Scanning laser densitometry and color perimetry demonstrate reduced photopigment density and sensitivity in two patients with retinal degeneration.

PubMed

Tornow, R P; Stilling, R; Zrenner, E

1999-10-01

To test the feasibility of scanning laser densitometry with a modified Rodenstock scanning laser ophthalmoscope (SLO) to measure the rod and cone photopigment distribution in patients with retinal diseases. Scanning laser densitometry was performed using a modified Rodenstock scanning laser ophthalmoscope. The distribution of the photopigments was calculated from dark adapted and bleached images taken with the 514 nm laser of the SLO. This wavelength is absorbed by rod and cone photopigments. Discrimination is possible due to their different spatial distribution. Additionally, to measure retinal sensitivity profiles, dark adapted two color static perimetry with a Tübinger manual perimeter was performed along the horizontal meridian with 1 degree spacing. A patient with retinitis pigmentosa had slightly reduced photopigment density within the central +/- 5 degrees but no detectable photopigment for eccentricities beyond 5 degrees. A patient with cone dystrophy had nearly normal pigment density beyond +/- 5 degrees, but considerably reduced photopigment density within the central +/- 5 degrees. Within the central +/- 5 degrees, the patient with retinitis pigmentosa had normal sensitivity for the red stimulus and reduced sensitivity for the green stimulus. There was no measurable function beyond 7 degrees. The patient with cone dystrophy had normal sensitivity for the green stimulus outside the foveal center and reduced sensitivity for the red stimulus at the foveal center. The results of color perimetry for this patient with a central scotoma were probably influenced by eccentric fixation. Scanning laser densitometry with a modified Rodenstock SLO is a useful method to assess the human photopigment distribution. Densitometry results were confirmed by dark adapted two color static perimetry. Photopigment distribution and retinal sensitivity profiles can be measured with high spatial resolution. This may help to measure exactly the temporal development of retinal diseases and to test the success of different therapeutic treatments. Both methods have limitations at the present state of development. However, some of these limitations can be overcome by further improving the instruments.

Lung densitometry: why, how and when

PubMed Central

Camiciottoli, Gianna; Diciotti, Stefano

2017-01-01

Lung densitometry assesses with computed tomography (CT) the X-ray attenuation of the pulmonary tissue which reflects both the degree of inflation and the structural lung abnormalities implying decreased attenuation, as in emphysema and cystic diseases, or increased attenuation, as in fibrosis. Five reasons justify replacement with lung densitometry of semi-quantitative visual scales used to measure extent and severity of diffuse lung diseases: (I) improved reproducibility; (II) complete vs. discrete assessment of the lung tissue; (III) shorter computation times; (IV) better correlation with pathology quantification of pulmonary emphysema; (V) better or equal correlation with pulmonary function tests (PFT). Commercially and open platform software are available for lung densitometry. It requires attention to technical and methodological issues including CT scanner calibration, radiation dose, and selection of thickness and filter to be applied to sections reconstructed from whole-lung CT acquisition. Critical is also the lung volume reached by the subject at scanning that can be measured in post-processing and represent valuable information per se. The measurements of lung density include mean and standard deviation, relative area (RA) at −970, −960 or −950 Hounsfield units (HU) and 1st and 15th percentile for emphysema in inspiratory scans, and RA at −856 HU for air trapping in expiratory scans. Kurtosis and skewness are used for evaluating pulmonary fibrosis in inspiratory scans. The main indication for lung densitometry is assessment of emphysema component in the single patient with chronic obstructive pulmonary diseases (COPD). Additional emerging applications include the evaluation of air trapping in COPD patients and in subjects at risk of emphysema and the staging in patients with lymphangioleiomyomatosis (LAM) and with pulmonary fibrosis. It has also been applied to assess prevalence of smoking-related emphysema and to monitor progression of smoking-related emphysema, alpha1 antitrypsin deficiency emphysema, and pulmonary fibrosis. Finally, it is recommended as end-point in pharmacological trials of emphysema and lung fibrosis. PMID:29221318

Joint Official Positions of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®). Executive Summary of the 2010 Position Development Conference on Interpretation and use of FRAX® in clinical practice.

PubMed

Hans, Didier B; Kanis, John A; Baim, Sanford; Bilezikian, John P; Binkley, Neil; Cauley, Jane A; Compston, Juliet E; Cooper, Cyrus; Dawson-Hughes, Bess; El-Hajj Fuleihan, Ghada; Leslie, William D; Lewiecki, E Michael; Luckey, Marjorie M; McCloskey, Eugene V; Papapoulos, Socrates E; Poiana, Catalina; Rizzoli, René

2011-01-01

The International Society for Clinical Densitometry (ISCD) and the International Osteoporosis Foundation (IOF) convened the FRAX(®) Position Development Conference (PDC) in Bucharest, Romania, on November 14, 2010, following a two-day joint meeting of the ISCD and IOF on the "Interpretation and Use of FRAX(®) in Clinical Practice." These three days of critical discussion and debate, led by a panel of international experts from the ISCD, IOF and dedicated task forces, have clarified a number of important issues pertaining to the interpretation and implementation of FRAX(®) in clinical practice. The Official Positions resulting from the PDC are intended to enhance the quality and clinical utility of fracture risk assessment worldwide. Since the field of skeletal assessment is still evolving rapidly, some clinically important issues addressed at the PDCs are not associated with robust medical evidence. Accordingly, some Official Positions are based largely on expert opinion. Despite limitations inherent in such a process, the ISCD and IOF believe it is important to provide clinicians and technologists with the best distillation of current knowledge in the discipline of bone densitometry and provide an important focus for the scientific community to consider. This report describes the methodology and results of the ISCD-IOF PDC dedicated to FRAX(®). Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Simultaneous Feulgen densitometry and autoradiographic grain counting with the Quantimet 720D image-analysis system. III. Improvements in Feulgen densitometry.

PubMed

Sklarew, R J

1983-10-01

A method has been developed for densitometric estimation of the Feulgen-stained DNA content of 3H-labeled nuclei in autoradiographs in conjunction with automated grain counting using a Quantimet Imaging System. Refinements in the methodology are reported which include 1) the incorporation of an Image-Editor Module into the Quantimet module configuration; 2) the optimization of incident illumination based upon evaluation of various light sources; 3) changes in the optical configuration which reduce glare and minimize the level of monitor shading correction; 4) the optimization of scanner sensitivity; and 5) the evaluation of cell-flattening and staining with respect to densitometry resolution and sensitivity. These refinements resulted in a CV of less than 6.4% in the G-1 and G-2 DNA peaks of rat kidney cells in autoradiographs compared to the previous CV of 10.5%, and a G-2 to G-1 ratio of 2.025. For a fixed field position the CV was 5.1% and the replication error less than 1.0%.

Changes in Astigmatism, Densitometry, and Aberrations After SMILE for Low to High Myopic Astigmatism: A 12-Month Prospective Study.

PubMed

Pedersen, Iben Bach; Ivarsen, Anders; Hjortdal, Jesper

2017-01-01

To evaluate 12-month changes in refraction, visual outcome, corneal densitometry, and postoperative aberrations after small incision lenticule extraction (SMILE) for myopic astigmatism. This 12-month prospective clinical trial comprised 101 eyes (101 patients) treated with SMILE for myopic astigmatism with cylinder of 0.75 to 4.00 diopters (D). The preoperative, 1-week, and 1-, 3-, 6-, 9-, and 12-month examinations included measurement of manifest refraction, uncorrected distance visual acuity (UDVA), and corrected (CDVA) distance visual acuity. Astigmatic error vector analysis was performed using Al-pin's method. Densitometry and aberrations were evaluated with Pentacam HR (Oculus Optikgeräte, Wetzlar, Germany). Preoperative spherical equivalent averaged -6.78 ± 1.90 D with 1.81 ± 1.00 D in cylinder correction. After 12 months, 74% and 93% of the eyes were within ±0.50 and ±1.00 D of the attempted refraction, respectively. The logMAR UDVA and CDVA averaged 0.03 ± 0.16 and -0.08 ± 0.09, respectively. Vector analysis showed a with-the-rule undercorrection at 12 months with a mean difference vector of 0.31 D @ 91°. There was a minor counterclockwise rotation of the axis, with an arithmetic angle of error of 0.34° ± 14°. An undercorrection of approximately 11% per diopter of attempted correction was seen at 12 months. Spherical aberrations, coma, and higher order aberrations remained stable during the postoperative period (P < .09). After 12 months, no increase in densitometry could be identified. Treatment of astigmatism with SMILE seems to be predictable and effective, but with an astigmatic undercorrection of approximately 11% and a small counterclockwise rotation of the axis. [J Refract Surg. 2017;33(1):11-17.]. Copyright 2017, SLACK Incorporated.

The usefulness of densitometry in predicting the composition and fragility of urolithiasis.

PubMed

Argüelles-Salido, Enrique; Lozano-Blasco, Jose Maria; Subira-Rios, Jorge; Bernardo-Villar, Pastora; Podio-Lora, Virtudes; Campoy-Martínez, Pedro; Vazquez-Albertino, Ricardo; Medina-Lopez, Rafael

2014-04-01

The choice of ideal treatment for a given lithiasis is a crucial factor for its success, minimizing the number of interventions and complications. Previous determination of stone composition and its fragility is desirable, to predict its behavior during extracorporeal shock wave lithotripsy and for evaluation of its appropriateness, or to set the indication for other techniques. To determine the role of densitometry in the prediction of composition and fragility of urinary lithiasis undergoing SWL. Experimental prospective, blinded, in vitro study using 193 urinary calculi of known composition : monohydrated calcium oxalate, mixed calcium oxalate, uric acid, and calcium carbonate, obtained from spontaneous passage or surgery. Densitometry and SWL were performed on them. We compare the mineral composition of the stone and mineral density of each composition group to check if they are characteristic of each type and correlate these parameters with the energy dose required to fragment them down to a given fragment size. Only 53 out of 193 stones showed valuable data. Calcium carbonate was the composition showing grater mineral content and density (1,24 gr and 0,47 gr/cm2), followed by mixed oxalate (0,51/0,26) and uric acid (0,52/ 0,15), finishing with the monohydrate calcium oxalate group (0,32/0,05).Only the comparison between calcium carbonate and monohydrated calcium oxalate showed statistically significant results (p<0,05). Correlation coefficients between mineral content (0,347) and density (0,424) and the energy used for stone fragmentation to a given fragment size were statistically significant (p<0,05) CONCLUSIONS: In our study, the use of densitometry to determine stone composition and lithiasic fragility did not show conclusive results due to the limited number of calculi tested. Nevertheless, there are signs that, with a different study design , more practically useful results could be achieved.

Neutron Resonance Densitometry for Particle-like Debris of Melted Fuel

NASA Astrophysics Data System (ADS)

Harada, H.; Kitatani, F.; Koizumi, M.; Takamine, J.; Kureta, M.; Tsutiya, H.; Iimura, H.; Seya, M.; Becker, B.; Kopecky, S.; Schillebeeckx, P.

2014-04-01

Neutron Resonance Densitometry (NRD) is proposed for the quantification of nuclear materials in particle-like debris of melted fuel from the reactors of the Fukushima Daiichi nuclear power plant. The method is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). It uses the neutron time-of-flight (TOF) technique with a pulsed white neutron source and a neutron flight path as short as 5 m. The spectrometer for NRCA is made of LaBr3(Ce) detectors. The achievable uncertainty due to only counting statistics is less than 1 % to determine Pu and U isotopes.

Seasonal vegetation differences from ERTS imagery

NASA Technical Reports Server (NTRS)

Ashley, M. D.; Rea, J.

1975-01-01

Knowledge of the times when crop and forest vegetation experience seasonally related changes in development is important in understanding growth and yield relationships. This article describes how densitometry of earth resources technology satellite (ERTS-1) multispectral scanner (MSS) imagery can be used to identify such phenological events. Adjustments for instrument calibration, aperture size, gray-scale differences between overpasses, and normalization of changing solar elevation are considered in detail. Seasonal vegetation differences can be identified by densitometry of band 5 (0.6-0.7 microns) and band 7 (0.8-1.1 microns) MSS imagery. Band-to-band ratios of the densities depicted the changes more graphically than the individual band readings.

Comparison of instruments for dual-energy X-ray bone mineral densitometry.

PubMed

Vainio, P; Ahonen, E; Leinonen, K; Sievänen, H; Koski, E

1992-04-01

While bone mineral densitometry has become a common laboratory test, it is important to pay attention to the compatibility of the results from different instruments. In this study results from three commercially available bone densitometers are compared using both patient and phantom studies. Overall correlation between instruments was good but there were systematic discrepancies in the results. The three instruments provided bone mineral density (BMD) values that differed by as much as 13.5% due to differences as large as 6% in bone mineral content and as large as 7% in bone area. Thus, the BMD values obtained from different manufacturers' instruments are not directly comparable.

Chlorogenic acid content, essential oil compositions, and in vitro antioxidant activities of Chromolaena odorata leaves

PubMed Central

Pitakpawasutthi, Yamon; Thitikornpong, Worathat; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2016-01-01

Chromolaena odorata (L.) R. M. King and H. Rob. is a Thai medicinal plant used for the treatment of wounds, rashes, diabetes, and insect repellent. The leaves of C. odorata were collected from 10 different sources throughout Thailand. The chemical constituents of essential oils were hydro-distilled from the leaves and were analyzed by gas chromatography-mass spectrometry. Chlorogenic acid contents were determined by thin-layer chromatography (TLC) - densitometry with winCATS software and TLC image analysis with ImageJ software. The TLC plate was developed in the mobile phase that consisted of ethyl acetate:water:formic acid (17:3:2). Antioxidant activities were examined by 1,1-diphenyl-2-picryl hydrazyl (DPPH) radical scavenging and β-carotene bleaching assays. C. odorata essential oil has shown the major components of pregeijerene, dauca-5, 8-diene, (E)-caryophyllene, β-pinene, and α-pinene. The chlorogenic acid content of C. odorata leaves was determined by TLC-densitometry and TLC image analysis. Results have shown that TLC-densitometry and TLC image analysis method were not statistically significantly different. DPPH radical scavenging and β-carotene bleaching assays of ethanolic extract of C. odorata leaves showed its antioxidant potential. PMID:27144150

Accommodating brightness and exposure levels in densitometry of stained polyacrylamide electrophoresis gels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, Han Yen; Ng, Tuck Wah; Liew, Oi Wah

2010-03-20

Flatbed scanner densitometers can be operated under various illumination and recording exposure levels. In this work, we show that optical density measurement accuracy, sensitivity, and stability of stained polyacrylamide electrophoresis gel densitometry are crucially dependent on these two factors (brightness and exposure level), notwithstanding that the source is monochromatic, spatially uniform, and the measurements are made using an accurately calibrated step wedge in tandem. We further outline a method to accommodate the intensity deviations over a range of illumination and exposure levels in order to maintain sensitivity and repeatability in the computed optical densities. Comparisons were also made with resultsmore » from a commercial densitometer.« less

Using bone densitometry to monitor therapy in treating osteoporosis: pros and cons.

PubMed

Deal, C L

2001-06-01

Measurement of bone density is crucial for evaluating fracture risk. Low bone mass is a powerful predictor of fracture and is necessary to assess the need for treatment. Dual energy x-ray absorptiometry is accurate and precise. Use of bone density for monitoring therapy is an important tool for evaluating response to therapy, but an understanding of the limitations of the procedure are important for the practicing physician. Precision error of the technology and what change in density is clinically significant (least significant change) are important concepts to interpret results and make appropriate treatment decisions. This article reviews the use of bone densitometry as a tool for monitoring treatment in patients with low bone mass.

[Evaluation of bone mineral density in children with sickle cell disease].

PubMed

Garrido Colino, C; Beléndez Bieler, C; Pérez Díaz, M; Cela de Julián, E

2015-04-01

To evaluate bone mineral density (BMD) in children with sickle cell disease (SCD) in the Community of Madrid. The BMD was estimated in 40 children with SCD, and with an age range between 3 and 16 years, using densitometry (DXA), as recommended by the International Society for Clinical Densitometry (ISCD). The mean age at the time of the study was 7.97±3.95 years, the mean value of the DXA expressed in Z -score was -0.91±1.46 with a range of minimum values - 5.30 and 2.30 maximum. More than half (57.5%) of all the children had normal BMD (Z>-1), 25% had low BMD (Z between -1 and -2), and 17.5% showed an abnormal Z -score values of osteoporosis (Z -score<-2). The Pearson linear correlation was statistically significant between Z -score value and the haemoglobin level (r=0.368, p=.019), finding no correlation with the levels of 25 (OH) vitamin D. Prospective studies are needed with a larger number of patients to understand the future implications of bone densitometry changes and associated risk factors. Copyright © 2013 Asociación Española de Pediatría. Published by Elsevier España, S.L.U. All rights reserved.

A systematic quality assurance study in bone densitometry devices

NASA Astrophysics Data System (ADS)

Tuncman, Duygu; Kovan, Hatice; Kovan, Bilal; Demir, Bayram; Turkmen, Cuneyt

2015-07-01

Osteoporosis is the most common metabolic bone disease and can result in devastating physical, psychosocial, and economic consequences. It occurs in women after menopause and affects most elderly. Dual-energy x-ray absorptiometry (DXA) is currently the most widely used method for the measurement of areal Bone Mineral Density (BMD) (g/cm2) .DXA is based on the variable absorption of X-ray by the different body components and uses high and low energy X-ray photons. There are two important values in the assessment of the DXA. These values are T-score and Z-score. The T-score is calculated by taking the difference between a patient's measured BMD with the mean BMD of the young normal population, matched for gender and ethnicity, and then by dividing the difference with the standard deviation (SD) of the BMD of the young normal population. T-score and also Z-score are directly depends on the Bone Mineral Density (BMD). BMD measurements should be made periodically in a patient life. But mostly, it is not possible with the same device. Therefore, in this study, for the quality assurance of bone densitometry devices, we evaluated the BMD results measured in the different Bone Densitometry (DXA) devices using a spine phantom.

Estimating Body Composition in Adolescent Sprint Athletes: Comparison of Different Methods in a 3 Years Longitudinal Design

PubMed Central

Aerenhouts, Dirk

2015-01-01

A recommended field method to assess body composition in adolescent sprint athletes is currently lacking. Existing methods developed for non-athletic adolescents were not longitudinally validated and do not take maturation status into account. This longitudinal study compared two field methods, i.e., a Bio Impedance Analysis (BIA) and a skinfold based equation, with underwater densitometry to track body fat percentage relative to years from age at peak height velocity in adolescent sprint athletes. In this study, adolescent sprint athletes (34 girls, 35 boys) were measured every 6 months during 3 years (age at start = 14.8 ± 1.5yrs in girls and 14.7 ± 1.9yrs in boys). Body fat percentage was estimated in 3 different ways: 1) using BIA with the TANITA TBF 410; 2) using a skinfold based equation; 3) using underwater densitometry which was considered as the reference method. Height for age since birth was used to estimate age at peak height velocity. Cross-sectional analyses were performed using repeated measures ANOVA and Pearson correlations between measurement methods at each occasion. Data were analyzed longitudinally using a multilevel cross-classified model with the PROC Mixed procedure. In boys, compared to underwater densitometry, the skinfold based formula revealed comparable values for body fatness during the study period whereas BIA showed a different pattern leading to an overestimation of body fatness starting from 4 years after age at peak height velocity. In girls, both the skinfold based formula and BIA overestimated body fatness across the whole range of years from peak height velocity. The skinfold based method appears to give an acceptable estimation of body composition during growth as compared to underwater densitometry in male adolescent sprinters. In girls, caution is warranted when interpreting estimations of body fatness by both BIA and a skinfold based formula since both methods tend to give an overestimation. PMID:26317426

Effect of chronic smoking on lens nucleus as assessed by Pentacam HR lens densitometry in young adults.

PubMed

Pekel, Gökhan; Cetin, Ebru Nevin; Acer, Semra; Yagci, Ramazan; Altintas, Seher; Ongun, Gülin Tugba

2014-06-01

To evaluate the effects of chronic tobacco smoking on lens nucleus by Pentacam HR lens densitometry (LD) in young adults. Prospective cross-sectional case series. Thirty subjects (23 M, 7 F) who were chronic cigarette smokers (≥10 cigarettes/day for at least 2 years) (group 1) and another 30 subjects (23 M, 7 F) who did not smoke (group 2), were included in this study. The patients were matched for age and sex between the groups. The exclusion criteria were any history of ocular surgery, any systemic disorders and any ocular diseases except for mild refractive disorders. Lens densitometry measurements were done with the Pentacam HR (Oculus, Wetzlar, Germany). The Schirmer test and pachymetry measurements were also performed. Mean age of the patients for both groups was 28.90 ± 8.20 years (range: 18-40 years). Mean lens densitometry (LD) measurements of Group 1 (chronic cigarette smoking group) were higher than those of Group 2 (control group) in all LD techniques; however only mean "peak" LD measurements showed a statistically significant difference between these two groups (Group 1: 8.67 ± 0.61, Group 2: 8.44 ± 0.70, p = 0.04). The mean Schirmer test value was 12.43 ± 5.60 mm in Group 1 and 13.00 ± 4.26 mm in Group 2 (p = 0.55). The mean central corneal thickness (CCT) value was 564.23 ± 34.61 µm in Group 1 and 550.47 ± 32.94 µm in Group 2 (p = 0.03). The Pentacam HR LD seems to be an important option for the evaluation of lens nucleus in young adults, because it gives objective and quantitative data. Although chronic smoking increases lens nucleus density in young adults, the effect is not statistically significant when compared with the control group.

Quantitative coronary angiography using image recovery techniques for background estimation in unsubtracted images

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wong, Jerry T.; Kamyar, Farzad; Molloi, Sabee

2007-10-15

Densitometry measurements have been performed previously using subtracted images. However, digital subtraction angiography (DSA) in coronary angiography is highly susceptible to misregistration artifacts due to the temporal separation of background and target images. Misregistration artifacts due to respiration and patient motion occur frequently, and organ motion is unavoidable. Quantitative densitometric techniques would be more clinically feasible if they could be implemented using unsubtracted images. The goal of this study is to evaluate image recovery techniques for densitometry measurements using unsubtracted images. A humanoid phantom and eight swine (25-35 kg) were used to evaluate the accuracy and precision of the followingmore » image recovery techniques: Local averaging (LA), morphological filtering (MF), linear interpolation (LI), and curvature-driven diffusion image inpainting (CDD). Images of iodinated vessel phantoms placed over the heart of the humanoid phantom or swine were acquired. In addition, coronary angiograms were obtained after power injections of a nonionic iodinated contrast solution in an in vivo swine study. Background signals were estimated and removed with LA, MF, LI, and CDD. Iodine masses in the vessel phantoms were quantified and compared to known amounts. Moreover, the total iodine in left anterior descending arteries was measured and compared with DSA measurements. In the humanoid phantom study, the average root mean square errors associated with quantifying iodine mass using LA and MF were approximately 6% and 9%, respectively. The corresponding average root mean square errors associated with quantifying iodine mass using LI and CDD were both approximately 3%. In the in vivo swine study, the root mean square errors associated with quantifying iodine in the vessel phantoms with LA and MF were approximately 5% and 12%, respectively. The corresponding average root mean square errors using LI and CDD were both 3%. The standard deviations in the differences between measured iodine mass in left anterior descending arteries using DSA and LA, MF, LI, or CDD were calculated. The standard deviations in the DSA-LA and DSA-MF differences (both {approx}21 mg) were approximately a factor of 3 greater than that of the DSA-LI and DSA-CDD differences (both {approx}7 mg). Local averaging and morphological filtering were considered inadequate for use in quantitative densitometry. Linear interpolation and curvature-driven diffusion image inpainting were found to be effective techniques for use with densitometry in quantifying iodine mass in vitro and in vivo. They can be used with unsubtracted images to estimate background anatomical signals and obtain accurate densitometry results. The high level of accuracy and precision in quantification associated with using LI and CDD suggests the potential of these techniques in applications where background mask images are difficult to obtain, such as lumen volume and blood flow quantification using coronary arteriography.« less

Bone mineral density test

MedlinePlus

... density test; Bone densitometry; DEXA scan; DXA; Dual-energy x-ray absorptiometry; p-DEXA; Osteoporosis - BMD ... most common and accurate way uses a dual-energy x-ray absorptiometry (DEXA) scan. DEXA uses low- ...

Osteoporosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riggs, B.L. Melton III, L.J.

This book contains 20 chapters. Some of the titles are: Radiology of asteoporosis; Quantitative computed tomography in assessment of osteoporosis; Nuclear medicine and densitometry; Assessment of bone turnover by histormorphometry in osteoporosis; and The biochemistry of bone.

[Computed tomography semiotics of osteonecrosis and sequestration in chronic hematogenic osteomyelitis].

PubMed

D'iachkova, G V; Mitina, Iu L

2007-01-01

Based on the data of computed tomography, radiography and densitometry in 39 patients the authors describe in detail the signs of osteonecrosis and sequestration of different localization and extension.

76 FR 55069 - Government-Owned Inventions; Availability for Licensing

Federal Register 2010, 2011, 2012, 2013, 2014

2011-09-06

... health problem primarily affecting the elderly and women after menopause. More specifically, the... automated bone mineral densitometry in a single examination. J Comput Assist Tomogr. 2011 Mar- Apr;35(2):212...

Rapidly assessing changes in bone mineral balance using natural stable calcium isotopes

PubMed Central

Morgan, Jennifer L. L.; Skulan, Joseph L.; Gordon, Gwyneth W.; Romaniello, Stephen J.; Smith, Scott M.; Anbar, Ariel D.

2012-01-01

The ability to rapidly detect changes in bone mineral balance (BMB) would be of great value in the early diagnosis and evaluation of therapies for metabolic bone diseases such as osteoporosis and some cancers. However, measurements of BMB are hampered by difficulties with using biochemical markers to quantify the relative rates of bone resorption and formation and the need to wait months to years for altered BMB to produce changes in bone mineral density large enough to resolve by X-ray densitometry. We show here that, in humans, the natural abundances of Ca isotopes in urine change rapidly in response to changes in BMB. In a bed rest experiment, use of high-precision isotope ratio MS allowed the onset of bone loss to be detected in Ca isotope data after about 1 wk, long before bone mineral density has changed enough to be detectable with densitometry. The physiological basis of the relationship between Ca isotopes and BMB is sufficiently understood to allow quantitative translation of changes in Ca isotope abundances to changes in bone mineral density using a simple model. The rate of change of bone mineral density inferred from Ca isotopes is consistent with the rate observed by densitometry in long-term bed rest studies. Ca isotopic analysis provides a powerful way to monitor bone loss, potentially making it possible to diagnose metabolic bone disease and track the impact of treatments more effectively than is currently possible. PMID:22652567

Modifying a Rodenstock scanning laser ophthalmoscope for imaging densitometry.

PubMed

Tornow, R P; Beuel, S; Zrenner, E

1997-08-01

The necessary modifications and technical requirements are described for using a commercially available scanning laser ophthalmoscope (Rodenstock Model 101 SLO) as an imaging densitometer to assess human photopigment distribution. The main requirements are a linear detector amplifier, fast shutters for the laser beams, and a trigger unit. Images must be compensated for varying laser intensity. Both rod and cone photopigments are measured with the 514-nm argon laser of the SLO. Discrimination is possible owing to the different spatial distribution. The cone pigment density peaks in the foveal center (D = 0.40) with a steep decrease with increasing eccentricity E (full width at half-maximum, 2.5 degrees ). Rod photopigment increases with increasing eccentricity (D = 0.23 for E = 11 degrees ). These values are in agreement with previous reported results obtained with scanning laser ophthalmoscopes specially designed for retinal densitometry and high stability.

Alternative light source (polilight) illumination with digital image analysis does not assist in determining the age of bruises.

PubMed

Hughes, V K; Ellis, P S; Langlois, N E I

2006-05-10

The age of a bruise may be of interest to forensic investigators. Previous research has demonstrated that an alternative light source may assist in the visualisation of faint or non-visible bruises. This project aimed to determine if an alternative light source could be utilised to assist investigators estimate the age of a bruise. Forty braises, sustained from blunt force trauma, were examined from 30 healthy subjects. The age of the bruises ranged from 2 to 231 h (mean = 74.6, median = 69.0). Alternative light source (polilight) illumination at 415 and 450 nm was used. The black and white photographs obtained were assessed using densitometry. A statistical analysis indicated that there was no correlation between time and the mean densitometry values. The alternative light source used in this study was unable to assist in determining the age of a bruise.

Determination of Flavonoids, Phenolic Acids, and Xanthines in Mate Tea (Ilex paraguariensis St.-Hil.)

PubMed Central

Bojić, Mirza; Simon Haas, Vicente; Maleš, Željan

2013-01-01

Raw material, different formulations of foods, and dietary supplements of mate demands control of the content of bioactive substances for which high performance thin layer chromatography (TLC), described here, presents simple and rapid approach for detections as well as quantification. Using TLC densitometry, the following bioactive compounds were identified and quantified: chlorogenic acid (2.1 mg/g), caffeic acid (1.5 mg/g), rutin (5.2 mg/g), quercetin (2.2 mg/g), and kaempferol (4.5 mg/g). The results obtained with TLC densitometry for caffeine (5.4 mg/g) and theobromine (2.7 mg/g) show no statistical difference to the content of total xanthines (7.6 mg/g) obtained by UV-Vis spectrophotometry. Thus, TLC remains a technique of choice for simple and rapid analysis of great number of samples as well as a primary screening technique in plant analysis. PMID:23841023

Changes in Corneal Density After Accelerated Corneal Collagen Cross-linking With Different Irradiation Intensities and Energy Exposures: 1-Year Follow-up.

PubMed

Akkaya Turhan, Semra; Toker, Ebru

2017-11-01

To determine and compare the changes in corneal density after 2 different protocols of accelerated corneal collagen cross-linking (A-CXL) in patients with progressive keratoconus. Two groups of eyes received A-CXL treatment; 20 eyes received A-CXL using continuous UVA light exposure at 9 mW/cm for 10 minutes with a total energy dose of 5.4 J/cm, and 24 eyes received A-CXL using continuous UVA light exposure at 30 mW/cm for 4 minutes with a total energy dose of 7.2 J/cm. Corneal density was measured with Scheimpflug tomography at 1, 3, 6, and 12 months of follow-up. Densitometry peaked at 1 month (mean: 16.34 ± 3.80, P = 0.006, 9-mW/cm A-CXL; mean: 20.90 ± 2.81, P < 0.0001, 30-mw/cm A-CXL) in both groups, and it decreased over time in 30-mW/cm A-CXL. However, in 9-mW/cm A-CXL, increased corneal densitometry plateaued until 6 months postoperatively and started to decrease thereafter. Densitometry completely returned to baseline after 12 months in both groups. The mean change in density at 1- and 3-month follow-up was higher in the 30-mW A-CXL group than in the 9-mW A-CXL group (P = 0.003, P = 0.044; respectively). High-energy exposure tends to induce more haze in the early posttreatment period, but it is reversible.

Densitometric and biochemical values of broiler tibias at different ages.

PubMed

Barreiro, F R; Sagula, A L; Junqueira, O M; Pereira, G T; Baraldi-Artoni, S M

2009-12-01

The objective of this experiment was to determine the normal values of bone radiographic density (BRD) by using the optical densitometry in radiographic images and the biochemical values represented by serum calcium, ash percentage, and minerals (calcium, phosphorus, and magnesium) from tibia ash of Cobb broilers at 8, 22, and 43 d of age. A total of 14 broilers were used for densitometric analysis, and 15 were used for biochemical dosages. The BRD values increased (P < 0.05) with age and in all tibia regions (proximal epiphysis, diaphysis, and distal epiphysis), concluding that growth was a determinative factor for bone performance, demanding a higher BRD during broiler development. Tibia proximal epiphysis presented higher BRD values in relation to the other bone regions (P < 0.05), as a result of a possible biomechanical adaptation to ligaments and tension of the muscle tendons at this region, allowing the support of the muscle mass increase. The serum calcium values were kept constant, as a result of the appropriate nutritional levels of the diet that supported the animal homeostasis. The bone ash and mineral percentage increased (P < 0.05) at 22 d of age, due to the higher mineral requirement in this age. The correlation between bone densitometry and the invasive techniques showed that the bone densitometry can substitute the determination of mineral percentage in the ash. This experiment presented normal values of the noninvasive and invasive methods more used in aviculture, allowing us to compare, subsequently, pathological and physiological values or results of broilers fed with different diets.

New Wrinkles in Retinal Densitometry

PubMed Central

Masella, Benjamin D.; Hunter, Jennifer J.; Williams, David R.

2014-01-01

Purpose. Retinal densitometry provides objective information about retinal function. But, a number of factors, including retinal reflectance changes that are not directly related to photopigment depletion, complicate its interpretation. We explore these factors and suggest a method to minimize their impact. Methods. An adaptive optics scanning light ophthalmoscope (AOSLO) was used to measure changes in photoreceptor reflectance in monkeys before and after photopigment bleaching with 514-nm light. Reflectance measurements at 514 nm and 794 nm were recorded simultaneously. Several methods of normalization to extract the apparent optical density of the photopigment were compared. Results. We identified stimulus-related fluctuations in 794-nm reflectance that are not associated with photopigment absorptance and occur in both rods and cones. These changes had a magnitude approaching those associated directly with pigment depletion, precluding the use of infrared reflectance for normalization. We used a spatial normalization method instead, which avoided the fluctuations in the near infrared, as well as a confocal AOSLO designed to minimize light from layers other than the receptors. However, these methods produced a surprisingly low estimate of the apparent rhodopsin density (animal 1: 0.073 ± 0.006, animal 2: 0.032 ± 0.003). Conclusions. These results confirm earlier observations that changes in photopigment absorption are not the only source of retinal reflectance change during dark adaptation. It appears that the stray light that has historically reduced the apparent density of cone photopigment in retinal densitometry arises predominantly from layers near the photoreceptors themselves. Despite these complications, this method provides a valuable, objective measure of retinal function. PMID:25316726

Physician visits and preventive care among Asian American and Pacific Islander long-term survivors of colorectal cancer, USA, 1996-2006.

PubMed

Steele, C Brooke; Townsend, Julie S; Tai, Eric; Thomas, Cheryll C

2014-03-01

Published literature on receipt of preventive healthcare services among Asian American and Pacific Islander (API) cancer survivors is scarce. We describe patterns in receipt of preventive services among API long-term colorectal cancer (CRC) survivors. Surveillance, Epidemiology, and End Results registry-Medicare data were used to identify 9,737 API and white patients who were diagnosed with CRC during 1996-2000 and who survived 5 or more years beyond their diagnoses. We examined receipt of vaccines, mammography (females), bone densitometry (females), and cholesterol screening among the survivors and how the physician specialties they visited for follow-up care correlated to services received. APIs were less likely than whites to receive mammography (52.0 vs. 69.3 %, respectively; P < 0.0001) but more likely to receive influenza vaccine, cholesterol screening, and bone densitometry. These findings remained significant in our multivariable model, except for receipt of bone densitometry. APIs visited PCPs only and both PCPs and oncologists more frequently than whites (P < 0.0001). Women who visited both PCPs and oncologists compared with PCPs only were more likely to receive mammography (odds ratio = 1.40; 95 % confidence interval, 1.05-1.86). Visits to both PCPs and oncologists were associated with increased use of mammography. Although API survivors visited these specialties more frequently than white survivors, API women may need culturally appropriate outreach to increase their use of this test. Long-term cancer survivors need to be aware of recommended preventive healthcare services, as well as who will manage their primary care and cancer surveillance follow-up.

Official Positions for FRAX® Bone Mineral Density and FRAX® simplification from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A; Moayyeri, Alireza; Adler, Robert A; Hans, Didier B; Kendler, David L; Diez-Perez, Adolfo; Krieg, Marc-Antoine; Masri, Basel K; Lorenc, Roman R; Bauer, Douglas C; Blake, Glen M; Josse, Robert G; Clark, Patricia; Khan, Aliya A

2011-01-01

Tools to predict fracture risk are useful for selecting patients for pharmacological therapy in order to reduce fracture risk and redirect limited healthcare resources to those who are most likely to benefit. FRAX® is a World Health Organization fracture risk assessment algorithm for estimating the 10-year probability of hip fracture and major osteoporotic fracture. Effective application of FRAX® in clinical practice requires a thorough understanding of its limitations as well as its utility. For some patients, FRAX® may underestimate or overestimate fracture risk. In order to address some of the common issues encountered with the use of FRAX® for individual patients, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) assigned task forces to review the medical evidence and make recommendations for optimal use of FRAX® in clinical practice. Among the issues addressed were the use of bone mineral density (BMD) measurements at skeletal sites other than the femoral neck, the use of technologies other than dual-energy X-ray absorptiometry, the use of FRAX® without BMD input, the use of FRAX® to monitor treatment, and the addition of the rate of bone loss as a clinical risk factor for FRAX®. The evidence and recommendations were presented to a panel of experts at the Joint ISCD-IOF FRAX® Position Development Conference, resulting in the development of Joint ISCD-IOF Official Positions addressing FRAX®-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The microcomputer in cell and neurobiology research

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mize, R.R.

1985-01-01

This book contains 21 chapters. They are divided into the following sections: The Microcomputer as a Research Tool, Microcomputer Uses in Light and Electron Microscopy, Microcomputer Uses in Morphometry, Serial Section Reconstruction, Microcomputer Uses in Imaging and Densitometry, and Microcomputer Uses in Electrophysiology.

Assessment of liver volume with computed tomography and comparison of findings with ultrasonography.

PubMed

Bora, Aydın; Alptekin, Cem; Yavuz, Alpaslan; Batur, Abdussamet; Akdemir, Zülküf; Berköz, Mehmet

2014-12-01

In this study, we aimed to investigate the impact of non-alcoholic hepatic steatosis on the liver volume. As investigating hepatic steatosis, we utilized computed tomography (CT) to determine the degree of steatosis and we utilized hepatobiliary ultrasonography (USG) for densitometry and correlation. As hepatosteatosis group, 35 patients over 18 years of age and whose abdominal CT scans were requested by several clinics and performed routinely were included in this study, and as control group, 40 healthy subjects without hepatosteatosis (clinically and radiologically) and correlated with hepatosteatosis group in terms of age and gender were included in this study. CT densitometry and liver attenuation index (LAI) of all individuals who participated in our study were calculated, and contrast images of patients were transferred to CT-Volume Software (Siemens Syngo Multimodality Workplace; Version VE52A). In this study, interactive and automated volume measurement techniques were used together. The volumes were measured separately in patient and control group. In this study for each stage in USG, there was found a direct correlation in terms of LAI and volume, and this correlation was statistically significant (p < 0.01). Furthermore, statistical significance between size and USG stage draws attention (p < 0.05). A significance relationship between USG stage and age could not be determined. As a result, we have reached the conclusion that CT densitometry can be used as an assistive technique along with USG to determine the degree of steatosis in the non-alcoholic fatty liver disease, and there is a positive linear correlation between the liver size and volume, and liver volume increases in the non-alcoholic fatty liver disease.

FRAX(®) Bone Mineral Density Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

Lewiecki, E Michael; Compston, Juliet E; Miller, Paul D; Adachi, Jonathan D; Adams, Judith E; Leslie, William D; Kanis, John A

2011-01-01

FRAX(®) is a fracture risk assessment algorithm developed by the World Health Organization in cooperation with other medical organizations and societies. Using easily available clinical information and femoral neck bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA), when available, FRAX(®) is used to predict the 10-year probability of hip fracture and major osteoporotic fracture. These values may be included in country specific guidelines to aid clinicians in determining when fracture risk is sufficiently high that the patient is likely to benefit from pharmacological therapy to reduce that risk. Since the introduction of FRAX(®) into clinical practice, many practical clinical questions have arisen regarding its use. To address such questions, the International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundations (IOF) assigned task forces to review the best available medical evidence and make recommendations for optimal use of FRAX(®) in clinical practice. Questions were identified and divided into three general categories. A task force was assigned to investigating the medical evidence in each category and developing clinically useful recommendations. The BMD Task Force addressed issues that included the potential use of skeletal sites other than the femoral neck, the use of technologies other than DXA, and the deletion or addition of clinical data for FRAX(®) input. The evidence and recommendations were presented to a panel of experts at the ISCD-IOF FRAX(®) Position Development Conference, resulting in the development of ISCD-IOF Official Positions addressing FRAX(®)-related issues. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Preventive Care Screening in the Puerto Rican Geriatric Population: A Formative Evaluation of Patient Knowledge.

PubMed

Sepúlveda-Rivera, Vanessa; Donato-Santana, Christian; Diaz-Vega, Gil

2017-12-01

This study was meant to be the first step in bridging a gap in the literature concerning Puerto Rican geriatric patients' levels of knowledge concerning 4 preventive care screening tests: mammography, bone densitometry, colonoscopy, and lipid panels. Patients 65 years old and older were interviewed at the University of Puerto Rico (UPR), Medical Sciences Campus, primary care clinics. Fisher's exact test was used to assess knowledge status for each screening test. Fifty-three participants, 53% being women, took part in the study. All the women (100%) reported having knowledge about mammography screening as well as about bone densitometry scans (71%); 91% of the participants reported having knowledge concerning colonoscopy. Only 34% understood what information results from a lipid panel. The majority of the participants were not aware of precisely when each of the screening tests under discussion should be undertaken. For all the screenings, level of education and provider recommendation were associated with increased levels of knowledge (though statistically significant only for bone densitometry and lipid panels). Elderly Puerto Ricans appear to have knowledge about screening tests; however, there is an overall lack of knowledge about the timing of screening. Risk factors for this lack of knowledge are having a relatively lower level of education, the lack of healthcare-provider recommendation, and the lack of patient education. Understanding when to have tests is vital for interventions, in order to improve patient outcomes, which can include death from treatable conditions or diseases. Future research should include larger samples as well as studies of outcomes associated with these screening tests. These will help researchers and policymakers better understand this issue and aid in the development and implementation of interventions for both patients and physicians.

Comparison of autogenous cancellous bone grafting and extracorporeal shock wave therapy on osteotomy healing in the tibial tuberosity advancement procedure in dogs. Radiographic densitometric evaluation.

PubMed

Barnes, K; Lanz, O; Werre, S; Clapp, K; Gilley, R

2015-01-01

To compare optical values in the osteotomy gap created after a tibial tuberosity advancement (TTA) treated with autogenous cancellous bone graft, extracorporeal shock wave therapy, a combination of autogenous cancellous bone graft and extracorporeal shock wave therapy, and absence of both autogenous cancellous bone graft and extracorporeal shock wave therapy using densitometry. Dogs that were presented for surgical repair of a cranial cruciate ligament rupture were randomly assigned to one of four groups: TTA with autogenous cancellous bone graft (TTA-G), TTA with autogenous cancellous bone graft and extracorporeal shock wave therapy (TTA-GS), TTA with extracorporeal shock wave therapy (TTA-S), and TTA with no additional therapy (TTA-O). Mediolateral radiographs at zero, four and eight weeks after surgery were evaluated to compare healing of the osteotomy gap via densitometry. An analysis of variance was used to compare the densitometric values between groups. At four weeks after surgery, a significant difference in osteotomy gap density was noted between TTA-GS (8.4 millimetres of aluminium equivalent [mmAleq]) and TTA-S (6.1 mmAleq), and between TTA-GS (8.4 mmAleq) and TTA-O (6.4 mmAleq). There were no significant differences noted between any groups at the eight week re-evaluation. There were no significant differences in the osteotomy gap density at eight weeks after surgery regardless of the treatment modality used. The combination of autogenous cancellous bone graft and extracorporeal shock wave therapy may lead to increased radiographic density of the osteotomy gap in the first four weeks after surgery. Densitometry using an aluminium step wedge is a feasible method for comparison of bone density after TTA in dogs.

Bone health and adherence to vitamin D and calcium therapy in early breast cancer patients on endocrine therapy with aromatase inhibitors.

PubMed

Bošković, Lidija; Gašparić, Maja; Petković, Marija; Gugić, Damir; Lovasić, Ingrid Belac; Soldić, Željko; Miše, Branka Petrić; Dabelić, Nina; Vazdar, Ljubica; Vrdoljak, Eduard

2017-02-01

Randomized trials involving aromatase inhibitors (AIs) in the adjuvant treatment of breast cancer patients have reported increased osteoporosis risk. Bone loss can be reduced with appropriate life style, vitamin D and calcium supplements, and with bisphosphonate therapy. The aim of this analysis was to investigate adherence to vitamin D and calcium in postmenopausal breast cancer patients receiving adjuvant non-steroidal AIs, and oncologists' adherence to the bone health guidelines. This prospective study included 438 newly diagnosed patients and those who have already been receiving non-steroidal AIs for up to 3.5 years. Median endocrine therapy duration before recruitment in the study was 10.5 months (interquartile 4.8-26.6). Densitometry was performed on 142 patients (32.4%) before initiation of endocrine therapy, and on additional 38 (8.6%) patients at second study visit. Densitometry was not performed on 258 (59%) patients. Vitamin D and calcium were prescribed to 329/438 (75.1%) patients at some point during the study. Patients who took more than 80% of the prescribed dose were considered adherent. Self-reported adherence was 88.4%. Osteoporosis was diagnosed in 24 patients (5.5%) of the total study population, bearing in mind that 258/438 (59%) patients did not have densitometry. Bisphosphonates were prescribed to 54/438 (12.3%) patients, whilst only 19 (35.2%) of those had osteoporosis. In this analysis, lack of oncologists' adherence to the bone health guidelines was observed. In addition, a significant proportion of the patients did not adhere to the vitamin D and calcium. Copyright © 2016 Elsevier Ltd. All rights reserved.

Validation Thin Layer Chromatography for the Determination of Acetaminophen in Tablets and Comparison with a Pharmacopeial Method

PubMed Central

Pyka, Alina; Budzisz, Marika; Dołowy, Małgorzata

2013-01-01

Adsorption thin layer chromatography (NP-TLC) with densitometry has been established for the identification and the quantification of acetaminophen in three leading commercial products of pharmaceutical tablets coded as brand: P1 (Product no. 1), P2 (Product no. 2), and P3 (Product no. 3). Applied chromatographic conditions have separated acetaminophen from its related substances, namely, 4-aminophenol and and 4′-chloroacetanilide. UV densitometry was performed in absorbance mode at 248 nm. The presented method was validated by specificity, range, linearity, accuracy, precision, detection limit, quantitative limit, and robustness. The TLC-densitometric method was also compared with a pharmacopeial UV-spectrophotometric method for the assay of acetaminophen, and the results confirmed statistically that the NP-TLC-densitometric method can be used as a substitute method. It could be said that the validated NP-TLC-densitometric method is suitable for the routine analysis of acetaminophen in quantity control laboratories. PMID:24063006

Changes in dynamic embryonic heart wall motion in response to outflow tract banding measured using video densitometry

NASA Astrophysics Data System (ADS)

Stovall, Stephanie; Midgett, Madeline; Thornburg, Kent; Rugonyi, Sandra

2016-11-01

Abnormal blood flow during early cardiovascular development has been identified as a key factor in the pathogenesis of congenital heart disease; however, the mechanisms by which altered hemodynamics induce cardiac malformations are poorly understood. This study used outflow tract (OFT) banding to model increased afterload, pressure, and blood flow velocities at tubular stages of heart development and characterized the immediate changes in cardiac wall motion due to banding in chicken embryo models with light microscopy-based video densitometry. Optical videos were used to acquire two-dimensional heart image sequences over the cardiac cycle, from which intensity data were extracted along the heart centerline at several locations in the heart ventricle and OFT. While no changes were observed in the synchronous contraction of the ventricle with banding, the peristaltic-like wall motion in the OFT was significantly affected. Our data provide valuable insight into early cardiac biomechanics and its characterization using a simple light microscopy-based imaging modality.

Quantification through TLC-densitometric analysis, repellency and anticholinesterase activity of the homemade extract of Indian cloves.

PubMed

Affonso, Raphael S; Lima, Josélia A; Lessa, Bruno M; Caetano, João V O; Obara, Marcos T; Nóbrega, Andréa B; Nepovimova, Eugenie; Musilek, Kamil; Kuca, Kamil; Slana, Gláucia B C A; França, Tanos C C

2018-02-01

The rise of the mosquitoes-transmitted diseases, like dengue, zika and chikungunya in Brazil in the last years has increased concerns on protection against mosquitoes bites. However, the prohibitive prices of the commercially available repellents for the majority of the Brazilian population has provoked a search for cheaper solutions, like the use of the homemade ethanolic extract of Indian clove (Syzygium aromaticum L.) as repellent, which has been reported as quite efficient by the local press. In order to verify this, we performed here the quantification of the main components of this extract through high-performance thin-layer chromatography (HPTLC)-densitometry and evaluated its efficiency as a repellent and its acetylcholinesterase (AChE) inhibition capacity. Our results have proved HPTLC-densitometry as an efficient and appropriate method for this quantification and confirmed the repellency activity, as well as its capacity of AChE inhibition. Copyright © 2017 John Wiley & Sons, Ltd.

Genome size estimates for crustaceans using Feulgen image analysis densitometry of ethanol-preserved tissues.

PubMed

Jeffery, Nicholas W; Gregory, T Ryan

2014-10-01

Crustaceans are enormously diverse both phylogenetically and ecologically, but they remain substantially underrepresented in the existing genome size database. An expansion of this dataset could be facilitated if it were possible to obtain genome size estimates from ethanol-preserved specimens. In this study, two tests were performed in order to assess the reliability of genome size data generated using preserved material. First, the results of estimates based on flash-frozen versus ethanol-preserved material were compared across 37 species of crustaceans that differ widely in genome size. Second, a comparison was made of specimens from a single species that had been stored in ethanol for 1-14 years. In both cases, the use of gill tissue in Feulgen image analysis densitometry proved to be a very viable approach. This finding is of direct relevance to both new studies of field-collected crustaceans as well as potential studies based on existing collections. © 2014 International Society for Advancement of Cytometry.

Qualitative and quantitative analysis of seven oligosaccharides in Morinda officinalis using double-development HPTLC and scanning densitometry.

PubMed

Zhou, Bin; Chang, Jun; Wang, Ping; Li, Jie; Cheng, Dan; Zheng, Peng-Wu

2014-01-01

The quality of Morindaofficinalis, which has been used as a Yang-tonic agent for a long time in China, can be evaluated. A double-development high performance thin layer chromatography (HPTLC) method has been established to simultaneously analyze quality and quantity of seven inulin-type oligosaccharides (DP=3-9) in Morindaofficinalis. The chromatography was performed on a silica gel 60 plate with the 7:5:2:1 proportion (v/v) of n-butanol-isopropanol-water-acetic acid for the first and second developments, respectively. The bands were visualized by the reaction with aniline-diphenylamine-phosphoric acid solution and analyzed by densitometric TLC at 540 nm. Quantification of seven oligosaccharides was achieved by densitometry at 540 nm. The investigated standard sugar had good linearity (R2>0.99) within test ranges. The amounts of seven oligosaccharides were calculated by the relative correction factor (RCF). Therefore, the developed TLC method could be used for quality control of Morindaofficinalis.

A new background subtraction method for Western blot densitometry band quantification through image analysis software.

PubMed

Gallo-Oller, Gabriel; Ordoñez, Raquel; Dotor, Javier

2018-06-01

Since its first description, Western blot has been widely used in molecular labs. It constitutes a multistep method that allows the detection and/or quantification of proteins from simple to complex protein mixtures. Western blot quantification method constitutes a critical step in order to obtain accurate and reproducible results. Due to the technical knowledge required for densitometry analysis together with the resources availability, standard office scanners are often used for the imaging acquisition of developed Western blot films. Furthermore, the use of semi-quantitative software as ImageJ (Java-based image-processing and analysis software) is clearly increasing in different scientific fields. In this work, we describe the use of office scanner coupled with the ImageJ software together with a new image background subtraction method for accurate Western blot quantification. The proposed method represents an affordable, accurate and reproducible approximation that could be used in the presence of limited resources availability. Copyright © 2018 Elsevier B.V. All rights reserved.

Official Positions for FRAX® clinical regarding smoking from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Dimai, Hans P; Chandran, Manju

2011-01-01

The worldwide prevalence of smoking has been estimated at about 50% in men, and 10% in women, with larger variations among different populations studied. Smoking has been shown to affect many organ systems resulting in severe morbidity and increased mortality. In addition, smoking has been identified as a predictor of ten-year fracture risk in men and women, largely independent of an individual's bone mineral density. This finding has eventually lead to incorporation of this risk factor into FRAX®, an algorithm that has been developed to calculate an individual's ten-year fracture risk. However, only little, or conflicting data is available on a possible association between smoking dose, duration, length of time after cessation, type of tobacco and fracture risk, limiting this risk factor's applicability in the context of FRAX®. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Linear Dichroism Characteristics of Ethidium and Proflavine Supercoiled DNA Complexes

DTIC Science & Technology

1990-01-01

of Ethidium-and Proflavine -Supercoi led DNA Complexes CHARLES E. SWENBERG, 1 SUSAN E. CARBERRV, 2 * and NICHOLAS E. GEACINTOV’ SRadliationl Biochenitr...drug were stained with EB, photographed under uv light, molecules, EB and proflavine (PF) (Figure 1), and the bands were quantitated by densitometry

[In vitro study with techniques of imaging of the composition of urinary calculi].

PubMed

Tellez Martínez-Fornés, M; Burgos Revilla, F J; Sáez Garrido, J C; Soria Descalzo, J; Barbero González, J; Sánchez Corral, J; Minaya Minaya, A; Vallejo Herrador, J

1997-02-01

Pre-treatment knowledge of the lithiasic composition can be useful to design the most appropriate therapeutic scheme for each kind of stone. The relationship between the stone's densitometry information provided by the different imaging techniques, conventional radiology (RX), computerized axial tomography (CAT) and dual energy radiographic densitometry (DO) is analyzed, as well as the elemental composition determined by the microanalysis of fragments obtained post-lithotrity using a scanning electronic microscope (SEM) associated to X-ray dispersion energy (XDE). 60 stones, 12 for each pure composition selected (calcium oxalate mono and dihydro, phosphocarbonate, magnesium ammonium phosphate and uric acid), were studied with XR, CAT and DO and were later subjected to lithofragmentation in vitro. Fragments analysis was carried out post-lithotrity with SEM associated to XDE. The X-ray does not allow to establish the composition of some calculi. CAT quantifies the mineral contents of the oxalocalcic and infective calculi and differentiates the uric acid from the other compositions because the mean density values are under 500 Hounsfield Units. DO evaluates the lithiasic content in phosphocarbonate salts which are structurally similar to bone hydroxyapatite.

National protocol for quality assurance in DXA-bone densitometry

NASA Astrophysics Data System (ADS)

Slavchev, A.; Avramova-Cholakova, S.; Vassileva, J.

2008-01-01

Osteoporosis becomes largely one of the most important socially significant and costly diseases. Modern techniques (DXA, US) are applied for bone densitometry. The paper presents a protocol for quality assurance especially of DXA-bone densitometers including quality control made in compliance with international standards (ISCD, IOF). The methodology has been tested in practice by measurements on site-functional assessment, entrance dose, radiation protection, calibration, in-vitro precision. It is expected to raise the quality of the diagnostic process in concert with the EU Medical Directive 97/43 particularly for population screening and sensitive groups. The protocol is an essential part of the National Program for constraining osteoporosis which has been elaborated at the Ministry of Health and at present under implementation throughout the country. It aims at reducing the risk, factors spreading, at diminishing the fracture risk the morbidity and the mortality from osteoporosis. An integral multidisciplinary approach to the problem solving is applied as well as training on three levels — doctors, patients, population, which effectively will contribute for obtaining real results in preventing osteoporosis.

Colour thresholding and objective quantification in bioimaging

NASA Technical Reports Server (NTRS)

Fermin, C. D.; Gerber, M. A.; Torre-Bueno, J. R.

1992-01-01

Computer imaging is rapidly becoming an indispensable tool for the quantification of variables in research and medicine. Whilst its use in medicine has largely been limited to qualitative observations, imaging in applied basic sciences, medical research and biotechnology demands objective quantification of the variables in question. In black and white densitometry (0-256 levels of intensity) the separation of subtle differences between closely related hues from stains is sometimes very difficult. True-colour and real-time video microscopy analysis offer choices not previously available with monochrome systems. In this paper we demonstrate the usefulness of colour thresholding, which has so far proven indispensable for proper objective quantification of the products of histochemical reactions and/or subtle differences in tissue and cells. In addition, we provide interested, but untrained readers with basic information that may assist decisions regarding the most suitable set-up for a project under consideration. Data from projects in progress at Tulane are shown to illustrate the advantage of colour thresholding over monochrome densitometry and for objective quantification of subtle colour differences between experimental and control samples.

Use of Competitive PCR to Detect and Quantify Haplosporidium nelsoni Infection (MSX disease) in the Eastern Oyster (Crassostrea virginica).

PubMed

Day, J Michael; Franklin, Dean E.; Brown, Bonnie L.

2000-09-01

This study was undertaken to develop a quantitative polymerase chain reaction assay that would improve the utility of PCR for detecting Haplosporidium nelsoni (MSX), a serious parasite of the eastern oyster Crassostrea virginica. A competitive PCR sequence was generated from the H. nelsoni small subunit ribosomal DNA fragment, originally described by Stokes and colleagues, that was amplified by the same PCR primers and had similar amplification performance. Assays performed using competitor dilutions ranging from 0.05 to 500 pg/µl DNA were used to test oyster samples designated using histological techniques as having "light" or "heavy" MSX infections. Visual diagnoses were confirmed equally well with three methods: densitometry of ethidium-bromide-stained agarose, densitometry of SYBRGreen-stained polyacrylamide gels, and analysis by GeneScan 3.0 of fluorescent products detected in ultrathin gels. Oysters diagnosed as negative for MSX tested as negative or light by PCR. Oysters with light MSX infections generally had less than 5 pg/µl infectious DNA. Oysters with heavy infections generally corresponded to 5 pg/µl or greater competitor dilutions.

FRAX(®) Clinical Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

McCloskey, Eugene V; Binkley, Neil

2011-01-01

The World Health Organization fracture risk assessment tool, FRAX(®), is an advance in clinical care that can assist in clinical decision-making. However, with increasing clinical utilization, numerous questions have arisen regarding how to best estimate fracture risk in an individual patient. Recognizing the need to assist clinicians in optimal use of FRAX(®), the International Osteoporosis Foundation (IOF) in conjunction with the International Society for Clinical Densitometry (ISCD) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX(®) usage. As part of the process, the charge of the FRAX(®) Clinical Task Force was to review and synthesize data surrounding a number of recognized clinical risk factors including rheumatoid arthritis, smoking, alcohol, prior fracture, falls, bone turnover markers and glucocorticoid use. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the Clinical Task Force composition and charge is presented here. Copyright © 2011. Published by Elsevier Inc.

Comparison of Sub-Bowman Keratoplasty Laser In situ Keratomileusis Flap Properties between Microkeratome and Femtosecond Laser.

PubMed

Fazel, Farhad; Ghoreishi, Mohammad; Ashtari, Alireza; Arefpour, Reza; Namgar, Mohammad

2017-01-01

Since thin and high-quality flaps produce more satisfactory surgical outcomes, flaps created by mechanical microkeratomes are more economical as compared with femtosecond lasers, and no Iranian study has concentrated laser in situ keratomileusis (LASIK) flap peculiarities between Moria Sub-Bowman keratoplasty (SBK) microkeratomes and LDV femtoseconds, the present study compares and contrasts them. This cross-sectional study was done on all patients who underwent LASIK surgery 1-month before this study. Thirty eyes were divided into per group. Flaps in the first group and second group were created, respectively, using Moria SBK microkeratome and LDV femtosecond laser. The other stages of LASIK were done equally in both groups. One month after surgery, the thickness of flaps was measured by anterior segment optical coherence tomography in five regions of flaps. Corneal anterior density was calculated and recorded 1-month after surgery using pentacam and by employing optical densitometry in a distance in the limit range of 0-6 mm from cornea center. Densitometry measurements were obtained and expressed in standardized grayscale units (GSUs). Postsurgery densitometry results reveal that anterior densities of cornea in limit range of 0-2 mm in groups of LDV femtosecond laser and Moria microkeratome are 21.35 ± 0.87 GSU and 22.85 ± 1.25 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P < 0.001). Moreover, anterior densities of the cornea in the limit range of 2-6 mm in these groups are 19.66 ± 0.99 GSU and 20.73 ± 1.24 GSU, respectively. Accordingly, these two groups are significantly different in this regard ( P = 0.04). There is a lower mean of flap thickness in the case of LDV femtosecond laser. Femtosecond laser method is greatly preferred as compared with Moria microkeratome because of greater homogeneity in flap thickness, smaller thickness, and lower density in optical zone.

FRAX® International Task Force of the 2010 Joint International Society for Clinical Densitometry & International Osteoporosis Foundation Position Development Conference.

PubMed

Cauley, Jane A; El-Hajj Fuleihan, Ghada; Luckey, Marjorie M

2011-01-01

Osteoporosis is a serious worldwide epidemic. FRAX® is a web-based tool developed by the Sheffield WHO Collaborating Center team, that integrates clinical risk factors and femoral neck BMD and calculates the 10 year fracture probability in order to help health care professionals identify patients who need treatment. However, only 31 countries have a FRAX® calculator. In the absence of a FRAX® model for a particular country, it has been suggested to use a surrogate country for which the epidemiology of osteoporosis most closely approximates the index country. More specific recommendations for clinicians in these countries are not available. In North America, concerns have also been raised regarding the assumptions used to construct the US ethnic specific FRAX® calculators with respect to the correction factors applied to derive fracture probabilities in Blacks, Asians and Hispanics in comparison to Whites. In addition, questions were raised about calculating fracture risk in other ethnic groups e.g., Native Americans and First Canadians. The International Society for Clinical Densitometry (ISCD) in conjunction with the International Osteoporosis Foundation (IOF) assembled an international panel of experts that ultimately developed joint Official Positions of the ISCD and IOF advising clinicians regarding FRAX® usage. As part of the process, the charge of the FRAX® International Task Force was to review and synthesize data regarding geographic and race/ethnic variability in hip fractures, non-hip osteoporotic fractures, and make recommendations about the use of FRAX® in ethnic groups and countries without a FRAX® calculator. This synthesis was presented to the expert panel and constitutes the data on which the subsequent Official Positions are predicated. A summary of the International Task Force composition and charge is presented here. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors Influencing Quality of Life of Hungarian Postmenopausal Women Screened by Osteodensitometry

ERIC Educational Resources Information Center

Maroti-Nagy, Agnes; Paulik, Edit

2011-01-01

The aim of our study was to evaluate factors influencing health related quality of life in Hungarian postmenopausal women who underwent osteodensitometry. A questionnaire-based cross-sectional study was carried out; 359 women aged over 40 years were involved, attending the outpatient Bone Densitometry Centre of Szeged. Two kinds of tools were…

Inhibition of Breast Cancer-lnduced Bone Pain, Metastasis, and Osteolysis in Nude Mice by LOVAZA and DHA Fatty Acids

DTIC Science & Technology

2012-10-01

ASIC3, TGAGAGCCACCAGCTTACCT/ACATGTCCTCAAGGGAGTGG (30 cycles); mouse TRPV1 , GTGACCCTCTTGGTGGAGAA/ CTTCAGTGTGGGGTGGAGTT (30 cycles), mouse GAPDH...densitometry assisted by the image analysis software MetaMorph Image ( xx). Sizes are as follows: ASIC1a 506bp, ASCI1b 563bp, ASCI3 245pb, TRPV1

Radial growth and wood density of white pine in relation to fossil-fired power plant operations

Treesearch

W. T. Lawhon; F. W. Woods

1976-01-01

The objectives of this study were twofold: (1) to develop a gamma densitometry technique for measuring the relative wood density and radial growth of trees from 12 mm increment cores; and (2) to determine whether changes in the relative wood density and radial growth of "resistant" eastern white pine (Pinus strobus L.) occurred after...

Modeling corewood-outerwood transition in loblolly pine using wood specific gravity

Treesearch

Christian R. Mora; H. Lee Allen; Richard F. Daniels; Alexander Clark

2007-01-01

A modified logistic function was used for modeling specific-gravity profiles obtained from X-ray densitometry analysis in 675 loblolly pine (Pinus taeda L.) trees in four regeneration trials. Trees were 21 or 22 years old at the time of the study. The function was used for demarcating corewood, transitional, and outerwood zones. Site and silvicultural effects were...

Long-term therapy in COPD: any evidence of adverse effect on bone?

PubMed Central

Langhammer, Arnulf; Forsmo, Siri; Syversen, Unni

2009-01-01

Patients with COPD have high risk for osteoporosis and fractures. Hip and vertebral fractures might impair mobility, and vertebral fractures further reduce lung function. This review discusses the evidence of bone loss due to medical treatment opposed to disease severity and risk factors for COPD, and therapeutic options for the prevention and treatment of osteoporosis in these patients. A review of the English-language literature was conducted using the MEDLINE database until June 2009. Currently used bronchodilators probably lack adverse effect on bone. Oral corticosteroids (OCS) increase bone resorption and decrease bone formation in a dose response relationship, but the fracture risk is increased more than reflected by bone densitometry. Inhaled corticosteroids (ICS) have been associated with both increased bone loss and fracture risk. This might be a result of confounding by disease severity, but high doses of ICS have similar effects as equipotent doses of OCS. The life-style factors should be modified, use of regular OCS avoided and use of ICS restricted to those with evidenced effect and probably kept at moderate doses. The health care should actively reveal risk factors, include bone densitometry in fracture risk evaluation, and give adequate prevention and treatment for osteoporosis. PMID:19888355

Wood densitometry in 17th and 18th century Dutch, German, Austrian and French violins, compared to classical Cremonese and modern violins.

PubMed

Stoel, Berend C; Borman, Terry M; de Jongh, Ronald

2012-01-01

Classical violins produced by makers such as Antonio Stradivari and Guarneri del Gesu have long been considered the epitome of the luthier's art and the expressive tool of choice for the most celebrated violinists. It has been speculated these makers had access to wood that was unique in some way and that this was responsible for their acclaimed tonal characteristics. In an attempt to discern whether the above conjecture is true, we analyzed 17 modern and classical Dutch, German, Austrian and French violins by wood densitometry using computed tomography and correlated these results with our previous study of modern and Cremonese violins; in all studying 30 instruments of the violin family. In order to make this comparison possible we developed methods to cross calibrate results from different CT manufacturers using calibration wood pieces. We found no significant differences in median densities between modern and classical violins, or between classical violins from different origins. These results suggest that it is unlikely classical Cremonese makers had access to wood with significantly different wood density characteristics than that available to contemporaneous or modern makers.

[Epidemiologic variables in postmenopausal women].

PubMed

Murillo-Uribe, A; Carranza-Lira, S; Martínez-Trejo, N A; Santos González, J E

1999-10-01

The objective was to know the characteristics of presentation, its clinical aspects and the modification in the diagnostic tools in a selected population of Mexican women with spontaneous menopause. The age at menarche, age at menopause, marital status, age at marriage, number of pregnancies and occupation of 1,099 women with spontaneous menopause were studied. In 619 women which were not receiving nor had received hormone replacement therapy the clinical, laboratory such as glucose, lipids, hormones, bone remodeling biochemistry; and X ray studies such as densitometry and mammography were analyzed. The age average of menarche presentation was at 13 years, and that of spontaneous menopause at 48.1 years 78% were married, with an age at marriage of 23 years, 66% had home duties. The screening tests showed that 30% of patients required cardiovascular evaluation, 40% showed alterations on lipids levels and at least 40% had some alteration on bone remodeling biochemistry or in densitometry. The mammography was normal in 81%. This study showed that most of the data in these group of women were similar to those of other populations, and many of them need intensive surveillance and adequate therapeutic prescriptions to diminish risk factors.

Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone

PubMed Central

de Mesquita, Alessandro Queiroz; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-01-01

OBJECTIVE: To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. METHODS: The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. RESULTS: Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. CONCLUSION: We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density. PMID:27982167

Correlation between ultrasound velocity and densitometry in fresh and demineralized cortical bone.

PubMed

Mesquita, Alessandro Queiroz de; Barbieri, Giuliano; Barbieri, Claudio Henrique

2016-11-01

To compare ultrasound propagation velocity with densitometry in the diaphyseal compact cortical bone of whole sheep metatarsals. The transverse ultrasound velocity and bone mineral density of 5-cm-long diaphyseal bone segments were first measured. The bone segments were then divided into four groups of 15 segments each and demineralized in an aqueous 0.5 N hydrochloric acid solution for 6, 12, 24 or 36 hours. All measurements were repeated after demineralization for each time duration and the values measured before and after demineralization were compared. Ultrasound velocity and bone mineral density decreased with demineralization time, and most differences in the pre- and post-demineralization values within each group and between groups were significant: A moderate correlation coefficient (r=0.75956) together with a moderate agreement was determined between both post-demineralization parameters, detected by the Bland-Altman method. We conclude that both ultrasound velocity and bone mineral density decrease as a result of demineralization, thus indicating that bone mineral content is of great importance for maintaining the acoustic parameters of cortical bone, as observed for cancellous bone. Ultrasound velocity can be used to evaluate both compact cortical bone quality and bone mineral density.

Automation of film densitometry for application in personal monitoring.

PubMed

Taheri, M; Movafeghi, A; Rastkhah, N

2011-03-01

In this research work, a semi-automatic densitometry system has been developed for large-scale monitoring services by use of film badge dosemeters. The system consists of a charge-coupled device (CCD)-based scanner that can scan optical densities (ODs) up to 4.2, a computer vision algorithm to improve the quality of digitised films and an analyser program to calculate the necessary information, e.g. the mean OD of region of interest and radiation doses. For calibration of the system, two reference films were used. The Microtek scanner International Color Consortium (ICC) profiler is applied for determining the colour attributes of the scanner accurately and a reference of the density step tablet, Bundesanstalt für Materialforschung und-prüfung (BAM) is used for calibrating the automatic conversion of gray-level values to OD values in the range of 0.2-4.0 OD. The system contributes to achieve more objectives and reliable results. So by applying this system, we can digitise a set of 20 films at once and calculate their relative doses less than about 4 min, and meanwhile it causes to avoid disadvantages of manual process and to enhance the accuracy of dosimetry.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis

PubMed Central

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-01-01

Background and Aims Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Methods Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Key Results Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. Conclusions A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. PMID:27107414

Consensus of official position of IOF/ISCD FRAX initiatives in Asia-Pacific region.

