analyses of the markers flanking the direct repeats in recombinant and nonrecombinant proviruses, the rates of intramolecular and intermolecular template switching were determined. The results of these analyses indicate that intramolecular template switching is much more efficient than intermolecular template switching and that direct repeat deletions occur primarily through intramolecular template switching events. These studies also indicate that retroviral recombination occurs within a distinct viral subpopulation and exhibits high negative interference, whereby the selection of one recombination event increases the probability that a second recombination event will be observed. PMID:9223494

Alleviation of carbon catabolite repression in Enterobacter aerogenes for efficient utilization of sugarcane molasses for 2,3-butanediol production.

PubMed

Jung, Moo-Young; Jung, Hwi-Min; Lee, Jinwon; Oh, Min-Kyu

2015-01-01

Due to its cost-effectiveness and rich sugar composition, sugarcane molasses is considered to be a promising carbon source for biorefinery. However, the sugar mixture in sugarcane molasses is not consumed as efficiently as glucose in microbial fermentation due to complex interactions among their utilizing pathways, such as carbon catabolite repression (CCR). In this study, 2,3-butanediol-producing Enterobacter aerogenes was engineered to alleviate CCR and improve sugar utilization by modulating its carbon preference. The gene encoding catabolite repressor/activator (Cra) was deleted in the genome of E. aerogenes to increase the fructose consumption rate. However, the deletion mutation repressed sucrose utilization, resulting in the accumulation of sucrose in the fermentation medium. Cra regulation on expression of the scrAB operon involved in sucrose catabolism was verified by reverse transcription and real-time PCR, and the efficiency of sucrose utilization was restored by disrupting the scrR gene and overexpressing the scrAB operon. In addition, overexpression of the ptsG gene involved in glucose utilization enhanced the glucose preference among mixed sugars, which relieved glucose accumulation in fed-batch fermentation. In fed-batch fermentation using sugarcane molasses, the maximum titer of 2,3-butanediol production by the mutant reached 140.0 g/L at 54 h, which was by far the highest titer of 2,3-butanediol with E. aerogenes achieved through genetic engineering. We have developed genetically engineered E. aerogenes as a 2,3-butanediol producer that efficiently utilizes sugarcane molasses. The fermentation efficiency was dramatically improved by the alleviation of CCR and modulation of carbon preference. These results offer a metabolic engineering approach for achieving highly efficient utilization of mixed sugars for the biorefinery industry.

Identification of copy number variation in French dairy and beef breeds using next-generation sequencing.

PubMed

Letaief, Rabia; Rebours, Emmanuelle; Grohs, Cécile; Meersseman, Cédric; Fritz, Sébastien; Trouilh, Lidwine; Esquerré, Diane; Barbieri, Johanna; Klopp, Christophe; Philippe, Romain; Blanquet, Véronique; Boichard, Didier; Rocha, Dominique; Boussaha, Mekki

2017-10-24

Copy number variations (CNV) are known to play a major role in genetic variability and disease pathogenesis in several species including cattle. In this study, we report the identification and characterization of CNV in eight French beef and dairy breeds using whole-genome sequence data from 200 animals. Bioinformatics analyses to search for CNV were carried out using four different but complementary tools and we validated a subset of the CNV by both in silico and experimental approaches. We report the identification and localization of 4178 putative deletion-only, duplication-only and CNV regions, which cover 6% of the bovine autosomal genome; they were validated by two in silico approaches and/or experimentally validated using array-based comparative genomic hybridization and single nucleotide polymorphism genotyping arrays. The size of these variants ranged from 334 bp to 7.7 Mb, with an average size of ~ 54 kb. Of these 4178 variants, 3940 were deletions, 67 were duplications and 171 corresponded to both deletions and duplications, which were defined as potential CNV regions. Gene content analysis revealed that, among these variants, 1100 deletions and duplications encompassed 1803 known genes, which affect a wide spectrum of molecular functions, and 1095 overlapped with known QTL regions. Our study is a large-scale survey of CNV in eight French dairy and beef breeds. These CNV will be useful to study the link between genetic variability and economically important traits, and to improve our knowledge on the genomic architecture of cattle.

Identification of a Novel De Novo Heterozygous Deletion in the SOX10 Gene in Waardenburg Syndrome Type II Using Next-Generation Sequencing.

PubMed

Li, Haonan; Jin, Peng; Hao, Qian; Zhu, Wei; Chen, Xia; Wang, Ping

2017-11-01

Waardenburg syndrome (WS) is a rare autosomal dominant disorder associated with pigmentation abnormalities and sensorineural hearing loss. In this study, we investigated the genetic cause of WSII in a patient and evaluated the reliability of the targeted next-generation exome sequencing method for the genetic diagnosis of WS. Clinical evaluations were conducted on the patient and targeted next-generation sequencing (NGS) was used to identify the candidate genes responsible for WSII. Multiplex ligation-dependent probe amplification (MLPA) and real-time quantitative polymerase chain reaction (qPCR) were performed to confirm the targeted NGS results. Targeted NGS detected the entire deletion of the coding sequence (CDS) of the SOX10 gene in the WSII patient. MLPA results indicated that all exons of the SOX10 heterozygous deletion were detected; no aberrant copy number in the PAX3 and microphthalmia-associated transcription factor (MITF) genes was found. Real-time qPCR results identified the mutation as a de novo heterozygous deletion. This is the first report of using a targeted NGS method for WS candidate gene sequencing; its accuracy was verified by using the MLPA and qPCR methods. Our research provides a valuable method for the genetic diagnosis of WS.

Genetic Analyses of the NF1 Gene in Turkish Neurofibromatosis Type I Patients and Definition of three Novel Variants

PubMed Central

Ulusal, SD; Gürkan, H; Atlı, E; Özal, SA; Çiftdemir, M; Tozkır, H; Karal, Y; Güçlü, H; Eker, D; Görker, I

2017-01-01

Abstract Neurofibromatosis Type I (NF1) is a multi systemic autosomal dominant neurocutaneous disorder predisposing patients to have benign and/or malignant lesions predominantly of the skin, nervous system and bone. Loss of function mutations or deletions of the NF1 gene is responsible for NF1 disease. Involvement of various pathogenic variants, the size of the gene and presence of pseudogenes makes it difficult to analyze. We aimed to report the results of 2 years of multiplex ligation-dependent probe amplification (MLPA) and next generation sequencing (NGS) for genetic diagnosis of NF1 applied at our genetic diagnosis center. The MLPA, semiconductor sequencing and Sanger sequencing were performed in genomic DNA samples from 24 unrelated patients and their affected family members referred to our center suspected of having NF1. In total, three novel and 12 known pathogenic variants and a whole gene deletion were determined. We suggest that next generation sequencing is a practical tool for genetic analysis of NF1. Deletion/duplication analysis with MLPA may also be helpful for patients clinically diagnosed to carry NF1 but do not have a detectable mutation in NGS. PMID:28924536

Modeling a model: Mouse genetics, 22q11.2 Deletion Syndrome, and disorders of cortical circuit development

PubMed Central

Meechan, Daniel W.; Maynard, Thomas M.; Fernandez, Alejandra; Karpinski, Beverly A.; Rothblat, Lawrence A.; LaMantia, Anthony S.

2015-01-01

Understanding the developmental etiology of autistic spectrum disorders, attention deficit/hyperactivity disorder and schizophrenia remains a major challenge for establishing new diagnostic and therapeutic approaches to these common, difficult-to-treat diseases that compromise neural circuits in the cerebral cortex. One aspect of this challenge is the breadth and overlap of ASD, ADHD, and SCZ deficits; another is the complexity of mutations associated with each, and a third is the difficulty of analyzing disrupted development in at-risk or affected human fetuses. The identification of distinct genetic syndromes that include behavioral deficits similar to those in ASD, ADHC and SCZ provides a critical starting point for meeting this challenge. We summarize clinical and behavioral impairments in children and adults with one such genetic syndrome, the 22q11.2 Deletion Syndrome, routinely called 22q11DS, caused by micro-deletions of between 1.5 and 3.0 MB on human chromosome 22. Among many syndromic features, including cardiovascular and craniofacial anomalies, 22q11DS patients have a high incidence of brain structural, functional, and behavioral deficits that reflect cerebral cortical dysfunction and fall within the spectrum that defines ASD, ADHD, and SCZ. We show that developmental pathogenesis underlying this apparent genetic “model” syndrome in patients can be defined and analyzed mechanistically using genomically accurate mouse models of the deletion that causes 22q11DS. We conclude that “modeling a model”, in this case 22q11DS as a model for idiopathic ASD, ADHD and SCZ, as well as other behavioral disorders like anxiety frequently seen in 22q11DS patients, in genetically engineered mice provides a foundation for understanding the causes and improving diagnosis and therapy for these disorders of cortical circuit development. PMID:25866365

The haloarchaeal MCM proteins: bioinformatic analysis and targeted mutagenesis of the β7-β8 and β9-β10 hairpin loops and conserved zinc binding domain cysteines

PubMed Central

Kristensen, Tatjana P.; Maria Cherian, Reeja; Gray, Fiona C.; MacNeill, Stuart A.

2014-01-01

The hexameric MCM complex is the catalytic core of the replicative helicase in eukaryotic and archaeal cells. Here we describe the first in vivo analysis of archaeal MCM protein structure and function relationships using the genetically tractable haloarchaeon Haloferax volcanii as a model system. Hfx. volcanii encodes a single MCM protein that is part of the previously identified core group of haloarchaeal MCM proteins. Three structural features of the N-terminal domain of the Hfx. volcanii MCM protein were targeted for mutagenesis: the β7-β8 and β9-β10 β-hairpin loops and putative zinc binding domain. Five strains carrying single point mutations in the β7-β8 β-hairpin loop were constructed, none of which displayed impaired cell growth under normal conditions or when treated with the DNA damaging agent mitomycin C. However, short sequence deletions within the β7-β8 β-hairpin were not tolerated and neither was replacement of the highly conserved residue glutamate 187 with alanine. Six strains carrying paired alanine substitutions within the β9-β10 β-hairpin loop were constructed, leading to the conclusion that no individual amino acid within that hairpin loop is absolutely required for MCM function, although one of the mutant strains displays greatly enhanced sensitivity to mitomycin C. Deletions of two or four amino acids from the β9-β10 β-hairpin were tolerated but mutants carrying larger deletions were inviable. Similarly, it was not possible to construct mutants in which any of the conserved zinc binding cysteines was replaced with alanine, underlining the likely importance of zinc binding for MCM function. The results of these studies demonstrate the feasibility of using Hfx. volcanii as a model system for reverse genetic analysis of archaeal MCM protein function and provide important confirmation of the in vivo importance of conserved structural features identified by previous bioinformatic, biochemical and structural studies. PMID:24723920

The genetic landscape of a physical interaction

PubMed Central

Diss, Guillaume

2018-01-01

A key question in human genetics and evolutionary biology is how mutations in different genes combine to alter phenotypes. Efforts to systematically map genetic interactions have mostly made use of gene deletions. However, most genetic variation consists of point mutations of diverse and difficult to predict effects. Here, by developing a new sequencing-based protein interaction assay – deepPCA – we quantified the effects of >120,000 pairs of point mutations on the formation of the AP-1 transcription factor complex between the products of the FOS and JUN proto-oncogenes. Genetic interactions are abundant both in cis (within one protein) and trans (between the two molecules) and consist of two classes – interactions driven by thermodynamics that can be predicted using a three-parameter global model, and structural interactions between proximally located residues. These results reveal how physical interactions generate quantitatively predictable genetic interactions. PMID:29638215

Assessment and Treatment in Autism Spectrum Disorders: A Focus on Genetics and Psychiatry

PubMed Central

Butler, Merlin G.; Youngs, Erin L.; Roberts, Jennifer L.; Hellings, Jessica A.

2012-01-01

Autism spectrum disorders (ASDs) are neurobehavioral disorders characterized by abnormalities in three behavioral domains including social interaction, impaired communication, and repetitive stereotypic behaviors. ASD affects approximately 1% of children and is on the rise with significant genetic mechanisms underlying these disorders. We review the current understanding of the role of genetic and metabolic factors contributing to ASD with the use of new genetic technology. Fifty percent is diagnosed with chromosomal abnormalities, small DNA deletions/duplications, single-gene conditions, or metabolic disturbances. Genetic evaluation is discussed along with psychiatric treatment and approaches for selection of medication to treat associated challenging behaviors or comorbidities seen in ASD. We emphasize the importance of prioritizing treatment based on target symptom clusters and in what order for individuals with ASD, as the treatment may vary from patient to patient. PMID:22934170

Copy-number variations associated with autism spectrum disorder.

PubMed

Kakinuma, Hiroaki; Sato, Hitoshi

2008-08-01

Autism spectrum disorder (ASD) is a clinically heterogeneous developmental disorder with a strong genetic component. Rare genetic disorders and various chromosomal abnormalities are thought to account for approximately 10% of people with ASD. The etiology of the remaining cases remains unknown. Recent advances in array-based technology have increased the resolution in detecting submicroscopic deletions and duplications, referred to as copy-number variations. ASD-associated copy-number variations, which are considered to be present in individuals with ASD but not in unaffected individuals, have been extensively investigated. These data will provide us with an opportunity not only to search for genes causing or contributing to ASDs but also to understand the genetics of ASD.

Genetic diversity and phylogenetic analysis of Aleutian mink disease virus isolates in north-east China.

PubMed

Leng, Xue; Liu, Dongxu; Li, Jianming; Shi, Kun; Zeng, Fanli; Zong, Ying; Liu, Yi; Sun, Zhibo; Zhang, Shanshan; Liu, Yadong; Du, Rui

2018-05-01

Aleutian mink disease is the most important disease in the mink-farming industry worldwide. So far, few large-scale molecular epidemiological studies of AMDV, based on the NS1 and VP2 genes, have been conducted in China. Here, eight new Chinese isolates of AMDV from three provinces in north-east China were analyzed to clarify the molecular epidemiology of AMDV. The seroprevalence of AMDV in north-east China was 41.8% according to counterimmuno-electrophoresis. Genetic variation analysis of the eight isolates showed significant non-synonymous substitutions in the NS1 and VP2 genes, especially in the NS1 gene. All eight isolates included the caspase-recognition sequence NS1:285 (DQTD↓S), but not the caspase recognition sequence NS1:227 (INTD↓S). The LN1 and LN2 strains had a new 10-amino-acid deletion in-between amino acids 28-37, while the JL3 strain had a one-amino-acid deletion at position 28 in the VP2 protein, compared with the AMDV-G strain. Phylogenetic analysis based on most of NS1 (1755 bp) and complete VP2 showed that the AMDV genotypes did not cluster according to their pathogenicity or geographic origin. Local and imported ADMV species are all prevalent in mink-farming populations in the north-east of China. This is the first study to report the molecular epidemiology of AMDV in north-east China based on most of NS1 and the complete VP2, and further provides information about polyG deletions and new variations in the amino acid sequences of NS1 and VP2 proteins. This report is a good foundation for further study of AMDV in China.

Real-time PCR based on SYBR-Green I fluorescence: an alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions.

PubMed

Ponchel, Frederique; Toomes, Carmel; Bransfield, Kieran; Leong, Fong T; Douglas, Susan H; Field, Sarah L; Bell, Sandra M; Combaret, Valerie; Puisieux, Alain; Mighell, Alan J; Robinson, Philip A; Inglehearn, Chris F; Isaacs, John D; Markham, Alex F

2003-10-13

Real-time PCR is increasingly being adopted for RNA quantification and genetic analysis. At present the most popular real-time PCR assay is based on the hybridisation of a dual-labelled probe to the PCR product, and the development of a signal by loss of fluorescence quenching as PCR degrades the probe. Though this so-called 'TaqMan' approach has proved easy to optimise in practice, the dual-labelled probes are relatively expensive. We have designed a new assay based on SYBR-Green I binding that is quick, reliable, easily optimised and compares well with the published assay. Here we demonstrate its general applicability by measuring copy number in three different genetic contexts; the quantification of a gene rearrangement (T-cell receptor excision circles (TREC) in peripheral blood mononuclear cells); the detection and quantification of GLI, MYC-C and MYC-N gene amplification in cell lines and cancer biopsies; and detection of deletions in the OPA1 gene in dominant optic atrophy. Our assay has important clinical applications, providing accurate diagnostic results in less time, from less biopsy material and at less cost than assays currently employed such as FISH or Southern blotting.

Characterization of Genomic Deletion Efficiency Mediated by Clustered Regularly Interspaced Palindromic Repeats (CRISPR)/Cas9 Nuclease System in Mammalian Cells*♦

PubMed Central

Canver, Matthew C.; Bauer, Daniel E.; Dass, Abhishek; Yien, Yvette Y.; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H.; Orkin, Stuart H.

2014-01-01

The clustered regularly interspaced palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. PMID:24907273

Mitochondrial DNA deletion percentage in sun exposed and non sun exposed skin.

PubMed

Powers, Julia M; Murphy, Gillian; Ralph, Nikki; O'Gorman, Susan M; Murphy, James E J

2016-12-01

The percentages of mitochondrial genomes carrying the mtDNA 3895 and the mtDNA 4977 (common) deletion were quantified in sun exposed and non sun exposed skin biopsies, for five cohorts of patients varying either in sun exposure profile, age or skin cancer status. Non-melanoma skin cancer diagnoses are rising in Ireland and worldwide [12] but most risk prediction is based on subjective visual estimations of sun exposure history. A quantitative objective test for pre-neoplastic markers may result in better adherence to sun protective behaviours. Mitochondrial DNA (mtDNA) is known to be subject to the loss of a significant proportion of specific sections of genetic code due to exposure to ultraviolet light in sunlight. Although one such deletion has been deemed more sensitive, another, called the mtDNA 4977 or common deletion, has proved to be a more useful indicator of possible risk in this study. Quantitative molecular analysis was carried out to determine the percentage of genomes carrying the deletion using non sun exposed and sun exposed skin biopsies in cohorts of patients with high or low sun exposure profiles and two high exposure groups undergoing treatment for NMSC. Results indicate that mtDNA deletions correlate to sun exposure; in groups with high sun exposure habits a significant increase in deletion number in exposed over non sun exposed skin occurred. An increase in deletion percentage was also seen in older cohorts compared to the younger group. The mtDNA 3895 deletion was detected in small amounts in exposed skin of many patients, the mtDNA 4977 common deletion, although present to some extent in non sun exposed skin, is suggested to be the more reliable and easily detected marker. In all cohorts except the younger group with relatively lower sun exposure, the mtDNA 4977 deletion was more frequent in sun exposed skin samples compared to non-sun exposed skin. Copyright © 2016 Elsevier B.V. All rights reserved.

Genetics Home Reference: Tietz syndrome

MedlinePlus

... groups? Genetic Changes Tietz syndrome is caused by mutations in the MITF gene. This gene provides instructions ... development of the retinal pigment epithelium. MITF gene mutations that cause Tietz syndrome either delete or change ...

Global diversity, population stratification, and selection of human copy number variation

PubMed Central

Sudmant, Peter H.; Mallick, Swapan; Nelson, Bradley J.; Hormozdiari, Fereydoun; Krumm, Niklas; Huddleston, John; Coe, Bradley P.; Baker, Carl; Nordenfelt, Susanne; Bamshad, Michael; Jorde, Lynn B.; Posukh, Olga L.; Sahakyan, Hovhannes; Watkins, W. Scott; Yepiskoposyan, Levon; Abdullah, M. Syafiq; Bravi, Claudio M.; Capelli, Cristian; Hervig, Tor; Wee, Joseph T. S.; Tyler-Smith, Chris; van Driem, George; Romero, Irene Gallego; Jha, Aashish R.; Karachanak-Yankova, Sena; Toncheva, Draga; Comas, David; Henn, Brenna; Kivisild, Toomas; Ruiz-Linares, Andres; Sajantila, Antti; Metspalu, Ene; Parik, Jüri; Villems, Richard; Starikovskaya, Elena B.; Ayodo, George; Beall, Cynthia M.; Di Rienzo, Anna; Hammer, Michael; Khusainova, Rita; Khusnutdinova, Elza; Klitz, William; Winkler, Cheryl; Labuda, Damian; Metspalu, Mait; Tishkoff, Sarah A.; Dryomov, Stanislav; Sukernik, Rem; Patterson, Nick; Reich, David; Eichler, Evan E.

2015-01-01

In order to explore the diversity and selective signatures of duplication and deletion human copy number variants (CNVs), we sequenced 236 individuals from 125 distinct human populations. We observed that duplications exhibit fundamentally different population genetic and selective signatures than deletions and are more likely to be stratified between human populations. Through reconstruction of the ancestral human genome, we identify megabases of DNA lost in different human lineages and pinpoint large duplications that introgressed from the extinct Denisova lineage now found at high frequency exclusively in Oceanic populations. We find that the proportion of CNV base pairs to single nucleotide variant base pairs is greater among non-Africans than it is among African populations, but we conclude that this difference is likely due to unique aspects of non-African population history as opposed to differences in CNV load. PMID:26249230

Notable Carrier Risks for Individuals Having Two Copies of SMN1 in Spinal Muscular Atrophy Families with 2-copy Alleles: Estimation Based on Chinese Meta-analysis Data.

PubMed

Wei, Xianda; Tan, Hu; Yang, Pu; Zhang, Rui; Tan, Bo; Zhang, Yue; Mei, Libin; Liang, Desheng; Wu, Lingqian

2017-02-01

Spinal muscular atrophy is an autosomal recessive neuromuscular disease mainly caused by homozygous deletion of SMN1. The 2-copy SMN1 allele may present in the families of SMA patients with homozygous deletion of SMN1, one of whose parents has two SMN1 copies. In such families, individuals having two SMN1 copies still have a chance to be "2 + 0" carriers. In this study, the risks for the parents, fetuses and other siblings having two SMN1 copies to be "2 + 0" carriers were estimated based on Chinese meta-analysis data and turned out to be rather striking. Our findings would help to optimize genetic counseling regarding spinal muscular atrophy.

Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression

PubMed Central

Luo, Michelle L.; Mullis, Adam S.; Leenay, Ryan T.; Beisel, Chase L.

2015-01-01

CRISPR-Cas systems have shown tremendous promise as heterologous tools for genome editing and transcriptional regulation. Because these RNA-directed immune systems are found in most prokaryotes, an opportunity exists to harness the endogenous systems as convenient tools in these organisms. Here, we report that the Type I-E CRISPR-Cas system in Escherichia coli can be co-opted for programmable transcriptional repression. We found that deletion of the signature cas3 gene converted this immune system into a programmable gene regulator capable of reversible gene silencing of heterologous and endogenous genes. Targeting promoter regions yielded the strongest repression, whereas targeting coding regions showed consistent strand bias. Furthermore, multi-targeting CRISPR arrays could generate complex phenotypes. This strategy offers a simple approach to convert many endogenous Type I systems into transcriptional regulators, thereby expanding the available toolkit for CRISPR-mediated genetic control while creating new opportunities for genome-wide screens and pathway engineering. PMID:25326321

Genetic Variation in Sialidase and Linkage to N-acetylneuraminate Catabolism in Mycoplasma synoviae

PubMed Central

May, Meghan; Brown, Daniel R.

2008-01-01

We explored the genetic basis for intraspecific variation in mycoplasmal sialidase activity that correlates with virulence, and its potentially advantageous linkage to nutrient catabolism. Polymorphism in N-acetylneuraminate scavenging and degradation genes (sialidase, N-acetylneuraminate lyase, N-acetylmannosamine kinase, N-acetylmannosamine-6-phosphate epimerase, N-acetylglucosamine-6-phosphate deacetylase, and glucosamine-6-phosphate deaminase) was evident among eight strains of the avian pathogen Mycoplasma synoviae. Most differences were single nucleotide polymorphisms, ranging from 0.34 ± 0.04 substitutions per 100 bp for N-acetylmannosamine kinase to 0.65 ± 0.03 for the single-copy sialidase gene nanI. Missense mutations were twice as common as silent mutations in nanI; 26% resulted in amino acids dissimilar to consensus; and there was a 12-base deletion near the nanI promoter in strain WVU1853T, supporting a complex genetic basis for differences in sialidase activity. Two strains had identical frameshifts in the N-acetylneuraminate lyase gene nanA, resulting in nonsense mutations, and both had downstream deletions in nanA. Such genetic lesions uncouple extracellular liberation of sialic acid from generation of fructose-6-phosphate and pyruvate via intracellular N-acetylneuraminate degradation. Retention of nanI by such strains, but not others in the M. synoviae phylogenetic cluster, is evidence that sialidase has an important non-nutritional role in the ecology of M. synoviae and certain other mycoplasmas. PMID:18490131

Biomechanical properties of bone in a mouse model of Rett syndrome

PubMed Central

Kamal, Bushra; Russell, David; Payne, Anthony; Constante, Diogo; Tanner, K. Elizabeth; Isaksson, Hanna; Mathavan, Neashan; Cobb, Stuart R.

2015-01-01

Rett syndrome (RTT) is an X-linked genetic disorder and a major cause of intellectual disability in girls. Mutations in the methyl-CpG binding protein 2 (MECP2) gene are the primary cause of the disorder. Despite the dominant neurological phenotypes, MECP2 is expressed ubiquitously throughout the body and a number of peripheral phenotypes such as scoliosis, reduced bone mineral density and skeletal fractures are also common and important clinical features of the disorder. In order to explore whether MeCP2 protein deficiency results in altered structural and functional properties of bone and to test the potential reversibility of any defects, we have conducted a series of histological, imaging and biomechanical tests of bone in a functional knockout mouse model of RTT. Both hemizygous Mecp2stop/y male mice in which Mecp2 is silenced in all cells and female Mecp2stop/+ mice in which Mecp2 is silenced in ~ 50% of cells as a consequence of random X-chromosome inactivation, revealed significant reductions in cortical bone stiffness, microhardness and tensile modulus. Microstructural analysis also revealed alterations in both cortical and cancellous femoral bone between wild-type and MeCP2-deficient mice. Furthermore, unsilencing of Mecp2 in adult mice cre-mediated stop cassette deletion resulted in a restoration of biomechanical properties (stiffness, microhardness) towards wild-type levels. These results show that MeCP2-deficiency results in overt, but potentially reversible, alterations in the biomechanical integrity of bone and highlights the importance of targeting skeletal phenotypes in considering the development of pharmacological and gene-based therapies. PMID:25445449

Genetics Home Reference: Y chromosome infertility

MedlinePlus

... deletions" of the human Y chromosome and their relationship with male infertility. J Genet Genomics. 2008 Apr; ... for Links Data Files & API Site Map Subscribe Customer Support USA.gov Copyright Privacy Accessibility FOIA Viewers & ...

Insertion/deletion polymorphism in alpha2-adrenergic receptor gene is a genetic risk factor for sudden cardiac death.

PubMed

Laukkanen, Jari A; Mäkikallio, Timo H; Kauhanen, Jussi; Kurl, Sudhir

2009-10-01

Adrenoceptors mediate contraction of vascular smooth muscle and induce coronary vasoconstriction in humans. A deletion variant of the human alpha(2B)-adrenoreseptor of glutamic acid residues has been associated with impaired receptor desensitization. This receptor variant could, therefore, be involved in cardiovascular diseases associated with enhanced vasoconstriction. Our aim was to study whether an insertion/deletion (I/D) polymorphism in the alpha(2B)-adrenoceptor gene is associated with the risk for sudden cardiac death. This was a prospective population-based study investigating risk factors for cardiovascular diseases in middle-aged men from 42 to 60 years from eastern Finland. The study is based on 1,606 men with complete data on DNA observed for an average time of 17 years. In this study population, 338 men (21%) had the D/D genotype, 467 (29%) had the I/I genotype, and 801 (50%) had a heterozygous genotype. There were 76 sudden cardiac deaths during follow-up (0.81 deaths/1,000 persons per year). In a Cox model adjusting for other coronary risk factors (age, systolic blood pressure, smoking, diabetes, serum low-density lipoprotein and high-density lipoprotein cholesterol, body mass index, and exercise-induced myocardial ischemia), men with the D/D or I/D genotype had 1.97 times (95% CI 1.08-3.59, P = .026) higher risk to experience sudden cardiac death (20 events for D/D genotype, 13 events for I/I genotype, and 43 events for I/D genotype) compared with men carrying the I/I genotype. In addition, the alpha(2B)-adrenoceptor D/D genotype was associated with the risk of coronary heart disease death and acute coronary events, after adjusting for risk factors. The genetic polymorphism of the alpha(2B)-adrenoreceptor is genetic risk predictor for sudden cardiac death.

CRISPR-Cas9D10A Nickase-Assisted Genome Editing in Lactobacillus casei

PubMed Central

Song, Xin; Huang, He; Xiong, Zhiqiang

2017-01-01

ABSTRACT Lactobacillus casei has drawn increasing attention as a health-promoting probiotic, while effective genetic manipulation tools are often not available, e.g., the single-gene knockout in L. casei still depends on the classic homologous recombination-dependent double-crossover strategy, which is quite labor-intensive and time-consuming. In the present study, a rapid and precise genome editing plasmid, pLCNICK, was established for L. casei genome engineering based on CRISPR-Cas9D10A. In addition to the P23-Cas9D10A and Pldh-sgRNA (single guide RNA) expression cassettes, pLCNICK includes the homologous arms of the target gene as repair templates. The ability and efficiency of chromosomal engineering using pLCNICK were evaluated by in-frame deletions of four independent genes and chromosomal insertion of an enhanced green fluorescent protein (eGFP) expression cassette at the LC2W_1628 locus. The efficiencies associated with in-frame deletions and chromosomal insertion is 25 to 62%. pLCNICK has been proved to be an effective, rapid, and precise tool for genome editing in L. casei, and its potential application in other lactic acid bacteria (LAB) is also discussed in this study. IMPORTANCE The lack of efficient genetic tools has limited the investigation and biotechnological application of many LAB. The CRISPR-Cas9D10A nickase-based genome editing in Lactobacillus casei, an important food industrial microorganism, was demonstrated in this study. This genetic tool allows efficient single-gene deletion and insertion to be accomplished by one-step transformation, and the cycle time is reduced to 9 days. It facilitates a rapid and precise chromosomal manipulation in L. casei and overcomes some limitations of previous methods. This editing system can serve as a basic technological platform and offers the possibility to start a comprehensive investigation on L. casei. As a broad-host-range plasmid, pLCNICK has the potential to be adapted to other Lactobacillus species for genome editing. PMID:28864652

Direct cellobiose production from cellulose using sextuple beta-glucosidase gene deletion Neurospora crassa mutants

USDA-ARS?s Scientific Manuscript database

Direct cellobiose production from cellulose by a genetically modified fungus—Neurospora crassa, was explored in this study. A library of N. crassa sextuple beta-glucosidase (bgl) gene deletion strains was constructed. Various concentrations of cellobiose were detected in the culture broth of the N. ...

Lassa Virus Reverse Genetics.

PubMed

Martínez-Sobrido, Luis; Paessler, Slobodan; de la Torre, Juan Carlos

2017-01-01

The Old World (OW) arenavirus Lassa (LASV ) is estimated to infect several hundred thousand people yearly in West Africa, resulting in high numbers of Lassa fever (LF), a viral hemorrhagic fever (HF) disease associated with high morbidity and mortality. To date, no licensed vaccines are available to LASV infections, and anti-LASV drug therapy is limited to an off-label use of ribavirin (Rib) that is only partially effective. The development of reverse genetics has provided investigators with a novel and powerful approach for the investigation of the molecular, cell biology, and pathogenesis of LASV. The use of cell-based LASV minigenome (MG) systems has allowed examining the cis- and trans-acting factors involved in genome replication and gene transcription and the identification of novel drugable LASV targets. Likewise, it is now feasible to rescue infectious recombinant (r)LASV entirely from cloned cDNAs containing predetermined mutations in their genomes to investigate virus-host interactions and mechanisms of pathogenesis, as well as to facilitate screens to identify antiviral drugs against LASV and the implementation of novel strategies to develop live-attenuated vaccines (LAV). In this chapter we will summarize the state-of-the-art experimental procedures for implementation of LASV reverse genetics. In addition, we will briefly discuss some significant translational research developments that have been made possible upon the development of LASV reverse genetics.

A resource for functional profiling of noncoding RNA in the yeast Saccharomyces cerevisiae.

PubMed

Parker, Steven; Fraczek, Marcin G; Wu, Jian; Shamsah, Sara; Manousaki, Alkisti; Dungrattanalert, Kobchai; de Almeida, Rogerio Alves; Estrada-Rivadeneyra, Diego; Omara, Walid; Delneri, Daniela; O'Keefe, Raymond T

2017-08-01

Eukaryotic genomes are extensively transcribed, generating many different RNAs with no known function. We have constructed 1502 molecular barcoded ncRNA gene deletion strains encompassing 443 ncRNAs in the yeast Saccharomyces cerevisiae as tools for ncRNA functional analysis. This resource includes deletions of small nuclear RNAs (snRNAs), transfer RNAs (tRNAs), small nucleolar RNAs (snoRNAs), and other annotated ncRNAs as well as the more recently identified stable unannotated transcripts (SUTs) and cryptic unstable transcripts (CUTs) whose functions are largely unknown. Specifically, deletions have been constructed for ncRNAs found in the intergenic regions, not overlapping genes or their promoters (i.e., at least 200 bp minimum distance from the closest gene start codon). The deletion strains carry molecular barcodes designed to be complementary with the protein gene deletion collection enabling parallel analysis experiments. These strains will be useful for the numerous genomic and molecular techniques that utilize deletion strains, including genome-wide phenotypic screens under different growth conditions, pooled chemogenomic screens with drugs or chemicals, synthetic genetic array analysis to uncover novel genetic interactions, and synthetic dosage lethality screens to analyze gene dosage. Overall, we created a valuable resource for the RNA community and for future ncRNA research. © 2017 Parker et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Molecular diagnosis of α-thalassemia in a multiethnic population.

PubMed

Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah

2017-06-01

α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Behavior in Prader-Willi syndrome: relationship to genetic subtypes and age.

PubMed

Dykens, Elisabeth M; Roof, Elizabeth

2008-09-01

Some behavioral features of Prader-Willi syndrome (PWS) are associated with the major genetic subtypes of this disorder. While most agree that those with maternal uniparental disomy (UPD) have a distinctive cognitive and psychiatric profile, findings are more controversial regarding possible differences among persons who vary in paternal deletion size. Caregivers of 88 persons with PWS aged 5 to 51 years (M = 22 years) were administered measures of problem behavior, compulsivity, hyperphagia, and adaptive skills. The sample was well characterized as having relatively large, Type I (n = 26) or smaller, Type II (n = 29) deletions, or UPD (n = 33). No significant behavioral differences were found between the Type I versus Type II deletion groups. Within each genetic subtype, however, differences emerged in how advancing age related to behavior. Although age did not emerge as a significant correlate of behavior in the Type II or UPD groups, in the Type I group age was consistently associated with lower problem behaviors, adaptive skills, and externalizing symptoms. Although differences between deletion subtypes were not found, significant within-subtype differences emerged in relationships between age and behavior. Negative associations between age and behavior in the Type I group only may relate to non-imprinted genes that are deleted in Type I but not Type II cases, including CYFIP1. Altered expression of CYFIP1 is seen in other developmental disabilities, including 15q disorders, and haploinsufficiency of CYFIP1 in Type I PWS cases may be associated with age-related phenotypic effects. Findings underscore the importance of a life-span perspective in phenotypic research.

Population genetic variation in the tree fern Alsophila spinulosa (Cyatheaceae): effects of reproductive strategy.

PubMed

Wang, Ting; Su, Yingjuan; Li, Yuan

2012-01-01

Essentially all ferns can perform both sexual and asexual reproduction. Their populations represent suitable study objects to test the population genetic effects of different reproductive systems. Using the diploid homosporous fern Alsophila spinulosa as an example species, the main purpose of this study was to assess the relative impact of sexual and asexual reproduction on the level and structure of population genetic variation. Inter-simple sequence repeats analysis was conducted on 140 individuals collected from seven populations (HSG, LCH, BPC, MPG, GX, LD, and ZHG) in China. Seventy-four polymorphic bands discriminated a total of 127 multilocus genotypes. Character compatibility analysis revealed that 50.0 to 70.0% of the genotypes had to be deleted in order to obtain a tree-like structure in the data set from populations HSG, LCH, MPG, BPC, GX, and LD; and there was a gradual decrease of conflict in the data set when genotypes with the highest incompatibility counts were successively deleted. In contrast, in population ZHG, only 33.3% of genotypes had to be removed to achieve complete compatibility in the data set, which showed a sharp decline in incompatibility upon the deletion of those genotypes. All populations examined possessed similar levels of genetic variation. Population ZHG was not found to be more differentiated than the other populations. Sexual recombination is the predominant source of genetic variation in most of the examined populations of A. spinulosa. However, somatic mutation contributes most to the genetic variation in population ZHG. This change of the primary mode of reproduction does not cause a significant difference in the population genetic composition. Character compatibility analysis represents an effective approach to separate the role of sexual and asexual components in shaping the genetic pattern of fern populations.

A Multi-Stage Reverse Logistics Network Problem by Using Hybrid Priority-Based Genetic Algorithm

NASA Astrophysics Data System (ADS)

Lee, Jeong-Eun; Gen, Mitsuo; Rhee, Kyong-Gu

Today remanufacturing problem is one of the most important problems regarding to the environmental aspects of the recovery of used products and materials. Therefore, the reverse logistics is gaining become power and great potential for winning consumers in a more competitive context in the future. This paper considers the multi-stage reverse Logistics Network Problem (m-rLNP) while minimizing the total cost, which involves reverse logistics shipping cost and fixed cost of opening the disassembly centers and processing centers. In this study, we first formulate the m-rLNP model as a three-stage logistics network model. Following for solving this problem, we propose a Genetic Algorithm pri (GA) with priority-based encoding method consisting of two stages, and introduce a new crossover operator called Weight Mapping Crossover (WMX). Additionally also a heuristic approach is applied in the 3rd stage to ship of materials from processing center to manufacturer. Finally numerical experiments with various scales of the m-rLNP models demonstrate the effectiveness and efficiency of our approach by comparing with the recent researches.

Chronic blockade or constitutive deletion of the serotonin transporter reduces operant responding for food reward.

PubMed

Sanders, Amy Cecilia; Hussain, Ali J; Hen, René; Zhuang, Xiaoxi

2007-11-01

The therapeutic effects of chronic selective serotonin reuptake inhibitors (SSRIs) are well documented, yet the elementary behavioral processes that are affected by such treatment have not been fully investigated. We report here the effects of chronic fluoxetine treatment and genetic deletion of the serotonin transporter (SERT) on food reinforced behavior in three paradigms: the progressive ratio operant task, the concurrent choice operant task, and the Pavlovian-to-Instrumental transfer task. We consistently find that chronic pharmacological blockade or genetic deletion of SERT result in similar behavioral consequences: reduced operant responding for natural reward. This is in line with previous studies reporting declines in operant responding for drugs and intracranial self-stimulation with fluoxetine treatment, suggesting that the effect of SERT blockade can be generalized to different reward types. Detailed analyses of behavioral parameters indicate that this reduction in operant responding affect both goal-directed and non-goal-directed behaviors without affecting the Pavlovian cue-triggered excessive operant responding. In addition, both pharmacological and genetic manipulations reduce locomotor activity in the open field novel environment. Our data contrast with the effect of dopamine in increasing operant responding for natural reward specifically in goal-directed behaviors and in increasing Pavlovian cue-triggered excessive operant responding. Serotonin and dopamine have been proposed to serve opposing functions in motivational processes. Our data suggest that their interactions do not result in simple opponency. The fact that pharmacological blockade and genetic deletion of SERT have similar behavioral consequences reinforces the utility of the SERT null mice for investigation of the mechanisms underlying chronic SSRIs treatment.

Disparities in visuo-spatial constructive abilities in Williams syndrome patients with typical deletion on chromosome 7q11.23.

PubMed

Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho

2017-02-01

Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

PubMed

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

A high-throughput method for the detection of homoeologous gene deletions in hexaploid wheat

PubMed Central

2010-01-01

Background Mutational inactivation of plant genes is an essential tool in gene function studies. Plants with inactivated or deleted genes may also be exploited for crop improvement if such mutations/deletions produce a desirable agronomical and/or quality phenotype. However, the use of mutational gene inactivation/deletion has been impeded in polyploid plant species by genetic redundancy, as polyploids contain multiple copies of the same genes (homoeologous genes) encoded by each of the ancestral genomes. Similar to many other crop plants, bread wheat (Triticum aestivum L.) is polyploid; specifically allohexaploid possessing three progenitor genomes designated as 'A', 'B', and 'D'. Recently modified TILLING protocols have been developed specifically for mutation detection in wheat. Whilst extremely powerful in detecting single nucleotide changes and small deletions, these methods are not suitable for detecting whole gene deletions. Therefore, high-throughput methods for screening of candidate homoeologous gene deletions are needed for application to wheat populations generated by the use of certain mutagenic agents (e.g. heavy ion irradiation) that frequently generate whole-gene deletions. Results To facilitate the screening for specific homoeologous gene deletions in hexaploid wheat, we have developed a TaqMan qPCR-based method that allows high-throughput detection of deletions in homoeologous copies of any gene of interest, provided that sufficient polymorphism (as little as a single nucleotide difference) amongst homoeologues exists for specific probe design. We used this method to identify deletions of individual TaPFT1 homoeologues, a wheat orthologue of the disease susceptibility and flowering regulatory gene PFT1 in Arabidopsis. This method was applied to wheat nullisomic-tetrasomic lines as well as other chromosomal deletion lines to locate the TaPFT1 gene to the long arm of chromosome 5. By screening of individual DNA samples from 4500 M2 mutant wheat lines generated by heavy ion irradiation, we detected multiple mutants with deletions of each TaPFT1 homoeologue, and confirmed these deletions using a CAPS method. We have subsequently designed, optimized, and applied this method for the screening of homoeologous deletions of three additional wheat genes putatively involved in plant disease resistance. Conclusions We have developed a method for automated, high-throughput screening to identify deletions of individual homoeologues of a wheat gene. This method is also potentially applicable to other polyploidy plants. PMID:21114819

Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

PubMed Central

Prontera, Paolo; Rogaia, Daniela; Mencarelli, Amedea; Ottaviani, Valentina; Guercini, Giorgio; Bersano, Anna; Stangoni, Gabriela

2017-01-01

Moyamoya angiopathy (MA) is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735). Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1). In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA. PMID:28926972

Deletion at the SLC1A1 glutamate transporter gene co-segregates with schizophrenia and bipolar schizoaffective disorder in a 5-generation family.

PubMed

Myles-Worsley, Marina; Tiobech, Josepha; Browning, Sharon R; Korn, Jeremy; Goodman, Sarah; Gentile, Karen; Melhem, Nadine; Byerley, William; Faraone, Stephen V; Middleton, Frank A

2013-03-01

Growing evidence for genetic overlap between schizophrenia (SCZ) and bipolar disorder (BPD) suggests that causal variants of large effect on disease risk may cross traditional diagnostic boundaries. Extended multigenerational families with both SCZ and BPD cases can be a valuable resource for discovery of shared biological pathways because they can reveal the natural evolution of the underlying genetic disruptions and their phenotypic expression. We investigated a deletion at the SLC1A1 glutamate transporter gene originally identified as a copy number variant exclusively carried by members of a 5-generation Palauan family. Using an expanded sample of 21 family members, quantitative PCR confirmed the deletion in all seven individuals with psychosis, three "obligate-carrier" parents and one unaffected sibling, while four marry-in parents were non-carriers. Linkage analysis under an autosomal dominant model generated a LOD-score of 3.64, confirming co-segregation of the deletion with psychosis. For more precise localization, we determined the approximate deletion end points using alignment of next-generation sequencing data for one affected deletion-carrier and then designed PCR amplicons to span the entire deletion locus. These probes established that the deletion spans 84,298 bp, thus eliminating the entire promoter, the transcription start site, and the first 59 amino acids of the protein, including the first transmembrane Na(2+)/dicarboxylate symporter domain, one of the domains that perform the glutamate transport action. Discovery of this functionally relevant SLC1A1 mutation and its co-segregation with psychosis in an extended multigenerational pedigree provides further support for the important role played by glutamatergic transmission in the pathophysiology of psychotic disorders. Copyright © 2013 Wiley Periodicals, Inc.

Clinical-etiologic correlation in children with Prader-Willi syndrome (PWS): an interdisciplinary study.

PubMed

Torrado, Maria; Araoz, Veronica; Baialardo, Edgardo; Abraldes, Karina; Mazza, Carmen; Krochik, Gabriela; Ozuna, Blanca; Leske, Vivian; Caino, Silvia; Fano, Virginia; Chertkoff, Lilien

2007-03-01

Prader-Willi syndrome (PWS) is a multisystemic disorder caused by the loss of expression of paternally transcribed genes within chromosome 15q11-q13. Most cases are due to paternal deletion of this region; the remaining cases result from maternal uniparental disomy (UPD) and imprinting defects. To better understand the phenotypic variability of PWS, a genotype-phenotype correlation study was performed in 91 children with PWS. Patients were diagnosed by Southern Blot Methylation assay and genetic subtypes were established using FISH and microsatellite analyses. Fifty-nine subjects with deletion (31/28 males/females; mean age 3.86 years), 30 with UPD (14/16 males/females; mean age 3.89 years) and 2 girls with a presumed imprinting defect (mean age 0.43 yrs) were identified. For correlation purposes patients were grouped as "deleted" and "non-deleted." An increased maternal age was found in the UPD group. Four of Holm's criteria were more frequently present in the deleted group: need for special feeding techniques, sleep disturbance, hypopigmentation, and speech articulation defects. Concerning cognitive assessments, only 9.52% of subjects with deletion had Full-Scale IQ (FSIQ) > or =70, while 61.53% of subjects without deletion had FSIQ > or =70. Similar results were found in behavioral measures. Sleep disorders and carbohydrate metabolism were systematically assessed. Polysomnoghaphic studies revealed a higher frequency of central events with desaturations > or =10% in the deleted group (P = 0.020). In summary, the phenotype was significantly different between both groups in certain parameters related to the CNS. These results might be related to the differences in brain gene expression of the genetic subtypes. (c) 2006 Wiley-Liss, Inc.

A founder large deletion mutation in Xeroderma pigmentosum-Variant form in Tunisia: implication for molecular diagnosis and therapy.

PubMed

Ben Rekaya, Mariem; Laroussi, Nadia; Messaoud, Olfa; Jones, Mariem; Jerbi, Manel; Naouali, Chokri; Bouyacoub, Yosra; Chargui, Mariem; Kefi, Rym; Fazaa, Becima; Boubaker, Mohamed Samir; Boussen, Hamouda; Mokni, Mourad; Abdelhak, Sonia; Zghal, Mohamed; Khaled, Aida; Yacoub-Youssef, Houda

2014-01-01

Xeroderma pigmentosum Variant (XP-V) form is characterized by a late onset of skin symptoms. Our aim is the clinical and genetic investigations of XP-V Tunisian patients in order to develop a simple tool for early diagnosis. We investigated 16 suspected XP patients belonging to ten consanguineous families. Analysis of the POLH gene was performed by linkage analysis, long range PCR, and sequencing. Genetic analysis showed linkage to the POLH gene with a founder haplotype in all affected patients. Long range PCR of exon 9 to exon 11 showed a 3926 bp deletion compared to control individuals. Sequence analysis demonstrates that this deletion has occurred between two Alu-Sq2 repetitive sequences in the same orientation, respectively, in introns 9 and 10. We suggest that this mutation POLH NG_009252.1: g.36847_40771del3925 is caused by an equal crossover event that occurred between two homologous chromosomes at meiosis. These results allowed us to develop a simple test based on a simple PCR in order to screen suspected XP-V patients. In Tunisia, the prevalence of XP-V group seems to be underestimated and clinical diagnosis is usually later. Cascade screening of this founder mutation by PCR in regions with high frequency of XP provides a rapid and cost-effective tool for early diagnosis of XP-V in Tunisia and North Africa.

A Founder Large Deletion Mutation in Xeroderma Pigmentosum-Variant Form in Tunisia: Implication for Molecular Diagnosis and Therapy

PubMed Central

Ben Rekaya, Mariem; Laroussi, Nadia; Messaoud, Olfa; Jones, Mariem; Jerbi, Manel; Bouyacoub, Yosra; Chargui, Mariem; Kefi, Rym; Fazaa, Becima; Boubaker, Mohamed Samir; Boussen, Hamouda; Mokni, Mourad; Abdelhak, Sonia; Zghal, Mohamed; Khaled, Aida; Yacoub-Youssef, Houda

2014-01-01

Xeroderma pigmentosum Variant (XP-V) form is characterized by a late onset of skin symptoms. Our aim is the clinical and genetic investigations of XP-V Tunisian patients in order to develop a simple tool for early diagnosis. We investigated 16 suspected XP patients belonging to ten consanguineous families. Analysis of the POLH gene was performed by linkage analysis, long range PCR, and sequencing. Genetic analysis showed linkage to the POLH gene with a founder haplotype in all affected patients. Long range PCR of exon 9 to exon 11 showed a 3926 bp deletion compared to control individuals. Sequence analysis demonstrates that this deletion has occurred between two Alu-Sq2 repetitive sequences in the same orientation, respectively, in introns 9 and 10. We suggest that this mutation POLH NG_009252.1: g.36847_40771del3925 is caused by an equal crossover event that occurred between two homologous chromosomes at meiosis. These results allowed us to develop a simple test based on a simple PCR in order to screen suspected XP-V patients. In Tunisia, the prevalence of XP-V group seems to be underestimated and clinical diagnosis is usually later. Cascade screening of this founder mutation by PCR in regions with high frequency of XP provides a rapid and cost-effective tool for early diagnosis of XP-V in Tunisia and North Africa. PMID:24877075

Next generation diagnostics of cystic fibrosis and CFTR-related disorders by targeted multiplex high-coverage resequencing of CFTR.

PubMed

Trujillano, D; Ramos, M D; González, J; Tornador, C; Sotillo, F; Escaramis, G; Ossowski, S; Armengol, L; Casals, T; Estivill, X

2013-07-01

Here we have developed a novel and much more efficient strategy for the complete molecular characterisation of the cystic fibrosis (CF) transmembrane regulator (CFTR) gene, based on multiplexed targeted resequencing. We have tested this approach in a cohort of 92 samples with previously characterised CFTR mutations and polymorphisms. After enrichment of the pooled barcoded DNA libraries with a custom NimbleGen SeqCap EZ Choice array (Roche) and sequencing with a HiSeq2000 (Illumina) sequencer, we applied several bioinformatics tools to call mutations and polymorphisms in CFTR. The combination of several bioinformatics tools allowed us to detect all known pathogenic variants (point mutations, short insertions/deletions, and large genomic rearrangements) and polymorphisms (including the poly-T and poly-thymidine-guanine polymorphic tracts) in the 92 samples. In addition, we report the precise characterisation of the breakpoints of seven genomic rearrangements in CFTR, including those of a novel deletion of exon 22 and a complex 85 kb inversion which includes two large deletions affecting exons 4-8 and 12-21, respectively. This work is a proof-of-principle that targeted resequencing is an accurate and cost-effective approach for the genetic testing of CF and CFTR-related disorders (ie, male infertility) amenable to the routine clinical practice, and ready to substitute classical molecular methods in medical genetics.

The Physiological Effects of Deleting the Mouse Slc30a8 Gene Encoding Zinc Transporter-8 Are Influenced by Gender and Genetic Background

PubMed Central

Pound, Lynley D.; Sarkar, Suparna A.; Ustione, Alessandro; Dadi, Prasanna K.; Shadoan, Melanie K.; Lee, Catherine E.; Walters, Jay A.; Shiota, Masakazu; McGuinness, Owen P.; Jacobson, David A.; Piston, David W.; Hutton, John C.; Powell, David R.; O’Brien, Richard M.

2012-01-01

Objective The SLC30A8 gene encodes the islet-specific transporter ZnT-8, which is hypothesized to provide zinc for insulin-crystal formation. A polymorphic variant in SLC30A8 is associated with altered susceptibility to type 2 diabetes. Several groups have examined the effect of global Slc30a8 gene deletion but the results have been highly variable, perhaps due to the mixed 129SvEv/C57BL/6J genetic background of the mice studied. We therefore sought to remove the conflicting effect of 129SvEv-specific modifier genes. Methods The impact of Slc30a8 deletion was examined in the context of the pure C57BL/6J genetic background. Results Male C57BL/6J Slc30a8 knockout (KO) mice had normal fasting insulin levels and no change in glucose-stimulated insulin secretion (GSIS) from isolated islets in marked contrast to the ∼50% and ∼35% decrease, respectively, in both parameters observed in male mixed genetic background Slc30a8 KO mice. This observation suggests that 129SvEv-specific modifier genes modulate the impact of Slc30a8 deletion. In contrast, female C57BL/6J Slc30a8 KO mice had reduced (∼20%) fasting insulin levels, though this was not associated with a change in fasting blood glucose (FBG), or GSIS from isolated islets. This observation indicates that gender also modulates the impact of Slc30a8 deletion, though the physiological explanation as to why impaired insulin secretion is not accompanied by elevated FBG is unclear. Neither male nor female C57BL/6J Slc30a8 KO mice showed impaired glucose tolerance. Conclusions Our data suggest that, despite a marked reduction in islet zinc content, the absence of ZnT-8 does not have a substantial impact on mouse physiology. PMID:22829903

A rapid NGS strategy for comprehensive molecular diagnosis of Birt-Hogg-Dubé syndrome in patients with primary spontaneous pneumothorax.

PubMed

Zhang, Xinxin; Ma, Dehua; Zou, Wei; Ding, Yibing; Zhu, Chengchu; Min, Haiyan; Zhang, Bin; Wang, Wei; Chen, Baofu; Ye, Minhua; Cai, Minghui; Pan, Yanqing; Cao, Lei; Wan, Yueming; Jin, Yu; Gao, Qian; Yi, Long

2016-05-27

Primary spontaneous pneumothorax (PSP) or pulmonary cysts is one of the manifestations of Birt-Hogg-Dube syndrome (BHDS) that is caused by heterozygous mutations in FLCN gene. Most of the mutations are SNVs and small indels, and there are also approximately 10 % large intragenic deletions and duplications of the mutations. These molecular findings are generally obtained by disparate methods including Sanger sequencing and Multiple Ligation-dependent Probe Amplification in the clinical laboratory. In addition, as a genetically heterogeneous disorder, PSP may be caused by mutations in multiple genes include FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 genes. For differential diagnosis, these genes should also be screened which makes the diagnostic procedure more time-consuming and labor-intensive. Forty PSP patients were divided into 2 groups. Nineteen patients with different pathogenic mutations of FLCN previously identified by conventional Sanger sequencing and MLPA were included in test group, 21 random PSP patients without any genetic screening were included in blinded sample group. 7 PSP genes including FLCN, FBN1, COL3A1, CBS, SERPINA1 and TSC1/TSC2 were designed and enriched by Haloplex system, sequenced on a Miseq platform and analyzed in the 40 patients to evaluate the performance of the targeted-NGS method. We demonstrated that the full spectrum of genes associated with pneumothorax including FLCN gene mutations can be identified simultaneously in multiplexed sequence data. Noteworthy, by our in-house copy number analysis of the sequence data, we could not only detect intragenic deletions, but also determine approximate deletion junctions simultaneously. NGS based Haloplex target enrichment technology is proved to be a rapid and cost-effective screening strategy for the comprehensive molecular diagnosis of BHDS in PSP patients, as it can replace Sanger sequencing and MLPA by simultaneously detecting exonic and intronic SNVs, small indels, large intragenic deletions and determining deletion junctions in PSP-related genes.

Hippo pathway deficiency reverses systolic heart failure after infarction.

PubMed

Leach, John P; Heallen, Todd; Zhang, Min; Rahmani, Mahdis; Morikawa, Yuka; Hill, Matthew C; Segura, Ana; Willerson, James T; Martin, James F

2017-10-12

Mammalian organs vary widely in regenerative capacity. Poorly regenerative organs, such as the heart are particularly vulnerable to organ failure. Once established, heart failure commonly results in mortality. The Hippo pathway, a kinase cascade that prevents adult cardiomyocyte proliferation and regeneration, is upregulated in human heart failure. Here we show that deletion of the Hippo pathway component Salvador (Salv) in mouse hearts with established ischaemic heart failure after myocardial infarction induces a reparative genetic program with increased scar border vascularity, reduced fibrosis, and recovery of pumping function compared with controls. Using translating ribosomal affinity purification, we isolate cardiomyocyte-specific translating messenger RNA. Hippo-deficient cardiomyocytes have increased expression of proliferative genes and stress response genes, such as the mitochondrial quality control gene, Park2. Genetic studies indicate that Park2 is essential for heart repair, suggesting a requirement for mitochondrial quality control in regenerating myocardium. Gene therapy with a virus encoding Salv short hairpin RNA improves heart function when delivered at the time of infarct or after ischaemic heart failure following myocardial infarction was established. Our findings indicate that the failing heart has a previously unrecognized reparative capacity involving more than cardiomyocyte renewal.

Genetic absence of PD-1 promotes accumulation of terminally differentiated exhausted CD8+ T cells

PubMed Central

Odorizzi, Pamela M.; Pauken, Kristen E.; Paley, Michael A.; Sharpe, Arlene

2015-01-01

Programmed Death-1 (PD-1) has received considerable attention as a key regulator of CD8+ T cell exhaustion during chronic infection and cancer because blockade of this pathway partially reverses T cell dysfunction. Although the PD-1 pathway is critical in regulating established “exhausted” CD8+ T cells (TEX cells), it is unclear whether PD-1 directly causes T cell exhaustion. We show that PD-1 is not required for the induction of exhaustion in mice with chronic lymphocytic choriomeningitis virus (LCMV) infection. In fact, some aspects of exhaustion are more severe with genetic deletion of PD-1 from the onset of infection. Increased proliferation between days 8 and 14 postinfection is associated with subsequent decreased CD8+ T cell survival and disruption of a critical proliferative hierarchy necessary to maintain exhausted populations long term. Ultimately, the absence of PD-1 leads to the accumulation of more cytotoxic, but terminally differentiated, CD8+ TEX cells. These results demonstrate that CD8+ T cell exhaustion can occur in the absence of PD-1. They also highlight a novel role for PD-1 in preserving TEX cell populations from overstimulation, excessive proliferation, and terminal differentiation. PMID:26034050

An Efficient and Versatile System for Visualization and Genetic Modification of Dopaminergic Neurons in Transgenic Mice

PubMed Central

Kramer, Edgar R.

2015-01-01

Background & Aims The brain dopaminergic (DA) system is involved in fine tuning many behaviors and several human diseases are associated with pathological alterations of the DA system such as Parkinson’s disease (PD) and drug addiction. Because of its complex network integration, detailed analyses of physiological and pathophysiological conditions are only possible in a whole organism with a sophisticated tool box for visualization and functional modification. Methods & Results Here, we have generated transgenic mice expressing the tetracycline-regulated transactivator (tTA) or the reverse tetracycline-regulated transactivator (rtTA) under control of the tyrosine hydroxylase (TH) promoter, TH-tTA (tet-OFF) and TH-rtTA (tet-ON) mice, to visualize and genetically modify DA neurons. We show their tight regulation and efficient use to overexpress proteins under the control of tet-responsive elements or to delete genes of interest with tet-responsive Cre. In combination with mice encoding tet-responsive luciferase, we visualized the DA system in living mice progressively over time. Conclusion These experiments establish TH-tTA and TH-rtTA mice as a powerful tool to generate and monitor mouse models for DA system diseases. PMID:26291828

Genetics Home Reference: 15q24 microdeletion

MedlinePlus

... Genetic Changes People with a 15q24 microdeletion are missing between 1.7 million and 6.1 million ... of the deletion varies, but all individuals are missing the same 1.2 Mb region. This region ...

A deletion mutation in the 5' part of the pol gene of Moloney murine leukemia virus blocks proteolytic processing of the gag and pol polyproteins.