PubMed

Wu, Chih-Hsing; McCloskey, Eugene V; Lee, Joon Kiong; Itabashi, Akira; Prince, Richard; Yu, Wei; Li-Yu, Julie; Chionh, Siok Bee; Zhao, Yanling; Shin, Chan Soo; Gunawan, Tirtarahardja; Tsai, Keh-Sung; Chieng, Poon-Ung; Changlai, Sheng-Pin; Chan, Ding-Cheng; Chen, Jung-Fu; Tanner, S Bobo; Hans, Didier B; Kanis, John A; Chang, Yin-Fan; Sun, Zih-Jie; Yang, Rong-Sen

2014-01-01

The fracture risk assessment tool (FRAX(®)) has been developed for the identification of individuals with high risk of fracture in whom treatment to prevent fractures would be appropriate. FRAX models are not yet available for all countries or ethnicities, but surrogate models can be used within regions with similar fracture risk. The International Society for Clinical Densitometry (ISCD) and International Osteoporosis Foundation (IOF) are nonprofit multidisciplinary international professional organizations. Their visions are to advance the awareness, education, prevention, and treatment of osteoporosis. In November 2010, the IOF/ISCD FRAX initiative was held in Bucharest, bringing together international experts to review and create evidence-based official positions guiding clinicians for the practical use of FRAX. A consensus meeting of the Asia-Pacific (AP) Panel of the ISCD recently reviewed the most current Official Positions of the Joint Official Positions of ISCD and IOF on FRAX in view of the different population characteristics and health standards in the AP regions. The reviewed position statements included not only the key spectrum of positions but also unique concerns in AP regions. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Composite uranium carbide targets at TRIUMF: Development and characterization with SEM, XRD, XRF and L-edge densitometry

NASA Astrophysics Data System (ADS)

Kunz, Peter; Bricault, Pierre; Dombsky, Marik; Erdmann, Nicole; Hanemaayer, Vicky; Wong, John; Lützenkirchen, Klaus

2013-09-01

The production of radioactive ion beams (RIB) from spallation targets by irradiation with a continuous 500 MeV proton beam, has been routine at TRIUMF for several years. Based on the experience with composite refractory carbide targets a procedure for the fabrication of UC2/C targets was developed. It includes the preparation of UC2 by carbothermal reduction of UO2, the slip-casting of fine-grained UC2/C slurry on graphite foil under inert gas atmosphere and the cutting of composite target discs which are stacked up to a lamellar structure. The thermal properties of such an arrangement are adequate to withstand the high power deposition of an intense, continuous proton beam and also beneficial for the fast release of short-lived radioactive isotopes. Molecular structure, particle size and the impact of sintering of the target discs were investigated via XRD and SEM. Thickness and mass distribution were measured with position-sensitive LIII-edge densitometry. The results confirm that the properties of the UC2/C target material are well suited for RIB production at TRIUMF while there is still room for improvement with regard to uniformity of mass distribution in target disc thickness.

Rapid and selective determination of multi-sulfonamides by high-performance thin layer chromatography coupled to fluorescent densitometry and electrospray ionization mass detection.

PubMed

Chen, Yisheng; Schwack, Wolfgang

2014-02-28

In the European Union (EU), sulfonamides are among the most widely administrated groups of antibiotics in animal husbandry. Therefore, monitoring their residues in edible animal tissues plays an important role in the EU food safety framework. In this work, a simple and efficient method for the rapid screening of twelve prior sulfonamides frequently prescribed as veterinary drugs by high-performance thin-layer chromatography (HPTLC) was established. Sample extracts obtained with acetonitrile were tenfold concentrated and applied to HPTLC without any further cleanup. Following separation and fluram derivatization, sensitive and selective quantitation of the analytes can readily be accomplished with fluorescent densitometry. Limits of detection and quantitation were 15-40 and 35-70μg/kg, respectively. Additionally, a confirmative detection by HPTLC-electrospray ionization mass spectrometry (HPTLC-ESI/MS) was optimized, offering straightforward identification of target zones. Therefore, the risk of potential false positive findings can efficiently be reduced. The method was validated to meet the enforced commission regulation (EU) No. 37/2010, regarding different matrix complexities (bovine milk, porcine liver and kidney). Copyright © 2014 Elsevier B.V. All rights reserved.

Wood density of young-growth western hemlock: relation to ring age, radial growth, stand density, and site quality.

Treesearch

Dean S. DeBell; Ryan Singleton; Barbara L. Gartner; David D. Marshall

2004-01-01

Breast-high stem sections were sampled from 56 western hemlock (Tsuga heterophylla (Raf.) Sarg.) trees growing in 15 plots representing a wide range of tree and site conditions in northwestern Oregon. Growth and wood density traits of individual rings were measured via X-ray densitometry, and relationships of ring density and its components to age...

Photographic consulting services to the Earth Resources program. [using aerial photography as a tool for scientific measurement

NASA Technical Reports Server (NTRS)

1976-01-01

The recommendations, procedures, and techniques are summarized which provided by the Kodak Apparatus Division to the Ames Research Center to support the Earth Resources Aircraft Program at that facility. Recommendations, procedures, and calibration data are included for sensitometry, densitometry, laboratory cleanliness, and determination of camera exposure. Additional comments are made regarding process control procedures and general laboratory operations.

Benefits for bone from resistance exercise and nutrition in long-duration spaceflight: Evidence from biochemistry and densitometry.

PubMed

Smith, Scott M; Heer, Martina A; Shackelford, Linda C; Sibonga, Jean D; Ploutz-Snyder, Lori; Zwart, Sara R

2012-09-01

Exercise has shown little success in mitigating bone loss from long-duration spaceflight. The first crews of the International Space Station (ISS) used the "interim resistive exercise device" (iRED), which allowed loads of up to 297 lb(f) (or 1337 N) but provided little protection of bone or no greater protection than aerobic exercise. In 2008, the Advanced Resistive Exercise Device (ARED), which allowed absolute loads of up to 600 lb(f) (1675 N), was launched to the ISS. We report dietary intake, bone densitometry, and biochemical markers in 13 crewmembers on ISS missions from 2006 to 2009. Of these 13, 8 had access to the iRED and 5 had access to the ARED. In both groups, bone-specific alkaline phosphatase tended to increase during flight toward the end of the mission (p = 0.06) and increased 30 days after landing (p < 0.001). Most markers of bone resorption were also increased in both groups during flight and 30 days after landing (p < 0.05). Bone densitometry revealed significant interactions (time and exercise device) for pelvis bone mineral density (BMD) and bone mineral content (p < 0.01), hip femoral neck BMD (p < 0.05), trochanter BMD (p < 0.05), and total hip BMD (p < 0.05). These variables were unchanged from preflight only for ARED crewmembers, who also returned from flight with higher percent lean mass and lower percent fat mass. Body mass was unchanged after flight in both groups. All crewmembers had nominal vitamin D status (75 ± 17 nmol/L) before and during flight. These data document that resistance exercise, coupled with adequate energy intake (shown by maintenance of body mass determined by dual-energy X-ray absorptiometry [DXA]) and vitamin D, can maintain bone in most regions during 4- to 6-month missions in microgravity. This is the first evidence that improving nutrition and resistance exercise during spaceflight can attenuate the expected BMD deficits previously observed after prolonged missions. Copyright © 2012 American Society for Bone and Mineral Research.

Review of comparative studies between bone densitometry and quantitative ultrasound of the calcaneus in osteoporosis.

PubMed

Flöter, Michelle; Bittar, Cíntia Kelly; Zabeu, José Luis; Carneiro, Ana Carolina

2011-01-01

To assess the utility of quantitative ultrasound (QUS) of the calcaneus for diagnosing osteoporosis compared to the gold standard, bone densitometry using dual-emission X-ray absorptiometry (DXA), according to published reports. In this systematic review, the Medline/PUBMED, Medline Ovid and Journals@Ovid, and Wilson General Sciences Full Text database were used. The search strategy involved use of the following MeSH descriptors: [osteoporosis AND (densitometry OR ultrasonography)], and 39 articles published between 2001 and April 2010 were assessed. However, only six articles met the inclusion criteria: sensitivity and specificity of QUS, sample (women or men with no treatment or other disease likely to change bone mass index), devices used, comparative T-score between QUS of the calcaneus and DXA. The GE-Lunar Achilles and Hologic Sahara devices were used in most of the tests reported and were effective. All studies assessed compared QUS of the calcaneus to DXA of the lumbar spine or femoral neck, as the gold standard. QUS sensitivity ranged from 79% to 93% and specificity ranged from 28% to 90% when at the lower threshold. It is a controversial parameter, because the gold-standard threshold (T-score < -2.5, DXA) could not be used for QUS without errors in osteoporosis diagnosis. All studies had a threshold determined by the authors’ criteria, with a variability of -1.7 (pDXA T--score) and -2.4 for QUS, leading to the same prevalence of osteoporosis, and a T-score of < -3.65 for QUS was equivalent to a T-score < -2.5 for DXA. Based on the analysis of seven studies, we conclude that QUS of the calcaneus still cannot be used to confirm diagnosis of osteoporosis by comparing the results to those of patients who had already received such a diagnosis based on DXA. However, further research should be conducted in this area, because it is possible to improve the number diagnoses by varying the cutoff T-score. Furthermore, using QUS of the calcaneus was a helpful tool for assessing pathological fractures, whether or not they were associated with osteoporosis.

The Relevance of Osteoclastic and Osteoblastic Activity Markers Follow-Up in Patients on Antiresorptive Osteoporosis Treatment.

PubMed

Smilic, Tanja N; Novakovic, Tatjana R; Markovic-Jovanovic, Snezana R; Smilic, Ljiljana L J; Mitic, Javorka S; Radunovic, Miodrag L

2017-11-02

In general, markers of bone formation and markers of bone resorption are changing synergistically, so the monitoring of any osteoclastic and any osteoblastic marker should reflect the rate of bone transformation. The aim of the study is to monitor the bone metabolism markers in postmenopausal women with osteoporosis and osteopenia along with the variations caused by the effects of bisphosphonate therapy. The study involved 55 women of average age of 57.95 years, with osteopenia or osteoporosis. The patients with osteoporosis were treated with bisphosphonates (75 mg once a week); the laboratory tests were performed before the treatment and 6 months later. Patients with osteopenia were evaluated at the first assessment and 6 months later. The tests included bone densitometry, dual-energy X-ray absorptiometry, osteocalcin, alkaline phosphatase, collagen 1 N-terminal pro-peptide (P1NP), and beta C telopeptide of type I collagen (CTX). The mean T-score was -2.80 ± 0.63 before therapy and -2.64 ± 0.45 6 months later (p < 0.001). Women with osteoporosis had elevated levels of osteocalcin and P1NP at the first assessment, whereas the alkaline phosphatase level did not change with the treatment. After the introduction of antiresorptive therapy, the levels of osteocalcin and P1NP significantly decreased (p < 0.001). In the group with osteopenia, the biochemical markers activity were increased in both assessments. In patients with osteoporosis, Beta-CTX was increased in the first evaluation, and decreased after treatment (p = 0.001). The results indicate that the assessment of biochemical markers of bone metabolism show excellent results in the assessment of prognosis, monitoring the course and the response to various treatment regimens of osteoporosis and evince strong correlation with standard densitometry and dual-energy X-ray absorptiometry procedures. P1NP and CTX show better diagnostic applicability compared with osteocalcin and alkaline phosphatase. The analysis of the activity of biochemical markers may obtain early information on the therapeutic response, before definitive assessment by bone density measurements. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Comparative effect of soy protein, soy isoflavones, and 17beta-estradiol on bone metabolism in adult ovariectomized rats.

PubMed

Cai, David J; Zhao, Yongdong; Glasier, Jennifer; Cullen, Diane; Barnes, Stephen; Turner, Charles H; Wastney, Meryl; Weaver, Connie M

2005-05-01

This study provided a comprehensive investigation on the effect of soy protein and soy isoflavones on both calcium and bone metabolism in virgin adult rats. The measurements included bone histology, calcium kinetic modeling, calcium balance, bone densitometry, and whole body densitometry. Results confirmed the bone-preserving effect of estrogen but did not support a bone-sparing role of soy isoflavones. Several animal and short-term human studies have indicated that soy protein isolate enriched with isoflavones may be used as an alternative therapy to estrogen replacement therapy. However, none of the previous studies have investigated this estrogenic effect on both calcium and bone metabolism in animals or humans, which is essential in ascertaining the mode of action of isoflavones. This study was designed to determine the effects of soy protein versus isoflavones on calcium and bone metabolism in an ovariectomized rat model. Unmated 6-month-old ovariectomized and sham-operated female Sprague-Dawley rats were randomly assigned to nine groups (16 rats/group) and pair-fed soy- or casein-based diets with or without isoflavones for 8 weeks. A reference group was administered estrogen through subcutaneous implants (20-35 pg/liter plasma). Bone densitometry, histomorphometry, and mechanical testing were used to study bone metabolism and quality. Calcium metabolism was studied using calcium tracer balance and kinetics. After ovariectomy, estrogen prevented bone loss in trabecular bone and suppressed formation on both trabecular and cortical bone surfaces. Isoflavones given as enriched soy protein isolate or supplements did not prevent trabecular bone loss. Combining isoflavones with estrogen had no additional benefits over estrogen alone. There were no differences in response to isoflavones caused by protein source. None of the treatments significantly affected either total Ca balance or (45)Ca absorption. However, soy protein showed significant effects on reducing urinary loss of Ca in animals, irrespective of isoflavone level, perhaps because of the lower amount of sulfur-containing amino acids in soy protein. Estrogen, but not isoflavones at the levels tested, suppressed bone remodeling in both trabecular and cortical bone after ovariectomy.

Validated electrochemical and chromatographic quantifications of some antibiotic residues in pharmaceutical industrial waste water.

PubMed

Ibrahim, Heba K; Abdel-Moety, Mona M; Abdel-Gawad, Sherif A; Al-Ghobashy, Medhat A; Kawy, Mohamed Abdel

2017-03-01

Realistic implementation of ion selective electrodes (ISEs) into environmental monitoring programs has always been a challenging task. This could be largely attributed to difficulties in validation of ISE assay results. In this study, the electrochemical response of amoxicillin trihydrate (AMX), ciprofloxacin hydrochloride (CPLX), trimethoprim (TMP), and norfloxacin (NFLX) was studied by the fabrication of sensitive membrane electrodes belonging to two types of ISEs, which are polyvinyl chloride (PVC) membrane electrodes and glassy carbon (GC) electrodes. Linear response for the membrane electrodes was in the concentration range of 10 -5 -10 -2  mol/L. For the PVC membrane electrodes, Nernstian slopes of 55.1, 56.5, 56.5, and 54.0 mV/decade were achieved over a pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. On the other hand, for GC electrodes, Nernstian slopes of 59.1, 58.2, 57.0, and 58.2 mV/decade were achieved over pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. In addition to assay validation to international industry standards, the fabricated electrodes were also cross-validated relative to conventional separation techniques; high performance liquid chromatography (HPLC), and thin layer chromatography (TLC)-densitometry. The HPLC assay was applied in concentration range of 0.5-10.0 μg/mL, for all target analytes. The TLC-densitometry was adopted over a concentration range of 0.3-1.0 μg/band, for AMX, and 0.1-0.9 μg/band, for CPLX, NFLX, and TMP. The proposed techniques were successfully applied for quantification of the selected drugs either in pure form or waste water samples obtained from pharmaceutical plants. The actual waste water samples were subjected to solid phase extraction (SPE) for pretreatment prior to the application of chromatographic techniques (HPLC and TLC-densitometry). On the other hand, the fabricated electrodes were successfully applied for quantification of the antibiotic residues in actual waste water samples without any pretreatment. This finding assures the suitability of the fabricated ISEs for environmental analysis.

Three Dimensional Cross-Sectional Properties From Bone Densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.; Dalton, Bonnie P. (Technical Monitor)

2001-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone in a single scan plane. Using three non-coplanar scans, we have extended the method to obtain the principal area Moments of inertia and orientations of the principal axes at each cross-section along the length of the scan. Various 5 aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of mass distribution. Factors considered included X-ray photon energy, initial scan orientation, the included angle of the 3 scans, and Imin/Imax ratios. Principal moments of inertia were accurate to within 3.1% and principal angles were within 1 deg. of the expected value for phantoms scanned with included angles of 60 deg. and 90 deg. at the higher X-ray photon energy. Low standard deviations in error also 10 indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 deg. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (Imin/Imax) values when various included angles are used make this technique viable for future in vivo studies.

Variation in sensitivity, absorption and density of the central rod distribution with eccentricity.

PubMed

Tornow, R P; Stilling, R

1998-01-01

To assess the human rod photopigment distribution and sensitivity with high spatial resolution within the central +/-15 degrees and to compare the results of pigment absorption, sensitivity and rod density distribution (number of rods per square degree). Rod photopigment density distribution was measured with imaging densitometry using a modified Rodenstock scanning laser ophthalmoscope. Dark-adapted sensitivity profiles were measured with green stimuli (17' arc diameter, 1 degrees spacing) using a T ubingen manual perimeter. Sensitivity profiles were plotted on a linear scale and rod photopigment optical density distribution profiles were converted to absorption profiles of the rod photopigment layer. Both the absorption profile of the rod photopigment and the linear sensitivity profile for green stimuli show a minimum at the foveal center and increase steeply with eccentricity. The variation with eccentricity corresponds to the rod density distribution. Rod photopigment absorption profiles, retinal sensitivity profiles, and the rod density distribution are linearly related within the central +/-15 degrees. This is in agreement with theoretical considerations. Both methods, imaging retinal densitometry using a scanning laser ophthalmoscope and dark-adapted perimetry with small green stimuli, are useful for assessing the central rod distribution and sensitivity. However, at present, both methods have limitations. Suggestions for improving the reliability of both methods are given.

Social determinants of bone densitometry uptake for osteoporosis risk in patients aged 50yr and older: a systematic review.

PubMed

Brennan, Sharon L; Wluka, Anita E; Gould, Haslinda; Nicholson, Geoffrey C; Leslie, William D; Ebeling, Peter R; Oldenburg, Brian; Kotowicz, Mark A; Pasco, Julie A

2012-01-01

The World Health Organization identifies that osteoporosis is one of the leading health problems in the Western world. An increased risk of fragility fracture is observed in more socially disadvantaged individuals in most Western countries. Dual-energy X-ray absorptiometry (DXA) is currently the procedure of choice to diagnose osteoporosis and assess fracture risk. We systematically reviewed the literature regarding social determinants of DXA utilization for osteoporosis detection in patients aged 50yr and older using a computer-aided search of MEDLINE, EMBASE, CINAHL, and PsychINFO from January 1994 to December 2010. Five cross-sectional studies, incorporating 16 separate analyses, were identified for inclusion in this review. The best evidence analysis identified limited evidence for a positive association between either income or education with DXA utilization; furthermore, the best evidence analysis found no evidence for an association between either marital status or working status and DXA utilization. Further research is required to identify whether a relationship exists and elucidate reasons for disparities in DXA utilization between different social groups, such as choice and referral processes, as a necessary precursor in identifying modifiable determinants and appropriate strategies to promote preventive screening to identify fracture risk. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Relationship between CT densitometry with a slice thickness of 0.5 mm and audiometry in otosclerosis.

PubMed

Kawase, Setsuko; Naganawa, Shinji; Sone, Michihiko; Ikeda, Mitsuru; Ishigaki, Takeo

2006-06-01

The appropriate cutoff Hounsfield unit (HU) value for the diagnosis of otosclerosis was determined and the correlation between the bone conduction threshold and the findings of computed tomography (CT) densitometry investigated. CT images, 0.5-mm thick, were evaluated in 24 ears with otosclerosis and 19 control ears. Eight regions of interest were set around the otic capsule. The mean HU values in the area anterior to the oval window (A-OW) and anterior to the internal auditory canal (A-IAC) were significantly lower in otosclerosis than in controls. Based on receiver operating characteristic (ROC) analysis, the cutoff HU value in A-OW was determined to be 2,187.3 HU. The mean HU value in retrofenestral otosclerosis was significantly lower in the area A-OW, A-IAC and around the cochlea than in controls. Based on ROC analysis, the cutoff HU value in the latter was determined to be 2,045 HU. A statistically significant correlation was found between the density of the area A-OW and the hearing level at 500 and 1,000 Hz, and between the density of the area around the cochlea and the hearing level at most frequencies. These results suggest the semi-automated diagnosis of otosclerosis may be possible.

A Monte Carlo simulation to study a design of a gamma-ray detector for neutron resonance densitometry

NASA Astrophysics Data System (ADS)

Tsuchiya, H.; Harada, H.; Koizumi, M.; Kitatani, F.; Takamine, J.; Kureta, M.; Iimura, H.

2013-11-01

Neutron resonance densitometry (NRD) has been proposed to quantify nuclear materials in melted fuel (MF) that will be removed from the Fukushima Daiichi nuclear power plant. The problem is complex due to the expected presence of strong neutron absorbing impurities such as 10B and high radiation field that is mainly caused by 137Cs. To identify the impurities under the high radiation field, NRD is based on a combination of neutron resonance transmission analysis (NRTA) and neutron resonance capture analysis (NRCA). We investigated with Geant4 the performance of a gamma-ray detector for NRCA in NRD. The gamma-ray detector has a well shape, consisting of cylindrical and tube type LaBr3 scintillators. We show how it measures 478 keV gamma rays derived from 10B(n, αγ) reaction in MF under a high 137Cs-radiation environment. It was found that the gamma-ray detector was able to well suppress the Compton edge of 662-keV gamma rays of 137Cs and had a high peak-to-Compton continuum ratio, by using the tube type scintillator as a back-catcher detector. Then, we demonstrate that with this ability, detection of 478-keV gamma rays from 10B is accomplished in realistic measuring time.

A field-to-desktop toolchain for X-ray CT densitometry enables tree ring analysis.

PubMed

De Mil, Tom; Vannoppen, Astrid; Beeckman, Hans; Van Acker, Joris; Van den Bulcke, Jan

2016-06-01

Disentangling tree growth requires more than ring width data only. Densitometry is considered a valuable proxy, yet laborious wood sample preparation and lack of dedicated software limit the widespread use of density profiling for tree ring analysis. An X-ray computed tomography-based toolchain of tree increment cores is presented, which results in profile data sets suitable for visual exploration as well as density-based pattern matching. Two temperate (Quercus petraea, Fagus sylvatica) and one tropical species (Terminalia superba) were used for density profiling using an X-ray computed tomography facility with custom-made sample holders and dedicated processing software. Density-based pattern matching is developed and able to detect anomalies in ring series that can be corrected via interactive software. A digital workflow allows generation of structure-corrected profiles of large sets of cores in a short time span that provide sufficient intra-annual density information for tree ring analysis. Furthermore, visual exploration of such data sets is of high value. The dated profiles can be used for high-resolution chronologies and also offer opportunities for fast screening of lesser studied tropical tree species. © The Author 2016. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Outcomes of bone density measurements in coeliac disease.

PubMed

Bolland, Mark J; Grey, Andrew; Rowbotham, David S

2016-01-29

Some guidelines recommend that patients with newly diagnosed coeliac disease undergo bone density scanning. We assessed the bone density results in a cohort of patients with coeliac disease. We searched bone density reports over two 5-year periods in all patients from Auckland District Health Board (2008-12) and in patients under 65 years from Counties Manukau District Health Board (2009-13) for the term 'coeliac.' Reports for 137 adults listed coeliac disease as an indication for bone densitometry. The average age was 47 years, body mass index (BMI) 25 kg/m(2), and 77% were female. The median time between coeliac disease diagnosis and bone densitometry was 261 days. The average bone density Z-score was slightly lower than expected (Z-score -0.3 to 0.4) at the lumbar spine, total hip and femoral neck, but 88-93% of Z-scores at each site lay within the normal range. Low bone density was strongly related to BMI: the proportions with Z-score <-2 for BMI <20, 20-25, 25-30, and >30 kg/m(2) were 28%, 15%, 6% and 0% respectively. Average bone density was normal, suggesting that bone density measurement is not indicated routinely in coeliac disease, but could be considered on a case-by-case basis for individuals with strong risk factors for fracture.

BMDO Technology Applications in Biomedicine

DTIC Science & Technology

1996-01-01

capacitance and low- noise detectors. NOVA’s systems could also be used for bone densitometry and panoramic dental X-rays. Potential Use to Medicine Dr...receiver coils, increasing signal-to- noise ratio by a factor of two in some cases. This change is especially important in low-strength MRI fields...ongoing in this area. Receivers for this technology must be even more sensitive than for conventional MRI, because the " noise " level in these tissue

Is Breast Densitometry a Measure of Breast Cancer Risk

DTIC Science & Technology

2001-09-01

preparing the same or similar computer software, or (c) used by a party other than the Government, except that the Government may release or disclose...compositional density. This increases the accuracy, dynamic range and precision of the measurement. This is the principal difference between...vivo whole body %FAT. By subtracting two x-ray images acquired at different x-ray energies, one component (say soft tissue) of a two component model (say

Determination of Small Animal Long Bone Properties Using Densitometry

NASA Technical Reports Server (NTRS)

Breit, Gregory A.; Goldberg, BethAnn K.; Whalen, Robert T.; Hargens, Alan R. (Technical Monitor)

1996-01-01

Assessment of bone structural property changes due to loading regimens or pharmacological treatment typically requires destructive mechanical testing and sectioning. Our group has accurately and non-destructively estimated three dimensional cross-sectional areal properties (principal moments of inertia, Imax and Imin, and principal angle, Theta) of human cadaver long bones from pixel-by-pixel analysis of three non-coplanar densitometry scans. Because the scanner beam width is on the order of typical small animal diapbyseal diameters, applying this technique to high-resolution scans of rat long bones necessitates additional processing to minimize errors induced by beam smearing, such as dependence on sample orientation and overestimation of Imax and Imin. We hypothesized that these errors are correctable by digital image processing of the raw scan data. In all cases, four scans, using only the low energy data (Hologic QDR-1000W, small animal mode), are averaged to increase image signal-to-noise ratio. Raw scans are additionally processed by interpolation, deconvolution by a filter derived from scanner beam characteristics, and masking using a variable threshold based on image dynamic range. To assess accuracy, we scanned an aluminum step phantom at 12 orientations over a range of 180 deg about the longitudinal axis, in 15 deg increments. The phantom dimensions (2.5, 3.1, 3.8 mm x 4.4 mm; Imin/Imax: 0.33-0.74) were comparable to the dimensions of a rat femur which was also scanned. Cross-sectional properties were determined at 0.25 mm increments along the length of the phantom and femur. The table shows average error (+/- SD) from theory of Imax, Imin, and Theta) over the 12 orientations, calculated from raw and fully processed phantom images, as well as standard deviations about the mean for the femur scans. Processing of phantom scans increased agreement with theory, indicating improved accuracy. Smaller standard deviations with processing indicate increased precision and repeatability. Standard deviations for the femur are consistent with those of the phantom. We conclude that in conjunction with digital image enhancement, densitometry scans are suitable for non-destructive determination of areal properties of small animal bones of comparable size to our phantom, allowing prediction of Imax and Imin within 2.5% and Theta within a fraction of a degree. This method represents a considerable extension of current methods of analyzing bone tissue distribution in small animal bones.

Validation of Long Bone Mechanical Properties from Densitometry

NASA Technical Reports Server (NTRS)

Whalen, R.; Katz, B.; Cleek, T.; Hargens, Alan R. (Technical Monitor)

1995-01-01

The objective of this study was to assess whether cross-sectional areal properties, calculated from densitometry, correlate to the true flexural properties. Right and left male embalmed tibiae were used in the study. Prior to scanning, the proximal end of each tibia was potted in a fixture with registration pins, flushed thoroughly with water under pressure to remove trapped air, and then placed in a constant thickness water bath attached to a precision indexer. Two sets of three scans of the entire tibia were taken with an Hologic QDR 1000/W densitometer at rotations of 0, 45, and 90 degrees about the tibia long axis. An aluminum step phantom and a bone step phantom, machined from bovine cortical bone, were also in the bath and scanned separately. Pixel attenuation data from the two sets of scans were averaged to reduce noise. Pixel data from the high energy beam were then converted to equivalent thicknesses using calibration equations. Cross-sectional areal properties (centroid, principal area moments and principal angle) along the length were computed from the three registered scans using methods developed in our laboratory. Flexural rigidities. Four strain gages were bonded around the circumference of each of 5 cross-sections encompassing the entire diaphysis. A known transverse load was then applied to the distal end and the bone was rotated 360 degrees in eight increments of 45 degrees each. Strains from the eight orientations were analyzed along with the known applied bending moments at each section to compute section centroids, curvatures, principal flexural rigidities and principal angle. Reference axes between the two methods were maintained within +/- 0.5 degrees using an electronic inclinometer. Principal angles (flexural - areal) differed by -2.0 +/- 4.0 degrees, and 1.0 +/- 2.5 degrees for the right and left tibia, respectively. Section principal flexural rigidities were highly correlated to principal areal moments (right: r(sup 2)= 0.997; left: r(sup 2)= 0.978) indicating a nearly constant effective flexural modulus. Right and left tibia exhibited a very high degree of symmetry when comparing either flexural or areal properties. To our knowledge this is the first study to validate the use of densitometry (DXA) to predict three dimensional structural properties of long bones. Our initial results support the conclusion that bone mineral and its distribution are the primary determinants of flexural modulus and rigidity.

Official Positions for FRAX(®) clinical regarding glucocorticoids: the impact of the use of glucocorticoids on the estimate by FRAX(®) of the 10 year risk of fracture from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX(®).

PubMed

Leib, Edward S; Saag, Kenneth G; Adachi, Jonathan D; Geusens, Piet P; Binkley, Neil; McCloskey, Eugene V; Hans, Didier B

2011-01-01

Given the significant impact the use of glucocorticoids can have on fracture risk independent of bone density, their use has been incorporated as one of the clinical risk factors for calculating the 10-year fracture risk in the World Health Organization's Fracture Risk Assessment Tool (FRAX(®)). Like the other clinical risk factors, the use of glucocorticoids is included as a dichotomous variable with use of steroids defined as past or present exposure of 3 months or more of use of a daily dose of 5 mg or more of prednisolone or equivalent. The purpose of this report is to give clinicians guidance on adjustments which should be made to the 10-year risk based on the dose, duration of use and mode of delivery of glucocorticoids preparations. A subcommittee of the International Society for Clinical Densitometry and International Osteoporosis Foundation joint Position Development Conference presented its findings to an expert panel and the following recommendations were selected. 1) There is a dose relationship between glucocorticoid use of greater than 3 months and fracture risk. The average dose exposure captured within FRAX(®) is likely to be a prednisone dose of 2.5-7.5 mg/day or its equivalent. Fracture probability is under-estimated when prednisone dose is greater than 7.5 mg/day and is over-estimated when the prednisone dose is less than 2.5 mg/day. 2) Frequent intermittent use of higher doses of glucocorticoids increases fracture risk. Because of the variability in dose and dosing schedule, quantification of this risk is not possible. 3) High dose inhaled glucocorticoids may be a risk factor for fracture. FRAX(®) may underestimate fracture probability in users of high dose inhaled glucocorticoids. 4) Appropriate glucocorticoid replacement in individuals with adrenal insufficiency has not been found to increase fracture risk. In such patients, use of glucocorticoids should not be included in FRAX(®) calculations. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Enhanced Precision of the New Hologic Horizon Model Compared With the Old Discovery Model Is Less Evident When Fewer Vertebrae Are Included in the Analysis.

PubMed

McNamara, Elizabeth A; Kilim, Holly P; Malabanan, Alan O; Whittaker, LaTarsha G; Rosen, Harold N

The International Society for Clinical Densitometry guidelines recommend using locally derived precision data for spine bone mineral densities (BMDs), but do not specify whether data derived from L1-L4 spines correctly reflect the precision for spines reporting fewer than 4 vertebrae. Our experience suggested that the decrease in precision with successively fewer vertebrae is progressive as more vertebrae are excluded and that the precision for the newer Horizon Hologic model might be better than that for the previous model, and we sought to quantify. Precision studies were performed on Hologic densitometers by acquiring spine BMD in fast array mode twice on 30 patients, according to International Society for Clinical Densitometry guidelines. This was done 10 different times on various Discovery densitometers, and once on a Horizon densitometer. When 1 vertebral body was excluded from analysis, there was no significant deterioration in precision. When 2 vertebrae were excluded, there was a nonsignificant trend to poorer precision, and when 3 vertebrae were excluded, there was significantly worse precision. When 3 or 4 vertebrae were reported, the precision of the spine BMD measurement was significantly better on the Hologic Horizon than on the Discovery, but the difference in precision between densitometers narrowed and was no longer significant when 1 or 2 vertebrae were reported. The results suggest that (1) the measurement of in vivo spine BMD on the new Hologic Horizon densitometer is significantly more precise than on the older Discovery model; (2) the difference in precision between the Horizon and Discovery models decreases as fewer vertebrae are included; (3) the measurement of spine BMD is less precise as more vertebrae are excluded, but still quite reasonable even when only 1 vertebral body is included; and (4) when 3 vertebrae are reported, L1-L4 precision data can reasonably be used to report significance of changes in BMD. When 1 or 2 vertebrae are reported, precision data for 1 or 2 vertebrae, respectively, should be used, because the exclusion of 2-3 vertebrae significantly worsens precision. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Systems to Detect Bacterial Contamination of Banked Blood in a Rapid, Non-Invasive Low Technology Manner. Phase 1.

DTIC Science & Technology

1994-08-25

Department of the Army position, policy or decision unless so designated by other documentation. 94-30800 IIV III !111 IiI I ’ I foron Appr •vedREPORT...copyrighted material is quoted, permission has been obtained to use such material. Where material from documents designated for limited distribution is...Laser Scanning Densitometry for quantitation of the color changes. (6) Narrative: a. Eperimental Methods: 1. Bacteria: Ten bacterial species

Journal of Special Operations Medicine. Volume 10, Edition 4, Fall 2010

DTIC Science & Technology

2010-01-01

Prior To Ascent? ● Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier ● Public Health Foodborne Illness Case Study...Scapula Fracture Secondary to Static Line Injury in a 22 year-old Active Duty Soldier LTC K. David Thompson, MPAS, PA-C Public Health Foodborne Illness...consistent measurements were achieved. Predicted lung vol- ume and an appropriate densitometry equation were used to calculate percent body fat (% BF

Standards and measurements for assessing bone health-workshop report co-sponsored by the International Society for Clinical Densitometry (ISCD) and the National Institute of Standards and Technology (NIST).

PubMed

Bennett, Herbert S; Dienstfrey, Andrew; Hudson, Lawrence T; Oreskovic, Tammy; Fuerst, Thomas; Shepherd, John

2006-01-01

This article reports and discusses the results of the recent ISCD-NIST Workshop on Standards and Measurements for Assessing Bone Health. The purpose of the workshop was to assess the status of efforts to standardize and compare results from dual-energy X-ray absorptiometry (DXA) scans, and then to identify and prioritize ongoing measurement and standards needs.

Automated cell disruption is a reliable and effective method of isolating RNA from fresh snap-frozen normal and malignant oral mucosa samples.

PubMed

Van der Vorst, Sébastien; Dekairelle, Anne-France; Irenge, Léonid; Hamoir, Marc; Robert, Annie; Gala, Jean-Luc

2009-01-01

This study compared automated vs. manual tissue grinding in terms of RNA yield obtained from oral mucosa biopsies. A total of 20 patients undergoing uvulectomy for sleep-related disorders and 10 patients undergoing biopsy for head and neck squamous cell carcinoma were enrolled in the study. Samples were collected, snap-frozen in liquid nitrogen, and divided into two parts of similar weight. Sample grinding was performed on one sample from each pair, either manually or using an automated cell disruptor. The performance and efficacy of each homogenization approach was compared in terms of total RNA yield (spectrophotometry, fluorometry), mRNA quantity [densitometry of specific TP53 amplicons and TP53 quantitative reverse-transcribed real-time PCR (qRT-PCR)], and mRNA quality (functional analysis of separated alleles in yeast). Although spectrophotometry and fluorometry results were comparable for both homogenization methods, TP53 expression values obtained by amplicon densitometry and qRT-PCR were significantly and consistently better after automated homogenization (p<0.005) for both uvula and tumor samples. Functional analysis of separated alleles in yeast results was better with the automated technique for tumor samples. Automated tissue homogenization appears to be a versatile, quick, and reliable method of cell disruption and is especially useful in the case of small malignant samples, which show unreliable results when processed by manual homogenization.

Position statement : executive summary. The Writing Group for the International Society for Clinical Densitometry (ISCD) Position Development Conference.

PubMed

2004-01-01

The International Society for Clinical Densitometry (ISCD) held a Position Development Conference in July 2003, at which time positions developed and researched by the organization's Scientific Advisory Committee were presented to a panel of international experts in the field of bone density testing. This panel reached agreement on a series of positions that were subsequently approved by the Board of Directors of the ISCD and are now official policy of the ISCD. These positions, which are outlined in this article and discussed in greater detail in subsequent articles in this journal, include (1) affirmation of the use of the World Health Organization classification for the diagnosis of osteoporosis in postmenopausal women; (2) the diagnosis of osteoporosis in men; (3) the diagnosis of osteoporosis in premenopausal women; (4) the diagnosis of osteoporosis in children; (5) technical standards for skeletal regions of interest by dual-energy X-ray absorptiometry (DXA); (6) the use of new technologies, such as vertebral fracture assessment; (7) technical standards for quality assurance, including phantom scanning and calibration; (8) technical standards for the performance of precision assessment at bone density testing centers, and for cross-calibration of DXA devices; (9) indications for bone density testing; (10) appropriate information for a bone density report; and (11) nomenclature and decimal places for bone density reporting.

Recommendations for the clinical evaluation of agents for treatment of osteoporosis: consensus of an expert panel representing the American Society for Bone and Mineral Research (ASBMR), the International Society for Clinical Densitometry (ISCD), and the National Osteoporosis Foundation (NOF).

PubMed

Silverman, Stuart L; Cummings, Steven R; Watts, Nelson B

2008-01-01

A panel of experts representing ASBMR, NOF, and ISCD reviewed evidence and reached consensus that regulatory approval of treatments for osteoporosis should be based on trials with fracture endpoints, lasting 18-24 mo, and extending treatment to 5 yr; other indications could be approved based on BMD and turnover markers. In response to an FDA request for clinical trial guidance in osteoporosis, an expert panel was convened with representatives from the American Society of Bone and Mineral Research, the International Society of Clinical Densitometry, and the National Osteoporosis Foundation. The panel used a validated evidence-based expert panel process (the Rand Appropriateness Method) to address issues of trial duration, trial design, use of intermediate endpoints as outcomes, and use of placebo-controlled trials in high-risk patients. The panel concluded that placebo-controlled trials with fracture endpoints are appropriate and, with informed consent, are ethical for registration of new compounds. Trials may be 18-24 mo in duration for efficacy, assuming longer duration to 5 yr for safety and demonstration of sustained fracture reduction. Once fracture efficacy has been established for a particular agent, intermediate endpoints (e.g., BMD and bone turnover markers) may be used as outcomes for new indications other than corticosteroid-induced osteoporosis.

Cross-sectional structural parameters from densitometry

NASA Technical Reports Server (NTRS)

Cleek, Tammy M.; Whalen, Robert T.

2002-01-01

Bone densitometry has previously been used to obtain cross-sectional properties of bone from a single X-ray projection across the bone width. Using three unique projections, we have extended the method to obtain the principal area moments of inertia and orientations of the principal axes at each scan cross-section along the length of the scan. Various aluminum phantoms were used to examine scanner characteristics to develop the highest accuracy possible for in vitro non-invasive analysis of cross-sectional properties. Factors considered included X-ray photon energy, initial scan orientation, the angle spanned by the three scans (included angle), and I(min)/I(max) ratios. Principal moments of inertia were accurate to within +/-3.1% and principal angles were within +/-1 degrees of the expected value for phantoms scanned with included angles of 60 degrees and 90 degrees at the higher X-ray photon energy (140 kVp). Low standard deviations in the error (0.68-1.84%) also indicate high precision of calculated measurements with these included angles. Accuracy and precision decreased slightly when the included angle was reduced to 30 degrees. The method was then successfully applied to a pair of excised cadaveric tibiae. The accuracy and insensitivity of the algorithms to cross-sectional shape and changing isotropy (I(min)/I(max)) values when various included angles are used make this technique viable for future in vivo studies.

Measurement of Human Blood and Plasma Volumes

NASA Technical Reports Server (NTRS)

Greenleaf, J. E.; Szalkay, H. G. H.

1987-01-01

Report reviews techniques for measuring blood-plasma volume in humans. Common technique of using radioactive iodine isotope to label plasma albumin involves unwarranted risks from low-level radiation. Report emphasizes techniques using Evans-blue-dye (T-1824) labeling of albumin, hematocrit or hemoglobin/hematocrit measurements, or blood densitometry. In Evans-blue-dye technique, plasma volume determined from decrease in dye concentration occurring after small amount of dye solution injected into circulatory system. Subjection of Evans blue dye to test for carcinogenicity gave negative results.

Ultrasonic fluid densitometry and densitometer

DOEpatents

Greenwood, Margaret S.; Lail, Jason C.

1998-01-01

The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface.

Ultrasonic fluid densitometry and densitometer

DOEpatents

Greenwood, M.S.; Lail, J.C.

1998-01-13

The present invention is an ultrasonic fluid densitometer that uses a material wedge having an acoustic impedance that is near the acoustic impedance of the fluid, specifically less than a factor of 11 greater than the acoustic impedance of the fluid. The invention also includes a wedge having at least two transducers for transmitting and receiving ultrasonic signals internally reflected within the material wedge. Density of a fluid is determined by immersing the wedge into the fluid and measuring reflection of ultrasound at the wedge-fluid interface. 6 figs.

Fan-beam densitometry of the growing skeleton: are we measuring what we think we are?

PubMed

Cole, Jacqueline H; Scerpella, Tamara A; van der Meulen, Marjolein C H

2005-01-01

Magnification error in fan-beam densitometers varies with distance from the X-ray source to the bone measured and might obscure bone mineral changes in the growing skeleton. Magnification was examined by scanning aluminum rods of different shapes (square, rectangular, solid round, and hollow round) at four distances above the X-ray source in two orientations, with rods aligned parallel (SI) and perpendicular (ML) to the longitudinal axis of the scanning table. Measured area (cm(2)) decreased linearly with distance above the X-ray source for all rods in the SI orientation (p < 0.005). Measured mineral content (g) decreased linearly with distance but only for SI round rods (p < 0.0001) and for ML hollow round rods (p < 0.005). Area and mineral content decreased 1.6-1.8% per centimeter above the source for round rods. Measured mineral density (g/cm(2)) decreased linearly with distance from the source only for ML hollow round rods (p < 0.005). Variation in area, mineral content, and mineral density measurements was 6.6-6.9%, 6.9-7.5%, and 1.9-2.3%, respectively, for SI round rods. Magnification errors of this magnitude are problematic for clinical studies using fan-beam densitometry. Particularly in pediatric subjects, increases in soft tissue during normal growth could increase a bone's distance from the fan-beam source and result in apparent reductions in area and bone mineral content.

30years of DXA technology innovations.

PubMed

Glüer, Claus-C

2017-11-01

As the successor of Dual Photon Absorptiometry (DPA), Dual X-ray Absorptiometry (DXA) has seen 30years of continuous technological innovations. Implementation of measures for standardization and quality assurance made DXA a reliable and clinically useful approach. Its use in clinical multicenter drug studies in osteoporosis lead to general acceptance as the standard technique of bone densitometry. The limitations of DXA are well established. As a measure of areal bone mineral density (aBMD) it depends on bone size and is biased by overlaying soft tissue and calcified structures. To some extent these errors can be reduced by estimation of bone depth and/or lateral imaging. DXA based aBMD can be supplemented by additional information obtainable from DXA scans: geometric indices such as hip axis length or complex models like 2-D finite element analysis have been developed and tested. Given the drastic improvement in image quality current DXA scans can be used for Vertebral Fracture Analysis (VFA) or grading of Abdominal Aortic Calcifications. A textural measure, Trabecular Bone Score (TBS) provides independent information on fracture risk. DXA devices can also be used for assessments beyond bone density. Periprosthetic aBMD changes can be monitored to study the mechanical fitting of bone implants. Total body composition measurements are increasingly being used in studies on nutrition, obesity, and sarcopenia. 30years after its inception DXA is the undisputed standard imaging technique for the assessment of osteoporotic fracture risk with new applications beyond bone densitometry adding to its value. Copyright © 2017 Elsevier Inc. All rights reserved.

The results of a proximally-coated cementless femoral component in total hip replacement: a five- to 12-year follow-up.

PubMed

Kim, Y-H

2008-03-01

This study reviewed the results of a cementless anatomical femoral component to give immediate post-operative stability, and with a narrow distal section in order not to contact the femoral cortex in the diaphysis, ensuring exclusively metaphyseal loading. A total of 471 patients (601 hips) who had a total hip replacement between March 1995 and February 2002 were included in the study. There were 297 men and 174 women. The mean age at the time of operation was 52.7 years (28 to 63). Clinical and radiological evaluation were performed at each follow-up. Bone densitometry was carried out on all patients two weeks after operation and at the final follow-up examination. The mean follow-up was 8.8 years (5 to 12). The mean pre-operative Harris hip score was 41 points (16 to 54), which improved to a mean of 96 (68 to 100) at the final follow-up. No patient complained of thigh pain at any stage. No acetabular or femoral osteolysis was observed and no hip required revision for aseptic loosening of either component. Deep infection occurred in two hips (0.3%) which required revision. One hip (0.2%) required revision of the acetabular component for recurrent dislocation. Bone mineral densitometry revealed a minimal bone loss in the proximal femur. This cementless anatomical femoral component with metaphyseal loading but without distal fixation produced satisfactory fixation and encourages proximal femoral loading.

Simultaneous Determination of Soyasaponins and Isoflavones in Soy (Glycine max L.) Products by HPTLC-densitometry-Multiple Detection.

PubMed

Shawky, Eman; Sallam, Shaimaa M

2017-11-01

A new high-throughput method was developed for the simultaneous analysis of isoflavones and soyasaponnins in Soy (Glycine max L.) products by high-performance thin-layer chromatography with densitometry and multiple detection. Silica gel was used as the stationary phase and ethyl acetate:methanol:water:acetic acid (100:20:16:1, v/v/v/v) as the mobile phase. After chromatographic development, multi-wavelength scanning was carried out by: (i) UV-absorbance measurement at 265 nm for genistin, daidzin and glycitin, (ii) Vis-absorbance measurement at 650 nm for Soyasaponins I and III, after post-chromatographic derivatization with anisaldehyde/sulfuric acid reagent. Validation of the developed method was found to meet the acceptance criteria delineated by ICH guidelines with respect to linearity, accuracy, precision, specificity and robustness. Calibrations were linear with correlation coefficients of >0.994. Intra-day precisions relative standard deviation (RSD)% of all substances in matrix were determined to be between 0.7 and 0.9%, while inter-day precisions (RSD%) ranged between 1.2 and 1.8%. The validated method was successfully applied for determination of the studied analytes in soy-based infant formula and soybean products. The new method compares favorably to other reported methods in being as accurate and precise and in the same time more feasible and cost-effective. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Is bone mineral density measurement using dual-energy X-ray absorptiometry affected by gamma rays?

PubMed

Xie, Liang-Jun; Li, Jian-Fang; Zeng, Feng-Wei; Jiang, Hang; Cheng, Mu-Hua; Chen, Yi

2013-01-01

The objective of this study was to determine whether the gamma rays emitted from the radionuclide effect bone mineral density (BMD) measurement. Nine subjects (mean age: 56 ± 17.96 yr) scheduled for bone scanning underwent BMD measurement using dual-energy X-ray absorptiometry (DXA) (Hologic/Discovery A) before and 1, 2, and 4 h after injection of technetium-99m-methylene diphosphonate (99mTc-MDP). Ten subjects (mean age: 41 ± 15.47 yr) scheduled for therapy of differentiated thyroid carcinoma with iodine-131 underwent BMD measurement before and 2 h after therapeutic radionuclide administration. All patients were given whole body BMD measurement, including head, arm, ribs, lumbar spine, pelvis, and leg sites. Besides, patients who referred to radioiodine therapy were given total hip and femoral neck BMD measurement as well. No statistically significant changes in BMD values were detected after 99mTc-MDP and iodine-131 administration for all measurement sites (p > 0.05), and individual difference of BMD before and after radionuclide imaging or therapy was less than the least significant change in lumbar spine, total hip, and femoral neck. In conclusion, BMD measurements are not influenced by the gamma rays emitted from technetium-99m and iodine-131. DXA bone densitometry may be performed simultaneously with bone scanning and radioiodine therapy. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Official Positions for FRAX® clinical regarding falls and frailty: can falls and frailty be used in FRAX®? From Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Masud, Tahir; Binkley, Neil; Boonen, Steven; Hannan, Marian T

2011-01-01

Risk factors for fracture can be purely skeletal, e.g., bone mass, microarchitecture or geometry, or a combination of bone and falls risk related factors such as age and functional status. The remit of this Task Force was to review the evidence and consider if falls should be incorporated into the FRAX® model or, alternatively, to provide guidance to assist clinicians in clinical decision-making for patients with a falls history. It is clear that falls are a risk factor for fracture. Fracture probability may be underestimated by FRAX® in individuals with a history of frequent falls. The substantial evidence that various interventions are effective in reducing falls risk was reviewed. Targeting falls risk reduction strategies towards frail older people at high risk for indoor falls is appropriate. This Task Force believes that further fracture reduction requires measures to reduce falls risk in addition to bone directed therapy. Clinicians should recognize that patients with frequent falls are at higher fracture risk than currently estimated by FRAX® and include this in decision-making. However, quantitative adjustment of the FRAX® estimated risk based on falls history is not currently possible. In the long term, incorporation of falls as a risk factor in the FRAX® model would be ideal. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Quantitative analysis of Curcuminoid collected from different location in Indonesia by TLC-Densitometry and its antioxidant capacity

NASA Astrophysics Data System (ADS)

Wahyuni, D. S. C.; Artanti, A. N.; Rinanto, Y.

2018-04-01

Curcuminoid, consisting of curcumin, demethoxycurcumin and bis demethoxycurcumin, is the active compound in Curcuma longa L. rhizome. It yielded vary depend on the environment and varieties. Curcumin has been known to have a potent antioxidants activity. The present work was conducted to assess the curcuminoid content and antioxidant capacity in the crude extracts of C. longa L. collected from eight different locations in Indonesia. Samples were collected from eight locations including Java island, Sumatera island and Nusa Tenggara island. All samples were extracted using 96% ethanol and analyzed quantitatively using TLC-Densitometry. Antioxidant activity was assessed using diphenylpicrylhydrazyl (DPPH) radical scavenging assay and analyzed at 517 nm using a spectrophotometer. Curcuminoid content in C. longa varied among eight different locations (0.53±0.05 - 5.33±0.12 % w/w). The highest curcumin, demethoxycurcumin and bisdemethoxycurcumin yield were found in the samples from Magetan (5.33±0.12%, 1.54±0.05%, 0.46±0.02% w/w, respectively). In contrast, the lowest curcumin, demethoxycurcumin and bisdemethoxycurcumin yield were found in the sample from Demak (0.53±0.05%, 0.17±0.05%, 0.17±0.05% w/w, respectively). Antioxidant capacity showed similar for all places unless sample from Magetan which exhibited two times lower than other locations. It is apparently curcuminoid content and antioxidant activity varied among places. These results are useful information for curcuminoid standardization method in pharmaceutical products.

Remote sensing of effects of land use practices on water quality

NASA Technical Reports Server (NTRS)

Graves, D. H.; Colthrap, G. B.

1977-01-01

An intensive study was conducted to determine the utility of manual densitometry and color additive viewing of aircraft and LANDSAT transparencies for monitoring land use and land use change. The relationship between land use and selected water quality parameters was also evaluated. Six watersheds located in the Cumberland Plateau region of eastern Kentucky comprised the study area for the project. Land uses present within the study area were reclaimed surface mining and forestry. Fertilization of one of the forested watersheds also occurred during the study period.

Dual Energy X-Ray Densitometry Apparatus and Method Using Single X-Ray Pulse

DTIC Science & Technology

1999-10-13

future bone fracture risk. Bone mineral loss is associated with aging and is more rapid in post-menopausal women. In addition, bone mineral loss is... parameters of the x-ray tube of Figures 1 and 2 illustrating, respectively, the calculated current, voltage and power; and Figures 4(a) and 4(d) are...assumed to be that of water. The bone mineral is hydroxyapatite (Ca5P30i3H) with an assumed density of 0.25 g/cm3 based on the lumbar vertebra metrology

Preferential solvatation of human serum albumin in dimethylsulfoxide-H2O binary solution

NASA Astrophysics Data System (ADS)

Grigoryan, K. R.

2009-12-01

The preferential solvatation of human serum albumin (HSA) in dimethylsulfoxide (DMSO) aqueous solutions were studied using the densitometry method. It has been shown that at DMSO low concentrations HSA undergoes to preferential hydration, but at DMSO higher concentrations preferential binding of DMSO molecules to protein occurs. It has been estimated that DMSO exhibits stabilizing/destabilizing effect on HSA structure which is explained in terms of hydration/solvatation of protein, on the one hand, and the medium structure enhancement/disruption around the protein molecule, on the other hand.

Densitometry By Acoustic Levitation

NASA Technical Reports Server (NTRS)

Trinh, Eugene H.

1989-01-01

"Static" and "dynamic" methods developed for measuring mass density of acoustically levitated solid particle or liquid drop. "Static" method, unknown density of sample found by comparison with another sample of known density. "Dynamic" method practiced with or without gravitational field. Advantages over conventional density-measuring techniques: sample does not have to make contact with container or other solid surface, size and shape of samples do not affect measurement significantly, sound field does not have to be know in detail, and sample can be smaller than microliter. Detailed knowledge of acoustic field not necessary.

[Bone quantitative ultrasound].

PubMed

Matsukawa, Mami

2016-01-01

The conventional ultrasonic bone densitometry system can give us information of bone as ultrasonic wave velocity and attenuation. However, the data reflect both structural and material properties of bone. In order to focus only on the bone matrix properties without the effect of bone structure, studies of microscopic Brillouin scattering technique are introduced. The wave velocity in a trabecula was anisotropic and depended on the position and structure of the cancellous bone. The glycation also affected on the wave velocities in bone. As a new bone quality, the piezoelectricity of bone is also discussed.

Quantitative analysis of major dibenzocyclooctane lignans in Schisandrae fructus by online TLC-DART-MS.

PubMed

Kim, Hye Jin; Oh, Myung Sook; Hong, Jongki; Jang, Young Pyo

2011-01-01

Direct analysis in real time (DART) ion source is a powerful ionising technique for the quick and easy detection of various organic molecules without any sample preparation steps, but the lack of quantitation capacity limits its extensive use in the field of phytochemical analysis. To improvise a new system which utilize DART-MS as a hyphenated detector for quantitation. A total extract of Schisandra chinensis fruit was analyzed on a TLC plate and three major lignan compounds were quantitated by three different methods of UV densitometry, TLC-DART-MS and HPLC-UV to compare the efficiency of each method. To introduce the TLC plate into the DART ion source at a constant velocity, a syringe pump was employed. The DART-MS total ion current chromatogram was recorded for the entire TLC plate. The concentration of each lignan compound was calculated from the calibration curve established with standard compound. Gomisin A, gomisin N and schisandrin were well separated on a silica-coated TLC plate and the specific ion current chromatograms were successfully acquired from the TLC-DART-MS system. The TLC-DART-MS system for the quantitation of natural products showed better linearity and specificity than TLC densitometry, and consumed less time and solvent than conventional HPLC method. A hyphenated system for the quantitation of phytochemicals from crude herbal drugs was successfully established. This system was shown to have a powerful analytical capacity for the prompt and efficient quantitation of natural products from crude drugs. Copyright © 2010 John Wiley & Sons, Ltd.

Development of HPTLC-UV absorption densitometry method for the analysis of alprazolam and sertraline in combination and its application in the evaluation of marketed preparations.

PubMed

Venkateswarlu, K; Venisetty, R K; Yellu, N R; Keshetty, S; Pai, M G

2007-09-01

A new simple, sensitive, and reproducible high-performance thin-layer chromatography method for the estimation of alprazolam and sertraline in combination is developed using silica gel plates with fluorescent indicators. The system is equipped with an automated sample applicator, and the detection was performed at 254 nm by using UV absorption densitometry. The mobile phase consists of carbon tetrachloride, methanol, acetone, and ammonia in the ratio 12:3:5:0.1. The retention factor values for alprazolam and sertraline are found to be 0.52 and 0.70, respectively. The limit of detection of alprazolam and sertraline in the mixture of given proportion is observed to be 0.05 microg/mL and 2.5 microg/mL and the limit of quantitation is 0.2 microg/mL and 10 microg/mL, respectively. The method has shown good linearity in the range of 0.2 microg/mL to 0.65 pg/mL for alprazolam (R2 > 0.9953) and 10 pg/mL to 32.5 microg/mL for sertraline (R2 > 0.9942). The intra- and inter-assay (n=5) variations in the linear range are less than 4% for alprazolam and 6% for sertraline. Three pharmaceutical products containing this combination are analyzed to test the applicability of the new method. The percentage of alprazolam and sertraline in the tablets studied range from 97.7% to 102.82% and 96.5% to 99.9%, respectively.

Soluble scute proteins of healthy and ill desert tortoises (Gopherus agassizii)

USGS Publications Warehouse

Homer, B.L.; Li, C.; Berry, K.H.; Denslow, N.D.; Jacobson, E.R.; Sawyer, R.H.; Williams, J.E.

2001-01-01

Objectives - To characterize protein composition of shell scute of desert tortoises and to determine whether detectable differences could be used to identify healthy tortoises from tortoises with certain illnesses. Animals - 20 desert tortoises. Procedures - Complete postmortem examinations were performed on all tortoises. Plastron scute proteins were solubilized, scute proteins were separated by use of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and proteins were analyzed, using densitometry. Two-dimensional immobilized pH gradient-PAGE (2D IPG-PAGE) and immunoblot analysis, using polyclonal antisera to chicken-feather ?? keratin and to alligator-scale ?? keratin, were conducted on representative samples. The 14-kd proteins were analyzed for amino acid composition. Results - The SDS-PAGE and densitometry revealed 7 distinct bands, each with a mean relative protein concentration of > 1 %, ranging from 8 to 47 kd, and a major protein component of approximately 14 kd that constituted up to 75% of the scute protein. The 2D IPG-PAGE revealed additional distinct 62-and 68-kd protein bands. On immunoblot analysis, the 14-, 32-, and 45-kd proteins reacted with both antisera. The 14-kd proteins had an amino acid composition similar to that of chicken ?? keratins. There was a substantial difference in the percentage of the major 14-kd proteins from scute of ill tortoises with normal appearing shells, compared with 14-kd proteins of healthy tortoises. Conclusions and Clinical Relevance - The major protein components of shell scute of desert tortoises have amino acid composition and antigenic features of ?? keratins. Scute protein composition may be altered in tortoises with certain systemic illnesses.

Advanced glycation end product (AGE) modified proteins in tears of diabetic patients.

PubMed

Zhao, Zhenjun; Liu, Jingfang; Shi, Bingyin; He, Shuixiang; Yao, Xiaoli; Willcox, Mark D P

2010-08-11

High glucose level in diabetic patients may lead to advanced glycation end product (AGE) modified proteins. This study investigated AGE modified proteins in tears and compared their levels in diabetic patients (DM) with non-diabetic controls (CTL). Basal tears were collected from DM with (DR) or without (DNR) retinopathy and CTL. Total AGE modified proteins were detected quantitatively by a dot immunobinding assay. The AGE modified proteins were separated in 1D- and 2D-SDS gels and detected by western-blotting. The individual AGE modified proteins were also compared between groups using densitometry. Compared with the CTL group, tear concentrations of AGE modified proteins were significantly elevated in DR and DNR groups. The concentration of AGE modified proteins in diabetic tears were positively correlated with AGE modified hemoglobin (HbA1c) and postprandial blood glucose level (PBG). Western blotting of AGE modified proteins from 1D-SDS gels showed several bands, the major one at around 60 kDa. The intensities of AGE modified protein bands were higher in DM tears than in CTL tears. Western blotting from 2D-SDS gels showed a strongly stained horizontal strip, which corresponded to the major band in 1D-SDS gels. Most of the other AGE modified protein species were within molecular weight of 30-60 kDa, PI 5.2-7.0. Densitometry analysis demonstrated several AGE modified proteins were elevated in DR or DNR tears. Total and some individual AGE modified proteins were elevated in DM tears. AGE modified proteins in tears may be used as biomarkers to diagnose diabetes and/or diabetic retinopathy.

Past and current weight change and forearm bone loss in middle-aged women: the Nord-Trøndelag Health Study, Norway.

PubMed

Forsmo, Siri; Langhammer, Arnulf; Schei, Berit

2009-01-01

The aim of this study was to investigate the association between bone loss and weight change before and concurrently to the assessment of forearm bone loss over 4.6 years in a population-based cohort of middle-aged women followed for more than 15 years. Among 8,856 women aged 45 to 60 years attending the first Nord-Trøndelag Health Study study, Norway (1984-1986), a 35% random sample was invited for forearm densitometry at Nord-Trøndelag Health Study 2 (1995-1997), and 2,188 women (78%) attended. After an average period of 4.6 years, they were subsequently invited for follow-up densitometry in 2001, and 1,421 women (67.8%) met. Weight and height were measured on all three occasions. During the total period of observation since baseline (15.5 y), the mean weight had increased by 3.4 kg, mostly in the youngest women. Weight loss had an accelerating and weight gain a decelerating effect on bone loss, and this was observed both for weight change occurring before the bone mineral density follow-up and for concurrent weight change. The relationship between prior weight gain or loss and bone loss seemed to persist, independent of the weight change observed during the period of bone loss assessment. Despite no mechanical impact of body weight on the forearm, weight loss in midlife women seems to be associated with a long-lasting negative effect on bone and vice versa for weight gain. This is presumably explained by humoral factors.

[Transversal study on the prevalence of Metabolic Bone Disease (MBD) and Home Parenteral Nutrition (HPN) in Spain: data from NADYA group].

PubMed

Martínez, C; Virgili, N; Cuerda, C; Chicharro, L; Gómez, P; Moreno, J M; Álvarez, J; Martí, E; Matía, P; Penacho, M A; Garde, C; De Luis, D; Gonzalo, M; Lobo, G

2010-01-01

Patients with intestinal failure who receive HPN are at high risk of developing MBD. The origin of this bone alteration is multifactorial and depends greatly on the underlying disease for which the nutritional support is required. Data on the prevalence of this disease in our environment is lacking, so NADYA-SEMPE group has sponsored this transversal study with the aim of knowing the actual MBD prevalence. Retrospective data from 51 patients from 13 hospitals were collected. The questionnaire included demographic data as well as the most clinically relevant for MBD data. Laboratory data (calciuria, PTH, 25 -OH -vitamin D) and the results from the first and last bone densitometry were also registered. Bone mineral density had only been assessed by densitometry in 21 patients at the moment HPN was started. Bone quality is already altered before HPN in a significant percentage of cases (52%). After a mean follow up of 6 years, this percentage increases up to 81%. Due to retrospective nature of the study and the low number of subjects included it has not been possible to determine the role that HPN plays in MBD etiology. Only 35% of patients have vitamin D levels above the recommended limits and the majority of them is not on specific supplementation. HPN is associated with very high risk of MBD, therefore, management protocols that can lead to early detection of the problem as well as guiding for follow up and treatment of these patients are needed.

Quality initiatives: improving patient flow for a bone densitometry practice: results from a Mayo Clinic radiology quality initiative.

PubMed

Aakre, Kenneth T; Valley, Timothy B; O'Connor, Michael K

2010-03-01

Lean Six Sigma process improvement methodologies have been used in manufacturing for some time. However, Lean Six Sigma process improvement methodologies also are applicable to radiology as a way to identify opportunities for improvement in patient care delivery settings. A multidisciplinary team of physicians and staff conducted a 100-day quality improvement project with the guidance of a quality advisor. By using the framework of DMAIC (define, measure, analyze, improve, and control), time studies were performed for all aspects of patient and technologist involvement. From these studies, value stream maps for the current state and for the future were developed, and tests of change were implemented. Comprehensive value stream maps showed that before implementation of process changes, an average time of 20.95 minutes was required for completion of a bone densitometry study. Two process changes (ie, tests of change) were undertaken. First, the location for completion of a patient assessment form was moved from inside the imaging room to the waiting area, enabling patients to complete the form while waiting for the technologist. Second, the patient was instructed to sit in a waiting area immediately outside the imaging rooms, rather than in the main reception area, which is far removed from the imaging area. Realignment of these process steps, with reduced technologist travel distances, resulted in a 3-minute average decrease in the patient cycle time. This represented a 15% reduction in the initial patient cycle time with no change in staff or costs. Radiology process improvement projects can yield positive results despite small incremental changes.

Clinical Guidelines for Management of Bone Health in Rett Syndrome Based on Expert Consensus and Available Evidence.

PubMed

Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny

2016-01-01

We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity.

Usefulness of the Trabecular Bone Score for assessing the risk of osteoporotic fracture.

PubMed

Redondo, L; Puigoriol, E; Rodríguez, J R; Peris, P; Kanterewicz, E

2018-04-01

The trabecular bone score (TBS) is an imaging technique that assesses the condition of the trabecular microarchitecture. Preliminary results suggest that TBS, along with the bone mineral density assessment, could improve the calculation of the osteoporotic fracture risk. The aim of this study was to analyse TBS values and their relationship with the clinical characteristics, bone mineral density and history of fractures of a cohort of posmenopausal women. We analysed 2,257 posmenopausal women from the FRODOS cohort, which was created to determine the risk factors for osteoporotic fracture through a clinical survey and bone densitometry with vertebral morphometry. TBS was applied to the densitometry images. TBS values ≤1230 were considered indicative of degraded microarchitecture. We performed a simple and multiple linear regression to determine the factors associated with this index. The mean TBS value in L1-L4 was 1.203±0.121. Some 55.3% of the women showed values indicating degraded microarchitecture. In the multiple linear regression analysis, the factors associated with low TBS values were age, weight, height, spinal T-score, glucocorticoid treatment, presence of type 2 diabetes and a history of fractures due to frailty. TBS showed microarchitecture degradation values in the participants of the FRODOS cohort and was associated with anthropometric factors, low bone mineral density values, the presence of fractures, a history of type 2 diabetes mellitus and the use of glucocorticoids. Copyright © 2017 Elsevier España, S.L.U. and Sociedad Española de Medicina Interna (SEMI). All rights reserved.

Comparison of fresh fuel experimental measurements to MCNPX calculations using self-interrogation neutron resonance densitometry

NASA Astrophysics Data System (ADS)

LaFleur, Adrienne M.; Charlton, William S.; Menlove, Howard O.; Swinhoe, Martyn T.

2012-07-01

A new non-destructive assay technique called Self-Interrogation Neutron Resonance Densitometry (SINRD) is currently being developed at Los Alamos National Laboratory (LANL) to improve existing nuclear safeguards measurements for Light Water Reactor (LWR) fuel assemblies. SINRD consists of four 235U fission chambers (FCs): bare FC, boron carbide shielded FC, Gd covered FC, and Cd covered FC. Ratios of different FCs are used to determine the amount of resonance absorption from 235U in the fuel assembly. The sensitivity of this technique is based on using the same fissile materials in the FCs as are present in the fuel because the effect of resonance absorption lines in the transmitted flux is amplified by the corresponding (n,f) reaction peaks in the fission chamber. In this work, experimental measurements were performed in air with SINRD using a reference Pressurized Water Reactor (PWR) 15×15 low enriched uranium (LEU) fresh fuel assembly at LANL. The purpose of this experiment was to assess the following capabilities of SINRD: (1) ability to measure the effective 235U enrichment of the PWR fresh LEU fuel assembly and (2) sensitivity and penetrability to the removal of fuel pins from an assembly. These measurements were compared to Monte Carlo N-Particle eXtended transport code (MCNPX) simulations to verify the accuracy of the MCNPX model of SINRD. The reproducibility of experimental measurements via MCNPX simulations is essential to validating the results and conclusions obtained from the simulations of SINRD for LWR spent fuel assemblies.

Void fraction, bubble size and interfacial area measurements in co-current downflow bubble column reactor with microbubble dispersion

DOE PAGES

Hernandez-Alvarado, Freddy; Kalaga, Dinesh V.; Turney, Damon; ...

2017-05-06

Micro-bubbles dispersed in bubble column reactors have received great interest in recent years, due to their small size, stability, high gas-liquid interfacial area concentrations and longer residence times. The high gas-liquid interfacial area concentrations lead to high mass transfer rates compared to conventional bubble column reactors. In the present work, experiments have been performed in a down-flow bubble column reactor with micro-bubbles generated and dispersed by a novel mechanism to determine the gas-liquid interfacial area concentrations by measuring the void fraction and bubble size distributions. Gamma-ray densitometry has been employed to determine the axial and radial distributions of void fractionmore » and a high speed camera equipped with a borescope is used to measure the axial and radial variations of bubble sizes. Also, the effects of superficial gas and liquid velocities on the two-phase flow characteristics have been investigated. Further, reconstruction techniques of the radial void fraction profiles from the gamma densitometry's chordal measurements are discussed and compared for a bubble column reactor with dispersed micro-bubbles. The results demonstrate that the new bubble generation technique offers high interfacial area concentrations (1,000 to 4,500 m 2/m 3) with sub-millimeter bubbles (500 to 900 µm) and high overall void fractions (10% – 60%) in comparison with previous bubble column reactor designs. The void fraction data was analyzed using slip velocity model and empirical correlation has been proposed to predict the Sauter mean bubble diameter.« less

Void fraction, bubble size and interfacial area measurements in co-current downflow bubble column reactor with microbubble dispersion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez-Alvarado, Freddy; Kalaga, Dinesh V.; Turney, Damon

Micro-bubbles dispersed in bubble column reactors have received great interest in recent years, due to their small size, stability, high gas-liquid interfacial area concentrations and longer residence times. The high gas-liquid interfacial area concentrations lead to high mass transfer rates compared to conventional bubble column reactors. In the present work, experiments have been performed in a down-flow bubble column reactor with micro-bubbles generated and dispersed by a novel mechanism to determine the gas-liquid interfacial area concentrations by measuring the void fraction and bubble size distributions. Gamma-ray densitometry has been employed to determine the axial and radial distributions of void fractionmore » and a high speed camera equipped with a borescope is used to measure the axial and radial variations of bubble sizes. Also, the effects of superficial gas and liquid velocities on the two-phase flow characteristics have been investigated. Further, reconstruction techniques of the radial void fraction profiles from the gamma densitometry's chordal measurements are discussed and compared for a bubble column reactor with dispersed micro-bubbles. The results demonstrate that the new bubble generation technique offers high interfacial area concentrations (1,000 to 4,500 m 2/m 3) with sub-millimeter bubbles (500 to 900 µm) and high overall void fractions (10% – 60%) in comparison with previous bubble column reactor designs. The void fraction data was analyzed using slip velocity model and empirical correlation has been proposed to predict the Sauter mean bubble diameter.« less

[Clinical observation on corneal transparency after small incision lenticule extraction surgery].