PubMed Central

Crawford, S; Goff, S P

1985-01-01

Deletion mutations in the 5' part of the pol gene of Moloney murine leukemia virus were generated by restriction enzyme site-directed mutagenesis of cloned proviral DNA. DNA sequence analysis indicated that one such deletion was localized entirely within the 5' part of the pol gene, did not affect the region encoding reverse transcriptase, and preserved the translational reading frame downstream of the mutation. The major viral precursor polyproteins (Pr65gag, Pr200gag-pol, and gPr80env) were synthesized at wild-type levels in cell lines carrying the mutant genome. These cell lines assembled and released wild-type levels of virion particles into the medium. Cleavage of both Pr65gag and Pr200gag-pol precursors to the mature proteins was completely blocked in the mutant virions. Surprisingly, these virions contained high levels of active reverse transcriptase; examination of the endogenous reverse transcription products synthesized by the mutant virions revealed normal amounts of minus-strand strong-stop DNA, indicating that the RNA genome was packaged and that reverse transcription in detergent-permeabilized virions was not significantly impaired. Processing of gPr80env to gP70env and P15E was not affected by the mutation, but cleavage of P15E to P12E was not observed. The mutant particles were poorly infectious; analysis indicated that infection was blocked at an early stage. The data are consistent with the idea that the 5' part of the pol gene encodes a protease directly responsible for processing Pr65gag, and possibly Pr200gag-pol, to the structural virion proteins. It appears that cleavage of the gag gene product is not required for budding and release of virions and that complete processing of the pol gene product to the mature form of reverse transcriptase is not required for its functional activation. Images PMID:3882995

Identification of deletions in children with congenital hypothyroidism and thyroid dysgenesis with the use of multiplex ligation-dependent probe amplification.

PubMed

Kumorowicz-Czoch, Malgorzata; Madetko-Talowska, Anna; Tylek-Lemanska, Dorota; Pietrzyk, Jacek J; Starzyk, Jerzy

2015-01-01

Thyroid dysgenesis (TD) is the most common cause of congenital hypothyroidism (CH). Important genetic factors possibly contributing to TD etiologies include mutations of thyroid transcription factors and TSHR-encoding genes. Our objective was to determine multiplex ligation-dependent probe amplification (MLPA) utility in detecting the copy number changes in patients with CH and TD. The study included 45 children from southeastern Poland selected via already established neonatal screening for CH. Genomic DNA was extracted from peripheral blood samples and used in MLPA analysis. Genetic variations were analyzed within selected fragments of the PAX8, FOXE1, NKX2-1, thyroid stimulating hormone receptor (TSHR), and TPO genes. Three heterozygous deletion types in probe hybridization regions were identified for the following genes: PAX8 (exon 7), TSHR (exon 2), and FOXE1 (exon 1). Monoallelic deletions were identified in 5/45 TD subjects. MLPA is a useful tool for copy number changes detection and might both improve and expand genetic analysis for CH and TD.

Attenuation and efficacy of live-attenuated Rift Valley fever virus vaccine candidates in non-human primates.

PubMed

Smith, Darci R; Johnston, Sara C; Piper, Ashley; Botto, Miriam; Donnelly, Ginger; Shamblin, Joshua; Albariño, César G; Hensley, Lisa E; Schmaljohn, Connie; Nichol, Stuart T; Bird, Brian H

2018-05-09

Rift Valley fever virus (RVFV) is an important mosquito-borne veterinary and human pathogen that has caused large outbreaks of severe disease throughout Africa and the Arabian Peninsula. Currently, no licensed vaccine or therapeutics exists to treat this potentially deadly disease. The explosive nature of RVFV outbreaks and the severe consequences of its accidental or intentional introduction into RVFV-free areas provide the impetus for the development of novel vaccine candidates for use in both livestock and humans. Rationally designed vaccine candidates using reverse genetics have been used to develop deletion mutants of two known RVFV virulence factors, the NSs and NSm genes. These recombinant viruses were demonstrated to be protective and immunogenic in rats, mice, and sheep, without producing clinical illness in these animals. Here, we expand upon those findings and evaluate the single deletion mutant (ΔNSs rRVFV) and double deletion mutant (ΔNSs-ΔNSm rRVFV) vaccine candidates in the common marmoset (Callithrix jacchus), a non-human primate (NHP) model resembling severe human RVF disease. We demonstrate that both the ΔNSs and ΔNSs-ΔNSm rRVFV vaccine candidates were found to be safe and immunogenic in the current study. The vaccinated animals received a single dose of vaccine that led to the development of a robust antibody response. No vaccine-induced adverse reactions, signs of clinical illness or infectious virus were detected in the vaccinated marmosets. All vaccinated animals that were subsequently challenged with RVFV were protected against viremia and liver disease. In summary, our results provide the basis for further development of the ΔNSs and ΔNSs-ΔNSm rRVFV as safe and effective human RVFV vaccines for this significant public health threat.

Copy Number Variation in Patients with Disorders of Sex Development Due to 46,XY Gonadal Dysgenesis

PubMed Central

White, Stefan; Ohnesorg, Thomas; Notini, Amanda; Roeszler, Kelly; Hewitt, Jacqueline; Daggag, Hinda; Smith, Craig; Turbitt, Erin; Gustin, Sonja; van den Bergen, Jocelyn; Miles, Denise; Western, Patrick; Arboleda, Valerie; Schumacher, Valerie; Gordon, Lavinia; Bell, Katrina; Bengtsson, Henrik; Speed, Terry; Hutson, John; Warne, Garry; Harley, Vincent; Koopman, Peter; Vilain, Eric; Sinclair, Andrew

2011-01-01

Disorders of sex development (DSD), ranging in severity from mild genital abnormalities to complete sex reversal, represent a major concern for patients and their families. DSD are often due to disruption of the genetic programs that regulate gonad development. Although some genes have been identified in these developmental pathways, the causative mutations have not been identified in more than 50% 46,XY DSD cases. We used the Affymetrix Genome-Wide Human SNP Array 6.0 to analyse copy number variation in 23 individuals with unexplained 46,XY DSD due to gonadal dysgenesis (GD). Here we describe three discrete changes in copy number that are the likely cause of the GD. Firstly, we identified a large duplication on the X chromosome that included DAX1 (NR0B1). Secondly, we identified a rearrangement that appears to affect a novel gonad-specific regulatory region in a known testis gene, SOX9. Surprisingly this patient lacked any signs of campomelic dysplasia, suggesting that the deletion affected expression of SOX9 only in the gonad. Functional analysis of potential SRY binding sites within this deleted region identified five putative enhancers, suggesting that sequences additional to the known SRY-binding TES enhancer influence human testis-specific SOX9 expression. Thirdly, we identified a small deletion immediately downstream of GATA4, supporting a role for GATA4 in gonad development in humans. These CNV analyses give new insights into the pathways involved in human gonad development and dysfunction, and suggest that rearrangements of non-coding sequences disturbing gene regulation may account for significant proportion of DSD cases. PMID:21408189

Oncogenic KIAA1549-BRAF fusion with activation of the MAPK/ERK pathway in pediatric oligodendrogliomas.

PubMed

Kumar, Anupam; Pathak, Pankaj; Purkait, Suvendu; Faruq, Mohammed; Jha, Prerana; Mallick, Supriya; Suri, Vaishali; Sharma, Mehar C; Suri, Ashish; Sarkar, Chitra

2015-03-01

Pediatric oligodendrogliomas (pODGs) are rare central nervous system tumors, and comparatively little is known about their molecular pathogenesis. Co-deletion of 1p/19q; and IDH1, CIC, and FUBP1 mutations, which are molecular signatures of adult oligodendrogliomas, are extremely rare in pODGs. In this report, two pODGs, one each of grade II and grade III, were evaluated using clinical, radiological, histopathologic, and follow-up methods. IDH1, TP53, CIC, H3F3A, and BRAF-V600 E mutations were analyzed by Sanger sequencing and immunohistochemical methods, and 1p/19q co-deletion was analyzed by fluorescence in situ hybridization. PDGFRA amplification, BRAF gain, intragenic duplication of FGFR-TKD, and KIAA1549-BRAF fusion (validated by Sanger sequencing) were analyzed by real-time reverse transcription PCR. Notably, both cases showed the oncogenic KIAA1549_Ex15-BRAF_Ex9 fusion transcript. Further, immunohistochemical analysis showed activation of the MAPK/ERK pathway in both of these cases. However, neither 1p/19q co-deletion; IDH1, TP53, CIC, H3F3A, nor BRAF-V600 E mutation; PDGFRA amplification; BRAF gain; nor duplication of FGFR-TKD was identified. Overall, this study highlights that pODGs can harbor the KIAA1549-BRAF fusion with aberrant MAPK/ERK signaling, and there exists an option of targeting these pathways in such patients. These results indicate that pODGs with the KIAA1549-BRAF fusion may represent a subset of this rare tumor that shares molecular and genetic features of pilocytic astrocytomas. These findings will increase our understanding of pODGs and may have clinical implications. Copyright © 2015 Elsevier Inc. All rights reserved.

Clinical, cytogenetic, and molecular analysis with 46,XX male sex reversal syndrome: case reports.

PubMed

Gao, Xuefeng; Chen, Guian; Huang, Jing; Bai, Quan; Zhao, Nan; Shao, Minjie; Jiao, Liping; Wei, Yanling; Chang, Liang; Li, Dan; Yang, Liping

2013-03-01

To investigate the clinical characteristics of different categories of sex-reversed 46,XX individuals and their relationships with chromosomal karyotype and the SRY gene. Chromosome karyotyping for peripheral blood culture and multi-PCR and FISH were performed. Endocrinological data showed that their endocrine hormone levels were similar to that observed for Klinefelter syndrome, with higher FSH and LH levels and lower T levels. Chromosome karyotyping for peripheral blood culture revealed 46, XX complement for 11 males. Molecular studies showed that there were locus deletions at SY84, SY86, SY127, SY134, SY254 and SY255 in AZF on chromosome Y in 9 cases, with the SRY gene present at the terminus of the X chromosome short arm. In one case, besides 6 locus deletions in AZF, there was also SRY gene deletion. In another case, there were locus deletions only at SY254 and SY255, with SY84, SY86, SY127 SY134 loci and SRY present. The majority (10/11) of 46,XX males were SRY positive, with the SRY gene translocated into the terminus of the X chromosome short arm. These patients were caused mainly by an X/Y chromosomal inter-change during paternal meiosis, leading to the differentiation of primary gonads into testes. Only a single patient (1/11) was SRY-negative, in which there might be some unknown downstream genes involved in sex determination.

A 11.7-kb deletion triggers intersexuality and polledness in goats.

PubMed

Pailhoux, E; Vigier, B; Chaffaux, S; Servel, N; Taourit, S; Furet, J P; Fellous, M; Grosclaude, F; Cribiu, E P; Cotinot, C; Vaiman, D

2001-12-01

Mammalian sex determination is governed by the presence of the sex determining region Y gene (SRY) on the Y chromosome. Familial cases of SRY-negative XX sex reversal are rare in humans, often hampering the discovery of new sex-determining genes. The mouse model is also insufficient to correctly apprehend the sex-determination cascade, as the human pathway is much more sensitive to gene dosage. Other species might therefore be considered in this respect. In goats, the polled intersex syndrome (PIS) mutation associates polledness and intersexuality. The sex reversal affects exclusively the XX individuals in a recessive manner, whereas the absence of horns is dominant in both sexes. The syndrome is caused by an autosomal gene located at chromosome band 1q43 (ref. 9), shown to be homologous to human chromosome band 3q23 (ref. 10). Through a positional cloning approach, we demonstrate that the mutation underlying PIS is the deletion of a critical 11.7-kb DNA element containing mainly repetitive sequences. This deletion affects the transcription of at least two genes: PISRT1, encoding a 1.5-kb mRNA devoid of open reading frame (ORF), and FOXL2, recently shown to be responsible for blepharophimosis ptosis epicanthus inversus syndrome (BPES) in humans. These two genes are located 20 and 200 kb telomeric from the deletion, respectively.

Characterization of genomic deletion efficiency mediated by clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 nuclease system in mammalian cells.

PubMed

Canver, Matthew C; Bauer, Daniel E; Dass, Abhishek; Yien, Yvette Y; Chung, Jacky; Masuda, Takeshi; Maeda, Takahiro; Paw, Barry H; Orkin, Stuart H

2014-08-01

The clustered regularly interspaced short [corrected] palindromic repeats (CRISPR)/CRISPR-associated (Cas) 9 nuclease system has provided a powerful tool for genome engineering. Double strand breaks may trigger nonhomologous end joining repair, leading to frameshift mutations, or homology-directed repair using an extrachromosomal template. Alternatively, genomic deletions may be produced by a pair of double strand breaks. The efficiency of CRISPR/Cas9-mediated genomic deletions has not been systematically explored. Here, we present a methodology for the production of deletions in mammalian cells, ranging from 1.3 kb to greater than 1 Mb. We observed a high frequency of intended genomic deletions. Nondeleted alleles are nonetheless often edited with inversions or small insertion/deletions produced at CRISPR recognition sites. Deleted alleles also typically include small insertion/deletions at predicted deletion junctions. We retrieved cells with biallelic deletion at a frequency exceeding that of probabilistic expectation. We demonstrate an inverse relationship between deletion frequency and deletion size. This work suggests that CRISPR/Cas9 is a robust system to produce a spectrum of genomic deletions to allow investigation of genes and genetic elements. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Microdeletions are a general feature of adult and adolescent acute lymphoblastic leukemia: Unexpected similarities with pediatric disease

PubMed Central

Paulsson, Kajsa; Cazier, Jean-Baptiste; MacDougall, Finlay; Stevens, Jane; Stasevich, Irina; Vrcelj, Nikoletta; Chaplin, Tracy; Lillington, Debra M.; Lister, T. Andrew; Young, Bryan D.

2008-01-01

We present here a genome-wide map of abnormalities found in diagnostic samples from 45 adults and adolescents with acute lymphoblastic leukemia (ALL). A 500K SNP array analysis uncovered frequent genetic abnormalities, with cryptic deletions constituting half of the detected changes, implying that microdeletions are a characteristic feature of this malignancy. Importantly, the pattern of deletions resembled that recently reported in pediatric ALL, suggesting that adult, adolescent, and childhood cases may be more similar on the genetic level than previously thought. Thus, 70% of the cases displayed deletion of one or more of the CDKN2A, PAX5, IKZF1, ETV6, RB1, and EBF1 genes. Furthermore, several genes not previously implicated in the pathogenesis of ALL were identified as possible recurrent targets of deletion. In total, the SNP array analysis identified 367 genetic abnormalities not corresponding to known copy number polymorphisms, with all but two cases (96%) displaying at least one cryptic change. The resolution level of this SNP array study is the highest used to date to investigate a malignant hematologic disorder. Our findings provide insights into the leukemogenic process and may be clinically important in adult and adolescent ALL. Most importantly, we report that microdeletions of key genes appear to be a common, characteristic feature of ALL that is shared among different clinical, morphological, and cytogenetic subgroups. PMID:18458336

Pearson syndrome in a Diamond-Blackfan anemia cohort.

PubMed

Alter, Blanche P

2014-07-17

In this issue of Blood, Gagne et al describe a cohort of 362 patients clinically classified as having Diamond-Blackfan anemia (DBA), in which 175 (48%) were found to have mutations and deletions in ribosomal protein genes or GATA1, and 8 of the remaining patients (2.2% overall) had mitochondrial gene deletions consistent with Pearson marrow-pancreas syndrome (PS). The authors propose that all patients with presumptive DBA should be tested for mitochondrial DNA (mtDNA) deletion during their initial genetic evaluation.

A Genetic System for the Thermophilic Acetogenic Bacterium Thermoanaerobacter kivui.

PubMed

Basen, Mirko; Geiger, Irina; Henke, Laura; Müller, Volker

2018-02-01

Thermoanaerobacter kivui is one of the very few thermophilic acetogenic microorganisms. It grows optimally at 66°C on sugars but also lithotrophically with H 2 + CO 2 or with CO, producing acetate as the major product. While a genome-derived model of acetogenesis has been developed, only a few physiological or biochemical experiments regarding the function of important enzymes in carbon and energy metabolism have been carried out. To address this issue, we developed a method for targeted markerless gene deletions and for integration of genes into the genome of T. kivui The strain naturally took up plasmid DNA in the exponential growth phase, with a transformation frequency of up to 3.9 × 10 -6 A nonreplicating plasmid and selection with 5-fluoroorotate was used to delete the gene encoding the orotate phosphoribosyltransferase ( pyrE ), resulting in a Δ pyrE uracil-auxotrophic strain, TKV002. Reintroduction of pyrE on a plasmid or insertion of pyrE into different loci within the genome restored growth without uracil. We subsequently studied fructose metabolism in T. kivui The gene fruK (TKV_c23150) encoding 1-phosphofructosekinase (1-PFK) was deleted, using pyrE as a selective marker via two single homologous recombination events. The resulting Δ fruK strain, TKV003, did not grow on fructose; however, growth on glucose (or on mannose) was unaffected. The combination of pyrE as a selective marker and the natural competence of the strain for DNA uptake will be the basis for future studies on CO 2 reduction and energy conservation and their regulation in this thermophilic acetogenic bacterium. IMPORTANCE Acetogenic bacteria are currently the focus of research toward biotechnological applications due to their potential for de novo synthesis of carbon compounds such as acetate, butyrate, or ethanol from H 2 + CO 2 or from synthesis gas. Based on available genome sequences and on biochemical experiments, acetogens differ in their energy metabolism. Thus, there is an urgent need to understand the carbon and electron flows through the Wood-Ljungdahl pathway and their links to energy conservation, which requires genetic manipulations such as deletion or overexpression of genes encoding putative key enzymes. Unfortunately, genetic systems have been reported for only a few acetogenic bacteria. Here, we demonstrate proof of concept for the genetic modification of the thermophilic acetogenic species Thermoanaerobacter kivui The genetic system will be used to study genes involved in biosynthesis and energy metabolism, and may further be applied to metabolically engineer T. kivui to produce fuels and chemicals. Copyright © 2018 American Society for Microbiology.

A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.

PubMed

Singha, Kritsada; Fucharoen, Goonnapa; Hama, Abdulloh; Fucharoen, Supan

2015-07-01

To report the phenotypes and genetic basis of a novel (A)γδβ(0)-thalassemia found in Thai individuals with several forms of thalassemia. An initial study was done in an adult Thai woman who had hypochromic microcytic red cells with unusually 100% Hb F. Extended study was carried out on her parents and another 17 unrelated individuals with elevated Hb F. Hb analysis was performed by capillary electrophoresis and DNA analysis was done using PCR. A novel diagnostic method based on multiplex PCR assays was developed. DNA analysis of the proband revealed the homozygosity for a novel deletion of 118.3 kb, removing the entire (A)γ, ψβ, δ-, β-globin and five olfactory receptor (OR) genes with an insertion of a 179 bp inverted DNA sequence located behind the OR52A5 gene located downstream and an insertion of 7 orphan nucleotides. Her parents were both carriers of this mutation. Further screening in suspected cases in our series unexpectedly led to identification of an additional 17 cases with this mutation in different genotypes including plain heterozygote, homozygote, compound heterozygote with Hb E, and double heterozygote with several forms of α-thalassemia. Hematological features associated with these genetic interactions are presented. Haplotype analysis indicated a single origin of this novel deletion-inversion-insertion (A)γδβ(0)-thalassemia in the Thai population. Differentiation of this mutation and other high Hb F determinants documented previously could be done by using a developed multiplex PCR assay. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

Conditional genetic deletion of PTEN after a spinal cord injury enhances regenerative growth of CST axons and motor function recovery in mice

PubMed Central

Danilov, Camelia A.; Steward, Oswald

2015-01-01

Previous studies indicate that conditional genetic deletion of phosphatase and tensin homolog (PTEN) in neonatal mice enhances the ability of axons to regenerate following spinal cord injury (SCI) in adults. Here, we assessed whether deleting PTEN in adult neurons post-SCI is also effective, and whether enhanced regenerative growth is accompanied by enhanced recovery of voluntary motor function. PTENloxP/loxP mice received moderate contusion injuries at cervical level 5 (C5). One group received unilateral injections of adeno-associated virus expressing CRE (AAV-CRE) into the sensorimotor cortex; controls received a vector expressing green fluorescent protein (AAV-GFP) or injuries only (no vector injections). Forelimb function was tested for 14 weeks post-SCI using a grip strength meter (GSM) and a hanging task. The corticospinal tract (CST) was traced by injecting mini-ruby BDA into the sensorimotor cortex. Forelimb gripping ability was severely impaired immediately post-SCI but recovered slowly over time. The extent of recovery was significantly greater in PTEN-deleted mice in comparison to either the AAV-GFP group or the injury only group. BDA tract tracing revealed significantly higher numbers of BDA-labeled axons in caudal segments in the PTEN-deleted group compared to control groups. In addition, in the PTEN-deleted group, there were exuberant collaterals extending from the main tract rostral to the lesion, into and around the scar tissue at the injury site. These results indicate that PTEN deletion in adult mice shortly post-SCI can enhance regenerative growth of CST axons and forelimb motor function recovery. PMID:25704959

Partial Genetic Deletion of Neuregulin 1 Modulates the Effects of Stress on Sensorimotor Gating, Dendritic Morphology, and HPA Axis Activity in Adolescent Mice

PubMed Central

Chohan, Tariq W.; Boucher, Aurelie A.; Spencer, Jarrah R.; Kassem, Mustafa S.; Hamdi, Areeg A.; Karl, Tim; Fok, Sandra Y.; Bennett, Maxwell R.; Arnold, Jonathon C.

2014-01-01

Stress has been linked to the pathogenesis of schizophrenia. Genetic variation in neuregulin 1 (NRG1) increases the risk of developing schizophrenia and may help predict which high-risk individuals will transition to psychosis. NRG1 also modulates sensorimotor gating, a schizophrenia endophenotype. We used an animal model to demonstrate that partial genetic deletion of Nrg1 interacts with stress to promote neurobehavioral deficits of relevance to schizophrenia. Nrg1 heterozygous (HET) mice displayed greater acute stress-induced anxiety-related behavior than wild-type (WT) mice. Repeated stress in adolescence disrupted the normal development of higher prepulse inhibition of startle selectively in Nrg1 HET mice but not in WT mice. Further, repeated stress increased dendritic spine density in pyramidal neurons of the medial prefrontal cortex (mPFC) selectively in Nrg1 HET mice. Partial genetic deletion of Nrg1 also modulated the adaptive response of the hypothalamic-pituitary-adrenal axis to repeated stress, with Nrg1 HET displaying a reduced repeated stress-induced level of plasma corticosterone than WT mice. Our results demonstrate that Nrg1 confers vulnerability to repeated stress-induced sensorimotor gating deficits, dendritic spine growth in the mPFC, and an abberant endocrine response in adolescence. PMID:24442851

[Prader Willi syndrome patients: study of 77 patients].

PubMed

Poyatos, David; Camprubí, Cristina; Gabau, Elisabeth; Nosas, Ramón; Villatoro, Sergi; Coll, María Dolores; Guitart, Miriam

2009-11-07

The Prader-Willi syndrome (PWS) is a disease of genetic origin. It is characterized by neonatal hypotonia, hypogonadism, hiperfagia leading to obesity, low stature, developmental delay, moderate mental retardation, abnormal behavior and characteristic facial appearance. It is caused by the loss or the inactivation of paternal genes of the imprinted region 15q11-13. There are different genetic causes: paternal 15q11-q13 deletion in 70% of patients, maternal uniparental disomy in the 20-25% and less than 5% have an imprinting defect. We present the results obtained in the transverse clinical - genetic study of 77 PWS patients. There has been realized the study of 374 suspected PWS patients. Cytogenetics studies of bands G and hybridization in situ fluorescent (FISH) and molecular genetics analysis of microsatellites, Southern blot, MS-PCR and sequenciation were carried out. Holm's criteria use for the correlation phenotype - genotype in 48 patients. PWS was confirmed in 77 patients, 46 deletion, 16 uniparental disomy, two imprinting defect and 13 only PWS methylation pattern. Significant differences do not observe in the correlation phenotype - genotype. The frequencies of the molecular alterations, 71.87 % deletion, 25 % UPD and 3.12 % DI, they are similar to described in the literature. It presents the algorithm of diagnosis used with the MS-PCR as rapid technology to confirm PWS.

Homozygous single base deletion in TUSC3 causes intellectual disability with developmental delay in an Omani family.

PubMed

Al-Amri, Ahmed; Saegh, Abeer Al; Al-Mamari, Watfa; El-Asrag, Mohammed E; Ivorra, Jose L; Cardno, Alastair G; Inglehearn, Chris F; Clapcote, Steven J; Ali, Manir

2016-07-01

Intellectual disability (ID) is the term used to describe a diverse group of neurological conditions with congenital or juvenile onset, characterized by an IQ score of less than 70 and difficulties associated with limitations in cognitive function and adaptive behavior. The condition can be inherited or caused by environmental factors. The genetic forms are heterogeneous, with mutations in over 500 known genes shown to cause the disorder. We report a consanguineous Omani family in which multiple individuals have ID and developmental delay together with some variably present features including short stature, microcephaly, moderate facial dysmorphism, and congenital malformations of the toes or hands. Homozygosity mapping combined with whole exome next generation sequencing identified a novel homozygous single base pair deletion in TUSC3, c.222delA, p.R74 fs. The mutation segregates with the disease phenotype in a recessive manner and is absent in 60,706 unrelated individuals from various disease-specific and population genetic studies. TUSC3 mutations have been previously identified as causing either syndromic or non-syndromic ID in patients from France, Italy, Iran and Pakistan. This paper supports the previous clinical descriptions of the condition caused by TUSC3 mutations and describes the seventh family with mutations in this gene, thus contributing to the genetic spectrum of mutations. This is the first report of a family from the Arabian peninsula with this form of ID. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Mapping Cortical Morphology in Youth with Velocardiofacial (22q11.2 Deletion) Syndrome

ERIC Educational Resources Information Center

Kates, Wendy R.; Bansal, Ravi; Fremont, Wanda; Antshel, Kevin M.; Hao, Xuejun; Higgins, Anne Marie; Liu, Jun; Shprintzen, Robert J.; Peterson, Bradley S.

2011-01-01

Objective: Velocardiofacial syndrome (VCFS; 22q11.2 deletion syndrome) represents one of the highest known risk factors for schizophrenia. Insofar as up to 30% of individuals with this genetic disorder develop schizophrenia, VCFS constitutes a unique, etiologically homogeneous model for understanding the pathogenesis of schizophrenia. Method:…

The 2.1-kb inverted repeat DNA sequences flank the mat2,3 silent region in two species of Schizosaccharomyces and are involved in epigenetic silencing in Schizosaccharomyces pombe.

PubMed Central

Singh, Gurjeet; Klar, Amar J S

2002-01-01

The mat2,3 region of the fission yeast Schizosaccharomyces pombe exhibits a phenomenon of transcriptional silencing. This region is flanked by two identical DNA sequence elements, 2.1 kb in length, present in inverted orientation: IRL on the left and IRR on the right of the silent region. The repeats do not encode any ORF. The inverted repeat DNA region is also present in a newly identified related species, which we named S. kambucha. Interestingly, the left and right repeats share perfect identity within a species, but show approximately 2% bases interspecies variation. Deletion of IRL results in variegated expression of markers inserted in the silent region, while deletion of the IRR causes their derepression. When deletions of these repeats were genetically combined with mutations in different trans-acting genes previously shown to cause a partial defect in silencing, only mutations in clr1 and clr3 showed additive defects in silencing with the deletion of IRL. The rate of mat1 switching is also affected by deletion of repeats. The IRL or IRR deletion did not cause significant derepression of the mat2 or mat3 loci. These results implicate repeats for maintaining full repression of the mat2,3 region, for efficient mat1 switching, and further support the notion that multiple pathways cooperate to silence the mat2,3 domain. PMID:12399374

New trends in chromosomal investigation in children with cardiovascular malformations.

PubMed

Schellberg, Ruth; Schwanitz, Gesa; Grävinghoff, Lutz; Kallenberg, Rolf; Trost, Detlef; Raff, Ruth; Wiebe, Walter

2004-12-01

We investigated a group of 376 children, seen over a period of 7 years with different types of congenital cardiovascular defects, to assess the presence of chromosomal aberrations. The diagnostic approach, achieved in 3 consecutive steps, revealed conventional chromosomal aberrations in 30 of the patients (8%) excluding trisomies 13, 18, 21. Fluorescence in situ hybridisation for microdeletions showed 51 microdeletions (15%), with 43 patients having deletions of 22q11.2, 7 patients with deletion of 7q11.23, and 1 patient with deletion of 4p16.3. In 23 patients with additional clinical abnormalities, we carried out a subtelomeric screening. This revealed, in two cases (9%), different subtelomeric aberrations, namely deletions of 1p and of 1q. Thus, subtelomeric screening proved to be a very valuable as a new diagnostic approach. Our approach to genetic investigation in three phases makes it possible to detect a high rate of pathologic karyotypes in patients with congenital cardiovascular malformations, thus guaranteeing more effective genetic counselling of the families, and a more precise prognosis for the patient.

Coexpression network analysis identifies transcriptional modules associated with genomic alterations in neuroblastoma.

PubMed

Yang, Liulin; Li, Yun; Wei, Zhi; Chang, Xiao

2018-06-01

Neuroblastoma is a highly complex and heterogeneous cancer in children. Acquired genomic alterations including MYCN amplification, 1p deletion and 11q deletion are important risk factors and biomarkers in neuroblastoma. Here, we performed a co-expression-based gene network analysis to study the intrinsic association between specific genomic changes and transcriptome organization. We identified multiple gene coexpression modules which are recurrent in two independent datasets and associated with functional pathways including nervous system development, cell cycle, immune system process and extracellular matrix/space. Our results also indicated that modules involved in nervous system development and cell cycle are highly associated with MYCN amplification and 1p deletion, while modules responding to immune system process are associated with MYCN amplification only. In summary, this integrated analysis provides novel insights into molecular heterogeneity and pathogenesis of neuroblastoma. This article is part of a Special Issue entitled: Accelerating Precision Medicine through Genetic and Genomic Big Data Analysis edited by Yudong Cai & Tao Huang. Copyright © 2017. Published by Elsevier B.V.

L1-Associated Genomic Regions are Deleted in Somatic Cells of the Healthy Human Brain

PubMed Central

Erwin, Jennifer A.; Paquola, Apuã C.M.; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy; Ivanio, Francisco; Butcher, Cheyenne R.; Herdy, Joseph R.; Sarkar, Anindita; Lasken, Roger S.; Muotri, Alysson R.; Gage, Fred H.