PubMed

Zhang, L; Wang, Y; Cui, T; Zhao, W; Cheng, W B

2018-01-11

Objective: To evaluate the changes of corneal transparency over the 1-year period after small incision lenticule extraction (SMILE) according to corneal Scheimpflug densitometry. Methods: Prospective cohort study. Fifty-five patients (100 eyes) with myopia (19 male and 36 female, aged 18 to 39 years with average of 24) who underwent SMILE and regular follow-up for at least 1 year at Tianjin Eye Hospital were enrolled. Examinations took place before SMILE and postoperatively at 1 day, 1 week, and 1, 3, 6, and 12 months. The preoperative spherical equivalent of surgical refractive correction was (-5.75±1.64) D. Corneal densitometry (CD) data were calculated automatically by the Pentacam Scheimpflug system and expressed in gray scale units (GSU), from 0 (completely transparent) to 100 (completely opaque). During the analysis of corneal densitometry, the average corneal optical density of three concentric radial zones centered on the apex of the cornea ≤2 mm, >2 mm and ≤6 mm, >6 mm and ≤10 mm diameter) were applied, and three layers were defined according to different corneal depths (the anterior 120 μm as 1st layer, and the posterior 60 μm as 3rd layer, and the center part between them of the cornea as 2nd layer). The automatic release mode was applied in order to avoid operator-induced errors. The preoperative and postoperative values in different corneal layers and different concentric radial zones were compared using Kruskal-Wallis. Results: Ninty-three eyes(93%) of all eyes achieved uncorrected distance visual acuity (UCVA) of 0.8 or better on the first day postoperatively, and 96% (96 of 100 eyes) achieved UCVA of 0.8 or better in the first week postoperatevely, and all eyes 100% (100 of 100 eyes) achieved UCVA 0.8 or better until the end of our follow-up (in 1 year postoperatively). In general, the difference preoperative and postoperative corneal average optical density is of no statistical significance (χ(2)=8.446, P =0.207), specifically, the overall postoperative CD increased in the first week after surgery (1 day to 15.90, 1 week to 15.65), and then decreased to the equivalent of baseline levels and maintained such level until 6 months after surgery (1 month to 15.60; 3 month to 15.50, 6 month to 15.55), though at the 12-month follow-up, densitometry values had spiked significantly again (12 month, 15.90). The difference between the preoperative and postoperative CD values in the central two zones (≤2 mm, >2 mm and ≤6 mm), but not the outer (>6 mm and ≤10 mm), were of statistical significance (χ(2)=61.961, 52.397, P< 0.000). When subdivided by corneal layer, significant changes in CD were detected in the anterior 120 μm layer (χ(2)=27.774, P< 0.000). The CD increased significantly (i.e., corneal transparency decreased) as compared to the preoperative baseline on the first postoperative day, and lasted through the first week. There were no significant changes in the CD of the central layer (χ(2)=0.918, P =0.986). Significant increases in the posterior 60 μm of the cornea after surgery were found only at the 6-month and 1-year follow-up examinations (χ(2)=17.469, P= 0.008). No correlation was found in the preoperative refractive error, ablation depth, postoperative UCVA and the CD. The CD at 6 months was found negatively correlated with SE at 6 months ( r= -0.219, P =0.028). Conclusions: SMILE reduced corneal transparency temporarily and primarily within the surgically altered area, however such change has no significant correlation with the ablation depth, SE, and the postoperative UCVA. Transparency recovered within a month, but patients should be monitored for at least 1 year. (Chin J Ophthalmol, 2018, 54: 27-32) .

Proposal to evaluate the use of ERTS-A imagery in mapping and managing soil and range resources in the Sand Hills Region of Nebraska

NASA Technical Reports Server (NTRS)

Drew, J. V. (Principal Investigator)

1973-01-01

The author has identified the following significant results. There appears to be a direct relationship between densitometry values obtained with MSS band 5 imagery and forage density for those range sites measured on the imagery, provided site category identification is indicated by other forms of imagery or ground truth. Overlap of density values for different site categories with differing forage condition classes does not allow assigning a given forage density value for a given densitometer value unless the range site category is known.

Densitometry and temperature measurement of combustion gas by X-ray Compton scattering

PubMed Central

Sakurai, Hiroshi; Kawahara, Nobuyuki; Itou, Masayoshi; Tomita, Eiji; Suzuki, Kosuke; Sakurai, Yoshiharu

2016-01-01

Measurement of combustion gas by high-energy X-ray Compton scattering is reported. The intensity of Compton-scattered X-rays has shown a position dependence across the flame of the combustion gas, allowing us to estimate the temperature distribution of the combustion flame. The energy spectra of Compton-scattered X-rays have revealed a significant difference across the combustion reaction zone, which enables us to detect the combustion reaction. These results demonstrate that high-energy X-ray Compton scattering can be employed as an in situ technique to probe inside a combustion reaction. PMID:26917151

Dynamics of distribution and density of phreatophytes and other arid land plant communities

NASA Technical Reports Server (NTRS)

Turner, R. M. (Principal Investigator)

1973-01-01

The author has identified the following significant results. Ground truth measurements of plant coverage on six satellite overflight dates reveal unique trends in coverage for the five desert or semi-desert communities selected. Densitometry and multispectral additive color viewing were used in a preliminary analysis of imagery using the electronic satellite image analyzer console at Stanford Research Institute. The densitometric analysis shows promise for mapping boundaries between plant communities. Color additive viewing of a chronologic sequence of the same scene shown in rapid order will provide a method for mapping phreatophyte communities.

Dietary supplements and medical foods for osteopenia and osteoporosis.

PubMed

Morgan, Sarah L

2013-01-01

Dietary supplements, medical foods, and pharmaceutical agents are all used in the management of metabolic bone disease. The intended populations, governing regulations, safety standards scientific requirements, physician supervision, and distribution vary markedly between supplements, medical foods, and drugs. This article will review characteristics of dietary supplements and medical foods and their use in osteoporosis care. A study that compares the pharmacokinetics of a supplement and a medical food containing similar ingredients is used to contrast the categories of dietary supplements and medical foods. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Continuous monitoring of blood volume changes in humans

NASA Technical Reports Server (NTRS)

Hinghofer-Szalkay, H.; Greenleaf, J. E.

1987-01-01

Use of on-line high-precision mass densitometry for the continuous monitoring of blood volume changes in humans was demonstrated by recording short-term blood volume alterations produced by changes in body position. The mass density of antecubital venous blood was measured continuously for 80 min per session with 0.1 g/l precision at a flow rate of 1.5 ml/min. Additional discrete plasma density and hematocrit measurements gave linear relations between all possible combinations of blood density, plasma density, and hematocrit. Transient filtration phenomena were revealed that are not amenable to discontinuous measurements.

Densitometry and temperature measurement of combustion gas by X-ray Compton scattering.

PubMed

Sakurai, Hiroshi; Kawahara, Nobuyuki; Itou, Masayoshi; Tomita, Eiji; Suzuki, Kosuke; Sakurai, Yoshiharu

2016-03-01

Measurement of combustion gas by high-energy X-ray Compton scattering is reported. The intensity of Compton-scattered X-rays has shown a position dependence across the flame of the combustion gas, allowing us to estimate the temperature distribution of the combustion flame. The energy spectra of Compton-scattered X-rays have revealed a significant difference across the combustion reaction zone, which enables us to detect the combustion reaction. These results demonstrate that high-energy X-ray Compton scattering can be employed as an in situ technique to probe inside a combustion reaction.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modem video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Linear Calibration of Radiographic Mineral Density Using Video-Digitizing Methods

NASA Technical Reports Server (NTRS)

Martin, R. Bruce; Papamichos, Thomas; Dannucci, Greg A.

1990-01-01

Radiographic images can provide quantitative as well as qualitative information if they are subjected to densitometric analysis. Using modern video-digitizing techniques, such densitometry can be readily accomplished using relatively inexpensive computer systems. However, such analyses are made more difficult by the fact that the density values read from the radiograph have a complex, nonlinear relationship to bone mineral content. This article derives the relationship between these variables from the nature of the intermediate physical processes, and presents a simple mathematical method for obtaining a linear calibration function using a step wedge or other standard.

Effects of anticonvulsants and inactivity on bone disease in epileptics

PubMed Central

Murchison, Lilian E.; Bewsher, P. D.; Chesters, Marion; Gilbert, J.; Catto, G.; Law, Elizabeth; McKay, E.; Ross, H. S.

1975-01-01

No significant biochemical or radiological features of vitamin D deficiency were found in groups of juvenile and adult epileptics and control groups of non-epileptic patients in hospitals for the mentally retarded. There was evidence of hepatic enzyme induction in patients on anticonvulsants, in that urinary D-glucaric acid concentration and excretion were raised. No effect was found of prolonged anticonvulsant therapy on bone densitometry, but in children immobility was closely associated with decreased bone density. The evidence suggests that disuse osteoporosis is the major bone disease in these mentally retarded children. PMID:1161672

Remote sensing techniques applied to multispectral recognition of the Aranjuez pilot zone

NASA Technical Reports Server (NTRS)

Lemos, G. L.; Salinas, J.; Rebollo, M.

1977-01-01

A rectangular (7 x 14 km) area 40 km S of Madrid was remote-sensed with a three-stage recognition process. Ground truth was established in the first phase, airborne sensing with a multispectral scanner and photographic cameras were used in the second phase, and Landsat satellite data were obtained in the third phase. Agronomic and hydrological photointerpretation problems are discussed. Color, black/white, and labeled areas are displayed for crop recognition in the land-use survey; turbidity, concentrations of pollutants and natural chemicals, and densitometry of the water are considered in the evaluation of water resources.

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY

PubMed Central

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2015-01-01

Objective: To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. Methods: 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. Results: The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). Conclusion: US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age. PMID:27027001

CORRELATION BETWEEN CALCANEAL BONE ULTRASOUND MEASUREMENTS AND DENSITOMETRY AMONG POSTMENOPAUSAL WOMEN WITH FRACTURES CAUSED BY BONE FRAGILITY.

PubMed

Moraes, Frederico Barra; Oliveira, Lindomar Guimarães de; Novais, Pierre de Souza; Melo, Murilo Rodrigues; Guimarães, Mara Lúcia Rassi

2011-01-01

To assess the correlation between ultrasound (US) measurement on the calcaneus and bone densitometry (DEXA), among postmenopausal women who already presented fragility fractures. 35 postmenopausal women over 40 years of age, with the ability to walk and presenting osteoporotic fractures of the wrist or spine, without previous treatment for osteoporosis, were analyzed in a retrospective cohort. Of these, 16 were under 60 and 19 were over 60. The broadband ultrasound attenuation (BUA) and speed of sound (SOS) were compared using DEXA (L1-L4, total femur, femoral neck and wrist). Two different values of BUA were used as cutoff points for osteoporosis: BUA < 60 dB/MHz and BUA < 64 dB/MHz (P < 0.05); and SOS < 1600 m/s. The confidence interval was 95%. The DEXA and US data were plotted on dispersion graphs and, through linear regression, it was possible to establish correlations. Following this, the sample was stratified according to age (up to 60 years and 60 years and over). Thus, the values were again compared and correlated. The best correlation obtained between DEXA and US was between the T-score of the wrist and BUA < 64 dB/MHz, with 92% sensitivity and 95% specificity. Better sensitivity at all DEXA sites was obtained when US was performed on patients over 60 years of age. The SOS compatible with osteoporosis was < 1592.5 m/s (89% sensitivity and 85% specificity). US on the calcaneus can be used for screening the risk of osteoporosis fractures, using a cutoff of BUA < 64 dB/MHz, especially among patients over 60 years of age.

Effect of post crosslinking haze on the repeatability of Scheimpflug-based and slit-scanning imaging devices

PubMed Central

Shetty, Rohit; Agrawal, Aarti; Deshmukh, Rashmi; Kaweri, Luci; Rao, Harsha L; Nagaraja, Harsha; Jayadev, Chaitra

2017-01-01

Purpose: The aim of this study was to analyze the effect of postcollagen crosslinking (CXL) haze on the measurement and repeatability of pachymetry and mean keratometry (Km) of four corneal topographers. Materials and Methods: Sixty eyes of sixty patients with progressive keratoconus who had undergone accelerated CXL (ACXL) underwent imaging with a scanning slit imaging device (Orbscan II) and three Scheimpflug imaging devices (Pentacam HR, Sirius, and Galilei). Post-ACXL haze was measured using the densitometry software on the Pentacam HR. Readings of the thinnest corneal thickness (TCT) and Km from three scans of each device were analyzed. Effect of haze on the repeatability of TCT and Km measurements was evaluated using regression models. Repeatability was assessed by coefficient of variation. Results: Corneal densitometry in different zones affected the repeatability of TCT measurement of Orbscan (P < 0.05) significantly but not the repeatability of TCT with Pentacam HR and Sirius (P = 0.03 and 0.05, respectively). Km values were affected by haze when measured with the Pentacam HR (P < 0.05). The repeatability of Km readings for all devices was unaffected by haze. In the anterior 0–2 mm and 2–6 mm zone, TCT (P = 0.43 and 0.45, respectively), Km values (P = 0.4 and 0.6, respectively), repeatability of TCT (P = 0.1 in both zones), and Km (P = 0.5 and 0.1, respectively) with Galilei were found to be the most reliable. Conclusion: Galilei measurements appear to be least affected by post-ACXL haze when compared with other devices. Hence, topography measurements in the presence of haze need to be interpreted with caution. PMID:28513495

Performance of clinical referral criteria for bone densitometry in patients under 65 years of age assessed by spine bone mineral density

PubMed Central

Kayan, K; de Takats, D; Ashford, R; Kanis, J; McCloskey, E

2003-01-01

Background: A case finding strategy based on a number of established risk factors has been suggested by Royal College of Physicians' (RCP) guidelines to optimise bone densitometry referrals for assessment of osteoporosis. Objective: The performance of clinical referral criteria was examined in women and men aged <65 years referred for bone mineral density (BMD) assessment. Study design: Cross sectional observational study over six months. Results: Though BMD tended to be lower in patients with multiple criteria for referral, differences from those referred with a single criterion were not statistically significant. The overall prevalence of osteoporosis was higher than expected in both sexes, 11.6% in women and 27.5% in men (expected prevalences were 8% and <1% respectively). BMD was significantly lower in patients referred with a single criterion compatible with the RCP guidelines than in age matched controls or in those patients referred with non-RCP criteria (mean (SD) Z score –0.47(1.38) v 0.35(1.41), p<0.001). Low body mass index was also significantly associated with a lower than expected BMD. In contrast, spine BMD was higher than expected in those with self reported back pain, loss of height, or spinal curvature (p = NS). Conclusion: Most of the criteria recommended by the RCP performed well in identifying relatively younger patients with low BMD and osteoporosis. However, prior fractures and corticosteroid use did not reach statistical significance probably due to inclusion of all energy fractures, and current or past steroid use of unspecified dose or duration. Criteria like loss of height and/or spine curvature perform relatively poorly, reflecting the need for further investigation to better identify those needing BMD assessment. PMID:14612601

Trace metal analysis by laser ablation-inductively coupled plasmamass spectrometry and x-ray K-edge densitometry of forensic samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berry, Jonna Elizabeth

This dissertation describes a variety of studies on the determination of trace elements in samples with forensic importance. Laser ablation-inductively coupled plasma-mass spectrometry (LA-ICP-MS) was used to determine the trace element composition of numerous lipstick samples. Lipstick samples were determined to be homogeneous. Most lipstick samples of similar colors were readily distinguishable at a 95% confidence interval based on trace element composition. Numerous strands of a multi-strand speaker cable were analyzed by LA-ICP-MS. The strands in this study are spatially heterogeneous in trace element composition. In actual forensic applications, the possibility of spatial heterogeneity must be considered, especially in casesmore » where only small samples (e.g., copper wire fragments after an explosion) are available. The effects of many unpredictable variables, such as weather, temperature, and human activity, on the retention of gunshot residue (GSR) around projectile wounds were assessed with LAICP- MS. Skin samples around gunshot and stab wounds and larvae feeding in and around the wounds on decomposing pig carcasses were analyzed for elements consistent with GSR (Sb, Pb, Ba, and Cu). These elements were detected at higher levels in skin and larvae samples around the gunshot wounds compared to the stab wounds for an extended period of time throughout decomposition in both a winter and summer study. After decomposition, radiographic images of the pig bones containing possible damage from bullets revealed metallic particles embedded within a number of bones. Metallic particles within the bones were analyzed with x-ray, K-edge densitometry and determined to contain lead, indicating that bullet residue can be retained throughout decomposition and detected within bones containing projectile trauma.« less

Relationship between metabolic syndrome and its components with bone densitometry in postmenopausal women.

PubMed

Abbasi, Mahnaz; Farzam, Seyed Amir; Mamaghani, Zahra; Yazdi, Zohreh

2017-11-01

Prevention of osteoporosis and bone fracture and the relationship between metabolic syndrome and bone density are controversial issues. The aim of this study was to evaluate the association between metabolic syndrome and its components with bone mineral density in post menopausal women referred for bone mineral density (BMD) test. A total of 143 postmenopausal women with at least one year of menopause experience participated in this cross-sectional study. Demographic and anthropometric characteristics for all participants were collected. Also, biochemical parameters including fasting blood sugar, Cholesterol (HDL and LDL), triglyceride were measured. Association between the components of metabolic syndrome and bone densitometry were analyzed by statistical methods. In this study, 72% of participants did not have metabolic syndrome. Among them, 43.4% and 28.7% had osteoporosis and normal density, respectively. Of remaining participants with metabolic syndrome, 12.6% and 15.4% had osteoporosis and normal density, respectively. Among the metabolic syndrome components, waist circumference, HDL cholesterol, and waist to hip ratio were significantly associated with bone mass (P<0.05). Osteoporotic women had lower waist circumference and waist to hip ratio and higher HDL than women without osteoporosis. On the other hand, women with metabolic syndrome did not have significant differences than women without metabolic syndrome in terms of lumbar and femoral neck density (P>0.05). Results from this study showed that metabolic syndrome and its components did not induce bone mass loss. The discrepancies of the studies in this area call for more large scale studies in population so as to prevent women problems in this area. Copyright © 2016 Diabetes India. Published by Elsevier Ltd. All rights reserved.

Validation of a thin-layer chromatography/densitometry method for the characterization of invertase activity.

PubMed

Ferey, Justine; Da Silva, David; Bravo-Veyrat, Sophie; Lafite, Pierre; Daniellou, Richard; Maunit, Benoît

2016-12-16

This paper presents a kinetic study of invertase, a specific fructofuranosidase cloned from the Leishmania major genome. The kinetic parameters of the β-d-fructofuranosidase from Leishmania major (BfrA) were determined using Thin-Layer Chromatography (TLC) and UV-densitometry (TLC@UV) specifically developed for the separation and detection of three carbohydrates namely sucrose, glucose and fructose. Separation was performed on TLC silica gel 60 F254 plates impregnated with sodium bisulphate and citrate and heated prior to development. This fast and easy separation was performed with two successive developments using ACN/H 2 O 80/20 (v/v) as mobile phase. Sensitive and repeatable derivatization of sugars was achieved by dipping the plates in a solution of 4-aminobenzoic acid. Quantification was performed by UV-detection. The method was validated according to ICH guidelines Q2(R1) in terms of specificity, limits of detection and quantification, precision and robustness (with n=3 replicates and CV ≤10%). The characterization of BfrA reaction kinetic was performed by monitoring the accumulation of either glucose or fructose detected by TLC@UV. Hydrolysis of sucrose was described by the Michaelis-Menten kinetic parameters (K M ; V max ) respectively equal to 63.09±7.590mM; 0.037±0.00094mM/min using glucose production and 83.01±14.39mM; 0.031±0.0021mM/min monitoring fructose. Hydrolyses of three alternative substrates, raffinose, stachyose and inulin, were also compared and the regiospecificity of the reaction was characterized. This TLC@UV method is shown to be suitable for the refined kinetic analysis of different reactions related to the hydrolysis of sugars. Copyright © 2016. Published by Elsevier B.V.

A simple 96 well microfluidic chip combined with visual and densitometry detection for resource-poor point of care testing

PubMed Central

Yang, Minghui; Sun, Steven; Kostov, Yordan

2010-01-01

There is a well-recognized need for low cost biodetection technologies for resource-poor settings with minimal medical infrastructure. Lab-on-a-chip (LOC) technology has the ability to perform biological assays in such settings. The aim of this work is to develop a low cost, high-throughput detection system for the analysis of 96 samples simultaneously outside the laboratory setting. To achieve this aim, several biosensing elements were combined: a syringe operated ELISA lab-on-a-chip (ELISA-LOC) which integrates fluid delivery system into a miniature 96-well plate; a simplified non-enzymatic reporter and detection approach using a gold nanoparticle-antibody conjugate as a secondary antibody and silver enhancement of the visual signal; and Carbon nanotubes (CNT) to increase primary antibody immobilization and improve assay sensitivity. Combined, these elements obviate the need for an ELISA washer, electrical power for operation and a sophisticated detector. We demonstrate the use of the device for detection of Staphylococcal enterotoxin B, a major foodborne toxin using three modes of detection, visual detection, CCD camera and document scanner. With visual detection or using a document scanner to measure the signal, the limit of detection (LOD) was 0.5ng/ml. In addition to visual detection, for precise quantitation of signal using densitometry and a CCD camera, the LOD was 0.1ng/ml for the CCD analysis and 0.5 ng/ml for the document scanner. The observed sensitivity is in the same range as laboratory-based ELISA testing. The point of care device can analyze 96 samples simultaneously, permitting high throughput diagnostics in the field and in resource poor areas without ready access to laboratory facilities or electricity. PMID:21503269

Cough-induced rib fractures.

PubMed

Hanak, Viktor; Hartman, Thomas E; Ryu, Jay H

2005-07-01

To define the demographic, clinical, and radiological features of patients with cough-induced rib fractures and to assess potential risk factors. For this retrospective, single-center study, we identified all cases of cough-induced rib fractures diagnosed at the Mayo Clinic in Rochester, Minn, over a 9-year period between January 1, 1996, and January 31, 2005. Bone densitometry data from patients' medical records were analyzed, and T scores were used to classify patients into bone density categories. The mean +/- SD age of the 54 study patients at presentation was 55+/-17 years, and 42 patients (78%) were female. Patients presented with chest wall pain after onset of cough. Rib fracture was associated with chronic cough (> or =3 weeks' duration) in 85% of patients. Rib fractures were documented by chest radiography, rib radiography, computed tomography, or bone scan. Chest radiography had been performed in 52 patients and revealed rib fracture in 30 (58%). There were 112 fractured ribs in 54 patients. One half of patients had more than one fractured rib. Right-sided rib fractures alone were present in 17 patients (26 fractured ribs), left-sided in 23 patients (35 fractured ribs), and bilateral in 14 patients (51 fractured ribs). The most commonly fractured rib on both sides was rib 6. The fractures were most common at the lateral aspect of the rib cage. Bone densitometry was done in 26 patients and revealed osteopenia or osteoporosis in 17 (65%). Cough-induced rib fractures occur primarily in women with chronic cough. Middle ribs along the lateral aspect of the rib cage are affected most commonly. Although reduced bone density is likely a risk factor, cough-induced rib fractures can occur in the presence of normal bone density.

Anti-inflammatory activity of Crateva adansonii DC on keratinocytes infected by Staphylococcus aureus: From traditional practice to scientific approach using HPTLC-densitometry.

PubMed

Ahama-Esseh, Kplolali; Bodet, Charles; Quashie-Mensah-Attoh, Akossiwa; Garcia, Magali; Théry-Koné, Isabelle; Dorat, Joelle; De Souza, Comlan; Enguehard-Gueiffier, Cécile; Boudesocque-Delaye, Leslie

2017-05-23

Leaves of Crateva adansonii DC (Capparidaceae), a small bush found in Togo, are widely used in traditional medicine to cure infectious abscesses. Traditional healers of Lomé harvest only budding leaves early in the morning, in specific area in order to prepare their drugs. The main goal was to validate the ancestral picking practices, and to assess the activity of C. adansonii medicine towards infectious abscesses. A phytochemical screening of various C. adansonii leaf samples was performed using an original HPTLC-densitometry protocol and major flavonoids were identified and quantified. C. adansonii samples were collected in different neighborhoods of Lomé, at different harvesting-times and at different ages. Radical scavenging capacity, using DPPH assay, was used to quickly screen all extracts. Extracts were tested for anti-Staphylococcus aureus activity and anti-inflammatory effect on human primary keratinocytes infected by S. aureus. IL6, IL8 and TNFα expression and production were assessed by RT-PCR and ELISA assays. Using antioxidant activity as selection criteria, optimal extracts were obtained with budding leaves, collected at 5:00am in Djidjolé neighborhood. This extract showed the strongest anti-inflammatory effect on S. aureus-infected keratinocytes by reducing IL6, IL8 and TNFα expression and production. None of the extracts inhibited the growth of S. aureus. Those results validate the traditional practices and the potential of C. adansonii as anti-inflammatory drug. Our findings suggest that traditional healers should add to C. adansonii leaves an antibacterial plant of Togo Pharmacopeia, in order to improve abscess healing. Copyright © 2017 Elsevier Ireland Ltd. All rights reserved.

[Importance of the clinical profile in the postmenopausal osteoporosis screening by densitometry].

PubMed

Bigler, J M; Abetel, G; Krieg, M A; Wimpfheimer, C; Burnand, B; Thiébaud, D; Burckhardt, P

1996-08-06

In order to test the impact of a given risk profile on the incidence of osteoporosis which could justify BMD measurement, and that of a low risk profile which could render it unnecessary, BMD was measured in 217 women under 72 in whom menopause had occurred at least 6 years previously and who corresponded to one of the two following profiles: high risk (A, n = 102) = BMI < 27 kg/m2, with no estrogen replacement treatment, and with at least one of the following risk factors: BMI < 20, early menopause, positive family history, no dairy products associated with tobacco consumption (> 10 cigarettes/day for > 20 years and/or alcohol consumption of > 0.5 l wine/day during > 10 years, corticotherapy of > 6 months, rickets, anorexia nervosa. Low risk (B, n = 115) = absence of characteristics of group A, BMI > 27 kg/m2 with (B+, n = 24) or without estrogen therapy (B-, n = 91). BMD was measured by DXA in 4 centers using Lunar or Hologic equipment. Results were expressed in % of the mean of the respective young adult control groups. As expected, BMD was significantly different in these two subgroups of the population. Osteoporosis was diagnosed (BMD < 75% = < -2.5 SD, according to WHO) in 72% of group A, and in 17% (B+) and 19% (B-) respectively of group B. There was no difference between the various risk factors in group A concerning their impact on BMD, but concerning incidence, low BMI and early menopause were the most frequent. The high risk profile of group A seems to justify densitometry, since it leads to the diagnosis of osteoporosis in over 70%. However, the protective profile of group B does not exclude osteoporosis (risk still 20%); only in severe obesity (BMI > 33) does it drop to 1%.

Clinical Guidelines for Management of Bone Health in Rett Syndrome Based on Expert Consensus and Available Evidence

PubMed Central

Jefferson, Amanda; Leonard, Helen; Siafarikas, Aris; Woodhead, Helen; Fyfe, Sue; Ward, Leanne M.; Munns, Craig; Motil, Kathleen; Tarquinio, Daniel; Shapiro, Jay R.; Brismar, Torkel; Ben-Zeev, Bruria; Bisgaard, Anne-Marie; Coppola, Giangennaro; Ellaway, Carolyn; Freilinger, Michael; Geerts, Suzanne; Humphreys, Peter; Jones, Mary; Lane, Jane; Larsson, Gunilla; Lotan, Meir; Percy, Alan; Pineda, Mercedes; Skinner, Steven; Syhler, Birgit; Thompson, Sue; Weiss, Batia; Witt Engerström, Ingegerd; Downs, Jenny

2016-01-01

Objectives We developed clinical guidelines for the management of bone health in Rett syndrome through evidence review and the consensus of an expert panel of clinicians. Methods An initial guidelines draft was created which included statements based upon literature review and 11 open-ended questions where literature was lacking. The international expert panel reviewed the draft online using a 2-stage Delphi process to reach consensus agreement. Items describe the clinical assessment of bone health, bone mineral density assessment and technique, and pharmacological and non-pharmacological interventions. Results Agreement was reached on 39 statements which were formulated from 41 statements and 11 questions. When assessing bone health in Rett syndrome a comprehensive assessment of fracture history, mutation type, prescribed medication, pubertal development, mobility level, dietary intake and biochemical bone markers is recommended. A baseline densitometry assessment should be performed with accommodations made for size, with the frequency of surveillance determined according to individual risk. Lateral spine x-rays are also suggested. Increasing physical activity and initiating calcium and vitamin D supplementation when low are the first approaches to optimizing bone health in Rett syndrome. If individuals with Rett syndrome meet the ISCD criterion for osteoporosis in children, the use of bisphosphonates is recommended. Conclusion A clinically significant history of fracture in combination with low bone densitometry findings is necessary for a diagnosis of osteoporosis. These evidence and consensus-based guidelines have the potential to improve bone health in those with Rett syndrome, reduce the frequency of fractures, and stimulate further research that aims to ameliorate the impacts of this serious comorbidity. PMID:26849438

Official Positions for FRAX® clinical regarding rheumatoid arthritis from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Broy, Susan B; Tanner, S Bobo

2011-01-01

Rheumatoid arthritis is the only secondary cause of osteoporosis that is considered independent of bone density in the FRAX(®) algorithm. Although input for rheumatoid arthritis in FRAX(®) is a dichotomous variable, intuitively, one would expect that more severe or active disease would be associated with a greater risk for fracture. We reviewed the literature to determine if specific disease parameters or medication use could be used to better characterize fracture risk in individuals with rheumatoid arthritis. Although many studies document a correlation between various parameters of disease activity or severity and decreased bone density, fewer have associated these variables with fracture risk. We reviewed these studies in detail and concluded that disability measures such as HAQ (Health Assessment Questionnaire) and functional class do correlate with clinical fractures but not morphometric vertebral fractures. One large study found a strong correlation with duration of disease and fracture risk but additional studies are needed to confirm this. There was little evidence to correlate other measures of disease such as DAS (disease activity score), VAS (visual analogue scale), acute phase reactants, use of non-glucocorticoid medications and increased fracture risk. We concluded that FRAX(®) calculations may underestimate fracture probability in patients with impaired functional status from rheumatoid arthritis but that this could not be quantified at this time. At this time, other disease measures cannot be used for fracture prediction. However only a few, mostly small studies addressed other disease parameters and further research is needed. Additional questions for future research are suggested. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Management of hypogonadism in adolescent girls and adult women with Prader-Willi syndrome.

PubMed

Eldar-Geva, Talia; Hirsch, Harry J; Pollak, Yehuda; Benarroch, Fortu; Gross-Tsur, Varda

2013-12-01

Prader-Willi syndrome (PWS) is a neurodevelopmental disorder characterized by an insatiable appetite, dysmorphic features, cognitive and behavioral difficulties, and hypogonadism. The heterogeneous reproductive hormone profiles indicate that some PWS women may have symptoms of hypoestrogenism, while others may potentially be fertile. We describe our experience in the assessment and treatment of hypogonadism in adolescents and adult females with PWS. The study population consisted of 20 PWS females, age ≥16 years (27.3 ± 7.9 years), followed in our clinic (12 deletion, 7 uniparental disomy, 1 imprinting-center defect). General physical examination, pubertal assessment, body mass index (BMI), gynecological examination, ultrasonography, bone densitometry, and hormonal profiles [FSH, LH, inhibin B, estradiol, prolactin, and TSH] were performed. The relevant assessed factors were: FSH and inhibin B, menstrual cycles (oligo/amenorrhea or irregular bleeding), ultrasound findings (endometrial thickness, uterine/ovarian abnormalities), BMI, bone densitometry, and patient/caregivers attitude. We classified seven women with inhibin B >20 ng/ml as potentially fertile. Following the assessment of the above factors, we recommended the individual-specific treatment; contraceptive pills, intra-uterine device, estrogen/progesterone replacement, and cyclic progesterone, in 3, 1, 4, and 1 patients, respectively. Four patients did not follow our recommendations due to poor compliance or family refusal. We recommended contraception pills for one 26-year-old woman with inhibin B and FSH levels 53 ng/ml and 6.4 IU/L; however, she refused treatment, conceived spontaneously and had an abortion. Guidelines for hormonal replacement therapy in PWS need to be tailored individually depending on physical development, hormonal profiles, bone density, and emotional and social needs of each PWS adolescent and adult. © 2013 Wiley Periodicals, Inc.

Effects of Curcumin on Bone Loss and Biochemical Markers of Bone Turnover in Patients with Spinal Cord Injury.

PubMed

Hatefi, Masoud; Ahmadi, Mohammad Reza Hafezi; Rahmani, Asghar; Dastjerdi, Masoud Moghadas; Asadollahi, Khairollah

2018-06-01

Osteoporosis is one of the most common problems of patients with spinal cord injuries (SCIs). The current study aimed to evaluate the antiosteoporotic effects of curcumin on densitometry parameters and biomarkers of bone turnovers among patients with SCI. The current controlled clinical trial was conducted among 100 patients with SCI referred to an outpatient clinic of rehabilitation in Ilam City, Iran, in 2013-2015. The intervention group received 110/mg/kg/day curcumin for 6 months and the control group received placebo. Bone mineral density (BMD) was measured in all patients. The level of procollagen type I N-terminal propeptide, serum carboxy-terminal telopeptide of type I collagen, osteocalcin, and bone-specific alkaline phosphates were compared before and after study. BMD indicators of lumbar, femoral neck, and total hip in the control group significantly decreased compared with the beginning of study. However, in the curcumin group, a significant increase was observed in BMD indicators of lumbar, femoral neck, and hip at the end of study compared with the beginning. There was also a significant difference between interventional and control groups for the mean BMD of femoral neck and hip at the end of study (0.718 ± 0.002 g/cm 2 vs. 0.712 ± 0.003 g/cm 2 and 0.742 ± 0.031 g/cm 2 vs. 0.692 ± 0.016 g/cm 2 , respectively). Curcumin, via modulation of densitometry indices and bone resorption markers, showed inhibitory effects on the process of osteoporosis. Treatment with curcumin was significantly associated with a decrease in the osteoporosis progression and bone turnover markers of patients with SCI after 6 months. Copyright © 2018 Elsevier Inc. All rights reserved.

Effect of Positioning of the ROI on BMD of the Forearm and Its Subregions.

PubMed

Rosen, Elizabeth O; McNamara, Elizabeth A; Whittaker, LaTarsha G; Malabanan, Alan O; Rosen, Harold N

2018-03-21

Inconsistent positioning of patients and region of interest (ROI) is known to influence the precision of bone mineral density (BMD) measurements in the spine and hip. However, it is unknown whether minor shifts in the positioning of the ROI along the shaft of the radius affect the measurement of forearm BMD and its subregions. The ultradistal (UD-), mid-, one-third, and total radius BMDs of 50 consecutive clinical densitometry patients were acquired. At baseline the distal end of the ROI was placed at the tip of the ulnar styloid as usual, and then the forearm was reanalyzed 10 more times, each time shifting the ROI 1 mm proximally. No corrections for multiple comparisons were necessary since the differences that were significant were significant at p < 0.001. The UD-radius BMD increased as the ROI was shifted proximally; the increase was significant when shifted even 1 mm proximally (p < 0.001). These same findings held true for the mid- and total radius bone density, though the percent increase with moving proximally was significantly greater for the UD radius than for the other subregions. However, there was no significant change in the one-third radius BMD when shifted proximally 1-10 mm. Minor proximal shifts of the forearm ROI substantially affect the BMD of the UD-, mid- and total radius, while having no effect on the one-third radius BMD. Since the one-third radius is the only forearm region usually reported, minor proximal shifts of the ROI should not influence forearm BMD results significantly. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Use of remote sensing for land use policy formulation

NASA Technical Reports Server (NTRS)

1982-01-01

Research projects described include: (1) identifying coniferous forest types in Michigan using LANDSAT imagery; (2) investigating synoptic temperature patterns in Michigan as determined via GOES and HCMM thermal imagery; (3) land surface change detection using satellite data and a geographic data base; (4) determining soil map unit composition by electronic scanning densitometry; and (5) delimiting areas of virus infection in vineyards and blueberry fields in southwestern and western Michigan. Contractual activities involve important farmlands inventory, changes in aquatic vegetation in Saginaw Bay, digitized soil association map of Michigan, and aerial photography for hybrid-poplar research. On-going projects are also being conducted in Jamaica, Honduras, the Dominican Republic and Kenya.

Kappa opioid receptors in rat spinal cord vary across the estrous cycle.

PubMed

Chang, P C; Aicher, S A; Drake, C T

2000-04-07

Kappa opioid receptors (KORs) were immunocytochemically localized in the lumbosacral spinal cord of female rats in different stages of the estrous cycle to examine the influence of hormonal status on receptor density. KOR labeling was primarily in fine processes and a few neuronal cell bodies in the superficial dorsal horn and the dorsolateral funiculus. Quantitative light microscopic densitometry of the superficial dorsal horn revealed that rats in diestrus had significantly lower KOR densities than those in proestrus or estrus. This suggests that female reproductive hormones regulate spinal KOR levels, which may contribute to variations in analgesic effectiveness of KOR agonists across the estrous cycle.

Method of high-precision microsampled blood and plasma mass densitometry

NASA Technical Reports Server (NTRS)

Hinghofer-Szalkay, H.

1986-01-01

The reliability of the mechanical oscillator technique for blood and plasma density measurements on samples of volumes less than 0.1 ml is examined, and a precision of 0.001 g/l is found if plasma-isodensic heparin solution and siliconized densitometers are employed. Sources of measurement errors in the density determinations include storage of plasma samples, inhomogeneity of blood samples, and density reading before adequate temperature equilibration. In tests of plasma sample storage, the best reproducibility was obtained with samples kept at 4 C. Linear correlations were found between plasma density and plasma protein concentration, blood density and blood hemoglobin concentration, and erythrocyte density and MCHC.

Multiwire Gamma Camera for Radionuclide and Radiographic Imaging in the Space environment

NASA Technical Reports Server (NTRS)

Lacy, Jeffrey L.

1985-01-01

Unique multiwire proportional counter technology has been developed at the Johnson Space Center over the past several years. The technology will be described and how it may apply both in near- and long-term NASA efforts. In the near-term, I feel that the technology will provide a significant tool for the cardiovascular research area. In particular, low-dose nuclear medicine and tissue densitometry techniques of expanded scope will be supplied. In the longer term, the multiwire technique can provide a general purpose radiology and nuclear medicine facility for use in the space station which would be difficult and costly to provide by other means.

Remote sensing of St. Augustine Decline (SAD) disease. [spectral reflectance of healthy and diseased grass

NASA Technical Reports Server (NTRS)

Odle, W. C.

1976-01-01

Laboratory and field spectral reflectance measurements of healthy and infected St. Augustine grass were made using several different instruments. Spectral differences between healthy and infected grass occured in the visible and near infrared regions. Multiband and color infrared photographs were taken of healthy and diseased turf from ground-based platforms and low altitude aircraft. Qualitative (density slicing) and quantitative (transmission densitometry) analyses revealed distinct tonal differences between healthy and St. Augustine disease (SAD) infected grass. Similar experiments are described for determining if healthy and diseased grass can be distinguished from waterstressed grass and grass deficient in either nitrogen or iron.

[Features of the periodontal pathology at patients with metabolic syndrome].

PubMed

Ermolaeva, L A; Shishkin, A N; Sheveleva, N A; Penkovoi, E A; Sheveleva, M A; Sokolovich, N A; Khabarova, O V; Mihailova, E S

2016-01-01

The purpose of this article is to familiarize readers on the relationship between metabolic syndrome and periodontitis, as well as common pathogenetic processes underlying these diseases. The data of modern researches, devoted to the correlation of lesions of periodontal and systemic diseases associated with metabolic syndrome. In the article analyzed also the data of the original study of the interaction of periodontitis and metabolic syndrome, which also used special methods of examination like Doppler ultrasound microcirculatory vasculature of the periodontal tissues and ultrasound densitometry. The possible methods of diagnostics of a condition of periodontal tissues in patients with metabolic syndrome are considered. Conclusions about the relationship of each component of metabolic syndrome with periodontitis are made.

Foveal cone spacing and cone photopigment density difference: objective measurements in the same subjects.

PubMed

Marcos, S; Tornow, R P; Elsner, A E; Navarro, R

1997-07-01

Foveal cone spacing was measured in vivo using an objective technique: ocular speckle interferometry. Cone packing density was computed from cone spacing data. Foveal cone photopigment density difference was measured in the same subjects using retinal densitometry with a scanning laser ophthalmoscope. Both the cone packing density and cone photopigment density difference decreased sharply with increasing retinal eccentricity. From the comparison of both sets of measurements, the computed amounts of photopigment per cone increased slightly with increasing retinal eccentricity. Consistent with previous results, decreases in cone outer segment length are over-compensated by an increase in the outer segment area, at least in retinal eccentricities up to 1 deg.

Current methods and advances in bone densitometry

NASA Technical Reports Server (NTRS)

Guglielmi, G.; Gluer, C. C.; Majumdar, S.; Blunt, B. A.; Genant, H. K.

1995-01-01

Bone mass is the primary, although not the only, determinant of fracture. Over the past few years a number of noninvasive techniques have been developed to more sensitively quantitate bone mass. These include single and dual photon absorptiometry (SPA and DPA), single and dual X-ray absorptiometry (SXA and DXA) and quantitative computed tomography (QCT). While differing in anatomic sites measured and in their estimates of precision, accuracy, and fracture discrimination, all of these methods provide clinically useful measurements of skeletal status. It is the intent of this review to discuss the pros and cons of these techniques and to present the new applications of ultrasound (US) and magnetic resonance (MRI) in the detection and management of osteoporosis.

Studies of the effects of gravitational and inertial forces on cardiovascular and respiratory dynamics

NASA Technical Reports Server (NTRS)

Ritman, E. L.; Wood, E. H.

1973-01-01

The current status and application are described of the biplane video roentgen densitometry, videometry and video digitization systems. These techniques were developed, and continue to be developed for studies of the effects of gravitational and inertial forces on cardiovascular and respiratory dynamics in intact animals and man. Progress is reported in the field of lung dynamics and three-dimensional reconstruction of the dynamic thoracic contents from roentgen video images. It is anticipated that these data will provide added insight into the role of shape and internal spatial relationships (which is altered particularly by acceleration and position of the body) of these organs as an indication of their functional status.

Reproducibility of CT bone densitometry: operator versus automated ROI definition.

PubMed

Louis, O; Luypaert, R; Kalender, W; Osteaux, M

1988-05-01

Intrasubject reproducibility with repeated determination of vertebral mineral density from a given set of CT images was investigated. The region of interest (ROI) in 10 patient scans was selected by four independent operators either manually or with an automated procedure separating cortical and spongeous bone, the operators being requested to interact in ROI selection. The mean intrasubject variation was found to be much lower with the automated process (0.3 to 0.6%) than with the conventional method (2.5 to 5.2%). In a second study, 10 patients were examined twice to determine the reproducibility of CT slice selection by the operator. The errors were of the same order of magnitude as in ROI selection.

Intagliated phosphor screen image tube project

NASA Technical Reports Server (NTRS)

Hertzel, R. J.

1982-01-01

The production and evaluation of a magnetic focus image tube for astronomical photography that has an intagliated phosphor screen is described. The modulation transfer function of such a tube was measured by electronic means and by film tests, and the results compared with tubes of more conventional construction. The physical properties of the image tube and film combination, the analytical model of the optical interface, and the salient features of the intagliated screen tube are described. The results of electronic MTF tests of the intagliated image tube and of the densitometry of the tube and film test samples are presented. It is concluded that the intagliated screen is a help, but that the thickness of the photographic film is also important.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Jay; Harris, Tequila

A novel bidirectional thickness profilometer based on transmission densitometry was designed to measure the localized thickness of semitransparent films on a dynamic manufacturing line. The densitometer model shows that, for materials with extinction coefficients between 0.3 and 2.9 D/mm, 100-500 {mu}m measurements can be recorded with less than {+-}5% error at more than 10,000 locations in real time. As a demonstration application, the thickness profiles of 75 mmx100 mm regions of polymer electrolyte membrane (PEM) were determined by converting the optical density of the sample to thickness with the Beer-Lambert law. The PEM extinction coefficient was determined to be 1.4more » D/mm, with an average thickness error of 4.7%.« less

Osteoporosis Care in the United States After Declines in Reimbursements for DXA

PubMed Central

Hayes, Burton L.; Curtis, Jeffrey R.; Laster, Andrew; Saag, Kenneth; Tanner, S. Bobo; Liu, Caiqin; Womack, Catherine; Johnson, Karen C.; Khaliq, Fazila; Carbone, Laura D.

2015-01-01

In January 2007, in the United States (US), Medicare initiated a series of cuts to reimbursement for dual-energy X-ray absorptiometry (DXA) services performed in the nonfacility setting that by January 2010 reduced payments for these services by more than 60% compared with 2006 levels. The objectives of this study were to determine if a temporal association exists between Medicare Physician Fee Schedule changes in office-based DXA reimbursement and attendance at educational conferences for osteoporosis, physicians’ perceptions of changes in their medical practices, or national trends in retail prescription medications for osteoporosis in those aged 65 and older. Compared with the 2 yr before the decline in Medicare reimbursement for DXA (2005–2006), attendance at educational meetings for osteoporosis in the US declined in the 2 yr after these cuts (2007–2008) by 6%; declines in attendance were only present in meetings selective for bone densitometry. Survey participants reported changes in DXA services with approximately one-third indicating that they had either decreased the number of DXAs they performed or declined service contracts or hardware/software updates compared with 2005–2006. The number of retail prescriptions for Food and Drug Administratione–approved osteoporosis drugs (excluding estrogen compounds and raloxifene) in the age 65 and older population increased by 5.5% in the time period 2007–2008 compared with 2005–2006. However, in the last year of the study (2008), total retail prescriptions for these drugs experienced for the first time over the interval of the study, a decline (1.4%) compared with the previous year. This occurred despite a 2.6% increase in the US population age 65 and older. In conclusion, there were temporal associations noted between Medicare cuts in DXA payments in attendance at educational conferences for bone densitometry, self-report of office-based provision of DXA services in the US, and retail prescriptions for osteoporosis therapies. PMID:21029972

Vertebral Fracture Assessment by dual-energy X-ray absorptiometry: insurance coverage issues in the United States. A White Paper of the International Society for Clinical Densitometry.

PubMed

Laster, Andrew J; Lewiecki, E Michael

2007-01-01

Clinical trial data and fracture risk prediction models unequivocally demonstrate the utility of identifying prevalent vertebral fractures to predict future fractures of all types. Knowledge of prevalent vertebral fractures can alter patient management decisions and result in initiation of therapy to reduce fracture risk in some patients who would not otherwise be treated. Cost-benefit analysis demonstrates that identifying and treating patients with vertebral fractures, even those with a densitometric classification of osteopenia, is cost effective. Vertebral fractures can be readily identified in the office setting using standard radiography or Vertebral Fracture Assessment (VFA), a software addition to a central dual-energy X-ray absorptiometry (DXA) machine. In the United States, VFA was assigned a Current Procedural Terminology (CPT) code in January 2005. Nevertheless, coverage of VFA has not been uniformly embraced by Medicare carriers, companies that contract with the federal government to administer Medicare coverage and process claims for a region of the United States. Unlike DXA, for which uniform national coverage of qualified Medicare beneficiaries is mandated by the Balanced Budget Act of 1997, VFA coverage policies are determined by the local Medicare carriers. Third-party insurers are also variable in their coverage of VFA. This International Society for Clinical Densitometry (ISCD) White Paper documents the role of VFA in the evaluation and treatment of women with postmenopausal osteoporosis and compares it with standard spine radiography. Arguments used by some Medicare carriers and insurers to deny coverage of VFA in the United States are analyzed and critiqued. For health care providers within the United States, this White Paper may serve as a resource to respond to insurers who deny coverage of VFA. For health care providers regardless of their country, this article underscores the value of VFA as an alternative to spine radiography in the evaluation and management of postmenopausal women with suspected osteoporosis.

Fetal programming of body dimensions and percentage body fat measured in prepubertal children with a 4-component model of body composition, dual-energy X-ray absorptiometry, deuterium dilution, densitometry, and skinfold thicknesses.

PubMed

Elia, Marinos; Betts, Peter; Jackson, Diane M; Mulligan, Jean

2007-09-01

Intrauterine programming of body composition [percentage body fat (%BF)] has been sparsely examined with multiple independent reference techniques in children. The effects on and consequences of body build (dimensions, mass, and length of body segments) are unclear. The study examined whether percentage fat and relation of percentage fat to body mass index (BMI; in kg/m2) in prepubertal children are programmed during intrauterine development and are dependent on body build. It also aimed to examine the extent to which height can be predicted by parental height and birth weight. Eighty-five white children (44 boys, 41 girls; aged 6.5-9.1 y) had body composition measured with a 4-component model (n = 58), dual-energy X-ray absorptiometry (n = 84), deuterium dilution (n = 81), densitometry (n = 62), and skinfold thicknesses (n = 85). An increase in birth weight of 1 SD was associated with a decrease of 1.95% fat as measured by the 4-component model (P = 0.012) and 0.82-2.75% by the other techniques. These associations were independent of age, sex, socioeconomic status, physical activity, BMI, and body build. Body build did not decrease the strength of the associations. Birth weight was a significantly better predictor of height than was self-reported midparental height, accounting for 19.4% of the variability at 5 y of age and 10.3% at 7.8 y of age (17.8% and 8.8% of which were independent of parental height at these ages, respectively). Consistent trends across body-composition measurement techniques add strength to the suggestion that percentage fat in prepubertal children is programmed in utero (independently of body build and BMI). It also suggests birth weight is a better predictor of prepubertal height than is self-reported midparental height.

Capacitive Detection of Low-Enthalpy, Higher-Order Phase Transitions in Synthetic and Natural Composition Lipid Membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taylor, Graham J.; Heberle, Frederick A.; Seinfeld, Jason S.

In-plane lipid organization and phase separation in natural membranes play key roles in regulating many cellular processes. Highly cooperative, first-order phase transitions in model membranes consisting of few lipid components are well understood and readily detectable via calorimetry, densitometry, and fluorescence. However, far less is known about natural membranes containing numerous lipid species and high concentrations of cholesterol, for which thermotropic transitions are undetectable by the above-mentioned techniques. We demonstrate that membrane capacitance is highly sensitive to low-enthalpy thermotropic transitions taking place in complex lipid membranes. Specifically, we measured the electrical capacitance as a function of temperature for droplet interfacemore » bilayer model membranes of increasing compositional complexity, namely, (a) a single lipid species, (b) domain-forming ternary mixtures, and (c) natural brain total lipid extract (bTLE). We observed that, for single-species lipid bilayers and some ternary compositions, capacitance exhibited an abrupt, temperature-dependent change that coincided with the transition detected by other techniques. In addition, capacitance measurements revealed transitions in mixed-lipid membranes that were not detected by the other techniques. Most notably, capacitance measurements of bTLE bilayers indicated a transition at ~38 °C not seen with any other method. Likewise, capacitance measurements detected transitions in some well-studied ternary mixtures that, while known to yield coexisting lipid phases, are not detected with calorimetry or densitometry. These results indicate that capacitance is exquisitely sensitive to low-enthalpy membrane transitions because of its sensitivity to changes in bilayer thickness that occur when lipids and excess solvent undergo subtle rearrangements near a phase transition. Our findings also suggest that heterogeneity confers stability to natural membranes that function near transition temperatures by preventing unwanted defects and macroscopic demixing associated with high-enthalpy transitions commonly found in simpler mixtures.« less

High-performance thin-layer chromatographic methods for the determination of febuxostat and febuxostat/diclofenac combination in human plasma.

PubMed

El-Yazbi, Fawzi A; Amin, Omayma A; El-Kimary, Eman I; Khamis, Essam F; Younis, Sameh E

2018-06-01

Two simple, sensitive and specific high-performance thin-layer chromatographic (HPTLC) methods were developed for the determination of febuxostat (FEB) individually, and simultaneously with diclofenac (DIC) in human plasma. Method A presents the first HPTLC-ultraviolet attempt for FEB determination in human plasma. FEB was separated from endogenous plasma components (at hR F  = 70) with ethyl acetate-methanol-water (9:2:1, v/v) mixture as mobile phase and quantified by densitometry at its λ max (315 nm). Method B is considered the first attempt for the simultaneous determination of FEB and DIC in human plasma. A mixture of petroleum ether-chloroform-ethyl acetate-formic acid (7.5:1:2.5:0.25, v/v) was used as the mobile phase. The two drugs were separated at hR F of 39 and 60 for FEB and DIC, respectively. FEB and DIC were quantified by densitometry at their isoabsorptive point (289 nm). FEB calibration plots were linear between 0.1 and 7 μg mL -1 in both methods A and B. In method B, DIC showed linear response in the range of 0.08-8 μg mL -1 . Sample preparation was performed by liquid-liquid extraction using diethyl ether. Both methods did not record any interference from plasma matrix, the studied drugs' metabolites or their decomposition products. They were successfully applied for the determination of the studied drugs in healthy male volunteers after oral administration of FEB or FEB/DIC dosage forms. FEB plasma concentration increased significantly when given with DIC. The proposed methods provided very simple, rapid and cheap approaches that might be attractive for the future pharmacokinetic and bioavailability studies of FEB and/or DIC. Copyright © 2018 Elsevier B.V. All rights reserved.

Capacitive Detection of Low-Enthalpy, Higher-Order Phase Transitions in Synthetic and Natural Composition Lipid Membranes

DOE PAGES

Taylor, Graham J.; Heberle, Frederick A.; Seinfeld, Jason S.; ...

2017-08-15

In-plane lipid organization and phase separation in natural membranes play key roles in regulating many cellular processes. Highly cooperative, first-order phase transitions in model membranes consisting of few lipid components are well understood and readily detectable via calorimetry, densitometry, and fluorescence. However, far less is known about natural membranes containing numerous lipid species and high concentrations of cholesterol, for which thermotropic transitions are undetectable by the above-mentioned techniques. We demonstrate that membrane capacitance is highly sensitive to low-enthalpy thermotropic transitions taking place in complex lipid membranes. Specifically, we measured the electrical capacitance as a function of temperature for droplet interfacemore » bilayer model membranes of increasing compositional complexity, namely, (a) a single lipid species, (b) domain-forming ternary mixtures, and (c) natural brain total lipid extract (bTLE). We observed that, for single-species lipid bilayers and some ternary compositions, capacitance exhibited an abrupt, temperature-dependent change that coincided with the transition detected by other techniques. In addition, capacitance measurements revealed transitions in mixed-lipid membranes that were not detected by the other techniques. Most notably, capacitance measurements of bTLE bilayers indicated a transition at ~38 °C not seen with any other method. Likewise, capacitance measurements detected transitions in some well-studied ternary mixtures that, while known to yield coexisting lipid phases, are not detected with calorimetry or densitometry. These results indicate that capacitance is exquisitely sensitive to low-enthalpy membrane transitions because of its sensitivity to changes in bilayer thickness that occur when lipids and excess solvent undergo subtle rearrangements near a phase transition. Our findings also suggest that heterogeneity confers stability to natural membranes that function near transition temperatures by preventing unwanted defects and macroscopic demixing associated with high-enthalpy transitions commonly found in simpler mixtures.« less

CONSENSUS STATEMENT BY THE AMERICAN ASSOCIATION OF CLINICAL ENDOCRINOLOGISTS AND AMERICAN COLLEGE OF ENDOCRINOLOGY ON THE QUALITY OF DXA SCANS AND REPORTS.

PubMed

Licata, Angelo A; Binkley, Neil; Petak, Steven M; Camacho, Pauline M

2018-02-01

High-quality dual-energy X-ray absorptiometry (DXA) scans are necessary for accurate diagnosis of osteoporosis and monitoring of therapy; however, DXA scan reports may contain errors that cause confusion about diagnosis and treatment. This American Association of Clinical Endocrinologists/American College of Endocrinology consensus statement was generated to draw attention to many common technical problems affecting DXA report conclusions and provide guidance on how to address them to ensure that patients receive appropriate osteoporosis care. The DXA Writing Committee developed a consensus based on discussion and evaluation of available literature related to osteoporosis and osteodensitometry. Technical errors may include errors in scan acquisition and/or analysis, leading to incorrect diagnosis and reporting of change over time. Although the International Society for Clinical Densitometry advocates training for technologists and medical interpreters to help eliminate these problems, many lack skill in this technology. Suspicion that reports are wrong arises when clinical history is not compatible with scan interpretation (e.g., dramatic increase/decrease in a short period of time; declines in previously stable bone density after years of treatment), when different scanners are used, or when inconsistent anatomic sites are used for monitoring the response to therapy. Understanding the concept of least significant change will minimize erroneous conclusions about changes in bone density. Clinicians must develop the skills to differentiate technical problems, which confound reports, from real biological changes. We recommend that clinicians review actual scan images and data, instead of relying solely on the impression of the report, to pinpoint errors and accurately interpret DXA scan images. AACE = American Association of Clinical Endocrinologists; BMC = bone mineral content; BMD = bone mineral density; DXA = dual-energy X-ray absorptiometry; ISCD = International Society for Clinical Densitometry; LSC = least significant change; TBS = trabecular bone score; WHO = World Health Organization.

Direct Comparison of the Precision of the New Hologic Horizon Model With the Old Discovery Model.

PubMed

Whittaker, LaTarsha G; McNamara, Elizabeth A; Vath, Savoun; Shaw, Emily; Malabanan, Alan O; Parker, Robert A; Rosen, Harold N

2017-11-22

Previous publications suggested that the precision of the new Hologic Horizon densitometer might be better than that of the previous Discovery model, but these observations were confounded by not using the same participants and technologists on both densitometers. We sought to study this issue methodically by measuring in vivo precision in both densitometers using the same patients and technologists. Precision studies for the Horizon and Discovery models were done by acquiring spine, hip, and forearm bone mineral density twice on 30 participants. The set of 4 scans on each participant (2 on the Discovery, 2 on the Horizon) was acquired by the same technologist using the same scanning mode. The pairs of data were used to calculate the least significant change according to the International Society for Clinical Densitometry guidelines. The significance of the difference between least significant changes was assessed using a Wilcoxon signed-rank test of the difference between the mean square error of the absolute value of the differences between paired measurements on the Discovery (Δ-Discovery) and the mean square error of the absolute value of the differences between paired measurements on the Horizon (Δ-Horizon). At virtually all anatomic sites, there was a nonsignificant trend for the precision to be better for the Horizon than for the Discovery. As more vertebrae were excluded from analysis, the precision deteriorated on both densitometers. The precision between densitometers was almost identical when reporting only 1 vertebral body. (1) There was a nonsignificant trend for greater precision on the new Hologic Horizon compared with the older Discovery model. (2) The difference in precision of the spine bone mineral density between the Horizon and the Discovery models decreases as fewer vertebrae are included. (3) These findings are substantially similar to previously published results which had not controlled as well for confounding from using different subjects and technologists. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Low agreement of visual rating for detailed quantification of pulmonary emphysema in whole-lung CT.

PubMed

Mascalchi, Mario; Diciotti, Stefano; Sverzellati, Nicola; Camiciottoli, Gianna; Ciccotosto, Cesareo; Falaschi, Fabio; Zompatori, Maurizio

2012-02-01

Multidetector spiral computed tomography (CT) has opened the possibility of quantitative evaluation of emphysema extent in the whole lung. Visual assessment can be used for such a purpose, but its reproducibility has not been established. To assess agreement of detailed assessment of pulmonary emphysema on whole-lung CT using a visual scale. Thirty patients with chronic obstructive pulmonary disease underwent whole-lung inspiratory CT. Four chest radiologists rated the same 22 ± 2 thin sections using a visual scale which defines a range of emphysema extent between 0 and 100. Two of them repeated the rating two months later. Inter- and intra-operator agreement was evaluated with the Bland and Altman method. In addition, the percentage of emphysema at -950 Hounsfield units in the whole lung was determined using fully automated commercially available software for 3D densitometry. In three of six operator pairs and in one of two intra-operator pairs the Kendall τ test showed a significant correlation between the difference and the average magnitude of visual scores. Among different operators the half-width of 95% limits of agreement (95% LoA) was wide ranging between a score of 14.2-27.7 for an average visual score of 20 and between 18.5-36.8 for an average visual score of 80. Within the same operator the half-width of 95% LoA ranged between a score of 10.9-21.0 for an average visual score of 20 and between 25.1-30.1 for an average visual score of 80. The visual scores of the four radiologists were correlated with the results of densitometry (P < 0.001; r = 0.65-0.81). The inter- and intra-operator agreement of detailed assessment of emphysema in the whole lung using a visual scale is low and decreases with increasing emphysema extent.

Pulmonary Emphysema in Cystic Fibrosis Detected by Densitometry on Chest Multidetector Computed Tomography

PubMed Central

Wielpütz, Mark O.; Weinheimer, Oliver; Eichinger, Monika; Wiebel, Matthias; Biederer, Jürgen; Kauczor, Hans-Ulrich; Heußel, Claus P.

2013-01-01

Background Histopathological studies on lung specimens from patients with cystic fibrosis (CF) and recent results from a mouse model indicate that emphysema may contribute to CF lung disease. However, little is known about the relevance of emphysema in patients with CF. In the present study, we used computationally generated density masks based on multidetector computed tomography (MDCT) of the chest for non-invasive characterization and quantification of emphysema in CF. Methods Volumetric MDCT scans were acquired in parallel to pulmonary function testing in 41 patients with CF (median age 20.1 years; range 7-66 years) and 21 non-CF controls (median age 30.4 years; range 4-68 years), and subjected to dedicated software. The lung was segmented, low attenuation volumes below a threshold of -950 Hounsfield units were assigned to emphysema volume (EV), and the emphysema index was computed (EI). Results were correlated with forced expiratory volume in 1 s percent predicted (FEV1%), residual volume (RV), and RV/total lung capacity (RV/TLC). Results We show that EV was increased in CF (457±530 ml) compared to non-CF controls (78±90 ml) (P<0.01). EI was also increased in CF (7.7±7.5%) compared to the control group (1.2±1.4%) (P<0.05). EI correlated inversely with FEV1% (rs=-0.66), and directly with RV (rs=0.69) and RV/TLC (rs=0.47) in patients with CF (P<0.007), but not in non-CF controls. Emphysema in CF was detected from early adolescence (~13 years) and increased with age (rs=0.67, P<0.001). Conclusions Our results indicate that early onset emphysema detected by densitometry on chest MDCT is a characteristic pathology that contributes to airflow limitation and may serve as a novel endpoint for monitoring lung disease in CF. PMID:23991177

Clinical Implications of Hip Flexion in the Measurement of Spinal Bone Mineral Density.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Nakamura, Yukio; Mukaiyama, Keijiro; Kato, Hiroyuki

2016-01-01

The aim of this study was to investigate if differences in leg positioning affect spinal bone mineral density (BMD) measurements and the detection of low bone mass. Subjects included 1039 Japanese patients, 878 women and 161 men (mean ages: 67 and 71 years, respectively). Spinal BMD (L1-4) was measured using dual-energy X-ray absorptiometry (DXA) with patients lying in 2 different positions: (1) supine on the scanning table with hips flexed and knees flexed over a 90° support pad (the standard position) and (2) simply supine (the supine position). Predictive indices were calculated for spinal DXA acquired with patients in the supine position. A BMD T-score of -2.5 or lower was set as the threshold for low bone mass. For the standard and the supine positions during scanning in women, BMDs were 0.911 and 0.915 g/cm(2), respectively; in men, they were 1.117  and 1.124 g/cm(2), respectively. The estimated systematic bias in BMD between the positions was 0.42% (95% confidence interval: 0.24, 0.59; p = 0.009). Random errors in the densitometry measurements for the standard and supine positions were 0.66% and 0.84%, respectively. There was no significant difference between the errors (p= 0.164). The likelihood ratios of a positive and negative test for the detection of low bone mass following supine DXA were 121.0 and 0.066, respectively, compared with results acquired using the standard position. In conclusion, DXA measurements acquired with patients in the supine position slightly overestimated BMD vs the standard position. However, the clinical equivalency between the positioning methods for DXA is preserved to the extent that low bone mass can be reliably detected in the supine position. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Official Positions for FRAX® clinical regarding prior fractures from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

Blank, Robert D

2011-01-01

The 2010 Position Development Conference addressed four questions related to the impact of previous fractures on 10-year fracture risk as calculated by FRAX(®). To address these questions, PubMed was searched on the keywords "fracture, epidemiology, osteoporosis." Titles of retrieved articles were reviewed for an indication that risk for future fracture was discussed. Abstracts of these articles were reviewed for an indication that one or more of the questions listed above was discussed. For those that did, the articles were reviewed in greater detail to extract the findings and to find additional past work and citing works that also bore on the questions. The official positions and the supporting literature review are presented here. FRAX(®) underestimates fracture probability in persons with a history of multiple fractures (good, A, W). FRAX(®) may underestimate fracture probability in individuals with prevalent severe vertebral fractures (good, A, W). While there is evidence that hip, vertebral, and humeral fractures appear to confer greater risk of subsequent fracture than fractures at other sites, quantification of this incremental risk in FRAX(®) is not possible (fair, B, W). FRAX(®) may underestimate fracture probability in individuals with a parental history of non-hip fragility fracture (fair, B, W). Limitations of the methodology include performance by a single reviewer, preliminary review of the literature being confined to titles, and secondary review being limited to abstracts. Limitations of the evidence base include publication bias, overrepresentation of persons of European descent in the published studies, and technical differences in the methods used to identify prevalent and incident fractures. Emerging topics for future research include fracture epidemiology in non-European populations and men, the impact of fractures in family members other than parents, and the genetic contribution to fracture risk. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Role of mitochondria in paricalcitol-mediated cytoprotection during obstructive nephropathy

PubMed Central

García, Isabel Mercedes; Altamirano, Liliana; Mazzei, Luciana; Fornés, Miguel; Molina, Marisa Nile; Ferder, León

2012-01-01

Vitamin D slows the progression of chronic kidney disease. Furthermore, activators of vitamin D receptors (VDR) have suppressant effects on the renin-angiotensin system, as well as anti-inflammatory and antifibrotic actions. This study aimed to evaluate the cytoprotective effects of paricalcitol, a VDR activator, at the mitochondrial level using an obstructive nephropathy model [unilateral ureteral obstruction (UUO)]. Rats subjected to UUO and controls were treated daily with vehicle or paricalcitol. The control group underwent a sham surgery. The treatment was done for 15 days (30 ng/kg). The following were determined: biochemical parameters; fibrosis; apoptosis; mitochondrial morphology; VDR, AT1 receptor, and NADPH oxidase 4 expression; and NADPH oxidase activity (in total and in mitochondrial fractions from the renal cortex). VDR activation prevented fibrosis (20 ± 5 vs. 60 ± 10%) and the number of TUNEL-positive apoptotic cells (10 ± 3 vs. 25 ± 4) in UUO. Biochemical, histological, and molecular studies suggest mitochondrial injury. Electron microscopy revealed in UUO electronically luminous material in the nucleus. Some mitochondria were increased in size and contained dilated crests and larger than normal spaces in their interiors. These changes were not present with paricalcitol treatment. Additionally, high AT1-receptor mRNA and NADPH activity was reverted in mitochondrial fractions from obstructed paricalcitol-treated animals (0.58 ± 0.06 vs. 0.95 ± 0.05 relative densitometry units and 9,000 ± 800 vs. 15,000 ± 1,000 relative fluorescence units·μg protein−1·min−1, respectively). These changes were consistent with an improvement in VDR expression (0.75 ± 0.05 vs. 0.35 ± 0.04 relative densitometry units). These results suggest that paricalcitol confers a protective effect and reveal, as well, a possible AT1 receptor-dependent protective effect that occurs at the mitochondrial level. PMID:22492946

Dynamics of Unjammed Emulsions

NASA Astrophysics Data System (ADS)

Guerra, Rodrigo; Kodger, Thomas; Weitz, David

2014-03-01

Light scattering and NMR densitometry measurements of quiescent emulsions have shown that amorphous packings of soft, repulsive droplets unjam at osmotic pressures 105 times larger than the typical droplet thermal energy density: 3kB/T 4 πR3. This transition corresponds to the pressure at which the thermal fluctuations of individual droplet positions match the yield strain of the packing and drive the fluidization of the material. We use confocal microscopy to investigate the microscopic dynamics of this fluid-like phase and find them to be fundamentally different from those of conventional glass-forming liquids; cage-breaking dynamics are not evident from droplet mean squared displacements and the effective viscosity of the emulsion, though 105 larger than the background fluid, appears largely insensitive to the confining pressure.

Stiles—Crawford effect and the bleaching of cone pigments

PubMed Central

Coble, J. R.; Rushton, W. A. H.

1971-01-01

1. The efficiency of light entering the eye through various points in the pupil (Stiles—Crawford effect) was studied using two criteria: (a) visual brightness judged by flicker fusion and (b) the rate of cone pigment bleaching measured by reflexion densitometry. 2. Both measurements were made in the same apparatus with the same geometry of presentation and both gave the same Stiles—Crawford effect. 3. This suggests that the densitometer measures pigment deep in the outer segments of the cones where light is absorbed for vision. 4. Foveal cones seem all to point in the same direction, since the fraction of pigment bleached by light entering the pupil at any one point is the same when measured by light entering anywhere. PMID:5571926

Bisphosphonate Treatment for Children With Disabling Conditions

PubMed Central

Boyce, Alison M.; Tosi, Laura L.; Paul, Scott M.

2014-01-01

Fractures are a frequent source of morbidity in children with disabling conditions. The assessment of bone density in this population is challenging, because densitometry is influenced by dynamic forces affecting the growing skeleton and may be further confounded by positioning difficulties and surgical hardware. First-line treatment for pediatric osteoporosis involves conservative measures, including optimizing the management of underlying conditions, maintaining appropriate calcium and vitamin D intake, encouraging weight-bearing physical activity, and monitoring measurements of bone mineral density. Bisphosphonates are a class of medications that increase bone mineral density by inhibiting bone resorption. Although bisphosphonates are commonly prescribed for treatment of adult osteoporosis, their use in pediatric patients is controversial because of the lack of long-term safety and efficacy data. PMID:24368091

PROCEDURES FOR ACCURATE PRODUCTION OF COLOR IMAGES FROM SATELLITE OR AIRCRAFT MULTISPECTRAL DIGITAL DATA.