2016-01-01

The healthy human brain is a mosaic of varied genomes. L1 retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that Somatic L1-Associated Variants (SLAVs) are actually composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs are, in fact, somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition- independent rearrangements within inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2/PSD93, and affect between 44–63% of cells of the cells in the healthy brain. PMID:27618310

Genetic deletion of HRP2 and HRP3 in Indian Plasmodium falciparum population and false negative malaria rapid diagnostic test.

PubMed

Kumar, Navin; Pande, Veena; Bhatt, R M; Shah, Naman K; Mishra, Neelima; Srivastava, Bina; Valecha, Neena; Anvikar, Anupkumar R

2013-01-01

Genetic polymorphisms in diagnostic antigens are important factors responsible for variable performance of rapid diagnostic tests. Additionally, the failure of antigen expression due to gene deletion may also contribute to variable performance. We report Indian Plasmodium falciparum field isolates lacking both Pfhrp2 and Pfhrp3 genes leading to false negative results of rapid diagnostic tests. The study highlights need to determine the prevalence of P. falciparum isolates lacking these genes in larger field populations in India. Copyright © 2012 Elsevier B.V. All rights reserved.

Production and genetic analysis of resynthesized Brassica napus from a B. rapa landrace from the Qinghai-Tibet Plateau and B. alboglabra.

PubMed

Liu, H D; Zhao, Z G; Du, D Z; Deng, C R; Fu, G

2016-01-08

This study aimed to reveal the genetic and epigenetic variations involved in a resynthesized Brassica napus (AACC) generated from a hybridization between a B. rapa (AA) landrace and B. alboglabra (CC). Amplified fragment length polymorphism (AFLP), methylation-sensitive amplified polymorphism, and the cDNA-AFLP technique were performed to detect changes between different generations at the genome, methylation, and transcription levels. We obtained 30 lines of resynthesized B. napus with a mean 1000-seed weight of over 7.50 g. All of the lines were self-compatible, probably because both parents were self-compatible. At the genome level, the S0 generation had the lowest frequency of variations (0.18%) and the S3 generation had the highest (6.07%). The main variation pattern was the elimination of amplified restriction fragments on the CC genome from the S0 to the S4 generations. At the methylation level, we found three loci that exhibited altered methylation patterns on the parental A genome; the variance rate was 1.35%. At the transcription level, we detected 43.77% reverse mutations and 37.56% deletion mutations that mainly occurred on the A and C genomes, respectively, in the S3 generation. Our results highlight the genetic variations that occur during the diploidization of resynthesized B. napus.

Molecular Diagnosis of Thalassemias and Hemoglobinopathies: An ACLPS Critical Review.

PubMed

Sabath, Daniel E

2017-07-01

To describe the use of molecular diagnostic techniques for patients with hemoglobin disorders. A clinical scenario is presented in which molecular diagnosis is important for genetic counseling. Globin disorders, techniques for their diagnosis, and the role of molecular genetic testing in managing patients with these disorders are described in detail. Hemoglobin disorders, including thalassemias and hemoglobinopathies, are among the commonest genetic diseases, and the clinical laboratory is essential for the diagnosis of patients with these abnormalities. Most disorders can be diagnosed with protein-based techniques such as electrophoresis and chromatography. Since severe syndromes can result due to inheritance of combinations of globin genetic disorders, genetic counseling is important to prevent adverse outcomes. Protein-based methods cannot always detect potentially serious thalassemia disorders; in particular, α-thalassemia may be masked in the presence of β-thalassemia. Deletional forms of β-thalassemia are also sometimes difficult to diagnose definitively with standard methods. Molecular genetic testing serves an important role in identifying individuals carrying thalassemia traits that can cause adverse outcomes in offspring. Furthermore, prenatal genetic testing can identify fetuses with severe globin phenotypes. © American Society for Clinical Pathology, 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

UCP2 and 3 deletion screening and distribution in 15 pig breeds.

PubMed

Li, Yanhua; Li, Hanjie; Zhao, Xingbo; Li, Ning; Wu, Changxin

2007-02-01

The uncoupling protein family is a mitochondrial anion carrier family. It plays an important role in the biological traits of animal body weight, basal metabolic rate and energy conversion. Using PCR and PCR-SSCP, we scanned the porcine uncoupling protein 2 gene (UCP2) and uncoupling protein 3 gene (UCP3) and found seven deletion sites, three in UCP2 and four in UCP3. The deletions in 15 pig breeds showed that deletion influenced weight. The genotype compounding of seven deletion sites in 15 pig breeds had significant effects on performance traits of the pig, such as body weight. We predicted the potential protein factor binding sites using the transcription factor analysis tool TFSearch version 1.3 online. Two deletions (1830 nt and 3219 nt) in UCP3 were found to change the transcriptional factor sites. The 16 bp deletion in 1830 nt added a SP1 site and a 6 bp deletion in 3219 nt removed two MZF1 sites. Seven deletion polymorphisms were covered in introns of linkage genes of UCP2 and UCP3, showing that UCPs have conservation and genetic reliability.

The human chromosomal fragile sites more often involved in constitutional deletions and duplications - A genetic and statistical assessment

NASA Astrophysics Data System (ADS)

Gomes, Dora Prata; Sequeira, Inês J.; Figueiredo, Carlos; Rueff, José; Brás, Aldina

2016-12-01

Human chromosomal fragile sites (CFSs) are heritable loci or regions of the human chromosomes prone to exhibit gaps, breaks and rearrangements. Determining the frequency of deletions and duplications in CFSs may contribute to explain the occurrence of human disease due to those rearrangements. In this study we analyzed the frequency of deletions and duplications in each human CFS. Statistical methods, namely data display, descriptive statistics and linear regression analysis were applied to analyze this dataset. We found that FRA15C, FRA16A and FRAXB are the most frequently involved CFSs in deletions and duplications occurring in the human genome.

Preventive effects of the deleted form of hepatocyte growth factor against various liver injuries.

PubMed

Masunaga, H; Fujise, N; Shiota, A; Ogawa, H; Sato, Y; Imai, E; Yasuda, H; Higashio, K

1998-01-26

The effects of a naturally occurring deleted form of hepatocyte growth factor (HGF) on hepatic disorder were studied in various models of hepatic failure. The pretreatment of rats and mice with the deleted form of HGF prevented the liver injuries and coagulopathy induced by endotoxin, dimethylnitrosamine and acetaminophen and reduced the mortality due to hepatic dysfunction induced by these hepatotoxins. The concurrent administration of the deleted form of HGF also prevented the liver injury and hepatic fibrosis in mice treated with alpha-naphthylisothiocyanate and in rats treated with dimethylnitrosamine. Moreover, the deleted form of HGF normalized the results of the bromosulphalein-clearance test and ameliorated jaundice in rats with periportal cholangiolitic hepatopathy induced by alpha-naphthylisothiocyanate. The deleted form of HGF also reversed the coagulopathy in rats with hepatic disorder induced by dimethylnitrosamine or by 70% resection of cirrhotic liver (induced by carbon tetrachloride). In Long Evans cinnamon rats receiving vehicle, 20 out of 21 animals died within 4 days after the onset of jaundice. After infusion of the deleted form of HGF for 4 days, 7 out of 20 Long-Evans cinnamon rats survived. These results indicate that the deleted form of HGF could have therapeutic potency in patients with severe hepatic failure.

Dmpk gene deletion or antisense knockdown does not compromise cardiac or skeletal muscle function in mice

PubMed Central

Carrell, Samuel T.; Carrell, Ellie M.; Auerbach, David; Pandey, Sanjay K.; Bennett, C. Frank; Dirksen, Robert T.; Thornton, Charles A.

2016-01-01

Myotonic dystrophy type 1 (DM1) is a genetic disorder in which dominant-active DM protein kinase (DMPK) transcripts accumulate in nuclear foci, leading to abnormal regulation of RNA processing. A leading approach to treat DM1 uses DMPK-targeting antisense oligonucleotides (ASOs) to reduce levels of toxic RNA. However, basal levels of DMPK protein are reduced by half in DM1 patients. This raises concern that intolerance for further DMPK loss may limit ASO therapy, especially since mice with Dmpk gene deletion reportedly show cardiac defects and skeletal myopathy. We re-examined cardiac and muscle function in mice with Dmpk gene deletion, and studied post-maturity knockdown using Dmpk-targeting ASOs in mice with heterozygous deletion. Contrary to previous reports, we found no effect of Dmpk gene deletion on cardiac or muscle function, when studied on two genetic backgrounds. In heterozygous knockouts, the administration of ASOs reduced Dmpk expression in cardiac and skeletal muscle by > 90%, yet survival, electrocardiogram intervals, cardiac ejection fraction and muscle strength remained normal. The imposition of cardiac stress by pressure overload, or muscle stress by myotonia, did not unmask a requirement for DMPK. Our results support the feasibility and safety of using ASOs for post-transcriptional silencing of DMPK in muscle and heart. PMID:27522499

Characterization of genetic deletions in Becker muscular dystrophy using monoclonal antibodies against a deletion-prone region of dystrophin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thanh, L.T.; Man, Nguyen Thi; Morris, G.E.

1995-08-28

We have produced a new panel of 20 monoclonal antibodies (mAbs) against a region of the dystrophin protein corresponding to a deletion-prone region of the Duchenne muscular dystrophy gene (exons 45-50). We show that immunohistochemistry or Western blotting with these {open_quotes}exon-specific{close_quotes} mAbs can provide a valuable addition to Southern blotting or PCR methods for the accurate identification of genetic deletions in Becker muscular dystrophy patients. The antibodies were mapped to the following exons: exon 45 (2 mAbs), exon 46 (6), exon 47 (1), exons 47/48 (4), exons 48-50 (6), and exon 50 (1). PCR amplification of single exons or groupsmore » of exons was used both to produce specific dystrophin immunogens and to map the mAbs obtained. PCR-mediated mutagenesis was also used to identify regions of dystrophin important for mAb binding. Because the mAbs can be used to characterize the dystrophin produced by individual muscle fibres, they will also be useful for studying {open_quotes}revertant{close_quotes} fibres in Duchenne muscle and for monitoring the results of myoblast therapy trials in MD patients with deletions in this region of the dystrophin gene. 27 refs., 7 figs., 3 tabs.« less

Genetic Tools for the Industrially Promising Methanotroph Methylomicrobium buryatense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Puri, AW; Owen, S; Chu, F

2015-02-10

Aerobic methanotrophs oxidize methane at ambient temperatures and pressures and are therefore attractive systems for methane-based bioconversions. In this work, we developed and validated genetic tools for Methylomicrobium buryatense, a haloalkaliphilic gammaproteobacterial (type I) methanotroph. M. buryatense was isolated directly on natural gas and grows robustly in pure culture with a 3-h doubling time, enabling rapid genetic manipulation compared to many other methanotrophic species. As a proof of concept, we used a sucrose counterselection system to eliminate glycogen production in M. buryatense by constructing unmarked deletions in two redundant glycogen synthase genes. We also selected for a more genetically tractablemore » variant strain that can be conjugated with small incompatibility group P (IncP)-based broad-host-range vectors and determined that this capability is due to loss of the native plasmid. These tools make M. buryatense a promising model system for studying aerobic methanotroph physiology and enable metabolic engineering in this bacterium for industrial biocatalysis of methane.« less

Genetic variation and forensic efficiency of autosomal insertion/deletion polymorphisms in Chinese Bai ethnic group: phylogenetic analysis to other populations

PubMed Central

Yang, Chun-Hua; Yin, Cai-Yong; Shen, Chun-Mei; Guo, Yu-Xin; Dong, Qian; Yan, Jiang-Wei; Wang, Hong-Dan; Zhang, Yu-Dang; Meng, Hao-Tian; Jin, Rui

2017-01-01

Thirty insertion/deletion loci were utilized to study the genetic diversities of 125 bloodstain samples collected from Bai group in Yunnan Dali region, China. The observed heterozygosity and expected heterozygosity of the 30 loci ranged from 0.1520 to 0.5680, and 0.1927 to 0.4997, respectively. No deviations from Hardy-Weinberg equilibrium tests after Bonferroni correction were found at all 30 loci in Bai group. The cumulative probability of exclusion and combined discrimination power were 0.9859 and 0.9999999999887, respectively, which indicated the 30 loci could be used as complementary genetic markers for paternity testing and were qualified for personal identification in forensic cases. We found the studied Bai group had close relationships with Tibetan, Yi and Han groups from China by the population structure, principal component analysis, population differentiations, and phylogenetic reconstruction studies. Even so, for a better understanding of Bai ethnicity's genetic milieu, DNA genotyping at various genetic markers is necessary in future studies. PMID:28465476

Genetic variation and forensic efficiency of autosomal insertion/deletion polymorphisms in Chinese Bai ethnic group: phylogenetic analysis to other populations.

PubMed

Yang, Chun-Hua; Yin, Cai-Yong; Shen, Chun-Mei; Guo, Yu-Xin; Dong, Qian; Yan, Jiang-Wei; Wang, Hong-Dan; Zhang, Yu-Dang; Meng, Hao-Tian; Jin, Rui; Chen, Feng; Zhu, Bo-Feng

2017-06-13

Thirty insertion/deletion loci were utilized to study the genetic diversities of 125 bloodstain samples collected from Bai group in Yunnan Dali region, China. The observed heterozygosity and expected heterozygosity of the 30 loci ranged from 0.1520 to 0.5680, and 0.1927 to 0.4997, respectively. No deviations from Hardy-Weinberg equilibrium tests after Bonferroni correction were found at all 30 loci in Bai group. The cumulative probability of exclusion and combined discrimination power were 0.9859 and 0.9999999999887, respectively, which indicated the 30 loci could be used as complementary genetic markers for paternity testing and were qualified for personal identification in forensic cases. We found the studied Bai group had close relationships with Tibetan, Yi and Han groups from China by the population structure, principal component analysis, population differentiations, and phylogenetic reconstruction studies. Even so, for a better understanding of Bai ethnicity's genetic milieu, DNA genotyping at various genetic markers is necessary in future studies.

Reversal of diet-induced obesity and insulin resistance by inducible genetic ablation of GRK2

PubMed Central

Vila-Bedmar, Rocio; Cruces-Sande, Marta; Lucas, Elisa; Willemen, Hanneke L.D.M.; Heijnen, Cobi J.; Kavelaars, Annemieke; Mayor, Federico; Murga, Cristina

2015-01-01

Insulin resistance is a common feature of obesity and predisposes individuals to various prevalent pathological conditions. G protein-coupled receptor kinase 2 (GRK2) integrates several signal transduction pathways and is emerging as a physiologically relevant inhibitor of insulin signaling. GRK2 abundanceis increased in humans with metabolic syndrome and in different murine models of insulin resistance. To support GRK2 as a potential drug target in type 2 diabetes and obesity, we investigated whether lowering GRK2 abundance reversed an ongoing systemic insulin-resistant phenotype, using a mouse model of tamoxifen-induced GRK2 ablation after high fat diet-dependent obesity and insulin resistance. Tamoxifen-triggered GRK2 deletion impeded further body weight gain, normalized fa sting glycemia, improved glucose tolerance and was associated with preserved insulin sensitivity in skeletal muscle and liver, thereby maintaining whole body glucose homeostasis. Moreover, when continued to be fed a high fat diet, these animals displayed reduced fat mass and smaller adipocytes, were resistant to the development of liver steatosis, and showed reduced expression of pro-inflammatory markers in the liver. Our results indicate that GRK2 acts as a hub to control metabolic functions in different tissues, which is key to controlling insulin resistance development in vivo. These data suggest that inhibiting GRK2 could reverse an established insulin-resistant and obese phenotype, thereby putting forward this enzyme as a potential therapeutic target linking glucose homeostasis and regulation of adiposity. PMID:26198359

Evaluation of potential models for imprinted and nonimprinted components of human chromosome 15q11-q13 syndromes by fine-structure homology mapping in the mouse.

PubMed Central

Nicholls, R D; Gottlieb, W; Russell, L B; Davda, M; Horsthemke, B; Rinchik, E M

1993-01-01

Prader-Willi and Angelman syndromes are complex neurobehavioral contiguous gene syndromes whose expression depends on the unmasking of genomic imprinting for different genetic loci in human chromosome 15q11-q13. The homologous chromosomal region in the mouse genome has been fine-mapped by using interspecific (Mus spretus) crosses and overlapping, radiation-induced deletions to evaluate potential animal models for both imprinted and nonimprinted components of these syndromes. Four evolutionarily conserved sequences from human 15q11-q13, including two cDNAs from fetal brain (DN10, D15S12h; DN34, D15S9h-1), a microdissected clone (MN7; D15F37S1h) expressed in mouse brain, and the gene for the beta 3 subunit of the gamma-aminobutyric acid type A receptor (Gabrb3), were mapped in mouse chromosome 7 by analysis of deletions at the pink-eyed dilution (p) locus. Three of these loci are deleted in pre- and postnatally lethal p-locus mutations, which extend up to 5.5 +/- 1.7 centimorgans (cM) proximal to p; D15S9h-1, which maps 1.1 +/- 0.8 cM distal to p and is the mouse homolog of the human gene D15S9 (which shows a DNA methylation imprint), is not deleted in any of the p-locus deletion series. A transcript from the Gabrb3 gene, but not the transcript detected by MN7 at the D15F37S1h locus, is expressed in mice homozygous for the p6H deletion, which have an abnormal neurological phenotype. Furthermore, the Gabrb3 transcript is expressed equally well from the maternal or paternal chromosome 7 and, therefore, its expression is not imprinted in mouse brain. Deletions at the mouse p locus should serve as intermediate genetic reagents and models with which to analyze the genetics and etiology of individual components of human 15q11-q13 disorders. Images Fig. 1 Fig. 2 Fig. 4 Fig. 5 PMID:8095339

Reversal of autophagy dysfunction in the TgCRND8 mouse model of Alzheimer's disease ameliorates amyloid pathologies and memory deficits.

PubMed

Yang, Dun-Sheng; Stavrides, Philip; Mohan, Panaiyur S; Kaushik, Susmita; Kumar, Asok; Ohno, Masuo; Schmidt, Stephen D; Wesson, Daniel; Bandyopadhyay, Urmi; Jiang, Ying; Pawlik, Monika; Peterhoff, Corrinne M; Yang, Austin J; Wilson, Donald A; St George-Hyslop, Peter; Westaway, David; Mathews, Paul M; Levy, Efrat; Cuervo, Ana M; Nixon, Ralph A

2011-01-01

Autophagy, a major degradative pathway for proteins and organelles, is essential for survival of mature neurons. Extensive autophagic-lysosomal pathology in Alzheimer's disease brain contributes to Alzheimer's disease pathogenesis, although the underlying mechanisms are not well understood. Here, we identified and characterized marked intraneuronal amyloid-β peptide/amyloid and lysosomal system pathology in the Alzheimer's disease mouse model TgCRND8 similar to that previously described in Alzheimer's disease brains. We further establish that the basis for these pathologies involves defective proteolytic clearance of neuronal autophagic substrates including amyloid-β peptide. To establish the pathogenic significance of these abnormalities, we enhanced lysosomal cathepsin activities and rates of autophagic protein turnover in TgCRND8 mice by genetically deleting cystatin B, an endogenous inhibitor of lysosomal cysteine proteases. Cystatin B deletion rescued autophagic-lysosomal pathology, reduced abnormal accumulations of amyloid-β peptide, ubiquitinated proteins and other autophagic substrates within autolysosomes/lysosomes and reduced intraneuronal amyloid-β peptide. The amelioration of lysosomal function in TgCRND8 markedly decreased extracellular amyloid deposition and total brain amyloid-β peptide 40 and 42 levels, and prevented the development of deficits of learning and memory in fear conditioning and olfactory habituation tests. Our findings support the pathogenic significance of autophagic-lysosomal dysfunction in Alzheimer's disease and indicate the potential value of restoring normal autophagy as an innovative therapeutic strategy for Alzheimer's disease.

COTIP: Cotton TILLING Platform, a Resource for Plant Improvement and Reverse Genetic Studies

PubMed Central

Aslam, Usman; Cheema, Hafiza M. N.; Ahmad, Sheraz; Khan, Iqrar A.; Malik, Waqas; Khan, Asif A.

2016-01-01

Cotton is cultivated worldwide for its white fiber, of which around 90% is tetraploid upland cotton (Gossypium hirsutum L.) carrying both A and D genome. Since centuries, yield increasing efforts for the cotton crop by conventional breeding approaches have caused an extensive erosion of natural genetic variability. Mutation based improvement strategies provide an effective way of creating new allelic variations. Targeting Induced Local Lesions IN Genomes (TILLING) provides a mutation based reverse genetic strategy to create and evaluate induced genetic variability at DNA level. Here, we report development and testing of TILLING populations of allotetraploid cotton (G. hirsutum) for functional genomic studies and mutation based enrichment of cotton genetic resources. Seed of two cotton cultivars “PB-899 and PB-900” were mutagenized with 0.3 and 0.2% (v/v) ethyl methanesulfonate, respectively. The phenotyping of M1 and M2 populations presented numerous mutants regarding the branching pattern, leaf morphology, disease resistance, photosynthetic lesions and flower sterility. Molecular screening for point mutations was performed by TILLING PCR aided CEL1 mismatch cleavage. To estimate the mutation frequency in the mutant genomes, five gene classes were TILLed in 8000 M2 plants of each var. “PB-899” and “PB-900.” These include actin (GhACT), Pectin Methyl Esterase (GhPME), sucrose synthase (GhSUS), resistance gene analog, and defense response gene (DRGs). The var. PB-899 was harboring 47% higher mutation induction rate than PB-900. The highest rate of mutation frequency was identified for NAC-TF5 (EU706348) of DRGs class, ranging from 1/58 kb in PB-899 to 1/105 kb in PB-900. The mutation screening assay revealed the presence of significant proportion of induced mutations in cotton TILLING populations such as 1/153 kb and 1/326 kb in var. “PB-899” and “PB-900,” respectively. The establishment of a cotton TILLING platform (COTIP) and data obtained from the resource TILLING population suggest its effectiveness in widening the genetic bases of cotton for improvement and utilizing it for subsequent reverse genetic studies of various genes. PMID:28082993

Method of detecting genetic deletions identified with chromosomal abnormalities

DOEpatents

Gray, Joe W; Pinkel, Daniel; Tkachuk, Douglas

2013-11-26

Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyzes. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acids probes are typically of a complexity greater tha 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particlularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML) and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar ut genetically different diseases, and for many prognostic and diagnostic applications.

Molecular and biochemical identification of alien chromosome additions in shallot (Allium cepa L. Aggregatum group) carrying extra chromosome(s) of bunching onion (A. fistulosum L.).

PubMed

Yaguchi, Shigenori; Hang, Tran Thi Minh; Tsukazaki, Hikaru; Hoa, Vu Quynh; Masuzaki, Shin-ichi; Wako, Tadayuki; Masamura, Noriya; Onodera, Shuichi; Shiomi, Norio; Yamauchi, Naoki; Shigyo, Masayoshi

2009-02-01

To develop the bunching onion (Allium fistulosum L.; genomes, FF) chromosome-specific genetic markers for identifying extra chromosomes, eight shallot (A. cepa L. Aggregatum group; genomes, AA)--A. fistulosum monosomic addition plants (AA+nF) and 62 shallot--A. fistulosum single-alien deletion plants (AAF-nF) were analyzed by 23 different chromosome-specific genetic markers of shallot. The eight monosomic addition plants consisted of one AA+2F, two AA+6F, and five AA+8F. Of the 62 single-alien deletion plants, 60 could be identified as six different single-alien deletion lines (AAF-1F, -3F, -4F, -6F, -7F, and -8F) out of the eight possible types. Several single-alien deletion lines were classified on the basis of leaf and bulb characteristics. AAF-8F had the largest number of expanded leaves of five deletion plants. AAF-7F grew most vigorously, as expressed by its long leaf blade and biggest bulb size. AAF-4F had very small bulbs. AAF-7F and AAF-8F had different bulbs from those of shallot as well as other types of single-alien deletion lines in skin and outer scale color. Regarding the sugar content of the bulb tissues, the single-alien deletion lines showed higher fructan content than shallot. Moreover, shallot could not produce fructan with degree of polymerization (DP) 12 or higher, although the single-alien deletion lines showed DP 20 or higher. The content of S-alk(en)yl-L-cysteine sulfoxide (ACSO) in the single-alien deletion lines was significantly lower than that in shallot. These results indicated that chromosomes from A. fistulosum might carry anonymous factors to increase the highly polymerized fructan production and inhibit the synthesis of ACSO in shallot bulbs. Accordingly, alien chromosomes from A. fistulosum in shallot would contribute to modify the quality of shallot bulbs.

Genetic engineering of microorganisms for biodiesel production

PubMed Central

Lin, Hui; Wang, Qun; Shen, Qi; Zhan, Jumei; Zhao, Yuhua

2013-01-01

Biodiesel, as one type of renewable energy, is an ideal substitute for petroleum-based diesel fuel and is usually made from triacylglycerides by transesterification with alcohols. Biodiesel production based on microbial fermentation aiming to establish more efficient, less-cost and sustainable biodiesel production strategies is under current investigation by various start-up biotechnology companies and research centers. Genetic engineering plays a key role in the transformation of microbes into the desired cell factories with high efficiency of biodiesel production. Here, we present an overview of principal microorganisms used in the microbial biodiesel production and recent advances in metabolic engineering for the modification required. Overexpression or deletion of the related enzymes for de novo synthesis of biodiesel is highlighted with relevant examples. PMID:23222170

Genetic engineering of microorganisms for biodiesel production.

PubMed

Lin, Hui; Wang, Qun; Shen, Qi; Zhan, Jumei; Zhao, Yuhua

2013-01-01

Biodiesel, as one type of renewable energy, is an ideal substitute for petroleum-based diesel fuel and is usually made from triacylglycerides by transesterification with alcohols. Biodiesel production based on microbial fermentation aiming to establish more efficient, less-cost and sustainable biodiesel production strategies is under current investigation by various start-up biotechnology companies and research centers. Genetic engineering plays a key role in the transformation of microbes into the desired cell factories with high efficiency of biodiesel production. Here, we present an overview of principal microorganisms used in the microbial biodiesel production and recent advances in metabolic engineering for the modification required. Overexpression or deletion of the related enzymes for de novo synthesis of biodiesel is highlighted with relevant examples.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

Population-genetic properties of differentiated copy number variations in cattle.

PubMed

Xu, Lingyang; Hou, Yali; Bickhart, Derek M; Zhou, Yang; Hay, El Hamidi Abdel; Song, Jiuzhou; Sonstegard, Tad S; Van Tassell, Curtis P; Liu, George E

2016-03-23

While single nucleotide polymorphism (SNP) is typically the variant of choice for population genetics, copy number variation (CNV) which comprises insertion, deletion and duplication of genomic sequence, is an informative type of genetic variation. CNVs have been shown to be both common in mammals and important for understanding the relationship between genotype and phenotype. However, CNV differentiation, selection and its population genetic properties are not well understood across diverse populations. We performed a population genetics survey based on CNVs derived from the BovineHD SNP array data of eight distinct cattle breeds. We generated high resolution results that show geographical patterns of variations and genome-wide admixture proportions within and among breeds. Similar to the previous SNP-based studies, our CNV-based results displayed a strong correlation of population structure and geographical location. By conducting three pairwise comparisons among European taurine, African taurine, and indicine groups, we further identified 78 unique CNV regions that were highly differentiated, some of which might be due to selection. These CNV regions overlapped with genes involved in traits related to parasite resistance, immunity response, body size, fertility, and milk production. Our results characterize CNV diversity among cattle populations and provide a list of lineage-differentiated CNVs.

Measurement of locus copy number by hybridisation with amplifiable probes

PubMed Central

Armour, John A. L.; Sismani, Carolina; Patsalis, Philippos C.; Cross, Gareth

2000-01-01

Despite its fundamental importance in genome analysis, it is only recently that systematic approaches have been developed to assess copy number at specific genetic loci, or to examine genomic DNA for submicroscopic deletions of unknown location. In this report we show that short probes can be recovered and amplified quantitatively following hybridisation to genomic DNA. This simple observation forms the basis of a new approach to determining locus copy number in complex genomes. The power and specificity of multiplex amplifiable probe hybridisation is demonstrated by the simultaneous assessment of copy number at a set of 40 human loci, including detection of deletions causing Duchenne muscular dystrophy and Prader–Willi/Angelman syndromes. Assembly of other probe sets will allow novel, technically simple approaches to a wide variety of genetic analyses, including the potential for extension to high resolution genome-wide screens for deletions and amplifications. PMID:10606661

Measurement of locus copy number by hybridisation with amplifiable probes.

PubMed

Armour, J A; Sismani, C; Patsalis, P C; Cross, G

2000-01-15

Despite its fundamental importance in genome analysis, it is only recently that systematic approaches have been developed to assess copy number at specific genetic loci, or to examine genomic DNA for submicro-scopic deletions of unknown location. In this report we show that short probes can be recovered and amplified quantitatively following hybridisation to genomic DNA. This simple observation forms the basis of a new approach to determining locus copy number in complex genomes. The power and specificity of multiplex amplifiable probe hybridisation is demonstrated by the simultaneous assessment of copy number at a set of 40 human loci, including detection of deletions causing Duchenne muscular dystrophy and Prader-Willi/Angelman syndromes. Assembly of other probe sets will allow novel, technically simple approaches to a wide variety of genetic analyses, including the potential for extension to high resolution genome-wide screens for deletions and amplifications.

A new physical mapping approach refines the sex-determining gene positions on the Silene latifolia Y-chromosome

NASA Astrophysics Data System (ADS)

Kazama, Yusuke; Ishii, Kotaro; Aonuma, Wataru; Ikeda, Tokihiro; Kawamoto, Hiroki; Koizumi, Ayako; Filatov, Dmitry A.; Chibalina, Margarita; Bergero, Roberta; Charlesworth, Deborah; Abe, Tomoko; Kawano, Shigeyuki

2016-01-01

Sex chromosomes are particularly interesting regions of the genome for both molecular genetics and evolutionary studies; yet, for most species, we lack basic information, such as the gene order along the chromosome. Because they lack recombination, Y-linked genes cannot be mapped genetically, leaving physical mapping as the only option for establishing the extent of synteny and homology with the X chromosome. Here, we developed a novel and general method for deletion mapping of non-recombining regions by solving “the travelling salesman problem”, and evaluate its accuracy using simulated datasets. Unlike the existing radiation hybrid approach, this method allows us to combine deletion mutants from different experiments and sources. We applied our method to a set of newly generated deletion mutants in the dioecious plant Silene latifolia and refined the locations of the sex-determining loci on its Y chromosome map.