USGS Publications Warehouse

Duval, Joseph S.

1985-01-01

Because the display and interpretation of satellite and aircraft remote-sensing data make extensive use of color film products, accurate reproduction of the color images is important. To achieve accurate color reproduction, the exposure and chemical processing of the film must be monitored and controlled. By using a combination of sensitometry, densitometry, and transfer functions that control film response curves, all of the different steps in the making of film images can be monitored and controlled. Because a sensitometer produces a calibrated exposure, the resulting step wedge can be used to monitor the chemical processing of the film. Step wedges put on film by image recording machines provide a means of monitoring the film exposure and color balance of the machines.

Osteoporosis: primary prevention in the community.

PubMed

Loh, K Y; Shong, H K

2007-10-01

The incidence of osteoporosis is increasing worldwide. It has great impact on the life of the elderly population. The most significant medical consequence of osteoporosis is fragility fracture which without proper treatment will cause severe medical and psychosocial complications. The overall cost in managing osteoporosis and its related fractures is escalating. Using bone densitometry to measure bone mineral density is useful in the diagnosis of osteoporosis but it is costly and not feasible in the community. Drugs such as estrogen replacement, raloxifene and calcitonin are effective in prevention and treatment of osteoporosis but they are also expensive. Identifying modifiable risk factors such as smoking, lack of exercise, low dietary calcium and vitamin D intake and healthy life style remain strategy in the primary prevention of osteoporosis in the community.

[INVESTIGATION OF THE LEVEL OF MINERAL DENSITY OF SKELETAL OSSEOUS TISSUE IN PATIENTS WITH PERIODONTAL TISSUE DISEASES].

PubMed

Hodovana, O I

2015-01-01

Results of investigation of mineral density condition of skeletal osseous tissue in patients with inflammatory and dystrophic-inflammatory diseases of periodontal tissues with ultrasound densitometry method have been presented. Various changes of osseous tissue of skeletal bones have been detected: osteopenia, osteoporosis and osteosclerosis, which correlated with the severity of pathological process in periodontium. Analysis of the obtained results has been carried out depending on patients' sex as well as form and severity degree of the course of periodontal diseases. It has been established that the peak of detected impairments of mineral density in the skeleton is due to osteopenia, the degree of severity of which deteriorates with the severity of pathological process in periodontal tissues, especially in women.

Document Examination: Applications of Image Processing Systems.

PubMed

Kopainsky, B

1989-12-01

Dealing with images is a familiar business for an expert in questioned documents: microscopic, photographic, infrared, and other optical techniques generate images containing the information he or she is looking for. A recent method for extracting most of this information is digital image processing, ranging from the simple contrast and contour enhancement to the advanced restoration of blurred texts. When combined with a sophisticated physical imaging system, an image pricessing system has proven to be a powerful and fast tool for routine non-destructive scanning of suspect documents. This article reviews frequent applications, comprising techniques to increase legibility, two-dimensional spectroscopy (ink discrimination, alterations, erased entries, etc.), comparison techniques (stamps, typescript letters, photo substitution), and densitometry. Computerized comparison of handwriting is not included. Copyright © 1989 Central Police University.

Indocyanine green kinetics to assess liver function: Ready for a clinical dynamic assessment in major liver surgery?

PubMed Central

De Gasperi, Andrea; Mazza, Ernestina; Prosperi, Manlio

2016-01-01

Indocyanine green (ICG) kinetics (PDR/R15) used to quantitatively assess hepatic function in the perioperative period of major resective surgery and liver transplantation have been the object of an extensive, updated and critical review. New, non invasive bedside monitors (pulse dye densitometry technology) make this opportunity widely available in clinical practice. After having reviewed basic concepts of hepatic clearance, we analysed the most common indications ICG kinetic parameters have nowadays in clinical practice, focusing in particular on the diagnostic and prognostic role of PDR and R15 in the perioperative period of major liver surgery and liver transplantation. As recently pointed out, even if of extreme interest, ICG clearance parameters have still some limitations, to be considered when using these tests. PMID:26981173

Quantification of sunscreen ethylhexyl triazone in topical skin-care products by normal-phase TLC/densitometry.

PubMed

Sobanska, Anna W; Pyzowski, Jaroslaw

2012-01-01

Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot(-1). Both methods were validated.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafleur, Adrienne M.; Ulrich, Timothy J. II; Menlove, Howard O.

Objective is to investigate the use of Passive Neutron Albedo Reactivity (PNAR) and Self-Interrogation Neutron Resonance Densitometry (SINRD) to quantify fissile content in FUGEN spent fuel assemblies (FAs). Methodology used is: (1) Detector was designed using fission chambers (FCs); (2) Optimized design via MCNPX simulations; and (3) Plan to build and field test instrument in FY13. Significance was to improve safeguards verification of spent fuel assemblies in water and increase sensitivity to partial defects. MCNPX simulations were performed to optimize the design of the SINRD+PNAR detector. PNAR ratio was less sensitive to FA positioning than SINRD and SINRD ratio wasmore » more sensitive to Pu fissile mass than PNAR. Significance was that the integration of these techniques can be used to improve verification of spent fuel assemblies in water.« less

Detection Progress of Selected Drugs in TLC

PubMed Central

Pyka, Alina

2014-01-01

This entry describes applications of known indicators and dyes as new visualizing reagents and various visualizing systems as well as photocatalytic reactions and bioautography method for the detection of bioactive compounds including drugs and compounds isolated from herbal extracts. Broadening index, detection index, characteristics of densitometric band, modified contrast index, limit of detection, densitometric visualizing index, and linearity range of detected compounds were used for the evaluation of visualizing effects of applied visualizing reagents. It was shown that visualizing effect depends on the chemical structure of the visualizing reagent, the structure of the substance detected, and the chromatographic adsorbent applied. The usefulness of densitometry to direct detection of some drugs was also shown. Quoted papers indicate the detection progress of selected drugs investigated by thin-layer chromatography (TLC). PMID:24551853

Technology development of the Space Transportation System mission and terrestrial applications of satellite technology

NASA Technical Reports Server (NTRS)

1981-01-01

The Space Transportation System (STS) is discussed, including the launch processing system, the thermal protection subsystem, meteorological research, sound supression water system, rotating service structure, improved hypergol or removal systems, fiber optics research, precision positioning, remote controlled solid rocket booster nozzle plugs, ground operations for Centaur orbital transfer vehicle, parachute drying, STS hazardous waste disposal and recycle, toxic waste technology and control concepts, fast analytical densitometry study, shuttle inventory management system, operational intercommunications system improvement, and protective garment ensemble. Terrestrial applications are also covered, including LANDSAT applications to water resources, satellite freeze forecast system, application of ground penetrating radar to soil survey, turtle tracking, evaluating computer drawn ground cover maps, sparkless load pulsar, and coupling a microcomputer and computing integrator with a gas chromatograph.

Official Positions for FRAX® clinical regarding biochemical markers from Joint Official Positions Development Conference of the International Society for Clinical Densitometry and International Osteoporosis Foundation on FRAX®.

PubMed

McCloskey, Eugene V; Vasikaran, Samuel; Cooper, Cyrus

2011-01-01

The best indirect evidence that increased bone turnover contributes to fracture risk is the fact that most of the proven therapies for osteoporosis are inhibitors of bone turnover. The evidence base that we can use biochemical markers of bone turnover in the assessment of fracture risk is somewhat less convincing. This relates to natural variability in the markers, problems with the assays, disparity in the statistical analyses of relevant studies and the independence of their contribution to fracture risk. More research is clearly required to address these deficiencies before biochemical markers might contribute a useful independent risk factor for inclusion in FRAX(®). Copyright © 2011. Published by Elsevier Inc.

A study of the lecithin/sphingomyelin ratio of amniotic fluid.

PubMed

Gebhardt, D O; Beintema, A; de Rooij, R E; Wildeboer, F N; Merkus, J M

1975-10-15

1. There is a significant correlation between lecithin/sphingomyelin (L/S) ratios based on densitometry (L/S)D and L/S ratios based on phosphorus determinations ((L/S)P). 2. The fetal lung is mature when the (L/S)D, determined according to Verhoeven, A.G.J. and Merkus, H.M.W.M. (1974) Clin. Chim. Acta 53, 229--232, is 1.2. This value is equivalent to an (L/S)P of 1.8. 3. The acetone precipitation procedure, introduced by Gluck, L., Kulovich, M.V., Borer, R.C. and Keidel, W.N. (1974) Am. J. Obstet. Gynecol. 120, 142--155, is a necessary step for isolating surface-active lecithin. 4. Standardization of the (L/S)D test is feasible and should permit different laboratories to use the same transition point.

Interest of a prescreening questionnaire to reduce the cost of bone densitometry.

PubMed

Ben Sedrine, W; Broers, P; Devogelaer, J P; Depresseux, G; Kaufman, J M; Goemaere, S; Reginster, J Y

2002-05-01

Bone mineral density (BMD) measurement is widely recognized as the best single tool to identify patients with a high lifetime risk of developing an osteoporosis-related fracture. However, the cost/benefit value of screening the whole population has been repeatedly challenged and demonstrated to be rather poor. In many countries, BMD scan is not or no longer reimbursed because of lack of validated criteria to identify patients who should benefit from this procedure. Based on the proposals of a nationwide expert panel, a simple questionnaire identifying historical, clinical and behavioral risk factors for osteoporosis was developed. The aim of this study was to assess the diagnostic accuracy of the proposed criteria; to determine the extent to which this questionnaire could be useful for optimizing the use of densitometry tests; and, more specifically, to estimate the diagnostic costs per osteoporotic or osteopenic patient detected. For this purpose, we applied the questionnaire to 3998 consecutive individuals at least 20 years old, of both genders, either consulting spontaneously or referred for a BMD measurement to an outpatient osteoporosis center. BMD was measured by dual-energy X-ray absorptiometry (DXA) at the lumbar spine and at the hip (both total hip and femoral neck). Diagnostic accuracies were evaluated through measures of sensitivity, specificity, and positive and negative predictive values. After determining a benchmark value for age, different strategies were compared in order to identify the most cost-effective one in terms of cost per patient detected. According to the WHO operational definition of osteoporosis (T-score <-2.5), 31% of the subjects were classified as osteoporotic at one or more of the measured sites. If only patients with at least one of the proposed risk factors had been referred for scans, 33.3% of the BMD measurements would have been avoided. Among those, less than 5% were missclassified as they did have osteoporosis at the total hip and up to 23% at one or more of the considered sites. On the other hand, of the subjects who would be recommended for a densitometry test, only a small fraction were identified correctly (the positive predictive values varied from 11.3% at the total hip to 34.8% at any site). In this first setting, the suggested criteria seem useful chiefly for excluding subjects who do not need a DXA scan rather than selecting osteoporotic patients. When applied only to patients aged 61 years or more, the positive predictive values rose to 15.1% (total hip) and 42.9% (any site), whereas the corresponding negative predictive values were set at 93% and 68.6%. In comparison, with a mass screening scenario the estimated diagnostic costs (costs associated with the DXA procedure) per osteoporotic patient detected at any of the considered sites would be reduced by more than 9% (59.4 instead of 65.3 Euros) if the suggested indications are taken into account for prescreening patients. And when the questionnaire is applied only to women over the age of 60 years these costs would be further reduced to 50.6 Euros, representing a 23% decrease. Then, a prescreening strategy based on these indications concomitantly with an age-selective criterion could represent a promising way toward a more rational use of BMD measurement.

Pharmacognostic Specification, Chlorogenic Acid Content, and In vitro Antioxidant Activities of Lonicera japonica Flowering Bud.

PubMed

Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2017-01-01

Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro . Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential, especially on reducing power property. Abbreviations Used: TLC: Thin layer chromatography, DPPH: 2,2-diphenyl-1-picrylhydrazyl, FRAP: Ferric ion Reducing Antioxidant Power, WHO: World Health Organization, ICH: International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use; LOD: Limit of detection; LOQ: Limit of quantitation; BHT: Butylated hydroxytoluene; FeSO 4 : Iron(II) sulfate; DMSO: Dimethyl sulfoxide; TPTZ: 2,4,6-tripyridyl-s-triazine.

Development of self-interrogation neutron resonance densitometry (sinrd) to measure the fissile content in nuclear fuel

NASA Astrophysics Data System (ADS)

LaFleur, Adrienne Marie

The development of non-destructive assay (NDA) capabilities to directly measure the fissile content in spent fuel is needed to improve the timely detection of the diversion of significant quantities of fissile material. Currently, the International Atomic Energy Agency (IAEA) does not have effective NDA methods to verify spent fuel and recover continuity of knowledge in the event of a containment and surveillance systems failure. This issue has become increasingly critical with the worldwide expansion of nuclear power, adoption of enhanced safeguards criteria for spent fuel verification, and recent efforts by the IAEA to incorporate an integrated safeguards regime. In order to address these issues, the use of Self-Interrogation Neutron Resonance Densitometry (SINRD) has been developed to improve existing nuclear safeguards and material accountability measurements. The following characteristics of SINRD were analyzed: (1) ability to measure the fissile content in Light Water Reactors (LWR) fuel assemblies and (2) sensitivity and penetrability of SINRD to the removal of fuel pins from an assembly. The Monte Carlo Neutral Particle eXtended (MCNPX) transport code was used to simulate SINRD for different geometries. Experimental measurements were also performed with SINRD and were compared to MCNPX simulations of the experiment to verify the accuracy of the MCNPX model of SINRD. Based on the results from these simulations and measurements, we have concluded that SINRD provides a number of improvements over current IAEA verification methods. These improvements include: (1) SINRD provides absolute measurements of burnup independent of the operator's declaration. (2) SINRD is sensitive to pin removal over the entire burnup range and can verify the diversion of 6% of fuel pins within 3o from LWR spent LEU and MOX fuel. (3) SINRD is insensitive to the boron concentration and initial fuel enrichment and can therefore be used at multiple spent fuel storage facilities. (4) The calibration of SINRD at one reactor facility carries over to reactor sites in different countries because it uses the ratio of fission chambers (FCs) that are not facility dependent. (5) SINRD can distinguish fresh and 1-cycle spent MOX fuel from 3- and 4-cycles spent LEU fuel without using reactor burnup codes.

Expected count rate for the Self- Interrogation Neutron Resonance Densitometry measurements of spent nuclear fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rossa, Riccardo; Universite libre de Bruxelles, Ecole polytechnique de Bruxelles - Service de Metrologie Nucleaire, CP 165/84, Avenue F.D. Roosevelt, 50 - B1050 Brussels; Borella, Alessandro

The Self-Interrogation Neutron Resonance Densitometry (SINRD) is a passive neutron technique that aims at a direct quantification of {sup 239}Pu in the fuel assemblies by measuring the attenuation of the neutron flux in the energy region close to the 0.3 eV resonance of {sup 239}Pu. The {sup 239}Pu mass is estimated by calculating the SINRD signature, that is the ratio between the neutron flux integrated over the fast energy region and around the 0.3 eV resonance region. The SINRD measurement approach considered in this study consists in introducing a small neutron detector in the central guide tube of a PWRmore » 17x17 fuel assembly. In order to measure the neutron flux in the energy regions defined in the SINRD signature, different detector types are used. The response of a bare {sup 238}U fission chamber is considered for the determination of the fast neutron flux, while other thermal-epithermal detectors wrapped in neutron absorbers are envisaged to measure the neutron flux around the resonance region. This paper provides an estimation of the count rate that can be achieved with the detector types proposed for the SINRD measurement. In the first section a set of detectors are evaluated in terms of count rate and sensitivity to the {sup 239}Pu content, in order to identify the optimal measurement configuration for each detector type. Then a study is performed to increase the count rate by increasing the detector size. The study shows that the highest count rate is achieved by using either {sup 3}He or {sup 10}B proportional counters because of the high neutron efficiency of these detectors. However, the calculations indicate that the biggest contribution to the measurement uncertainty is due to the measurement of the fast neutron flux. Finally, similar sensitivity to the {sup 239}Pu content is obtained by using the different detector types for the measurement of the neutron flux close to the resonance region. Therefore, the count rate associated to each detector type will play a major role in the selection of the detector types used for the SINRD measurement. (authors)« less

Vitamin D and nutritional status are related to bone fractures in alcoholics.

PubMed

González-Reimers, Emilio; Alvisa-Negrín, Julio; Santolaria-Fernández, Francisco; Candelaria Martín-González, M; Hernández-Betancor, Iván; Fernández-Rodríguez, Camino M; Viña-Rodríguez, J; González-Díaz, Antonieta

2011-01-01

Bone fractures are common in alcoholics. To analyse which factors (ethanol consumption; liver function impairment; bone densitometry; hormone changes; nutritional status, and disrupted social links and altered eating habits) are related to bone fractures in 90 alcoholic men admitted to our hospitalization unit because of organic problems. Bone homoeostasis-related hormones were measured in patients and age- and sex-matched controls. Whole-body densitometry was performed by a Hologic QDR-2000 (Waltham, MA, USA) densitometer, recording bone mineral density (BMD) and fat and lean mass; nutritional status and liver function were assessed. The presence of prevalent fractures was assessed by anamnesis and chest X-ray film. Forty-nine patients presented at least one fracture. We failed to find differences between patients with and without fractures regarding BMD parameters. Differences regarding fat mass were absent, but lean mass was lower among patients with bone fracture. The presence of fracture was significantly associated with impaired subjective nutritional evaluation (χ² = 5.79, P = 0.016), lower vitamin D levels (Z = 2.98, P = 0.003) and irregular eating habits (χ² = 5.32, P = 0.02). Reduced lean mass and fat mass, and altered eating habits were more prevalent among patients with only rib fractures (n = 36) than in patients with multiple fractures and/or fractures affecting other bones (n = 13). These last were more closely related to decompensated liver disease. Serum vitamin D levels showed a significant relationship with handgrip strength (ρ = 0.26, P = 0.023) and lean mass at different parts of the body, but not with fat mass. By logistic regression analysis, only vitamin D and subjective nutritional evaluation were significantly, independently related with fractures. Prevalent fractures are common among heavy alcoholics. Their presence is related more closely to nutritional status, lean mass and vitamin D levels than to BMD. Lean mass is more reduced, nutritional status is more impaired and there is a trend to more altered eating habits among patients with rib fractures, whereas multiple fractures depend more heavily on advanced liver disease.

Advanced imaging of the macrostructure and microstructure of bone

NASA Technical Reports Server (NTRS)

Genant, H. K.; Gordon, C.; Jiang, Y.; Link, T. M.; Hans, D.; Majumdar, S.; Lang, T. F.

2000-01-01

Noninvasive and/or nondestructive techniques are capable of providing more macro- or microstructural information about bone than standard bone densitometry. Although the latter provides important information about osteoporotic fracture risk, numerous studies indicate that bone strength is only partially explained by bone mineral density. Quantitative assessment of macro- and microstructural features may improve our ability to estimate bone strength. The methods available for quantitatively assessing macrostructure include (besides conventional radiographs) quantitative computed tomography (QCT) and volumetric quantitative computed tomography (vQCT). Methods for assessing microstructure of trabecular bone noninvasively and/or nondestructively include high-resolution computed tomography (hrCT), micro-computed tomography (muCT), high-resolution magnetic resonance (hrMR), and micromagnetic resonance (muMR). vQCT, hrCT and hrMR are generally applicable in vivo; muCT and muMR are principally applicable in vitro. Although considerable progress has been made in the noninvasive and/or nondestructive imaging of the macro- and microstructure of bone, considerable challenges and dilemmas remain. From a technical perspective, the balance between spatial resolution versus sampling size, or between signal-to-noise versus radiation dose or acquisition time, needs further consideration, as do the trade-offs between the complexity and expense of equipment and the availability and accessibility of the methods. The relative merits of in vitro imaging and its ultrahigh resolution but invasiveness versus those of in vivo imaging and its modest resolution but noninvasiveness also deserve careful attention. From a clinical perspective, the challenges for bone imaging include balancing the relative advantages of simple bone densitometry against the more complex architectural features of bone or, similarly, the deeper research requirements against the broader clinical needs. The considerable potential biological differences between the peripheral appendicular skeleton and the central axial skeleton have to be addressed further. Finally, the relative merits of these sophisticated imaging techniques have to be weighed with respect to their applications as diagnostic procedures requiring high accuracy or reliability on one hand and their monitoring applications requiring high precision or reproducibility on the other. Copyright 2000 S. Karger AG, Basel.

Synovial fluid matrix metalloproteinase-2 and -9 activities in dogs suffering from joint disorders.

PubMed

Murakami, Kohei; Maeda, Shingo; Yonezawa, Tomohiro; Matsuki, Naoaki

2016-07-01

The activity of matrix metalloproteinase (MMP)-2 and MMP-9 in synovial fluids (SF) sampled from dogs with joint disorders was investigated by gelatin zymography and densitometry. Pro-MMP-2 showed similar activity levels in dogs with idiopathic polyarthritis (IPA; n=17) or canine rheumatoid arthritis (cRA; n=4), and healthy controls (n=10). However, dogs with cranial cruciate ligament rupture (CCLR; n=5) presented significantly higher pro-MMP-2 activity than IPA and healthy dogs. Meanwhile, dogs with IPA exhibited significantly higher activity of pro- and active MMP-9 than other groups. Activity levels in pro- and active MMP-9 in cRA and CCLR dogs were not significantly different from those in healthy controls. Different patterns of MMP-2 and MMP-9 activity may reflect the differences in the underlying pathological processes.

Bone mineral measurement using dual energy x ray densitometry

NASA Technical Reports Server (NTRS)

Smith, Steven W.

1989-01-01

Bone mineral measurements before and after space missions have shown that weightlessness greatly accelerates bone demineralization. Bone mineral losses as high as 1 to 3 percent per month were reported. Highly precise instrumentation is required to monitor this loss and thereby test the efficacy of treatment. During the last year, a significant improvement was made in Dual-Photon Absorptiometry by replacing the radioactive source with an x ray tube. Advantages of this system include: better precision, lower patient dose, better spacial resolution, and shorter scan times. The high precision and low radiation dose of this technique will allow detection of bone mineral changes of less than 1 percent with measurements conducted directly at the sites of interest. This will allow the required bone mineral studies to be completed in a shorter time with greater confidence.

Effect of clofibric acid on desmin and vimentin contents in rat myocardiocytes.

PubMed

Sampayo-Reyes, Adriana; Narro-Juárez, Antonio; Saíd-Fernández, Salvador; Lozano-Garza, Héctor G; Vargas-Villarreal, Javier; Mata-Cárdenas, Benito D; Morales-Aguilera, Antonio; González-Garza, María Teresa; Cortés-Gutiérrez, Elva I; Cerda-Flores, Ricardo M; Martínez-Rodríguez, Herminia G

2006-01-01

The aim of this experimental study was to analyze in vitro effects of clofibric acid on vimentin and desmin contents in rat myocardiocytes, which was carried out in primary myocardiocyte cells that were treated only with clofibric acid at 0.1 mM. The measurement of vimentin and desmin were done by Western blotting and densitometry. This study showed that myocardiocytes exposed to clofibric acid exhibit a 26.3% decrease in vimentin and a 42.1% decrease in desmin. Considering the role that these intermediate filaments play in the anchorage and cellular organization of myocardiocytes, the decrease of desmin and vimentin observed in cells treated with clofibric acid may be partially responsible for the adverse effects observed in patients. In conclusion, the alteration of cytoskeletal proteins may be a cause of cardiopathy in patients treated with these compounds.

A first exploration of genome size diversity in sponges.

PubMed

Jeffery, Nicholas W; Jardine, Catherine B; Gregory, T Ryan

2013-08-01

The phyla known as early-branching lineages of animals have become the subject of increasing interest from the perspectives of genomics and evolutionary biology. Unfortunately, data on even the most fundamental properties of their genomes, such as genome size, remain very scarce. In this study, genome size estimates are reported for 75 species of sponges (phylum Porifera) representing 33 families and 12 orders, marking the first large survey of genome size diversity for an early-branching phylum. Sponge genome sizes averaged around 0.2 pg but exhibited a 17-fold range overall (0.04-0.63 pg). In addition, the results of comparisons of two methods of genome size quantification (flow cytometry and Feulgen image analysis densitometry) are presented, thereby facilitating future work on these animals. Some particularly promising avenues for future investigation are highlighted.

Discrimination of osteoarthritic and rheumatoid human synovial cells in culture by nuclear image analysis.

PubMed

Delage, B; Giroud, F; Monet, J D; Ekindjian, O G; Cals, M J

1999-06-01

Rheumatoid arthritic (RA) and osteoarthritic (OA) synovial cells in culture differ in their metabolic and proliferative behaviour. To assess links between these properties and nuclear changes, we used image analysis to study chromatin texture, together with nuclear morphometry and densitometry of OA and RA cells in primary culture. Chromatin pattern at the third day (D3) was heterogeneous and granular with chromatin clumps whereas at the final stage (D11) of culture a homogeneous and finely granular chromatin texture was observed. This evolution indicates global chromatin decondensation. These characteristics were more marked for RA than for OA nuclei. At each culture time, RA nuclei could be discriminated with high confidence from OA ones from parameters evaluating the organization of the chromatine texture. Nuclear image analysis is thus a useful tool for investigating synovial cell biology.

Biomedical technology transfer. Applications of NASA science and technology

NASA Technical Reports Server (NTRS)

Harrison, D. C.

1980-01-01

Ongoing projects described address: (1) intracranial pressure monitoring; (2) versatile portable speech prosthesis; (3) cardiovascular magnetic measurements; (4) improved EMG biotelemetry for pediatrics; (5) ultrasonic kidney stone disintegration; (6) pediatric roentgen densitometry; (7) X-ray spatial frequency multiplexing; (8) mechanical impedance determination of bone strength; (9) visual-to-tactile mobility aid for the blind; (10) Purkinje image eyetracker and stabilized photocoalqulator; (11) neurological applications of NASA-SRI eyetracker; (12) ICU synthesized speech alarm; (13) NANOPHOR: microelectrophoresis instrument; (14) WRISTCOM: tactile communication system for the deaf-blind; (15) medical applications of NASA liquid-circulating garments; and (16) hip prosthesis with biotelemetry. Potential transfer projects include a person-portable versatile speech prosthesis, a critical care transport sytem, a clinical information system for cardiology, a programmable biofeedback orthosis for scoliosis a pediatric long-bone reconstruction, and spinal immobilization apparatus.

Quantification of Sunscreen Ethylhexyl Triazone in Topical Skin-Care Products by Normal-Phase TLC/Densitometry

PubMed Central

Sobanska, Anna W.; Pyzowski, Jaroslaw

2012-01-01

Ethylhexyl triazone (ET) was separated from other sunscreens such as avobenzone, octocrylene, octyl methoxycinnamate, and diethylamino hydroxybenzoyl hexyl benzoate and from parabens by normal-phase HPTLC on silica gel 60 as stationary phase. Two mobile phases were particularly effective: (A) cyclohexane-diethyl ether 1 : 1 (v/v) and (B) cyclohexane-diethyl ether-acetone 15 : 1 : 2 (v/v/v) since apart from ET analysis they facilitated separation and quantification of other sunscreens present in the formulations. Densitometric scanning was performed at 300 nm. Calibration curves for ET were nonlinear (second-degree polynomials), with R > 0.998. For both mobile phases limits of detection (LOD) were 0.03 and limits of quantification (LOQ) 0.1 μg spot−1. Both methods were validated. PMID:22629203

Synovial fluid matrix metalloproteinase-2 and -9 activities in dogs suffering from joint disorders

PubMed Central

MURAKAMI, Kohei; MAEDA, Shingo; YONEZAWA, Tomohiro; MATSUKI, Naoaki

2016-01-01

The activity of matrix metalloproteinase (MMP)-2 and MMP-9 in synovial fluids (SF) sampled from dogs with joint disorders was investigated by gelatin zymography and densitometry. Pro-MMP-2 showed similar activity levels in dogs with idiopathic polyarthritis (IPA; n=17) or canine rheumatoid arthritis (cRA; n=4), and healthy controls (n=10). However, dogs with cranial cruciate ligament rupture (CCLR; n=5) presented significantly higher pro-MMP-2 activity than IPA and healthy dogs. Meanwhile, dogs with IPA exhibited significantly higher activity of pro- and active MMP-9 than other groups. Activity levels in pro- and active MMP-9 in cRA and CCLR dogs were not significantly different from those in healthy controls. Different patterns of MMP-2 and MMP-9 activity may reflect the differences in the underlying pathological processes. PMID:26902805

[A structural protein study of the influenza A (H1N1) virus by polyacrylamide gel electrophoresis].

PubMed

Pérez Guevara, M T; Savón Valdés, C; Rivas Arjona, M; Goyenechea Hernández, A

1992-01-01

Influenza is an acute respiratory disease typically appearing as an epidemic. Three immunological types of the influenza virus are known: A, B and C. Continually, antigen changes occur, especially in type A. Therefore, a comparative study was carried out on 4 influenza A(H1N1) virus strains in relation to protein structure (surface antigens), by using polyacrylamide gel electrophoresis by the modified Laemmli method. The objective was to compare the structural proteins of the A/Havana/1292/78 (H1N1) national strain with the proteins of 3 international pattern strains. In all the cases, 6 bands were detected by densitometry. In the 4 strains studied the most abundant protein was M. Great differences between the Cuban strain and the 3 international patterns were not seen.

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment.

PubMed

Stagi, Stefano; Cavalli, Loredana; Seminara, Salvatore; de Martino, Maurizio; Brandi, Maria Luisa

2014-06-07

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed.

Nuclear Fuel Assay through analysis of Uranium L-shell by Hybrid L-edge/XRF Densitometer using a Surrogate Material

NASA Astrophysics Data System (ADS)

Park, Seunghoon; Joung, Sungyeop; Park, Jerry AB(; ), AC(; )

2018-01-01

Assay of L-series of nuclear material solution is useful for determination of amount of nuclear materials and ratio of minor actinide in the materials. The hybrid system of energy dispersive X-ray absorption edge spectrometry, i.e. L-edge densitometry, and X-ray fluorescence spectrometry is one of the analysis methods. The hybrid L-edge/XRF densitometer can be a promising candidate for a portable and compact equipment due to advantage of using low energy X-ray beams without heavy shielding systems and liquid nitrogen cooling compared to hybrid K-edge/XRF densitometer. A prototype of the equipment was evaluated for feasibility of the nuclear material assay using a surrogate material (lead) to avoid radiation effects from nuclear materials. The uncertainty of L-edge and XRF characteristics of the sample material and volume effects was discussed in the article.

Response of the skeletal system to helicopter-unique vibration.

PubMed

Gearhart, J R

1978-01-01

An 18-month prospective skeletal system study was conducted on flying and nonflying personnel relative to chronic low-frequency vibration as experienced in helicopter flight. The aviators were initial entry students in rotary-wing training while the non-flying participants were beginning basic military training. Comparisons were made on the basis of anthropometric measurements, radiological studies, and bone mineral density changes as measured by photon absorption. The bone mineral densitometry showed no significant variation in the aviator group. A short-term 10% demineralization of the distal ulna in the non-flying group was noted immediately following the physical training. The final bone mineral density of basic training subjects returned to the initial level 18 months after the physical training. It was concluded that the helicopter aircrew members under study were exposed to levels of vibration below the threshold of vibration required to produce a measurable change in the skeletal system.

Partial hypopituitarism and Langerhans cell histiocytosis

PubMed Central

Balaguruswamy, S; Chattington, P D

2011-01-01

A case of multisystem Langerhans cell histiocytosis with pituitary involvement nearly 20 years after initial presentation. A 48-year-old man had histiocytosis X 22 years ago initially involving the groin; subsequently his external auditory meatus, scalp, gum, mandibular bone, perineum and axilla were involved and treated. The pituitary gland was involved 4 years ago. A thyrotropin-releasing hormone test showed delayed response suggestive of hypothalamic disease. Prolactin levels were normal. A gonadotropin-releasing hormone test showed impaired testosterone and gonadotrophin response in keeping with pituitary disease. A glucagon stimulation test showed an impaired growth hormone response but a normal cortisol increase. MRI pituitary showed an empty sella. There was no evidence of diabetes insipidus. Bone mineral densitometry was normal. He has partial hypopituitarism needing thyroxine and testosterone replacement. He also developed type 2 diabetes mellitus 9 years ago. He is closely monitored for any development of diabetes insipidus and the need for growth hormone supplementation. PMID:22715201

Genome size and chromosome number in velvet worms (Onychophora).

PubMed

Jeffery, Nicholas W; Oliveira, Ivo S; Gregory, T Ryan; Rowell, David M; Mayer, Georg

2012-12-01

The Onychophora (velvet worms) represents a small group of invertebrates (~180 valid species), which is commonly united with Tardigrada and Arthropoda in a clade called Panarthropoda. As with the majority of invertebrate taxa, genome size data are very limited for the Onychophora, with only one previously published estimate. Here we use both flow cytometry and Feulgen image analysis densitometry to provide genome size estimates for seven species of velvet worms from both major subgroups, Peripatidae and Peripatopsidae, along with karyotype data for each species. Genome sizes in these species range from roughly 5-19 pg, with densitometric estimates being slightly larger than those obtained by flow cytometry for all species. Chromosome numbers range from 2n = 8 to 2n = 54. No relationship is evident between genome size, chromosome number, or reproductive mode. Various avenues for future genomic research are presented based on these results.

[DEFINITION OF INTERRELATION BETWEEN AMINOACID COMPOSITION OF URINE AND BONE TISSUE DENSITY AT CHILDREN WITH ACUTE LEUKAEMIA FOR ONCOHEMATOLOGICAL PATHOLOGY RISK GROUP FORMATION].

PubMed

Bebeshko, V G; Bruslova, E M; Volodina, T T; Tsvietkova, N M; Lyashenko, L A; Pushkareva, T I; Voloshko, V I; Veselskaya, L P; Chernysh, T A; Trikhleb, I V

2014-12-01

Age and sexual indexies of densitometry at patients with acute leukemia (AL) and healthy children are presented. 31% of children with AL during the initial period of disease had manifestations of the osteopenic syndrome. At patients with AL more often than at healthy children anomalies of development of front part of skull are defined. The partial contribution of free and peptides-connencted oxyproline in urine at AL patients differs in comparison with control group that is caused by modification or deficiency of the corresponding enzymes. 30% of patients with AL had raised concentration of free oxyproline in urine, and lowered glycine concentration that testifies to the increased disintegration of collagen and deficiency of tile plastic material necessary for collagene-forming processes. The obtained data should be considered for forming of risk group on oncohematological pathology at children.

Ethnic Differences in Bone Health

PubMed Central

Zengin, Ayse; Prentice, Ann; Ward, Kate Anna

2015-01-01

There are differences in bone health between ethnic groups in both men and in women. Variations in body size and composition are likely to contribute to reported differences. Most studies report ethnic differences in areal bone mineral density (aBMD), which do not consistently parallel ethnic patterns in fracture rates. This suggests that other parameters beside aBMD should be considered when determining fracture risk between and within populations, including other aspects of bone strength: bone structure and microarchitecture, as well as muscle strength (mass, force generation, anatomy) and fat mass. We review what is known about differences in bone-densitometry-derived outcomes between ethnic groups and the extent to which they account for the differences in fracture risk. Studies are included that were published primarily between 1994 and 2014. A “one size fits all approach” should definitely not be used to understand better ethnic differences in fracture risk. PMID:25852642

[Influence of occupational factors on the bone and joint functional state in the upper extremities and cervical spine in female workers of clothing manufacture].

PubMed

Druzhinin, V N; Shardakova, É F; Cherniĭ, A N

2014-01-01

The studies using multiple X-ray methods covered influence of complex containing working process and occupational environment factors on locomotory apparatus of upper limbs and cervical spine in female seamers engaged into various productions. Comparative analysis involved results of regular (standard X-ray) and special X-ray methods (stereoroentgenography, high definition roentgenography, roentgen densitometry, roentgenogrammetry) in 370 examinees with early and moderate clinical symptoms of occupationally mediated diseases of the stated areas. X-ray studies of locomotory apparatus of upper limbs and cervical spine in clothing manufacture workers, with special diagnostic methods, enabled to determine incidence and severity of functional and structural changes more reliably than via standard examination. The changes revealed were assigned mostly in "early" and "moderate" categories and matched with occupational peculiarities of the workers examined.

Selective determination of aloin in different matrices by HPTLC densitometry in fluorescence mode.

PubMed

Coran, Silvia A; Bartolucci, Gianluca; Bambagiotti-Alberti, Massimo

2011-01-25

A novel method based on the fluorescence excited solely on aloin by a H₃BO₃ derivatizing procedure, allowed its rapid and selective determination among the co-occurring components in a variety of complex matrices as several Aloes dried extracts and related commercial products. HPTLC LiChrospher silica gel 60 F254S, 20 cm x 10 cm, plates with ethyl formate: CH₃OH:H₂O (100:14.5:10, v/v) as the mobile phase were used. Densitometric determinations were performed in fluorescence mode, exciting wavelength 365 nm, optical filter K540 after derivatization with H₃BO₃. The method was validated giving rise to a dependable and high throughput procedure well suited to routine application. Aloin was quantified in the range of 110-330 ng with RSD of repeatability and intermediate precision not exceeding 2.3% and accuracy inside the acceptance limits. Copyright © 2010 Elsevier B.V. All rights reserved.

The ever-expanding conundrum of primary osteoporosis: aetiopathogenesis, diagnosis, and treatment

PubMed Central

2014-01-01

In recent years, as knowledge regarding the etiopathogenetic mechanisms of bone involvement characterizing many diseases has increased and diagnostic techniques evaluating bone health have progressively improved, the problem of low bone mass/quality in children and adolescents has attracted more and more attention, and the body evidence that there are groups of children who may be at risk of osteoporosis has grown. This interest is linked to an increased understanding that a higher peak bone mass (PBM) may be one of the most important determinants affecting the age of onset of osteoporosis in adulthood. This review provides an updated picture of bone pathophysiology and characteristics in children and adolescents with paediatric osteoporosis, taking into account the major causes of primary osteoporosis (PO) and evaluating the major aspects of bone densitometry in these patients. Finally, some options for the treatment of PO will be briefly discussed. PMID:24906390

Screening and determination of sibutramine in adulterated herbal slimming supplements by HPTLC-UV densitometry.

PubMed

Mathon, Caroline; Ankli, Anita; Reich, Eike; Bieri, Stefan; Christen, Philippe

2014-01-01

The adulteration of herbal supplements is of growing importance, especially when they contain undeclared compounds like sibutramine that are unsafe drugs. Sibutramine was withdrawn from US and European markets in 2010. In this study, an HPTLC-UV densitometric method was developed for the quantification of sibutramine in herbal diet foods. Sample extracts were directly applied onto HPTLC silica gel plates and separated with a mobile phase made of a toluene-methanol mixture. Sibutramine was quantified at 225 nm and its unequivocal identification was confirmed by MS using a TLC-MS interface. During two surveys, 52 weight loss supplements obtained via the Internet were screened. Half of those were adulterated with sibutramine at amounts reaching up to 35 mg per capsule. The results of this validated HPTLC method were compared with those obtained by HPLC-UV and HPLC-MS/MS. The results were not significantly different with the three methods.

Raman spectroscopy for DNA quantification in cell nucleus.

PubMed

Okotrub, K A; Surovtsev, N V; Semeshin, V F; Omelyanchuk, L V

2015-01-01

Here we demonstrate the feasibility of a novel approach to quantify DNA in cell nuclei. This approach is based on spectroscopy analysis of Raman light scattering, and avoids the problem of nonstoichiometric binding of dyes to DNA, as it directly measures the signal from DNA. Quantitative analysis of nuclear DNA contribution to Raman spectrum could be reliably performed using intensity of a phosphate mode at 1096 cm(-1) . When compared to the known DNA standards from cells of different animals, our results matched those values at error of 10%. We therefore suggest that this approach will be useful to expand the list of DNA standards, to properly adjust the duration of hydrolysis in Feulgen staining, to assay the applicability of fuchsines for DNA quantification, as well as to measure DNA content in cells with complex hydrolysis patterns, when Feulgen densitometry is inappropriate. © 2014 International Society for Advancement of Cytometry.

Analysis of correlation between initial alveolar bone density and apical root resorption after 12 months of orthodontic treatment without extraction

PubMed Central

Scheibel, Paula Cabrini; Ramos, Adilson Luiz; Iwaki, Lilian Cristina Vessoni; Micheletti, Kelly Regina

2014-01-01

OBJECTIVE: The aim of the present study was to investigate the correlation between initial alveolar bone density of upper central incisors (ABD-UI) and external apical root resorption (EARR) after 12 months of orthodontic movement in cases without extraction. METHODS: A total of 47 orthodontic patients 11 years old or older were submitted to periapical radiography of upper incisors prior to treatment (T1) and after 12 months of treatment (T2). ABD-UI and EARR were measured by means of densitometry. RESULTS: No statistically significant correlation was found between initial ABD-UI and EARR at T2 (r = 0.149; p = 0.157). CONCLUSION: Based on the present findings, alveolar density assessed through periapical radiography is not predictive of root resorption after 12 months of orthodontic treatment in cases without extraction. PMID:25715722

Biochemical markers in the assessment of bone disease

NASA Technical Reports Server (NTRS)

Bikle, D. D.

1997-01-01

As the mean age of our population increases, increasing attention has been paid to the diseases associated with aging, including diseases of the skeleton such as osteoporosis. Effective means of treating and possibly preventing such skeletal disorders are emerging, making their early recognition an important goal for the primary care physician. Although bone density measurements and skeletal imaging studies remain of primary diagnostic importance in this regard, a large number of assays for biochemical markers of bone formation and resorption are being developed that promise to complement the densitometry measurements and imaging studies, providing an assessment of the rates of bone turnover and an earlier evaluation of the effects of therapy. In this review, emphasizing the recent literature, the major biochemical markers currently in use or under active investigation are described, and their application in a number of diseases of the skeleton including osteoporosis is evaluated.

Myosin heavy chain isoform expression in human extraocular muscles: longitudinal variation and patterns of expression in global and orbital layers.

PubMed

Park, Kyung-Ah; Lim, Jeonghee; Sohn, Seongsoo; Oh, Sei Yeul

2012-05-01

We investigated the distribution of myosin heavy chain (MyHC) isoforms along the length of the global and orbital layers of human extraocular muscles (EOMs). Whole muscle tissue extracts of human EOMs were cross-sectioned consecutively and separated into orbital and global layers. The extracts from these layers were subjected to electrophoretic analysis, followed by quantification with scanning densitometry. MyHC isoforms displayed different distributions along the lengths of EOMs. In the orbital and global layers of all EOMs except for the superior oblique muscle, MyHCeom was enriched in the central regions. MyHCIIa and MyHCI were most abundant in the proximal and distal ends. A variation in MyHC isoform expression was apparent along the lengths of human EOMs. These results provide a basis for understanding the molecular mechanisms underlying the functional diversity of EOMs. Copyright © 2012 Wiley Periodicals, Inc.

Pharmacognostic Specification, Chlorogenic Acid Content, and In vitro Antioxidant Activities of Lonicera japonica Flowering Bud

PubMed Central

Chaowuttikul, Chayanon; Palanuvej, Chanida; Ruangrungsi, Nijsiri

2017-01-01

Background: Lonicera japonica Thunb. or Japanese Honeysuckle has been widely used in traditional medicine for antipyretic. Objective: To establish the pharmacognostic specification of L. japonica flowering bud in Thailand and to determine its chlorogenic acid content and in vitro antioxidant activities. Materials and Methods: Dried L. japonica flowering bud from 15 various herbal drugstores throughout Thailand were investigated for pharmacognostic specification. Their chlorogenic acid contents were quantitatively analyzed by thin layer chromatography (TLC) densitometry with winCATS software. The mobile phase for TLC development consisted of ethyl acetate: formic acid: acetic acid: water (10:1.1:1.1:2.6). Antioxidant activities were investigated by 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical scavenging, ferric ion reducing antioxidant power assay, nitric oxide scavenging assay, and β-carotene bleaching assays. Results: Qualified L. japonica flowering bud in Thailand was presented that the contents of loss on drying, total ash, acid-insoluble ash, and water should not be >10.11%, 6.59%, 1.14%, and 10.82% by weight, respectively. The ethanol and water soluble extractive values should not be < 16.46% and 28.88% by weight, respectively. Chlorogenic acid content in L. japonica flowering bud was found to be 2.24 ± 0.50 g/100 g of crude drug. L. japonica flowering bud showed DPPH and nitric oxide scavenging activities as well as reducing power property. Conclusion: This pharmacognostic specification with special reference to the chlorogenic acid content can be used for quality control of L. japonica flowering bud in Thailand. The potential antioxidant of this crude drug was demonstrated in vitro. SUMMARY Pharmacognostic specification of Lonicera japonica flowering bud in Thailand has been establishedThe chlorogenic acid content has been quantified by thin layer chromatography-densitometryThe ethanolic extract of L. japonica flowering bud showed antioxidation potential, especially on reducing power property. Abbreviations Used: TLC: Thin layer chromatography, DPPH: 2,2-diphenyl-1-picrylhydrazyl, FRAP: Ferric ion Reducing Antioxidant Power, WHO: World Health Organization, ICH: International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use; LOD: Limit of detection; LOQ: Limit of quantitation; BHT: Butylated hydroxytoluene; FeSO4: Iron(II) sulfate; DMSO: Dimethyl sulfoxide; TPTZ: 2,4,6-tripyridyl-s-triazine. PMID:28539735

Expected total counts for the Self-Interrogation Neutron Resonance Densitometry measurements of spent nuclear fuel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rossa, Riccardo; Universite Libre de Bruxelles; Borella, Alessandro

2015-07-01

The Self-Interrogation Neutron Resonance Densitometry (SINRD) is a passive neutron technique that aims at a direct quantification of {sup 239}Pu in spent fuel assemblies by measuring the attenuation of the neutron flux in the energy region close to the 0.3 eV resonance of {sup 239}Pu. The {sup 239}Pu mass is estimated by calculating the SINRD signature, that is the ratio between the neutron counts in the fast energy region and around the 0.3 eV resonance region. The SINRD measurement approach in this study consisted in introducing a small neutron detector in the central guide tube of a PWR 17x17 fuelmore » assembly. In order to measure the neutron flux in the energy regions defined in the SINRD signature, different detector types were used. The response of a bare {sup 238}U fission chamber is considered for the determination of the fast neutron flux, while other thermal-epithermal detectors wrapped in neutron absorbers are envisaged to measure the neutron flux around the resonance region. This paper provides an estimation of the total neutron counts that can be achieved with the detector types proposed for the SINRD measurement. In the first section a set of detectors are evaluated in terms of total neutron counts and sensitivity to the {sup 239}Pu content, in order to identify the optimal measurement configuration for each detector type. Then a study is performed to increase the total neutron counts by increasing the detector size. The study shows that the highest total neutron counts are achieved by using either {sup 3}He or {sup 10}B proportional counters because of the high neutron efficiency of these detectors. However, the calculations indicate that the biggest contribution to the measurement uncertainty is due to the measurement of the fast neutron flux. Finally, similar sensitivity to the {sup 239}Pu content is obtained by using the different detector types for the measurement of the neutron flux close to the resonance region. Therefore, the total neutron counts associated to each detector type will play a major role in the selection of the detector types used for the SINRD measurement. (authors)« less

The anabolic effects of vitamin D-binding protein-macrophage activating factor (DBP-MAF) and a novel small peptide on bone.

PubMed

Schneider, Gary B; Grecco, Kristina J; Safadi, Fayez F; Popoff, Steven N

2003-01-01

Vitamin D-binding protein-macrophage activating factor (DBP-MAF) has previously been shown to stimulate bone resorption and correct the skeletal defects associated with osteopetrosis in two nonallelic mutations in rats. This same protein and a small fragment of the protein have now been shown to demonstrate an anabolic effect on the skeleton of both newborn and young adult, intact rats. The novel peptide fragment was synthetically produced based on the human amino acid sequence at the site of glycosylation in the third domain of the native protein (DBP). The peptide tested is 14 amino acids in length and demonstrates no homologies other than to that region of DBP. Newborn rats were injected i.p. with saline, peptide (0.4 ng/g body wt.) or DBP-MAF (2 ng/g body wt.) every other day from birth to 14 days of age. On day 16 the rats were euthanized and the long bones collected for bone densitometry by pQCT. After 2 weeks of treatment with either the whole protein (DBP-MAF) or the small peptide, bone density was significantly increased in the treated animals compared to the saline controls. Young adult female rats (180 grams) were given s.c. injections of saline or peptide (0.4 ng/g body wt. or 5 ng/g body wt.) every other day for 2 weeks; 2 days after the final injections, the rats were euthanized and the femurs and tibias collected for bone densitometry. Both doses of the peptide resulted in significant increases in bone density as determined by pQCT. Young adult rats were injected locally with a single dose of the peptide (1 microg) or saline into the marrow cavity of the distal femur. One week after the single injection, the bones were collected for radiographic and histological evaluation. The saline controls showed no evidence of new bone formation, whereas the peptide-treated animals demonstrated osteoinduction in the marrow cavity and osteogenesis of surrounding cortical and metaphyseal bone. These data suggest that DBP-MAF and the synthetic peptide represent therapeutic opportunities for the treatment of a number of bone diseases and skeletal disorders. Systemic administration could be used to treat osteoporosis and a number of other osteopenias, and local administration could be effective in fractures, bony defect repairs, spinal surgery, and joint replacement.

Survival Fraction at 2 Gy and γH2AX Expression Kinetics in Peripheral Blood Lymphocytes From Cancer Patients: Relationship With Acute Radiation-Induced Toxicities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pouliliou, Stamatia E.; Lialiaris, Theodoros S.; Dimitriou, Thespis

Purpose: Predictive assays for acute radiation toxicities would be clinically relevant in radiation oncology. We prospectively examined the predictive role of the survival fraction at 2 Gy (SF2) and of γH2AX (double-strand break [DSB] DNA marker) expression kinetics in peripheral blood mononuclear cells (PBMCs) from cancer patients before radiation therapy. Methods and Materials: SF2 was measured with Trypan Blue assay in the PBMCs from 89 cancer patients undergoing radiation therapy at 4 hours (SF2{sub [4h]}) and 24 hours (SF2{sub [24h]}) after ex vivo irradiation. Using Western blot analysis and band densitometry, we further assessed the expression of γH2AX in PBMC DNA at 0 hours, 30 minutes,more » and 4 hours (33 patients) and 0 hour, 4 hours, and 24 hours (56 patients), following ex vivo irradiation with 2 Gy. Appropriate ratios were used to characterize each patient, and these were retrospectively correlated with early radiation therapy toxicity grade. Results: The SF2{sub (4h)} was inversely correlated with the toxicity grade (P=.006). The γH2AX-ratio{sub (30min)} (band density of irradiated/non-irradiated cells at 30 minutes) revealed, similarly, a significant inverse association (P=.0001). The DSB DNA repair rate from 30 minutes to 4 hours, calculated as the relative RγH2AX-ratio (γH2AX-ratio{sub (4h)}/γH2AX-ratio{sub (30min)}) showed a significant direct association with high toxicity grade (P=.01). Conclusions: Our results suggest that SF2 is a significant radiation sensitivity index for patients undergoing radiation therapy. γH2AX Western blot densitometry analysis provided 2 important markers of normal tissue radiation sensitivity. Low γH2AX expression at 30 minutes was linked with high toxicity grade, suggesting that poor γH2AX repair activity within a time frame of 30 minutes after irradiation predicts for poor radiation tolerance. On the other hand, rapid γH2AX content restoration at 4 hours after irradiation, compatible with efficient DSB repair ability, predicts for increased radiation tolerance.« less

A DXA Whole Body Composition Cross-Calibration Experience: Evaluation With Humans, Spine, and Whole Body Phantoms.

PubMed

Krueger, Diane; Libber, Jessie; Sanfilippo, Jennifer; Yu, Hui Jing; Horvath, Blaine; Miller, Colin G; Binkley, Neil

2016-01-01

New densitometer installation requires cross-calibration for accurate longitudinal assessment. When replacing a unit with the same model, the International Society for Clinical Densitometry recommends cross-calibrating by scanning phantoms 10 times on each instrument and states that spine bone mineral density (BMD) should be within 1%, whereas total body lean, fat, and %fat mass should be within 2% of the prior instrument. However, there is limited validation that these recommendations provide adequate total body cross-calibration. Here, we report a total body cross-calibration experience with phantoms and humans. Cross-calibration between an existing and new Lunar iDXA was performed using 3 encapsulated spine phantoms (GE [GE Lunar, Madison, WI], BioClinica [BioClinica Inc, Princeton, NJ], and Hologic [Hologic Inc, Bedford, MA]), 1 total body composition phantom (BioClinica), and 30 human volunteers. Thirty scans of each phantom and a total body scan of human volunteers were obtained on each instrument. All spine phantom BMD means were similar (within 1%; <-0.010 g/cm2 bias) between the existing and new dual-energy X-ray absorptiometry unit. The BioClinica body composition phantom (BBCP) BMD and bone mineral content (BMC) values were within 2% with biases of 0.005 g/cm2 and -3.4 g. However, lean and fat mass and %fat differed by 4.6%-7.7% with biases of +463 g, -496 g, and -2.8%, respectively. In vivo comparison supported BBCP data; BMD and BMC were within ∼2%, but lean and fat mass and %fat differed from 1.6% to 4.9% with biases of +833 g, -860 g, and -1.1%. As all body composition comparisons exceeded the recommended 2%, the new densitometer was recalibrated. After recalibration, in vivo bias was lower (<0.05%) for lean and fat; -23 and -5 g, respectively. Similarly, BBCP lean and fat agreement improved. In conclusion, the BBCP behaves similarly, but not identical, to human in vivo measurements for densitometer cross-calibration. Spine phantoms, despite good BMD and BMC agreement, did not detect substantial lean and fat differences observed using BBCP and in vivo assessments. Consequently, spine phantoms are inadequate for dual-energy X-ray absorptiometry whole body composition cross-calibration. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors affecting bone mineral density in postmenopausal women.

PubMed

Heidari, Behzad; Hosseini, Reza; Javadian, Yahya; Bijani, Ali; Sateri, Mohammad Hassan; Nouroddini, Haj Ghorban

2015-01-01

This study aimed to determine the relationship between bone mineral density (BMD) and demographic, biochemical, and clinical features according to BMD measurement sites. The results indicated that BMD correlates negatively with menopause duration, parity, and history of fractures but positively correlates with obesity, physical activity, education, and serum ferritin. Osteoporosis (OP) is an important cause of morbidity and mortality in the elderly people. The impacts of various factors on bone mineral density (BMD) differ across diverse population. We hypothesized that the influences of factors which affect BMD vary according to BMD measurement sites. The aim of this study was to determine the relationship between BMD in the femoral neck (FN) and lumbar spine (LS) with some common clinical, demographic, and biochemical parameters in postmenopausal women. In this cross-sectional case-control study, all postmenopausal women of the Amirkola Health and Ageing Project (AHAP) who performed bone densitometry were included. BMD at FN and LS was measured by DXA method. Data regarding clinical, demographic, and biochemical characteristics were provided. OP was diagnosed by the International Society for Clinical Densitometry criteria. Pearson correlation and multivariate regression analyses with simultaneous adjustment were performed to determine relationship. Five hundred thirty-seven women with mean age of 67.9 ± 6.7 years and mean menopause duration (MD) of 15.8 ± 5.1 years were studied. MD correlated negatively with FN-BMD and LS-BMD g/cm(2) (r = -0.405, p = 0.001 and r = -0.217, p = 0.001). Body mass index (BMI) correlated positively with FN and LS-BMD g/cm(2) (r = 0.397, p = 0.001 and r = 0.311, p = 0.001). The association of MD with risk of FN-OP was stronger than LS-OP. Obesity and metabolic syndrome (MS) and higher serum ferritin reduced the risk of OP at both LS and FN similarly, whereas the impacts of parity, prior fracture, high level of education, and physical activity were significantly different across BMD measurement sites. The results of this study indicated a significant association between OP and MD, obesity, parity, MS, history of fracture, serum ferritin, level of education, and physical activity. However, the direction and the strength of association varied across BMD measurement sites.

[Distribution of corneal densitometry and its correlation with ocular stray light in healthy eyes].

PubMed

Wu, Zhiqing; Wang, Yan; Zhang, Lin; Wu, Di; Wei, Shengsheng; Su, Xiaolian

2014-01-01

To evaluate and investigate the distribution of corneal density and its Correlation with stray-light value in adult and healthy eyes. A prospective study. Human corneal specimens ranging in age between 20 and 49 years, 116 patients (232 eyes) in total, divided into three groups: 20-29, 30-39, 40-49. Pentacam was used to evaluate total corneal average density and corneal thickness at different diameter around the corneal apex, for corneal density were ≤ 2 mm, >2 mm and ≤ 6 mm, >6 mm and ≤ 10 mm, for corneal thickness were 2 mm, 6 mm and 10 mm, C-quant was used for the stray-light value. Software SPSS 17.0 was used for statistical analysis. Independent samples t testing method was applied to compare the corneal densitometry in different gender and between left eyes and right ones, One-way ANOVA was applied to analyze the differences of corneal density in different age groups and diameters. Pearson correlation analysis was applied to assess the correlation in corneal densitometry values of different diameters, between corneal density of different diameters and age, corneal density of different diameters and corneal thickness of different diameters, corneal density of different diameters and stray-light values. Corneal density for ≤ 2 mm, >2 mm and ≤ 6 mm, >6 mm and ≤ 10 mm diameter are 10.1 ± 1.5(8.2-16.7), 9.3 ± 1.3(7.9-14.2), 9.6 ± 1.7(7.3-16.2). Corneal density of >6 mm and ≤ 10 mm diameter in different age groups were 8.9 ± 1.1, 9.3 ± 1.2, 10.7 ± 2.1, there was a statistical difference in these values (F = 28.939, P = 0.000), and there was a positive correlation between corneal density of >6 mm and ≤ 10 mm diameter and age (r = 0.417, P = 0.000), There were no statistical differences in corneal density values of ≤ 2 mm and >2 mm and ≤ 6 mm in different age groups (F = 1.575, 1.436; P > 0.05), and they had no correlation with age (r = 0.002, 0.048; P > 0.05). There was no statistical difference in corneal density in different gender (t = 1.744, 1.647, -1.181; P > 0.05). Corneal density values of left eyes and right ones had positive relationships at the same diameter (r = 0.977, P = 0.000; r = 0.992, P = 0.000; r = 0.933, P = 0.000), and there were no statistical differences (t = 0.124, 0.199, -0.020;P > 0.05). Between corneal density values of different diameter, there are also some positive relationships, >6 mm and ≤ 10 mm and ≤ 2 mm (r = 0.710, P = 0.000), >6 mm and ≤ 10 mm and >2 mm and ≤ 6 mm (r = 0.748, P = 0.000), ≤ 2 mm and >2 mm and ≤ 6 mm (r = 0.973, P = 0.000), relationship between ≤ 2 mm and >2 mm and ≤ 6 mm, >2 mm and ≤ 6 mm and >6 mm and ≤ 10 mm was obvious, and there was statistical difference in them (F = 17.057, P = 0.000) . The ocular stray light value was 0.95 ± 0.19(0.48-1.38), Corneal density values of ≤ 2 mm, >2 mm and ≤ 6 mm and >6 mm and ≤ 10 mm diameter had positive relationships with the stray light value (r = 0.134,0.146,0.159, P = 0.042,0.026,0.016). Corneal density can be influenced by age, the influence from age infected the corneal density of peripheral more. There was no correlation between corneal density and corneal thickness. There were some influences of corneal density of healthy eyes to the ocular stray light.

X-RAY DENSITOMETRY OF NORWAY SPRUCE SUBFOSSIL WOOD FROM THE AUSTRIAN ALPS

PubMed Central

KŁUSEK, MARZENA; GRABNER, MICHAEL

2016-01-01

The processing of subfossil wood poses some difficulties in densitometric research. Problems arise because of the physio-chemical changes of wood occurring in the sedimentation environment. Subfossil wood modification can result from the uptake of mineral and organic substances into the wood tissue. It can also occur as the effect of microbiological degradation of wood. The goal of this study was to identify the appropriate method of subfossil wood preparation for the densitometric research. For this purpose the wood of Norway spruce from Lake Schwarzensee was subjected to extraction in deionized water, acetone and diluted acetic acid. The application of acetic acid did not significantly influence the density of the wood and acetone seemed to be too aggressive. The best result was obtained by rinsing the samples in cold de-ionized water. This extraction procedure allowed removal of unwanted water-soluble, organic and inorganic compounds from wood and simultaneously did not lead to the degradation of subfossil samples. PMID:27158247

Bioindicators in the MIDUS National Study: Protocol, Measures, Sample, and Comparative Context

PubMed Central

Love, Gayle Dienberg; Seeman, Teresa E.; Weinstein, Maxine; Ryff, Carol D.

2010-01-01

Objectives MIDUS is a national study of health and aging among individuals aged 25 to 74 at baseline(1995/96). Longitudinal survey assessments (2004/05), were followed by biological assessments on a subsample aged 35–85. To facilitate public use, we describe the protocol, measures, and sample. Methods Respondents traveled to clinics for a two-day data collection protocol that included fasting blood specimens, 12-hour urine specimen, medical history, physical exam, bone densitometry, a laboratory challenge (heart rate variability, blood pressure, respiration, salivary cortisol). Results Response rates for the biological protocol (N = 1,255) were 39.3%, or 43.1% (adjusting for those who could not be located or contacted). Reasons for non-participation were travel, family obligations, and being too busy. Respondents were comparable to the recruitment pool on most demographic characteristics and health assessments. Discussion Strengths of the protocol vis-à-vis other similar studies include opportunities to link biological factors with diverse content from other MIDUS projects. PMID:20876364

[Hearing and balance in metabolic bone diseases].

PubMed

Zatoński, Tomasz; Temporale, Hanna; Krecicki, Tomasz

2012-03-01

There are reports that hearing loss is one of the clinical manifestations of metabolic bone diseases. Demineralization can lead to a reduction in ossicular mass. Paget's disease can reveal loss of mineral density of the cochlear bone. Ear bone remodeling in osteoporosis is similar to the changes in otosclerosis. Moreover, osteoporosis, osteogenesis imperfecta and otosclerosis have a similar genetic mechanism. According to some researchers osteopenia and osteoporosis may well be associated with idiopathic benign positional vertigo (BPV). Dysfunction of the organ of hearing and balance in patients with renal insufficiency may be due to disturbances in calcium phosphate balance and renal osteodystrophy in the course of the disease. Proving the presence of hearing loss in patients with metabolic bone diseases may lead to determining the new indications for bone densitometry in some patients with hearing impairment. Furthermore, audiological examination in patients with osteoporosis may be important because of the impact of hearing loss on prognosis for patients with metabolic bone diseases.

Determination of cortisol in human plasma by thin-layer chromatography and fluorescence derivatization with isonicotinic acid hydrazide.

PubMed

Fenske, Martin

2008-01-01

The present work describes a specific and rapid determination of cortisol in human plasma. The method includes liquid-liquid extraction of plasma samples, thin-layer chromatography (TLC) of ethanolic extracts on aluminium foil-backed silica gel 60 TLC plates, derivatization of cortisol with isonicotinic acid hydrazide, and densitometric measurement of the fluorescence intensity of cortisol hydrazone. The fluorescence was linearly related to cortisol amounts; the correlation coefficients of standard curve plots were r>0.99. The coefficient of variation ranged between 2.8-7.9% (20 ng, within-assay/between assay variation) and 1.6-6.8% (80 ng, within-assay/between assay variation). The recovery of cortisol from plasma spiked with 21-deoxycortisol was 85%+/-4%. Cortisol concentration in the plasma was 66+/-32 ng/mL (mean+/-standard deviation, n=24). The advantage of this method is its simplicity to separate cortisol from other steroids by TLC, its specificity (formation of cortisol hydrazone), and the rapid quantitation of cortisol by densitometry.

Partial molar volumes of proteins: amino acid side-chain contributions derived from the partial molar volumes of some tripeptides over the temperature range 10-90 degrees C.

PubMed

Häckel, M; Hinz, H J; Hedwig, G R

1999-11-15

The partial molar volumes of tripeptides of sequence glycyl-X-glycine, where X is one of the amino acids alanine, leucine, threonine, glutamine, phenylalanine, histidine, cysteine, proline, glutamic acid, and arginine, have been determined in aqueous solution over the temperature range 10-90 degrees C using differential scanning densitometry . These data, together with those reported previously, have been used to derive the partial molar volumes of the side-chains of all 20 amino acids. The side-chain volumes are critically compared with literature values derived using partial molar volumes for alternative model compounds. The new amino acid side-chain volumes, along with that for the backbone glycyl group, were used to calculate the partial specific volumes of several proteins in aqueous solution. The results obtained are compared with those observed experimentally. The new side-chain volumes have also been used to re-determine residue volume changes upon protein folding.

A compact x-ray system for two-phase flow measurement

NASA Astrophysics Data System (ADS)

Song, Kyle; Liu, Yang

2018-02-01

In this paper, a compact x-ray densitometry system consisting of a 50 kV, 1 mA x-ray tube and several linear detector arrays is developed for two-phase flow measurement. The system is capable of measuring void fraction and velocity distributions with a spatial resolution of 0.4 mm per pixel and a frequency of 1000 Hz. A novel measurement model has been established for the system which takes account of the energy spectrum of x-ray photons and the beam hardening effect. An improved measurement accuracy has been achieved with this model compared with the conventional log model that has been widely used in the literature. Using this system, void fraction and velocity distributions are measured for a bubbly and a slug flow in a 25.4 mm I.D. air-water two-phase flow test loop. The measured superficial gas velocities show an error within  ±4% when compared with the gas flowmeter for both conditions.

Simultaneous quantification of withanolides in Withania somnifera by a validated high-performance thin-layer chromatographic method.

PubMed

Srivastava, Pooja; Tiwari, Neerja; Yadav, Akhilesh K; Kumar, Vijendra; Shanker, Karuna; Verma, Ram K; Gupta, Madan M; Gupta, Anil K; Khanuja, Suman P S

2008-01-01

This paper describes a sensitive, selective, specific, robust, and validated densitometric high-performance thin-layer chromatographic (HPTLC) method for the simultaneous determination of 3 key withanolides, namely, withaferin-A, 12-deoxywithastramonolide, and withanolide-A, in Ashwagandha (Withania somnifera) plant samples. The separation was performed on aluminum-backed silica gel 60F254 HPTLC plates using dichloromethane-methanol-acetone-diethyl ether (15 + 1 + 1 + 1, v/v/v/v) as the mobile phase. The withanolides were quantified by densitometry in the reflection/absorption mode at 230 nm. Precise and accurate quantification could be performed in the linear working concentration range of 66-330 ng/band with good correlation (r2 = 0.997, 0.999, and 0.996, respectively). The method was validated for recovery, precision, accuracy, robustness, limit of detection, limit of quantitation, and specificity according to International Conference on Harmonization guidelines. Specificity of quantification was confirmed using retention factor (Rf) values, UV-Vis spectral correlation, and electrospray ionization mass spectra of marker compounds in sample tracks.

Effect of the menstrual cycle in ethanol pharmacokinetics.

PubMed

Haddad, L; Milke, P; Zapata, L; de la Fuente, J R; Vargas-Vorácková, F; Lorenzana-Jiménez, M; Corte, G; Tamayo, J; Kaplan, M; Márquez, M; Kershenobich, D

1998-01-01

Differences in ethanol pharmacokinetics within the menstrual cycle have previously been reported and attributed to variations in body composition, hormonal influences and gastric emptying. To establish the role of the menstrual cycle in ethanol pharmacokinetics associated with changes in body composition, ethanol blood concentrations were measured in nine healthy women during the midfollicular (P1, days 8-10) and midluteal (P2, days 22-24) phases of the menstrual cycle after a postprandial oral ethanol dose (0.3 g kg(-1)). Total body water was assessed by dual-energy x-ray densitometry (DEXA) on both occasions. Median total body water did not vary during either phase of the menstrual cycle (P1 = 54.54%, P2 = 54.66%; P = 0.9296). Median area under the ethanol concentration-time curve (AUC) was lower during P1 (215.33 mg.h dl(-1)) than during P2 (231.33 mg.h dl(-1))(P = 0.8253). No significant differences were found on ethanol pharmacokinetics in either phase of the menstrual cycle.

In situ micropillar compression reveals superior strength and ductility but an absence of damage in lamellar bone

NASA Astrophysics Data System (ADS)

Schwiedrzik, Jakob; Raghavan, Rejin; Bürki, Alexander; Lenader, Victor; Wolfram, Uwe; Michler, Johann; Zysset, Philippe

2014-07-01

Ageing societies suffer from an increasing incidence of bone fractures. Bone strength depends on the amount of mineral measured by clinical densitometry, but also on the micromechanical properties of the hierarchical organization of bone. Here, we investigate the mechanical response under monotonic and cyclic compression of both single osteonal lamellae and macroscopic samples containing numerous osteons. Micropillar compression tests in a scanning electron microscope, microindentation and macroscopic compression tests were performed on dry ovine bone to identify the elastic modulus, yield stress, plastic deformation, damage accumulation and failure mechanisms. We found that isolated lamellae exhibit a plastic behaviour, with higher yield stress and ductility but no damage. In agreement with a proposed rheological model, these experiments illustrate a transition from a ductile mechanical behaviour of bone at the microscale to a quasi-brittle response driven by the growth of cracks along interfaces or in the vicinity of pores at the macroscale.

Reconstruction of Canine Mandibular Bone Defects Using a Bone Transport Reconstruction Plate

PubMed Central

Elsalanty, Mohammed E.; Zakhary, Ibrahim; Akeel, Sara; Benson, Byron; Mulone, Timothy; Triplett, Gilbert R.; Opperman, Lynne A.

2010-01-01

Objectives Reconstruction of mandibular segmental bone defects is a challenging task. This study tests a new device used for reconstructing mandibular defects based on the principle of bone transport distraction osteogenesis. Methods Thirteen beagle dogs were divided into control and experimental groups. In all animals, a 3 cm defect was created on one side of the mandible. In eight control animals, the defect was stabilized with a reconstruction plate without further reconstruction and the animals were sacrificed two to three months after surgery. The remaining five animals were reconstructed with a bone transport reconstruction plate (BTRP), comprising a reconstruction plate with attached intraoral transport unit, and were sacrificed after one month of consolidation. Results Clinical evaluation, cone-beam CT densitometry, three-dimensional histomorphometry, and docking site histology revealed significant new bone formation within the defect in the distracted group. Conclusion The physical dimensions and architectural parameters of the new bone were comparable to the contralateral normal bone. Bone union at the docking site remains a problem. PMID:19770704

Comparison of conventional and digital radiography for radiometric differentiation of dental cements.