Prevalence and Spectrum of Large Deletions or Duplications in the Major Long QT Syndrome-Susceptibility Genes and Implications for Long QT Syndrome Genetic Testing

PubMed Central

Tester, David J.; Benton, Amber J.; Train, Laura; Deal, Barbara; Baudhuin, Linnea M.; Ackerman, Michael J.

2010-01-01

Long QT Syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for three cardiac ion channel alpha-subunits (LQT1-3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. Here, we set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes among unrelated patients who were mutation-negative following point mutation analysis of LQT1-12-susceptibility genes. Forty-two unrelated clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification (MLPA), a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA-MLPA LQTS Kit from MRC-Holland was used to analyze the three major LQTS-associated genes: KCNQ1, KCNH2, and SCN5A and the two minor genes: KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2/42 (4.8%, CI, 1.7–11%) unrelated patients. A deletion of KCNQ1 exon 3 was identified in a 10 year-old Caucasian boy with a QTc of 660 milliseconds (ms), a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17 year-old Caucasian girl with a QTc of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, since nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. PMID:20920651

A large deletion of PROP1 gene in patients with combined pituitary hormone deficiency from two unrelated Chinese pedigrees.

PubMed

Zhang, Huiwen; Wang, Yi; Han, Lianshu; Gu, Xuefan; Shi, Dingping

2010-01-01

Familial combined pituitary hormone deficiency (CPHD) appears to have a genetic cause, PROP1 gene mutations being the most common one. We investigated whether PROP1 plays a role in two Chinese familial cases of CPHD. PROP1 gene and adjacent sequences from genomic samples from two unrelated families were amplified to investigate molecular variations and define the extension of a potential deletion. A quantitative real-time polymerase chain reaction was conducted to analyze the copy number of PROP1 gene in the probands' mothers. The relationship of the two distantly located families was further analyzed using microsatellite markers. A segment of about 53.2 kilobases (kb) comprehending PROP1 and another gene encoding a hypothetical protein Q6ZTH3 was deleted in both pedigrees. The mother of one of the probands was hemizygous for this large deletion, which confirmed the assumption that the affected children inherited the deletion allele from their consanguineous parents. The difference of three microsatellites surrounding the absent segment indicated that the two pedigrees were genetically unrelated. We report the largest genomic deletion including PROP1 gene associated with CPHD. Q6ZTH3 is unlikely to exert an indispensable function during embryogenesis or organogenesis. The 7.7-kb segment upstream of the transcription of PROP1 probably harbors a fragile site that favors the occurrence of breakpoints. Copyright (c) 2010 S. Karger AG, Basel.

Dominant Drop mutants are gain-of-function alleles of the muscle segment homeobox gene (msh) whose overexpression leads to the arrest of eye development.

PubMed

Mozer, B A

2001-05-15

Dominant Drop (Dr) mutations are nearly eyeless and have additional recessive phenotypes including lethality and patterning defects in eye and sensory bristles due to cis-regulatory lesions in the cell cycle regulator string (stg). Genetic analysis demonstrates that the dominant small eye phenotype is the result of separate gain-of-function mutations in the closely linked muscle segment homeobox (msh) gene, encoding a homeodomain transcription factor required for patterning of muscle and nervous system. Reversion of the Dr(Mio) allele was coincident with the generation of lethal loss-of-function mutations in msh in cis, suggesting that the dominant eye phenotype is the result of ectopic expression. Molecular genetic analysis revealed that two dominant Dr alleles contain lesions upstream of the msh transcription start site. In the Dr(Mio) mutant, a 3S18 retrotransposon insertion is the target of second-site mutations (P-element insertions or deletions) which suppress the dominant eye phenotype following reversion. The pattern of 3S18 expression and the absence of msh in eye imaginal discs suggest that transcriptional activation of the msh promoter accounts for ectopic expression. Dr dominant mutations arrest eye development by blocking the progression of the morphogenetic furrow leading to photoreceptor cell loss via apoptosis. Gal4-mediated ubiquitous expression of msh in third-instar larvae was sufficient to arrest the morphogenetic furrow in the eye imaginal disc and resulted in lethality prior to eclosion. Dominant mutations in the human msx2 gene, one of the vertebrate homologs of msh, are associated with craniosynostosis, a disease affecting cranial development. The Dr mutations are the first example of gain-of-function mutations in the msh/msx gene family identified in a genetically tractible model organism and may serve as a useful tool to identify additional genes that regulate this class of homeodomain proteins. Copyright 2001 Academic Press.

Reversed gender ratio of autism spectrum disorder in Smith-Magenis syndrome.

PubMed

Nag, Heidi Elisabeth; Nordgren, Ann; Anderlid, Britt-Marie; Nærland, Terje

2018-01-01

A substantial amount of research shows a higher rate of autistic type of problems in males compared to females. The 4:1 male to female ratio is one of the most consistent findings in autism spectrum disorder (ASD).Lately, the interest in studying ASD in genetic disorders has increased, and research has shown a higher prevalence of ASD in some genetic disorders than in the general population.Smith-Magenis syndrome (SMS) is a rare and complex genetic syndrome caused by an interstitial deletion of chromosome 17p11.2 or a mutation on the retinoic acid induced 1 gene. The disorder is characterised by intellectual disability, multiple congenital anomalies, obesity, neurobehavioural abnormalities and a disrupted circadian sleep-wake pattern. Parents of 28 persons with SMS between 5 and 50 years old participated in this study. A total of 12 of the persons with SMS were above the age of 18 at the time of the study. A total of 11 came from Sweden and 17 were from Norway.We collected information regarding the number of autism spectrum symptoms using the Social Communication Questionnaire (SCQ) and the Social Responsiveness Scale (SRS). Adaptive behaviour was also measured using the Vineland Adaptive Behavior Scale II. The level of intellectual disability was derived from a review of the medical chart. We found significant gender differences in ASD symptomatology using the SCQ and SRS questionnaires. We found approximately three females per male above the SCQ cutoff. The same differences were not found in the intellectual level and adaptive behaviour or for behavioural and emotional problems.Gender had an independent contribution in a regression model predicting the total SCQ score, and neither the Vineland Adaptive Behavior Scale II nor the Developmental Behaviour Checklist had an independent contribution to the SCQ scores. We found a clear reversed gender difference in ASD symptomatology in persons with SMS. This may be relevant in the search for female protective factors assumed to explain the male bias in ASD.

Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7 RNA polymerase.

PubMed

van Gennip, H G; van Rijn, P A; Widjojoatmodjo, M N; Moormann, R J

1999-03-01

A new method for the recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones of the C-strain was developed. Classical reverse genetics is based on transfection of in vitro transcribed RNA to target cells to recover RNA viruses. However, the specific infectivity of such in vitro transcribed RNA in swine kidney cells is usually low. To improve reverse genetics for CSFV, a stable swine kidney cell line was established that expresses cytoplasmic bacteriophage T7 RNA polymerase (SK6.T7). A 200-fold increased virus titre was obtained from SK6.T7 cells transfected with linearized full-length cDNA compared to in vitro transcribed RNA, whereas transfection of circular full-length cDNA resulted in 20-fold increased virus titres. Viruses generated on the SK6.T7 cells are indistinguishable from the viruses generated by the classical reverse genetic procedures. These results show the improved recovery of infectious CSFV directly from full-length cDNAs. Furthermore, the reverse genetic procedures are simplified to a faster, one step protocol. We conclude that the SK6.T7 cell line will be a valuable tool for recovering mutant CSFV and will contribute to future pestivirus research.

Schizophrenia and chromosomal deletions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Baldini, A.; Morris, M. A.

Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized.more » These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.« less

Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

PubMed

Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

1999-06-01

Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

Attenuation of monkeypox virus by deletion of genomic regions

USGS Publications Warehouse

Lopera, Juan G.; Falendysz, Elizabeth A.; Rocke, Tonie E.; Osorio, Jorge E.

2015-01-01

Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivostudies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence.

Attenuation of monkeypox virus by deletion of genomic regions.

PubMed

Lopera, Juan G; Falendysz, Elizabeth A; Rocke, Tonie E; Osorio, Jorge E

2015-01-15

Monkeypox virus (MPXV) is an emerging pathogen from Africa that causes disease similar to smallpox. Two clades with different geographic distributions and virulence have been described. Here, we utilized bioinformatic tools to identify genomic regions in MPXV containing multiple virulence genes and explored their roles in pathogenicity; two selected regions were then deleted singularly or in combination. In vitro and in vivo studies indicated that these regions play a significant role in MPXV replication, tissue spread, and mortality in mice. Interestingly, while deletion of either region led to decreased virulence in mice, one region had no effect on in vitro replication. Deletion of both regions simultaneously also reduced cell culture replication and significantly increased the attenuation in vivo over either single deletion. Attenuated MPXV with genomic deletions present a safe and efficacious tool in the study of MPX pathogenesis and in the identification of genetic factors associated with virulence. Copyright © 2014 Elsevier Inc. All rights reserved.

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites.

PubMed

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the 100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed.

Deletion of Plasmodium falciparum Histidine-Rich Protein 2 (pfhrp2) and Histidine-Rich Protein 3 (pfhrp3) Genes in Colombian Parasites

PubMed Central

Murillo Solano, Claribel; Akinyi Okoth, Sheila; Abdallah, Joseph F.; Pava, Zuleima; Dorado, Erika; Incardona, Sandra; Huber, Curtis S.; Macedo de Oliveira, Alexandre; Bell, David; Udhayakumar, Venkatachalam; Barnwell, John W.

2015-01-01

A number of studies have analyzed the performance of malaria rapid diagnostic tests (RDTs) in Colombia with discrepancies in performance being attributed to a combination of factors such as parasite levels, interpretation of RDT results and/or the handling and storage of RDT kits. However, some of the inconsistencies observed with results from Plasmodium falciparum histidine-rich protein 2 (PfHRP2)-based RDTs could also be explained by the deletion of the gene that encodes the protein, pfhrp2, and its structural homolog, pfhrp3, in some parasite isolates. Given that pfhrp2- and pfhrp3-negative P. falciparum isolates have been detected in the neighboring Peruvian and Brazilian Amazon regions, we hypothesized that parasites with deletions of pfhrp2 and pfhrp3 may also be present in Colombia. In this study we tested 100 historical samples collected between 1999 and 2009 from six Departments in Colombia for the presence of pfhrp2, pfhrp3 and their flanking genes. Seven neutral microsatellites were also used to determine the genetic background of these parasites. In total 18 of 100 parasite isolates were found to have deleted pfhrp2, a majority of which (14 of 18) were collected from Amazonas Department, which borders Peru and Brazil. pfhrp3 deletions were found in 52 of the100 samples collected from all regions of the country. pfhrp2 flanking genes PF3D7_0831900 and PF3D7_0831700 were deleted in 22 of 100 and in 1 of 100 samples, respectively. pfhrp3 flanking genes PF3D7_1372100 and PF3D7_1372400 were missing in 55 of 100 and in 57 of 100 samples. Structure analysis of microsatellite data indicated that Colombian samples tested in this study belonged to four clusters and they segregated mostly based on their geographic region. Most of the pfhrp2-deleted parasites were assigned to a single cluster and originated from Amazonas Department although a few pfhrp2-negative parasites originated from the other three clusters. The presence of a high proportion of pfhrp2-negative isolates in the Colombian Amazon may have implications for the use of PfHRP2-based RDTs in the region and may explain inconsistencies observed when PfHRP2-based tests and assays are performed. PMID:26151448

Application of Whole Exome Sequencing in Six Families with an Initial Diagnosis of Autosomal Dominant Retinitis Pigmentosa: Lessons Learned

PubMed Central

Fernandez-San Jose, Patricia; Liu, Yichuan; March, Michael; Pellegrino, Renata; Golhar, Ryan; Corton, Marta; Blanco-Kelly, Fiona; López-Molina, Maria Isabel; García-Sandoval, Blanca; Guo, Yiran; Tian, Lifeng; Liu, Xuanzhu; Guan, Liping; Zhang, Jianguo; Keating, Brendan; Xu, Xun

2015-01-01

This study aimed to identify the genetics underlying dominant forms of inherited retinal dystrophies using whole exome sequencing (WES) in six families extensively screened for known mutations or genes. Thirty-eight individuals were subjected to WES. Causative variants were searched among single nucleotide variants (SNVs) and insertion/deletion variants (indels) and whenever no potential candidate emerged, copy number variant (CNV) analysis was performed. Variants or regions harboring a candidate variant were prioritized and segregation of the variant with the disease was further assessed using Sanger sequencing in case of SNVs and indels, and quantitative PCR (qPCR) for CNVs. SNV and indel analysis led to the identification of a previously reported mutation in PRPH2. Two additional mutations linked to different forms of retinal dystrophies were identified in two families: a known frameshift deletion in RPGR, a gene responsible for X-linked retinitis pigmentosa and p.Ser163Arg in C1QTNF5 associated with Late-Onset Retinal Degeneration. A novel heterozygous deletion spanning the entire region of PRPF31 was also identified in the affected members of a fourth family, which was confirmed with qPCR. This study allowed the identification of the genetic cause of the retinal dystrophy and the establishment of a correct diagnosis in four families, including a large heterozygous deletion in PRPF31, typically considered one of the pitfalls of this method. Since all findings in this study are restricted to known genes, we propose that targeted sequencing using gene-panel is an optimal first approach for the genetic screening and that once known genetic causes are ruled out, WES might be used to uncover new genes involved in inherited retinal dystrophies. PMID:26197217

Clinical and genetic analysis of Indian patients with NDP-related retinopathies.

PubMed

Sudha, Dhandayuthapani; Ganapathy, Aparna; Mohan, Puja; Mannan, Ashraf U; Krishna, Shuba; Neriyanuri, Srividya; Swaminathan, Meenakshi; Rishi, Pukhraj; Chidambaram, Subbulakshmi; Arunachalam, Jayamuruga Pandian

2017-06-10

NDP-related retinopathies are a group of X-linked disorders characterized by degenerative and proliferative changes of the neuroretina, occasionally accompanied with varying degrees of mental retardation and sensorineural hearing loss. NDP is the predominant gene associated with NDP-related retinopathies. The purpose of this study was to report the clinical and genetic findings in three unrelated patients diagnosed with NDP-related retinopathies. The patients underwent complete ophthalmic examination followed by genetic analyses. NDP gene was screened by direct sequencing approach. Targeted resequencing of several other ocular genes was carried out in patient samples that either indicated NDP gene deletion or tested negative for NDP mutation. Gene quantitation analysis was performed using real-time PCR. The whole NDP gene was deleted in patient I, while a missense NDP mutation, c.205T>C, was identified in patient II, and both had classical Norrie disease ocular phenotype (with no other systemic defects). Patient III who was diagnosed with familial exudative vitreoretinopathy did not show any mutation in the known candidate genes as well as in other ocular genes tested. The patient with whole NDP gene deletion did not exhibit any apparent extraocular defects (like mental retardation or sensorineural hearing loss) during his first decade of life, and this is considered to be a notable finding. Our study also provides evidence emphasizing the need for genetic testing which could eliminate ambiguities in clinical diagnosis and detect carrier status, thereby aiding the patient and family members during genetic counseling.

Overlapping Numerical Cognition Impairments in Children with Chromosome 22q11.2 Deletion or Turner Syndromes

ERIC Educational Resources Information Center

Simon, T. J.; Takarae, Y.; DeBoer, T.; McDonald-McGinn, D. M.; Zackai, E. H.; Ross, J. L.

2008-01-01

Children with one of two genetic disorders (chromosome 22q11.2 deletion syndrome and Turner syndrome) as well typically developing controls, participated in three cognitive processing experiments. Two experiments were designed to test cognitive processes involved in basic aspects numerical cognition. The third was a test of simple manual motor…

Mathematical Learning Disabilities in Children with 22q11.2 Deletion Syndrome: A Review

ERIC Educational Resources Information Center

De Smedt, Bert; Swillen, Ann; Verschaffel, Lieven; Ghesquiere, Pol

2009-01-01

Mathematical learning disabilities (MLD) occur frequently in children with specific genetic disorders, like Turner syndrome, fragile X syndrome and neurofibromatosis. This review focuses on MLD in children with chromosome 22q11.2 deletion syndrome (22q11DS). This syndrome is the most common known microdeletion syndrome with a prevalence of at…

Surface-Enhanced Raman Optical Data Storage system

DOEpatents

Vo-Dinh, T.

1994-06-28

An improved Surface-Enhanced Raman Optical Data Storage System (SERODS) is disclosed. In the improved system, entities capable of existing in multiple reversible states are present on the storage device. Such entities result in changed Surface-Enhanced Raman Scattering (SERS) when localized state changes are effected in less than all of the entities. Therefore, by changing the state of entities in localized regions of a storage device, the SERS emissions in such regions will be changed. When a write-on device is controlled by a data signal, such a localized regions of changed SERS emissions will correspond to the data written on the device. The data may be read by illuminating the surface of the storage device with electromagnetic radiation of an appropriate frequency and detecting the corresponding SERS emissions. Data may be deleted by reversing the state changes of entities in regions where the data was initially written. In application, entities may be individual molecules which allows for the writing of data at the molecular level. A read/write/delete head utilizing near-field quantum techniques can provide for a write/read/delete device capable of effecting state changes in individual molecules, thus providing for the effective storage of data at the molecular level. 18 figures.

Surface-enhanced raman optical data storage system

DOEpatents

Vo-Dinh, Tuan

1994-01-01

An improved Surface-Enhanced Raman Optical Data Storage System (SERODS) is disclosed. In the improved system, entities capable of existing in multiple reversible states are present on the storage device. Such entities result in changed Surface-Enhanced Raman Scattering (SERS) when localized state changes are effected in less than all of the entities. Therefore, by changing the state of entities in localized regions of a storage device, the SERS emissions in such regions will be changed. When a write-on device is controlled by a data signal, such a localized regions of changed SERS emissions will correspond to the data written on the device. The data may be read by illuminating the surface of the storage device with electromagnetic radiation of an appropriate frequency and detecting the corresponding SERS emissions. Data may be deleted by reversing the state changes of entities in regions where the data was initially written. In application, entities may be individual molecules which allows for the writing of data at the molecular level. A read/write/delete head utilizing near-field quantum techniques can provide for a write/read/delete device capable of effecting state changes in individual molecules, thus providing for the effective storage of data at the molecular level.

Molecular genetic classification in Prader-Willi syndrome: a multisite cohort study.

PubMed

Butler, Merlin G; Hartin, Samantha N; Hossain, Waheeda A; Manzardo, Ann M; Kimonis, Virginia; Dykens, Elisabeth; Gold, June Anne; Kim, Soo-Jeong; Weisensel, Nicolette; Tamura, Roy; Miller, Jennifer L; Driscoll, Daniel J

2018-05-05

Prader-Willi syndrome (PWS) is due to errors in genomic imprinting. PWS is recognised as the most common known genetic cause of life-threatening obesity. This report summarises the frequency and further characterises the PWS molecular classes and maternal age effects. High-resolution microarrays, comprehensive chromosome 15 genotyping and methylation-specific multiplex ligation probe amplification were used to describe and further characterise molecular classes of maternal disomy 15 (UPD15) considering maternal age. We summarised genetic data from 510 individuals with PWS and 303 (60%) had the 15q11-q13 deletion; 185 (36%) with UPD15 and 22 (4%) with imprinting defects. We further characterised UPD15 findings into subclasses based on the presence (size, location) or absence of loss of heterozygosity (LOH). Additionally, significantly older mothers (mean age=32.5 years vs 27.7 years) were found in the UPD15 group (n=145) compared with the deletion subtype (n=200). We report on molecular classes in PWS using advanced genomic technology in the largest cohort to date. LOH patterns in UPD15 may impact the risk of having a second genetic condition if the mother carries a recessive mutant allele in the isodisomic region on chromosome 15. The risk of UPD15 may also increase with maternal age. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Identification of an 18 bp deletion in the TWIST1 gene by CO-amplification at lower denaturation temperature-PCR (COLD-PCR) for non-invasive prenatal diagnosis of craniosynostosis: first case report.

PubMed

Galbiati, Silvia; Stenirri, Stefania; Sbaiz, Luca; Barberis, Marco; Cremonesi, Laura; Restagno, Gabriella; Ferrari, Maurizio

2014-04-01

Non-invasive prenatal diagnosis has found application in a limited number of genetic diseases due to the difficulty in detecting a few copies of fetal mutated sequences in the presence of a large excess of wild-type maternal alleles, even in the case of single-base mutations. We developed conditions for the enrichment of fetal mutated alleles in maternal plasma based on CO-amplification at lower denaturation temperature-PCR (COLD-PCR). In particular, we applied a full COLD-PCR protocol to the identification of a p.A87_G92del mutation in the TWIST1 gene causing craniosynostosis in a couple at risk for the disease. The use of the COLD-PCR protocol coupled with direct sequencing enabled correct identification of the fetal paternally inherited mutated allele, in accordance with the result obtained on DNA extracted from chorionic villi. COLD-PCR proved to be a simple and powerful tool for the identification of minority mutated alleles even in the case of a moderately large deletion (18 bp) and confirmed to be very suitable for non-invasive prenatal diagnosis of a variety of genetic diseases.

Assessing copy number from exome sequencing and exome array CGH based on CNV spectrum in a large clinical cohort.

PubMed

Retterer, Kyle; Scuffins, Julie; Schmidt, Daniel; Lewis, Rachel; Pineda-Alvarez, Daniel; Stafford, Amanda; Schmidt, Lindsay; Warren, Stephanie; Gibellini, Federica; Kondakova, Anastasia; Blair, Amanda; Bale, Sherri; Matyakhina, Ludmila; Meck, Jeanne; Aradhya, Swaroop; Haverfield, Eden

2015-08-01

Detection of copy-number variation (CNV) is important for investigating many genetic disorders. Testing a large clinical cohort by array comparative genomic hybridization provides a deep perspective on the spectrum of pathogenic CNV. In this context, we describe a bioinformatics approach to extract CNV information from whole-exome sequencing and demonstrate its utility in clinical testing. Exon-focused arrays and whole-genome chromosomal microarray analysis were used to test 14,228 and 14,000 individuals, respectively. Based on these results, we developed an algorithm to detect deletions/duplications in whole-exome sequencing data and a novel whole-exome array. In the exon array cohort, we observed a positive detection rate of 2.4% (25 duplications, 318 deletions), of which 39% involved one or two exons. Chromosomal microarray analysis identified 3,345 CNVs affecting single genes (18%). We demonstrate that our whole-exome sequencing algorithm resolves CNVs of three or more exons. These results demonstrate the clinical utility of single-exon resolution in CNV assays. Our whole-exome sequencing algorithm approaches this resolution but is complemented by a whole-exome array to unambiguously identify intragenic CNVs and single-exon changes. These data illustrate the next advancements in CNV analysis through whole-exome sequencing and whole-exome array.Genet Med 17 8, 623-629.

Viral Vector-Based Targeting of miR-21 in Cardiac Nonmyocyte Cells Reduces Pathologic Remodeling of the Heart

PubMed Central

Ramanujam, Deepak; Sassi, Yassine; Laggerbauer, Bernhard; Engelhardt, Stefan

2016-01-01

Systemic inhibition of miR-21 has proven effective against myocardial fibrosis and dysfunction, while studies in cardiac myocytes suggested a protective role in this cell type. Considering potential implications for therapy, we aimed to determine the cell fraction where miR-21 exerts its pathological activity. We developed a viral vector-based strategy for gene targeting of nonmyocyte cardiac cells in vivo and compared global to cardiac myocyte-specific and nonmyocyte-specific deletion of miR-21 in chronic left ventricular pressure overload. Murine moloney virus and serotype 9 of adeno-associated virus were engineered to encode improved Cre recombinase for genetic deletion in miR-21fl/fl mice. Pericardial injection of murine moloney virus-improved Cre recombinase to neonates achieved highly selective genetic ablation of miR-21 in nonmyocyte cardiac cells, identified as cardiac fibroblasts and endothelial cells. Upon left ventricular pressure overload, cardiac function was only preserved in mice with miR-21 deficiency in nonmyocyte cardiac cells, but not in mice with global or cardiac myocyte-specific ablation. Our data demonstrate that miR-21 exerts its pathologic activity directly in cardiac nonmyocytes and encourage further development of antimiR-21 therapy toward cellular tropism. PMID:27545313

Long-range activation of Sox9 in Odd Sex (Ods) mice.

PubMed

Qin, Yangjun; Kong, Ling-kun; Poirier, Christophe; Truong, Cavatina; Overbeek, Paul A; Bishop, Colin E

2004-06-15

The Odd Sex mouse mutation arose in a transgenic line of mice carrying a tyrosinase minigene driven by the dopachrome tautomerase (Dct) promoter region. The minigene integrated 0.98 Mb upstream of Sox9 and was accompanied by a deletion of 134 kb. This mutation causes female to male sex reversal in XX Ods/+ mice, and a characteristic eye phenotype of microphthalmia with cataracts in all mice carrying the transgene. Ods causes sex reversal in the absence of Sry by upregulating Sox9 expression and maintaining a male pattern of Sox9 expression in XX Ods/+ embryonic gonads. This expression, which begins at E11.5, triggers downstream events leading to the formation of a testis. We report here that the 134 kb deletion, in itself, is insufficient to cause sex reversal. We demonstrate that in Ods, the Dct promoter is capable of acting over a distance of 1 Mb to induce inappropriate expression of Sox9 in the retinal pigmented epithelium of the eye, causing the observed microphthalmia. In addition, it induces Sox9 expression in the melanocytes where it causes pigmentation defects. We propose that Ods sex reversal is due to the Dct promoter element interacting with gonad-specific enhancer elements to produce the observed male pattern expression of Sox9 in the embryonic gonads.

tCRISPRi: tunable and reversible, one-step control of gene expression

NASA Astrophysics Data System (ADS)

Li, Xin-Tian; Jun, Yonggun; Erickstad, Michael J.; Brown, Steven D.; Parks, Adam; Court, Donald L.; Jun, Suckjoon

2016-12-01

The ability to control the level of gene expression is a major quest in biology. A widely used approach employs deletion of a nonessential gene of interest (knockout), or multi-step recombineering to move a gene of interest under a repressible promoter (knockdown). However, these genetic methods are laborious, and limited for quantitative study. Here, we report a tunable CRISPR-cas system, “tCRISPRi”, for precise and continuous titration of gene expression by more than 30-fold. Our tCRISPRi system employs various previous advancements into a single strain: (1) We constructed a new strain containing a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-(d)Cas protein over two orders of magnitude in a plasmid-free system. (2) tCRISPRi is reversible, and gene expression is repressed under knockdown conditions. (3) tCRISPRi shows significantly less than 10% leaky expression. (4) Most important from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering. Our results show that tCRISPRi, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries.

Constitutional von Hippel-Lindau (VHL) gene deletions detected in VHL families by fluorescence in situ hybridization.

PubMed

Pack, S D; Zbar, B; Pak, E; Ault, D O; Humphrey, J S; Pham, T; Hurley, K; Weil, R J; Park, W S; Kuzmin, I; Stolle, C; Glenn, G; Liotta, L A; Lerman, M I; Klausner, R D; Linehan, W M; Zhuang, Z

1999-11-01

von Hippel-Lindau (VHL) disease is an autosomal dominantly inherited cancer syndrome predisposing to a variety of tumor types that include retinal hemangioblastomas, hemangioblastomas of the central nervous system, renal cell carcinomas, pancreatic cysts and tumors, pheochromocytomas, endolymphatic sac tumors, and epididymal cystadenomas [W. M. Linehan et al., J. Am. Med. Assoc., 273: 564-570, 1995; E. A. Maher and W. G. Kaelin, Jr., Medicine (Baltimore), 76: 381-391, 1997; W. M. Linehan and R. D. Klausner, In: B. Vogelstein and K. Kinzler (eds.), The Genetic Basis of Human Cancer, pp. 455-473, McGraw-Hill, 1998]. The VHL gene was localized to chromosome 3p25-26 and cloned [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. Germline mutations in the VHL gene have been detected in the majority of VHL kindreds. The reported frequency of detection of VHL germline mutations has varied from 39 to 80% (J. M. Whaley et al., Am. J. Hum. Genet., 55: 1092-1102, 1994; Clinical Research Group for Japan, Hum. Mol. Genet., 4: 2233-2237, 1995; F. Chen et al., Hum. Mutat., 5: 66-75, 1995; E. R. Maher et al., J. Med. Genet., 33: 328-332, 1996; B. Zbar, Cancer Surv., 25: 219-232, 1995). Recently a quantitative Southern blotting procedure was found to improve this frequency (C. Stolle et al., Hum. Mutat., 12: 417-423, 1998). In the present study, we report the use of fluorescence in situ hybridization (FISH) as a method to detect and characterize VHL germline deletions. We reexamined a group of VHL patients shown previously by single-strand conformation and sequencing analysis not to harbor point mutations in the VHL locus. We found constitutional deletions in 29 of 30 VHL patients in this group using cosmid and P1 probes that cover the VHL locus. We then tested six phenotypically normal offspring from four of these VHL families: two were found to carry the deletion and the other four were deletion-free. In addition, germline mosaicism of the VHL gene was identified in one family. In sum, FISH was found to be a simple and reliable method to detect VHL germline deletions and practically useful in cases where other methods of screening have failed to detect a VHL gene abnormality.

Identification of a novel large deletion in a patient with severe factor V deficiency using an in-house F5 MLPA assay.

PubMed

Nuzzo, F; Paraboschi, E M; Straniero, L; Pavlova, A; Duga, S; Castoldi, E

2015-01-01

Factor V (FV) deficiency is a rare autosomal recessive bleeding disorder caused by mutations in the F5 gene. FV-deficient patients in whom no mutation or only one mutation is found may harbour large gene rearrangements, which are not detected by conventional mutation screening strategies. The aim of this study was to develop and validate a multiplex ligation-dependent probe amplification (MLPA) assay for the detection of large deletions and duplications in the F5 gene. Twenty-two MLPA probes targeting 19 of the 25 exons and the upstream and downstream regions of the F5 gene were designed and tested in 10 normal controls, a patient with a known heterozygous deletion of F5 exons 1-7 (positive control) and 14 genetically unexplained FV-deficient patients. MLPA results were confirmed by digital PCR on a QuantStudio(™) 3D Digital PCR System. The F5-specific probes yielded a reproducible peak profile in normal controls, correctly detected the known deletion in the positive control and suggested the presence of a novel deletion of exons 9-10 in a patient with undetectable FV levels and only one identified mutation. Follow-up by chip-based digital PCR, long-range PCR and direct sequencing confirmed that this patient carried a heterozygous F5 deletion of 1823 bp extending from intron 8 to intron 10. Bioinformatics sequence analysis pinpointed repetitive elements that might have originated the deletion. In conclusion, we have developed and validated an MLPA assay for the detection of gross F5 gene rearrangements. This assay may represent a valuable tool for the molecular diagnosis of FV deficiency. © 2014 John Wiley & Sons Ltd.

Investigating the Role of Twist1 in Diabetes Pathogenesis

DTIC Science & Technology

Several genes associated with diabetes have been identified in genome wide association studies, but their genetic validation as causative factors...of insulin. Loss-of-function genetic experiments demonstrated that Twist1 deletion against fatty pancreas formation driven by obesity, thereby

Construction of upp deletion mutant strains of Lactobacillus casei and Lactococcus lactis based on counterselective system using temperature-sensitive plasmid.

PubMed

Song, Li; Cui, Hongyu; Tang, Lijie; Qiao, Xinyuan; Liu, Min; Jiang, Yanping; Cui, Wen; Li, Yijing

2014-07-01

Integration plasmids are often used in constructing chromosomal mutations, as it enables the alternation of genes at any location by integration or replacement. Food-grade integration vectors can integrate into the host genome without introducing any selectable markers or residual bases, and the recombination often happens in non-coding region. In this study we used the temperature-sensitive pWV01 replicon to construct 2 chloramphenicol-resistant integration plasmids (pGBHC32-upp) containing the uracil phosphoribosyl transferase (upp) gene as a counterselective marker for Lactobacillus casei (L. casei) ATCC393 and Lactococcus lactis (L. lactis) MG1363. We then ligated the designed homologous arms to the pGBHC32-upp plasmids to allow their integration to the bacterial chromosome, and selected upp deletion mutants of L. casei ATCC393 and L. lactis MG1363 in the presence of 5-fluorouracil (5-FU). Analysis of genetic stability, growth curve, carbon utilization and scanning electronic microscopy showed that, except for 5-FU resistance, there were no significant differences between the wild type and mutant lactic acid bacteria. The integration system and the upp deletion strains could be used in the insertion or deletion of genes at any location of the chromosome of both L. casei ATCC 393 and L. lactis MG1363, and the homologous recombination would not introduce any selectable markers or residual bases. These mutant strains can be further investigated for heterologous protein expression and construction of a live mucosal vaccine carrier. Copyright © 2014 Elsevier B.V. All rights reserved.

Highly efficient gene targeting in Aspergillus oryzae industrial strains under ligD mutation introduced by genome editing: Strain-specific differences in the effects of deleting EcdR, the negative regulator of sclerotia formation.

PubMed

Nakamura, Hidetoshi; Katayama, Takuya; Okabe, Tomoya; Iwashita, Kazuhiro; Fujii, Wataru; Kitamoto, Katsuhiko; Maruyama, Jun-Ichi

2017-07-11

Numerous strains of Aspergillus oryzae are industrially used for Japanese traditional fermentation and for the production of enzymes and heterologous proteins. In A. oryzae, deletion of the ku70 or ligD genes involved in non-homologous end joining (NHEJ) has allowed high gene targeting efficiency. However, this strategy has been mainly applied under the genetic background of the A. oryzae wild strain RIB40, and it would be laborious to delete the NHEJ genes in many A. oryzae industrial strains, probably due to their low gene targeting efficiency. In the present study, we generated ligD mutants from the A. oryzae industrial strains by employing the CRISPR/Cas9 system, which we previously developed as a genome editing method. Uridine/uracil auxotrophic strains were generated by deletion of the pyrG gene, which was subsequently used as a selective marker. We examined the gene targeting efficiency with the ecdR gene, of which deletion was reported to induce sclerotia formation under the genetic background of the strain RIB40. As expected, the deletion efficiencies were high, around 60~80%, in the ligD mutants of industrial strains. Intriguingly, the effects of the ecdR deletion on sclerotia formation varied depending on the strains, and we found sclerotia-like structures under the background of the industrial strains, which have never been reported to form sclerotia. The present study demonstrates that introducing ligD mutation by genome editing is an effective method allowing high gene targeting efficiency in A. oryzae industrial strains.

Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

PubMed Central

Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

1995-01-01

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

Conditional genetic deletion of PTEN after a spinal cord injury enhances regenerative growth of CST axons and motor function recovery in mice.

PubMed

Danilov, Camelia A; Steward, Oswald

2015-04-01

Previous studies indicate that conditional genetic deletion of phosphatase and tensin homolog (PTEN) in neonatal mice enhances the ability of axons to regenerate following spinal cord injury (SCI) in adults. Here, we assessed whether deleting PTEN in adult neurons post-SCI is also effective, and whether enhanced regenerative growth is accompanied by enhanced recovery of voluntary motor function. PTEN(loxP/loxP) mice received moderate contusion injuries at cervical level 5 (C5). One group received unilateral injections of adeno-associated virus expressing CRE (AAV-CRE) into the sensorimotor cortex; controls received a vector expressing green fluorescent protein (AAV-GFP) or injuries only (no vector injections). Forelimb function was tested for 14weeks post-SCI using a grip strength meter (GSM) and a hanging task. The corticospinal tract (CST) was traced by injecting mini-ruby BDA into the sensorimotor cortex. Forelimb gripping ability was severely impaired immediately post-SCI but recovered slowly over time. The extent of recovery was significantly greater in PTEN-deleted mice in comparison to either the AAV-GFP group or the injury only group. BDA tract tracing revealed significantly higher numbers of BDA-labeled axons in caudal segments in the PTEN-deleted group compared to control groups. In addition, in the PTEN-deleted group, there were exuberant collaterals extending from the main tract rostral to the lesion and into and around the scar tissue at the injury site. These results indicate that PTEN deletion in adult mice shortly post-SCI can enhance regenerative growth of CST axons and forelimb motor function recovery. Copyright © 2015 Elsevier Inc. All rights reserved.

Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morrow, B.; Carlson, C.; Gupta, R.D.

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

Stereochemical analysis of the functional significance of the conserved inverted CCAAT and TATA elements in the rat bone sialoprotein gene promoter.

PubMed

Su, Ming; Lee, Daniel; Ganss, Bernhard; Sodek, Jaro

2006-04-14

Basal transcription of the bone sialoprotein gene is mediated by highly conserved inverted CCAAT (ICE; ATTGG) and TATA elements (TTTATA) separated by precisely 21 nucleotides. Here we studied the importance of the relative position and orientation of the CCAAT and TATA elements in the proximal promoter by measuring the transcriptional activity of a series of mutated reporter constructs in transient transfection assays. Whereas inverting the TTTATA (wild type) to a TATAAA (consensus TATA) sequence increased transcription slightly, transcription was reduced when the flanking dinucleotides were also inverted. In contrast, reversing the ATTGG (wild type; ICE) to a CCAAT (RICE) sequence caused a marked reduction in transcription, whereas both transcription and NF-Y binding were progressively increased with the simultaneous inversion of flanking nucleotides (f-RICE-f). Reducing the distance between the ICE and TATA elements produced cyclical changes in transcriptional activity that correlated with progressive alterations in the relative positions of the CCAAT and TATA elements on the face of the DNA helix. Minimal transcription was observed after 5 nucleotides were deleted (equivalent to approximately one half turn of the helix), whereas transcription was fully restored after deleting 10 nucleotides (approximately one full turn of the DNA helix), transcriptional activity being progressively lost with deletions beyond 10 nucleotides. In comparison, when deletions were made with the ICE in the reversed (f-RICE-f) orientation transcriptional activity was progressively lost with no recovery. These results show that, although transcription can still occur when the CCAAT box is reversed and/or displaced relative to the TATA box, the activity is dependent upon the flexibility of the intervening DNA helix needed to align the NF-Y complex on the CCAAT box with preinitiation complex proteins that bind to the TATA box. Thus, the precise location and orientation of the CCAAT element is necessary for optimizing basal transcription of the bone sialoprotein gene.

GSTT1 deletion is related to polycyclic aromatic hydrocarbons-induced DNA damage and lymphoma progression.

PubMed

Yang, Fan; Xiong, Jie; Jia, Xiao-E; Gu, Zhao-Hui; Shi, Jing-Yi; Zhao, Yan; Li, Jun-Min; Chen, Sai-Juan; Zhao, Wei-Li

2014-01-01

The interrelationship between genetic susceptibility and carcinogenic exposure is important in cancer development. Polymorphisms in detoxification enzymes of the glutathione-S-transferases (GST) family are associated with an increased incidence of lymphoma. Here we investigated the molecular connection of the genetic polymorphism of GSTT1 to the response of lymphocytes to polycyclic aromatic hydrocarbons (PAH). In neoplastic situation, GSTT1 deletions were more frequently observed in lymphoma patients (54.9%) than in normal controls (42.0%, P = 0.009), resulting in an increased risk for lymphoma in individuals with GSTT1-null genotype (Odds ratio = 1.698, 95% confidence interval = 1.145-2.518). GSTT1 gene and protein expression were accordingly decreased in GSTT1-deleting patients, consistent with activated profile of cell cycle regulation genes. Mimicking environmental exposure using long-term repeat culture with low-dose PAH metabolite Hydroquinone, malignant B- and T-lymphocytes presented increased DNA damage, pCHK1/MYC expression and cell proliferation, which were counteracted by ectopic expression of GSTT1. Moreover, GSTT1 expression retarded xenograft tumor formation of Hydroquinone-treated lymphoma cells in nude mice. In non-neoplastic situation, when zebrafish was exposed to PAH Benzo(a)pyrene, molecular silencing of gstt1 enhanced the proliferation of normal lymphocytes and upregulated myca expression. Collectively, these findings suggested that GSTT1 deletion is related to genetic predisposition to lymphoma, particularly interacting with environmental pollutants containing PAH.

Efficient assembly of full-length infectious clone of Brazilian IBDV isolate by homologous recombination in yeast

PubMed Central

Silva, J.V.J.; Arenhart, S.; Santos, H.F.; Almeida-Queiroz, S.R.; Silva, A.N.M.R.; Trevisol, I.M.; Bertani, G.R.; Gil, L.H.V.G.

2014-01-01

The Infectious Bursal Disease Virus (IBDV) causes immunosuppression in young chickens. Advances in molecular virology and vaccines for IBDV have been achieved by viral reverse genetics (VRG). VRG for IBDV has undergone changes over time, however all strategies used to generate particles of IBDV involves multiple rounds of amplification and need of in vitro ligation and restriction sites. The aim of this research was to build the world’s first VRG for IBDV by yeast-based homologous recombination; a more efficient, robust and simple process than cloning by in vitro ligation. The wild type IBDV (Wt-IBDV-Br) was isolated in Brazil and had its genome cloned in pJG-CMV-HDR vector by yeast-based homologous recombination. The clones were transfected into chicken embryo fibroblasts and the recovered virus (IC-IBDV-Br) showed genetic stability and similar phenotype to Wt-IBDV-Br, which were observed by nucleotide sequence, focus size/morphology and replication kinetics, respectively. Thus, IBDV reverse genetics by yeast-based homologous recombination provides tools to IBDV understanding and vaccines/viral vectors development. PMID:25763067

Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

PubMed

Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

2013-08-08

Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of 23 (35%) of 'missing' mutations in Usher type 2 probands with only a single heterozygous USH2A mutation detected with Sanger sequencing could be attributed to deletions, duplications or a pathogenic deep intronic variant. Future mutation detection strategies and genetic counselling will need to take into account the prevalence of these types of mutations in order to provide a more comprehensive diagnostic service.

Deletion analysis of Streptococcus pneumoniae late competence genes distinguishes virulence determinants that are dependent or independent of competence induction.

PubMed

Zhu, Luchang; Lin, Jingjun; Kuang, Zhizhou; Vidal, Jorge E; Lau, Gee W

2015-07-01

The competence regulon of Streptococcus pneumoniae (pneumococcus) is crucial for genetic transformation. During competence development, the alternative sigma factor ComX is activated, which in turn, initiates transcription of 80 'late' competence genes. Interestingly, only 16 late genes are essential for genetic transformation. We hypothesized that these late genes that are dispensable for competence are beneficial to pneumococcal fitness during infection. These late genes were systematically deleted, and the resulting mutants were examined for their fitness during mouse models of bacteremia and acute pneumonia. Among these, 14 late genes were important for fitness in mice. Significantly, deletion of some late genes attenuated pneumococcal fitness to the same level in both wild-type and ComX-null genetic backgrounds, suggesting that the constitutive baseline expression of these genes was important for bacterial fitness. In contrast, some mutants were attenuated only in the wild-type genetic background but not in the ComX-null background, suggesting that specific expression of these genes during competence state contributed to pneumococcal fitness. Increased virulence during competence state was partially caused by the induction of allolytic enzymes that enhanced pneumolysin release. These results distinguish the role of basal expression versus competence induction in virulence functions encoded by ComX-regulated late competence genes. © 2015 John Wiley & Sons Ltd.

A reverse genetics approach identifies novel mutants in light responses and anthocyanin metabolism in petunia.

PubMed

Berenschot, Amanda S; Quecini, Vera

2014-01-01

Flower color and plant architecture are important commercially valuable features for ornamental petunias (Petunia x hybrida Vilm.). Photoperception and light signaling are the major environmental factors controlling anthocyanin and chlorophyll biosynthesis and shade-avoidance responses in higher plants. The genetic regulators of these processes were investigated in petunia by in silico analyses and the sequence information was used to devise a reverse genetics approach to probe mutant populations. Petunia orthologs of photoreceptor, light-signaling components and anthocyanin metabolism genes were identified and investigated for functional conservation by phylogenetic and protein motif analyses. The expression profiles of photoreceptor gene families and of transcription factors regulating anthocyanin biosynthesis were obtained by bioinformatic tools. Two mutant populations, generated by an alkalyting agent and by gamma irradiation, were screened using a phenotype-independent, sequence-based method by high-throughput PCR-based assay. The strategy allowed the identification of novel mutant alleles for anthocyanin biosynthesis (CHALCONE SYNTHASE) and regulation (PH4), and for light signaling (CONSTANS) genes.

Biomechanical properties of bone in a mouse model of Rett syndrome.

PubMed

Kamal, Bushra; Russell, David; Payne, Anthony; Constante, Diogo; Tanner, K Elizabeth; Isaksson, Hanna; Mathavan, Neashan; Cobb, Stuart R

2015-02-01

Rett syndrome (RTT) is an X-linked genetic disorder and a major cause of intellectual disability in girls. Mutations in the methyl-CpG binding protein 2 (MECP2) gene are the primary cause of the disorder. Despite the dominant neurological phenotypes, MECP2 is expressed ubiquitously throughout the body and a number of peripheral phenotypes such as scoliosis, reduced bone mineral density and skeletal fractures are also common and important clinical features of the disorder. In order to explore whether MeCP2 protein deficiency results in altered structural and functional properties of bone and to test the potential reversibility of any defects, we have conducted a series of histological, imaging and biomechanical tests of bone in a functional knockout mouse model of RTT. Both hemizygous Mecp2(stop/y) male mice in which Mecp2 is silenced in all cells and female Mecp2(stop/+) mice in which Mecp2 is silenced in ~50% of cells as a consequence of random X-chromosome inactivation, revealed significant reductions in cortical bone stiffness, microhardness and tensile modulus. Microstructural analysis also revealed alterations in both cortical and cancellous femoral bone between wild-type and MeCP2-deficient mice. Furthermore, unsilencing of Mecp2 in adult mice cre-mediated stop cassette deletion resulted in a restoration of biomechanical properties (stiffness, microhardness) towards wild-type levels. These results show that MeCP2-deficiency results in overt, but potentially reversible, alterations in the biomechanical integrity of bone and highlights the importance of targeting skeletal phenotypes in considering the development of pharmacological and gene-based therapies. Copyright © 2014. Published by Elsevier Inc.

Recurrent SOX9 deletion campomelic dysplasia due to somatic mosaicism in the father.

PubMed

Smyk, M; Obersztyn, E; Nowakowska, B; Bocian, E; Cheung, S W; Mazurczak, T; Stankiewicz, P

2007-04-15

Haploinsufficiency of SOX9, a master gene in chondrogenesis and testis development, leads to the semi-lethal skeletal malformation syndrome campomelic dysplasia (CD), with or without XY sex reversal. We report on two children with CD and a phenotypically normal father, a carrier of a somatic mosaic SOX9 deletion. This is the first report of a mosaic deletion of SOX9; few familial CD cases with germline and somatic mutation mosaicism have been described. Our findings confirm the utility of aCGH and indicate that for a more accurate estimate of the recurrence risk for a completely penetrant autosomal dominant disorder, parental somatic mosaicism should be considered in healthy parents. Copyright 2007 Wiley-Liss, Inc.

Genetic Reduction of Matrix Metalloproteinase-9 Promotes Formation of Perineuronal Nets Around Parvalbumin-Expressing Interneurons and Normalizes Auditory Cortex Responses in Developing Fmr1 Knock-Out Mice.

PubMed

Wen, Teresa H; Afroz, Sonia; Reinhard, Sarah M; Palacios, Arnold R; Tapia, Kendal; Binder, Devin K; Razak, Khaleel A; Ethell, Iryna M

2017-10-13

Abnormal sensory responses associated with Fragile X Syndrome (FXS) and autism spectrum disorders include hypersensitivity and impaired habituation to repeated stimuli. Similar sensory deficits are also observed in adult Fmr1 knock-out (KO) mice and are reversed by genetic deletion of Matrix Metalloproteinase-9 (MMP-9) through yet unknown mechanisms. Here we present new evidence that impaired development of parvalbumin (PV)-expressing inhibitory interneurons may underlie hyper-responsiveness in auditory cortex of Fmr1 KO mice via MMP-9-dependent regulation of perineuronal nets (PNNs). First, we found that PV cell development and PNN formation around GABAergic interneurons were impaired in developing auditory cortex of Fmr1 KO mice. Second, MMP-9 levels were elevated in P12-P18 auditory cortex of Fmr1 KO mice and genetic reduction of MMP-9 to WT levels restored the formation of PNNs around PV cells. Third, in vivo single-unit recordings from auditory cortex neurons showed enhanced spontaneous and sound-driven responses in developing Fmr1 KO mice, which were normalized following genetic reduction of MMP-9. These findings indicate that elevated MMP-9 levels contribute to the development of sensory hypersensitivity by influencing formation of PNNs around PV interneurons suggesting MMP-9 as a new therapeutic target to reduce sensory deficits in FXS and potentially other autism spectrum disorders. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Diverse Genetic Regulon of the Virulence-Associated Transcriptional Regulator MucR in Brucella abortus 2308

PubMed Central

Caswell, Clayton C.; Elhassanny, Ahmed E. M.; Planchin, Emilie E.; Roux, Christelle M.; Weeks-Gorospe, Jenni N.; Ficht, Thomas A.; Dunman, Paul M.

2013-01-01

The Ros-type regulator MucR is one of the few transcriptional regulators that have been linked to virulence in Brucella. Here, we show that a Brucella abortus in-frame mucR deletion strain exhibits a pronounced growth defect during in vitro cultivation and, more importantly, that the mucR mutant is attenuated in cultured macrophages and in mice. The genetic basis for the attenuation of Brucella mucR mutants has not been defined previously, but in the present study the genes regulated by MucR in B. abortus have been elucidated using microarray analysis and real-time reverse transcription-PCR (RT-PCR). In B. abortus 2308, MucR regulates a wide variety of genes whose products may function in establishing and maintaining cell envelope integrity, polysaccharide biosynthesis, iron homeostasis, genome plasticity, and transcriptional regulation. Particularly notable among the MucR-regulated genes identified is arsR6 (nolR), which encodes a transcriptional regulator previously linked to virulence in Brucella melitensis 16 M. Importantly, electrophoretic mobility shift assays (EMSAs) determined that a recombinant MucR protein binds directly to the promoter regions of several genes repressed by MucR (including arsR6 [nolR]), and in Brucella, as in other alphaproteobacteria, MucR binds to its own promoter to repress expression of the gene that encodes it. Overall, these studies have uncovered the diverse genetic regulon of MucR in Brucella, and in doing so this work has begun to define the MucR-controlled genetic circuitry whose misregulation contributes to the virulence defect of Brucella mucR mutants. PMID:23319565

Mispair-specific Recruitment of the Mlh1-Pms1 Complex Identifies Repair Substrates of the Saccharomyces cerevisiae Msh2-Msh3 Complex*

PubMed Central

Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D.

2014-01-01

DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions. PMID:24550389

Mispair-specific recruitment of the Mlh1-Pms1 complex identifies repair substrates of the Saccharomyces cerevisiae Msh2-Msh3 complex.

PubMed

Srivatsan, Anjana; Bowen, Nikki; Kolodner, Richard D

2014-03-28

DNA mismatch repair is initiated by either the Msh2-Msh6 or the Msh2-Msh3 mispair recognition heterodimer. Here we optimized the expression and purification of Saccharomyces cerevisiae Msh2-Msh3 and performed a comparative study of Msh2-Msh3 and Msh2-Msh6 for mispair binding, sliding clamp formation, and Mlh1-Pms1 recruitment. Msh2-Msh3 formed sliding clamps and recruited Mlh1-Pms1 on +1, +2, +3, and +4 insertion/deletions and CC, AA, and possibly GG mispairs, whereas Msh2-Msh6 formed mispair-dependent sliding clamps and recruited Mlh1-Pms1 on 7 of the 8 possible base:base mispairs, the +1 insertion/deletion mispair, and to a low level on the +2 but not the +3 or +4 insertion/deletion mispairs and not on the CC mispair. The mispair specificity of sliding clamp formation and Mlh1-Pms1 recruitment but not mispair binding alone correlated best with genetic data on the mispair specificity of Msh2-Msh3- and Msh2-Msh6-dependent mismatch repair in vivo. Analysis of an Msh2-Msh6/Msh3 chimeric protein and mutant Msh2-Msh3 complexes showed that the nucleotide binding domain and communicating regions but not the mispair binding domain of Msh2-Msh3 are responsible for the extremely rapid dissociation of Msh2-Msh3 sliding clamps from DNA relative to that seen for Msh2-Msh6, and that amino acid residues predicted to stabilize Msh2-Msh3 interactions with bent, strand-separated mispair-containing DNA are more critical for the recognition of small +1 insertion/deletions than larger +4 insertion/deletions.

The Fate of Arabidopsis thaliana Homeologous CNSs and Their Motifs in the Paleohexaploid Brassica rapa

PubMed Central

Subramaniam, Sabarinath; Wang, Xiaowu; Freeling, Michael; Pires, J. Chris

2013-01-01

Following polyploidy, duplicate genes are often deleted, and if they are not, then duplicate regulatory regions are sometimes lost. By what mechanism is this loss and what is the chance that such a loss removes function? To explore these questions, we followed individual Arabidopsis thaliana–A. thaliana conserved noncoding sequences (CNSs) into the Brassica ancestor, through a paleohexaploidy and into Brassica rapa. Thus, a single Brassicaceae CNS has six potential orthologous positions in B. rapa; a single Arabidopsis CNS has three potential homeologous positions. We reasoned that a CNS, if present on a singlet Brassica gene, would be unlikely to lose function compared with a more redundant CNS, and this is the case. Redundant CNSs go nondetectable often. Using this logic, each mechanism of CNS loss was assigned a metric of functionality. By definition, proved deletions do not function as sequence. Our results indicated that CNSs that go nondetectable by base substitution or large insertion are almost certainly still functional (redundancy does not matter much to their detectability frequency), whereas those lost by inferred deletion or indels are approximately 75% likely to be nonfunctional. Overall, an average nondetectable, once-redundant CNS more than 30 bp in length has a 72% chance of being nonfunctional, and that makes sense because 97% of them sort to a molecular mechanism with “deletion” in its description, but base substitutions do cause loss. Similarly, proved-functional G-boxes go undetectable by deletion 82% of the time. Fractionation mutagenesis is a procedure that uses polyploidy as a mutagenic agent to genetically alter RNA expression profiles, and then to construct testable hypotheses as to the function of the lost regulatory site. We show fractionation mutagenesis to be a “deletion machine” in the Brassica lineage. PMID:23493633

Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood.

PubMed

Ahrens, Hellen E; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

2015-07-01

Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a (51)Chromium release assay and by ex vivo kidney perfusions with human blood. Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation.

Kidneys From α1,3-Galactosyltransferase Knockout/Human Heme Oxygenase-1/Human A20 Transgenic Pigs Are Protected From Rejection During Ex Vivo Perfusion With Human Blood

PubMed Central

Ahrens, Hellen E.; Petersen, Björn; Ramackers, Wolf; Petkov, Stoyan; Herrmann, Doris; Hauschild-Quintern, Janet; Lucas-Hahn, Andrea; Hassel, Petra; Ziegler, Maren; Baars, Wiebke; Bergmann, Sabine; Schwinzer, Reinhard; Winkler, Michael; Niemann, Heiner

2015-01-01

Background Multiple modifications of the porcine genome are required to prevent rejection after pig-to-primate xenotransplantation. Here, we produced pigs with a knockout of the α1,3-galactosyltransferase gene (GGTA1-KO) combined with transgenic expression of the human anti-apoptotic/anti-inflammatory molecules heme oxygenase-1 and A20, and investigated their xenoprotective properties. Methods The GGTA1-KO/human heme oxygenase-1 (hHO-1)/human A20 (hA20) transgenic pigs were produced in a stepwise approach using zinc finger nuclease vectors targeting the GGTA1 gene and a Sleeping Beauty vector coding for hA20. Two piglets were analyzed by quantitative reverse-transcription polymerase chain reaction, flow cytometry, and sequencing. The biological function of the genetic modifications was tested in a 51Chromium release assay and by ex vivo kidney perfusions with human blood. Results Disruption of the GGTA1 gene by deletion of few basepairs was demonstrated in GGTA1-KO/hHO-1/hA20 transgenic pigs. The hHO-1 and hA20 mRNA expression was confirmed by quantitative reverse-transcription polymerase chain reaction. Ex vivo perfusion of 2 transgenic kidneys was feasible for the maximum experimental time of 240 minutes without symptoms of rejection. Conclusions Results indicate that GGTA1-KO/hHO-1/hA20 transgenic pigs are a promising model to alleviate rejection and ischemia-reperfusion damage in porcine xenografts and could serve as a background for further genetic modifications toward the production of a donor pig that is clinically relevant for xenotransplantation. PMID:27500225

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome

PubMed Central

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-01-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield. PMID:25333064

Screening for single nucleotide variants, small indels and exon deletions with a next-generation sequencing based gene panel approach for Usher syndrome.

PubMed

Krawitz, Peter M; Schiska, Daniela; Krüger, Ulrike; Appelt, Sandra; Heinrich, Verena; Parkhomchuk, Dmitri; Timmermann, Bernd; Millan, Jose M; Robinson, Peter N; Mundlos, Stefan; Hecht, Jochen; Gross, Manfred

2014-09-01

Usher syndrome is an autosomal recessive disorder characterized both by deafness and blindness. For the three clinical subtypes of Usher syndrome causal mutations in altogether 12 genes and a modifier gene have been identified. Due to the genetic heterogeneity of Usher syndrome, the molecular analysis is predestined for a comprehensive and parallelized analysis of all known genes by next-generation sequencing (NGS) approaches. We describe here the targeted enrichment and deep sequencing for exons of Usher genes and compare the costs and workload of this approach compared to Sanger sequencing. We also present a bioinformatics analysis pipeline that allows us to detect single-nucleotide variants, short insertions and deletions, as well as copy number variations of one or more exons on the same sequence data. Additionally, we present a flexible in silico gene panel for the analysis of sequence variants, in which newly identified genes can easily be included. We applied this approach to a cohort of 44 Usher patients and detected biallelic pathogenic mutations in 35 individuals and monoallelic mutations in eight individuals of our cohort. Thirty-nine of the sequence variants, including two heterozygous deletions comprising several exons of USH2A, have not been reported so far. Our NGS-based approach allowed us to assess single-nucleotide variants, small indels, and whole exon deletions in a single test. The described diagnostic approach is fast and cost-effective with a high molecular diagnostic yield.

High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families.

PubMed

Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C

2014-06-01

Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic deletion of the bacterial sensor NOD2 improves murine Crohn’s disease-like ileitis independent of functional dysbiosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Corridoni, D.; Rodriguez-Palacios, A.; Di Stefano, G.

Although genetic polymorphisms in NOD2 (nucleotide-binding oligomerization domain-containing 2) have been associated with the pathogenesis of Crohn’s disease (CD), little is known regarding the role of wild-type (WT) NOD2 in the gut. To date, most murine studies addressing the role of WT Nod2 have been conducted using healthy (ileitis/colitis-free) mouse strains. Here, we evaluated the effects of Nod2 deletion in a murine model of spontaneous ileitis, i.e., the SAMP1Yit/Fc (SAMP) strain, which closely resembles CD. Remarkably, Nod2 deletion improved both chronic cobblestone ileitis (by 50% assessed, as the % of abnormal mucosa at 24 wks of age), as well asmore » acute dextran sodium sulfate (DSS) colitis. Mechanistically, Th2 cytokine production and Th2-transcription factor activation (i.e., STAT6 phosphorylation) were reduced. Microbiologically, the effects of Nod2 deletion appeared independent of fecal microbiota composition and function, assessed by 16S rRNA and metatranscriptomics. Our findings indicate that pharmacological blockade of NOD2 signaling in humans could improve health in Th2-driven chronic intestinal inflammation.« less

RNA Virus Reverse Genetics and Vaccine Design

PubMed Central

Stobart, Christopher C.; Moore, Martin L.

2014-01-01

RNA viruses are capable of rapid spread and severe or potentially lethal disease in both animals and humans. The development of reverse genetics systems for manipulation and study of RNA virus genomes has provided platforms for designing and optimizing viral mutants for vaccine development. Here, we review the impact of RNA virus reverse genetics systems on past and current efforts to design effective and safe viral therapeutics and vaccines. PMID:24967693

Selfish Little Circles: Transmission Bias and Evolution of Large Deletion-Bearing Mitochondrial DNA in Caenorhabditis briggsae Nematodes

PubMed Central

Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.