PubMed

Baksi, B Güniz; Ermis, R Banu

2007-10-01

To test the efficacy of conventional radiometry with indirect digital image analysis in the assessment of the relative radiopacity of dental cements used as liners or bases compared to human enamel and dentin. Disks of 15 different dental cements, 5 mm in diameter and 2 mm thick, were exposed to radiation together with 2-mm-thick disks of enamel and dentin and an aluminum step wedge. Density was evaluated by digital transmission densitometry and with the histogram function of an image analysis program following digitization of the radiographs with a flatbed scanner. A higher number of dental cements were discriminated from both dentin and enamel with conventional radiographic densitometer. All the cements examined, except Ionoseal (Voco) and Ionobond (Voco), were more radiopaque than dentin. With both methods, Chelon-Silver (3M ESPE) had the highest radiopacity and glass-ionomer cements the lowest. Radiodensity of dental cements can be differentiated with a high probability with the conventional radiometric method.

Genome size of termites (Insecta, Dictyoptera, Isoptera) and wood roaches (Insecta, Dictyoptera, Cryptocercidae)

NASA Astrophysics Data System (ADS)

Koshikawa, Shigeyuki; Miyazaki, Satoshi; Cornette, Richard; Matsumoto, Tadao; Miura, Toru

2008-09-01

The evolution of genome size has been discussed in relation to the evolution of various biological traits. In the present study, the genome sizes of 22 dictyopteran species were estimated by Feulgen image analysis densitometry and 6-diamidino-2-phenylindole (DAPI)-based flow cytometry. The haploid genome sizes ( C-values) of termites (Isoptera) ranged from 0.58 to 1.90 pg, and those of Cryptocercus wood roaches (Cryptocercidae) were 1.16 to 1.32 pg. Compared to known values of other cockroaches (Blattaria) and mantids (Mantodea), these values are low. A relatively small genome size appears to be a (syn)apomorphy of Isoptera + Cryptocercus, together with their sociality. In some phylogenetic groups, genome size evolution is thought to be influenced by selective pressure on a particular trait, such as cell size or rate of development. The present results raise the possibility that genome size is influenced by selective pressures on traits associated with the evolution of sociality.

Genome size of termites (Insecta, Dictyoptera, Isoptera) and wood roaches (Insecta, Dictyoptera, Cryptocercidae).

PubMed

Koshikawa, Shigeyuki; Miyazaki, Satoshi; Cornette, Richard; Matsumoto, Tadao; Miura, Toru

2008-09-01

The evolution of genome size has been discussed in relation to the evolution of various biological traits. In the present study, the genome sizes of 22 dictyopteran species were estimated by Feulgen image analysis densitometry and 6-diamidino-2-phenylindole (DAPI)-based flow cytometry. The haploid genome sizes (C-values) of termites (Isoptera) ranged from 0.58 to 1.90 pg, and those of Cryptocercus wood roaches (Cryptocercidae) were 1.16 to 1.32 pg. Compared to known values of other cockroaches (Blattaria) and mantids (Mantodea), these values are low. A relatively small genome size appears to be a (syn)apomorphy of Isoptera + Cryptocercus, together with their sociality. In some phylogenetic groups, genome size evolution is thought to be influenced by selective pressure on a particular trait, such as cell size or rate of development. The present results raise the possibility that genome size is influenced by selective pressures on traits associated with the evolution of sociality.

Validation of a reversed phase high performance thin layer chromatographic-densitometric method for secoisolariciresinol diglucoside determination in flaxseed.

PubMed

Coran, Silvia A; Bartolucci, Gianluca; Bambagiotti-Alberti, Massimo

2008-10-17

The validation of a HPTLC-densitometric method for the determination of secoisolariciresinol diglucoside (SDG) in flaxseed was performed improving the reproducibility of a previously reported HPTLC densitometric procedure by the use of fully wettable reversed phase plates (silica gel 60 RP18W F(254S), 10cmx10cm) with MeOH:HCOOH 0.1% (40:60, v/v) mobile phase. The analysis required only the alkaline hydrolysis in aqueous medium of undefatted samples and densitometry at 282nm of HPTLC runs. The method was validated following the protocol proposed by the Société Francaise des Sciences et Techniques Pharmaceutiques (SFSTP) giving rise to a dependable and high throughput procedure well suited to routine application. SDG was quantified in the range of 321-1071ng with RSD of repeatability and intermediate precision not exceeding 3.61% and accuracy inside the acceptance limits. Flaxseed of five cultivars of different origin was elected as test-bed.

Determination colchicine content in aquadest-extracted Gloriosa superba seed from Sukoharjo and Gunung Kidul

NASA Astrophysics Data System (ADS)

Rahmawati, S. I.; Susilowati, A.; Yunus, A.; Widyastuti, Y.

2018-03-01

Colchicine is a toxic alkaloid compound from the Colchicum autumnale plant. Colchicine can be used in agriculture as anti-mitosis in the procurement of plants with polyploid cells. Gloriosa superba is an herb contains colchicine as a mutagen (polyploid) potential in its parts, especially in the seeds. The aims of this research were to determine colchicine content from aquadest-extracted Gloriosa superba seed obtained from Sukoharjo and Gunung Kidul. Gloriosa superba seed samples were obtained naturally in January - April 2017. Samples were divided into immature seed samples from Mulur, Sukoharjo, Central Java and old seed samples from Krakal Beach, Gunung Kidul, Yogyakarta. Extraction seeds of Gloriosa superba using the maceration method with aquadest solvent (1: 1). Determination content of colchicine extract using TLC-Densitometry method. The results indicated that colchicine content of old seed Gloriosa superba samples 37,6 μg/μl (± 6,63) higher than colchicine content of immature seed Gloriosa superba samples 12,84 μg/μl (± 2,88)

Standardization of an in vitro Model for Evaluating the Bioavailability of Topically Applied Compounds on Damaged Skin: Application to Sunscreen Analysis.

PubMed

Jacques-Jamin, Carine; Jeanjean-Miquel, Corinne; Domergue, Anaïs; Bessou-Touya, Sandrine; Duplan, Hélène

2017-01-01

Information is lacking on the dermal penetration of topically applied formulations on in vitro skin models, under conditions where the stratum corneum (SC) is damaged. Therefore, we have developed a standardized in vitro barrier-disrupted skin model using tape stripping. Different tape stripping conditions were evaluated using histology, transepidermal water loss, infrared densitometry, and caffeine absorption. The effects of tape stripping were comparable using pig and human skin. Optimized conditions were used to test the effect of SC damage and UV irradiation on the absorption of an UV filter combination present in a sunscreen. The bioavailability of the filters was extremely low regardless of the extent of skin damage, suggesting bioavailability would not be increased if the consumer applied the sunscreen to sun-damaged skin. This standardized in vitro methodology using pig or human skin for damaged skin will add valuable information for the safety assessment of topically applied products. © 2017 S. Karger AG, Basel.

Fad diets and obesity--Part I: Measuring weight in a clinical setting.

PubMed

Moyad, Mark A

2004-04-01

Obesity is a recognized epidemic in many regions around the world and billions of dollars are spent each year in attempting to combat this problem. However, before a discussion of the different conventional and alternative treatments for obesity can be initiated, it is first critical to determine whether or not a certain individual is actually overweight, obese, or has an excess of adipose tissue. Therefore, a review of the various popular and unpopular measurements of obesity is needed. A variety of measurements exist such as bioelectrical impedance, body mass index (BMI), crude weight, densitometry, dual energy x-ray absorptiometry (DEXA), lean body mass (LBM), skinfold thickness, and waist-to-hip ratio (WHR). All of these measurements contain inherent advantages and disadvantages, but many of these can still be used in a clinical setting. Health professionals should acquaint themselves with these different measurements in order to take the first step in bringing attention to and potentially treating a condition that affects virtually every medical discipline.

Automatic lung lobe segmentation of COPD patients using iterative B-spline fitting

NASA Astrophysics Data System (ADS)

Shamonin, D. P.; Staring, M.; Bakker, M. E.; Xiao, C.; Stolk, J.; Reiber, J. H. C.; Stoel, B. C.

2012-02-01

We present an automatic lung lobe segmentation algorithm for COPD patients. The method enhances fissures, removes unlikely fissure candidates, after which a B-spline is fitted iteratively through the remaining candidate objects. The iterative fitting approach circumvents the need to classify each object as being part of the fissure or being noise, and allows the fissure to be detected in multiple disconnected parts. This property is beneficial for good performance in patient data, containing incomplete and disease-affected fissures. The proposed algorithm is tested on 22 COPD patients, resulting in accurate lobe-based densitometry, and a median overlap of the fissure (defined 3 voxels wide) with an expert ground truth of 0.65, 0.54 and 0.44 for the three main fissures. This compares to complete lobe overlaps of 0.99, 0.98, 0.98, 0.97 and 0.87 for the five main lobes, showing promise for lobe segmentation on data of patients with moderate to severe COPD.

Supercomplexes of the mitochondrial electron transport chain decline in the aging rat heart.

PubMed

Gómez, Luis A; Monette, Jeffrey S; Chavez, Juan D; Maier, Claudia S; Hagen, Tory M

2009-10-01

Accumulation of mitochondrial electron transport chain (ETC) defects is a recognized hallmark of the age-associated decline in cardiac bioenergetics; however, the molecular events involved are only poorly understood. In the present work, we hypothesized that age-related ETC deterioration stemmed partly from disassociation of large solid-state macromolecular assemblies termed "supercomplexes". Mitochondrial proteins from young and old rat hearts were separated by blue native-PAGE, protein bands analyzed by LC-MALDI-MS/MS, and protein levels quantified by densitometry. Results showed that supercomplexes comprised of various stoichiometries of complexes I, III and IV were observed, and declined significantly (p<0.05, n=4) with age. Supercomplexes displaying the highest molecular masses were the most severely affected. Considering that certain diseases (e.g. Barth Syndrome) display similar supercomplex destabilization as our results for aging, the deterioration in ETC supercomplexes may be an important underlying factor for both impaired mitochondrial function and loss of cardiac bioenergetics with age.

Performance assessment of self-interrogation neutron resonance densitometry for spent nuclear fuel assay

NASA Astrophysics Data System (ADS)

Hu, Jianwei; Tobin, Stephen J.; LaFleur, Adrienne M.; Menlove, Howard O.; Swinhoe, Martyn T.

2013-11-01

Self-Interrogation Neutron Resonance Densitometry (SINRD) is one of several nondestructive assay (NDA) techniques being integrated into systems to measure spent fuel as part of the Next Generation Safeguards Initiative (NGSI) Spent Fuel Project. The NGSI Spent Fuel Project is sponsored by the US Department of Energy's National Nuclear Security Administration to measure plutonium in, and detect diversion of fuel pins from, spent nuclear fuel assemblies. SINRD shows promising capability in determining the 239Pu and 235U content in spent fuel. SINRD is a relatively low-cost and lightweight instrument, and it is easy to implement in the field. The technique makes use of the passive neutron source existing in a spent fuel assembly, and it uses ratios between the count rates collected in fission chambers that are covered with different absorbing materials. These ratios are correlated to key attributes of the spent fuel assembly, such as the total mass of 239Pu and 235U. Using count rate ratios instead of absolute count rates makes SINRD less vulnerable to systematic uncertainties. Building upon the previous research, this work focuses on the underlying physics of the SINRD technique: quantifying the individual impacts on the count rate ratios of a few important nuclides using the perturbation method; examining new correlations between count rate ratio and mass quantities based on the results of the perturbation study; quantifying the impacts on the energy windows of the filtering materials that cover the fission chambers by tallying the neutron spectra before and after the neutrons go through the filters; and identifying the most important nuclides that cause cooling-time variations in the count rate ratios. The results of these studies show that 235U content has a major impact on the SINRD signal in addition to the 239Pu content. Plutonium-241 and 241Am are the two main nuclides responsible for the variation in the count rate ratio with cooling time. In short, this work provides insights into some of the main factors that affect the performance of SINRD, and it should help improve the hardware design and the algorithm used to interpret the signal for the SINRD technique. In addition, the modeling and simulation techniques used in this work can be easily adopted for analysis of other NDA systems, especially when complex systems like spent nuclear fuel are involved. These studies were conducted at Los Alamos National Laboratory.

Dual-energy imaging of bone marrow edema on a dedicated multi-source cone-beam CT system for the extremities

NASA Astrophysics Data System (ADS)

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-03-01

Purpose: Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods: Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results: For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion: Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities

PubMed Central

Zbijewski, W.; Sisniega, A.; Stayman, J. W.; Thawait, G.; Packard, N.; Yorkston, J.; Demehri, S.; Fritz, J.; Siewerdsen, J. H.

2015-01-01

Purpose Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Methods Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. Results For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 – 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Conclusion Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI. PMID:26045631

Dual-Energy Imaging of Bone Marrow Edema on a Dedicated Multi-Source Cone-Beam CT System for the Extremities.

PubMed

Zbijewski, W; Sisniega, A; Stayman, J W; Thawait, G; Packard, N; Yorkston, J; Demehri, S; Fritz, J; Siewerdsen, J H

2015-02-21

Arthritis and bone trauma are often accompanied by bone marrow edema (BME). BME is challenging to detect in CT due to the overlaying trabecular structure but can be visualized using dual-energy (DE) techniques to discriminate water and fat. We investigate the feasibility of DE imaging of BME on a dedicated flat-panel detector (FPD) extremities cone-beam CT (CBCT) with a unique x-ray tube with three longitudinally mounted sources. Simulations involved a digital BME knee phantom imaged with a 60 kVp low-energy beam (LE) and 105 kVp high-energy beam (HE) (+0.25 mm Ag filter). Experiments were also performed on a test-bench with a Varian 4030CB FPD using the same beam energies as the simulation study. A three-source configuration was implemented with x-ray sources distributed along the longitudinal axis and DE CBCT acquisition in which the superior and inferior sources operate at HE (and collect half of the projection angles each) and the central source operates at LE. Three-source DE CBCT was compared to a double-scan, single-source orbit. Experiments were performed with a wrist phantom containing a 50 mg/ml densitometry insert submerged in alcohol (simulating fat) with drilled trabeculae down to ~1 mm to emulate the trabecular matrix. Reconstruction-based three-material decomposition of fat, soft tissue, and bone was performed. For a low-dose scan (36 mAs in the HE and LE data), DE CBCT achieved combined accuracy of ~0.80 for a pattern of BME spherical lesions ranging 2.5 - 10 mm diameter in the knee phantom. The accuracy increased to ~0.90 for a 360 mAs scan. Excellent DE discrimination of the base materials was achieved in the experiments. Approximately 80% of the alcohol (fat) voxels in the trabecular phantom was properly identified both for single and 3-source acquisitions, indicating the ability to detect edemous tissue (water-equivalent plastic in the body of the densitometry insert) from the fat inside the trabecular matrix (emulating normal trabecular bone with significant fraction of yellow marrow). Detection of BME and quantification of water and fat content were achieved in extremities DE CBCT with a longitudinal configuration of sources providing DE imaging in a single gantry rotation. The findings support the development of DE imaging capability for CBCT of the extremities in areas conventionally in the domain of MRI.

[Rapid laboratory detection of antigens of infective agents of infections and technical means for their realization].

PubMed

Kal'noĭ, S M

2003-01-01

A system of new accelerated and rapid methods for the detection of the antigens of the infective agents of plague, cholera, tularemia and brucellosis were developed on the basis of solid phase immunosuspension tests: the passive hemagglutination (PHA) test and the latex agglutination (LA) test. The immunological and physico-chemical properties of suspensions in the PHA and LA tests made it possible to use extraneous sources of energy (centrifugal acceleration and the electric field) to accelerate these tests. The results of the PHA and LA tests were registered with the use of a densitometer, model Ultrascan 2202, and a tester, model C 34014.2. To apply centrifugal acceleration and the electric field, a laboratory centrifuge and an electrophoretic microchamber were designed. Densitometry was carried out on modified plates and conductometry, with the use of modified electrodes. The time of obtaining the results of the PHA and LA tests was 15-30 minutes with the use of centrifugation and 2-5 minutes in the electric field, which made it possible to regard these tests as rapid.

Early handling, but not maternal separation, decreases emotional responses in two paradigms of fear without changes in mesolimbic dopamine.

PubMed

Madruga, Clarice; Xavier, Léder L; Achaval, Matilde; Sanvitto, Gilberto L; Lucion, Aldo B

2006-01-30

This study aimed at identifying the effects of neonatal handling (H) and maternal separation (MS) on two paradigms of fear, learned and innate, and on the tyrosine hydroxylase (TH) immunoreactive cells in adult life. Wistar rats were daily handled with a brief maternal separation, maternal separated for 3 h or left undisturbed during the first 10 days of life. Behavioural responses in the open-field (innate fear) and conditioned fear (learned fear) were evaluated. Moreover, a semi-quantitative analysis of TH immunoreactivity in the ventral tegmental area (VTA) and substantia nigra pars compacta (SNpc) was performed using optical densitometry and confirmed by planar measurements of neuronal density. Early handling decreased behaviour responses of innate and learned fear in adult life, while maternal separation had no significant long-lasting effect on these responses compared to the non-handled group. The behavioural effects of early handling could not be explained by changes in the density of midbrain dopaminergic cells, which were not affected by handling or maternal separation.

Adipokines, cytokines and body fat stores in hepatitis C virus liver steatosis

PubMed Central

González-Reimers, Emilio; López-Prieto, Javier; Quintero-Platt, Geraldine; Pelazas-González, Ricardo; Alemán-Valls, M Remedios; Pérez-Hernández, Onán; de-la-Vega-Prieto, M José; Gómez-Rodríguez, M Angeles; Martín-González, Candelaria; Santolaria-Fernández, Francisco

2016-01-01

AIM: To identify patients with or without liver steatosis and its severity in treatment-naïve patients affected by hepatitis C virus (HCV) infection. METHODS: We included 56 HCV infected patients, and assessed the amount of liver fat by histomorphometry, and its relationships with fat and lean mass at different parts of the body (by densitometry), hormones [insulin, homeostatic model assessment (HOMA)], adipokines (resistin, adiponectin, leptin), and cytokines (tumor necrosis factor α, interleukin-6). RESULTS: Although the intensity of liver steatosis is related to trunk fat mass and HOMA, 33% of patients showed no liver steatosis, and this finding was not related to body mass index or genotype. Besides trunk fat mass, no other factor was related to the presence or not of liver steatosis, or to the intensity of it, by multivariate analysis. Lean mass was not related to liver steatosis. Adiponectin levels were lower among patients. No differences were observed in leptin and resistin. CONCLUSION: Steatosis in HCV infection is common (67.2%), and closely related to trunk fat, and insulin resistance, but not with leg fat mass or adipokines. PMID:26783423

Adipokines, cytokines and body fat stores in hepatitis C virus liver steatosis.

PubMed

González-Reimers, Emilio; López-Prieto, Javier; Quintero-Platt, Geraldine; Pelazas-González, Ricardo; Alemán-Valls, M Remedios; Pérez-Hernández, Onán; de-la-Vega-Prieto, M José; Gómez-Rodríguez, M Angeles; Martín-González, Candelaria; Santolaria-Fernández, Francisco

2016-01-08

To identify patients with or without liver steatosis and its severity in treatment-naïve patients affected by hepatitis C virus (HCV) infection. We included 56 HCV infected patients, and assessed the amount of liver fat by histomorphometry, and its relationships with fat and lean mass at different parts of the body (by densitometry), hormones [insulin, homeostatic model assessment (HOMA)], adipokines (resistin, adiponectin, leptin), and cytokines (tumor necrosis factor α, interleukin-6). Although the intensity of liver steatosis is related to trunk fat mass and HOMA, 33% of patients showed no liver steatosis, and this finding was not related to body mass index or genotype. Besides trunk fat mass, no other factor was related to the presence or not of liver steatosis, or to the intensity of it, by multivariate analysis. Lean mass was not related to liver steatosis. Adiponectin levels were lower among patients. No differences were observed in leptin and resistin. Steatosis in HCV infection is common (67.2%), and closely related to trunk fat, and insulin resistance, but not with leg fat mass or adipokines.

Automatic Estimation of Osteoporotic Fracture Cases by Using Ensemble Learning Approaches.

PubMed

Kilic, Niyazi; Hosgormez, Erkan

2016-03-01

Ensemble learning methods are one of the most powerful tools for the pattern classification problems. In this paper, the effects of ensemble learning methods and some physical bone densitometry parameters on osteoporotic fracture detection were investigated. Six feature set models were constructed including different physical parameters and they fed into the ensemble classifiers as input features. As ensemble learning techniques, bagging, gradient boosting and random subspace (RSM) were used. Instance based learning (IBk) and random forest (RF) classifiers applied to six feature set models. The patients were classified into three groups such as osteoporosis, osteopenia and control (healthy), using ensemble classifiers. Total classification accuracy and f-measure were also used to evaluate diagnostic performance of the proposed ensemble classification system. The classification accuracy has reached to 98.85 % by the combination of model 6 (five BMD + five T-score values) using RSM-RF classifier. The findings of this paper suggest that the patients will be able to be warned before a bone fracture occurred, by just examining some physical parameters that can easily be measured without invasive operations.

Dry immunochemical sensor for the detection of PETN vapor

NASA Astrophysics Data System (ADS)

Lukens, Herbert Richard

1992-05-01

Giaever (1973) showed that an indium semi-mirror coated with a monolayer of a substance would undergo reduced optical reflectance after incubation with a solution of the substance's antibody. He was able to see the effect with the naked eye. Lukens and Williams (1977) reversed the process by first attaching the target substance's antibody to the semi-mirror, after which the device would show a decline in optical density when exposed to a solution of the target substance. Lukens and Williams (1982) subsequently found that the device could also be used as an immunochemical film badge (IFB) to detect an airborne target substance. Early efforts to develop the IFB for the detection of airborne substances were plagued by such a high degree of performance variability that there were doubts in some quarters that an airborne target substance could bind to its antibody until Lukens (1990) demonstrated such binding in experiments with radiolabeled cocaine and morphine. Recently improved semi-mirrors and densitometry have been obtained and have led to improved performance of IFB's. As shown in this paper, IFB's can now be constructed that detect PETN vapor in a few seconds.

Evolutionary Origins of the Differences in Osteoporosis Risk in US Populations.

PubMed

Nelson, Dorothy A

2018-03-23

Over the past 50 years, it has been increasingly evident that there are population differences in bone mass and the risk of osteoporosis. In the United States, many studies have reported a lower prevalence of osteoporosis in African Americans compared with people of European descent. If we trace the trajectory of changes in lifeways from the earliest migrations of early Homo out of Africa over the past two million years or so, to include lower vitamin D levels in higher latitudes; more meat in the diet; increasing sedentism; and a longer lifespan/longer postmenopausal period, it is not surprising that osteoporosis occurs more frequently in populations of European descent. While many scholars have explored the apparent "paradox" of higher bone mass, lower vitamin D levels, and higher parathyroid hormone levels among African Americans, this brief review of evolutionary shifts that affected our species may change the approach to understanding the current population differences in the United States. Copyright © 2018 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The Design of a Quantitative Western Blot Experiment

PubMed Central

Taylor, Sean C.; Posch, Anton

2014-01-01

Western blotting is a technique that has been in practice for more than three decades that began as a means of detecting a protein target in a complex sample. Although there have been significant advances in both the imaging and reagent technologies to improve sensitivity, dynamic range of detection, and the applicability of multiplexed target detection, the basic technique has remained essentially unchanged. In the past, western blotting was used simply to detect a specific target protein in a complex mixture, but now journal editors and reviewers are requesting the quantitative interpretation of western blot data in terms of fold changes in protein expression between samples. The calculations are based on the differential densitometry of the associated chemiluminescent and/or fluorescent signals from the blots and this now requires a fundamental shift in the experimental methodology, acquisition, and interpretation of the data. We have recently published an updated approach to produce quantitative densitometric data from western blots (Taylor et al., 2013) and here we summarize the complete western blot workflow with a focus on sample preparation and data analysis for quantitative western blotting. PMID:24738055

Bone's mechanostat: a 2003 update.

PubMed

Frost, Harold M

2003-12-01

The still-evolving mechanostat hypothesis for bones inserts tissue-level realities into the former knowledge gap between bone's organ-level and cell-level realities. It concerns load-bearing bones in postnatal free-living bony vertebrates, physiologic bone loading, and how bones adapt their strength to the mechanical loads on them. Voluntary mechanical usage determines most of the postnatal strength of healthy bones in ways that minimize nontraumatic fractures and create a bone-strength safety factor. The mechanostat hypothesis predicts 32 things that occur, including the gross anatomical bone abnormalities in osteogenesis imperfecta; it distinguishes postnatal situations from baseline conditions at birth; it distinguishes bones that carry typical voluntary loads from bones that have other chief functions; and it distinguishes traumatic from nontraumatic fractures. It provides functional definitions of mechanical bone competence, bone quality, osteopenias, and osteoporoses. It includes permissive hormonal and other effects on bones, a marrow mediator mechanism, some limitations of clinical densitometry, a cause of bone "mass" plateaus during treatment, an "adaptational lag" in some children, and some vibration effects on bones. The mechanostat hypothesis may have analogs in nonosseous skeletal organs as well. Copyright 2003 Wiley-Liss, Inc.

Assessment of bone metabolism in premenopausal females with hyperthyroidism and hypothyroidism.

PubMed

Tuchendler, Dominika; Bolanowski, Marek

2013-01-01

Osteoporosis is one of the commonest metabolic diseases of bone. Its possible causes may include thyroid hormonal dysfunction. The objective of this study was to evaluate the effects of hyperthyroidism and hypothyroidism on osseous tissue metabolism in premenopausal women. 38 women with hyperthyroidism, 40 with hypothyroidism and 41 healthy women participated in this study. Initially after 6 and 12 months, each patient underwent selected hormonal, immunological and biochemical tests, measurement of concentrations of bone turnover markers and densitometry were also performed. On initial evaluation, lower cortical bone density was found in patients with hyperthyroidism (femoral neck). After 12 months, an increase in BMD was seen, but it was still lower than in the control group. Statistically significantly higher concentrations of bone turnover markers, decreasing from the sixth month of treatment, were noted only in the group with hyperthyroidism. Statistically significant differences were not noted in the femoral neck nor in the lumbar spine BMD in patients with hypothyroidism. Hyperthyroidism poses a negative effect on bone metabolism. Hypothyroidism in premenopausal females does not have any influence on bone density.

A qualitative and quantitative HPTLC densitometry method for the analysis of cannabinoids in Cannabis sativa L.

PubMed

Fischedick, Justin T; Glas, Ronald; Hazekamp, Arno; Verpoorte, Rob

2009-01-01

Cannabis and cannabinoid based medicines are currently under serious investigation for legitimate development as medicinal agents, necessitating new low-cost, high-throughput analytical methods for quality control. The goal of this study was to develop and validate, according to ICH guidelines, a simple rapid HPTLC method for the quantification of Delta(9)-tetrahydrocannabinol (Delta(9)-THC) and qualitative analysis of other main neutral cannabinoids found in cannabis. The method was developed and validated with the use of pure cannabinoid reference standards and two medicinal cannabis cultivars. Accuracy was determined by comparing results obtained from the HTPLC method with those obtained from a validated HPLC method. Delta(9)-THC gives linear calibration curves in the range of 50-500 ng at 206 nm with a linear regression of y = 11.858x + 125.99 and r(2) = 0.9968. Results have shown that the HPTLC method is reproducible and accurate for the quantification of Delta(9)-THC in cannabis. The method is also useful for the qualitative screening of the main neutral cannabinoids found in cannabis cultivars.

[Analysis of microdeletions in 22q11 in Colombian patients with congenital heart disease].

PubMed

Salazar, Marleny; Villalba, Guiovanny; Mateus, Heidi; Villegas, Victoria; Fonseca, Dora; Núñez, Federico; Caicedo, Víctor; Pachón, Sonia; Bernal, Jaime E

2011-12-01

Cardiac defects are the most frequent congenital malformations, with an incidence estimated between 4 and 12 per 1000 newborns. Their etiology is multifactorial and might be attributed to genetic predispositions and environmental factors. Since 1990 these types of pathologies have been associated with 22q11 microdeletion. In this study, the frequency of microdeletion 22q11 was determined in 61 patients with non-syndromic congenital heart disease. DNA was extracted from peripheral blood and TUPLE1 and STR D10S2198 genes were amplified by multiplex PCR and visualized in agarose gels. Gene content was quantified by densitometry. Three patients were found with microdeletion 22q11, representing a 4.9% frequency. This microdeletion was associated with two cases of Tetralogy of Fallot and a third case with atrial septal defect (ASD). In conclusion, the frequency for microdeletion 22q11 in the population analyzed was 4.9%. The cases that presented Teratology of Fallot had a frequency for this microdeletion of 7.4% and for ASD of 11.1%.

Surface Behavior of BSA/Water/Carbohydrate Systems from Molecular Polarizability Measurements.

PubMed

Alvarado, Ysaías J; Ferrebuz, Atilio; Paz, Jose Luis; Rodríguez-Lugo, Patricia; Restrepo, Jelem; Romero, Freddy; Fernández-Acuña, Jaqueline; Williams, Yhan O'Neil; Toro-Mendoza, Jhoan

2018-04-19

The effect of the presence of glucose and sucrose on the nonintrinsic contribution to partial molar volume ⟨Θ⟩ ni of bovine serum albumin (BSA) is determined by means of static and dynamic electronic polarizability measurements. For that aim, a combined strategy based on high-resolution refractometry, high exactitude densitometry, and synchronous fluorescence spectroscopy is applied. Both static and dynamic mean electronic molecular polarizability values are found to be sensitive to the presence of glucose. In the case of sucrose, the polarizability of BSA is not appreciably affected. In fact, our results revealed that the electronic changes observed occurred without a modification of the native conformation of BSA. On the contrary, a nonmonotonous behavior with the concentration is observed in presence of glucose. These results advocate the influence of the electronic polarization on the repulsive and attractive protein-carbohydrate interactions. An analysis using the scaled particle theory indicates that the accumulation of glucose on the protein surface promotes dehydration. Inversely, hydration and preferential exclusion occur in the vicinity of the protein surface for sucrose-enriched systems.

Enhanced biofilm formation and melanin synthesis by the oyster settlement-promoting Shewanella colwelliana is related to hydrophobic surface and simulated intertidal environment.

PubMed

Mitra, Sayani; Gachhui, Ratan; Mukherjee, Joydeep

2015-01-01

A direct relationship between biofilm formation and melanogenesis in Shewanella colwelliana with increased oyster recruitment is already established. Previously, S. colwelliana was grown in a newly patented biofilm-cultivation device, the conico-cylindrical flask (CCF), offering interchangeable hydrophobic/hydrophilic surfaces. Melanization was enhanced when S. colwelliana was cultivated in a hydrophobic vessel compared with a hydrophilic vessel. In the present study, melanogenesis in the CCF was positively correlated with increased architectural parameters of the biofilm (mean thickness and biovolume obtained by confocal laser scanning microscopy) and melanin gene (melA) expression observed by densitometry. Niche intertidal conditions were mimicked in a process operated in an ultra-low-speed rotating disk bioreactor, which demonstrated enhanced biofilm formation, melanogenesis, exopolysaccharide synthesis and melA gene expression compared with a process where 12-h periodic immersion and emersion was prevented. The wettability properties of the settling plane as well as intermittent wetting and drying, which influenced biofilm formation and melA expression, may affect oyster settlement in nature.

Expression and mutational analysis of Cip/Kip family in early glottic cancer.

PubMed

Kim, D-K; Lee, J H; Lee, O J; Park, C H

2015-02-01

Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

Evaluation of capillary zone electrophoresis for the determination of protein composition in therapeutic immunoglobulins and human albumins.

PubMed

Christians, Stefan; van Treel, Nadine Denise; Bieniara, Gabriele; Eulig-Wien, Annika; Hanschmann, Kay-Martin; Giess, Siegfried

2016-07-01

Capillary zone electrophoresis (CZE) provides an alternative means of separating native proteins on the basis of their inherent electrophoretic mobilities. The major advantage of CZE is the quantification by UV detection, circumventing the drawbacks of staining and densitometry in the case of gel electrophoresis methods. The data of this validation study showed that CZE is a reliable assay for the determination of protein composition in therapeutic preparations of human albumin and human polyclonal immunoglobulins. Data obtained by CZE are in line with "historical" data obtained by the compendial method, provided that peak integration is performed without time correction. The focus here was to establish a rapid and reliable test to substitute the current gel based zone electrophoresis techniques for the control of protein composition of human immunoglobulins or albumins in the European Pharmacopoeia. We believe that the more advanced and modern CZE method described here is a very good alternative to the procedures currently described in the relevant monographs. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Normocalcemic primary hyperparathyroidism in clinical practice: an indolent condition or a silent threat?

PubMed Central

Marques, Thyciara Fontenele; Vasconcelos, Renata; Diniz, Erik; Rêgo, Daniela; Griz, Luiz; Bandeira, Francisco

2015-01-01

Objective To describe the characteristics of normocalcemic primary hyperparathyroidism (NPHPT) in patients seen for osteoporosis evaluation. Patients and methods We examined the records of 156 women who came to the hospital to be screened for osteoporosis. Measurements of total calcium, PTH, 25-hydroxy vitamin D, and β-C-telopeptide were recorded. Bone mineral density and T-scores were evaluated by densitometry of the lumbar spine, femoral neck and distal one-third of the radius. The latter was only measured in patients with primary hyperparathyroidism. Nephrolithiasis and bone fractures were documented by a review of the medical records. Results We identified 14 patients with NPHPT, accounting for 8.9% of the population studied. In the medical records, the occurrence of kidney stones was reported in 28.6% of the patients with NPHPT, in contrast with only 0.7% of the noncarriers. Regarding the presence of general fractures, 21.4% of the patients with NPHPT were affected versus 16.2% of noncarriers. Conclusion Data from our study suggest that NPHPT has a diverse phenotypic presentation, implying that this may not be an “indolent” disease. PMID:21881813

A case of pathological rib fractures: focal osteolysis or osteoporosis?

PubMed

Vrbanić, T S L; Novak, S; Sestan, B; Tudor, A; Gulan, G

2008-03-01

This paper reports on a unique, previously unreported, successful outcome in the case of a patient with focal osteolytic lesions of the ribs as a first sign of osteoporosis. The lesions were detected by chance after acute cough-induced rib fractures were seen on plain chest radiographs. The diagnosis had to be approached as a diagnosis of exclusion since known causes of the osteolytic process had to be eliminated. The authors describe multiple focal osteolytic lesions with rib fractures appearing in a pattern that could be confused with metastases. Laboratory results were normal. Final diagnosis was based on plain radiography, bone scan and bone densitometry. Pharmacomedical treatments for osteoporosis were applied. The patient was observed between the year 2000 and 2005. Five years later radiological and bone scintigraphy revealed resolution of the lesion. We conclude that osteoporosis should be included in the differential diagnosis of asymptomatic focal osteolysis of the ribs with rib fractures as a complication of acute cough. The case suggests that focal osteolytic lesions of the ribs may regress over time and become scintigraphically inactive.

Vitamin K and bone health.

PubMed

Hamidi, Maryam S; Gajic-Veljanoski, Olga; Cheung, Angela M

2013-01-01

Vitamin K has been purported to play an important role in bone health. It is required for the gamma-carboxylation of osteocalcin (the most abundant noncollagenous protein in bone), making osteocalcin functional. There are 2 main forms (vitamin K1 and vitamin K2), and they come from different sources and have different biological activities. Epidemiologic studies suggest a diet high in vitamin K is associated with a lower risk of hip fractures in aging men and women. However, randomized controlled trials of vitamin K1 or K2 supplementation in white populations did not increase bone mineral density at major skeletal sites. Supplementation with vitamin K1 and K2 may reduce the risk of fractures, but the trials that examined fractures as an outcome have methodological limitations. Large well-designed trials are needed to compare the efficacies of vitamin K1 and K2 on fractures. We conclude that currently there is not enough evidence to recommend the routine use of vitamin K supplements for the prevention of osteoporosis and fractures in postmenopausal women. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Body composition changes in pregnancy: measurement, predictors and outcomes

PubMed Central

Widen, EM; Gallagher, D

2014-01-01

Prevalence of overweight and obesity has risen in the United States over the past few decades. Concurrent with this rise in obesity has been an increase in pregravid body mass index and gestational weight gain affecting maternal body composition changes in pregnancy. During pregnancy, many of the assumptions inherent in body composition estimation are violated, particularly the hydration of fat-free mass, and available methods are unable to disentangle maternal composition from fetus and supporting tissues; therefore, estimates of maternal body composition during pregnancy are prone to error. Here we review commonly used and available methods for assessing body composition changes in pregnancy, including: (1) anthropometry, (2) total body water, (3) densitometry, (4) imaging, (5) dual-energy X-ray absorptiometry, (6) bioelectrical impedance and (7) ultrasound. Several of these methods can measure regional changes in adipose tissue; however, most of these methods provide only whole-body estimates of fat and fat-free mass. Consideration is given to factors that may influence changes in maternal body composition, as well as long-term maternal and offspring outcomes. Finally, we provide recommendations for future research in this area. PMID:24667754

Serum protein fractionation using supported molecular matrix electrophoresis.

PubMed

Dong, Weijie; Matsuno, Yu-ki; Kameyama, Akihiko

2013-08-01

Supported molecular matrix electrophoresis (SMME), in which a hydrophilic polymer such as PVA serves as a support within a porous PVDF membrane, was recently developed. This method is similar to cellulose acetate membrane electrophoresis but differs in the compatibility to glycan analysis of the separated bands. In this report, we describe the first instance of the application of SMME to human serum fractionation, and demonstrate the differences with serum fractionation by cellulose acetate membrane electrophoresis. The SMME membrane exhibited almost no EOF during electrophoresis, unlike the cellulose acetate membrane, but afforded comparative results for serum fractionation. The visualization of each fraction was achieved by conventional staining with dye such as Direct Blue-71, and objective quantification was obtained by densitometry after inducing membrane transparency with 1-nonene. Immunostaining was also achieved. Moreover, mass spectrometric analysis of both N-linked and O-linked glycans from the separated bands was demonstrated. Serum fractionation and glycan profiling of each fraction using SMME will enable novel insights into the relationships between various glycosylation profiles and disease states. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Stability of catechins in green tea nutraceutical products: application of solid phase extraction-thin layer chromatography densitometry.

PubMed

Abd-Elsalam, Heba-Alla H; Al-Ghobashy, Medhat A; Zaazaa, Hala E; Ibrahim, Mohamed A

2014-08-01

Epigallocatechin gallate (EGCG) is a powerful antioxidant and commonly used nutraceutical. Accelerated stability of EGCG in tablet formulations was investigated. LLE and SPE were employed for sample clean-up and enrichment of EGCG over caffeine. Samples were analysed after spiking with fixed concentration of gallic acid (GA), in order to verify reproducibility of analysis. A TLC-densitometric assay was developed and validated for determination of % loss EGCG. EGCG, GA and caffeine were resolved with Rf values 0.54, 0.69 and 0.80, respectively. LC-MS/MS was used to verify identity and purity of the EGCG band. Determination was carried out over a concentration range of 0.50-5.00μg/band and 0.20-2.40μg/band for GA and caffeine, respectively. Results showed significant reduction in EGCG content after one, three and six months: 24.00%, 28.00% and 52.00% respectively. Results continue to demonstrate that stability of nutraceutical products should be investigated in-depth using industry-oriented protocols before granting marketing authorisation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Identification of structural and morphogenesis genes of Pseudoalteromonas phage φRIO-1 and placement within the evolutionary history of Podoviridae.

PubMed

Hardies, Stephen C; Thomas, Julie A; Black, Lindsay; Weintraub, Susan T; Hwang, Chung Y; Cho, Byung C

2016-02-01

The virion proteins of Pseudoalteromonas phage φRIO-1 were identified and quantitated by mass spectrometry and gel densitometry. Bioinformatic methods customized to deal with extreme divergence defined a φRIO-1 tail structure homology group of phages, which was further related to T7 tail and internal virion proteins (IVPs). Similarly, homologs of tubular tail components and internal virion proteins were identified in essentially all completely sequenced podoviruses other than those in the subfamily Picovirinae. The podoviruses were subdivided into several tail structure homology groups, in addition to the RIO-1 and T7 groups. Molecular phylogeny indicated that these groups all arose about the same ancient time as the φRIO-1/T7 split. Hence, the T7-like infection mechanism involving the IVPs was an ancestral property of most podoviruses. The IVPs were found to variably host both tail lysozyme domains and domains destined for the cytoplasm, including the N4 virion RNA polymerase embedded within an IVP-D homolog. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Early Fluid and Protein Shifts in Men During Water Immersion

NASA Technical Reports Server (NTRS)

Hinghofer-Szalkay, H.; Harrison, M. H.; Greenleaf, J. E.

1987-01-01

High precision blood and plasma densitometry was used to measure transvascular fluid shifts during water immersion to the neck. Six men (28-49 years) undertook 30 min of standing immersion in water at 35.0 +/- 0.2 C; immersion was preceded by 30 min control standing in air at 28 +/- 1 C. Blood was sampled from an antecubital catheter for determination of Blood Density (BD), Plasma Density (PD), Haematocrit (Ht), total Plasma Protein Concentration (PPC), and Plasma Albumin Concentration (PAC). Compared to control, significant decreases (p less than 0.01) in all these measures were observed after 20 min immersion. At 30 min, plasma volume had increased by 11.0 +/- 2.8%; the average density of the fluid shifted from extravascular fluid into the vascular compartment was 1006.3 g/l; albumin moved with the fluid and its albumin concentration was about one-third of the plasma protein concentration during early immersion. These calculations are based on the assumption that the F-cell ratio remained unchanged. No changes in erythrocyte water content during immersion were found. Thus, immersion-induced haemodilution is probably accompanied by protein (mainly albumin) augmentation which accompanies the intra-vascular fluid shift.

Assessment of vitamin K2 levels in osteoporotic patients: a case control study.

PubMed

Noori, Akram; Lashkari, Mahin; Oveisi, Sonia; Khair Khah, Mohamad Reza; Zargar, Ali

2014-07-14

The aim of this study was to measure the level of Vitamin K2 (Vit K2) in osteoporotic patients and individuals with normal bone density as controls. This case-control study was done in Outpatient Department of Rheumatology at Qazvin Boo-ali Sina Hospital in 2013. Participants were 50 patients with osteoporotic densitometry measured by DEXA (T score? -2.5) who were matched with 48 persons in control group with normal bone density (T score> -1). The level of Vit K2 in samples was measured using enzyme linked immunosorbent assay (ELISA). Data were analyzed by Mann-Whitney U test and Chi-square test. The level of Vit K2 in patients with osteoporosis was not significantly different from the control group (Median: 75.95 vs. 71.35 nmol/L, respectively; P-value: 0.709). The authors determined cut-offs 75 percentile of vitamin K2 in all participants that was 85 nmol/L and percentages of persons in two groups were similar. Although Vit K2 level in patients with osteoporosis was not significantly different from the control group, further studies are necessary to confirm the association of osteoporosis and Vit K2.

The effect of a histone deacetylase inhibitor - valproic acid - on nucleoli in human leukaemic myeloblasts.

PubMed

Smetana, K; Zápotocký, M

2010-01-01

The present study was undertaken to provide more information on nucleolar changes induced by a histone deacetylase inhibitor such as valproic acid in leukaemic myeloblasts at the single-cell level. For this study, RNA in nucleoli was visualized by a simple but sensitive cytochemical procedure in unfixed cytospins of short-term bone marrow cultures from patients suffering from acute myeloid leukaemia. Valproic acid in leukaemic myeloblasts markedly reduced the nucleolar size and also produced significant transformation of "active" to "resting" and "inactive" nucleoli that reflected the alteration of the nucleolar transcription in sensitive myeloblasts. On this occasion it should be added that valproic acid significantly increased the incidence of altered myeloblasts that changed to apoptotic cells or apoptotic bodies and cell ghosts. In contrast to the above-mentioned decreased nucleolar size, the nucleolar RNA concentration, expressed by computerassisted RNA image densitometry in valproic acidtreated myeloblasts, was not significantly changed. The results of the present study clearly indicated that the nucleolar size and transformation of "active" to "sleeping" or "inactive" nucleoli are convenient markers of the sensitivity and alteration of leukaemic myeloblasts produced by a histone deacetylase inhibitor, valproic acid, at the single-cell level.

Lifetime fluorescence spectroscopy for in situ investigation of osteogenic differentiation

NASA Astrophysics Data System (ADS)

Marcu, Laura; Elbarbary, Amir; Zuk, Patricia; De Ugarte, Daniel A.; Benhaim, Prosper; Kurt, Hamza; Hedrick, Marc H.; Ashjian, Peter

2003-07-01

Time-Resolved Laser-Induced Fluorescence Spectroscopy (TR-LIFS) represents a potential tool for the in-situ characterization of bioengineered tissues. In this study, we evaluate the application of TR-LIFS to non-intrusive monitoring of matrix composition during osteogenetic differentiation. Human adipose-derived stem cells, harvested from 3 patients, were induced in osteogenic media for 3, 5, and 7 weeks. Samples were subsequently collected and probed for time-resolved fluorescence emission with a pulsed nitrogen laser. Fluorescence parameters, derived from both spectral- and time-domain, were used for sample characterization. The samples were further analyzed using Western blot analysis and computer-based densitometry. A significant change in the fluorescence parameters was detected for samples beyond 3 weeks of osteogenic differentiation. The spectroscopic observations: 1) show increase of collagen I when contrasted against the time-resolved fluorescence spectra of commercially available collagens; and 2) are in agreement with Western blot analysis that demonstrated significant increase in collagen I content between 3- vs. 5-weeks and 3- vs. 7-weeks and no changes for collagens III, IV, and V. Our results suggest that TR-LIFS can be used as a non-invasive means for the detection of specific collagens in maturing connective tissues.

Simultaneous Analysis of Losartan Potassium, Amlodipine Besylate, and Hydrochlorothiazide in Bulk and in Tablets by High-Performance Thin Layer Chromatography with UV-Absorption Densitometry

PubMed Central

Santhana Lakshmi, Karunanidhi; Lakshmi, Sivasubramanian

2012-01-01

A Simple high-performance thin layer chromatography (HPTLC) method for separation and quantitative analysis of losartan potassium, amlodipine, and hydrochlorothiazide in bulk and in pharmaceutical formulations has been established and validated. After extraction with methanol, sample and standard solutions were applied to silica gel plates and developed with chloroform : methanol : acetone : formic acid 7.5 : 1.3 : 0.5 : 0.03 (v/v/v/v) as mobile phase. Zones were scanned densitometrically at 254 nm. The R f values of amlodipine besylate, hydrochlorothiazide, and losartan potassium were 0.35, 0.57, and 0.74, respectively. Calibration plots were linear in the ranges 500–3000 ng per spot for losartan potassium, amlodipine and hydrochlorothiazide, the correlation coefficients, r, were 0.998, 0.998, and 0.999, respectively. The suitability of this method for quantitative determination of these compounds was by validation in accordance with the requirements of pharmaceutical regulatory standards. The method can be used for routine analysis of these drugs in bulk and in formulation. PMID:22567550

Association between duration of playing video games and bone mineral density in Chinese adolescents.

PubMed

Shao, Haiyu; Xu, Shaonan; Zhang, Jun; Zheng, Jiayin; Chen, Jinping; Huang, Yazeng; Ru, Bin; Jin, Yongming; Zhang, Qi; Ying, Qifeng

2015-01-01

The aim of the study was to investigate the association between duration of playing video games and bone mineral density (BMD) in Chinese adolescents. Three hundred eighty-four Chinese adolescents aged 14-18 yr (148 males and 236 females) were analyzed. Anthropometric measurements were obtained using standard procedures. Total body and regional BMD were measured using dual-energy X-ray absorptiometry. Duration of playing video games, defined as hours per day, was measured by a self-report questionnaire. We examined the association between duration of playing video games and BMD using multiple linear regression analysis. After adjustment for age, sex, pubertal stage, parental education, body mass index, adolescents with longer video game duration were more likely to have lower legs, trunk, pelvic, spine, and total BMD (p < 0.05). We concluded that duration of video game was negatively associated with BMD in Chinese adolescents. These findings provide support for reducing duration of playing video games as a possible means to increase BMD in adolescents. Future research is needed to elucidate the underlined mechanisms linking playing video games and osteoporosis. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Primary hyperparathyroidism: recent advances.

PubMed

Walker, Marcella D; Bilezikian, John P

2018-07-01

The purpose of this review is to describe recent advances and changes in the evaluation and management of primary hyperparathyroidism (PHPT). Although it has long been recognized that asymptomatic PHPT is associated with bone loss, particularly at cortical skeletal sites when evaluated with dual-energy X-ray absorptiometry, new imaging techniques suggest that trabecular skeletal deterioration as well as clinically silent vertebral fractures and nephrolithiasis are common. Nonclassical targets of asymptomatic PHPT as well as the effect of vitamin D deficiency and treatment upon PHPT presentation have been the subject of recent intense investigation. Randomized clinical trials are now available regarding the effect of parathyroidectomy (PTX) upon both classical and nonclassical target organs. They have confirmed results from observational studies with regard to the skeletal benefits of PTX but have not consistently shown improvements in nonclassical symptoms. These findings have led to recommendations for more extensive renal and skeletal evaluation and broader criteria for PTX in PHPT. In addition to dual-energy X-ray absorptiometry, vertebral and renal imaging is recommended. When available, trabecular imaging techniques may be helpful. PTX criteria now include subclinical kidney stones, vertebral fractures and hypercalciuria, in addition to those based on age, serum calcium, bone densitometry and renal function.

Body composition and Vo2max of exceptional weight-trained athletes.

PubMed

Fahey, T D; Akka, L; Rolph, R

1975-10-01

The maximal oxygen uptake and body composition of 30 exceptional athletes who have trained extensively with weights was measured. The sample included 3 world record holders, 8 other world class athletes, and 19 national class competitors. The sports represented were shot-putting, discus throwing, body building, power lifting, wrestling, and olympic lifting. Vo2max as determined on a bicycle ergometer by the open-circuit method was 4.6 +/- 0.7 1-min-1 (mean +/- SD) (48.8 +/- 7 ml-kg-1., 56.4 +/- 8.6 ml-(kg LBW)-1). The mean maximal heart rate was 185.3 +/- 11.6 beats-min-1. The subjects attained a work rate of 1,728.2 +/- 223 kpm-min-1 on a continuous progressive bicycle ergometer test and had mean maximal ventilations of 152.5 +/- 27.7 1-min-1 BTPS. Body composition was determined by densitometry. Body weight averaged 96.0 +/- 14.9 kg, with mean percent fat of 13.8 +/- 4.5. The results of this study indicate that exceptional weight-trained athletes are within the normal college-age population range in body fat and of somewhat higher physical working capacity.

Hypervitaminosis D: case report of pediatric osteoporosis secondary to cystic fibrosis.

PubMed

Cialdella, Pietro; Carella, Francesco

2011-09-01

The objective of the study is to evaluate alterations of bone metabolism in adolescence and adult CF, determining the rate of osteoporosis, osteopenia and vertebral and non-vertebral fractures. We took into account the clinical case of a child who right from the age of seven years has presented joint pain.The little girl was diagnosed with osteopenia taken with therapy of calcium and vitamin D; after few years despite treatment nephrocalcinosis and osteoporosis take over.It was examined a cohort of patients with cystic fibrosis of the southern Italy, 24 patients aged between 12 and 44 years, 12 females and 12 males with BMD assessment methods like dual energy X-rays (DXA) and calcaneal ultrasound densitometry in a few cases, ultrasonography was used jointly.From this case study we tried to establish the relationship between cystic fibrosis and osteoporosis etiopathogenetic, the adoptive therapy and the impact of therapies on patients.It was concluded that, given the high number of unrecognized patients with impaired bone mineralization, we must implement and integrate a more aggressive treatment with bisphosphonates and prevention programs that can combat the lifestyle and new eating habits of our young people that facilitate the loss of bone mass.

An update on childhood bone health: mineral accrual, assessment and treatment.

PubMed

Sopher, Aviva B; Fennoy, Ilene; Oberfield, Sharon E

2015-02-01

To update the reader's knowledge about the factors that influence bone mineral accrual and to review the advances in the assessment of bone health and treatment of bone disorders. Maternal vitamin D status influences neonatal calcium levels, bone mineral density (BMD) and bone size. In turn, BMD z-score tends to track in childhood. These factors highlight the importance of bone health as early as fetal life. Dual-energy x-ray absorptiometry is the mainstay of clinical bone health assessment in this population because of the availability of appropriate reference data. Recently, more information has become available about the assessment and treatment of bone disease in chronically ill pediatric patients. Bone health must become a health focus starting prenatally in order to maximize peak bone mass and to prevent osteoporosis-related bone disease in adulthood. Vitamin D, calcium and weight-bearing activity are the factors of key importance throughout childhood in achieving optimal bone health as BMD z-score tracks through childhood and into adulthood. Recent updates of the International Society for Clinical Densitometry focus on the appropriate use of dual-energy x-ray absorptiometry in children of all ages, including children with chronic disease, and on the treatment of pediatric bone disease.

Does a high dietary acid content cause bone loss, and can bone loss be prevented with an alkaline diet?

PubMed

Hanley, David A; Whiting, Susan J

2013-01-01

A popular concept in nutrition and lay literature is that of the role of a diet high in acid or protein in the pathogenesis of osteoporosis. A diet rich in fruit and vegetable intake is thought to enhance bone health as the result of its greater potassium and lower "acidic" content than a diet rich in animal protein and sodium. Consequently, there have been a number of studies of diet manipulation to enhance potassium and "alkaline" content of the diet to improve bone density or other parameters of bone health. Although acid loading or an acidic diet featuring a high protein intake may be associated with an increase in calciuria, the evidence supporting a role of these variables in the development of osteoporosis is not consistent. Similarly, intervention studies with a more alkaline diet or use of supplements of potassium citrate or bicarbonate have not consistently shown a bone health benefit. In the elderly, inadequate protein intake is a greater problem for bone health than protein excess. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Continuous blood densitometry - Fluid shifts after graded hemorrhage in animals

NASA Technical Reports Server (NTRS)

Hinghofer-Szalkay, H.

1986-01-01

Rapid fluid shifts in four pigs and two dogs subjected to graded hemorrhage are investigated. Arterial blood density (BD), mean arterial pressure (MAP), central venous pressure (CVP), arterial plasma density (PD), hematocrit (Hct) and erythrocyte density were measured. The apparatus and mechancial oscillator technique for measuring density are described. Fluid shifts between red blood cells and blood plasma and alterations in the whole-body-to-large vessel Hct, F(cell) are studied using two models. The bases of the model calculations are discussed. A decrease in MAP, CVP, and BP is detected at the beginning of hemorrhaging; continued bleeding results in further BD decrease correlating with volume displacement. The data reveal that at 15 ml/kg blood loss the mean PD and BD dropped by 0.99 + or - 0.15 and 2.42 + or 0.26 g/liter, respectively, and the Hct dropped by 2.40 + or 0.47 units. The data reveal that inward-shifted fluid has a higher density than normal ultrafiltrate and/or there is a rise in the F(cell) ratio. It is noted that rapid fluid replacement ranged from 5.8 + or - 0.8 to 10.6 + or - 2.0 percent of the initial plasma volume.

Mutiple Spontaneous Rib Fractures in Patient with Cushing's Syndrome.

PubMed

Lee, Hyun Jung; Je, Ji Hye; Seo, Ji Hye; Na, Young Ju; Yoo, Hye Jin

2014-11-01

Glucocorticoid (GC) excess, including Cushing's syndrome, is a common cause of secondary osteoporosis. Thirty to fifty percent of Cushing's syndrome patients experience non-traumatic fractures, which is often the presenting manifestation of Cushing's syndrome. However, there have been rare cases of Cushing's syndrome diagnosed only based upon bone manifestations. We describe a case of Cushing's syndrome that was diagnosed in a 44-year-old woman who initially visited our hospital due to multiple non-traumatic rib fractures. She did not exhibit any other manifestations of Cushing's syndrome such as moon face, buffalo hump or abdominal striae. Initially, we evaluated her for bone metastases from a cancer of unknown origin, but there was no evidence of metastatic cancer. Instead, we found a left adrenal incidentaloma. As a result of the hormone study, she was diagnosed as having Cushing's syndrome. Interestingly, her bony manifestation of Cushing's syndrome, which was evident in the bone scan and bone mineral densitometry, completely recovered after a left adrenalectomy. Therefore, the possibility of Cushing's syndrome as a cause of secondary osteoporosis should be considered in young patients with non-traumatic multiple fractures, with or without any other typical features of Cushing's syndrome.

Comparison of gravimetric and spectroscopic approaches to quantify stratum corneum removed by tape-stripping.

PubMed

Mohammed, D; Yang, Q; Guy, R H; Matts, P J; Hadgraft, J; Lane, M E

2012-09-01

Skin surface tape-stripping is an extensively used technique to examine the distribution profile, penetration and safety of various active compounds. It is also a widely accepted method to probe skin barrier properties and more specifically, those of the stratum corneum (SC). The amount of SC removed by tape-stripping is generally determined either gravimetrically or by extraction and measurement of SC proteins. A novel infra-red densitometry (IRD) technique has recently been introduced to measure SC protein content. In the present study, IRD was investigated as an alternative method to measure the mass of SC removed by tape-stripping. Tape-stripping experiments were conducted on human volunteers. The weight of the stratum corneum removed was assessed by the gravimetric approach and by IRD. Transepidermal water loss (TEWL) was also measured before and after each tape-strip. A linear correlation coefficient was obtained for the data from the gravimetric and IRD measurements (r(2)=0.65; n=240). IRD is therefore proposed as a rapid, non-destructive alternative to the gravimetric approach to estimate the amount of SC removed by tape-stripping in vivo. Copyright © 2012 Elsevier B.V. All rights reserved.

HPTLC-FLD-SERS as a facile and reliable screening tool: Exemplarily shown with tyramine in cheese.

PubMed

Wang, Liao; Xu, Xue-Ming; Chen, Yi-Sheng; Ren, Jie; Liu, Yun-Tao

2018-04-01

The serious cytotoxicity of tyramine attracted marked attention as it induced necrosis of human intestinal cells. This paper presented a novel and facile high performance thin-layer chromatography (HPTLC) method tailored for screening tyramine in cheese. Separation was performed on glass backed silica gel plates, using methanol/ethyl acetate/ammonia (6/4/1 v/v/v) as the mobile phase. Special efforts were focused on optimizing conditions (substrate preparation, laser wavelength, salt types and concentrations) of surface enhanced Raman spectroscopy (SERS) measurements directly on plates after derivatization, which enabled molecule-specific identification of targeted bands. In parallel, fluorescent densitometry (FLD) scanning at 380

Exercise and Sarcopenia.

PubMed

Phu, Steven; Boersma, Derek; Duque, Gustavo

2015-01-01

Sarcopenia is a major component of the frailty syndrome and is also a strong predictor of disability, morbidity, and mortality in older persons. Without any available pharmacological intervention to sarcopenia, non-pharmacological interventions are the only option to prevent these poor outcomes in sarcopenic patients. Among those interventions, physical activity with or without protein supplementation has demonstrated to be effective in improving muscle mass and function and in preventing disability and frailty in older persons. Additionally, to the beneficial effect of physical activity on metabolic and cardiovascular diseases, a regular exercise program (3 times/wk) that includes resistance and endurance exercise training would have a major positive effect on sarcopenic muscle through improving muscle mass, strength, and function. In this review, we looked at the effect of exercise on sarcopenic frail older persons from the biological aspects of the response of the muscle to exercise to some practical aspects of exercise prescription in this high-risk population. We conclude that, although challenging, older persons should be encouraged to participate in this type of programs, which would improve not only their function and independence but also their quality of life. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

[Relationship among anthropometric and gluco-metabolic parameters, bone mineral density and endometriosis].

PubMed

Nava-González, Edna J; de la Garza-Casas, Yolanda E; Salazar-Montalvo, Raúl G; Gallegos-Cabriales, Esther C

2013-01-01

women with endometriosis may have a decreased bone mineral density (BMD). Several studies have shown that accumulation of adipose tissue profoundly affects BMD. It has also been documented that excess body fat is associated with risk of developing endometriosis. The aim was to analyze the relationship between BMD, fat mass, and the insulin-glucose axis in women with endometriosis. thirty women with a diagnosis of endometriosis established by surgery were enrolled to participate in an observational prospective study. Anthropometry was performed to determine body mass index, and a dual X-ray densitometry to collect data on body composition and BMD. Glucose and insulin determinations were performed. Women were divided in two groups: with normal weight (n = 18) or overweight (n = 12). For the analysis of the results, we used descriptive statistics and Pearson's test. normal weight/overweight: mean age 32.5/35.2 years; body mass index 21.5/30.2; adiposity index: 27.7 %/36.1 %; fat mass index: 35.4/45.8 %; overweight women showed a significant value with p < 0.05. overweight, high values of adiposity index and fat mass index were related to endometriosis. This could support the hypothesis about a common pathogenesis among endometriosis, osteoporosis, diabetes and obesity.

A MODIFIED PROTEIN ASSAY FROM MICROGRAM TO LOW NANOGRAM LEVELS IN DILUTE SAMPLES

PubMed Central

Heda, Ghanshyam D.; Kunwar, Upasana; Heda, Rajiv P.

2013-01-01

In this paper we present a modified and improved protein assay that was previously described as ‘amidoschwarz assay’ by Schaffner and Weissmann (Anal. Biochem. 56, 1973, 502–514). Our improved protein assay is user-friendly and 30 to 40 times more sensitive than the earlier method. The assay was developed into 3 formats (maco, micro, and nanoassay) with TCA as protein precipitating agent; measuring up to 96 samples. The macro and micro formats of this assay require a single reagent staining with amido black of protein dots, bound to nitrocellulose membrane with lowest protein measurements to 1 μg and 0.1 μg respectively. The nanoassay on the other hand with combination staining of amido black followed by colloidal gold can extend the detection limit to 2.5 ng of protein. Protein concentrations were determined by densitometry and/or spectrophotometry. This assay is compatible with many ionic and non-ionic detergents. This improved protein assay provides an additional choice to researchers in measuring total protein concentration accurately in dilute biological samples as low as 0.125 μg/ml, prior to their biochemical analysis such as in comparative proteomics. PMID:24135655

Provider Distribution Changes in Dual-Energy X-Ray Absorptiometry in the Medicare Population Over the Past Decade.

PubMed

Intenzo, Charles M; Parker, Laurence; Levin, David C; Kim, Sung M; Rao, Vijay M

2016-01-01

Both radiologists as well as nonimaging physicians perform dual-energy X-ray absorptiometry (DXA) imaging in the United States. This study aims to compare provider distribution between these physician groups on the Medicare population, which is the predominant age group of patients evaluated by this imaging procedure. Using the 2 relevant Current Procedural Terminology, Fourth Edition codes for DXA scans, source data were obtained from the CMS Physician Supplier Procedure Summary Master Files from 2003 through 2013. DXA scan procedure volumes for radiologists and nonradiologists on Medicare patients were tabulated. Utilization rates were calculated. From 2003 to 2013, the total number of DXA scans performed on Medicare patients decreased by 2%. However, over the same period, the number of scans performed by radiologists had increased by 25% over nonimaging specialists, whose utilization had declined by approximately the same amount. From 2003 to 2013, the rate of utilization of DXA scans in the Medicare fee-for-service population declined somewhat. However, radiologists continue to gain market share from other specialists and now predominate in this type of imaging by a substantial margin. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Functional Effects of Prebiotic Fructans in Colon Cancer and Calcium Metabolism in Animal Models.

PubMed

Rivera-Huerta, Marisol; Lizárraga-Grimes, Vania Lorena; Castro-Torres, Ibrahim Guillermo; Tinoco-Méndez, Mabel; Macías-Rosales, Lucía; Sánchez-Bartéz, Francisco; Tapia-Pérez, Graciela Guadalupe; Romero-Romero, Laura; Gracia-Mora, María Isabel

2017-01-01

Inulin-type fructans are polymers of fructose molecules and are known for their capacity to enhance absorption of calcium and magnesium, to modulate gut microbiota and energy metabolism, and to improve glycemia. We evaluated and compared the effects of Chicory inulin "Synergy 1®" and inulin from Mexican agave "Metlin®" in two experimental models of colon cancer and bone calcium metabolism in mice and rats. Inulins inhibited the development of dextran sulfate sodium-induced colitis and colon cancer in mice; these fructans reduced the concentration of tumor necrosis factor alpha and prevented the formation of intestinal polyps, villous atrophy, and lymphoid hyperplasia. On the other hand, inulin treatments significantly increased bone densitometry (femur and vertebra) in ovariectomized rats without altering the concentration of many serum biochemical parameters and urinary parameters. Histopathology results were compared between different experimental groups. There were no apparent histological changes in rats treated with inulins and a mixture of inulins-isoflavones. Our results showed that inulin-type fructans have health-promoting properties related to enhanced calcium absorption, potential anticancer properties, and anti-inflammatory effects. The use of inulin as a prebiotic can improve health and prevent development of chronic diseases such as cancer and osteoporosis.

Determinants of 24-hour energy expenditure in man. Methods and results using a respiratory chamber.

PubMed Central

Ravussin, E; Lillioja, S; Anderson, T E; Christin, L; Bogardus, C

1986-01-01

Daily human energy requirements calculated from separate components of energy expenditure are inaccurate and usually in poor agreement with measured energy intakes. Measurement of energy expenditure over periods of 24 h or longer is needed to determine more accurately rates of daily energy expenditure in humans. We provide a detailed description of a human respiratory chamber and methods used to determine rates of energy expenditure over 24-h periods in 177 subjects. The results show that: fat-free mass (FFM) as estimated by densitometry is the best available determinant of 24-h energy expenditures (24EE) and explains 81% of the variance observed between individuals (24EE [kcal/d] = 597 + 26.5 FFM); 24EE in an individual is very reproducible (coefficient of variation = 2.4%); and even when adjusted for differences in FFM, there is still considerable interperson variability of the daily energy expenditure. A large portion of the variability of 24EE among individuals, independent of differences in body size, was due to variability in the degree of spontaneous physical activity, i.e., "fidgeting," which accounted for 100-800 kcal/d in these subjects. Images PMID:3782471

The Role of Concentration and Solvent Character in the Molecular Organization of Humic Acids.

PubMed

Klučáková, Martina; Věžníková, Kateřina

2016-10-27

The molecular organization of humic acids in different aqueous solutions was studied over a wide concentration range (0.01-10 g·dm -3 ). Solutions of humic acids were prepared in three different media: NaOH, NaCl, and NaOH neutralized by HCl after dissolution of the humic sample. Potentiometry, conductometry, densitometry, and high resolution ultrasound spectrometry were used in order to investigate conformational changes in the humic systems. The molecular organization of humic acids in the studied systems could be divided into three concentration ranges. The rearrangements were observed at concentrations of ~0.02 g·dm -3 and ~1 g·dm -3 . The first "switch-over point" was connected with changes in the hydration shells of humic particles resulting in changes in their elasticity. The compressibility of water in the hydration shells is less than the compressibility of bulk water. The transfer of hydration water into bulk water increased the total compressibility of the solution, reducing the ultrasonic velocity. The aggregation of humic particles and the formation of rigid structures in systems with concentrations higher than 1 g·dm -3 was detected.

Transient peripartum osteoporosis of the femoral head in first and third pregnancy.

PubMed

Truszczyńska, Aleksandra; Walczak, Piotr; Rapała, Kazimierz

2012-01-01

The aim of this article was to present transient peripartum femoral head osteoporosis. This very rare condition occurred twice in our patient-a woman in her 30s. The cases described in the literature were mostly unilateral, with bilateral hip involvement noted much less frequently. In our patient, transient osteoporosis occurred in the third trimester of her first pregnancy in the right hip, her second pregnancy was uncomplicated, and in the third trimester of the patient's third pregnancy, osteoporotic changes were noted in the left hip joint. The patient breastfed her first and third babies only 3 wk each. She breastfed her second baby for 4 mo. The diagnostic workup was based on the clinical examination and radiographic/magnetic resonance imaging, which revealed bone marrow edema, and the dual-energy X-ray absorptiometry scans. The treatment consisted in core decompression of the femoral head (foragé), unloading of the hip using crutches as well as administration of calcitonin and calcium supplements. Complete recovery of the femoral heads was achieved. The follow-up time was 7 yr. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Skeletal changes during and after spaceflight.

PubMed

Vico, Laurence; Hargens, Alan

2018-03-21

Space sojourns are challenging for life. The ability of the human body to adapt to these extreme conditions has been noted since the beginning of human space travel. Skeletal alterations that occur during spaceflight are now better understood owing to tools such as dual-energy X-ray densitometry and high-resolution peripheral quantitative CT, and murine models help researchers to understand cellular and matrix changes that occur in bone and that are difficult to measure in humans. However, questions remain with regard to bone adaptation and osteocyte fate, as well as to interactions of the skeleton with fluid shifts towards the head and with the vascular system. Further investigations into the relationships between the musculoskeletal system, energy metabolism and sensory motor acclimatisation are needed. In this regard, an integrated intervention is required that will address multiple systems simultaneously. Importantly, radiation and isolation-related stresses are gaining increased attention as the prospect of human exploration into deep space draws nearer. Although space is a unique environment, clear parallels exist between the effects of spaceflight, periods of immobilization and ageing, with possibly irreversible features. Space travel offers an opportunity to establish integrated deconditioning and ageing interventions that combine nutritional, physical and pharmaceutical strategies.

Visualization of newt aragonitic otoconial matrices using transmission electron microscopy

NASA Technical Reports Server (NTRS)

Steyger, P. S.; Wiederhold, M. L.

1995-01-01

Otoconia are calcified protein matrices within the gravity-sensing organs of the vertebrate vestibular system. These protein matrices are thought to originate from the supporting or hair cells in the macula during development. Previous studies of mammalian calcitic, barrel-shaped otoconia revealed an organized protein matrix consisting of a thin peripheral layer, a well-defined organic core and a flocculent matrix inbetween. No studies have reported the microscopic organization of the aragonitic otoconial matrix, despite its protein characterization. Pote et al. (1993b) used densitometric methods and inferred that prismatic (aragonitic) otoconia have a peripheral protein distribution, compared to that described for the barrel-shaped, calcitic otoconia of birds, mammals, and the amphibian utricle. By using tannic acid as a negative stain, we observed three kinds of organic matrices in preparations of fixed, decalcified saccular otoconia from the adult newt: (1) fusiform shapes with a homogenous electron-dense matrix; (2) singular and multiple strands of matrix; and (3) more significantly, prismatic shapes outlined by a peripheral organic matrix. These prismatic shapes remain following removal of the gelatinous matrix, revealing an internal array of organic matter. We conclude that prismatic otoconia have a largely peripheral otoconial matrix, as inferred by densitometry.

Development of radiochromic film for spatially quantitative dosimetric analysis of indirect ionizing radiation fields

NASA Astrophysics Data System (ADS)

Brady, Samuel Loren

Two types of radiochromic films (RCF) were characterized for this work: EBT and XRQA film. Both films were investigated for: radiation interaction with film structure; light interaction with film structure for optimal film readout (densitometry) sensitivity; range of absorbed dose measurements; dependence of film dose measurement response as a function of changing radiation energy; fractionation and dose rate effects on film measurement response; film response sensitivity to ambient factors; and stability of measured film response with time. EBT film was shown to have the following properties: near water equivalent atomic weight (Zeff); dynamic dose range of 10 -1-102 Gy; 3% change in optical density (OD) response for a single exposure level when exposed to radiation energies from (75-18,000) kV; and best digitized using transmission densitometry. XRQA film was shown to have: a Zeff of ˜25; a 12 fold increase in sensitivity at lower photon energies for a dynamic dose range of 10-3-100 Gy, a difference of 25% in OD response when comparing 120 kV to 320 kV, and best digitized using reflective densitometry. Both XRQA and EBT films were shown to have: a temporal stability (DeltaOD) of ˜1% for t > 24 hr post film exposure for up to ˜20 days; a change in dose response of ˜0.03 mGy hr-1 when exposed to fluorescent room lighting at standard room temperature and humidity levels; a negligible dose rate and fractionation effect when operated within the optimal dose ranges; and a light wavelength dependence with dose for film readout. The flat bed scanner was chosen as the primary film digitizer due to its availability, cost, OD range, functionality (transmission and reflection scanning), and digitization speed. As a cost verses functionality comparison, the intrinsic and operational limitations were determined for two flat bed scanners. The EPSON V700 and 10000XL exhibited equal spatial and OD accuracy. The combined precision of both the scanner light sources and CCD sensors measured < 2% and < 7% deviation in pixel light intensities for 50 consecutive scans, respectively. Both scanner light sources were shown to be uniform in transmission and reflection scan modes along the center axis of light source translation. Additionally, RCFs demonstrated a larger dynamic range in pixel light intensities, and to be less sensitive to off axis light inhomogeneity, when scanned in landscape mode (long axis of film parallel with axis of light source translation). The EPSON 10000XL demonstrated slightly better light source/CCD temporal stability and provided a capacity to scan larger film formats at the center of the scanner in landscape mode. However, the EPSON V700 only measured an overall difference in accuracy and precision by 2%, and though smaller in size, at the time of this work, was one sixth the cost of the 10000XL. A scan protocol was developed to maximize RCF digitization accuracy and precision, and a calibration fitting function was developed for RCF absolute dosimetry. The fitting function demonstrated a superior goodness of fit for both RCF types over a large range of absorbed dose levels as compared to the currently accepted function found in literature. The RCF dosimetry system was applied to three novel areas from which a benefit could be derived for 2D or 3D dosimetric information. The first area was for a 3D dosimetry of a pendant breast in 3D-CT mammography. The novel method of developing a volumetric image of the breast from a CT acquisition technique was empirically measured for its dosimetry and compared to standard dual field digital mammography. The second area was dose reduction in CT for pediatric and adult scan protocols. In this application, novel methodologies were developed to measure 3D organ dosimetry and characterize a dose reduction scan protocol for pediatric and adult body habitus. The third area was in the field of small animal irradiation for radiobiology purposes and cancer patient treatment verification. In every case, the RCF dosimetry system was verified for accuracy using a traditional PDD as the golden standard. When considering all areas of radiation energy applications, the RCF dosimetry system agreed to better than 7% of the golden standard, and in some cases within better than 1%. In many instances, this work provided vital dosimetric information that otherwise was not captured using the PDD in similar geometry. This work demonstrates the need for RCF to more accurately measure volumetric dose. (Abstract shortened by UMI.)

Influence of education, marital status, occupation, and the place of living on skeletal status, fracture prevalence, and the course and effectiveness of osteoporotic therapy in women in the RAC-OST-POL Study.

PubMed

Pluskiewicz, Wojciech; Adamczyk, Piotr; Czekajło, Aleksandra; Grzeszczak, Władysław; Drozdzowska, Bogna

2014-01-01

The RAC-OST-POL population-based, epidemiological study provided data concerning the influence of education, marital status, occupation, and the place of living (residence) on skeletal status, fracture prevalence, and the course and effectiveness of osteoporotic therapy in 625 women older than 55 years, all of them recruited from the District of Raciborz in Poland. Their mean age was 66.4 ± 7.8 years. All the women completed a specially designed questionnaire. The skeletal status was assessed by femoral neck (FN) and total hip (TH) densitometry, using a Lunar DPX system (USA). In univariate analyses, taking into consideration the age differences, bone mineralization was dependent on marital status (Z score for FN and TH was significantly higher in widows than in divorcees; p < 0.05), place of residence (better results in rural areas; p < 0.05), and occupation (better in standing than sitting jobs; p < 0.05 for FN Z score and p < 0.01 for TH Z score). The multivariate model allowed us to verify that only place of living and type of occupation had a significant influence on densitometry results. In direct comparison, fracture prevalence seemed to be borderline significantly more common in widows (33.5%) and least common among divorcees (11.8%) (χ(2) = 6.9, df = 3, p = 0.07), but reanalysis performed after age adjustment excluded a true impact of marital status on fracture occurrence. Other factors did not affect fracture occurrence. Some factors influenced the use of medications for osteoporosis: higher level of education was associated with a more frequent use of vitamin D (χ(2) = 8.49, df = 3, p < 0.05) and of hormone replacement therapy (HRT) (χ(2) = 35.7, df = 3, p < 0.00001). HRT was most commonly used by unmarried women (30%) and least commonly by divorcees (11.8%) (χ(2) = 11.7, df = 3, p = 0.01). Vitamin D was more often used among women from the urban area of Raciborz than by those from surrounding rural areas (χ(2) = 9.2, df = 1, p < 0.01). The frequency of use of the three aforementioned medications was associated with the character of occupation. Women with sedentary jobs demonstrated the highest frequency of intake for vitamin D (χ(2) = 9.92, df = 3, p < 0.05) and HRT (χ(2) = 19.48, df = 3, p < 0.001) as well as for other antiresorptive medications (χ(2) = 8.18, df = 3, p < 0.05). We concluded that the results of the epidemiological study demonstrate that both skeletal status and use of antiosteoporotic medications were partially modified by analyzed social factors, whereas fracture prevalence was generally independent from those factors. These data suggest that education, marital status, place of living, and type of occupation may have impacts on implementation of osteoporosis-preventing health programs.

A non-radioisotopic quantitative competitive polymerase chain reaction method: application in measurement of human herpesvirus 7 load.

PubMed

Kidd, I M; Clark, D A; Emery, V C

2000-06-01

Quantitative-competitive polymerase chain reaction (QCPCR) is a well-optimised and objective methodology for the determination of viral load in clinical specimens. A major advantage of QCPCR is the ability to control for the differential modulation of the PCR process in the presence of potentially inhibitory material. QCPCR protocols were developed previously for CMV, HHV-6, HHV-7 and HHV-8 and relied upon radioactively labelled primers, followed by autoradiography of the separated and digested PCR products to quantify viral load. Whilst this approach offers high accuracy and dynamic range, non-radioactive approaches would be attractive. Here, an alternative detection system is reported, based on simple ethidium bromide staining and computer analysis of the separated reaction products, which enables its adoption in the analysis of a large number of samples. In calibration experiments using cloned HHV-7 DNA, the ethidium bromide detection method showed an improved correlation with known copy number over that obtained with the isotopic method. In addition, 67 HHV-7 PCR positive blood samples, derived from immunocompromised patients, were quantified using both detection techniques. The results showed a highly significant correlation with no significant difference between the two methods. The applicability of the computerised densitometry method in the routine laboratory is discussed.

Whole-body vibration improves fracture healing and bone quality in rats with ovariectomy-induced osteoporosis.

PubMed

Butezloff, Mariana Maloste; Zamarioli, Ariane; Leoni, Graziela Bianchi; Sousa-Neto, Manoel Damião; Volpon, Jose Batista

2015-11-01

To investigate the effect of vibration therapy on the bone callus of fractured femurs and the bone quality of intact femurs in ovariectomized rats. Fifty-six rats aged seven weeks were divided into four groups: control with femoral fracture (CON, n=14), ovariectomized with femoral fracture (OVX, n=14), control with femoral fracture plus vibration therapy (CON+VT, n=14), and ovariectomized with femoral fracture plus vibration therapy (OVX+VT, n=14). Three months after ovariectomy or sham surgery, a complete fracture was produced at the femoral mid-diaphysis and stabilized with a 1-mm-diameter intramedullary Kirschner wire. X-rays confirmed the fracture alignment and fixation. Three days later, the VT groups underwent vibration therapy (1 mm, 60 Hz for 20 minutes, three times per week for 14 or 28 days). The bone and callus quality were assessed by densitometry, three-dimensional microstructure, and mechanical test. Ovariectomized rats exhibited a substantial loss of bone mass and severe impairment in bone microarchitecture, both in the non-fractured femur and the bone callus. Whole-body vibration therapy exerted an important role in ameliorating the bone and fracture callus parameters in the osteoporotic bone. Vibration therapy improved bone quality and the quality of the fracture bone callus in ovariectomized rats.

In vitro sealing of iatrogenic fetal membrane defects by a collagen plug imbued with fibrinogen and plasma.

PubMed

Engels, A C; Hoylaerts, M F; Endo, M; Loyen, S; Verbist, G; Manodoro, S; DeKoninck, P; Richter, J; Deprest, J A

2013-02-01

We aimed to demonstrate local thrombin generation by fetal membranes, as well as its ability to generate fibrin from fibrinogen concentrate. Furthermore, we aimed to investigate the efficacy of collagen plugs, soaked with plasma and fibrinogen, to seal iatrogenic fetal membrane defects. Thrombin generation by homogenized fetal membranes was measured by calibrated automated thrombography. To identify the coagulation caused by an iatrogenic membrane defect, we analyzed fibrin formation by optical densitometry, upon various concentrations of fibrinogen. The ability of a collagen plug soaked with fibrinogen and plasma was tested in an ex vivo model for its ability to seal an iatrogenic fetal membrane defect. Fetal membrane homogenates potently induced thrombin generation in amniotic fluid and diluted plasma. Upon the addition of fibrinogen concentrate, potent fibrin formation was triggered. Measured by densiometry, fibrin formation was optimal at 1250 µg/mL fibrinogen in combination with 4% plasma. A collagen plug soaked with fibrinogen and plasma sealed an iatrogenic membrane defect about 35% better than collagen plugs without these additives (P = 0.037). These in vitro experiments suggest that the addition of fibrinogen and plasma may enhance the sealing efficacy of collagen plugs in closing iatrogenic fetal membrane defects. © 2013 John Wiley & Sons, Ltd.

Muon tomography in the Mont Terri underground rock laboratory

NASA Astrophysics Data System (ADS)

Lesparre, N.; Gibert, D.; Marteau, J.; Carlus, B.; Nussbaum, C.

2012-04-01

The Mont Terri underground rock laboratory (Switzerland) was excavated in a Mesozoic shale formation constituted by Opalinus clay. This impermeable formation presents suitable properties for hosting repository sites of radioactive waste. A muon telescope has been placed in this laboratory in October 2009 to establish the feasibility of the muon tomography and to test the sensor performance in a calm environment, where we are protected from atmospheric noisy particles. However, the presence of radon in the gallery as well as charged particles issued from the decay of gamma rays may create a background noise. This noise shift and smooths the signal inducing an under estimation of the rock density. The uncorrelated background has been measured by placing the planes of detection in anti-coincidence. This estimation is preponderant and has to be combined to the theoretical feasibility evaluation to determine the best experimental set-up to observe muon flux fluctuations due to density variations. The muon densitometry experience is here exposed with the estimation of its feasibility. The data acquired from different locations inside the underground laboratory are presented. They are compared to two models representing the layer above the laboratory corresponding to a minimum and a maximum muon flux expectation depending on the values of the rock density.

Clinical relevance of radiologic examination of the skeleton and bone density measurements in osteoporosis of old age

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuester, W.; Seidl, G.; Linkesch, W.

1981-10-01

For the diagnosis of primary osteoporosis, various semiquantitative radiologic methods were compared in 149 unselected patients, aged over 50 years. Crush fracture syndrome (CFS), lumbar spine index (LSI), and Singh Index (SI) were assessed by three radiologists and after reevaluation, the intra- and interobserver errors were calculated. The reliability of the subjective grading was improved by joint and repeated reading of the radiographs. Additionally, the peripheral trabecular bone content was measured by photon absorption densitometry (PAD). To test the value of the various semiquantitative methods. LSI, Si, and PAD have been compared with sex-matching before and after separation into agemore » in decades in CFS-positive and CFS-negative patients. In an attempt to differentiate osteoporotics and non-osteoporotics by CFS, our results indicate that CFS-positive and CFS-negative males cannot be separated by LSI, Si, and PAD, whereas in females these methods can discriminate irrespective of the age in decades. However, in age related groups, only SI can discriminate significantly between CFS-positive and CFS-negative females. Correlation of the semiquantitative methods, regardless of the diagnosis of a CFS, revealed a significant correlation-between SI and PAD, but no correlation between LSI and SI, and LSI and PAD, respectively.« less

Effects of 2-oxoglutaric acid on bone morphometry, densitometry, mechanics, and immunohistochemistry in 9-month-old boars with prenatal dexamethasone-induced osteopenia.

PubMed

Tomaszewska, Ewa; Dobrowolski, Piotr; Bieńko, Marek; Prost, Łukasz; Szymańczyk, Sylwia; Zdybel, Adam

2015-11-01

The structural quality of the connective tissue is genetically determined and is influenced by hormonal and nutritional modification. An effect of a 2-Ox-rich diet on bone mineralization and structure and expression of non-collagenous protein in articular and growth cartilages of maternal dexamethasone-treated 9-month-old boars was considered in this study. Sows were treated i.m. with dexamethasone at the dose of 0.03 mg kg(-1) body weight every second day during the last 45 days of pregnancy. After the birth, the boars were divided into two groups: administered and not supplemented with 2-Ox for 9 months (0.4 g/kg body weight/day). Dexamethasone given during the prenatal time inhibited the growth and negatively influenced the mechanics, geometry and histomorphometrical parameters of long bones and cartilage irrespective of the diet. Moreover, maternal dexamethasone treatment resulted in expression of osteocalcin in the articular cartilage, and the diet rich in 2-Ox limited the OC expression. This study demonstrated that changes observed in adult boars initiated by dexamethasone treatment in the prenatal period were persistent and long-term use of alimentary 2-Ox supplementation can counteract only some of the destructive changes evoked by prenatal dexamethasone excess.

Computed tomography of the lung of healthy snakes of the species Python regius, Boa constrictor, Python reticulatus, Morelia viridis, Epicrates cenchria, and Morelia spilota.

PubMed

Pees, Michael; Kiefer, Ingmar; Thielebein, Jens; Oechtering, Gerhard; Krautwald-Junghanns, Maria-Elisabeth

2009-01-01

Thirty-nine healthy boid snakes representing six different species (Python regius, Boa constrictor, Python reticulatus, Morelia viridis, Epicrates cenchria, and Morelia spilota) were examined using computed tomography (CT) to characterize the normal appearance of the respiratory tissue. Assessment was done subjectively and densitometry was performed using a defined protocol. The length of the right lung was calculated to be 11.1% of the body length, without a significant difference between species. The length of the left lung in proportion to the right was dependent on the species examined. The most developed left lung was in P. regius (81.2%), whereas in B. constrictor, the left lung was vestigial or absent (24.7%). A median attenuation of -814.6 HU and a variability of 45.9 HU were calculated for all species with no significant difference between species. Within the species, a significantly higher attenuation was found for P. regius in the dorsal and cranial aspect of the lung compared with the ventral and caudal part. In B. constrictor, the reduced left lung was significantly hyperattenuating compared with the right lung. Results of this study emphasize the value of CT and provide basic reference data for assessment of the snake lung in these species. Veterinary Radiology &

Feasibility of simultaneous computed tomographic colonography and fully automated bone mineral densitometry in a single examination.

PubMed

Summers, Ronald M; Baecher, Nicolai; Yao, Jianhua; Liu, Jiamin; Pickhardt, Perry J; Choi, J Richard; Hill, Suvimol

2011-01-01

To show the feasibility of calculating the bone mineral density (BMD) from computed tomographic colonography (CTC) scans using fully automated software. Automated BMD measurement software was developed that measures the BMD of the first and second lumbar vertebrae on computed tomography and calculates the mean of the 2 values to provide a per patient BMD estimate. The software was validated in a reference population of 17 consecutive women who underwent quantitative computed tomography and in a population of 475 women from a consecutive series of asymptomatic patients enrolled in a CTC screening trial conducted at 3 medical centers. The mean (SD) BMD was 133.6 (34.6) mg/mL (95% confidence interval, 130.5-136.7; n = 475). In women aged 42 to 60 years (n = 316) and 61 to 79 years (n = 159), the mean (SD) BMDs were 143.1 (33.5) and 114.7 (28.3) mg/mL, respectively (P < 0.0001). Fully automated BMD measurements were reproducible for a given patient with 95% limits of agreement of -9.79 to 8.46 mg/mL for the mean difference between paired assessments on supine and prone CTC. Osteoporosis screening can be performed simultaneously with screening for colorectal polyps.

Tracing Dietary Mercury Histochemically, with Autometallography, through the Liver to the Ovaries and Spawned Eggs of the Spot, a Temperate Coastal Marine Fish.

PubMed

Govoni, John J; Morris, James A; Evans, David W

2017-09-01

Exposure to mercury (Hg) results in reproductive abnormalities and deficiencies in female fish. We traced the maternal assimilation and redistribution of dietary inorganic (HgII) and organic (MeHg) forms of Hg in a coastal marine fish, the Spot Leiostomus xanthurus. We conducted a 90-d laboratory experiment in which treatment Spot were fed muscle of Blue Marlin Makaira nigricans with elevated concentrations of Hg mixed with a commercial fish food, while control Spot were fed only commercial food pellets. Gonadal maturation was induced by shortening the photoperiod and increasing the temperature. Spawning was induced by intramuscular injection of human chorionic gonadotropin at 100 IU/kg. Solid-sampling atomic absorption spectrophotometry measured the total Hg (THg), HgII, and MeHg in Blue Marlin muscle. Autometallography located Hg-sulfide granules in the liver, ovaries, and spawned eggs, and densitometry provided comparisons of Hg-sulfide granules in the ovaries of treatment and control Spot. Overall, the intensity and prevalence of Hg-sulfide granules were greater in the liver, ovaries, and eggs from treatment Spot than in those from controls. The tissue and cellular distribution of Hg-sulfide granules differed. Received November 18, 2016; accepted June 18, 2017.

Osteoporosis diagnosis in men: the T-score controversy revisited.

PubMed

Binkley, Neil; Adler, Robert; Bilezikian, John P

2014-12-01

Osteoporosis becomes common with aging in both sexes, but is often ignored in men. The 2013 International Society for Clinical Densitometry consensus conference endorsed a Caucasian female referent database for T-score calculation in men. This recommendation has generated controversy and concern. Accumulating data indicate that at the same DXA-measured body mineral density (BMD) (g/cm(2)), men and women are at approximately the same fracture risk. With this point in mind, using the same database to derive the T-score in men and women is reasonable. As a result, a greater proportion of men who sustain a fragility fracture will have T-scores that are higher than they would if a male database were used; in fact, many men will fracture at T-scores that are "normal." This highlights the importance of diagnosing osteoporosis not just by T-score, but also by the presence of fragility fracture and/or by estimations of fracture risk as generated by tools such as the FRAX calculator. The practical consequences of this change in densitometric definition of osteoporosis in men should be monitored, including the proportion of men at risk identified and treated as well as defining the response to treatment in those assessed by this more comprehensive approach.

INVESTIGATION OF BONE MINERALIZATION IN PATIENTS WITH CORONARY HEART DISEASE COMPLICATED BY CHRONIC HEART FAILURE, STAGE II-A.

PubMed

Krynytska, I; Marushchak, M; Zaets, T; Savchenko, I; Habor, H

2017-06-01

The majority of the studies have shown that individuals with cardiovascular diseases have a higher risk of experiencing bone loss and thus greater predisposition to risk of fracture. On the other hand there is growing evidence that individuals with low bone mass have higher mortality for cardiovascular events compared to patients with cardiovascular disease with normal bone mass. This research aims to investigate bone mineralization in patients with coronary heart disease complicated by stage II-A chronic heart failure. The study involved 33 men with coronary heart disease complicated by Stage II-A chronic heart failure. Bone mineral density was measured using dual energy x-ray densitometry of lumbar region of spine. Structural and functional changes of bone tissue of the lumbar spine have been found in 49,2% patients with coronary heart disease complicated by Stage II-A chronic heart failure, in particular, I stage of osteopenia - in 44,6%, II stage of osteopenia - in 27,7%, III stage of osteopenia - in 10,8% and osteoporosis - in 16,9%. It was established the same type of downward trend for BMD decreasing in L1 of patients with different stages of osteopenia, but in case of osteoporosis mineralization decreased equally in all vertebrae.

Estimation of capsaicin through scanning densitometry and evaluation of different varieties of capsicum in India.

PubMed

Gantait, Arunava; Maji, Amal; Barman, Tapu; Banerji, Pratim; Venkatesh, P; Mukherjee, Pulok K

2012-01-01

Capsicum annuum L. (family: Solanaceae) possesses therapeutic benefits for the treatment of rheumatism, neuropathy, psoriasis, flatulence and so on. In this study fruits of four different varieties of C. annuum from four different geographical regions in India were evaluated based on their total content of capsaicin. Ethanol extracts of the fruits were used. HPTLC plates were developed in a mobile phase containing benzene, ethyl acetate and methanol (75:20:5). Densitometric scanning was performed at a wavelength of 283 nm in the absorbance mode. The calibration curve was described by the equation Y=393.587+3.836*X with a correlation coefficient (r) of 0.99890. The content of capsaicin in Nagaland, Manipur, West Bengal and Shimla varieties was found to be 3.71%, 1.78%, 0.54% and 0.06%, respectively. The developed densitometric method was found to be specific, accurate and precise. A recovery study and precision showed low levels of %RSD values. The linearity range of the curve for capsaicin was found to be 300-900 ng per spot. The limit of detection and the limit of quantification values were determined to be 31 and 94 ng, respectively, proving the sensitivity of the method. Thus the method can be used to control the total content of capsaicin on an industrial scale.

High transmittance of X-rays in the utricular otolith of upside-down swimming catfish, Synodontis nigriventris.

PubMed

Ohnishi, Ken; Yamamoto, Toshihiro; Ogawa, Yoichi; Takahashi, Akihisa; Yamashita, Masayuki; Ohnishi, Takeo

2002-03-01

The upside-down swimming catfish (Synodontis nigriventris) has unique behavior, i.e., it frequently shows a stable upside-down posture during swimming and resting. To examine whether the unique postural control in S. nigriventris results from the characteristics of the vestibular organ, we observed the morphological aspects of the otolith and the orientation of sensory hair cells in the utricle. Soft X-ray densitometry analysis showed that the transmittance of soft X-rays in the otolith of S. nigriventris was higher than that in a closely related species (Synodontis multipunctatus) belonging to Synodontis family, goldfish (Carassius auratus) or miniature catfish (Corydoras paleatus) which shows upside-up swimming. The higher transmittance of soft X-rays suggests that the density of the otolith in S. nigriventris is lower than that in S. multipunctatus, C. auratus or C. paleatus. It is possible that the low density of the otolith may have a relation to the control of the unique upside-down posture of S. nigriventris. The hair cells in S. nigriventris were present at the ventral to ventro-lateral site of the utricular epithelium, forming a single hair cell layer as in the other 3 species of fish. The orientation of the sensory hair cells does not appear to cause the unique postural control.

Effect of Clothing on Measurement of Bone Mineral Density.

PubMed

McNamara, Elizabeth A; Feldman, Anna Z; Malabanan, Alan O; Abate, Ejigayehu G; Whittaker, LaTarsha G; Yano-Litwin, Amanda; Dorazio, Jolene; Rosen, Harold N

2016-01-01

It is unknown whether allowing patients to have BMD (bone mineral density) studies acquired while wearing radiolucent clothing adlib contributes appreciably to the measurement error seen. To examine this question, a spine phantom was scanned 30 times without any clothing, while draped with a gown, and while draped with heavy winter clothing. The effect on mean BMD and on SD (standard deviation) was assessed. The effect of clothing on mean or SD of the area was not significant. The effect of clothing on mean and SD for BMD was small but significant and was around 1.6% for the mean. However, the effect on BMD precision was much more clinically important. Without clothing the spine phantom had an least significant change of 0.0077 gm/cm(2), while when introducing variability of clothing the least significant change rose as high as 0.0305 gm/cm(2). We conclude that, adding clothing to the spine phantom had a small but statistically significant effect on the mean BMD and on variance of the measurement. It is unlikely that the effect on mean BMD has any clinical significance, but the effect on the reproducibility (precision) of the result is likely clinically significant. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Life satisfaction and bone mineral density among postmenopausal women: cross-sectional and longitudinal associations.

PubMed

Rauma, Päivi H; Koivumaa-Honkanen, Heli; Williams, Lana J; Tuppurainen, Marjo T; Kröger, Heikki P; Honkanen, Risto J

2014-01-01

The purpose of this study was to determine whether and how global life satisfaction is associated with bone mineral density (BMD) and bone loss. A total of 2167 women from a cohort of Finnish women born in 1932 to 1941 were included in the cross-sectional and 1147 women in the 10-year longitudinal part of the present study. Participants responded to a postal enquiry and underwent femoral BMD densitometry in 1999 (baseline) and 2009 (follow-up). During the follow-up, their life satisfaction was repeatedly measured using a four-item scale. Self-reported data on health, life-style, and medication were used to adjust the multivariate linear regression models. Mean (standard deviation) femoral BMD decreased over the 10-year follow-up from 880 (125) to 846 (122) mg/cm. In the multivariate model, life satisfaction (p = .028) and its improvement (p = .001) predicted reduced bone loss, whereas hospitalization due to depression predicted increased bone loss (B = -0.523 annual % change, standard error = 0.212, p = .014). These effects were independent of each other. Easily assessed global life satisfaction should be taken into account when effects of aging and prevention of osteoporosis as well as health promotion in postmenopausal women are considered.

Volume adjustment of lung density by computed tomography scans in patients with emphysema.

PubMed

Shaker, S B; Dirksen, A; Laursen, L C; Skovgaard, L T; Holstein-Rathlou, N H

2004-07-01

To determine how to adjust lung density measurements for the volume of the lung calculated from computed tomography (CT) scans in patients with emphysema. Fifty patients with emphysema underwent 3 CT scans at 2-week intervals. The scans were analyzed with a software package that detected the lung in contiguous images and subsequently generated a histogram of the pixel attenuation values. The total lung volume (TLV), lung weight, percentile density (PD), and relative area of emphysema (RA) were calculated from this histogram. RA and PD are commonly applied measures of pulmonary emphysema derived from CT scans. These parameters are markedly influenced by changes in the level of inspiration. The variability of lung density due to within-subject variation in TLV was explored by plotting TLV against PD and RA. The coefficients for volume adjustment for PD were relatively stable over a wide range from the 10th to the 80th percentile, whereas for RA the coefficients showed large variability especially in the lower range, which is the most relevant for quantitation of pulmonary emphysema. Volume adjustment is mandatory in repeated CT densitometry and is more robust for PD than for RA. Therefore, PD seems more suitable for monitoring the progression of emphysema.

Serum proteins by capillary zone electrophoresis: approaches to the definition of reference values.

PubMed

Petrini, C; Alessio, M G; Scapellato, L; Brambilla, S; Franzini, C

1999-10-01

The Paragon CZE 2000 (Beckman Analytical, Milan, Italy) is an automatic dedicated capillary zone electrophoresis (CZE) system, producing a five-zone serum protein pattern with quantitative estimation of the zones. With the view of substituting this instrument for two previously used serum protein electrophoresis techniques, we planned to produce reference values for the "new" systems leading to compatible interpretation of the results. High resolution cellulose acetate electrophoresis with visual inspection and descriptive reporting (HR-CAE) and five-zone cellulose acetate electrophoresis with densitometry (CAE-D) were the previously used techniques. Serum samples (n = 167) giving "normal pattern" with HR-CAE were assayed with the CZE system, and the results were statistically assessed to yield 0.95 reference intervals. One thousand normal and pathological serum samples were then assayed with the CAE-D and the CZE techniques, and the regression equations of the CAE-D values over the CZE values for the five zones were used to transform the CAE-D reference limits into the CZE reference limits. The two sets of reference values thereby produced were in good agreement with each other and also with reference values previously reported for the CZE system. Thus, reference values for the CZE techniques permit interpretation of results coherent with the previously used techniques and reporting modes.

Quantitation of total protein deposits on contact lenses by means of amino acid analysis.

PubMed

Yan, G; Nyquist, G; Caldwell, K D; Payor, R; McCraw, E C

1993-04-01

This study was done to characterize and quantify the protein deposits on worn contact lenses and to measure the residual deposits after extraction in 2% sodium dodecyl sulfate and the total protein deposits on worn vifilcon, atlafilcon, and tefilcon lenses (Food and Drug Administration Types IV, II, and I, respectively). Contact lens extracts were separated with gel electrophoresis, and the amount of protein was estimated after silver staining and densitometry. To determine the residual deposits, the contact lenses were hydrolyzed, and amino acid analysis was carried out by reverse-phase high-performance liquid chromatography after precolumn derivatization with phenylisothiocyanate. Refinement of the hydrolysis conditions was undertaken to minimize interference by the lens polymers. The extraction removed only approximately 25% of the protein deposits. Mild hydrolytic conditions, 20 hr in 6 N HCl at 105 degrees C, were found to cause minimal polymer interference. Of the 350, 10, and 20 micrograms of protein typically determined on whole vifilcon, atlafilcon, and tefilcon lenses, the polymers were estimated to account for 4, 0.5, and less than 0.4 micrograms, respectively. Hydrolysis of worn contact lenses with subsequent amino acid separation can be applied to determine the total protein deposits without the uncertainty inherent in extraction of the deposits.

Co-autodisplay of Z-domains and bovine caseins on the outer membrane of E. coli.

PubMed

Yoo, Gu; Saenger, Thorsten; Bong, Ji-Hong; Jose, Joachim; Kang, Min-Jung; Pyun, Jae-Chul

2015-12-01

In this work, two proteins, Z-domains and bovine casein, were auto-displayed on the outer membrane of the same Escherichia coli cells by co-transformation of two different auto-display vectors. On the basis of SDS-PAGE densitometry, Z-domains and bovine casein were expressed at 3.12 × 10⁵ and 1.55 × 10⁵ proteins/E. coli cell, respectively. The co-auto-displayed Z-domains had antibody-binding activity and the bovine casein had adhesive properties. E. coli with co-auto-displayed proteins were analyzed by fluorescence assisted cell sorting (FACS). E. coli with co-auto-displayed Z-domains and bovine casein aggregated due to hydrophobic interaction. For application to immunoassays, the Z-domain activity was estimated after (1) immobilizing the E. coli and (2) forming an OM layer. E. coli with co-auto-displayed two proteins that were immobilized on a polystyrene microplate had the same antibody-binding activity as did E. coli with auto-displayed Z-domains only. The OM layer from the co-transformed E. coli had Z-domains and bovine casein expressed at a 1:2 ratio from antibody-binding activity measurements. Copyright © 2015 Elsevier B.V. All rights reserved.

Spontaneous rib fractures.

PubMed

Katrancioglu, Ozgur; Akkas, Yucel; Arslan, Sulhattin; Sahin, Ekber

2015-07-01

Other than trauma, rib fracture can occur spontaneously due to a severe cough or sneeze. In this study, patients with spontaneous rib fractures were analyzed according to age, sex, underlying pathology, treatment, and complications. Twelve patients who presented between February 2009 and February 2011 with spontaneous rib fracture were reviewed retrospectively. The patients' data were evaluated according to anamnesis, physical examination, and chest radiographs. The ages of the patients ranged from 34 to 77 years (mean 55.91 ± 12.20 years), and 7 (58.4%) were male. All patients had severe cough and chest pain. The fractures were most frequently between 4th and 9th ribs; multiple rib fractures were detected in 5 (41.7%) patients. Eight (66.7%) patients had chronic obstructive pulmonary disease, 2 (16.7%) had bronchial asthma, and 2 (16.7%) had osteoporosis. Bone densitometry revealed a high risk of bone fracture in all patients. Patients with chronic obstructive pulmonary disease or bronchial asthma had been treated with high-dose steroids for over a year. Spontaneous rib fracture due to severe cough may occur in patients with osteoporosis, chronic obstructive pulmonary disease, or bronchial asthma, receiving long-term steroid therapy. If these patients have severe chest pain, chest radiography should be performed to check for bone lesions. © The Author(s) 2015.

Pediatric data for dual X-ray absorptiometric measures of normal lumbar bone mineral density in children under 5 years of age using the lunar prodigy densitometer.

PubMed

Manousaki, D; Rauch, F; Chabot, G; Dubois, J; Fiscaletti, M; Alos, N

2016-09-07

Knowledge of physiological variations of bone mineral density (BMD) in newborns and infants is necessary to evaluate pathological changes associated with fractures. Limited reference data for children under 5 years old are available. This study provides normative data of lumbar BMD for the Lunar Prodigy in young children under 5 years old. We assessed cross-sectionally 155 healthy children (77 boys, 80% Caucasian), ranging in age from newborn to the age of 5 years. Lumbar bone mineral content (BMC) and areal BMD were measured by dual-energy X-ray absorptiometry using a Lunar Prodigy absorptiometer. Volumetric BMD was calculated using the Kroeger and Carter methods. BMC and areal BMD increased from birth to 5 years (p<0.001). Volumetric BMD did not change with age. BMD and BMC correlated with age, weight and height (R(2)≥0.85 for all), with a maximum gain between the ages of 1 and 4 years, which did not follow the same pattern as height velocity. We did not find significant sex difference for any of the three measured parameters. This study provides normative data for lumbar spine densitometry of infants and young children using the Lunar Prodigy DXA system.

Cartilage Degeneration, Subchondral Mineral and Meniscal Mineral Densities in Hartley and Strain 13 Guinea Pigs

PubMed Central

Sun, Yubo; Scannell, Brian P; Honeycutt, Patrick R; Mauerhan, David R; H, James Norton; Hanley Jr, Edward N

2015-01-01

Osteoarthritis is a joint disease involved in articular cartilage, subchondral bone, meniscus and synovial membrane. This study sought to examine cartilage degeneration, subchondral bone mineral density (BMD) and meniscal mineral density (MD) in male Hartley, female Hartley and female strain 13 guinea pigs to determine the association of cartilage degeneration with subchondral BMD and meniscal MD. Cartilage degeneration, subchondral BMD and meniscal MD in 12 months old guinea pigs were examined with histochemistry, X-ray densitometry and calcium analysis. We found that male Hartley guinea pigs had more severe cartilage degeneration, subchondral BMD and meniscal MD than female Hartley guinea pigs, but not female strain 13 guinea pigs. Female strain 13 guinea pigs had more severe cartilage degeneration and higher subchondral BMD, but not meniscal MD, than female Hartley guinea pigs. These findings indicate that higher subchondral BMD, not meniscal MD, is associated with more severe cartilage degeneration in the guinea pigs and suggest that abnormal subchondral BMD may be a therapeutic target for OA treatment. These findings also indicate that the pathogenesis of OA in the male guinea pigs and female guinea pigs are different. Female strain 13 guinea pig may be used to study female gender-specific pathogenesis of OA. PMID:26401159

Basketball Affects Bone Mineral Density Accrual in Boys More Than Swimming and Other Impact Sports: 9-mo Follow-Up.

PubMed

Agostinete, Ricardo R; Lynch, Kyle R; Gobbo, Luís A; Lima, Manoel Carlos Spiguel; Ito, Igor H; Luiz-de-Marco, Rafael; Rodrigues-Junior, Mario A; Fernandes, Romulo A

2016-01-01

The objective of this study was to analyze the effect of different sports on bone mineral density (BMD) accrual among male adolescents during a 9-mo follow-up. The sample was composed of 82 boys (control [n = 13], basketball [n = 14], karate [n = 9], soccer [n = 18], judo [n = 12], and swimming [n = 16]) who were followed up for 9 mo (from October 2013 to August 2014). BMD (gram per square centimeter) was assessed at baseline and follow-up using a dual-energy X-ray absorptiometry scanner, whereas somatic maturation was estimated through the use of the peak height velocity. Vitamin D consumption was assessed by questionnaire. After 9 mo of follow-up, all groups (including the control group) presented significant BMD accrual (overall sample: 4.5% in the whole body). On the other hand, the basketball group presented higher BMD accrual in the upper limbs (17.6%) than the control group (7.2%). A similar difference was observed in whole-body BMD (control group: 4.1% vs basketball group: 7.1%). The basketball group had significantly higher BMD gains than the control group and other sports groups. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Unilateral vs bilateral hip bone mineral density measurement for the diagnosis of osteoporosis.

PubMed

Ikegami, Shota; Kamimura, Mikio; Uchiyama, Shigeharu; Mukaiyama, Keijiro; Kato, Hiroyuki

2014-01-01

It has not been established whether unilateral or bilateral hip dual-energy X-ray absorptiometry (DXA) is preferable for the diagnosis of osteoporosis. We investigated the discordance in DXA measurements in bilateral hips to determine whether unilateral DXA is valid for osteoporosis diagnosis. The subjects were 2964 Japanese patients without a previous diagnosis of primary osteoporosis. We measured bilateral femoral bone mineral density (BMD) and calculated indices, related to the unilateral results, for predicting contralateral hip osteoporosis. A likelihood ratio (LR) of a negative test (LR [-]) of less than 0.2 was considered to exclude the diagnosis. In the normal spinal BMD group, the sensitivity of unilateral DXA for women was 27-73% and LR (-) was 0.28-0.73; the sensitivity for men was 0-50% and LR (-) was 0.51-1.00; the diagnosis of contralateral osteoporosis was not excluded. Sensitivity increased and LR (-) increased with worsening spinal BMD status; however, LR (-) did not meet the cutoff for exclusion. We could exclude unilateral hip osteoporosis, in women only, by performing contralateral femoral DXA; this necessitated lowering the T-score cutoff from -2.5 to -2.0. Unilateral femoral DXA is not useful for excluding the diagnosis of contralateral hip osteoporosis. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Quantitative tomographic measurements of opaque multiphase flows

DOE Office of Scientific and Technical Information (OSTI.GOV)

GEORGE,DARIN L.; TORCZYNSKI,JOHN R.; SHOLLENBERGER,KIM ANN

2000-03-01

An electrical-impedance tomography (EIT) system has been developed for quantitative measurements of radial phase distribution profiles in two-phase and three-phase vertical column flows. The EIT system is described along with the computer algorithm used for reconstructing phase volume fraction profiles. EIT measurements were validated by comparison with a gamma-densitometry tomography (GDT) system. The EIT system was used to accurately measure average solid volume fractions up to 0.05 in solid-liquid flows, and radial gas volume fraction profiles in gas-liquid flows with gas volume fractions up to 0.15. In both flows, average phase volume fractions and radial volume fraction profiles from GDTmore » and EIT were in good agreement. A minor modification to the formula used to relate conductivity data to phase volume fractions was found to improve agreement between the methods. GDT and EIT were then applied together to simultaneously measure the solid, liquid, and gas radial distributions within several vertical three-phase flows. For average solid volume fractions up to 0.30, the gas distribution for each gas flow rate was approximately independent of the amount of solids in the column. Measurements made with this EIT system demonstrate that EIT may be used successfully for noninvasive, quantitative measurements of dispersed multiphase flows.« less

Cone pigments in human deutan colour vision defects.

PubMed Central

Alpern, M; Wake, T

1977-01-01

1. The Nagel anomaloscope, neutral points and dichromatic matches to a spectral green light identified a population of seventy red-green dichromats. 2. The anomaloscope settings allow the calculation of the relative action spectrum of the match at the wave-length of the red (645 nm) and green (535 nm) primaries. The distribution of this ratio is bimodal; there are two clusters with a gap of about 0-75 long units between. Among the thirty-eight deuteranopes there are wide differences in anomaloscope matches; similar differences appear among the thirty-two protanopes. 3. Retinal densitometry of the foveas of fifteen of the deuteranopes is compared and contrasted with measurements on trichromats. In the former, only one photolabile pigment is found in the red-green region of the spectrum; normals always have two. The view of Rushton (1965a) that deuteranopes have erythrolabe but no measurable chlorolabe is confirmed for each member of this group. 4. Simple deuteranomalous show two red-green cone pigments. The difference spectra of extreme deuteranomalous are very similar to those found in deuteranopia. 5. Individual differnce in kinetics (photosensitivity, time constant of regeneration) and in the density and lambdamax of the difference spectrum of erythrolabe in deuteranopia are appreciable; the reasons for these differences are not clear. PMID:301185

A novel method for flow pattern identification in unstable operational conditions using gamma ray and radial basis function.

PubMed

Roshani, G H; Nazemi, E; Roshani, M M

2017-05-01

Changes of fluid properties (especially density) strongly affect the performance of radiation-based multiphase flow meter and could cause error in recognizing the flow pattern and determining void fraction. In this work, we proposed a methodology based on combination of multi-beam gamma ray attenuation and dual modality densitometry techniques using RBF neural network in order to recognize the flow regime and determine the void fraction in gas-liquid two phase flows independent of the liquid phase changes. The proposed system is consisted of one 137 Cs source, two transmission detectors and one scattering detector. The registered counts in two transmission detectors were used as the inputs of one primary Radial Basis Function (RBF) neural network for recognizing the flow regime independent of liquid phase density. Then, after flow regime identification, three RBF neural networks were utilized for determining the void fraction independent of liquid phase density. Registered count in scattering detector and first transmission detector were used as the inputs of these three RBF neural networks. Using this simple methodology, all the flow patterns were correctly recognized and the void fraction was predicted independent of liquid phase density with mean relative error (MRE) of less than 3.28%. Copyright © 2017 Elsevier Ltd. All rights reserved.

Matrix metalloproteinase and tissue inhibitor of metalloproteinase in serum and synovial fluid of osteoarthritic dogs.

PubMed

Salinardi, B J; Roush, J K; Schermerhorn, T; Mitchell, K E

2006-01-01

To better understand the mechanisms responsible for the pathological processes of osteoarthritis (OA) and to potentially identify a profile of changes that could be predictive of early OA, matrix metalloproteinase-1 (MMP-1) and tissue inhibitor of matrix metalloproteinase-2 (TIMP-2) in the synovial fluid and serum of normal and osteoarthritic dogs were examined. The concentration of MMP-1 in the synovial fluid of osteoarthritic dogs (0.62 +/- 0.16), as measured by densitometry, was significantly higher than that found in control dogs (0.42 +/- 0.19) (P = 0.03). The concentration of MMP-1 in the serum of osteoarthritic dogs (0.74 +/- 0.16) was significantly less than that found in control dogs (0.87 +/- 0.08) (P = 0.05). The concentration of TIMP-2 in the synovial fluid of osteoarthritic dogs (46.2 +/- 21.9 ng/ml) was significantly less than that of control dogs (122.0 +/- 66.5 ng/ml) (P = 0.009). The concentration of TIMP-2 in the serum of osteoarthritic dogs (116.2 +/- 43.1 ng/ml) was not significantly different than that of control dogs (95.1 +/- 94.4 ng/ml) (P = 0.554). In addition, a phospho-tyrosine immunoprecipitation and mass spectrometry were used to isolate and identify interferon-alpha in canine synovial fluid.

BIOCHEMICAL ANALYSIS AND BONE REMODELING IN RESPONSE TO OOPHORECTOMY AND AQUATIC TRAINING

PubMed Central

SOUZA, HELENA RIBEIRO; GIROL, ANA PAULA; SCHIAVETO, ADRIANA PAULA SANCHEZ; GEROMEL, MAIRTO ROBERIS; IYOMASA, MELINA MIZUSAKI; ARRUDA, MAURÍCIO FERRAZ DE

2016-01-01

ABSTRACT Objective: To investigate whether swimming could prevent bone loss and could be indicated to assist in treatment of osteoporosis. Methods: Female rats were divided into 4 groups (n=6), two of them were oophorectomized. Animals from two groups, one oophorectomized and another not oophorectomized, underwent aquatic training for eight weeks. After training, the animals were sacrificed and their blood was collected for calcium and alkaline phosphatase serum dosage; the femur was removed and subjected to radiological and histological densitometry analysis to assess bone loss and osteoclast counting on femoral head and neck. Results: Increase in serum calcium was not observed. There was an increasing activity of alkaline phosphatase in the oophorectomized groups. The radiographs suggest that there was a greater bone mass density in the trained groups. Concerning histology, the trained groups had better tissue structural organization than the sedentary groups. In the oophorectomized and sedentary group, higher presence of osteoclasts was observed a. Conclusion: Exercise and oophorectomy did not promote changes in serum calcium levels. The decrease of sex steroids caused by oophorectomy was responsible for severe bone loss, but swimming exercise was able to reduce this loss. Oophorectomy promoted the proliferation of osteoclasts and the exercise proved to be able to diminish it. Level of Evidence I, Experimental Study. PMID:28149187

Nutrition in inflammatory bowel disease

PubMed

Martínez Gómez, María Josefa; Melián Fernández, Cristóbal; Romeo Donlo, María

2016-07-12

Inflammatory bowel disease (IBD) is a chronic pathology that has an outbreaks course that in recent years have seen an increase in incidence, especially at younger ages. Malnutrition is frequently associated with this condition, therefore, it is very important to ensure a right nutritional intervention, especially in pediatric patients, to ensure an optimal growth and also an improvement in the clinic. Our goal will be updated the role of nutrition in this disease and in its treatment based on the published evidence. Malnutrition in these patients is frequent and is influenced by various factors such as, decreased food intake, increased nutrient requirements, increased protein loss and malabsorption of nutrients. Therefore there should be a nutritional monitoring of all of them, in which anthropometric measurements, laboratory tests and densitometry were made to establish the needs and sufficient caloric intake tailored to each patient. The use of enteral nutrition as a treatment in Crohn’s disease with mild to moderate outbreak in child population, is amply demonstrated, has even shown to be superior to the use of corticosteroids. Therefore we can conclude by stressing that nutritional intervention is a mainstay in the management of patients with IBD, which aims to prevent and / or control disease-related malnutrition to decrease morbidity and mortality and improve quality of life.

Uni-dimensional double development HPTLC-densitometry method for simultaneous analysis of mangiferin and lupeol content in mango (Mangifera indica) pulp and peel during storage.

PubMed

Jyotshna; Srivastava, Pooja; Killadi, Bharti; Shanker, Karuna

2015-06-01

Mango (Mangifera indica) fruit is one of the important commercial fruit crops of India. Similar to other tropical fruits it is also highly perishable in nature. During storage/ripening, changes in its physico-chemical quality parameters viz. firmness, titrable acidity, total soluble solid content (TSSC), carotenoids content, and other biochemicals are inevitable. A uni-dimensional double-development high-performance thin-layer chromatography (UDDD-HPTLC) method was developed for the real-time monitoring of mangiferin and lupeol in mango pulp and peel during storage. The quantitative determination of both compounds of different classes was achieved by densitometric HPTLC method. Silica gel 60F254 HPTLC plates and two solvent systems viz. toluene/EtOAC/MeOH and EtOAC/MeOH, respectively were used for optimum separation and selective evaluation. Densitometric quantitation of mangiferin was performed at 390nm, while lupeol at 610nm after post chromatographic derivatization. Validated method was used to real-time monitoring of mangiferin and lupeol content during storage in four Indian cultivars, e.g. Bombay green (Bgreen), Dashehari, Langra, and Chausa. Significant correlations (p<0.05) between of acidity and TSSC with mangiferin and lupeol in pulp and peel during storage were also observed. Copyright © 2014 Elsevier Ltd. All rights reserved.

Telomere content measurement in human hematopoietic cells: Comparative analysis of qPCR and Flow-FISH techniques.

PubMed

Wand, Taylor; Fang, Mike; Chen, Christina; Hardy, Nathan; McCoy, J Philip; Dumitriu, Bogdan; Young, Neal S; Biancotto, Angélique

2016-10-01

Abnormal telomere lengths have been linked to cancer and other hematologic disorders. Determination of mean telomere content (MTC) is traditionally performed by Southern blotting and densitometry, giving a mean telomere restriction fragment (TRF) value for the total cell population studied. Here, we compared a quantitative Polymerase Chain Reaction approach (qPCR) and a flow cytometric approach, fluorescence in situ hybridization (Flow-FISH), to evaluate telomere content distribution in total patient peripheral blood mononuclear cells or specific cell populations. Flow-FISH is based on in situ hybridization using a fluorescein-labeled peptide nucleic acid (PNA) (CCCTAA) 3 probe and DNA staining with propidium iodide. We showed that both qPCR and Flow-FISH provide a robust measurement, with Flow-FISH measuring a relative content longer than qPCR at a single cell approach and that TRF2 fluorescence intensity did not correlate with MTC. Both methods showed comparable telomere content reduction with age, and the rate of relative telomere loss was similar. Published 2016 Wiley Periodicals Inc. This article is a US government work and, as such, is in the public domain in the United States of America. Published 2016 Wiley Periodicals Inc. This article is a US government work and, as such, is in the public domain in the United States of America.

A comparison of peripheral imaging technologies for bone and muscle quantification: a technical review of image acquisition

PubMed Central

Wong, A.K.O.

2016-01-01

The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses. PMID:27973379

Nandrolone decanoate appears to increase bone callus formation in young adult rats after a complete femoral fracture.

PubMed

Guimarães, Ana Paula Franttini Garcia Moreno; Butezloff, Mariana Maloste; Zamarioli, Ariane; Issa, João Paulo Mardegan; Volpon, José Batista

2017-11-01

To evaluate the influence of nandrolone decanoate on fracture healing and bone quality in normal rats. Male rats were assigned to four groups (n=28/group): Control group consisting of animals without any intervention, Nandrolone decanoate (DN) group consisting of animals that received intramuscular injection of nandrolone decanoate, Fracture group consisting of animals with a fracture at the mid-diaphysis of the femur, and Fracture and nandrolone decanoate group consisting of animals with a femur fracture and treatment with nandrolone decanoate. Fractures were created at the mid-diaphysis of the right femur by a blunt trauma and internally fixed using an intramedullary steel wire. The DN was injected intramuscularly twice per week (10 mg/kg of body mass). The femurs were measured and evaluated by densitometry and mechanical resistance after animal euthanasia. The newly formed bone and collagen type I levels were quantified in the callus. The treated animals had longer femurs after 28 days. The quality of the intact bone was not significantly different between groups. The bone callus did show a larger mass in the treated rats. The administration of nandrolone decanoate did not affect the quality of the intact bone, but might have enhanced the bone callus formation.

Automated brain computed tomographic densitometry of early ischemic changes in acute stroke

PubMed Central

Stoel, Berend C.; Marquering, Henk A.; Staring, Marius; Beenen, Ludo F.; Slump, Cornelis H.; Roos, Yvo B.; Majoie, Charles B.

2015-01-01

Abstract. The Alberta Stroke Program Early CT score (ASPECTS) scoring method is frequently used for quantifying early ischemic changes (EICs) in patients with acute ischemic stroke in clinical studies. Varying interobserver agreement has been reported, however, with limited agreement. Therefore, our goal was to develop and evaluate an automated brain densitometric method. It divides CT scans of the brain into ASPECTS regions using atlas-based segmentation. EICs are quantified by comparing the brain density between contralateral sides. This method was optimized and validated using CT data from 10 and 63 patients, respectively. The automated method was validated against manual ASPECTS, stroke severity at baseline and clinical outcome after 7 to 10 days (NIH Stroke Scale, NIHSS) and 3 months (modified Rankin Scale). Manual and automated ASPECTS showed similar and statistically significant correlations with baseline NIHSS (R=−0.399 and −0.277, respectively) and with follow-up mRS (R=−0.256 and −0.272), except for the follow-up NIHSS. Agreement between automated and consensus ASPECTS reading was similar to the interobserver agreement of manual ASPECTS (differences <1 point in 73% of cases). The automated ASPECTS method could, therefore, be used as a supplementary tool to assist manual scoring. PMID:26158082

A comparison of peripheral imaging technologies for bone and muscle quantification: a technical review of image acquisition.

PubMed

Wong, A K

2016-12-14

The choice of an appropriate imaging technique to quantify bone, muscle, or muscle adiposity needs to be guided by a thorough understanding of its competitive advantages over other modalities balanced by its limitations. This review details the technical machinery and methods behind peripheral quantitative computed tomography (pQCT), high-resolution (HR)-pQCT, and magnetic resonance imaging (MRI) that drive successful depiction of bone and muscle morphometry, densitometry, and structure. It discusses a number of image acquisition settings, the challenges associated with using one versus another, and compares the risk-benefits across the different modalities. Issues related to all modalities including partial volume artifact, beam hardening, calibration, and motion assessment are also detailed. The review further provides data and images to illustrate differences between methods to better guide the reader in selecting an imaging method strategically. Overall, investigators should be cautious of the impact of imaging parameters on image signal or contrast-to-noise-ratios, and the need to report these settings in future publications. The effect of motion should be assessed on images and a decision made to exclude prior to segmentation. A more standardized approach to imaging bone and muscle on pQCT and MRI could enhance comparability across studies and could improve the quality of meta-analyses.

Profiling and quantification of grain anthocyanins in purple pericarp × blue aleurone wheat crosses by high-performance thin-layer chromatography and densitometry.

PubMed

Böhmdorfer, Stefan; Oberlerchner, Josua Timotheus; Fuchs, Christina; Rosenau, Thomas; Grausgruber, Heinrich

2018-01-01

Anthocyanins are abundant secondary metabolites responsible for most blue to blue-black, and red to purple colors of various plant organs. In wheat grains, anthocyanins are accumulated in the pericarp and/or aleurone layer. Anthocyanin pigmented wheat grains can be processed into functional foods with potential health benefits due to the antioxidant properties of the anthocyanins. The grain anthocyanin content can be increased by pyramidizing the different genes responsible for the accumulation of anthocyanins in the different grain layers. Our objective was to develop a high-performance thin-layer chromatography (HPTLC) method that allows the determination of both the anthocyanin profile and the total pigment concentration. Thereby, selection of breeding lines with significantly higher grain anthocyanin content from purple pericarp × blue aleurone wheat crosses should become more efficient than selection based on only visual scoring of grain color and the unspecific determination of anthocyanin concentration by UV/Vis spectroscopy. A wide variability in the grain anthocyanin content was observed in breeding lines and check varieties. The highest concentration of anthocyanins was observed in deep purple (i.e. combination of the purple pericarp and blue aleurone genetics) grained breeding lines, followed by blue aleurone and purple pericarp genotypes. Determination of the total anthocyanin content was included into the chromatographic analysis, rendering an additional photometric analysis unnecessary. Ten target zones were identified in anthocyanin pigmented wheat grains; four of these zones were typically for blue aleurone types, five for purple pericarp types, and one (i.e. kuromanin glucoside) was characteristic for both. Chemometrics applied to the anthocyanin profile recorded by scanning densitometry revealed that peak heights and peak areas are highly correlated and that seven out of the ten target zones were responsible for about 90% of the total variation in the germplasm. Multivariate analysis of these seven target zones allowed not only a separation of the genetic material into purple, blue and deep purple grained genotypes, but also the identification of genotypes with a specific anthocyanin pattern. Thereby, the original classification by visual scoring was overruled in about one-third of the breeding lines. The presented HPTLC method with à côté calibration allowed the profiling of the pigments and quantification of wheat grain anthocyanin content in a single analysis, replacing UV/Vis spectroscopy with subsequent HPLC analysis. Moreover, no sample preparation apart from extraction and filtration is required, and more than 15 samples can be evaluated in one analysis run, corresponding to several dozens of samples per day. Hence, the method fulfills the requirements for screening methods in early generations of a plant breeding program such as high-throughput, small sample size, high repeatability, fast determination, and reasonable costs per sample. Combined with multivariate statistical analysis, the anthocyanin pattern allowed the validation of the genetic background in the offspring of purple × blue wheat crosses and, therefore, the efficient selection of genotypes exhibiting both the cyanidin and delphinidin aglycon.

[Effect of donor graft characteristics on clinical outcomes in Descemet stripping automated endothelial keratoplasty (DSAEK)].

PubMed

Ho Wang Yin, G; Sampo, M; Soare, S; Hoffart, L

2017-01-01

The purpose of our study was to evaluate the progression of lamellar corneal grafts after endothelial keratoplasty by Descemet stripping automated endothelial keratoplasty (DSAEK) and the effect of their characteristics on the clinical and functional results. This was a prospective study in which 74 patients who had undergone endothelial keratoplasty by DSAEK were included. The corneal grafts were obtained from a French tissue bank and were delivered in a preservation medium containing a deturgescent agent (Corneajet ® or Stemalpha 3 ® ). Pachymetry of the corneal graft was measured ex vivo by ultrasonic pachymetry prior to dissection, then after the 1st or 2 nd cut as necessary. Corrected visual acuity in logMAR, total graft pachymetry, measured by anterior segment OCT (Spectralis ® HRA+SDOCT, Heidelberg engineering, Inc., Heidelberg, Germany) and corneal density (Pentacam ® , Oculus, Inc., Wetzlar, Germany) were obtained for each patient preoperatively, at D5, M1, M3, M6, M9 and M12. Overall, 74 corneal grafts, from donors of mean age 69.7±13.3 years (37 to 92 years) were transplanted into 67 patients aged 70.3±12.1 years. Predissection pachymetry was statistically significantly thicker in the case of short deturgescence time (r=-0.383, P=0.001). For the same deturgescence time, predissection pachymetry was statistically significantly thicker in the Stemalpha 3 ® medium (691±89μm for Corneajet ® vs. 760±100μm for Stemalpha 3 ® , P=0.01), with the same final pachymetry (168±31μm vs. 166±25μm, P=0.833). Graft pachymetry and total corneal pachymetry decreased significantly between the preoperative measurement and M12 (168±29μm vs. 92±57μm, P=0.0008 et 665±124μm vs. 566±73μm, P=0.027 respectively). Preoperative endothelial cell density (2938±418 cells/mm 2 ) did not correlate with postoperative visual acuity. There was a positive correlation between visual acuity at D5 and donor age (r=0.3, P=0.04). Postoperative visual acuity correlated positively with preoperative visual acuity (P<0.05). Corneal densitometry was statically higher than normal postoperative densitometry. Corneal density at M1 correlated positively with time since obtaining the donor tissue (r=0.373, P=0.043). There was no significant difference between the sub-groups of over or under 130μm. Seven patients experienced graft failure with no statistically significant graft risk factor. The preservation medium affects predissection pachymetry with no consequence on clinical results. In our study, preoperative visual acuity and donor age were correlated with visual acuity after DSAEK. Although donor age was associated with better visual acuity at D5, the other donor characteristics had no effect on clinical results. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Validation of gamma-ray detection techniques for safeguards monitoring at natural uranium conversion facilities

NASA Astrophysics Data System (ADS)

Dewji, S. A.; Lee, D. L.; Croft, S.; Hertel, N. E.; Chapman, J. A.; McElroy, R. D.; Cleveland, S.

2016-07-01

Recent IAEA circulars and policy papers have sought to implement safeguards when any purified aqueous uranium solution or uranium oxides suitable for isotopic enrichment or fuel fabrication exists. Under the revised policy, IAEA Policy Paper 18, the starting point for nuclear material under safeguards was reinterpreted, suggesting that purified uranium compounds should be subject to safeguards procedures no later than the first point in the conversion process. In response to this technical need, a combination of simulation models and experimental measurements were employed to develop and validate concepts of nondestructive assay monitoring systems in a natural uranium conversion plant (NUCP). In particular, uranyl nitrate (UO2(NO3)2) solution exiting solvent extraction was identified as a key measurement point (KMP), where gamma-ray spectroscopy was selected as the process monitoring tool. The Uranyl Nitrate Calibration Loop Equipment (UNCLE) facility at Oak Ridge National Laboratory was employed to simulate the full-scale operating conditions of a purified uranium-bearing aqueous stream exiting the solvent extraction process in an NUCP. Nondestructive assay techniques using gamma-ray spectroscopy were evaluated to determine their viability as a technical means for drawing safeguards conclusions at NUCPs, and if the IAEA detection requirements of 1 significant quantity (SQ) can be met in a timely way. This work investigated gamma-ray signatures of uranyl nitrate circulating in the UNCLE facility and evaluated various gamma-ray detector sensitivities to uranyl nitrate. These detector validation activities include assessing detector responses to the uranyl nitrate gamma-ray signatures for spectrometers based on sodium iodide, lanthanum bromide, and high-purity germanium detectors. The results of measurements under static and dynamic operating conditions at concentrations ranging from 10-90 g U/L of natural uranyl nitrate are presented. A range of gamma-ray lines is examined, including attenuation for transmission measurement of density and concentration. It was determined that transmission-corrected gamma-ray spectra provide a reliable way to monitor the 235U concentration of uranyl nitrate solution in transfer pipes in NUCPs. Furthermore, existing predictive and analysis methods are adequate to design and realize practical designs. The 137Cs transmission source employed in this work is viable but not optimal for 235U densitometry determination. Validated simulations assessed the viability of 133Ba and 57Co as alternative densitometry sources. All three gamma-ray detectors are viable for monitoring natural uranium feed; although high-purity germanium is easiest to interpret, it is, however, the least attractive as an installation instrument. Overall, for monitoring throughput in a facility such as UNCLE, emulating the uranium concentration and pump speeds of the Springfields conversion facility in the United Kingdom, an uncertainty of less than 0.17% is required in order to detect the diversion of 1 SQ of uranyl nitrate through changes in uranium concentration over an accountancy period of one year with a detection probability of 50%. Although calibrated gamma-ray detection systems are capable of determining the concentration of uranium content in NUCPs, it is only in combination with verifiable operator declarations and supporting data, such as flow rate and enrichment, that safeguards conclusions can be drawn.

Monocyte chemotactic protein-3: possible involvement in apical periodontitis chemotaxis.

PubMed

Dezerega, A; Osorio, C; Mardones, J; Mundi, V; Dutzan, N; Franco, M; Gamonal, J; Oyarzún, A; Overall, C M; Hernández, M

2010-10-01

To study the expression of monocyte chemotactic protein-3 (MCP-3, also known as chemokine CCL-7) in tissue from apical lesions (AL) and to associate MCP-3 expression with symptomatic or asymptomatic apical periodontitis. To determine the expression of MCP-3 in AL, biopsies obtained during tooth extraction procedures were fixed, subjected to routine processing and diagnosed as apical granuloma (AG) (n = 7) or radicular cyst (RC) (n = 5). As controls, apical periodontal ligament (PDL) specimens from healthy premolars extracted for orthodontics reasons were included (n = 7). All specimens were immunostained for MCP-3 and examined under a light microscope. In addition, homogenates from AL (n = 14) and healthy PDL samples (n = 7) were studied through immunowestern blot. Finally, periapical exudates samples were collected from root canals of teeth having diagnosis of symptomatic (n = 14) and asymptomatic apical periodontitis (n = 14) during routine endodontic treatments and analysed by immunowestern blot and densitometry.   MCP-3 was detected in AG and RC and localized mainly to inflammatory leucocytes, whereas no expression was observed in healthy PDLs. MCP-3 was also detected in periapical exudate, and its levels were significantly higher in symptomatic than in asymptomatic apical periodontitis. MCP-3 was expressed in AL and its levels associated with clinical symptoms. MCP-3 might play a role in disease pathogenesis, possibly by stimulating mononuclear chemotaxis. © 2010 International Endodontic Journal.

Influence of growth rate on nitrogen balance in adolescent sprint athletes.

PubMed

Aerenhouts, Dirk; Van Cauwenberg, Jelle; Poortmans, Jacques Remi; Hauspie, Ronald; Clarys, Peter

2013-08-01

This study aimed to estimate nitrogen balance and protein requirements in adolescent sprint athletes as a function of growth rate and physical development. Sixty adolescent sprint athletes were followed up biannually over a 2-yr period. Individual growth curves and age at peak height velocity were determined. Skeletal muscle mass (SMM) was estimated based on anthropometric measurements and fat mass was estimated by underwater densitometry. Seven-day diet and physical activity diaries were completed to estimate energy balance and protein intake. Nitrogen analysis of 24-hr urine samples collected on 1 weekday and 1 weekend day allowed calculation of nitrogen balance. Body height, weight, and SMM increased throughout the study period in both genders. Mean protein intakes were between 1.4 and 1.6 g kg-1 day-1 in both genders. A protein intake of 1.46 g kg-1 day-1 in girls and 1.35 g kg-1 day-1 in boys was needed to yield a positive nitrogen balance. This did not differ between participants during and after their growth spurt. None of the growth parameters was significantly related to nitrogen balance. It can be concluded that a mean protein intake around 1.5 g kg-1 day-1 was sufficient to stay in a positive nitrogen balance, even during periods of peak growth. Therefore, protein intake should not be enhanced in peak periods of linear or muscular growth.

Topographical investigation of changes in depth-wise proteoglycan distribution in rabbit femoral articular cartilage at 4 weeks after transection of the anterior cruciate ligament.

PubMed

Arokoski, Mikko E A; Tiitu, Virpi; Jurvelin, Jukka S; Korhonen, Rami K; Fick, James M

2015-09-01

In this study, we explore topographical changes in proteoglycan distribution from femoral condylar cartilage in early osteoarthritis, acquired from both the lateral and medial condyles of anterior cruciate ligament transected (ACLT) and contralateral (CNTRL) rabbit knee joints, at 4 weeks post operation. Four sites across the cartilage surface in a parasagittal plane were defined across tissue sections taken from femoral condyles, and proteoglycan (PG) content was quantified using digital densitometry. The greatest depth-wise change in PG content due to an ACLT (compared to the CNTRL group) was observed anteriorly (site C) from the most weight-bearing location within the lateral compartment. In the medial compartment, the greatest change was observed in the most weight-bearing location (site B). The depth-wise changes in PG content were observed up to 48% and 28% depth from the tissue surface at these aforementioned sites, respectively (p < 0.05). The smallest depth-wise change in PG content was observed posteriorly (site A) from the most weight-bearing location within both femoral condyles (up to 20% and up to 5% depth from the tissue surface at lateral and medial compartments, respectively). This study gives further insight into how early cartilage deterioration progresses across the parasagittal plane of the femoral condyle. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Density of the crystalline lens in obese and nonobese children.

PubMed

Acer, Semra; Ağladıoğlu, Sebahat Yılmaz; Pekel, Gökhan; Özhan, Bayram; Çetin, Ebru Nevin; Yağcı, Ramazan; Yıldırım, Cem

2016-02-01

To compare crystalline lens density in obese and nonobese children. A total of 40 obese (25 females) and 46 age-sex matched controls (26 females) were included in this prospective study. Children with ocular diseases (except for mild refractive errors), ocular trauma, or surgery and any systemic disorders, including diabetes, were excluded. Lens densitometry (LD), central corneal thickness (CCT), anterior chamber depth (ACD) and corneal volume (CV) were measured by Pentacam HR. Mean participant age was 12.0 ± 1.9 (range, 7.2-18 years) in the obese group and 11.7 ± 2.0 (range, 7.5-16.1 years) in the control group. The BMI was 29.9 ± 4.5 in the obese group and 18.7 ± 2.5 in the control group (P ≤ 0.05). The vertical, horizontal, and areal lens density measurements were higher in obese group than in controls (P ≤ 0.05). There was a positive correlation between BMI and vertical, horizontal, and areal lens density measurements. The difference in CCT, ACD, and CV was not statistically significant between groups (P ≥ 0.05). There is increased lens density in the obese children compared with controls. Pentacam HR may provide objective data about lens density in children. Copyright © 2016 American Association for Pediatric Ophthalmology and Strabismus. Published by Elsevier Inc. All rights reserved.

Relationship Between BMD and Prevalent Vertebral Fractures in Indian Women Older Than 50 Yr.

PubMed

Gupta, Yashdeep; Marwaha, Raman K; Kukreja, Subhash; Bhadra, Kuntal; Narang, Archana; Mani, Kalaivani; Mithal, Ambrish; Tandon, Nikhil

2016-01-01

The purpose of the study was to study the relationship of morphometric vertebral fractures with bone mineral density (BMD) in Indian women older than 50 yr. Four hundred fifteen healthy Indian women older than 50 yr (mean age: 62.8 yr) underwent lateral X-rays of the lumbar and thoracic spine. Genant's semiquantitative method was used to diagnose and classify morphometric vertebral fractures. BMD was measured by DXA at lumbar spine and total hip. Recruited subjects underwent anthropometric, biochemical, and hormonal evaluation. Vertebral fractures were present in 17.1% (95% confidence interval: 13.5, 20.8) subjects. Prevalence of osteoporosis based on BMD was 35.7%. By adding those with prevalent fractures, the number of women requiring therapy for osteoporosis would increase to 46.5%. The BMD measured at femur neck, total hip, and lumbar spine (L1eL4) was not found to be lower in women with vertebral fractures as compared with those without fractures. BMD was not found to be lower in women with vertebral fractures as compared with those without fractures. Significant number of additional subjects with BMD in the normal or osteopenic range become eligible for osteoporosis treatment when presence of vertebral fracture is used as an independent indication for such treatment. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Stress degradation studies and development of stability-indicating TLC-densitometry method for determination of prednisolone acetate and chloramphenicol in their individual and combined pharmaceutical formulations

PubMed Central

2012-01-01

A rapid and reproducible stability indicating TLC method was developed for the determination of prednisolone acetate and chloramphenicol in presence of their degraded products. Uniform degradation conditions were maintained by refluxing sixteen reaction mixtures for two hours at 80°C using parallel synthesizer including acidic, alkaline and neutral hydrolysis, oxidation and wet heating degradation. Oxidation at room temperature, photochemical and dry heating degradation studies were also carried out. Separation was done on TLC glass plates, pre-coated with silica gel 60F-254 using chloroform: methanol (14:1 v/v). Spots at Rf 0.21 ± 0.02 and Rf 0.41 ± 0.03 were recognized as chloramphenicol and prednisolone acetate, respectively. Quantitative analysis was done through densitometric measurements at multiwavelength (243 nm, λmax of prednisolone acetate and 278 nm, λmax of chloramphenicol), simultaneously. The developed method was optimized and validated as per ICH guidelines. Method was found linear over the concentration range of 200-6000 ng/spot with the correlation coefficient (r2 ± S.D.) of 0.9976 ± 3.5 and 0.9920 ± 2.5 for prednisolone acetate and chloramphenicol, respectively. The developed TLC method can be applied for routine analysis of prednisolone acetate and chloramphenicol in presence of their degraded products in their individual and combined pharmaceutical formulations. PMID:22264235

Determination of body composition using air displacement plethysmography, anthropometry and bio-electrical impedance in rural elderly Mexican men and women.