2012-01-01

Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984

Deficiency of Interleukin-1 Receptor Antagonist (DIRA): Report of the First Indian Patient and a Novel Deletion Affecting IL1RN.

PubMed

Mendonca, Leonardo O; Malle, Louise; Donovan, Frank X; Chandrasekharappa, Settara C; Montealegre Sanchez, Gina A; Garg, Megha; Tedgard, Ulf; Castells, Mariana; Saini, Shiv S; Dutta, Sourabh; Goldbach-Mansky, Raphaela; Suri, Deepti; Jesus, Adriana A

2017-07-01

Deficiency of interleukin-1 receptor antagonist (DIRA) is a rare life-threatening autoinflammatory disease caused by autosomal recessive mutations in IL1RN. DIRA presents clinically with early onset generalized pustulosis, multifocal osteomyelitis, and elevation of acute phase reactants. We evaluated and treated an antibiotic-unresponsive patient with presumed DIRA with recombinant IL-1Ra (anakinra). The patient developed anaphylaxis to anakinra and was subsequently desensitized. Genetic analysis of IL1RN was undertaken and treatment with anakinra was initiated. A 5-month-old Indian girl born to healthy non-consanguineous parents presented at the third week of life with irritability, sterile multifocal osteomyelitis including ribs and clavicles, a mild pustular rash, and elevated acute phase reactants. SNP array of the patient's genomic DNA revealed a previously unrecognized homozygous deletion of approximately 22.5 Kb. PCR and Sanger sequencing of the borders of the deleted area allowed identification of the breakpoints of the deletion, thus confirming a homozygous 22,216 bp deletion that spans the first four exons of IL1RN. Due to a clinical suspicion of DIRA, anakinra was initiated which resulted in an anaphylactic reaction that triggered desensitization with subsequent marked and sustained clinical and laboratory improvement. We report a novel DIRA-causing homozygous deletion affecting IL1RN in an Indian patient. The mutation likely is a founder mutation; the design of breakpoint-specific primers will enable genetic screening in Indian patients suspected of DIRA. The patient developed anaphylaxis to anakinra, was desensitized, and is in clinical remission on continued treatment.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

PubMed

Hassan, Maaz; Butler, Merlin G

2016-11-01

We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Generation of EMS-Mutagenized Populations of Arabidopsis thaliana for Polyamine Genetics.

PubMed

Atanasov, Kostadin E; Liu, Changxin; Tiburcio, Antonio F; Alcázar, Rubén

2018-01-01

In the recent years, genetic engineering of polyamine biosynthetic genes has provided evidence for their involvement in plant stress responses and different aspects of plant development. Such approaches are being complemented with the use of reverse genetics, in which mutants affected on a particular trait, tightly associated with polyamines, are isolated and the causal genes mapped. Reverse genetics enables the identification of novel genes in the polyamine pathway, which may be involved in downstream signaling, transport, homeostasis, or perception. Here, we describe a basic protocol for the generation of ethyl methanesulfonate (EMS) mutagenized populations of Arabidopsis thaliana for its use in reverse genetics applied to polyamines.

Canine GM2-Gangliosidosis Sandhoff Disease Associated with a 3-Base Pair Deletion in the HEXB Gene.

PubMed

Wang, P; Henthorn, P S; Galban, E; Lin, G; Takedai, T; Casal, M

2018-01-01

GM2-gangliosidosis is a fatal neurodegenerative lysosomal storage disease (LSD) caused by deficiency of either β-hexosaminidase A (Hex-A) and β-hexosaminidase B (Hex-B) together, or the GM2 activator protein. Clinical signs can be variable and are not pathognomonic for the specific, causal deficiency. To characterize the phenotype and genotype of GM2-gangliosidosis disease in an affected dog. One affected Shiba Inu and a clinically healthy dog. Clinical and neurologic evaluation, brain magnetic resonance imaging (MRI), assays of lysosomal enzyme activities, and sequencing of all coding regions of HEXA, HEXB, and GM2A genes. A 14-month-old, female Shiba Inu presented with clinical signs resembling GM2-gangliosidosis in humans and GM1-gangliosidosis in the Shiba Inu. Magnetic resonance imaging (MRI) of the dog's brain indicated neurodegenerative disease, and evaluation of cerebrospinal fluid (CSF) identified storage granules in leukocytes. Lysosomal enzyme assays of plasma and leukocytes showed deficiencies of Hex-A and Hex-B activities in both tissues. Genetic analysis identified a homozygous, 3-base pair deletion in the HEXB gene (c.618-620delCCT). Clinical, biochemical, and molecular features are characterized in a Shiba Inu with GM2-gangliosidosis. The deletion of 3 adjacent base pairs in HEXB predicts the loss of a leucine residue at amino acid position 207 (p.Leu207del) supporting the hypothesis that GM2-gangliosidosis seen in this dog is the Sandhoff type. Because GM1-gangliosidosis also exists in this breed with almost identical clinical signs, genetic testing for both GM1- and GM2-gangliosidosis should be considered to make a definitive diagnosis. Copyright © 2017 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

Williams Syndrome: A Relationship between Genetics, Brain Morphology and Behaviour

ERIC Educational Resources Information Center

Fahim, C.; Yoon, U.; Nashaat, N. H.; Khalil, A. K.; El-Belbesy, M.; Mancini-Marie, A.; Evans, A. C.; Meguid, N.

2012-01-01

Background: Genetically Williams syndrome (WS) promises to provide essential insight into the pathophysiology of cortical development because its ~28 deleted genes are crucial for cortical neuronal migration and maturation. Phenotypically, WS is one of the most puzzling childhood neurodevelopmental disorders affecting most intellectual…

A patient with PMP22-related hereditary neuropathy and DBH-gene-related dysautonomia.

PubMed

Bartoletti-Stella, Anna; Chiaro, Giacomo; Calandra-Buonaura, Giovanna; Contin, Manuela; Scaglione, Cesa; Barletta, Giorgio; Cecere, Annagrazia; Garagnani, Paolo; Tieri, Paolo; Ferrarini, Alberto; Piras, Silvia; Franceschi, Claudio; Delledonne, Massimo; Cortelli, Pietro; Capellari, Sabina

2015-10-01

Recurrent focal neuropathy with liability to pressure palsies is a relatively frequent autosomal-dominant demyelinating neuropathy linked to peripheral myelin protein 22 (PMP22) gene deletions. The combination of PMP22 gene mutations with other genetic variants is known to cause a more severe phenotype than expected. We present the case of a patient with severe orthostatic hypotension since 12 years of age, who inherited a PMP22 gene deletion from his father. Genetic double trouble was suspected because of selective sympathetic autonomic disturbances. Through exome-sequencing analysis, we identified two novel mutations in the dopamine beta hydroxylase gene. Moreover, with interactome analysis, we excluded a further influence on the origin of the disease by variants in other genes. This case increases the number of unique patients presenting with dopamine-β-hydroxylase deficiency and of cases with genetically proven double trouble. Finding the right, complete diagnosis is crucial to obtain adequate medical care and appropriate genetic counseling.

Genetic analysis of West Nile virus isolates from an outbreak in Idaho, United States, 2006-2007.

PubMed

Grinev, Andriyan; Chancey, Caren; Añez, Germán; Ball, Christopher; Winkelman, Valerie; Williamson, Phillip; Foster, Gregory A; Stramer, Susan L; Rios, Maria

2013-09-23

West Nile virus (WNV) appeared in the U.S. in 1999 and has since become endemic, with yearly summer epidemics causing tens of thousands of cases of serious disease over the past 14 years. Analysis of WNV strains isolated during the 2006-2007 epidemic seasons demonstrates that a new genetic variant had emerged coincidentally with an intense outbreak in Idaho during 2006. The isolates belonging to the new variant carry a 13 nt deletion, termed ID-Δ13, located at the variable region of the 3'UTR, and are genetically related. The analysis of deletions and insertions in the 3'UTR of two major lineages of WNV revealed the presence of conserved repeats and two indel motifs in the variable region of the 3'UTR. One human and two bird isolates from the Idaho 2006-2007 outbreaks were sequenced using Illumina technology and within-host variability was analyzed. Continued monitoring of new genetic variants is important for public health as WNV continues to evolve.

A Comprehensive Molecular Investigation of α-Thalassemia in an Iranian Cohort from Different Provinces of North Iran.

PubMed

Eftekhari, Hajar; Tamaddoni, Ahmad; Mahmoudi Nesheli, Hassan; Vakili, Mohsen; Sedaghat, Sadegh; Banihashemi, Ali; Azizi, Mandana; Youssefi Kamangar, Reza; Akhavan-Niaki, Haleh

2017-01-01

α-Thalassemia (α-thal) is the most common monogenic disease that is caused by the absence or reduced expression of α-globin genes. The aim of this study was to investigate common α-globin mutations and their associated haplotypes in four northern provinces of Iran (Gilan, Mazandaran, Golestan, Khorasan). One thousand, one hundred and ninety-one persons were tested for α-thal mutations by gap-polymerase chain reaction (PCR), reverse dot-blot hybridization, restriction fragment length polymorphism (RFLP) analysis and sequencing. Of the nine different mutations found, the most frequent were -α 3.7 (rightward deletion) (45.6%), polyadenylation site (α p ° lyA2 α) (α2) (AATAAA>AATGAA; HBA2: c.*92 A>G) (15.27%), - - MED (Mediterranean deletion) (6.86%), -α 4.2 (leftward deletion), (6.17%), α CS α [Hb Constant Spring (Hb CS) (HBA2: c.427 T>C)] (4.62%), -α -5 nt (HBA2: c.95+2_95+6delTGAGG) (3.70%). All chromosomes bearing an α-globin point mutation [α p ° lyA2 α, -α -5 nt α, α CS α, α p ° lyA1 α (AATAAA> AATAAG; HBA2: c.*94 A>G)] showed only one haplotype that was present in most normal chromosomes, while the -α 3.7 deletion was associated with three distinct haplotypes. Our results indicate that α-thal mutations are heterogeneous and -α 3.7 and α p ° lyA2 α are the most prevalent mutations in this region. The presence of -α 3.7 with three different haplotypes suggests an older history for this mutation. The high prevalence of α p ° lyA2 α in Mazandaran Province, Iran compared to other parts of the country and the world, suggests a founder effect. Altogether, we here provide further data confirming the heterogeneity of the northern population of Iran. These data may contribute to the establishment of a national mutation database, more accurate genetic counseling and prenatal diagnosis (PND).

Microenvironment acidity as a major determinant of tumor chemoresistance: Proton pump inhibitors (PPIs) as a novel therapeutic approach.

PubMed

Taylor, Sophie; Spugnini, Enrico Pierluigi; Assaraf, Yehuda G; Azzarito, Tommaso; Rauch, Cyril; Fais, Stefano

2015-11-01

Despite the major progresses in biomedical research and the development of novel therapeutics and treatment strategies, cancer is still among the dominant causes of death worldwide. One of the crucial challenges in the clinical management of cancer is primary (intrinsic) and secondary (acquired) resistance to both conventional and targeted chemotherapeutics. Multiple mechanisms have been identifiedthat underlie intrinsic and acquired chemoresistance: these include impaired drug uptake, increased drug efflux, deletion of receptors, altered drug metabolism, quantitative and qualitative alterations in drug targets, increased DNA damage repair and various mechanisms of anti-apoptosis. The fast efflux of anticancer drugs mediated by multidrug efflux pumps and the partial or complete reversibility of chemoresistance combined with the absence of genetic mutations suggests a multifactorial process. However, a growing body of recent evidence suggests that chemoresistance is often triggered by the highly acidic microenvironment of tumors. The vast majority of drugs, including conventional chemotherapeutics and more recent biological agents, are weak bases that are quickly protonated and neutralized in acidic environments, such as the extracellular microenvironment and the acidic organelles of tumor cells. It is therefore essential to develop new strategies to overcome the entrapment and neutralization of weak base drugs. One such strategy is the use of proton pump inhibitors which can enhance tumor chemosensitivity by increasing the pH of the tumor microenvironment. Recent clinical trials in animals with spontaneous tumors have indicated that patient alkalization is capable of reversing acquired chemoresistance in a large percentage of tumors that are refractory to chemotherapy. Of particular interest was the benefit of alkalization for patients undergoing metronomic regimens which are becoming more widely used in veterinary medicine. Overall, these results provide substantial new evidence that altering the acidic tumor microenvironment is an effective, well tolerated and low cost strategy for the overcoming of anticancer drug resistance. Copyright © 2015 Elsevier Ltd. All rights reserved.

Development of a reverse genetics system to generate a recombinant Ebola virus Makona expressing a green fluorescent protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albariño, César G., E-mail: calbarino@cdc.gov; Wiggleton Guerrero, Lisa; Lo, Michael K.

Previous studies have demonstrated the potential application of reverse genetics technology in studying a broad range of aspects of viral biology, including gene regulation, protein function, cell entry, and pathogenesis. Here, we describe a highly efficient reverse genetics system used to generate recombinant Ebola virus (EBOV) based on a recent isolate from a human patient infected during the 2014–2015 outbreak in Western Africa. We also rescued a recombinant EBOV expressing a fluorescent reporter protein from a cleaved VP40 protein fusion. Using this virus and an inexpensive method to quantitate the expression of the foreign gene, we demonstrate its potential usefulnessmore » as a tool for screening antiviral compounds and measuring neutralizing antibodies. - Highlights: • Recombinant Ebola virus (EBOV) derived from Makona variant was rescued. • New protocol for viral rescue allows 100% efficiency. • Modified EBOV expresses a green fluorescent protein from a VP40-fused protein. • Modified EBOV was tested as tool to screen antiviral compounds and measure neutralizing antibodies.« less

A new and efficient approach for construction of uridine/uracil auxotrophic mutants in the filamentous fungus Aspergillus oryzae using Agrobacterium tumefaciens-mediated transformation.

PubMed

Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Do, Loc Thi Binh Xuan; Mai, Linh Thi Dam; Pham, Duc-Ngoc; Tran, Huyen Thi Thanh; Le, Diep Hong; Nguyen, Huy Quang; Tran, Van-Tuan

2017-06-01

Aspergillus oryzae is a filamentous fungus widely used in food industry and as a microbial cell factory for recombinant protein production. Due to the inherent resistance of A. oryzae to common antifungal compounds, genetic transformation of this mold usually requires auxotrophic mutants. In this study, we show that Agrobacterium tumefaciens-mediated transformation (ATMT) method is very efficient for deletion of the pyrG gene in different Aspergillus oryzae wild-type strains to generate uridine/uracil auxotrophic mutants. Our data indicated that all the obtained uridine/uracil auxotrophic transformants, which are 5- fluoroorotic acid (5-FOA) resistant, exist as the pyrG deletion mutants. Using these auxotrophic mutants and the pyrG selectable marker for genetic transformation via A. tumefaciens, we could get about 1060 transformants per 10 6 fungal spores. In addition, these A. oryzae mutants were also used successfully for expression of the DsRed fluorescent reporter gene under control of the A. oryzae amyB promoter by the ATMT method, which resulted in obvious red transformants on agar plates. Our work provides a new and effective approach for constructing the uridine/uracil auxotrophic mutants in the importantly industrial fungus A. oryzae. This strategy appears to be applicable to other filamentous fungi to develop similar genetic transformation systems based on auxotrophic/nutritional markers for food-grade recombinant applications.

The Neuroanatomy of Genetic Subtype Differences in Prader-Willi Syndrome

PubMed Central

Honea, Robyn A.; Holsen, Laura M.; Lepping, Rebecca J.; Perea, Rodrigo; Butler, Merlin G.; Brooks, William M.; Savage, Cary R.

2012-01-01

Objective Despite behavioral differences between genetic subtypes of Prader-Willi syndrome, no studies have been published characterizing brain structure in these subgroups. Our goal was to examine differences in the brain structure phenotype of common subtypes of Prader-Willi syndrome (PWS) [chromosome 15q deletions and maternal uniparental disomy 15 (UPD)]. Methods Fifteen individuals with PWS due to a typical deletion ((DEL) Type I; n=5, Type II; n=10), 8 with PWS due to UPD, and 25 age-matched healthy-weight individuals (HWC) participated in structural magnetic resonance imaging (MRI) scans. A custom voxel-based morphometry processing stream was used to examine regional differences in gray and white matter volume between groups, covarying for age, sex, and body mass index (BMI). Results Overall, compared to HWC, PWS individuals had lower gray matter volumes that encompassed the prefrontal, orbitofrontal and temporal cortices, hippocampus and parahippocampal gyrus, and lower white matter volumes in the brain stem, cerebellum, medial temporal and frontal cortex. Compared to UPD, the DEL subtypes had lower gray matter volume primarily in the prefrontal and temporal cortices, and lower white matter in the parietal cortex. The UPD subtype had more extensive lower gray and white matter volumes in the orbitofrontal and limbic cortices compared to HWC. Conclusions These preliminary findings are the first structural neuroimaging findings to support potentially separate neural mechanisms mediating the behavioral differences seen in these genetic subtypes. PMID:22241551

The neuroanatomy of genetic subtype differences in Prader-Willi syndrome.

PubMed

Honea, Robyn A; Holsen, Laura M; Lepping, Rebecca J; Perea, Rodrigo; Butler, Merlin G; Brooks, William M; Savage, Cary R

2012-03-01

Despite behavioral differences between genetic subtypes of Prader-Willi syndrome (PWS), no studies have been published characterizing brain structure in these subgroups. Our goal was to examine differences in the brain structure phenotype of common subtypes of PWS [chromosome 15q deletions and maternal uniparental disomy 15 (UPD)]. Fifteen individuals with PWS due to a typical deletion [(DEL) type I; n = 5, type II; n = 10], eight with PWS due to UPD, and 25 age-matched healthy-weight individuals (HWC) participated in structural magnetic resonance imaging (MRI) scans. A custom voxel-based morphometry processing stream was used to examine regional differences in gray and white matter volume (WMV) between groups, covarying for age, sex, and body mass index (BMI). Overall, compared to HWC, PWS individuals had lower gray matter volumes (GMV) that encompassed the prefrontal, orbitofrontal and temporal cortices, hippocampus and parahippocampal gyrus, and lower WMVs in the brain stem, cerebellum, medial temporal, and frontal cortex. Compared to UPD, the DEL subtypes had lower GMV primarily in the prefrontal and temporal cortices, and lower white matter in the parietal cortex. The UPD subtype had more extensive lower gray and WMVs in the orbitofrontal and limbic cortices compared to HWC. These preliminary findings are the first structural neuroimaging findings to support potentially separate neural mechanisms mediating the behavioral differences seen in these genetic subtypes. Copyright © 2012 Wiley Periodicals, Inc.

P-52 Balloting of Hull and Mechanical Standards

DTIC Science & Technology

1992-05-01

N) 3. We connot allow standards from ASTM to be an excuse for the Industry to go sole source. Unless the vendor whose design Is being used has...safe working load is 400 lbs. vii Nicholas Jerqovich (MARAD) 2. Para 4.1.3. - Recommend that "or capacity" be deleted. 3. Para 5.1.1.6 - Delete " stapler ...material is used for plate? (d) Det.E - is incorrectly drawn. . . . 17. Figs 1 & 2 - (a) Det. "X" & "B" are reversed. . . (b) See Fig.A..... if stapler

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

PubMed

Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

2014-12-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain.

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

PubMed Central

Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

2014-01-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence interval 2.24–31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. PMID:25281868

An Investigation of Executive Function Abilities in Adults with Praderwilli Syndrome

ERIC Educational Resources Information Center

Walley, R. M.; Donaldson, M. D. C.

2005-01-01

Background: PraderWilli syndrome (PWS) is a genetic disorder caused by the absence of expression of maternally imprinted genes on the long arm of chromosome 15 (15q 11-13). There are two main genetic sub-types: (1) deletion, caused by the absence of paternally derived genetic material; and (2) uniparental disomy (UPD), where two copies of…

A patient with 22q11.2 deletion syndrome: case report.

PubMed

Eryılmaz, Sema Kabataş; Baş, Firdevs; Satan, Ali; Darendeliler, Feyza; Bundak, Rüveyde; Günöz, Hülya; Saka, Nurçin

2009-01-01

22q11 deletion is one of the most frequently encountered genetic syndromes. The phenotypic spectrum shows a wide variability. We report a boy who presented at age 11.9 years with seizures due to hypocalcemia as a result of hypoparathyroidism. FISH analysis revealed a heterozygote deletion at 22q11.2. Positive findings for the syndrome were delayed speech development due to velofacial dysfunction, recurrent croup attacks in early childhood due to latent hypocalcemia and mild dysmorphic features. The findings of this patient indicate that 22q11 deletion syndrome may present with a wide spectrum of clinical findings and that this diagnosis needs to be considered even in patients of older ages presenting with hypocalcemia.

A Patient with 22q11.2 Deletion Syndrome: Case Report

PubMed Central

Baş, Firdevs; Satan, Ali; Darendeliler, Feyza; Bundak, Rüveyde; Günöz, Hülya; Saka, Nurçin

2009-01-01

22q11 deletion is one of the most frequently encountered genetic syndromes. The phenotypic spectrum shows a wide variability. We report a boy who presented at age 11.9 years with seizures due to hypocalcemia as a result of hypoparathyroidism. FISH analysis revealed a heterozygote deletion at 22q11.2. Positive findings for the syndrome were delayed speech development due to velofacial dysfunction, recurrent croup attacks in early childhood due to latent hypocalcemia and mild dysmorphic features. The findings of this patient indicate that 22q11 deletion syndrome may present with a wide spectrum of clinical findings and that this diagnosis needs to be considered even in patients of older ages presenting with hypocalcemia. Conflict of interest:None declared. PMID:21274400

L1-associated genomic regions are deleted in somatic cells of the healthy human brain.

PubMed

Erwin, Jennifer A; Paquola, Apuã C M; Singer, Tatjana; Gallina, Iryna; Novotny, Mark; Quayle, Carolina; Bedrosian, Tracy A; Alves, Francisco I A; Butcher, Cheyenne R; Herdy, Joseph R; Sarkar, Anindita; Lasken, Roger S; Muotri, Alysson R; Gage, Fred H

2016-12-01

The healthy human brain is a mosaic of varied genomes. Long interspersed element-1 (LINE-1 or L1) retrotransposition is known to create mosaicism by inserting L1 sequences into new locations of somatic cell genomes. Using a machine learning-based, single-cell sequencing approach, we discovered that somatic L1-associated variants (SLAVs) are composed of two classes: L1 retrotransposition insertions and retrotransposition-independent L1-associated variants. We demonstrate that a subset of SLAVs comprises somatic deletions generated by L1 endonuclease cutting activity. Retrotransposition-independent rearrangements in inherited L1s resulted in the deletion of proximal genomic regions. These rearrangements were resolved by microhomology-mediated repair, which suggests that L1-associated genomic regions are hotspots for somatic copy number variants in the brain and therefore a heritable genetic contributor to somatic mosaicism. We demonstrate that SLAVs are present in crucial neural genes, such as DLG2 (also called PSD93), and affect 44-63% of cells of the cells in the healthy brain.

Identification of the first multi-exonic WDR72 deletion in isolated amelogenesis imperfecta, and generation of a WDR72-specific copy number screening tool.

PubMed

Hentschel, Julia; Tatun, Dana; Parkhomchuk, Dmitri; Kurth, Ingo; Schimmel, Bettina; Heinrich-Weltzien, Roswitha; Bertzbach, Sabine; Peters, Hartmut; Beetz, Christian

2016-09-15

Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous disorder of tooth development which is due to aberrant deposition or composition of enamel. Both syndromic and isolated forms exist; they may be inherited in an X-linked, autosomal recessive, or autosomal dominant manner. WDR72 is one of ten currently known genes for recessive isolated AI; nine WDR72 mutations affecting single nucleotides have been described to date. Based on whole exome sequencing in a large consanguineous AI pedigree, we obtained evidence for presence of a multi-exonic WDR72 deletion. A home-made multiplex ligation-dependent probe amplification assay was used to confirm the aberration, to narrow its extent, and to identify heterozygous carriers. Our study extends the mutational spectrum for WDR72 to include large deletions, and supports a relevance of the previously proposed loss-of-function mechanism. It also introduces an easy-to-use and highly sensitive tool for detecting WDR72 copy number alterations. Copyright © 2016. Published by Elsevier B.V.

Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

PubMed

Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

2015-11-12

Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

The Yeast Deletion Collection: A Decade of Functional Genomics

PubMed Central

Giaever, Guri; Nislow, Corey

2014-01-01

The yeast deletion collections comprise >21,000 mutant strains that carry precise start-to-stop deletions of ∼6000 open reading frames. This collection includes heterozygous and homozygous diploids, and haploids of both MATa and MATα mating types. The yeast deletion collection, or yeast knockout (YKO) set, represents the first and only complete, systematically constructed deletion collection available for any organism. Conceived during the Saccharomyces cerevisiae sequencing project, work on the project began in 1998 and was completed in 2002. The YKO strains have been used in numerous laboratories in >1000 genome-wide screens. This landmark genome project has inspired development of numerous genome-wide technologies in organisms from yeast to man. Notable spinoff technologies include synthetic genetic array and HIPHOP chemogenomics. In this retrospective, we briefly describe the yeast deletion project and some of its most noteworthy biological contributions and the impact that these collections have had on the yeast research community and on genomics in general. PMID:24939991

Orientation perception in Williams Syndrome: discrimination and integration

PubMed Central

Palomares, Melanie; Landau, Barbara; Egeth, Howard

2009-01-01

Williams Syndrome (WS) is a rare neurodevelopmental disorder, which stems from a genetic deletion on chromosome 7 that causes a profound weakness in visuospatial cognition. Our current study explores how orientation perception may contribute to the visuospatial deficits in WS. In Experiment 1, we found that WS individuals and normal 3-4 year olds had similar orientation discrimination thresholds and had similar prevalence of mirror-reversal errors for diagonal targets (±45 deg). In Experiment 2, we asked whether this immaturity in orientation discrimination would also be reflected in a task requiring integration of oriented elements. We found that sensitivities of WS individuals for detecting orientation-defined contours were higher than sensitivities of normal 3-4 year olds, and were not significantly different from sensitivities of normal adults. Together, these results suggest that orientation discrimination and orientation integration have different maturational trajectories in normal development and different susceptibilities to damage in WS, which may reflect largely separate visuospatial mechanisms. PMID:19231058

A Mini HIP HOP Assay Uncovers a Central Role for Copper and Zinc in the Antifungal Mode of Action of Allicin.

PubMed

Prescott, Thomas A K; Panaretou, Barry

2017-05-10

Garlic contains the organosulfur compound allicin which exhibits potent antifungal activity. Here we demonstrate the use of a highly simplified yeast chemical genetic screen to characterize its mode of action. By screening 24 validated yeast gene deletion "signature" strains for which hypersensitivity is characteristic for common antifungal modes of action, yeast lacking the high affinity Cu 2+ transporter Ctr1 was found to be hypersensitive to allicin. Focusing on transition metal related genes identified two more hypersensitive strains lacking the Cu 2+ and Zn 2+ transcription factors Mac1 and Zap1. Hypersensitivity in these strains was reversed by the addition of Cu 2+ and Zn 2+ ions, respectively. The results suggest the antifungal activity of allicin is mediated through restricted Cu 2+ and Zn 2+ uptake or inhibition of Cu 2+ and Zn 2+ metalloproteins. As certain antimicrobial modes of action are much more common than others, the approach taken here provides a useful way to identify them early on.

Bmi1 limits dilated cardiomyopathy and heart failure by inhibiting cardiac senescence

PubMed Central

Gonzalez-Valdes, I.; Hidalgo, I.; Bujarrabal, A.; Lara-Pezzi, E.; Padron-Barthe, L.; Garcia-Pavia, P.; Gómez-del Arco, Pablo; Redondo, J.M.; Ruiz-Cabello, J.M.; Jimenez-Borreguero, L.J.; Enriquez, J.A.; de la Pompa, J.L.; Hidalgo, A.; Gonzalez, S.

2015-01-01

Dilated cardiomyopathy (DCM) is the most frequent cause of heart failure and the leading indication for heart transplantation. Here we show that epigenetic regulator and central transcriptional instructor in adult stem cells, Bmi1, protects against DCM by repressing cardiac senescence. Cardiac-specific Bmi1 deletion induces the development of DCM, which progresses to lung congestion and heart failure. In contrast, Bmi1 overexpression in the heart protects from hypertrophic stimuli. Transcriptome analysis of mouse and human DCM samples indicates that p16INK4a derepression, accompanied by a senescence-associated secretory phenotype (SASP), is linked to severely impaired ventricular dimensions and contractility. Genetic reduction of p16INK4a levels reverses the pathology of Bmi1-deficient hearts. In parabiosis assays, the paracrine senescence response underlying the DCM phenotype does not transmit to healthy mice. As senescence is implicated in tissue repair and the loss of regenerative potential in aging tissues, these findings suggest a source for cardiac rejuvenation. PMID:25751743

A Conserved Dopamine-Cholecystokinin Signaling Pathway Shapes Context–Dependent Caenorhabditis elegans Behavior

PubMed Central

Bhattacharya, Raja; Touroutine, Denis; Barbagallo, Belinda; Climer, Jason; Lambert, Christopher M.; Clark, Christopher M.; Alkema, Mark J.; Francis, Michael M.

2014-01-01

An organism's ability to thrive in changing environmental conditions requires the capacity for making flexible behavioral responses. Here we show that, in the nematode Caenorhabditis elegans, foraging responses to changes in food availability require nlp-12, a homolog of the mammalian neuropeptide cholecystokinin (CCK). nlp-12 expression is limited to a single interneuron (DVA) that is postsynaptic to dopaminergic neurons involved in food-sensing, and presynaptic to locomotory control neurons. NLP-12 release from DVA is regulated through the D1-like dopamine receptor DOP-1, and both nlp-12 and dop-1 are required for normal local food searching responses. nlp-12/CCK overexpression recapitulates characteristics of local food searching, and DVA ablation or mutations disrupting muscle acetylcholine receptor function attenuate these effects. Conversely, nlp-12 deletion reverses behavioral and functional changes associated with genetically enhanced muscle acetylcholine receptor activity. Thus, our data suggest that dopamine-mediated sensory information about food availability shapes foraging in a context-dependent manner through peptide modulation of locomotory output. PMID:25167143

Autism-Associated Insertion Mutation (InsG) of Shank3 Exon 21 Causes Impaired Synaptic Transmission and Behavioral Deficits

PubMed Central

Speed, Haley E.; Kouser, Mehreen; Xuan, Zhong; Reimers, Jeremy M.; Ochoa, Christine F.; Gupta, Natasha; Liu, Shunan

2015-01-01

SHANK3 (also known as PROSAP2) is a postsynaptic scaffolding protein at excitatory synapses in which mutations and deletions have been implicated in patients with idiopathic autism, Phelan–McDermid (aka 22q13 microdeletion) syndrome, and other neuropsychiatric disorders. In this study, we have created a novel mouse model of human autism caused by the insertion of a single guanine nucleotide into exon 21 (Shank3G). The resulting frameshift causes a premature STOP codon and loss of major higher molecular weight Shank3 isoforms at the synapse. Shank3G/G mice exhibit deficits in hippocampus-dependent spatial learning, impaired motor coordination, altered response to novelty, and sensory processing deficits. At the cellular level, Shank3G/G mice also exhibit impaired hippocampal excitatory transmission and plasticity as well as changes in baseline NMDA receptor-mediated synaptic responses. This work identifies clear alterations in synaptic function and behavior in a novel, genetically accurate mouse model of autism mimicking an autism-associated insertion mutation. Furthermore, these findings lay the foundation for future studies aimed to validate and study region-selective and temporally selective genetic reversal studies in the Shank3G/G mouse that was engineered with such future experiments in mind. PMID:26134648

Deletion 22q13.3 syndrome.

PubMed

Phelan, Mary C

2008-05-27

The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH) or array comparative genomic hybridization (CGH) is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy). Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements. Individuals with deletion 22q13 should have routine examinations by the primary care physician as well as genetic evaluations with referral to specialists if neurological, gastrointestinal, renal, or other systemic problems are suspected. Affected individuals benefit from early intervention programs, intense occupational and communication therapies, adaptive exercise and sport programs, and other therapies to strengthen their muscles and increase their communication skills. No apparent life-threatening organic abnormalities accompany the diagnosis of deletion 22q13.

Spectrum of SMARCB1/INI1 Mutations in Familial and Sporadic Rhabdoid Tumors

PubMed Central

Eaton, Katherine W.; Tooke, Laura S.; Wainwright, Luanne M.; Judkins, Alexander R.; Biegel, Jaclyn A.

2011-01-01

Background Germline mutations and deletions of SMARCB1/INI1 in chromosome band 22q11.2 predispose patients to rhabdoid tumor and schwannomatosis. Previous estimates suggested that 15–20% of rhabdoid tumors were caused by an underlying germline abnormality of SMARCB1. However, these studies were limited by case selection and an inability to detect intragenic deletions and duplications. Procedure One hundred matched tumor and blood samples from patients with rhabdoid tumors of the brain, kidney, or soft tissues were analyzed for mutations and deletions of SMARCB1 by FISH, multiplex ligation-dependent probe amplification (MLPA), sequence analysis and high resolution Illumina 610K SNP based oligonucleotide array studies. Results Thirty-five of 100 patients were found to have a germline SMARCB1 abnormality. These abnormalities included point and frameshift mutations, intragenic deletions and duplications, and larger deletions including regions both proximal and distal to SMARCB1. There were 9 cases that demonstrated parent to child transmission of a mutated copy of SMARCB1. In 8 of the 9 cases, one or more family members were also diagnosed with rhabdoid tumor or schwannoma, and 2 of the 8 families presented with multiple affected children in a manner consistent with gonadal mosaicism. Conclusions Approximately one third of newly diagnosed patients with rhabdoid tumor have an underlying genetic predisposition to tumors due to a germline SMARCB1 alteration. Families may demonstrate incomplete penetrance and gonadal mosaicism, which must be considered when counseling families of patients with rhabdoid tumor. PMID:21108436

Genetic heterogeneity in patients with Bartter syndrome type 1

PubMed Central

Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

2017-01-01

Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss-of-function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease-causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next-generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long-range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought. PMID:28000888

Genetic heterogeneity in patients with Bartter syndrome type 1.

PubMed

Sun, Mingran; Ning, Jing; Xu, Weihong; Zhang, Han; Zhao, Kaishu; Li, Wenfu; Li, Guiying; Li, Shibo

2017-02-01

Bartter syndrome (BS) type 1 is an autosomal recessive kidney disorder caused by loss‑of‑function mutations in the solute carrier family 12 member 1 (SLC12A1) gene. To date, 72 BS type 1 patients harboring SLC12A1 mutations have been documented. Of these 144 alleles studied, 68 different disease‑causing mutations have been detected in 129 alleles, and no mutation was detected in the remaining 15 alleles. The mutation types included missense/nonsense mutations, splicing mutations and small insertions and deletions ranging from 1 to 4 nucleotides. A large deletion encompassing a whole exon in the SLC12A1 gene has not yet been reported. The current study initially identified an undocumented homozygous frameshift mutation (c.1833delT) by Sanger sequencing analysis of a single infant with BS type 1. However, in a subsequent analysis, the mutation was detected only in the father's DNA. Upon further investigation using a next‑generation sequencing approach, a deletion in exons 14 and 15 in both the patient and patient's mother was detected. The deletion was subsequently confirmed by use of a long‑range polymerase chain reaction and was determined to be 3.16 kb in size based on sequencing of the junction fragment. The results of the present study demonstrated that pathogenic variants of SLC12A1 are heterogeneous. Large deletions appear to serve an etiological role in BS type 1, and may be more prevalent than previously thought.

Temporal lobe pleomorphic xanthoastrocytoma and acquired BRAF mutation in an adolescent with the constitutional 22q11.2 deletion syndrome.

PubMed

Murray, Jeffrey C; Donahue, David J; Malik, Saleem I; Dzurik, Yvette B; Braly, Emily Z; Dougherty, Margaret J; Eaton, Katherine W; Biegel, Jaclyn A

2011-05-01

DiGeorge syndrome, or velocardiofacial syndrome (DGS/VCFS), is a rare and usually sporadic congenital genetic disorder resulting from a constitutional microdeletion at chromosome 22q11.2. While rare cases of malignancy have been described, likely due to underlying immunodeficiency, central nervous system tumors have not yet been reported. We describe an adolescent boy with DGS/VCFS who developed a temporal lobe pleomorphic xanthoastrocytoma. High-resolution single nucleotide polymorphism array studies of the tumor confirmed a constitutional 22q11.21 deletion, and revealed acquired gains, losses and copy number neutral loss of heterozygosity of several chromosomal regions, including a homozygous deletion of the CDKN2A/B locus. The tumor also demonstrated a common V600E mutation in the BRAF oncogene. This is the first reported case of a patient with DiGeorge syndrome developing a CNS tumor of any histology and expands our knowledge about low-grade CNS tumor molecular genetics.

[Phenotypic and genetic analysis of a patient presented with Tietz/Waardenburg type II a syndrome].

PubMed

Wang, Huanhuan; Tang, Lifang; Zhang, Jingmin; Hu, Qin; Chen, Yingwei; Xiao, Bing

2015-08-01

To determine the genetic cause for a patient featuring decreased pigmentation of the skin and iris, hearing loss and multiple congenital anomalies. Routine chromosomal banding was performed to analyze the karyotype of the patient and his parents. Single nucleotide polymorphism array (SNP array) was employed to identify cryptic chromosome aberrations, and quantitative real-time PCR was used to confirm the results. Karyotype analysis has revealed no obvious anomaly for the patient and his parents. SNP array analysis of the patient has demonstrated a 3.9 Mb deletion encompassing 3p13p14.1, which caused loss of entire MITF gene. The deletion was confirmed by quantitative real-time PCR. Clinical features of the patient have included severe bilateral hearing loss, decreased pigmentation of the skin and iris and multiple congenital anomalies. The patient, carrying a 3p13p14.1 deletion, has features of Tietz syndrome/Waardenburg syndrome type IIa. This case may provide additional data for the study of genotype-phenotype correlation of this disease.

Abnormal response to the anorexic effect of GHS-R inhibitors and exenatide in male Snord116 deletion mouse model for Prader-Willi Syndrome

USDA-ARS?s Scientific Manuscript database

Prader-Willi syndrome (PWS) is a genetic disease characterized by persistent hunger and hyperphagia. The lack of the Snord116 small nucleolar RNA cluster has been identified as the major contributor to PWS symptoms. The Snord116 deletion (Snord116del) mouse model manifested a subset of PWS symptoms ...

Childhood Predictors of Written Expression in Late Adolescents with 22q11.2 Deletion Syndrome: A Longitudinal Study

ERIC Educational Resources Information Center

Hamsho, N.; Antshel, K. M.; Eckert, T. L.; Kates, W. R.

2017-01-01

Background: 22q11.2 deletion syndrome (22q11DS) is the second most prevalent genetic syndrome and has a characteristic academic and behavioural phenotype. The primary objective of the current study was to examine the childhood predictors of written expression achievement in adolescents with 22q11DS. Written expression is an important skill that…

Genetic Separation of Hypoxanthine and Guanine-Xanthine Phosphoribosyltransferase Activities by Deletion Mutations in Salmonella typhimurium

PubMed Central

Gots, Joseph S.; Benson, Charles E.; Shumas, Susan R.

1972-01-01

Certain proAB deletion mutants of Salmonella typhimurium were found to be simultaneously deleted in a gene required for the utilization of guanine and xanthine (designated gxu). These mutants were resistant to 8-azaguanine and when carrying an additional pur mutation were unable to use guanine or xanthine as a purine source. The defect was correlated with deficiencies in the uptake and phosphoribosyltransferase activities for guanine and xanthine. Hypoxanthine and adenine activities were unaltered. The deficiency was restored to normal by transduction to pro+ and in F′ merodiploids. PMID:4563984

Germline APOBEC3B deletion is associated with breast cancer risk in an Asian multi-ethnic cohort and with immune cell presentation.

PubMed

Wen, Wei Xiong; Soo, Jaslyn Sian-Siu; Kwan, Pui Yoke; Hong, Elaine; Khang, Tsung Fei; Mariapun, Shivaani; Lee, Christine Shu-Mei; Hasan, Siti Norhidayu; Rajadurai, Pathmanathan; Yip, Cheng Har; Mohd Taib, Nur Aishah; Teo, Soo Hwang

2016-05-27

APOBEC3B is a cytosine deaminase implicated in immune response to viral infection, cancer predisposition and carcinogenesis. Germline APOBEC3B deletion is more common in East Asian women and confers a modest risk to breast cancer in both East Asian and Caucasian women. Analysis of tumour samples from women of European descent has shown that germline APOBEC3B deletion is associated with an increased propensity to develop somatic mutations and with an enrichment for immune response-related gene sets. However, this has not been examined in Asian tumour samples, where population differences in genetic and dietary factors may have an impact on the immune system. In this study, we determined the prevalence of germline APOBEC3B deletion and its association with breast cancer risk in a cross-sectional hospital-based Asian multi-ethnic cohort of 1451 cases and 1442 controls from Malaysia. We compared gene expression profiles of breast cancers arising from APOBEC3B deletion carriers and non-carriers using microarray analyses. Finally, we characterised the overall abundance of tumour-infiltrating immune cells in breast cancers from TCGA and METABRIC using ESTIMATE and relative frequency of 22 immune cell subsets in breast cancers from METABRIC using CIBERSORT. The minor allelic frequency of APOBEC3B deletion was estimated to be 0.35, 0.42 and 0.16 in female populations of Chinese, Malay and Indian descent, respectively, and that germline APOBEC3B deletion was associated with breast cancer risk with odds ratios of 1.23 (95 % CI: [1.05, 1.44]) for one-copy deletion and 1.38 (95 % CI: [1.10, 1.74]) for two-copy deletion compared to women with no deletion. Germline APOBEC3B deletion was not associated with any clinicopathologic features or the expression of any APOBEC family members but was associated with immune response-related gene sets (FDR q values < 0.05). Analysis of breast cancers from METABRIC revealed breast cancers from APOBEC3B deletion carriers to have significantly higher abundance of tumour-infiltrating immune cells (P < 0.001). Taken together, our data suggests that tumour-infiltrating immune cells may be an important feature of breast cancers arising in women with APOBEC3B germline deletion, and that this may be of particular interest in Asian women where the germline deletion is more common.

Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree.

PubMed

Bai, Ying; Chen, Yibing; Kong, Xiangdong

2018-02-02

It has been reported that mutations in arginine vasopressin type 2 receptor (AVPR2) cause congenital X-linked nephrogenic diabetes insipidus (NDI). However, only a few cases of AVPR2 deletion have been documented in China. An NDI pedigree was included in this study, including the proband and his mother. All NDI patients had polyuria, polydipsia, and growth retardation. PCR mapping, long range PCR and sanger sequencing were used to identify genetic causes of NDI. A novel 22,110 bp deletion comprising AVPR2 and ARH4GAP4 genes was identified by PCR mapping, long range PCR and sanger sequencing. The deletion happened perhaps due to the 4-bp homologous sequence (TTTT) at the junctions of both 5' and 3' breakpoints. The gross deletion co-segregates with NDI. After analyzing available data of putative clinical signs of AVPR2 and ARH4GAP4 deletion, we reconsider the potential role of AVPR2 deletion in short stature. We identified a novel 22.1-kb deletion leading to X-linked NDI in a Chinese pedigree, which would increase the current knowledge in AVPR2 mutation.

Adaptation Genomics of a Small-Colony Variant in a Pseudomonas chlororaphis 30-84 Biofilm

PubMed Central

Dorosky, Robert J.; Han, Cliff S.; Lo, Chien-chi; Dichosa, Armand E. K.; Chain, Patrick S.; Yu, Jun Myoung; Pierson, Leland S.

2014-01-01

The rhizosphere-colonizing bacterium Pseudomonas chlororaphis 30-84 is an effective biological control agent against take-all disease of wheat. In this study, we characterize a small-colony variant (SCV) isolated from a P. chlororaphis 30-84 biofilm. The SCV exhibited pleiotropic phenotypes, including small cell size, slow growth and motility, low levels of phenazine production, and increased biofilm formation and resistance to antimicrobials. To better understand the genetic alterations underlying these phenotypes, RNA and whole-genome sequencing analyses were conducted comparing an SCV to the wild-type strain. Of the genome's 5,971 genes, transcriptomic profiling indicated that 1,098 (18.4%) have undergone substantial reprograming of gene expression in the SCV. Whole-genome sequence analysis revealed multiple alterations in the SCV, including mutations in yfiR (cyclic-di-GMP production), fusA (elongation factor), and cyoE (heme synthesis) and a 70-kb deletion. Genetic analysis revealed that the yfiR locus plays a major role in controlling SCV phenotypes, including colony size, growth, motility, and biofilm formation. Moreover, a point mutation in the fusA gene contributed to kanamycin resistance. Interestingly, the SCV can partially switch back to wild-type morphologies under specific conditions. Our data also support the idea that phenotypic switching in P. chlororaphis is not due to simple genetic reversions but may involve multiple secondary mutations. The emergence of these highly adherent and antibiotic-resistant SCVs within the biofilm might play key roles in P. chlororaphis natural persistence. PMID:25416762

Human mitochondrial DNA replication machinery and disease

PubMed Central

Young, Matthew J.; Copeland, William C.

2016-01-01

The human mitochondrial genome is replicated by DNA polymerase γ in concert with key components of the mitochondrial DNA (mtDNA) replication machinery. Defects in mtDNA replication or nucleotide metabolism cause deletions, point mutations, or depletion of mtDNA. The resulting loss of cellular respiration ultimately induces mitochondrial genetic diseases, including mtDNA depletion syndromes such as Alpers or early infantile hepatocerebral syndromes, and mtDNA deletion disorders such as progressive external ophthalmoplegia, ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy. Here we review the current literature regarding human mtDNA replication and heritable disorders caused by genetic changes of the POLG, POLG2, Twinkle, RNASEH1, DNA2 and MGME1 genes. PMID:27065468

Attempt to rescue sex-reversal by transgenic expression of the PISRT1 gene in XX PIS-/- goats.

PubMed

Boulanger, L; Kocer, A; Daniel, N; Pannetier, M; Chesné, P; Heyman, Y; Renault, L; Mandon-Pépin, B; Chavatte-Palmer, P; Vignon, X; Vilotte, J-L; Cotinot, C; Renard, J-P; Pailhoux, E

2008-01-01

The Polled Intersex Syndrome (PIS mutation) in goats leads to an absence of horn and to an early sex-reversal of the XX gonads. This mutation is a deletion of an 11.7-kb DNA fragment showing a tissue-specific regulatory activity. Indeed, in XX PIS(-/-) gonads the deletion of PIS leads to the transcriptional extinction of at least 3 neighboring genes, FOXL2, PFOXic and PISRT1. Among them, only FOXL2 is a 'classical' gene, encoding a highly conserved transcription factor. On the other hand, knock-out of Foxl2 in mice results in an early blocking of follicle formation without sex-reversal. This phenotype discrepancy leads to two hypotheses, either FOXL2 is responsible for XX sex-reversal in goat assuming distinct functions of its protein during ovarian differentiation in different mammals, or other PIS-regulated genes are involved. To assess the second possibility, PISRT1 expression was constitutively restored in XX PIS(-/-) gonads. Six transgenic fetuses were obtained by nuclear transfer and studied at 2 developmental stages, 41 and 46 days post-reconstruction. The gonads of these fetuses appear phenotypically identical to those of cloned non-transgenic controls. Conclusively, this result argues for FOXL2 being responsible for the PIS gonad-associated phenotype. Its invalidation in goat will help to better understand this complex syndrome. Copyright 2008 S. Karger AG, Basel.

High Yields of 2,3-Butanediol and Mannitol in Lactococcus lactis through Engineering of NAD+ Cofactor Recycling ▿ †

PubMed Central

Gaspar, Paula; Neves, Ana Rute; Gasson, Michael J.; Shearman, Claire A.; Santos, Helena

2011-01-01

Manipulation of NADH-dependent steps, and particularly disruption of the las-located lactate dehydrogenase (ldh) gene in Lactococcus lactis, is common to engineering strategies envisaging the accumulation of reduced end products other than lactate. Reverse transcription-PCR experiments revealed that three out of the four genes assigned to lactate dehydrogenase in the genome of L. lactis, i.e., the ldh, ldhB, and ldhX genes, were expressed in the parental strain MG1363. Given that genetic redundancy is often a major cause of metabolic instability in engineered strains, we set out to develop a genetically stable lactococcal host tuned for the production of reduced compounds. Therefore, the ldhB and ldhX genes were sequentially deleted in L. lactis FI10089, a strain with a deletion of the ldh gene. The single, double, and triple mutants, FI10089, FI10089ΔldhB, and FI10089ΔldhBΔldhX, showed similar growth profiles and displayed mixed-acid fermentation, ethanol being the main reduced end product. Hence, the alcohol dehydrogenase-encoding gene, the adhE gene, was inactivated in FI10089, but the resulting strain reverted to homolactic fermentation due to induction of the ldhB gene. The three lactate dehydrogenase-deficient mutants were selected as a background for the production of mannitol and 2,3-butanediol. Pathways for the biosynthesis of these compounds were overexpressed under the control of a nisin promoter, and the constructs were analyzed with respect to growth parameters and product yields under anaerobiosis. Glucose was efficiently channeled to mannitol (maximal yield, 42%) or to 2,3-butanediol (maximal yield, 67%). The theoretical yield for 2,3-butanediol was achieved. We show that FI10089ΔldhB is a valuable basis for engineering strategies aiming at the production of reduced compounds. PMID:21841021

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

PubMed

Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

2015-04-01

We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

Full-length genome analysis of two genetically distinct variants of porcine epidemic diarrhea virus in Thailand.

PubMed

Cheun-Arom, Thaniwan; Temeeyasen, Gun; Tripipat, Thitima; Kaewprommal, Pavita; Piriyapongsa, Jittima; Sukrong, Suchada; Chongcharoen, Wanchai; Tantituvanont, Angkana; Nilubol, Dachrit

2016-10-01

Porcine epidemic diarrhea virus (PEDV) has continued to cause sporadic outbreaks in Thailand since 2007 and a pandemic variant containing an insertion and deletion in the spike gene was responsible for outbreaks. In 2014, there were further outbreaks of the disease occurring within four months of each other. In this study, the full-length genome sequences of two genetically distinct PEDV isolates from the outbreaks were characterized. The two PEDV isolates, CBR1/2014 and EAS1/2014, were 28,039 and 28,033 nucleotides in length and showed 96.2% and 93.6% similarities at nucleotide and amino acid levels respectively. In total, we have observed 1048 nucleotide substitutions throughout the genome. Compared to EAS1/2014, CBR1/2014 has 2 insertions of 4 ((56)GENQ(59)) and 1 ((140)N) amino acid positions 56-59 and 140, and 2 deletions of 2 ((160)DG(161)) and 1 ((1199)Y) amino acid positions 160-161 and 1199. The phylogenetic analysis based on full-length genome of CBR1/2014 isolate has grouped the virus with the pandemic variants. In contrast, EAS1/2014 isolate was grouped with CV777, LZC and SM98, a classical variant. Our findings demonstrated the emergence of EAS1/2014, a classical variant which is novel to Thailand and genetically distinct from the currently circulating endemic variants. This study warrants further investigations into molecular epidemiology and genetic evolution of the PEDV in Thailand. Copyright © 2016 Elsevier B.V. All rights reserved.

Loss of function of the retinoid-related nuclear receptor (RORB) gene and epilepsy

PubMed Central

Rudolf, Gabrielle; Lesca, Gaetan; Mehrjouy, Mana M; Labalme, Audrey; Salmi, Manal; Bache, Iben; Bruneau, Nadine; Pendziwiat, Manuela; Fluss, Joel; de Bellescize, Julitta; Scholly, Julia; Møller, Rikke S; Craiu, Dana; Tommerup, Niels; Valenti-Hirsch, Maria Paola; Schluth-Bolard, Caroline; Sloan-Béna, Frédérique; Helbig, Katherine L; Weckhuysen, Sarah; Edery, Patrick; Coulbaut, Safia; Abbas, Mohamed; Scheffer, Ingrid E; Tang, Sha; Myers, Candace T; Stamberger, Hannah; Carvill, Gemma L; Shinde, Deepali N; Mefford, Heather C; Neagu, Elena; Huether, Robert; Lu, Hsiao-Mei; Dica, Alice; Cohen, Julie S; Iliescu, Catrinel; Pomeran, Cristina; Rubenstein, James; Helbig, Ingo; Sanlaville, Damien; Hirsch, Edouard; Szepetowski, Pierre

2016-01-01

Genetic generalized epilepsy (GGE), formerly known as idiopathic generalized epilepsy, is the most common form of epilepsy and is thought to have predominant genetic etiology. GGE are clinically characterized by absence, myoclonic, or generalized tonic-clonic seizures with electroencephalographic pattern of bilateral, synchronous, and symmetrical spike-and-wave discharges. Despite their strong heritability, the genetic basis of generalized epilepsies remains largely elusive. Nevertheless, recent advances in genetic technology have led to the identification of numerous genes and genomic defects in various types of epilepsies in the past few years. In the present study, we performed whole-exome sequencing in a family with GGE consistent with the diagnosis of eyelid myoclonia with absences. We found a nonsense variant (c.196C>T/p.(Arg66*)) in RORB, which encodes the beta retinoid-related orphan nuclear receptor (RORβ), in four affected family members. In addition, two de novo variants (c.218T>C/p.(Leu73Pro); c.1249_1251delACG/p.(Thr417del)) were identified in sporadic patients by trio-based exome sequencing. We also found two de novo deletions in patients with behavioral and cognitive impairment and epilepsy: a 52-kb microdeletion involving exons 5–10 of RORB and a larger 9q21-microdeletion. Furthermore, we identified a patient with intellectual disability and a balanced translocation where one breakpoint truncates RORB and refined the phenotype of a recently reported patient with RORB deletion. Our data support the role of RORB gene variants/CNVs in neurodevelopmental disorders including epilepsy, and especially in generalized epilepsies with predominant absence seizures. PMID:27352968

Population-genetic nature of copy number variations in the human genome.

PubMed

Kato, Mamoru; Kawaguchi, Takahisa; Ishikawa, Shumpei; Umeda, Takayoshi; Nakamichi, Reiichiro; Shapero, Michael H; Jones, Keith W; Nakamura, Yusuke; Aburatani, Hiroyuki; Tsunoda, Tatsuhiko

2010-03-01

Copy number variations (CNVs) are universal genetic variations, and their association with disease has been increasingly recognized. We designed high-density microarrays for CNVs, and detected 3000-4000 CNVs (4-6% of the genomic sequence) per population that included CNVs previously missed because of smaller sizes and residing in segmental duplications. The patterns of CNVs across individuals were surprisingly simple at the kilo-base scale, suggesting the applicability of a simple genetic analysis for these genetic loci. We utilized the probabilistic theory to determine integer copy numbers of CNVs and employed a recently developed phasing tool to estimate the population frequencies of integer copy number alleles and CNV-SNP haplotypes. The results showed a tendency toward a lower frequency of CNV alleles and that most of our CNVs were explained only by zero-, one- and two-copy alleles. Using the estimated population frequencies, we found several CNV regions with exceptionally high population differentiation. Investigation of CNV-SNP linkage disequilibrium (LD) for 500-900 bi- and multi-allelic CNVs per population revealed that previous conflicting reports on bi-allelic LD were unexpectedly consistent and explained by an LD increase correlated with deletion-allele frequencies. Typically, the bi-allelic LD was lower than SNP-SNP LD, whereas the multi-allelic LD was somewhat stronger than the bi-allelic LD. After further investigation of tag SNPs for CNVs, we conclude that the customary tagging strategy for disease association studies can be applicable for common deletion CNVs, but direct interrogation is needed for other types of CNVs.

Cognitive abilities and genotype in a population-based sample of people with Prader-Willi syndrome.

PubMed

Whittington, J; Holland, A; Webb, T; Butler, J; Clarke, D; Boer, H

2004-02-01

Prader-Willi syndrome (PWS) is characterized by extreme floppiness at birth, impaired sexual development, short stature, severe over-eating, characteristic physical features and learning disabilities (LD). Impaired social cognition, literal mindedness and cognitive inflexibility are also present. The syndrome has two main genetic subtypes that both result in the failure of expression of maternally imprinted genes on chromosome 15 at the locus q11-13. Through multiple sources, we attempted to identify all people with PWS living in one health region in the UK. Additional people with PWS identified in other regions were also recruited to augment the study sample. A comparison group of people with LD as a result of aetiologies other than PWS was also identified. All people from these three groups, over age three, who gave their consent, were assessed using tests of ability and attainment. In addition, their main carers were interviewed using a semistructured interview. Blood samples for genetic diagnosis were obtained from all consenting participants. The IQ distribution of the population sample was approximately normal with a mean IQ 40 points below that of the general population. There were systematic differences between the two main genetic subtypes. Those with disomies differed in cognitive profiles from both those with deletions and the comparison LD group (the latter two groups were very similar) in terms of better verbal abilities and impaired coding ability. Some people with PWS deletions had strong visuospatial skills. We propose that the normal distribution of IQ, shifted downwards relative to that of the general population, is the result of a global effect on IQ of the PWS gene(s), and that the different cognitive profile seen in those with chromosome 15 maternal disomies is a specific effect of a gene, or genes, on chromosome 15 which is differentially either expressed or not expressed in those with disomies relative to those with deletions. One hypothesis is that these subtle cognitive differences are a manifestation of the genetic influences of gender-specific imprinted genes on cerebral lateralization. This requires further investigation.

Mcm2 deficiency results in short deletions allowing high resolution identification of genes contributing to lymphoblastic lymphoma

PubMed Central

Rusiniak, Michael E.; Kunnev, Dimiter; Freeland, Amy; Cady, Gillian K.; Pruitt, Steven C.

2011-01-01

Mini-chromosome maintenance (Mcm) proteins are part of the replication licensing complex that is loaded onto chromatin during the G1-phase of the cell cycle and required for initiation of DNA replication in the subsequent S-phase. Mcm proteins are typically loaded in excess of the number of locations that are utilized during S-phase. Nonetheless, partial depletion of Mcm proteins leads to cancers and stem cell deficiencies. Mcm2 deficient mice, on a 129Sv genetic background, display a high rate of thymic lymphoblastic lymphoma. Here array comparative genomic hybridization (aCGH) is utilized to characterize the genetic damage accruing in these tumors. The predominant events are deletions averaging less than 0.5 Mb, considerably shorter than observed in prior studies using alternative mouse lymphoma models or human tumors. Such deletions facilitate identification of specific genes and pathways responsible for the tumors. Mutations in many genes that have been implicated in human lymphomas are recapitulated in this mouse model. These features, and the fact that the mutation underlying the accelerated genetic damage does not target a specific gene or pathway a priori, are valuable features of this mouse model for identification of tumor suppressor genes. Genes affected in all tumors include Pten, Tcfe2a, Mbd3 and Setd1b. Notch1 and additional genes are affected in subsets of tumors. The high frequency of relatively short deletions is consistent with elevated recombination between nearby stalled replication forks in Mcm2 deficient mice. PMID:22158038

Virus fitness differences observed between two naturally occurring isolates of Ebola virus Makona variant using a reverse genetics approach.

PubMed

Albariño, César G; Guerrero, Lisa Wiggleton; Chakrabarti, Ayan K; Kainulainen, Markus H; Whitmer, Shannon L M; Welch, Stephen R; Nichol, Stuart T

2016-09-01

During the large outbreak of Ebola virus disease that occurred in Western Africa from late 2013 to early 2016, several hundred Ebola virus (EBOV) genomes have been sequenced and the virus genetic drift analyzed. In a previous report, we described an efficient reverse genetics system designed to generate recombinant EBOV based on a Makona variant isolate obtained in 2014. Using this system, we characterized the replication and fitness of 2 isolates of the Makona variant. These virus isolates are nearly identical at the genetic level, but have single amino acid differences in the VP30 and L proteins. The potential effects of these differences were tested using minigenomes and recombinant viruses. The results obtained with this approach are consistent with the role of VP30 and L as components of the EBOV RNA replication machinery. Moreover, the 2 isolates exhibited clear fitness differences in competitive growth assays. Published by Elsevier Inc.