PubMed

Aleman-Mateo, H; Esparza Romero, J; Macias Morales, N; Salazar, G; Wyatt, J; Valencia, M E

2004-01-01

Air displacement plethysmography with the BOD-POD is a new densitometry technique, and has been found to be an accurate method to measure body composition. The aim of this study was to assess body composition in a group of free living healthy subjects 60 years of age or older from a rural area of Northwest Mexico, and to evaluate body composition by anthropometry and bioelectrical impedance (BIA) using equations reported for other elderly populations. Body composition was evaluated in 21 women and 26 men with the BOD-POD, by anthropometry, and BIA and compared to different equations using the Bland- Altman procedure. Body fat in elderly women and men was 42.7 and 30.2 % respectively. In women, Segal's equation using BIA 1, based on standing height, showed no significant differences with the BOD-POD. There was satisfactory agreement between Segal's equation and BOD-POD. In men similar results was found with Deurenberg's equation using B1A 2 based on recumbent length. Segal's and Deurenberg's equations were accurate and precise for the estimation of body fat in the elderly of this study. The use of these equations could improve the estimation of body composition for similar elderly subjects. Further studies are recommended with a larger size samples to include elderly subjects from other Latin American countries.

The value of hypercalciuria in patients with osteopenia versus osteoporosis.

PubMed

Girón-Prieto, María Sierra; Del Carmen Cano-García, María; Poyatos-Andújar, Antonio; Arias-Santiago, Salvador; de Haro-Muñoz, Tomás; Arrabal-Martín, Miguel; Arrabal-Polo, Miguel Ángel

2017-06-01

The aim of this study was to analyze the presence of lithogenic metabolic factors in the blood and urine of patients with osteopenia versus osteoporosis. This is a cross-sectional study including 67 patients who were divided into two groups according to the presence of either osteopenia or osteoporosis as measured by bone densitometry: group 1-40 patients with osteopenia (22 men and 18 women) and group 2-27 patients with osteoporosis (13 men and 14 women). Metabolic studies were performed on the blood and urine; statistical analysis was performed comparing means and conducting linear correlation and multivariate analyses with SPSS. Statistical significance was considered to be p ≤ 0.05. The mean age of patients in group 1 was 52.9 ± 12.8 years versus 50.3 ± 11.4 in group 2; the difference was not statistically significant. In group 2, higher levels of osteocalcin, β-crosslaps, urinary calcium, fasting urine calcium/creatinine, 24 h urine calcium/creatinine and 24 h oxaluria were observed compared to group 1. In the multivariate analysis, only the β-crosslaps and urinary calcium were independently associated with osteoporosis. It would be advisable to determine the urinary calcium levels in patients with osteoporosis since altered levels may necessitate modifying the diagnostic and therapeutic approach to osteoporosis.

Beyond BMI: Conceptual Issues Related to Overweight and Obese Patients

PubMed Central

Müller, Manfred James; Braun, Wiebke; Enderle, Janna; Bosy-Westphal, Anja

2016-01-01

BMI is widely used as a measure of weight status and disease risks; it defines overweight and obesity based on statistical criteria. BMI is a score; neither is it biologically sound nor does it reflect a suitable phenotype worthwhile to study. Because of its limited value, BMI cannot provide profound insight into obesity biology and its co-morbidity. Alternative assessments of weight status include detailed phenotyping by body composition analysis (BCA). However, predicting disease risks, fat mass, and fat-free mass as assessed by validated techniques (i.e., densitometry, dual energy X ray absorptiometry, and bioelectrical impedance analysis) does not exceed the value of BMI. Going beyond BMI and descriptive BCA, the concept of functional body composition (FBC) integrates body components into regulatory systems. FBC refers to the masses of body components, organs, and tissues as well as to their inter-relationships within the context of endocrine, metabolic and immune functions. FBC can be used to define specific phenotypes of obesity, e.g. the sarcopenic-obese patient. Well-characterized obesity phenotypes are a precondition for targeted research (e.g., on the genomics of obesity) and patient-centered care (e.g., adequate treatment of individual obese phenotypes such as the sarcopenic-obese patient). FBC contributes to a future definition of overweight and obesity based on physiological criteria rather than on body weight alone. PMID:27286962

Immunohistochemical distribution of early pregnancy factor in ovary, oviduct and placenta of pregnant gilts.

PubMed

Grosso, M C; Bellingeri, R V; Motta, C E; Alustiza, F E; Picco, N Y; Vivas, A B

2015-01-01

Early pregnancy factor (EPF) is an immunosuppressant that promotes maternal immune system tolerance of the allogenic fetus. Little is known about localization of this factor in different tissues and nothing has been reported about localization in swine reproductive and placental tissues. We determined the concentration of EPF in serum of gilts and porcine placenta conditioned medium (PPCM). We also analyzed the expression of EPF in different reproductive tissues of pregnant gilts at 10, 30, 60 and 90 days of pregnancy. EPF concentration in serum and PPCM was determined by western blot and densitometry. EPF expression in reproductive tissue was assessed by immunohistochemistry. The highest concentration of EPF was observed at 30 days in serum and PPCM; the concentration was higher in PPCM than in serum at the stages we evaluated. All reproductive tissues from the gestational stages analyzed showed specific labeling of EPF, but this labeling did not appear in non-pregnant gilts. At 30 days pregnancy, the EPF expression in the ovary was predominantly in follicular lutein cells, probably owing to its function as a luteotrophic factor. In the oviduct, EPF was expressed in unciliated secretory epithelial cells and in the cilia of ciliated cells. In the placenta, EPF was expressed in the fetal portion (mesoderm chorioallantois and epithelium of endoderm). EPF acts as an autocrine and paracrine growth factor for the trophoblast during the peri-implantation period.

Lecithin-cholesterol acyltransferase in brain: Does oxidative stress influence the 24-hydroxycholesterol esterification?

PubMed

La Marca, Valeria; Maresca, Bernardetta; Spagnuolo, Maria Stefania; Cigliano, Luisa; Dal Piaz, Fabrizio; Di Iorio, Giuseppe; Abrescia, Paolo

2016-04-01

24-Hydroxycholesterol (24OH-C) is esterified by the enzyme lecithin-cholesterol acyltransferase (LCAT) in the cerebrospinal fluid (CSF). We report here that the level of 24OH-C esters was lower in CSF of patients with amyotrophic lateral sclerosis than in healthy subjects (54% vs 68% of total 24OH-C, p=0.0005; n=8). Similarly, the level of 24OH-C esters in plasma was lower in patients than in controls (62% vs 77% of total 24OH-C; p=0.0076). The enzyme amount in CSF, as measured by densitometry of the protein band revealed by immunoblotting, was about 4-fold higher in patients than in controls (p=0.0085). As differences in the concentration of the LCAT stimulator Apolipoprotein E were not found, we hypothesized that the reduced 24OH-C esterification in CSF of patients might depend on oxidative stress. We actually found that oxidative stress reduced LCAT activity in vitro, and 24OH-C effectively stimulated the enzyme secretion from astrocytoma cells in culture. Enhanced LCAT secretion from astrocytes might represent an adaptive response to the increase of non-esterified 24OH-C percentage, aimed to avoid the accumulation of this neurotoxic compound. The low degree of 24OH-C esterification in CSF or plasma might reflect reduced activity of LCAT during neurodegeneration. Copyright © 2015 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

The effect of Amifostine prophylaxis on bone densitometry, biomechanical strength and union in mandibular pathologic fracture repair.

PubMed

Tchanque-Fossuo, Catherine N; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S; Weiss, Daniela M; Buchman, Steven R

2013-11-01

Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine's effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. © 2013.

Amifostine Prophylaxis on Bone Densitometry, Biomechanical Strength and Union in Mandibular Pathologic Fracture Repair

PubMed Central

Tchanque-Fossuo, Catherine N.; Donneys, Alexis; Sarhaddi, Deniz; Poushanchi, Behdod; Deshpande, Sagar S.; Weiss, Daniela M.

2013-01-01

Background Pathologic fractures (Fx) of the mandibles are severely debilitating consequences of radiation (XRT) in the treatment of craniofacial malignancy. We have previously demonstrated Amifostine’s effect (AMF) in the remediation of radiation-induced cellular damage. We posit that AMF prophylaxis will preserve bone strength and drastically reverse radiotherapy-induced non-union in a murine mandibular model of pathologic fracture repair. Materials and Methods Twenty-nine rats were randomized into 3 groups: Fx, XRT/Fx, and AMF/XRT/Fx. A fractionated human equivalent dose of radiation was delivered to the left hemimandibles of XRT/Fx and AMF/XRT/Fx. AMF/XRT/Fx was pre-treated with AMF. All groups underwent left mandibular osteotomy with external fixation and setting of a 2.1mm fracture gap post-operatively. Utilizing micro-computed tomography and biomechanical testing, the healed fracture was evaluated for strength. Results All radiomorphometrics and biomechanical properties were significantly diminished in XRT/Fx compared to both Fx and AMF/XRT/Fx. No difference was demonstrated between Fx and AMF/XRT/Fx in both outcomes. Conclusion Our investigation establishes the significant and substantial capability of AMF prophylaxis to preserve and enhance bone union, quality and strength in the setting of human equivalent radiotherapy. Such novel discoveries establish the true potential to utilize pharmacotherapy to prevent and improve the treatment outcomes of radiation-induced late pathologic fractures. PMID:23860272

Levodopa in Mucuna pruriens and its degradation

NASA Astrophysics Data System (ADS)

Pulikkalpura, Haridas; Kurup, Rajani; Mathew, Paravanparampil Jacob; Baby, Sabulal

2015-06-01

Mucuna pruriens is the best known natural source of L-dopa, the gold standard for treatment of Parkinsonism. M. pruriens varieties are protein rich supplements, and are used as food and fodder worldwide. Here, we report L-dopa contents in seeds of fifty six accessions of four M. pruriens varieties, M. pruriens var. pruriens, M. pruriens var. hirsuta, M. pruriens var. utilis and M. pruriens var. thekkadiensis, quantified by HPTLC-densitometry. L-dopa contents varied between 0.58 to 6.42 (%, dr. wt.). High and low L-dopa yielding genotypes/chemotypes of M. pruriens could be multiplied for medicinal and nutritional purposes, respectively. HPTLC profiles of M. pruriens seeds on repeated extraction (24 h) in 1:1 formic acid-alcohol followed by development in butanol:acetic acid:water (4:1:1, v/v) showed consistent degradation of L-dopa (Rf 0.34 ± 0.02) into a second peak (Rf 0.41 ± 0.02). An average of 52.11% degradation of L-dopa was found in seeds of M. pruriens varieties. Since M. pruriens seeds and/or L-dopa are used for treatment of Parkinson’s disease and as an aphrodisiac both in modern and/or traditional systems of medicine, the finding of high level of L-dopa degradation (in pure form and in M. pruriens extracts) into damaging quinones and ROS is very significant.

Levodopa in Mucuna pruriens and its degradation.

PubMed

Pulikkalpura, Haridas; Kurup, Rajani; Mathew, Paravanparampil Jacob; Baby, Sabulal

2015-06-09

Mucuna pruriens is the best known natural source of L-dopa, the gold standard for treatment of Parkinsonism. M. pruriens varieties are protein rich supplements, and are used as food and fodder worldwide. Here, we report L-dopa contents in seeds of fifty six accessions of four M. pruriens varieties, M. pruriens var. pruriens, M. pruriens var. hirsuta, M. pruriens var. utilis and M. pruriens var. thekkadiensis, quantified by HPTLC-densitometry. L-dopa contents varied between 0.58 to 6.42 (%, dr. wt.). High and low L-dopa yielding genotypes/chemotypes of M. pruriens could be multiplied for medicinal and nutritional purposes, respectively. HPTLC profiles of M. pruriens seeds on repeated extraction (24 h) in 1:1 formic acid-alcohol followed by development in butanol:acetic acid:water (4:1:1, v/v) showed consistent degradation of L-dopa (Rf 0.34 ± 0.02) into a second peak (Rf 0.41 ± 0.02). An average of 52.11% degradation of L-dopa was found in seeds of M. pruriens varieties. Since M. pruriens seeds and/or L-dopa are used for treatment of Parkinson's disease and as an aphrodisiac both in modern and/or traditional systems of medicine, the finding of high level of L-dopa degradation (in pure form and in M. pruriens extracts) into damaging quinones and ROS is very significant.

Levodopa in Mucuna pruriens and its degradation

PubMed Central

Pulikkalpura, Haridas; Kurup, Rajani; Mathew, Paravanparampil Jacob; Baby, Sabulal

2015-01-01

Mucuna pruriens is the best known natural source of L-dopa, the gold standard for treatment of Parkinsonism. M. pruriens varieties are protein rich supplements, and are used as food and fodder worldwide. Here, we report L-dopa contents in seeds of fifty six accessions of four M. pruriens varieties, M. pruriens var. pruriens, M. pruriens var. hirsuta, M. pruriens var. utilis and M. pruriens var. thekkadiensis, quantified by HPTLC-densitometry. L-dopa contents varied between 0.58 to 6.42 (%, dr. wt.). High and low L-dopa yielding genotypes/chemotypes of M. pruriens could be multiplied for medicinal and nutritional purposes, respectively. HPTLC profiles of M. pruriens seeds on repeated extraction (24 h) in 1:1 formic acid-alcohol followed by development in butanol:acetic acid:water (4:1:1, v/v) showed consistent degradation of L-dopa (Rf 0.34 ± 0.02) into a second peak (Rf 0.41 ± 0.02). An average of 52.11% degradation of L-dopa was found in seeds of M. pruriens varieties. Since M. pruriens seeds and/or L-dopa are used for treatment of Parkinson’s disease and as an aphrodisiac both in modern and/or traditional systems of medicine, the finding of high level of L-dopa degradation (in pure form and in M. pruriens extracts) into damaging quinones and ROS is very significant. PMID:26058043

Age- and Sex-Dependent Values of the Distribution of Body Composition Parameters Among Chinese Children Using the Hattori Chart.

PubMed

Guo, Bin; Hu, Li; Wu, Qiulian; Gong, Jian; Xu, Hao

This study aimed to examine the relationship between the fat-free mass (FFM) and fat mass (FM) and between the fat-free mass index (FFMI) and fat mass index (FMI) in Chinese children using the Hattori chart and to compare the changing pattern with Korean counterparts. In this study, 1541 (764 girls) children and adolescents aged 5-19 yr were recruited from southern China. The subjects' body composition was measured using dual-energy X-ray absorptiometry. The relationship between FFM and FM and between FFMI and FMI were delineated using the Hattori chart. Between 5 and 12 yr, a concurrent increase in FFM and FM and in FFMI and FMI was found in both sexes. After 12 yr, the age-related changing patterns are generally characterized by a sharp increase in FM, with a relatively small increase in FFM for girls, and a sharp increase in FFM, with a relatively little fluctuation in FM for boys. The increase in weight and BMI with age for this stage is largely due to the increase in FFM and FFMI in boys and in both the FFM and FM and FFMI and FMI components in girls. Sex differences in the patterns of body composition were found in Chinese children and adolescents. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Up-regulation of peroxidase proliferator-activated receptor gamma in cholesteatoma.

PubMed

Hwang, Soon Jae; Kang, Hee Joon; Song, Jae-Jun; Kang, Jae Seong; Woo, Jeong Soo; Chae, Sung Won; Lee, Heung-Man

2006-01-01

To evaluate the localization and expression of peroxidase proliferator-activated receptor (PPAR)gamma in cholesteatoma epithelium. Experimental study. Reverse-transcription polymerase chain reaction was performed on cholesteatoma tissues from 10 adult patients undergoing tympanomastoid surgery for middle ear cholesteatoma and on 10 samples of normal external auditory canal skin tissue. The expression levels of PPARgamma to glyceraldehyde-3-phosphate dehydrogenase transcripts were semiquantified by densitometry. We also characterized the cellular localization of the PPARgamma protein immunohistochemically. Ki-67 was also localized to compare the proliferative activity of cells in cholesteatoma epithelium and in normal external auditory canal skin. PPARgamma mRNA and protein were detected in normal external auditory canal skin and in cholesteatoma epithelium. The expression level of PPARgamma mRNA in cholesteatoma was significantly increased compared with that in normal external auditory canal skin. PPARgamma protein was expressed in cells mainly in the granular and prickle cell layers. However, the intensity of its expression was generally decreased in the parabasal layer of the cholesteatoma epithelium. Ki-67 was expressed in the nuclei of cells in the basal and parabasal layers, and a greater number of cells were Ki-67 immunopositive in cholesteatoma epithelium. PPARgamma is up-regulated in the cholesteatoma epithelium compared with normal external auditory canal skin. These results suggest that PPARgamma may play an important role in the pathogenesis of cholesteatoma.

Testosterone is an independent determinant of bone mineral density in men with type 2 diabetes mellitus.

PubMed

Vasilkova, Olga; Mokhort, Tatiana; Sanec, Igor; Sharshakova, Tamara; Hayashida, Naomi; Takamura, Noboru

2011-01-01

Although many reports have elucidated pathophysiological characteristics of abnormal bone metabolism in patients with type 2 diabetes mellitus (DT2), determinants of bone mineral density (BMD) in patients with DT2 are still controversial. We examined 168 Belarussian men 45-60 years of age. Plasma total cholesterol (TC), high-density lipoprotein cholesterol, low-density lipoprotein cholesterol, very low-density lipoprotein cholesterol, triglycerides, hemoglobin A(1c) (HbA(1c)), immunoreactive insulin, and C-reactive protein concentrations were assessed. BMD was measured using dual energy X-ray densitometry of the lumbar spine (L(1)-L(4)). Total testosterone (TT) and sex hormone-binding globulin were measured, and free testosterone (FT) was calculated. Using univariate linear regression analysis, BMD of the lumbar spine was significantly correlated with FT (r=0.32, p<0.01) and TT (r=0.36, p<0.01). Using multiple linear regression analysis adjusted for confounding factors, BMD was significantly correlated with TT (β=0.23, p<0.001) and TC (β=-0.029, p=0.005). Age (β=0.005, p=0.071), body mass index (β=0.005, p=0.053), HbA(1c) (β=-0.002, p=0.72) and duration of diabetes (β=0.001, p=0.62) were not significantly correlated with BMD. Our data indicate that androgens are independent determinants of BMD in male patients with DT2.

Physical activity and dark skin tone: protective factors against low bone mass in Mexican men.

PubMed

Vivanco-Muñoz, Nalleli; Jo, Talavera; Gerardo, Huitron-Bravo; Juan, Tamayo; Clark, Patricia

2012-01-01

A cross-sectional study was conducted on 268 Mexican men between the ages of 13 and 80 yr to evaluate the association of clinical factors related with bone mass. Men from high schools, universities, and retirement homes were invited to participate. Body mass index (BMI) was measured, and bone mineral density (BMD) was assessed using dual-energy X-ray absorptiometry for L1-L4 and total hip. Factors related to bone mass were assessed by questionnaire and analyzed using a logistic regression model. Demographic factors (age, education, and occupation), clinical data (BMI, skin tone, previous fracture, history of osteoporosis [OP], and history of fractures), and lifestyle variables (diet, physical activity, sun exposure, and smoking) were evaluated. Physical activity (≥ 60 min/5 times a week) reduced the risk for low BMD for age, osteopenia, and OP at the spine and total hip (odds ratio [OR]: 0.276; 95% confidence interval [CI]: 0.099-0.769; p=0.014; and OR: 0.184; 95% CI: 0.04-0.849; p=0.03, respectively). Dark skin tone was a protective factor, decreasing the risk by up to 70%. In this population of healthy Mexican men (aged 13-80 yr), dark skin and physical activity were protective factors against low bone mass. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Adiponectin isoform patterns in ethnic-specific ADIPOQ mutation carriers: The IRAS Family Study

PubMed Central

Tabb, Keri L.; Gao, Chuan; Hicks, Pamela J.; Hawkins, Gregory A.; Rotter, Jerome I.; da Chen, Yii-Der I; Guo, Xiuqing; Norris, Jill M.; Lorenzo, Carlos; Freedman, Barry I.; Bowden, Donald W.; Palmer, Nicholette D.

2017-01-01

Objective Adiponectin is found in human serum in three groups of multimers (high, medium, and low molecular weight). Previously, we reported two ethnic-specific variants in ADIPOQ, G45R (Hispanic Americans) and R55C (African Americans). Although carriers of both variants had mean adiponectin levels ≤20% of those of non-carriers, they were not clinically different from non-carriers. To compare carriers of both variants and non-carriers, relative quantification of adiponectin isoforms to total adiponectin was performed on serum samples. Methods The multimeric patterns of serum adiponectin in G45R carriers (n=23), R55C carriers (n=3), and Hispanic and African American non-carriers (n=84 and 44, respectively) from the IRAS Family Study were explored using native western blotting and densitometry. Results Serum samples from carriers showed an absence of the high molecular weight (HMW) isoform and a marked reduction in the medium molecular weight isoform but an approximate two-fold increase in the amount of the low molecular weight isoform (LMW). Thus, individuals making only LMW adiponectin are metabolically normal. Conclusions The results contrast with the proposed biological importance of the HMW multimer. This suggests that the LMW isoform may functionally compensate for some of the loss/reduction of the higher-order multimers in carriers of the G45R and R55C mutations. PMID:28643464

Gel-based coloration technique for the submillimeter-scale imaging of labile phosphorus in sediments and soils with diffusive gradients in thin films.

PubMed

Ding, Shiming; Wang, Yan; Xu, Di; Zhu, Chungang; Zhang, Chaosheng

2013-07-16

We report a highly promising technique for the high-resolution imaging of labile phosphorus (P) in sediments and soils in combination with the diffusive gradients in thin films (DGT). This technique was based on the surface coloration of the Zr-oxide binding gel using the conventional molybdenum blue method following the DGT uptake of P to this gel. The accumulated mass of the P in the gel was then measured according to the grayscale intensity on the gel surface using computer-imaging densitometry. A pretreatment of the gel in hot water (85 °C) for 5 d was required to immobilize the phosphate and the formed blue complex in the gel during the color development. The optimal time required for a complete color development was determined to be 45 min. The appropriate volume of the coloring reagent added was 200 times of that of the gel. A calibration equation was established under the optimized conditions, based on which a quantitative measurement of P was obtained when the concentration of P in solutions ranged from 0.04 mg L(-1) to 4.1 mg L(-1) for a 24 h deployment of typical DGT devices at 25 °C. The suitability of the coloration technique was well demonstrated by the observation of small, discrete spots with elevated P concentrations in a sediment profile.

Influence of post-starvation extraction time and prey-specific diet in Tityus serrulatus scorpion venom composition and hyaluronidase activity.

PubMed

Pucca, Manuela Berto; Amorim, Fernanda Gobbi; Cerni, Felipe Augusto; Bordon, Karla de Castro Figueiredo; Cardoso, Iara Aimê; Anjolette, Fernando Antonio Pino; Arantes, Eliane Candiani

2014-11-01

The role of diet in venom composition has been a topic of intense research interest. This work presents evidence that the variation in the venom composition from the scorpion Tityus serrulatus (Ts) is closely associated with post-starvation extraction time and prey-specific diet. The scorpions were fed with cockroach, cricket, peanut beetle or giant Tenebrio. The venoms demonstrated a pronounced difference in the total protein and toxins composition, which was evaluated by electrophoresis, reversed-phase chromatography, densitometry, hyaluronidase activity and N-terminal sequencing. Indeed, many toxins and peptides, such as Ts1, Ts2, Ts4, Ts5, Ts6, Ts15, Ts19 frag. II, hypotensins 1 and 3, PAPE peptide and peptide 9797 (first described in Ts venom), were all identified in different proportions in the analyzed Ts venoms. This study is pioneer on assessing the influence of the starvation time and the prey diet on hyaluronidase activity as well as to describe a modification of Tricine-gel-electrophoresis to evaluate this enzyme activity. Altogether, this study reveal a large contribution of the extraction time and diet on Ts venom variability as well as present a background to recommend the cockroach diet to obtain higher protein content and the cricket diet to obtain higher hyaluronidase specific activity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Density of ocular components of the bovine eye.

PubMed

Su, Xiao; Vesco, Christina; Fleming, Jacquelyn; Choh, Vivian

2009-10-01

Density is essential for acoustic characterization of tissues and provides a basic input for ultrasound backscatter and absorption models. Despite the existence of extensive compilations of acoustic properties, neither unified data on ocular density nor comparisons of the densities between all ocular components can be found. This study was undertaken to determine the mass density of all the ocular components of the bovine eye. Liquid components were measured through mass/volume ratio, whereas solid tissues were measured with two different densitometry techniques based on Archimedes Principle. The first method determines the density by measuring dry and wet weight of the tissues. The second method consists of immersing the tissues in sucrose solutions of varying densities and observing their buoyancy. Although the mean densities for all tissues were found to be within 0.02 g/cm by both methods, only the sucrose solution method offered a consistent relative order for all measured ocular components, as well as a considerably smaller standard deviation (a maximum standard deviation of 0.004 g/cm for cornea). The lens was found to be the densest component, followed by the sclera, cornea, choroid, retina, aqueous, and vitreous humors. The consistent results of the sucrose solution tests suggest that the ocular mass density is a physical property that is more dependent on the compositional and structural characteristics of the tissue and than on population variability.

Dietary coral calcium and zeolite protects bone in a mouse model for postmenopausal bone loss.

PubMed

Banu, Jameela; Varela, Erika; Guerra, Juan M; Halade, Ganesh; Williams, Paul J; Bahadur, Ali N; Hanaoka, Kokichi; Fernandes, Gabriel

2012-12-01

In patients diagnosed with osteoporosis, calcium is lost from bones making them weaker and easily susceptible to fractures. Supplementation of calcium is highly recommended for such conditions. However, the source of calcium plays an important role in the amount of calcium that is assimilated into bone. We hypothesize that naturally occurring coral calcium and zeolite may prevent ovariectomy-induced bone loss. We have measured bone loss in ovariectomized mice supplemented with coral calcium and Zeolite. Female C57BL/6 mice were either sham-operated or ovariectomized and fed diets containing coral calcium or zeolite for 6 months. Serum was analyzed for bone biochemical markers and cytokines. Bones were analyzed using dual x-ray absorbtiometry, peripheral quantitative computed tomography, and micro-computed tomography densitometry. In the distal femoral metaphysis, total bone and cortical bone mass was restored and the endocortical surface was significantly decreased in coral calcium and zeolite fed ovariectomized (OVX) mice. Trabecular number and the ratio of bone volume to total volume was higher in OVX mice after coral calcium and zeolite feeding, while trabecular separation decreased in the different treatment OVX groups. Coral calcium protected bone to a lesser extent in the proximal tibia and lumbar vertebrae. Overall, coral calcium and zeolite may protect postmenopausal bone loss. Copyright © 2012 Elsevier Inc. All rights reserved.

The QUALYOR (QUalité Osseuse LYon Orléans) study: a new cohort for non invasive evaluation of bone quality in postmenopausal osteoporosis. Rationale and study design.

PubMed

Chapurlat, Roland; Pialat, Jean-Baptiste; Merle, Blandine; Confavreux, Elisabeth; Duvert, Florence; Fontanges, Elisabeth; Khacef, Farida; Peres, Sylvie Loiseau; Schott, Anne-Marie; Lespessailles, Eric

2017-12-27

The diagnostic performance of densitometry is inadequate. New techniques of non-invasive evaluation of bone quality may improve fracture risk prediction. Testing the value of these techniques is the goal of the QUALYOR cohort. The bone mineral density (BMD) of postmenopausal women who sustain osteoporotic fracture is generally above the World Health Organization definition for osteoporosis. Therefore, new approaches to improve the detection of women at high risk for fracture are warranted. We have designed and recruited a new cohort to assess the predictive value of several techniques to assess bone quality, including high-resolution peripheral quantitative computerized tomography (HRpQCT), hip QCT, calcaneus texture analysis, and biochemical markers. We have enrolled 1575 postmenopausal women, aged at least 50, with an areal BMD femoral neck or lumbar spine T-score between - 1.0 and - 3.0. Clinical risk factors for fracture have been collected along with serum and blood samples. We describe the design of the QUALYOR study. Among these 1575 women, 80% were aged at least 60. The mean femoral neck T-score was - 1.6 and the mean lumbar spine T-score was -1.2. This cohort is currently being followed up. QUALYOR will provide important information on the relationship between bone quality variables and fracture risk in women with moderately decreased BMD.

Simultaneous Detection of Three Phosphodiesterase Type 5 Inhibitors and Eight of Their Analogs in Lifestyle Products and Screening for Adulterants by High-Performance Thin-Layer Chromatography.

PubMed

Do, Tiên T K; Theocharis, Grigorios; Reich, Eike

2015-01-01

An HPTLC method is proposed to permit effective screening for the presence of three phosphodiesterase type 5 inhibitors (PDE5-Is; sildenafil, vardenafil, and tadalafil) and eight of their analogs (hydroxyacetildenafil, homosildenafil, thiohomosildenafil, acetildenafil, acetaminotadalafil, propoxyphenyl hydroxyhomosildenafil, hydroxyhomosildenafil, and hydroxythiohomosildenafil) in finished products, including tablets, capsules, chocolate, instant coffee, syrup, and chewing gum. For all the finished products, the same simple sample preparation may be applied: ultrasound-assisted extraction in 10 mL methanol for 30 min followed by centrifugation. The Rf values of individual HPTLC bands afford preliminary identification of potential PDE5-Is. Scanning densitometry capabilities enable comparison of the unknown UV spectra with those of known standard compounds and allow further structural insight. Mass spectrometric analysis of the material derived from individual zones supplies an additional degree of confidence. Significantly, the proposed screening technique allows focus on the already known PDE5 Is and provides a platform for isolation and chemical categorization of the newly-synthesized analogs. Furthermore, the scope could be expanded to other therapeutic categories (e.g., analgesics, antidiabetics, and anorexiants) that are occasionally coadulterated along with the PDE5-Is. The method was successfully applied to screening of 45 commercial lifestyle products. Of those, 31 products tested positive for at least one illegal component (sildenafil, tadalafil, propoxyphenyl hydroxyhomosildenafil, or dimethylsildenafil).

Challenges of Estimating Fracture Risk with DXA: Changing Concepts About Bone Strength and Bone Density.

PubMed

Licata, Angelo A

2015-07-01

Bone loss due to weightlessness is a significant concern for astronauts' mission safety and health upon return to Earth. This problem is monitored with bone densitometry (DXA), the clinical tool used to assess skeletal strength. DXA has served clinicians well in assessing fracture risk and has been particularly useful in diagnosing osteoporosis in the elderly postmenopausal population for which it was originally developed. Over the past 1-2 decades, however, paradoxical and contradictory findings have emerged when this technology was widely employed in caring for diverse populations unlike those for which it was developed. Although DXA was originally considered the surrogate marker for bone strength, it is now considered one part of a constellation of factors-described collectively as bone quality-that makes bone strong and resists fracturing, independent of bone density. These characteristics are beyond the capability of routine DXA to identify, and as a result, DXA can be a poor prognosticator of bone health in many clinical scenarios. New clinical tools are emerging to make measurement of bone strength more accurate. This article reviews the historical timeline of bone density measurement (dual X-ray absorptiometry), expands upon the clinical observations that modified the relationship of DXA and bone strength, discusses some of the new clinical tools to predict fracture risk, and highlights the challenges DXA poses in the assessment of fracture risk in astronauts.

Electrophoretic mobility patterns of collagen following laser welding

NASA Astrophysics Data System (ADS)

Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.

1991-06-01

Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.

First impressions of cardiovascular calcification treatment in hemodialysis patients with a new dialysis fluid containing sodium thiosulphate (STS).

PubMed

Yonova, Diana H; Vazelov, Evgueniy S; Trendafilov, Ivan I; Stoinova, Veselka V; Nedevska, Mariya T; Antonov, Simeon A

2014-04-01

Cardiovascular calcification (CVC) in hemodialysis patients (HDP) causes cardiovascular pathology. Up until now very few drugs and therapeutic interventions have been able to reduce cardiovascular calcium deposits in hemodialysis patients and the process requires more than a year. Our idea in this study was to test 2 calcium binders--sodium thiosulfate (STS) and dinatrium ethylene diamine tetraacetic acid (DNEDTA)--for prevention and treatment of cardiovascular calcification of hemodialysis patients, using both substances not as an intravenous infusion but by adding them to the liquid bicarbonate part of the dialysis fluid. 6 HDPs were treated with sodium thiosulphate (STS), 6 with dinatrium ethylene diamine tetraacetic acid (DNEDTA), and 6 patients served as controls. Electrolytes, liver function, markers of inflammation, oxidative stress, bone metabolism, spiral computed tomography (SCT) of coronary CVC and bone densitometry were performed twice (start and end of the study). Starting blood parameters were similar to the end (STS group). No toxic or side effects from STS were observed. Initially in the DNEDTA group all the patients had vomiting so we excluded DNEDTA from the study. SCT found a significant reduction of calcification in 4 patients (STS group) and retardation in 2 patients comparatively to controls. The first results are hopeful, but the number of the patients was small, so we are enlarging the enrollment in the expectation of corroborating our results soon.

Supine vs decubitus lateral patient positioning in vertebral fracture assessment.

PubMed

Paggiosi, Margaret Anne; Finigan, Judith; Peel, Nicola; Eastell, Richard; Ferrar, Lynne

2012-01-01

In vertebral fracture assessment (VFA), lateral scans are obtained with the patient positioned supine (C-arm densitometers) or lateral decubitus (fixed-arm densitometers). We aimed to determine the impact of positioning on image quality and fracture definition. We performed supine and decubitus lateral VFA in 50 postmenopausal women and used the algorithm-based qualitative method to identify vertebral fractures. We compared the 2 techniques for the identification of fractures (kappa analysis) and compared the numbers of unreadable vertebrae (indiscernible endplates) and vertebrae that were projected obliquely (Wilcoxon matched-pairs signed-rank test). The kappa score for agreement between the VFA techniques (to identify women with vertebral fractures) was 0.84 (95% confidence interval [CI]: 0.68-0.99), and for agreement with fracture assessments made from radiographs, kappa was 0.76 (95% CI: 0.57-0.94) for both supine and decubitus lateral VFA. There were more unreadable vertebrae with supine lateral (48 vertebrae in supine lateral compared with 14 in decubitus lateral; p=0.001), but oblique projection was less common (93 vertebrae compared with 145 in decubitus lateral; p=0.002). We conclude that there were significantly different projection effects with supine and decubitus lateral VFA, but these differences did not influence the identification of vertebral fractures in our study sample. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Zinc deficiency reduces bone mineral density in the spine of young adult rats: a pilot study.

PubMed

Ryz, Natasha R; Weiler, Hope A; Taylor, Carla G

2009-01-01

The objective of this study was to investigate the effects of zinc deficiency initiated during adolescence on skeletal densitometry, serum markers of bone metabolism, femur minerals and morphometry in young adult rats. Ten-week-old male rats were fed a <1-mg Zn/kg diet (9ZD), a 5-mg Zn/kg diet (9MZD) or a 30-mg Zn/kg diet (9CTL) for up to 9 weeks. Analyses included bone mineral density, serum osteocalcin and C-terminal peptides of type I collagen, serum zinc, femur zinc, calcium and phosphorus, and femur morphometry. Bone mineral density was 14% lower in the spine of 9ZD, but was not altered in the whole body, tibia or femur, or in any of the aforementioned sites in 9MZD, compared to 9CTL. When adjusted for size, spine bone mineral apparent density was still 8% lower in 9ZD than 9CTL. Serum osteocalcin, a marker for bone formation, was approximately 33% lower in 9ZD compared to both 9MZD and 9CTL. The 9ZD and 9MZD had 57% lower femur zinc and 56-88% lower serum zinc concentrations compared to 9CTL. These findings indicate that severe zinc deficiency initiated during adolescence may have important implications for future bone health, especially with regards to bone consolidation in the spine. 2009 S. Karger AG, Basel.

Systematic Development and Validation of a Thin-Layer Densitometric Bioanalytical Method for Estimation of Mangiferin Employing Analytical Quality by Design (AQbD) Approach

PubMed Central

Khurana, Rajneet Kaur; Rao, Satish; Beg, Sarwar; Katare, O.P.; Singh, Bhupinder

2016-01-01

The present work aims at the systematic development of a simple, rapid and highly sensitive densitometry-based thin-layer chromatographic method for the quantification of mangiferin in bioanalytical samples. Initially, the quality target method profile was defined and critical analytical attributes (CAAs) earmarked, namely, retardation factor (Rf), peak height, capacity factor, theoretical plates and separation number. Face-centered cubic design was selected for optimization of volume loaded and plate dimensions as the critical method parameters selected from screening studies employing D-optimal and Plackett–Burman design studies, followed by evaluating their effect on the CAAs. The mobile phase containing a mixture of ethyl acetate : acetic acid : formic acid : water in a 7 : 1 : 1 : 1 (v/v/v/v) ratio was finally selected as the optimized solvent for apt chromatographic separation of mangiferin at 262 nm with Rf 0.68 ± 0.02 and all other parameters within the acceptance limits. Method validation studies revealed high linearity in the concentration range of 50–800 ng/band for mangiferin. The developed method showed high accuracy, precision, ruggedness, robustness, specificity, sensitivity, selectivity and recovery. In a nutshell, the bioanalytical method for analysis of mangiferin in plasma revealed the presence of well-resolved peaks and high recovery of mangiferin. PMID:26912808

Development and validation of a reversed-phase high-performance thin-layer chromatography-densitometric method for determination of atorvastatin calcium in bulk drug and tablets.

PubMed

Shirkhedkar, Atul A; Surana, Sanjay J

2010-01-01

Atorvastatin calcium is a synthetic HMG-CoA reductase inhibitor that is used as a cholesterol-lowering agent. A simple, sensitive, selective, and precise RP-HPTLC-densitometric determination of atorvastatin calcium both as bulk drug and from pharmaceutical formulation was developed and validated according to International Conference on Harmonization guidelines. The method used aluminum sheets precoated with silica gel 60 RP18F254S as the stationary phase, and the mobile phase consisted of methanol-water (3.5 + 1.5, v/v). The system gave a compact band for atorvastatin calcium with an Rf value of 0.62 +/- 0.02. Densitometric quantification was carried out at 246 nm. The linear regression analysis data for the calibration plots showed a good linear relationship with r = 0.9992 in the working concentration range of 100-800 ng/band. The method was validated for precision, accuracy, ruggedness, robustness, specificity, recovery, LOD, and LOQ. The LOD and LOQ were 6 and 18 ng, respectively. The drug underwent hydrolysis when subjected to acidic conditions and was found to be stable under alkali, oxidation, dry heat, and photodegradation conditions. Statistical analysis proved that the developed RP-HPTLC-densitometry method is reproducible and selective and that it can be applied for identification and quantitative determination of atorvastatin calcium in bulk drug and tablet formulation.

Work- and travel-related physical activity and alcohol consumption: relationship with bone mineral density and calcaneal quantitative ultrasonometry.

PubMed

Sritara, Chanika; Thakkinstian, Ammarin; Ongphiphadhanakul, Boonsong; Pornsuriyasak, Prapaporn; Warodomwichit, Daruneewan; Akrawichien, Tawatchai; Vathesatogkit, Prin; Sritara, Piyamitr

2015-01-01

A number of healthy workers rarely exercise because of a lack of time or resources. Physical activity related to work and everyday travel may be more feasible, but evidence of its beneficial effect on bone health is scarce. We assessed if this form of physical activity was associated with higher bone mineral density (BMD) and stiffness index (SI) when adjusted for recreational physical activity, age, body mass index, smoking, alcohol consumption, education, and serum level of 25-hydroxyvitamin D. Healthy workers, aged 25-54 yr, of the Electricity Generating Authority of Thailand were surveyed. The outcomes were BMD (lumbar spine, femoral neck, and total hip) and calcaneal SI. Physical activity was estimated using the global physical activity questionnaire and considered active when >600 metabolic equivalent tasks (min). Of 2268 subjects, 74% were men. Active male subjects had significantly higher BMD at the femoral neck and total hip (p<0.005). However, the association was not significant with male lumbar spine BMD, male SI, or any bone parameters in women (p>0.05). In men, work and travel physical activity seems beneficial to male bone health; hence, it should be encouraged. Furthermore, smoking appeared harmful while moderate alcohol consumption was beneficial. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Calcaneal quantitative ultrasound value for middle-aged and elderly Malaysian Chinese men and its association with age and body anthropometry.

PubMed

Chin, Kok-Yong; Ima-Nirwana, Soelaiman; Isa Naina, Mohamed; Norazlina, Mohamed; Ahmad Nazrun, Shuid; Norliza, Muhammad; Faizah, Othman; Farihah, H Suhaimi; Elvy Suhana, Mohd Ramli; Wan Zurinah, Wan Ngah

2012-01-01

Quantitative ultrasound (QUS) is a relatively easy, reliable, and safe method for bone status assessment, but reference data for Asian males remain scarce. Our study aimed to determine the values for one QUS parameter, the speed of sound (SOS) at the calcaneus, in Malaysian Chinese men and to determine the association between the SOS and several demographic characteristics, such as age, weight, height, and body mass index. Three hundred forty-eight Malaysian Chinese men aged 40 yr and older were recruited, and their calcaneal QUS value was determined using the CM-200 densitometer (Furuno Electric, Nishinomiya City, Japan). The results indicated a significant correlation between SOS and age, and multiple stepwise regression analysis indicated that age and height were important predictors of SOS. A significant reduction in SOS value was observed when men 60 yr and older were compared with men aged 40-49 yr. Compared with the reference data for Japanese males, Chinese men in Malaysia showed higher SOS values across all the age groups studied. In conclusion, there is an age-related decrease in SOS values in Malaysian Chinese men, and the SOS values established in this study can be used as a reference for future studies. Copyright © 2012 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Stress proteins hsp60 and hsp70 in three species of amphipods exposed to cadmium, diazinon, dieldrin and fluoranthene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werner, I.; Nagel, R.

1997-11-01

To investigate the use of stress proteins hsp60 and hsp70 as sublethal biomarkers for contaminant exposure in sediments, two infaunal (Ampelisca abdita, estuarine; Rhepoxynius abronius, marine) and one epifaunal (Hyalella azteca, freshwater) amphipod species were exposed for 24 h to solutions of the heavy metal cadmium, the pesticides diazinon and dieldrin, and the polycyclic aromatic hydrocarbon fluoranthene. All three species are routinely used in standard sediment toxicity tests. Analysis of hsp60 and hsp70 was performed using western blotting techniques with subsequent comparative quantification by densitometry. Results demonstrated compound and species-specific induction of stress protein synthesis. Whereas one member of themore » hsp70 protein family showed the most sensitive response to xenobiotic compounds in H. azteca, several members of the hsp60 protein family were the main proteins induced in A. abdita and R. abronius. Sensitivity of the detected stress protein response was highest in H. azteca with significant effects at concentrations 110-, 50-, >1,000-, and >1-fold lower than LC50 values for cadmium, diazinon, dieldrin, and fluoranthene, respectively. The corresponding values were >5 (cadmium), 0.7 (diazinon), >1 (dieldrin), and 2.9 (fluoranthene) for A. abdita, and >2 (cadmium), 3.1 (diazinon), > 100 (dieldrin), and >2.9 (fluoranthene) for R. abronius.« less

Quantification and characterization of enzymatically produced hyaluronan with fluorophore-assisted carbohydrate electrophoresis.

PubMed

Kooy, Floor K; Ma, Muyuan; Beeftink, Hendrik H; Eggink, Gerrit; Tramper, Johannes; Boeriu, Carmen G

2009-01-15

Hyaluronan (HA) is a polysaccharide with high-potential medical applications, depending on the chain length and the chain length distribution. Special interest goes to homogeneous HA oligosaccharides, which can be enzymatically produced using Pasteurella multocida hyaluronan synthase (PmHAS). We have developed a sensitive, simple, and fast method, based on fluorophore-assisted carbohydrate electrophoresis (FACE), for characterization and quantification of polymerization products. A chromatographic pure fluorescent template was synthesized from HA tetrasaccharide (HA4) and 2-aminobenzoic acid. HA4-fluor and HA4 were used as template for PmHAS-mediated polymerization of nucleotide sugars. All products, fluorescent and nonfluorescent, were analyzed with gel electrophoresis and quantified using lane densitometry. Comparison of HA4- and HA4-fluor-derived polymers showed that the fluorophore did not negatively influence the PmHAS-mediated polymerization. Only even-numbered oligosaccharide products were observed using HA4-fluor or HA4 as template. The fluorophore intensity was linearly related to its concentration, and the limit of detection was determined to be 7.4pmol per product band. With this assay, we can now differentiate oligosaccharides of size range DP2 (degree of polymerization 2) to approximately DP400, monitor the progress of polymerization reactions, and measure subtle differences in polymerization rate. Quantifying polymerization products enables us to study the influence of experimental conditions on HA synthesis.

Quantitative determination of triterpenes from Amphiptherygium adstringens by liquid chromatography and thin-layer chromatography and morphological analysis of cuachalalate preparations.

PubMed

Navarrete, Andres; Avula, Bharathi; Joshi, Vaishali C; Ji, Xiuhong; Hersh, Paul; Khan, Ikhlas A

2006-01-01

Amphiptherygium adstringens (Anacardiaceae/Julianaceae), local name "cuachalalate," is used in folk medicine for the treatment of cholelithiasis, fevers, fresh wounds, hypercholesterolemia, gastritis, gastric ulcers, and cancer of the gastrointestinal tract. The development of column high-performance liquid chromatography-photodiode array detector (LC-PDA) and high-performance thin-layer chromatography (HPTLC)-densitometry methods for the determination of masticadienonic acid and 3-hydroxymasticadienonic acid in cuachalalate preparations is described in this paper. Good separation of the compounds could be achieved by both methods. Either might be preparable depending on the requirements. The LC separation was performed on a Phenomenex Synergi MAX-RP 80A reversed-phase column operated at 40 degrees C with detection at 215 nm. The plant materials were extracted with methanol by sonication. The triterpenes present in the plant material and commercial extracts were separated with an acetonitrile-water reagent alcohol isocratic system. The limit of detection was 0.1-0.2 microg/mL. The relative standard deviation values for the determination of triterpenes in plant extracts were less than 1.00%. This is the first report of an analytical method developed for the quantitative analysis of triterpenes from Amphiptherygium adstringens by LC-PDA and HPTLC. The stem bark showed higher amounts of triterpenes, and low amounts in root and stem root. The microscopic description of the crude drug of cuachalalate was also provided.

Validation of gamma-ray detection techniques for safeguards monitoring at natural uranium conversion facilities

DOE PAGES

Dewji, Shaheen A.; Lee, Denise L.; Croft, Stephen; ...

2016-03-28

Recent IAEA circulars and policy papers have sought to implement safeguards when any purified aqueous uranium solution or uranium oxides suitable for isotopic enrichment or fuel fabrication exists. Under the revised policy, IAEA Policy Paper 18, the starting point for nuclear material under safeguards was reinterpreted, suggesting that purified uranium compounds should be subject to safeguards procedures no later than the first point in the conversion process. In response to this technical need, a combination of simulation models and experimental measurements were employed to develop and validate concepts of nondestructive assay monitoring systems in a natural uranium conversion plant (NUCP).more » In particular, uranyl nitrate (UO 2(NO 3) 2) solution exiting solvent extraction was identified as a key measurement point (KMP), where gamma-ray spectroscopy was selected as the process monitoring tool. The Uranyl Nitrate Calibration Loop Equipment (UNCLE) facility at Oak Ridge National Laboratory was employed to simulate the full-scale operating conditions of a purified uranium-bearing aqueous stream exiting the solvent extraction process in an NUCP. Nondestructive assay techniques using gamma-ray spectroscopy were evaluated to determine their viability as a technical means for drawing safeguards conclusions at NUCPs, and if the IAEA detection requirements of 1 significant quantity (SQ) can be met in a timely way. This work investigated gamma-ray signatures of uranyl nitrate circulating in the UNCLE facility and evaluated various gamma-ray detector sensitivities to uranyl nitrate. These detector validation activities include assessing detector responses to the uranyl nitrate gamma-ray signatures for spectrometers based on sodium iodide, lanthanum bromide, and high-purity germanium detectors. The results of measurements under static and dynamic operating conditions at concentrations ranging from 10–90 g U/L of natural uranyl nitrate are presented. A range of gamma-ray lines is examined, including attenuation for transmission measurement of density and concentration. It was determined that transmission-corrected gamma-ray spectra provide a reliable way to monitor the 235U concentration of uranyl nitrate solution in transfer pipes in NUCPs. Furthermore, existing predictive and analysis methods are adequate to design and realize practical designs. The 137Cs transmission source employed in this work is viable but not optimal for 235U densitometry determination. Validated simulations assessed the viability of 133Ba and 57Co as alternative densitometry sources. All three gamma-ray detectors are viable for monitoring natural uranium feed; although high-purity germanium is easiest to interpret, it is, however, the least attractive as an installation instrument. Overall, for monitoring throughput in a facility such as UNCLE, emulating the uranium concentration and pump speeds of the Springfields conversion facility in the United Kingdom, an uncertainty of less than 0.17% is required in order to detect the diversion of 1 SQ of uranyl nitrate through changes in uranium concentration over an accountancy period of one year with a detection probability of 50%. As a result, calibrated gamma-ray detection systems are capable of determining the concentration of uranium content in NUCPs, it is only in combination with verifiable operator declarations and supporting data, such as flow rate and enrichment, that safeguards conclusions can be drawn.« less

Quantification of phenylpropanoids in commercial Echinacea products using TLC with video densitometry as detection technique and ANN for data modelling.

PubMed

Agatonovic-Kustrin, S; Loescher, Christine M; Singh, Ragini

2013-01-01

Echinacea preparations are among the most popular herbal remedies worldwide. Although it is generally assigned immune enhancement activities, the effectiveness of Echinacea is highly dependent on the Echinacea species, part of the plant used, the age of the plant, its location and the method of extraction. The aim of this study was to investigate the capacity of an artificial neural network (ANN) to analyse thin-layer chromatography (TLC) chromatograms as fingerprint patterns for quantitative estimation of three phenylpropanoid markers (chicoric acid, chlorogenic acid and echinacoside) in commercial Echinacea products. By applying samples with different weight ratios of marker compounds to the system, a database of chromatograms was constructed. One hundred and one signal intensities in each of the TLC chromatograms were correlated to the amounts of applied echinacoside, chlorogenic acid and chicoric acid using an ANN. The developed ANN correlation was used to quantify the amounts of three marker compounds in Echinacea commercial formulations. The minimum quantifiable level of 63, 154 and 98 ng and the limit of detection of 19, 46 and 29 ng were established for echinacoside, chlorogenic acid and chicoric acid respectively. A novel method for quality control of herbal products, based on TLC separation, high-resolution digital plate imaging and ANN data analysis has been developed. The method proposed can be adopted for routine evaluation of the phytochemical variability in Echinacea formulations available in the market. Copyright © 2012 John Wiley & Sons, Ltd.

Hydroxyurea enhances SMN2 gene expression through nitric oxide release.

PubMed

Xu, Cheng; Chen, Xin; Grzeschik, Susanna M; Ganta, Madhuri; Wang, Ching H

2011-02-01

Small molecules that increase full-length survivor motor neuron (SMN) gene transcript are promising therapeutic candidates for spinal muscular atrophy (SMA). Hydroxyurea (HU) has recently been shown to increase full-length SMN transcript in cultured lymphocytes from patients with SMA. We investigate the mechanism by which HU enhances full-length SMN2 gene expression in SMA lymphocytes. Nitric oxide (NO) is a major intracellular metabolite of HU. We test whether NO donors can themselves enhance full-length SMN2 expression. Eighteen cell lines (five type I, five type II, six type III SMA, and two non-SMA controls) were treated with or without NO donors for 48 h. SMA cells treated with HU and three NO donors: two long-acting donors, Deta-NONOate and S-nitrosoglutathione, and one short-acting donor, 3-ethyl-3-(ethylaminoethyl)-1-hydroxy-2-oxo-1-triazene, resulted in significant increase in full-length SMN2 mRNA. These effects were abolished by co-treatment with an NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazoline-1-oxyl 3-oxide. One short-acting NO donor, S-nitroso-N-acetyl-DL-penicillamine, failed to show significant effect on full-length SMN2 expression, possibly due to high degree of cytotoxicity. These results were observed using both densitometry and quantitative PCR methods. We conclude that HU enhances SMN2 expression through the release of NO. NO donors may themselves be considered as new therapeutic candidates for SMA.

Association of unipedal standing time and bone mineral density in community-dwelling Japanese women.

PubMed

Sakai, A; Toba, N; Takeda, M; Suzuki, M; Abe, Y; Aoyagi, K; Nakamura, T

2009-05-01

Bone mineral density (BMD) and physical performance of the lower extremities decrease with age. In community-dwelling Japanese women, unipedal standing time, timed up and go test, and age are associated with BMD while in women aged 70 years and over, unipedal standing time is associated with BMD. The aim of this study was to clarify whether unipedal standing time is significantly associated with BMD in community-dwelling women. The subjects were 90 community-dwelling Japanese women aged 54.7 years. BMD of the second metacarpal bone was measured by computed X-ray densitometry. We measured unipedal standing time as well as timed up and go test to assess physical performance of the lower extremities. Unipedal standing time decreased with increased age. Timed up and go test significantly correlated with age. Low BMD was significantly associated with old age, short unipedal standing time, and long timed up and go test. Stepwise regression analysis revealed that age, unipedal standing time, and timed up and go test were significant factors associated with BMD. In 21 participants aged 70 years and over, body weight and unipedal standing time, but not age, were significantly associated with BMD. BMD and physical performance of the lower extremities decrease with older age. Unipedal standing time, timed up and go test, and age are associated with BMD in community-dwelling Japanese women. In women aged 70 years and over, unipedal standing time is significantly associated with BMD.

Validation of a Thin-Layer Chromatography for the Determination of Hydrocortisone Acetate and Lidocaine in a Pharmaceutical Preparation

PubMed Central

Dołowy, Małgorzata; Kulpińska-Kucia, Katarzyna; Pyka, Alina

2014-01-01

A new specific, precise, accurate, and robust TLC-densitometry has been developed for the simultaneous determination of hydrocortisone acetate and lidocaine hydrochloride in combined pharmaceutical formulation. The chromatographic analysis was carried out using a mobile phase consisting of chloroform + acetone + ammonia (25%) in volume composition 8 : 2 : 0.1 and silica gel 60F254 plates. Densitometric detection was performed in UV at wavelengths 200 nm and 250 nm, respectively, for lidocaine hydrochloride and hydrocortisone acetate. The validation of the proposed method was performed in terms of specificity, linearity, limit of detection (LOD), limit of quantification (LOQ), precision, accuracy, and robustness. The applied TLC procedure is linear in hydrocortisone acetate concentration range of 3.75 ÷ 12.50 μg·spot−1, and from 1.00 ÷ 2.50 μg·spot−1 for lidocaine hydrochloride. The developed method was found to be accurate (the value of the coefficient of variation CV [%] is less than 3%), precise (CV [%] is less than 2%), specific, and robust. LOQ of hydrocortisone acetate is 0.198 μg·spot−1 and LOD is 0.066 μg·spot−1. LOQ and LOD values for lidocaine hydrochloride are 0.270 and 0.090 μg·spot−1, respectively. The assay value of both bioactive substances is consistent with the limits recommended by Pharmacopoeia. PMID:24526880

Validation of a thin-layer chromatography for the determination of hydrocortisone acetate and lidocaine in a pharmaceutical preparation.

PubMed

Dołowy, Małgorzata; Kulpińska-Kucia, Katarzyna; Pyka, Alina

2014-01-01

A new specific, precise, accurate, and robust TLC-densitometry has been developed for the simultaneous determination of hydrocortisone acetate and lidocaine hydrochloride in combined pharmaceutical formulation. The chromatographic analysis was carried out using a mobile phase consisting of chloroform+acetone+ammonia (25%) in volume composition 8:2:0.1 and silica gel 60F254 plates. Densitometric detection was performed in UV at wavelengths 200 nm and 250 nm, respectively, for lidocaine hydrochloride and hydrocortisone acetate. The validation of the proposed method was performed in terms of specificity, linearity, limit of detection (LOD), limit of quantification (LOQ), precision, accuracy, and robustness. The applied TLC procedure is linear in hydrocortisone acetate concentration range of 3.75÷12.50  μg·spot(-1), and from 1.00÷2.50  μg·spot(-1) for lidocaine hydrochloride. The developed method was found to be accurate (the value of the coefficient of variation CV [%] is less than 3%), precise (CV [%] is less than 2%), specific, and robust. LOQ of hydrocortisone acetate is 0.198  μg·spot(-1) and LOD is 0.066  μg·spot(-1). LOQ and LOD values for lidocaine hydrochloride are 0.270 and 0.090  μg·spot(-1), respectively. The assay value of both bioactive substances is consistent with the limits recommended by Pharmacopoeia.

Study on the mechanism of the bronchodilatory effects of Cynodon dactylon (Linn.) and identification of the active ingredient.

PubMed

Patel, Maulik R; Bhalodia, Yagnik S; Pathak, Nimish L; Patel, Maulik S; Suthar, Kunal; Patel, Nilesh; Golwala, Dharmesh K; Jivani, Nurudin P

2013-10-24

In the traditional medicine, Cynodon dactylon (Linn.) is used in asthma, but scientific studies to provide evidence for medicinal uses are sparse. Thus this study was undertaken to provide evidence for medicinal use in asthma as a bronchodilator, and to identify active ingredient(s). In vivo, acetylcholine (Ach)-induced bronchospasm was conducted in guinea pig while isolated rat tracheal strip was suspended in organ bath to measure the concentration response curve using multichannel data acquisition system. The chloroform extract of Cynodon dactylon (CECD) protected against Ach-induced bronchospasm in guinea pigs, similar to atropine. In the in vitro studies, CECD relaxed carbachol (CCh) and high K + -induced contraction of rat tracheal strip, similar to atropine and verapamil respectively, suggesting antimuscarinic and calcium channel blocking (CCB) activities, which were confirmed by right ward shifting of CCh and Ca +2 concentration response curve (CRC). The phosphodiestrase (PDE) inhibitory activity was confirmed by potentiation of isoprenaline-induced inhibitory response, similar to papaverine. Densitometry analyses led to the identification of scopoletin as an active ingredient. Effectively, it significantly inhibited high K + , and Ca +2 induced contractile response, similar to verapamil. The phosphodiestrase (PDE) inhibitory activity was confirmed by direct evidence of potentiation of isoprenaline-induced inhibitory response, similar to papaverine. These results suggest that the bronchodilator activity of CECD is partly due to presence of scopoletin, and mediated possibly through CCB and PDE inhibition. © 2013 Elsevier Ireland Ltd. All rights reserved.

Study on the mechanism of the bronchodilatory effects of Cynodon dactylon (Linn.) and identification of the active ingredient.

PubMed

Patel, Maulik R; Bhalodia, Yagnik S; Pathak, Nimish L; Patel, Maulik S; Suthar, Kunal; Patel, Nilesh; Golwala, Dharmesh K; Jivani, Nurudin P

2013-12-12

In the traditional medicine, Cynodon dactylon (Linn.) is used in asthma, but scientific studies to provide evidence for medicinal uses are sparse. Thus this study was undertaken to provide evidence for medicinal use in asthma as a bronchodilator, and to identify active ingredient(s). In vivo, acetylcholine (Ach)-induced bronchospasm was conducted in guinea pig while isolated rat tracheal strip was suspended in organ bath to measure the concentration response curve using multichannel data acquisition system. The chloroform extract of Cynodon dactylon (CECD) protected against Ach-induced bronchospasm in guinea pigs, similar to atropine. In the in vitro studies, CECD relaxed carbachol (CCh) and high K+-induced contraction of rat tracheal strip, similar to atropine and verapamil respectively, suggesting antimuscarinic and calcium channel blocking (CCB) activities, which were confirmed by right ward shifting of CCh and Ca(+2) concentration response curve (CRC). The phosphodiestrase (PDE) inhibitory activity was confirmed by potentiation of isoprenaline-induced inhibitory response, similar to papaverine. Densitometry analyses led to the identification of scopoletin as an active ingredient. Effectively, it significantly inhibited high K+, and Ca(+2) induced contractile response, similar to verapamil. The phosphodiestrase (PDE) inhibitory activity was confirmed by direct evidence of potentiation of isoprenaline-induced inhibitory response, similar to papaverine. These results suggest that the bronchodilator activity of CECD is partly due to presence of scopoletin, and mediated possibly through CCB and PDE inhibition.

The three subtypes of atrial natriuretic peptide (ANP) receptors are expressed in the rat adrenal gland.

PubMed

Grandclément, B; Ronsin, B; Morel, G

1997-03-01

Atrial natriuretic peptide (ANP) actions are mediated by highly selective and specific receptors. Three subtypes have been characterized and cloned: ANP receptor-A (or GC-A), -B (or GC-B) and -C (the so-called clearance receptor). In rat adrenal gland, the mRNA for each subtype was detected using 35S-dUTP or digoxigenin-11-dUTP specific labeled probes, and in situ hybridization at light and electron microscopic levels respectively. The three subtypes were expressed the most abundantly in the zona glomerulosa. The amount of GC-A mRNA expression, quantified using macro-autoradiography and densitometry, was higher than the amounts of GC-B mRNA and ANPR-C mRNA both in zona glomerulosa and medullary of adrenal gland. At electron microscopic level, the three subtypes of ANPR were revealed in glomerulosa cells. A noticeable signal was also present in the medullary area, especially for GC-A mRNA, in adrenaline-containing chromaffin cells. No signal was detected in noradrenaline-containing chromaffin cells. The subcellular localization of the three mRNAs is similar: in the cytoplasmic matrix and in the euchromatin of the nucleus in each cell of glomerulosa, and in the same compartments of the adrenaline-containing chromaffin cells. These data indicate that the adrenal gland is an important target tissue for ANP action both in glomerulosa cells and adrenaline-containing chromaffin cells. The mRNA expression levels were different for each ANPR subtype.

High degree of discordance between three-dimensional and two-dimensional lumbar spine bone mineral density in Turner's syndrome.

PubMed

Lage, Andrea Z; Brandão, Cynthia A; Mendes, Judite R T; Huayllas, Martha K; Liberman, Bernardo; Mendonça, Berenice B; Costa, Elaine M F; Verreschi, Ieda T; Lazaretti-Castro, Marise

2005-01-01

Low bone mineral density (BMD) measured by dual-energy X-ray absorptiometry (DXA) has been described in Turner's syndrome (TS). One of the error factors of DXA is short stature, a common finding in TS patients. Aimed to evaluate the influence of a low stature on BMD, we compared the two-dimensional (2D) or conventional BMD (cBMD) with three-dimensional (3D) or volumetric BMD (vBMD) in 62 females (10 to 48 yr old) with TS diagnosis in a case control study. They were compared to 102 normal females (7 to 45 yr old) grouped by age-ranges. All patients were subjected to a lumbar spine densitometry by DXA in the PA and lateral projections, obtained the cBMD and vBMD and calculated for the apparent BMD (appBMD). In TS, the mean of Z-score for cBMD was significantly lower than that for vBMD and for appBMD (-2.31 +/- 1.42; -0.64 +/- 1.55; and -1.72 +/- 1.5; respectively). Most of the patients (83.8%) had a Z-score <-1 for cBMD, whereas the majority (58.1%) had a Z-score <-1 for vBMD. Concluding, the cBMD underestimates the bone mass of the lumbar spine in patients with TS inducing to false diagnoses of bone fragility. Volumetric BMD approached the bone mass of control patients, while appBMD just partially do that.

Increasing methylation of the calcitonin gene during disease progression in sequential samples from CML patients.

PubMed

Mills, K I; Guinn, B A; Walsh, V A; Burnett, A K

1996-09-01

In chronic myeloid leukaemia (CML), disease progression from the initial chronic phase to the acute phase or blast crisis has previously been shown to be correlated with progressive increases in hyper-methylation of the calcitonin gene, located at chromosome 11p15. However, sequential studies of individual patients were not performed in these investigations. We have analysed 44 samples from nine patients with typical Philadelphia chromosome positive CML throughout their disease progression to determine the methylation state of the calcitonin gene at these time points. Densitometry was used to quantitate the ratio of the normal 2.0 kb Hpa II fragments, indicating normal methylation status of the gene, compared to the intensity of the abnormal, hyper-methylated, 2.6-3.1 kb Hpa II fragments. We found a gradual increase in the ratio of methylated:unmethylated calcitonin gene during chronic phase with a dramatic rise at blast crisis. Further, the ratio of the abnormal hypermethylated 3.1 kb fragments to the methylated 2.6 kb fragment resulted in the identification of a clonal expansion of abnormally methylated cells. This expansion of cells with hypermethylation of the calcitonin gene during chronic phase was shown to coincide with the presence of a mutation in the p53 gene. The data presented in this study would suggest that an increased methylation status of the calcitonin gene during disease progression may indicate the expansion of abnormal blast cell populations and subsequent progression to blast crisis.

Hypocalcemia development in patients operated for primary hyperparathyroidism: Can it be predicted preoperatively?

PubMed

Kaya, Cafer; Tam, Abbas Ali; Dirikoç, Ahmet; Kılıçyazgan, Aylin; Kılıç, Mehmet; Türkölmez, Şeyda; Ersoy, Reyhan; Çakır, Bekir

2016-10-01

Primary hyperparathyroidism (PHP) is a common endocrine disease, and its most effective treatment is surgery. Postoperative hypocalcemia is a morbidity of parathyroid surgeries, and it may extend hospitalization durations. The purpose of this study is to determine the predictive factors related to the development of hypocalcemia and hungry bone syndrome (HBS) in patients who underwent parathyroidectomy for PHP. Laboratory data comprising parathyroid hormone (PTH), calcium, phosphate, 25-OHD, albumin, magnesium, alkaline phosphatase (ALP), blood urea nitrogen (BUN), and thyroid stimulating hormone (TSH) of the patients were recorded preoperatively, on the 1st and 4th days postoperatively, and in the 6th postoperative month, and their neck ultrasound (US) and bone densitometry data were also recorded. Hypocalcemia was seen in 63 patients (38.4%) on the 1st day after parathyroidectomy. Ten patients (6.1%) had permanent hypocalcemia in the 6th month after surgery. Out of the patients who underwent parathyroidectomy for PHP, 22 (13.4%) had HBS. The incidence of postoperative hypocalcemia was higher in patients who underwent parathyroidectomy for PHP, who had parathyroid hyperplasia, and who had osteoporosis. Preoperative PTH, ALP, and BUN values were higher in those patients who developed HBS. Furthermore, HBS was more common in patients who had osteoporosis, who had parathyroid hyperplasia, and who underwent thyroidectomy simultaneously with parathyroidectomy. As a result, patients who have the risk factors for development of hypocalcemia and HBS should be monitored more attentively during the perioperative period.

American Association of Clinical Endocrinologists Medical Guidelines for clinical practice for the evaluation and treatment of hypogonadism in adult male patients--2002 update.

PubMed

Petak, Steven M; Nankin, Howard R; Spark, Richard F; Swerdloff, Ronald S; Rodriguez-Rigau, Luis J

2002-01-01

In these clinical practice guidelines, specific recommendations are made for determining the most effective methods of diagnosing and treating hypogonadism in adult male patients. The target populations for these guidelines include the following: (1) men with primary testicular failure requiring testosterone replacement (hypergonadotropic hypogonadism); (2) male patients with gonadotropin deficiency or dysfunction who may have received testosterone replacement therapy or treatment for infertility (hypogonadotropic hypogonadism); and (3) aging men with symptoms relating to testosterone deficiency who could benefit from testosterone replacement therapy. Initial hormonal evaluation generally consists of a testosterone determination, in conjunction with a free testosterone or sex hormone-binding globulin level, inpatients with clear symptoms and signs but normal-range total testosterone, follicle-stimulating hormone, luteinizing hormone, and prolactin levels. Other possible tests include semen analysis, pituitary imaging studies, genetic studies, bone densitometry, testicular ultrasonography,testicular biopsy, and specialized hormonal dynamic testing. Therapeutic options generally consist of testosterone replacement by injections, patches, or topically applied gel in hypergonadotropic patients and in hypogonadotropic patients not interested in fertility. In hypogonadotropic patients interested in fertility, gonadal stimulation option scan be considered, including human chorionic gonadotropin stimulation therapy with or without human menopausal gonadotropin (or follicle-stimulating hormone) or gonadotropin-releasing hormone pump therapy. These therapies may be combined with assisted reproductive technologies such as in vitro fertilization with intracytoplasmic sperm injection, which may allow pregnancy to occur with very low numbers of sperm.

Is It Possible to Increase the Clinical Effectiveness of the Fracture Risk Assessment Tool in Osteopenia Patients by Taking Into Account Bone Mineral Density Values?

PubMed

Park, Jin-Sung; Lee, Jaewon; Park, Ye-Soo

2016-01-01

The study aimed to investigate the effectiveness of the clinical use of the Fracture Risk Assessment Tool (FRAX(®)) developed by the World Health Organization identifying patients at risk of osteoporotic fracture and to evaluate changes in osteoporotic fracture risk prediction according to bone mineral density (BMD) values. We identified the occurrence of osteoporotic fracture among patients whose BMD was measured in our hospital between April 2003 and March 2013. We then analyzed FRAX(®) scores obtained with or without BMD on the day before the occurrence of an osteoporotic fracture in actual osteoporotic fracture patients. According to the National Osteoporosis Foundation high-risk criteria, we identified the percentage of high-risk patients before the actual fracture. Among 445 osteoporotic fracture patients, when FRAX(®)-BMD was used, 281 patients (63%) were identified as high-risk before an actual osteoporotic fracture, and when FRAX(®) without BMD was used, 258 patients (58%) were identified (p = 0.115). In the 84 osteopenia patients, 39 patients (46.4%) were identified as high-risk when FRAX(®) without BMD was used, and 19 patients (22.6%) were identified when FRAX(®)-BMD was used (p = 0.001). The use of BMD in FRAX(®) does not seem to increase the clinical effectiveness of predicting osteoporotic fracture in osteopenia patients. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Factors in daily physical activity related to calcaneal mineral density in men.

PubMed

Hutchinson, T M; Whalen, R T; Cleek, T M; Vogel, J M; Arnaud, S B

1995-05-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g.cm-2) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry (SXA, Osteon, Inc., Wahiawa, HI). Subjects walked a mean (+/- SD) of 7902 (+/- 2534) steps per day or approximately 3.9 (+/- 1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143 (2-772) (median and range) min.wk-1 exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRFz) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRFz less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g.cm-2 vs 0.597 +/- 0.062 g.cm-2, P < 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P < 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Factors in Daily Physical Activity Related to Calcaneal Mineral Density in Men

NASA Technical Reports Server (NTRS)

Hutchinson, Teresa M.; Whalen, Robert T.; Cleek, Tammy M.; Vogel, John M.; Arnaud, Sara B.

1995-01-01

To determine the factors in daily physical activity that influence the mineral density of the calcaneus, we recorded walking steps and the type and duration of exercise in 43 healthy 26-to 51-yr-old men. Areal (g/sq cm) calcaneal bone mineral density (CBMD) was measured by single energy x-ray densitometry. Subjects walked a mean (+/- SD) of 7902(+/-2534) steps per day or approximately 3.9(+/-1.2) miles daily. Eight subjects reported no exercise activities. The remaining 35 subjects spent 143(2-772) (median and range) min/wk exercising. Twenty-eight men engaged in exercise activities that generate single leg peak vertical ground reaction forces (GRF(sub z)) of 2 or more body weights (high loaders, HL), and 15 reported exercise or daily activities that typically generate GRF(sub z) less than 1.5 body weights (low loaders, LL). CBMD was 12% higher in HL than LL (0.668 +/- 0.074 g/sq cm vs 0.597 +/- 0.062 g/sq cm, P less than 0.004). In the HL group, CBMD correlated to reported minutes of high load exercise (r = 0.41, P less than 0.03). CBMD was not related to the number of daily walking steps (N = 43, r = 0.03, NS). The results of this study support the concept that the dominant factor in daily physical activity relating to bone mineral density is the participation in site specific high loading activities, i.e., for the calcaneus, high calcaneal loads.

Growth, body composition, and bone density following pediatric liver transplantation.

PubMed

Sheikh, Amin; Cundy, Tim; Evans, Helen Maria

2018-04-24

Patients transplanted for cholestatic liver disease are often significantly fat-soluble vitamin deficient and malnourished pretransplant, with significant corticosteroid exposure post-transplant, with increasing evidence of obesity and metabolic syndrome post-LT. Our study aimed to assess growth, body composition, and BMD in patients post-pediatric LT. Body composition and bone densitometry scans were performed on 21 patients. Pre- and post-transplant anthropometric data were analyzed. Bone health was assessed using serum ALP, calcium, phosphate, and procollagen-1-N-peptide levels. Median ages at transplant and at this assessment were 2.7 and 10.6 years, respectively. Physiological markers of bone health, median z-scores for total body, and lumbar spine aBMD were normal. Bone area was normal for height and BMAD at L3 was normal for age, indicating, respectively, normal cortical and trabecular bone accrual. Median z-scores for weight, height, and BMI were 0.6, -0.9, 1.8 and 0.6, 0.1, 0.8 pre- and post-transplant, respectively. Total body fat percentages measured on 21 body composition scans revealed 2 underweight, 7 normal, 6 overweight, and 6 obese. Bone mass is preserved following pediatric LT with good catch-up height. About 52% of patients were either overweight/obese post-transplant, potentially placing them at an increased risk of metabolic syndrome and its sequelae in later life. BMI alone is a poor indicator of nutritional status post-transplant. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Comparison of DXA Scans and Conventional X-rays for Spine Morphometry and Bone Age Determination in Children.

PubMed

Hoyer-Kuhn, Heike; Knoop, Kai; Semler, Oliver; Kuhr, Kathrin; Hellmich, Martin; Schoenau, Eckhard; Koerber, Friederike

2016-01-01

Conventional lateral spine and hand radiographs are the standard tools to evaluate vertebral morphometry and bone age in children. Beside bone mineral density analyses, dual-energy X-ray absorptiometry (DXA) measurements with lower radiation exposure provide high-resolution scans which are not approved for diagnostic purposes. Data about the comparability of conventional radiographs and DXA in children are missing yet. The purpose of the trial was to evaluate whether conventional hand and spine radiographs can be replaced by DXA scans to diminish radiation exposure. Thirty-eight children with osteogenesis imperfecta or secondary osteoporosis or short stature (male, n=20; age, 5.0-17.0 yr) were included and assessed once by additional DXA (GE iDXA) of the spine or the left hand. Intraclass correlation coefficients (ICCs) were used to express agreement between X-ray and iDXA assessment. Evaluation of the spine morphometry showed reasonable agreement between iDXA and radiography (ICC for fish-shape, 0.75; for wedge-shape, 0.65; and for compression fractures, 0.70). Bone age determination showed excellent agreement between iDXA and radiography (ICC, 0.97). IDXA-scans of the spine in a pediatric population should be used not only to assess bone mineral density but also to evaluate anatomic structures and vertebral morphometry. Therefore, iDXA can replace some radiographs in children with skeletal diseases. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Personalized liposome-protein corona in the blood of breast, gastric and pancreatic cancer patients.

PubMed

Colapicchioni, Valentina; Tilio, Martina; Digiacomo, Luca; Gambini, Valentina; Palchetti, Sara; Marchini, Cristina; Pozzi, Daniela; Occhipinti, Sergio; Amici, Augusto; Caracciolo, Giulio

2016-06-01

When nanoparticles (NPs) are dispersed in a biofluid, they are covered by a protein corona the composition of which strongly depends on the protein source. Recent studies demonstrated that the type of disease has a crucial role in the protein composition of the NP corona with relevant implications on personalized medicine. Proteomic variations frequently occur in cancer with the consequence that the bio-identity of NPs in the blood of cancer patients may differ from that acquired after administration to healthy volunteers. In this study we investigated the correlation between alterations of plasma proteins in breast, gastric and pancreatic cancer and the biological identity of clinically approved AmBisome-like liposomes as determined by a combination of dynamic light scattering, zeta potential analysis, one-dimensional sodium dodecyl sulfate polyacrylamide gel electrophoresis (1D-SDS-PAGE) and semi-quantitative densitometry. While size of liposome-protein complexes was not significantly different between cancer groups, the hard corona from pancreatic cancer patients was significantly less negatively charged. Of note, the hard corona from pancreatic cancer patients was more enriched than those of other cancer types this enrichment being most likely due to IgA and IgG with possible correlations with the autoantibodies productions in cancer. Given the strict relationship between tumor antigen-specific autoantibodies and early cancer detection, our results could be the basis for the development of novel nanoparticle-corona-based screening tests of cancer. Copyright © 2015 Elsevier Ltd. All rights reserved.

Comparison between wire mesh sensor and gamma densitometry void measurements in two-phase flows

NASA Astrophysics Data System (ADS)

Sharaf, S.; Da Silva, M.; Hampel, U.; Zippe, C.; Beyer, M.; Azzopardi, B.

2011-10-01

Wire mesh sensors (WMS) are fast imaging instruments that are used for gas-liquid and liquid-liquid two-phase flow measurements and experimental investigations. Experimental tests were conducted at Helmholtz-Zentrum Dresden-Rossendorf to test both the capacitance and conductance WMS against a gamma densitometer (GD). A small gas-liquid test facility was utilized. This consisted of a vertical round pipe approximately 1 m in length, and 50 mm internal diameter. A 16 × 16 WMS was used with high spatial and temporal resolutions. Air-deionized water was the two-phase mixture. The gas superficial velocity was varied between 0.05 m s-1 and 1.4 m s-1 at two liquid velocities of 0.2 and 0.7 m s-1. The GD consisted of a collimated source and a collimated detector. The GD was placed on a moving platform close to the plane of wires of the sensor, in order to align it accurately using a counter mechanism, with each of the wires of the WMS, and the platform could scan the full section of the pipe. The WMS was operated as a conductivity WMS for a half-plane with eight wires and as a capacitance WMS for the other half. For the cross-sectional void (time and space averaged), along each wire, there was good agreement between WMS and the GD chordal void fraction near the centre of the pipe.

Streptococcus pneumoniae PstS production is phosphate responsive and enhanced during growth in the murine peritoneal cavity

NASA Technical Reports Server (NTRS)

Orihuela, C. J.; Mills, J.; Robb, C. W.; Wilson, C. J.; Watson, D. A.; Niesel, D. W.

2001-01-01

Differential display-PCR (DDPCR) was used to identify a Streptococcus pneumoniae gene with enhanced transcription during growth in the murine peritoneal cavity. Northern dot blot analysis and comparative densitometry confirmed a 1.8-fold increase in expression of the encoded sequence following murine peritoneal culture (MPC) versus laboratory culture or control culture (CC). Sequencing and basic local alignment search tool analysis identified the DDPCR fragment as pstS, the phosphate-binding protein of a high-affinity phosphate uptake system. PCR amplification of the complete pstS gene followed by restriction analysis and sequencing suggests a high level of conservation between strains and serotypes. Quantitative immunodot blotting using antiserum to recombinant PstS (rPstS) demonstrated an approximately twofold increase in PstS production during MPC from that during CCs, a finding consistent with the low levels of phosphate observed in the peritoneum. Moreover, immunodot blot and Northern analysis demonstrated phosphate-dependent production of PstS in six of seven strains examined. These results identify pstS expression as responsive to the MPC environment and extracellular phosphate concentrations. Presently, it remains unclear if phosphate concentrations in vivo contribute to the regulation of pstS. Finally, polyclonal antiserum to rPstS did not inhibit growth of the pneumococcus in vitro, suggesting that antibodies do not block phosphate uptake; moreover, vaccination of mice with rPstS did not protect against intraperitoneal challenge as assessed by the 50% lethal dose.

Osteoporosis screening is unjustifiably low in older African-American women.

PubMed Central

Wilkins, Consuelo H.; Goldfeder, Jason S.

2004-01-01

BACKGROUND: More than one million Americans suffer osteoporotic fractures yearly, resulting in a marked increase in morbidity and mortality. Despite a decrease in bone mineral density with increasing age in all ethnic groups and both genders, preventative and therapeutics efforts in osteoporosis have been focused on caucasian and Asian women. This study assesses the osteoporosis screening practices and the frequency of low bone density in a primarily African-American population of older women. METHODS: Medical records of 252 women at risk for osteoporosis were reviewed for the diagnosis of osteoporosis, prior osteoporosis screening, prior breast cancer screening, and the use of calcium, vitamin D or estrogen. Subsequently, 128 women were assessed for risk factors for osteoporosis, and their bone mineral density was measured using a peripheral bone densitometer. RESULTS: Osteoporosis screening had been performed in 11.5% of the subjects. Of the women evaluated by peripheral bone densitometry, 44.5% of all women, 40.4% of African-American women, and 53.3% of caucasian women had abnormally low bone density measurements. The frequency of abnormal bone density increased with both increasing age and decreasing body mass index. CONCLUSIONS: Although few women in this population were previously screened for osteoporosis, low bone density occurred in African-American women at substantial rates. Increasing age and low body mass are important risk factors for low bone density in African-American women. Ethnicity should not be used as an exclusion criterion for screening for osteoporosis. PMID:15101666

The Genome Sizes of Ostracod Crustaceans Correlate with Body Size and Evolutionary History, but not Environment.

PubMed

Jeffery, Nicholas W; Ellis, Emily A; Oakley, Todd H; Gregory, T Ryan

2017-09-01

Within animals, a positive correlation between genome size and body size has been detected in several taxa but not in others, such that it remains unknown how pervasive this pattern may be. Here, we provide another example of a positive relationship in a group of crustaceans whose genome sizes have not previously been investigated. We analyze genome size estimates for 46 species across the 2 most diverse orders of Class Ostracoda, commonly known as seed shrimps, including 29 new estimates made using Feulgen image analysis densitometry and flow cytometry. Genome sizes in this group range ~80-fold, a level of variability that is otherwise not seen in crustaceans with the exception of some malacostracan orders. We find a strong positive correlation between genome size and body size across all species, including after phylogenetic correction. We additionally detect evidence of XX/XO sex determination in 3 species of marine ostracods where male and female genome sizes were estimated. On average, genome sizes are larger but less variable in Order Myodocopida than in Order Podocopida, and marine ostracods have larger genomes than freshwater species, but this appears to be explained by phylogenetic inertia. The relationship between phylogeny, genome size, body size, and habitat is complex in this system and provides a baseline for future studies examining the interactions of these biological traits. © The American Genetic Association 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A comparison of field methods to assess body composition in a diverse group of sedentary women.

PubMed

D'Alonzo, Karen T; Aluf, Ana; Vincent, Linda; Cooper, Kristin

2009-01-01

Accurate assessment of body composition is essential in the evaluation of obesity. While laboratory methods are commonly used to assess fat mass, field measures (e.g., skinfold thickness [SKF] and bioelectrical impedance [BIA]) may be more practical for screening large numbers of individuals in intervention studies. In this study, a correlational design was used among 46 racially and ethnically diverse, sedentary women (mean age = 25.73 years) to (a) compare the percentage of body fat as determined by SKF and the upper body BIA and (b) examine the effects of body mass index (BMI), racial/ethnic background, age, and stage of the menstrual cycle on differences in the estimated percentage of body fat obtained using the SKF and BIA. Overall, a significant correlation between SKF and BIA (r = .98, p < .001) was found, with similar findings among Black, Hispanic and White non-Hispanic women. The mean differences between BIA and SKF were not significantly correlated with BMI, age, race/ethnicity or stage of the menstrual cycle. Data from this study suggest that BIA showed similar body fat prediction values compared with SKF and may be a viable alternative to SKF among diverse groups of healthy women. Additional testing and comparison of these field methods with the laboratory methods of hydro-densitometry or dual energy X-ray absorptiometry is recommended to further determine whether BIA devices can be routinely recommended as an alternative to the SKF.

Total and regional body volumes derived from dual-energy X-ray absorptiometry output.

PubMed

Wilson, Joseph P; Fan, Bo; Shepherd, John A

2013-01-01

Total body volume is an important health metric used to measure body density, shape, and multicompartmental body composition but is currently only available through underwater weighing or air displacement plethysmography (ADP). The objective of this investigation was to derive an accurate body volume from dual-energy X-ray absorptiometry (DXA)-reported measures for advanced body composition models. Volunteers received a whole body DXA scan and an ADP measure at baseline (N = 25) and 6 mo (N = 22). Baseline measures were used to calibrate body volume from the reported DXA masses of fat, lean, and bone mineral content. A second population (N = 385) from the National Health and Nutrition Examination Survey was used to estimate the test-retest precision of regional (arms, legs, head, and trunk) and total body volumes. Overall, we found that DXA-volume was highly correlated to ADP-volume (R² = 0.99). The 6-mo change in total DXA-volume was highly correlated to change in ADP-volume (R² = 0.98). The root mean square percent coefficient of variation precision of DXA-volume measures ranged from 1.1% (total) to 3.2% (head). We conclude that the DXA-volume method can measure body volume accurately and precisely, can be used in body composition models, could be an independent health indicator, and is useful as a prospective or retrospective biomarker of body composition. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The Effect of Changing Scan Mode on Trabecular Bone Score Using Lunar Prodigy.

PubMed

Chen, Weiwen; Slattery, Anthony; Center, Jacqueline; Pocock, Nicholas

2016-10-01

Trabecular bone score (TBS) is a measure of gray scale homogeneity that correlates with trabecular microarchitecture and is an independent predictor of fracture risk. TBS is being increasingly used in the assessment of patients at risk of osteoporosis and has recently been incorporated into FRAX ® . GE Lunar machines acquire spine scans using 1 of 3 acquisition modes depending on abdominal tissue thickness (thin, standard, and thick). From a database review, 30 patients (mean body mass index: 30.8, range 26.2-34.1) were identified who had undergone lumbar spine DXA scans (GE Lunar Prodigy, software 14.10; Lunar Radiation Corporation, Madison, WI) in both standard mode and thick mode, on the same day with no repositioning. Lumbar spine bone mineral density (L1-L4) and TBS were derived from the 30 paired spine scans. There was no significant difference in lumbar spine bone mineral density between the 2 scanning modes. There were, however, significant higher TBS values from the spine scans acquired in thick mode compared to the TBS values derived from spine acquisitions in standard mode (mean TBS difference: 0.24 [20%], standard deviation ±0.10). In conclusion, these preliminary data suggest that TBS values acquired in the GE Lunar Prodigy are dependent on the scanning mode used. Further evaluation is required to confirm the cause and develop appropriate protocols. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Inverse relationship between central obesity and osteoporosis in osteoporotic drug naive elderly females: The Tianliao Old People (TOP) Study.

PubMed

Chang, Chin-Sung; Chang, Yin-Fan; Wang, Mei-Wen; Chen, Chuan-Yu; Chao, Yu-Jang; Chang, Hsuan-Jui; Kuo, Po-Hsiu; Yang, Yi-Ching; Wu, Chih-Hsing

2013-01-01

To examine the relationship between central obesity and osteoporosis in elderly females in a rural community, a total of 368 ambulatory elderly women were recruited by random sampling during July 2009. Structured questionnaires were completed to survey possible osteoporosis-related risk factors. Subjects were dichotomized into either noncentral obese (waist circumference [WC]<80cm) or central obese subgroups (WC≥80cm) for further analysis. Bone mineral densities were scanned by dual-energy X-ray absorptiometry installed in a mobile bus. Thoracolumbar spine X-ray examination was interpreted by the same radiologist. Of the 365 subjects with completed data, 275 (75.3%) aged women were classified as having osteoporosis based on diagnostic Model III. Compared with the nonosteoporosis subjects, the subjects with osteoporosis had relatively higher mean age, lower body mass index, and a lower percentage of central obesity. Using the binary logistic regression method, central obesity was negatively associated with osteoporosis in all 3 models (odds ratios in the 3 models were 0.348, 95% confidence interval [CI]: 0.130-0.927; 0.444, 95% CI: 0.218-0.905; and 0.415, 95% CI: 0.184-0.936, respectively; p<0.05). Our study suggests that the paradox between central obesity and osteoporosis in elderly women should be of concern and warrants further study. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Cortical Porosity Identifies Women with Osteopenia at Increased Risk for Forearm Fractures

PubMed Central

Bala, Yohann; Zebaze, Roger; Ghasem-Zadeh, Ali; Atkinson, Elizabeth J.; Iuliano, Sandra; Peterson, James M.; Amin, Shreyasee; Bjørnerem, Åshild; Melton, L. Joseph; Johansson, Helena; Kanis, John A.; Khosla, Sundeep; Seeman, Ego

2014-01-01

Background Most fragility fractures arise among the many women with osteopenia, not the smaller number with osteoporosis at high risk for fracture. Thus, most women at risk for fracture assessed only by measuring areal bone mineral density (aBMD) will remain untreated. Methods We measured cortical porosity and trabecular bone volume/total volume (BV/TV) of the ultradistal radius (UDR) using high-resolution peripheral quantitative computed tomography, aBMD using densitometry, and 10-year fracture probability using the country-specific FRAX tool in 68 postmenopausal women with forearm fractures and 70 age-matched community controls in Olmsted County, Minnesota. Results Women with forearm fractures had 0.4 standard deviations (SD) higher cortical porosity and 0.6 SD lower trabecular BV/TV. Compact-appearing cortical porosity predicted fracture independent of aBMD; odds ratio [OR] 1.92 (95%CI, 1.10–3.33). In women with osteoporosis at the UDR, cortical porosity did not distinguish those with, from those without, fractures because high porosity was present in 92% and 86% of each group respectively. By contrast, in women with osteopenia at the UDR, high porosity of the compact-appearing cortex conferred an OR for fracture of 4.00 (95%CI, 1.15–13.90). Conclusion In women with osteoporosis, porosity is captured by aBMD and so measuring UDR cortical porosity does not improve diagnostic sensitivity. However, in women with osteopenia, cortical porosity was associated with forearm fractures. PMID:24519558

Phenotype of sarcopenic obesity in older individuals with a history of falling.

PubMed

Huo, Ya Ruth; Suriyaarachchi, Pushpa; Gomez, Fernando; Curcio, Carmen L; Boersma, Derek; Gunawardene, Piumali; Demontiero, Oddom; Duque, Gustavo

2016-01-01

Although sarcopenic obesity is associated with disability in middle-aged community-dwelling individuals, the phenotype of sarcopenic obesity in people 65 and older, especially those with a history of falls, remain unknown. To fill this knowledge gap, the goal of this study was to obtain a comprehensive phenotype of sarcopenic obesity in this high-risk population. Cross-sectional study of 680 subjects (mean age=79±9, 65% female) assessed between 2009 and 2013 at the Falls and Fractures Clinic, Nepean Hospital (Penrith, Australia). The assessment included a comprehensive examination, posturography, gait velocity, grip strength, bone densitometry and body composition by DXA, and blood tests for biochemical status. Patients were divided into four groups based on DXA and clinical criteria: 1) sarcopenic obese; 2) non-sarcopenic obese; 3) sarcopenic and; 4) non-sarcopenic/non-obese. The difference between groups was assessed by one-way ANOVA, chi-square analysis, and multivariable linear regression. Sarcopenic obese subjects were older (81.1±7.3), mostly female and more likely to have lower bone mineral density, lower grip strength, slower gait velocity, and poor balance. Sarcopenic obese individuals also showed significantly higher parathyroid hormone and lower vitamin D. We identified a particular set of clinical and biochemical characteristics in our subgroup of sarcopenic obese older fallers. Identification of these particular characteristics in the clinical setting is essential in order to prevent poor outcomes in this high-risk population. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Cohort Profile: The JS High School study (JSHS): a cohort study of Korean adolescents.

PubMed

Choi, Dong Phil; Lee, Joo Young; Kim, Hyeon Chang

2017-04-01

Major aetiologies of atherosclerotic cardiovascular diseases begin in childhood and atherosclerotic vascular abnormalities can be observed among children and adolescents. Adolescent cohort studies have important advantages because they can observe earlier changes in vascular structure and function. The purpose of the JS High School study (JSHS) is to identify biomarkers predicting or indicating early structural and functional vascular change in adolescents. The JSHS is a prospective cohort study of a Korean adolescent population. The target population of the JSHS was first-graders (aged 14 to17 years) at a high school of South Korea. Enrolment and baseline examinations were conducted in years 2007, 2010, 2011 and 2012. Among the total eligible population of 1115 students, 1071 (96.1%) participated in the study and completed all baseline examinations. Informed consent forms were obtained from each participant and his/her parent or guardian. Baseline examinations include: questionnaires on demographics, health behaviours, medical history, and depression symptoms; fasting blood analysis; anthropometric measurement; body impedance analysis; blood pressure measurement; radial artery tonometry; bone densitometry; pulmonary function tests; and carotid ultrasonography. Participants enrolled from 2007 through 2012 were re-examined after 30 months of follow-up, and those who enrolled in 2012 were re-examined after 24 months of follow-up. The corresponding author may be contacted for potential collaboration and data access. © The Author 2015; all rights reserved. Published by Oxford University Press on behalf of the International Epidemiological Association.

quanTLC, an online open-source solution for videodensitometric quantification.

PubMed

Fichou, Dimitri; Morlock, Gertrud E

2018-07-27

The image is the key feature of planar chromatography. Videodensitometry by digital image conversion is the fastest way of its evaluation. Instead of scanning single sample tracks one after the other, only few clicks are needed to convert all tracks at one go. A minimalistic software was newly developed, termed quanTLC, that allowed the quantitative evaluation of samples in few minutes. quanTLC includes important assets such as open-source, online, free of charge, intuitive to use and tailored to planar chromatography, as none of the nine existent software for image evaluation covered these aspects altogether. quanTLC supports common image file formats for chromatogram upload. All necessary steps were included, i.e., videodensitogram extraction, preprocessing, automatic peak integration, calibration, statistical data analysis, reporting and data export. The default options for each step are suitable for most analyses while still being tunable, if needed. A one-minute video was recorded to serve as user manual. The software capabilities are shown on the example of a lipophilic dye mixture separation. The quantitative results were verified by comparison with those obtained by commercial videodensitometry software and opto-mechanical slit-scanning densitometry. The data can be exported at each step to be processed in further software, if required. The code was released open-source to be exploited even further. The software itself is online useable without installation and directly accessible at http://shinyapps.ernaehrung.uni-giessen.de/quanTLC. Copyright © 2018 Elsevier B.V. All rights reserved.

Differential sensitivity of cranial and limb motor function to nigrostriatal dopamine depletion

PubMed Central

Plowman, Emily K.; Maling, Nicholas; Rivera, Benjamin J.; Larson, Krista; Thomas, Nagheme J.; Fowler, Stephen C.; Manfredsson, Fredric P.; Shrivastav, Rahul; Kleim, Jeffrey A.

2012-01-01

The present study determined the differential effects of unilateral striatal dopamine depletion on cranial motor versus limb motor function. Forty male Long Evans rats were first trained on a comprehensive motor testing battery that dissociated cranial versus limb motor function and included: cylinder forepaw placement, single pellet reaching, vermicelli pasta handling; sunflower seed opening, pasta biting acoustics, and a licking task. Following baseline testing, animals were randomized to either a 6-hydroxydopamine (6-OHDA) (n = 20) or control (n = 20) group. Animals in the 6-OHDA group received unilateral intrastriatal 6-OHDA infusions to induce striatal dopamine depletion. Six-weeks following infusion, all animals were re-tested on the same battery of motor tests. Near infrared densitometry was performed on sections taken through the striatum that were immunohistochemically stained for tyrosine hydroxylase (TH). Animals in the 6-OHDA condition showed a mean reduction in TH staining of 88.27%. Although 6-OHDA animals were significantly impaired on all motor tasks, limb motor deficits were more severe than cranial motor impairments. Further, performance on limb motor tasks was correlated with degree of TH depletion while performance on cranial motor impairments showed no significant correlation. These results suggest that limb motor function may be more sensitive to striatal dopaminergic depletion than cranial motor function and is consistent with the clinical observation that therapies targeting the nigrostriatal dopaminergic system in Parkinson’s disease are more effective for limb motor symptoms than cranial motor impairments. PMID:23018122

Consensus and controversy regarding osteoporosis in the pediatric population.

PubMed

Bachrach, Laura Keyes

2007-09-01

To review current consensus and controversy surrounding the diagnosis and treatment of osteoporosis in childhood and adolescence. The medical literature was reviewed with emphasis on the importance of early skeletal health, risk factors for bone fragility, and the diagnosis and management of children at risk for osteoporosis. Childhood and adolescence are critical periods for optimizing bone growth and mineral accrual. Bone strength is determined by bone size, geometry, quality, and mass-variables that are influenced by genetic factors, activity, nutrition, and hormones. For children with genetic skeletal disorders or chronic disease, bone growth and mineral accrual may be compromised, increasing the lifetime risk of osteoporosis. The goal for the clinician is to identify children at greatest risk for future fragility fracture. Bone densitometry and turnover markers are challenging to interpret in children. Prevention and treatment of bone fragility in children are less well established than in adults. Optimizing nutrition and activity may not restore bone health, but the drug armamentarium is limited. Sex steroid replacement has not proven effective in restoring bone mass in patients with anorexia nervosa or exercise-associated amenorrhea. Bisphosphonates can increase bone mass and may reduce bone pain and fractures, most convincingly in patients with osteogenesis imperfecta. Further studies are needed to establish the safety, efficacy, and optimal drug, duration, and dosage in pediatric patients. Bone health during the first 2 decades contributes to the lifetime risk of osteoporosis. Further research is needed to develop evidence-based recommendations for the diagnosis and treatment of osteoporosis in childhood.

Planar chromatography mediated screening of tetracycline and fluoroquinolone antibiotics in milk by fluorescence and mass selective detection.

PubMed

Chen, Yisheng; Schwack, Wolfgang

2013-10-18

A rapid and efficient method for preliminary screening of four tetracyclines (tetracycline, chlortetracycline, oxytetracycline, doxycline) and three fluoroquinolones (enrofloxacin, ciprofloxacin, marbofloxacin), mostly detected in milk, by high-performance thin-layer chromatography-fluorescence detection and electrospray ionization mass spectrometry (HPTLC-FLD-ESI/MS) is highlighted. The optimized separation of the target antibiotics on ethylenediamine tetraacetic acid modified silica gel plates showed marked benefits for screening purposes. Besides, selective and sensitive densitometry in fluorescence mode was established with excitation at 366nm for the tetracyclines, 300nm for enrofloxacin and ciprofloxacin, and 280nm for marbofloxacin. Limits of detection (LOD) and quantitation (LOQ) with 95% confidence were in the range of 12-25 and 45-95μg/kg, respectively, in milk samples. Recoveries of target antibiotics from milk samples spiked at three critical levels (50, 100 and 150μg/kg) ranged from 76% to 105%. More importantly, a mass selective detection (MSD) was established as additional tool for confirmatory purposes. Using the elution-head based TLC-MS interface, the optimized elution flow consisting of acetonitrile/ammonium formate buffer (9/1, v/v) at a rate of 0.3mL/min enabled time-dependent resolution of analytes from the major interfering compounds, thus circumventing serious ion suppression effects. The established MSD assay also offered high sensitivity (25μg/kg) for confirmation, meeting Commission Regulation (EU) No. 37/2010. Copyright © 2013 Elsevier B.V. All rights reserved.

Lead exposure is a risk for worsening bone mineral density in middle-aged male workers.

PubMed

Akbal, Ayla; Tutkun, Engin; Yılmaz, Hınç

2014-09-01

Lead exposure linked to osteoporosis in women. However, there is no direct evidence whether lead exposure has effects on bone metabolism in middle-aged male subjects. Therefore, the present study investigated the relationship between bone mineral densitometry measurements, bone markers, endocrine hormones and blood lead levels. The present study included lead exposure patients (n: 30) and control subjects (n: 32). We recorded information on patient demographics and risk factors of osteoporosis. Blood lead levels were evaluated using Varian AA 240Z atomic absorption spectrophotometry. Bone mineral density measurements were measured using dual-energy X-ray absorptiometry. Each lumbar T and Z scores in the lead exposure group were lower than the control group. There were no significant differences in femur neck and femur total T and Z scores between two groups. Blood lead levels were also negatively correlated with lumbar 2-4 T score, total lumbar T score, lumbar 2-4 Z score and total lumbar Z score. Urinary hydroxyproline and urinary deoxypyridinoline levels in the lead exposure group were significantly higher compared to controls. Blood lead levels were strong, positively correlated with urinary deoxypyridinoline. Endocrine hormone levels and 1,25-dihydroxy-vitamin D3 levels were comparable between lead exposure and control group. Lead exposure in male workers is an important factor for deterioration in bone mineral density. We should be screening blood lead levels and history of lead exposure in male osteoporosis.

Systematic Development and Validation of a Thin-Layer Densitometric Bioanalytical Method for Estimation of Mangiferin Employing Analytical Quality by Design (AQbD) Approach.

PubMed

Khurana, Rajneet Kaur; Rao, Satish; Beg, Sarwar; Katare, O P; Singh, Bhupinder

2016-01-01

The present work aims at the systematic development of a simple, rapid and highly sensitive densitometry-based thin-layer chromatographic method for the quantification of mangiferin in bioanalytical samples. Initially, the quality target method profile was defined and critical analytical attributes (CAAs) earmarked, namely, retardation factor (Rf), peak height, capacity factor, theoretical plates and separation number. Face-centered cubic design was selected for optimization of volume loaded and plate dimensions as the critical method parameters selected from screening studies employing D-optimal and Plackett-Burman design studies, followed by evaluating their effect on the CAAs. The mobile phase containing a mixture of ethyl acetate : acetic acid : formic acid : water in a 7 : 1 : 1 : 1 (v/v/v/v) ratio was finally selected as the optimized solvent for apt chromatographic separation of mangiferin at 262 nm withRf 0.68 ± 0.02 and all other parameters within the acceptance limits. Method validation studies revealed high linearity in the concentration range of 50-800 ng/band for mangiferin. The developed method showed high accuracy, precision, ruggedness, robustness, specificity, sensitivity, selectivity and recovery. In a nutshell, the bioanalytical method for analysis of mangiferin in plasma revealed the presence of well-resolved peaks and high recovery of mangiferin. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The Influence of Reconstruction Kernel on Bone Mineral and Strength Estimates Using Quantitative Computed Tomography and Finite Element Analysis.

PubMed

Michalski, Andrew S; Edwards, W Brent; Boyd, Steven K

2017-10-17

Quantitative computed tomography has been posed as an alternative imaging modality to investigate osteoporosis. We examined the influence of computed tomography convolution back-projection reconstruction kernels on the analysis of bone quantity and estimated mechanical properties in the proximal femur. Eighteen computed tomography scans of the proximal femur were reconstructed using both a standard smoothing reconstruction kernel and a bone-sharpening reconstruction kernel. Following phantom-based density calibration, we calculated typical bone quantity outcomes of integral volumetric bone mineral density, bone volume, and bone mineral content. Additionally, we performed finite element analysis in a standard sideways fall on the hip loading configuration. Significant differences for all outcome measures, except integral bone volume, were observed between the 2 reconstruction kernels. Volumetric bone mineral density measured using images reconstructed by the standard kernel was significantly lower (6.7%, p < 0.001) when compared with images reconstructed using the bone-sharpening kernel. Furthermore, the whole-bone stiffness and the failure load measured in images reconstructed by the standard kernel were significantly lower (16.5%, p < 0.001, and 18.2%, p < 0.001, respectively) when compared with the image reconstructed by the bone-sharpening kernel. These data suggest that for future quantitative computed tomography studies, a standardized reconstruction kernel will maximize reproducibility, independent of the use of a quantitative calibration phantom. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Construction and validation of a population-based bone densitometry database.

PubMed

Leslie, William D; Caetano, Patricia A; Macwilliam, Leonard R; Finlayson, Gregory S

2005-01-01

Utilization of dual-energy X-ray absorptiometry (DXA) for the initial diagnostic assessment of osteoporosis and in monitoring treatment has risen dramatically in recent years. Population-based studies of the impact of DXA and osteoporosis remain challenging because of incomplete and fragmented test data that exist in most regions. Our aim was to create and assess completeness of a database of all clinical DXA services and test results for the province of Manitoba, Canada and to present descriptive data resulting from testing. A regionally based bone density program for the province of Manitoba, Canada was established in 1997. Subsequent DXA services were prospectively captured in a program database. This database was retrospectively populated with earlier DXA results dating back to 1990 (the year that the first DXA scanner was installed) by integrating multiple data sources. A random chart audit was performed to assess completeness and accuracy of this dataset. For comparison, testing rates determined from the DXA database were compared with physician administrative claims data. There was a high level of completeness of this database (>99%) and accurate personal identifier information sufficient for linkage with other health care administrative data (>99%). This contrasted with physician billing data that were found to be markedly incomplete. Descriptive data provide a profile of individuals receiving DXA and their test results. In conclusion, the Manitoba bone density database has great potential as a resource for clinical and health policy research because it is population based with a high level of completeness and accuracy.

Heterologous expression of Homo sapiens alpha-folate receptors in E. coli by fusion with a trigger factor for enhanced solubilization.

PubMed

Miranda, Beatriz Nogueira Messias; Fotoran, Wesley Luzetti; Canduri, Fernanda; Souza, Dulce Helena Ferreira; Wunderlich, Gerhard; Carrilho, Emanuel

2018-02-01

The role of Alpha folate receptors (FRα) in folate metabolism and cancer development has been extensively studied. The reason for this is not only associated to its direct relation to disease development but also to its potential use as a highly sensitive and specific biomarker for cancers therapies. Over the recent years, the crystal structures of human FRα complexed with different ligands were described relying on an expensive and time-consuming production process. Here, we constructed an efficient system for the expression and purification of a human FRα in E. coli. Unlike a conventional expression method we used a specific protein fusion expressing the target protein together with a trigger factor (TF). This factor is a chaperone from E. coli that assists the correct folding of newly synthesized polypeptide chains. The activity of rTFFRα was comparable to glycosylphosphatidylinositol (GPI) anchored proteins extracted from HeLa tumor cells. Our work demonstrates a straightforward and versatile approach for the production of active human FRα by heterologous expression; this approach further enhances the development of inhibition studies and biotechnological applications. The purified product was then conjugated to liposomes, obtaining a 35% higher signal from densitometry measurement on the immunoblotting assay in the contruct containing the Ni-NTA tag, as a mimesis of an exosome, which is of vital importance to nanotherapeutic techniques associated to treatment and diagnosis of tumors. Copyright © 2017 Elsevier Inc. All rights reserved.

Analysis of the Liver Soluble Proteome from Bull Terriers Affected with Inherited Lethal Acrodermatitis

PubMed Central

Mouat, Michael F.; Mauldin, Elizabeth A.; Casal, Margret L.

2012-01-01

Lethal acrodermatitis (LAD) is a genetic disease affecting bull terrier dogs. The phenotype is similar to that for acrodermatitis enteropathica in humans, but is currently without treatment. The purpose of the research presented here is to determine the biochemical defects associated with LAD using proteomic methodologies. Two affected (male and female) and one unaffected (male) bull terrier pups were euthanized at 14 weeks of age, their livers dissected and prepared for two-dimensional gel electrophoresis (2DE) and densitometry. Approximately 200 protein spots were observed. The density of the spots within each gel was normalized to the total spot volume of the gel; only those soluble liver protein spots that were consistently different in both of the livers of the affected pups compared to the unaffected pup were excised manually and submitted for MALDI mass spectrometry. Thirteen proteins were identified as differentially expressed in the affected, compared to the unaffected, pups. The proteins were involved in numerous cellular physiological functions, including chaperones, calcium binding, and energy metabolism, as well as being associated with the inflammatory response. Of note were haptoglobin, glutamine synthetase, prohibitin and keratin 10 which exhibited at least a 4-fold level of differential expression. These data represent the first proteomic analysis of this mutation. The differentially expressed proteins that were identified may be key in understanding the etiology of LAD, and may lead to diagnostic tools for its identification within the bull terrier population. PMID:17693109

Assessment of fat and lean mass by quantitative magnetic resonance: a future technology of body composition research?

PubMed

Bosy-Westphal, Anja; Müller, Manfred J

2015-09-01

For the assessment of energy balance or monitoring of therapeutic interventions, there is a need for noninvasive and highly precise methods of body composition analysis that are able to accurately measure small changes in fat and fat-free mass (FFM). The use of quantitative magnetic resonance (QMR) for measurement of body composition has long been established in animal studies. There are, however, only a few human studies that examine the validity of this method. These studies have consistently shown a high precision of QMR and only a small underestimation of fat mass by QMR when compared with a 4-compartment model as a reference. An underestimation of fat mass by QMR is also supported by the comparison between measured energy balance (as a difference between energy intake and energy expenditure) and energy balance predicted from changes in fat mass and FFM. Fewer calories were lost and gained as fat mass compared with the value expected from measured energy balance. Current evidence in healthy humans has shown that QMR is a valid and precise method for noninvasive measurement of body composition. Contrary to standard reference methods, such as densitometry and dual X-ray absorptiometry, QMR results are independent of FFM hydration. However, despite a high accuracy and a low minimal detectable change, underestimation of fat mass by QMR is possible and limits the use of this method for quantification of energy balance.

Physiological correlates of symbiont migration during bleaching of two octocoral species.

PubMed

Netherton, Sarah E; Scheer, Daniele M; Morrison, Patrick R; Parrin, Austin P; Blackstone, Neil W

2014-05-01

Perturbed colonies of Phenganax parrini and Sarcothelia sp. exhibit migration of symbionts of Symbiodinium spp. into the stolons. Densitometry and visual inspection indicated that polyps bleached while stolons did not. When migration was triggered by temperature, light and confinement, colonies of Sarcothelia sp. decreased rates of oxygen formation in the light (due to the effects of perturbation on photosynthesis and respiration) and increased rates of oxygen uptake in the dark (due to the effects of perturbation on respiration alone). Colonies of P. parrini, by contrast, showed no significant changes in either aspect of oxygen metabolism. When migration was triggered by light and confinement, colonies of Sarcothelia sp. showed decreased rates of oxygen formation in the light and increased rates of oxygen uptake in the dark, while colonies of P. parrini maintained the former and increased the latter. During symbiont migration into their stolons, colonies of both species showed dramatic increases in reactive oxygen species (ROS), as visualized with a fluorescent probe, with stolons of Sarcothelia sp. exhibiting a nearly immediate increase of ROS. Differences in symbiont type may explain the greater sensitivity of colonies of Sarcothelia sp. Using fluorescent probes, direct measurements of migrating symbionts in the stolons of Sarcothelia sp. showed higher levels of reactive nitrogen species and lower levels of ROS than the surrounding host tissue. As measured by native fluorescence, levels of NAD(P)H in the stolons were unaffected by perturbation. Symbiont migration thus correlates with dramatic physiological changes and may serve as a marker for coral condition.

Interpregnancy interval as a risk factor for postmenopausal osteoporosis.

PubMed

Sahin Ersoy, Gulcin; Giray, Burak; Subas, Seda; Simsek, Ersin; Sakin, Onder; Turhan, Omer Talip; Bulut, Sadullah

2015-10-01

Bone mass loss associated with pregnancy and lactation is usually regained in the postpartum period. However, it is not known whether the bone loss is completely recovered in women with a shortened interpregnancy interval (IPI). The aim of this study was to analyze the effect of IPI and gynecological history on postmenopausal osteoporosis. The study was conducted among 537 postmenopausal women who were divided into two groups in accordance with the osteoporosis status. Prior to bone densitometry, the patients were questioned about reproductive history. Dual-energy X-ray absorptiometry was used to measure lumbar spinal, femur neck and total femoral bone mineral density. Association between IPI and postmenopausal osteoporosis was analyzed. The comparison of both groups according to the total duration of breastfeeding did not reveal a considerable variation (p=0.288). In the osteoporosis group the age and duration of menopause were found to be significantly higher (p<0.001) whereas the age of first pregnancy and IPI were notably lower in comparison to the controls group (p<0.001). Multivariate logistic regression analyses revealed that women who have 0-12 months interpregnancy interval have the highest risk for osteoporosis (OR: 4.306; 95% CI, 1.684-11.01). This analysis confirmed that the occurrence of first pregnancy under 27 years of age conveyed a higher risk for osteoporosis, as well. Shortened IPI may have a detrimental effect on bone mineral density in postmenopausal age. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Patient questionnaires in rheumatoid arthritis: advantages and limitations as a quantitative, standardized scientific medical history.

PubMed

Pincus, Theodore; Yazici, Yusuf; Bergman, Martin J

2009-11-01

In many chronic diseases, objective gold standard measures such as blood pressure, cholesterol, and bone densitometry often provide most of the information used to establish a diagnosis and guide therapy. By contrast, in inflammatory rheumatic diseases, information from a patient history usually is considerably more prominent in clinical management. Patient history data can be recorded as standardized, quantitative scientific data through use of validated self-reported questionnaires. Patient questionnaires address the primary concerns of patients and their families. Questionnaire scores distinguish active from control treatments in clinical trials at similar levels to swollen and tender joint counts or laboratory tests. Patient questionnaire data are correlated significantly with joint counts, radiographic scores, and laboratory tests, but usually are far more significant than these measures in the prognosis of severe outcomes of rheumatoid arthritis (RA), including work disability, costs, and premature death. Limitations of patient questionnaires are based on cultural features involving variation in responses among ethnic groups, and a need for translation, although translated questionnaires can be as valuable as a translator. Patient questionnaires do not replace further medical history, physical examination, laboratory tests, and imaging data, and they require interpretation in a context of these standard sources of information at any clinical encounter. Patient questionnaires are useful to monitor patient status in usual clinical care, with almost no effort on the part of the physician and staff if distributed by the receptionist in the infrastructure of office practice.

Marrow Fat Quality Differences by Sex in Healthy Adults.

PubMed

Maciel, Jamilly G; de Araújo, Iana M; Carvalho, Adriana L; Simão, Marcelo N; Bastos, Clara M; Troncon, Luiz E A; Salmon, Carlos E G; de Paula, Francisco J A; Nogueira-Barbosa, Marcello H

Several studies have demonstrated the relationship between bone marrow adiposity (BMAT) and bone mass. 1 H magnetic resonance spectroscopy is a noninvasive technique able to assess both BMAT quantity and quality. The aim of our study was to perform quantitative and qualitative analyses of BMAT and to investigate its association with bone mineral density (BMD) in healthy nonobese volunteers. Fifty-one healthy volunteers, 21 men and 30 women, underwent 1.5 T 1 H magnetic resonance spectroscopy of the lumbar spine. BMD was determined by dual-energy X-ray absorptiometry of the lumbar spine. Correlation analysis was performed to evaluate association among lipids fractions, BMD, and age. The female and male volunteers had similar body mass index and BMD (p > 0.05). Our data demonstrated an inverse correlation of BMD and BMAT with age, with a stronger correlation of saturated lipids (r = 0.701; p < 0.0001) compared with unsaturated lipids (UL) (r = 0.278; p = 0.004). Importantly, female subjects had the highest amount of UL (confidence interval: 0.685%-1.722%; p < 0.001). Our study reports that men and women with similar BMD and body mass index have striking differences in bone marrow lipids composition, namely women have higher UL than men. In addition, we believe that our study brings new insights to the complex network involving BMAT and other factors that influence bone integrity. Copyright © 2016 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Comparison of the relationship between bone marrow adipose tissue and volumetric bone mineral density in children and adults.

PubMed

Shen, Wei; Velasquez, Gilbert; Chen, Jun; Jin, Ye; Heymsfield, Steven B; Gallagher, Dympna; Pi-Sunyer, F Xavier

2014-01-01

Several large-scale studies have reported the presence of an inverse relationship between bone mineral density (BMD) and bone marrow adipose tissue (BMAT) in adults. We aim to determine if there is an inverse relationship between pelvic volumetric BMD (vBMD) and pelvic BMAT in children and to compare this relationship in children and adults. Pelvic BMAT and bone volume (BV) was evaluated in 181 healthy children (5-17yr) and 495 healthy adults (≥18yr) with whole-body magnetic resonance imaging (MRI). Pelvic vBMD was calculated using whole-body dual-energy X-ray absorptiometry to measure pelvic bone mineral content and MRI-measured BV. An inverse correlation was found between pelvic BMAT and pelvic vBMD in both children (r=-0.374, p<0.001) and adults (r=-0.650, p<0.001). In regression analysis with pelvic vBMD as the dependent variable and BMAT as the independent variable, being a child or adult neither significantly contribute to the pelvic BMD (p=0.995) nor did its interaction with pelvic BMAT (p=0.415). The inverse relationship observed between pelvic vBMD and pelvic BMAT in children extends previous findings that found the inverse relationship to exist in adults and provides further support for a reciprocal relationship between adipocytes and osteoblasts. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Associated Factors of Bone Mineral Density and Osteoporosis in Elderly Males

PubMed Central

Heidari, Behzad; Muhammadi, Abdollah; Javadian, Yahya; Bijani, Ali; Hosseini, Reza; Babaei, Mansour

2016-01-01

Background Low bone mineral density and osteoporosis is prevalent in elderly subjects. This study aimed to determine the associated factors of bone mineral density and osteoporosis in elderly males. Methods All participants of the Amirkola health and ageing project cohort aged 60 years and older entered the study. Bone mineral density at femoral neck and lumbar spine was assessed by the dual energy X-ray absorptiometry (DXA) method. Osteoporosis was diagnosed by the international society for clinical densitometry criteria and the association of bone mineral density and osteoporosis with several clinical, demographic and biochemical parameters. Multiple logistic regression analysis was used to determine independent associations. Results A total of 553 patients were studied and 90 patients (16.2%) had osteoporosis at either femoral neck or lumbar spine. Diabetes, obesity, metabolic syndrome, overweight, and quadriceps muscle strength > 30 kg, metabolic syndrome, abdominal obesity and education level were associated with higher bone mineral density and lower prevalence of osteoporosis, whereas age, anemia, inhaled corticosteroids and fracture history were associated with lower bone mineral density and higher prevalence of osteoporosis (P = 0.001). After adjustment for all covariates, osteoporosis was negatively associated only with diabetes, obesity, overweight, and QMS > 30 kg and positively associated with anemia and fracture history. The association of osteoporosis with other parameters did not reach a statistical level. Conclusions The findings of the study indicate that in elderly males, diabetes, obesity and higher muscle strength was associated with lower prevalence of osteoporosis and anemia, and prior fracture with higher risk of osteoporosis. This issue needs further longitudinal studies. PMID:28835759

Expression analysis of URI/RMP gene in endometrioid adenocarcinoma by tissue microarray immunohistochemistry.

PubMed

Gu, Junxia; Liang, Yuting; Qiao, Longwei; Li, Xiaoyun; Li, Xingang; Lu, Yaojuan; Zheng, Qiping

2013-01-01

Multiple studies have recently demonstrated the oncogenic property of URI (or RMP, a member of the prefoldin family of molecular chaperones) during progression of hepatocellular carcinoma, ovarian cancer, and possibly prostate cancer. Most recently, we have shown that URI/RMP is up-regulated in cervical cancer, another reproductive system tumor beside ovarian and prostate cancers. To investigate if URI/RMP also plays a role in other reproductive system tumors, especially in endometrioid adenocarcinoma, we analyzed URI/RMP expression in a TMA (tissue microarray) containing tissues from 30 cases of endometrioid adenocarcinoma (which covers tumor tissues from Grade I through Grade III) and adjacent endometrium by immunohistochemistry (IHC) and densitometry analysis using image-pro plus 6.0 software. Our results showed that the mean density of URI/RMP expression in cancerous tissue is slightly higher than that of the adjacent endometrial tissue, though not statistically significant (p>0.05). There is no significant difference either between the mean density of Grade III cancerous tissue and that of Grade I and II cancers. Notably, we detected significantly higher signal intensity in cancerous tissue of all 7 Grade III cases than that of their adjacent endometrial tissue (p<0.05), suggesting a correlation of URI/RMP expression with the differentiation and pathological classification of endometrioid adenocarcinoma. Together, our results demonstrate the heterogeneous expression of URI/RMP in endometrioid adenocarcinoma. The higher level of URI/RMP expression in high-grade endometrioid adenocarcinomas compared to tissues of adjacent endometrium or gland suggests a diagnostic and possibly, a prognostic value of URI/RMP in endometrioid adenocarcinoma.

The peripheral quantitative computed tomographic and densitometric analysis of skeletal tissue in male Wistar rats after chromium sulfate treatment.

PubMed

Bieńko, Marek; Radzki, Radosław Piotr; Wolski, Dariusz

2017-09-21

This study evaluates the effects of three different doses of chromium sulphate on bone density and the tomographic parameters of skeletal tissue of rats. The experiment was performed on 40 male Wistar rats which received, by gavage, during 90 days, a chromium sulphate in either a daily dose of 400, 600 or 800 µg/kg BW. At the end of experiment, the rats were scanned using the densitometry method (DXA) to determine the bone mineral density, bone mineral content of total skeleton and vertebral column (L2-L4) and parameters of body composition (Lean Mass and Fat Mass). The isolated femora were scanned using peripheral a quantitative computed tomography method (pQCT) for a separate analysis of the trabecular and cortical bone tissue. The ultimate strength, work to ultimate and the Young modulus of femora was also investigated by the three-point bending test. The negative impact of chromium was observed in relation to bone tissue. All doses significantly decreased total skeleton density and mineral content, and also had impact upon the isolated femora and vertebral column. Trabecular volumetric bone mineral density and trabecular bone mineral content measured by pQCT in distal femur metaphysis were significantly lower in the experimental groups than in the control. Higher doses of chromium also significantly decreased values of ultimate strength and Young modulus in the investigated femora. The results of the experiment demonstrate that chromium sulphate is dose dependent, and exerts a disadvantageous effect on the skeleton, as it decreases bone density and resistance.

Proteolytic activities of kiwifruit actinidin (Actinidia deliciosa cv. Hayward) on different fibrous and globular proteins: a comparative study of actinidin with papain.

PubMed

Chalabi, Maryam; Khademi, Fatemeh; Yarani, Reza; Mostafaie, Ali

2014-04-01

Actinidin, a member of the papain-like family of cysteine proteases, is abundant in kiwifruit. To date, a few studies have been provided to investigate the proteolytic activity and substrate specificity of actinidin on native proteins. Herein, the proteolytic activity of actinidin was compared to papain on several different fibrous and globular proteins under neutral, acidic and basic conditions. The digested samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and densitometry to assess the proteolytic effect. Furthermore, the levels of free amino nitrogen (FAN) of the treated samples were determined using the ninhydrin colorimetric method. The findings showed that actinidin has no or limited proteolytic effect on globular proteins such as immunoglobulins including sheep IgG, rabbit IgG, chicken IgY and fish IgM, bovine serum albumin (BSA), lipid transfer protein (LTP), and whey proteins (α-lactalbumin and β-lactoglobulin) compared to papain. In contrast to globular proteins, actinidin could hydrolyze collagen and fibrinogen perfectly at neutral and mild basic pHs. Moreover, this enzyme could digest pure α-casein and major subunits of micellar casein especially in acidic pHs. Taken together, the data indicated that actinidin has narrow substrate specificity with the highest enzymatic activity for the collagen and fibrinogen substrates. The results describe the actinidin as a mild plant protease useful for many special applications such as cell isolation from different tissues and some food industries as a mixture formula with other relevant proteases.

Melanocortin antagonism ameliorates muscle wasting and inflammation in chronic kidney disease.

PubMed

Cheung, Wai W; Mak, Robert H

2012-11-01

Aberrant melanocortin signaling has been implicated in the pathogenesis of wasting in chronic kidney disease (CKD). Previously, we demonstrated that agouti-related peptide (AgRP), a melenocortin-4 receptor antagonist, reduced CKD-associated cachexia in CKD mice. Our previous studies with AgRP utilized dual energy X-ray (DXA) densitometry to assess the body composition in mice (Cheung W, Kuo HJ, Markison S, Chen C, Foster AC, Marks DL, Mak RH. J Am Soc Nephrol 18: 2517-2524, 2007; Cheung W, Yu PX, Little BM, Cone RD, Marks DL, Mak RH. J Clin Invest 115: 1659-1665, 2005). DXA is unable to differentiate water content in mice, and fluid retention in CKD may lead to an overestimate of lean mass. In this study, we employed quantitative magnetic resonance technique to evaluate body composition change following central administration of AgRP in a CKD mouse model. AgRP treatment improved energy expenditure, total body mass, fat mass, and lean body mass in CKD mouse. We also investigated the effect of CKD-associated cachexia on the signaling pathways leading to wasting in skeletal muscle, as well as whether these changes can be ameliorated by central administration of AgRP. AgRP treatment caused an overall decrease in proinflammatory cytokines, which may be one important mechanism of its effects. Muscle wasting in CKD may be due to the activation of proteolytic pathways as well as inhibition of myogenesis and muscle regeneration processes. Our results suggest that these aberrant pathological pathways leading to muscle wasting in CKD mice were ameliorated by central administration of AgRP.

An experimental and theoretical study of the thermal decomposition of C 4H 6 isomers

DOE PAGES

Lockhart, James P. A.; Goldsmith, C. Franklin; Randazzo, John B.; ...

2017-04-25

The chemistry of small unsaturated hydrocarbons, such as 1,3–butadiene (1,3–C 4H 6), 1,2–butadiene (1,2–C 4H 6), 2–butyne (2–C 4H 6) and 1–butyne (1–C 4H 6), is of central importance to the modeling of combustion systems. These species are important intermediates in combustion processes, and yet their high-temperature chemistry remains poorly understood, with various dissociation and isomerization pathways proposed in the literature. Here we investigate the thermal decompositions of 1,3–C 4H 6, 1,2–C 4H 6, 2–C 4H 6 and 1–C 4H 6 inside a diaphragmless shock tube, at post shock total pressures of 26–261 Torr and temperatures ranging from 1428–2354 K,more » using laser schlieren densitometry. The experimental work has been complemented by high-level ab initio calculations, which collectively provide strong evidence that formally direct dissociation is the major channel for pyrolysis of 1,3–C 4H 6 and 2–C 4H 6; these paths have not been previously reported but are critical to reconciling the current work and disparate literature reports. The reaction mechanism presented here simulates the current experiments and experimental data from the literature very well. As a result, pressure and temperature dependent rate coefficients are given for the isomerization, formally direct and direct dissociation paths.« less

Sarcopenia is related to increased risk for low bone mineral density.

PubMed

Wu, Chia-Hung; Yang, Kun-Cheh; Chang, Hao-Hsiang; Yen, Jo-Fang; Tsai, Ko-Sung; Huang, Kuo-Chin

2013-01-01

Lean body mass is positively correlated with bone mineral density (BMD). The association between sarcopenia and BMD is less studied. The aim of the study is to investigate the association between sarcopenia and abnormal BMD. A total of 600 community residents aged 40-85 years (mean=63.63 ± 10.12) from Taipei, Taiwan were included. Abnormal and normal BMD groups were categorized by T-score of femoral neck and lumbar spine (L2-L4) measured by dual-energy X-ray absorptiometry. Skeletal muscle mass (SM) index (SMI) was obtained from SM divided by height squared using bioelectrical impedance analysis (BIA) method. Sarcopenia was defined as SMI less than 8.87 kg/m² in men and 6.42 kg/m² in women according to previous Taiwanese sarcopenia study. The association between BMD groups and sarcopenia was examined using binary logistic regression analyses after controlling potential confounders. Subjects with sarcopenia were at higher risk for low BMD (odds ratio (OR) = 1.59, 95% confidence interval (CI)=1.06-2.39 for femoral neck BMD and OR=1.72, 95% CI=1.09-2.72 for lumbar BMD) compared with the nonsarcopenia group. Even in different gender groups with age categorized, sarcopenia was still an important independent factor in female group. The least square (LS) means of BMD of femoral neck and lumbar spine were significantly lower in sarcopenia group. The risk of low BMD increased significantly with sarcopenia. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

The role of bone shape in determining gender differences in vertebral bone mass.

PubMed

Barlow, Tricia; Carlino, Will; Blades, Heather Z; Crook, Jon; Harrison, Rachel; Arundel, Paul; Bishop, Nick J

2011-01-01

Dual-energy X-ray absorptiometry (DXA) measures of bone mineral density (BMD) in children fail to account for growth because bone depth is unmeasured. While multiple adjustment methods have been proposed using body or bone size, the effect of vertebral shape is relatively unknown. Our study aimed to determine gender differences in vertebral shape and their impact on areal BMD (aBMD). We recruited 189 children, including 107 boys, aged 4-17 years, who attended the emergency department due to trauma. None had fractured. Height, weight, Tanner stage, and DXA measurements of the lumbar spine (LS) and total body were obtained. Cylindrical models were used to predict relationships between vertebral width (VW) and areal density for a given vertebral area assuming uniform volumetric density. The actual relationships between VW, bone area, and aBMD for the LS in the children were then determined. The theoretical models predicted a positive relationship between width and areal density for a constant vertebral area. Actual vertebral measurements demonstrated that boys had greater VW for a given vertebral area but lower aBMD for a given VW than girls at any age. The most likely explanation for the apparent paradox was that vertebral cortical thickness relative to width was greater in girls. This difference remained after adjusting for lean mass, suggesting that bone's response to mechanical stimulation may vary between the sexes during growth with consequent evolutionary advantage for girls approaching reproductive age. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Vesicular neurotransmitter transporters in Huntington's disease: initial observations and comparison with traditional synaptic markers.

PubMed

Suzuki, M; Desmond, T J; Albin, R L; Frey, K A

2001-09-15

Markers of identified neuronal populations have previously suggested selective degeneration of projection neurons in Huntington's disease (HD) striatum. Interpretations are, however, limited by effects of compensatory regulation and atrophy. Studies of the vesicular monoamine transporter type-2 (VMAT2) and of the vesicular acetylcholine transporter (VAChT) in experimental animals indicate that they are robust markers of presynaptic integrity and are not subject to regulation. We measured dopamine and acetylcholine vesicular transporters to characterize the selectivity of degeneration in HD striatum. Brains were obtained at autopsy from four HD patients and five controls. Autoradiography was used to quantify radioligand binding to VMAT2, VAChT, the dopamine plasmalemmal transporter (DAT), benzodiazepine (BZ) binding sites, and D2-type dopamine receptors. The activity of choline acetyltransferase (ChAT) was determined as an additional marker of cholinergic neurons. Autoradiograms were analyzed by video-assisted densitometry and assessment of atrophy was made from regional structural areas in the coronal projection. Striatal VMAT2, DAT, and VAChT concentrations were unchanged or increased, while D2 and BZ binding and ChAT activity were decreased in HD. After atrophy correction, all striatal binding sites were decreased. However, the decrease in ChAT activity was 3-fold greater than that of VAChT binding. In addition to degeneration of striatal projection neurons, there are losses of extrinsic nigrostriatal projections and of striatal cholinergic interneurons in HD on the basis of vesicular transporter measures. There is also markedly reduced expression of ChAT by surviving cholinergic striatal interneurons. Copyright 2001 Wiley-Liss, Inc.

Low-Cost Charged-Coupled Device (CCD) Based Detectors for Shiga Toxins Activity Analysis.

PubMed

Rasooly, Reuven; Prickril, Ben; Bruck, Hugh A; Rasooly, Avraham

2017-01-01

To improve food safety there is a need to develop simple, low-cost sensitive devices for detection of food-borne pathogens and their toxins. We describe a simple, low-cost webcam-based detector which can be used for various optical detection modalities, including fluorescence, chemiluminescence, densitometry, and colorimetric assays. The portable battery-operated CCD-based detection system consists of four modules: (1) a webcam to measure and record light emission, (2) a sample plate to perform assays, (3) a light emitting diode (LED) for illumination, and (4) a portable computer to acquire and analyze images. To demonstrate the technology, we used a cell based assay for fluorescence detection of the activity of the food borne Shiga toxin type 2 (Stx2), differentiating between biologically active toxin and inactive toxin which is not a risk. The assay is based on Shiga toxin inhibition of cell protein synthesis measured through inhibition of the green fluorescent protein (GFP). In this assay, GFP emits light at 509 nm when excited with a blue LED equipped with a filter at 486 nm. The emitted light is then detected with a green filter at 535 nm. Toxin activity is measured through a reduction in the 509 nm emission. In this system the level of detection (LOD) for Stx2 was 0.1 pg/ml, similar to the LOD of commercial fluorometers. These results demonstrate the utility and potential of low cost detectors for toxin activity. This approach could be readily adapted to the detection of other food-borne toxins.

Iatrogenic osteoporosis, bilateral HIP osteonecrosis, and secondary adrenal suppression in an HIV-infected man receiving inhaled corticosteroids and ritonavir-boosted highly active antiretroviral therapy.

PubMed

Kaviani, Nargess; Bukberg, Phillip; Manessis, Anastasios; Yen, Vincent; Young, Iven

2011-01-01

To report the first case of severe osteoporosis associated with a vertebral pathologic fracture and osteonecrosis of femoral heads in an HIV-infected man receiving inhaled corticosteroids and ritonavir-boosted antiretroviral therapy. We describe an HIV-infected man with severe osteoporosis, bilateral hip osteonecrosis, and secondary adrenal suppression, including detailed clinical, laboratory, and radiographic data, and review the related literature. A 60-year-old man with a 15-year history of HIV infection and a medical history of long-standing bronchiectasis treated with inhaled corticosteroids and hypogonadism treated with testosterone was referred to the endocrinology clinic after experiencing an osteoporotic vertebral fracture. He was taking ritonavir-boosted antiretroviral therapy. Osteonecrosis of both hips was also diagnosed, which required total hip replacement therapy. Laboratory evaluation revealed adrenal insufficiency due to increased effect of exogenous inhaled steroids and no other secondary causes of osteoporosis. A bone densitometry study showed osteoporosis of both hips and the lumbar spine. He was treated with intravenous pamidronate. During treatment, he developed bilateral femoral fractures after minor trauma. Given the potential for increased serum levels of inhaled corticosteroids in patients taking ritonavir-boosted highly active antiretroviral therapy, attention must be paid to the risk of bone loss in HIV-infected patients taking inhaled corticosteroids. Prescribing calcium and vitamin D supplementation and considering early osteoporosis screening are reasonable measures for this patient population. Interaction between inhaled corticosteroids and ritonavir may increase risk of hypothalamus-pituitary-adrenal axis suppression.

Expression analysis of URI/RMP gene in endometrioid adenocarcinoma by tissue microarray immunohistochemistry

PubMed Central

Gu, Junxia; Liang, Yuting; Qiao, Longwei; Li, Xiaoyun; Li, Xingang; Lu, Yaojuan; Zheng, Qiping

2013-01-01

Multiple studies have recently demonstrated the oncogenic property of URI (or RMP, a member of the prefoldin family of molecular chaperones) during progression of hepatocellular carcinoma, ovarian cancer, and possibly prostate cancer. Most recently, we have shown that URI/RMP is up-regulated in cervical cancer, another reproductive system tumor beside ovarian and prostate cancers. To investigate if URI/RMP also plays a role in other reproductive system tumors, especially in endometrioid adenocarcinoma, we analyzed URI/RMP expression in a TMA (tissue microarray) containing tissues from 30 cases of endometrioid adenocarcinoma (which covers tumor tissues from Grade I through Grade III) and adjacent endometrium by immunohistochemistry (IHC) and densitometry analysis using image-pro plus 6.0 software. Our results showed that the mean density of URI/RMP expression in cancerous tissue is slightly higher than that of the adjacent endometrial tissue, though not statistically significant (p>0.05). There is no significant difference either between the mean density of Grade III cancerous tissue and that of Grade I and II cancers. Notably, we detected significantly higher signal intensity in cancerous tissue of all 7 Grade III cases than that of their adjacent endometrial tissue (p<0.05), suggesting a correlation of URI/RMP expression with the differentiation and pathological classification of endometrioid adenocarcinoma. Together, our results demonstrate the heterogeneous expression of URI/RMP in endometrioid adenocarcinoma. The higher level of URI/RMP expression in high-grade endometrioid adenocarcinomas compared to tissues of adjacent endometrium or gland suggests a diagnostic and possibly, a prognostic value of URI/RMP in endometrioid adenocarcinoma. PMID:24228101

Alveolar bone healing process in spontaneously hypertensive rats (SHR). A radiographic densitometry study

PubMed Central

MANRIQUE, Natalia; PEREIRA, Cassiano Costa Silva; GARCIA, Lourdes Maria Gonzáles; MICARONI, Samuel; de CARVALHO, Antonio Augusto Ferreira; PERRI, Sílvia Helena Venturoli; OKAMOTO, Roberta; SUMIDA, Doris Hissako; ANTONIALI, Cristina

2012-01-01

Hypertension is one of the most important public health problems worldwide. If undiagnosed or untreated, this pathology represents a systemic risk factor and offers unfavorable conditions for dental treatments, especially those requiring bone healing. Objectives The purpose of this study was to demonstrate, by analysis of bone mineral density (BMD), that the alveolar bone healing process is altered in spontaneously hypertensive rats (SHRs). Material and Methods Wistar rats and SHRs were submitted to extraction of the upper right incisor and were euthanized 7, 14, 21, 28 and 42 days after surgery. Right maxillae were collected, radiographed and analyzed using Digora software. BMD was expressed as minimum (min), middle (med) and maximum (max) in the medium (MT) and apical (AT) thirds of the dental alveolus. Results The results were compared across days and groups. Wistar showed difference in med and max BMD in the MT between 7 and 28 and also between 14 and 28 days. The AT exhibited significant difference in med and min BMD between 7 and 28 days, as well as difference in min BMD between 28 and 42 days. SHRs showed lower med BMD in the MT at 28 days when compared to 21 and 42 days. Differences were observed across groups in med and min BMD at day 28 in the MT and AT; and in max BMD at 14, 21 and 42 days in the MT. Conclusions These results suggest that the alveolar bone healing process is delayed in SHRs comparing with Wistar rats. PMID:22666841

Other notable protein blotting methods: a brief review.

PubMed

Kurien, Biji T; Scofield, R Hal

2015-01-01

Proteins have been transferred from the gel to the membrane by a variety of methods. These include vacuum blotting, centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low- and high-molecular-weight proteins, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization mass spectrometric-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before matrix-assisted laser desorption/ionization tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

A brief review of other notable protein blotting methods.

PubMed

Kurien, Biji T; Scofield, R Hal

2009-01-01

A plethora of methods have been used for transferring proteins from the gel to the membrane. These include centrifuge blotting, electroblotting of proteins to Teflon tape and membranes for N- and C-terminal sequence analysis, multiple tissue blotting, a two-step transfer of low and high molecular weight proteins, blotting of Coomassie Brilliant Blue (CBB)-stained proteins from polyacrylamide gels to transparencies, acid electroblotting onto activated glass, membrane-array method for the detection of human intestinal bacteria in fecal samples, protein microarray using a new black cellulose nitrate support, electrotransfer using square wave alternating voltage for enhanced protein recovery, polyethylene glycol-mediated significant enhancement of the immunoblotting transfer, parallel protein chemical processing before and during western blot and the molecular scanner concept, electronic western blot of matrix-assisted laser desorption/ionization (MALDI) mass spectrometry-identified polypeptides from parallel processed gel-separated proteins, semidry electroblotting of peptides and proteins from acid-urea polyacrylamide gels, transfer of silver-stained proteins from polyacrylamide gels to polyvinylidene difluoride (PVDF) membranes, and the display of K(+) channel proteins on a solid nitrocellulose support for assaying toxin binding. The quantification of proteins bound to PVDF membranes by elution of CBB, clarification of immunoblots on PVDF for transmission densitometry, gold coating of nonconductive membranes before MALDI tandem mass spectrometric analysis to prevent charging effect for analysis of peptides from PVDF membranes, and a simple method for coating native polysaccharides onto nitrocellulose are some of the methods involving either the manipulation of membranes with transferred proteins or just a passive transfer of antigens to membranes. All these methods are briefly reviewed in this chapter.

Outcomes of Corneal Cross-Linking Correlate With Cone-Specific Lysyl Oxidase Expression in Patients With Keratoconus.

PubMed

Shetty, Rohit; Rajiv Kumar, Nimisha; Pahuja, Natasha; Deshmukh, Rashmi; Vunnava, KrishnaPoojita; Abilash, Valsala Gopalakrishnan; Sinha Roy, Abhijit; Ghosh, Arkasubhra

2018-03-01

To evaluate the correlation of visual and keratometry outcomes after corneal cross-linking (CXL) in patients with keratoconus with cone epithelium-specific gene expression levels. Corneal epithelium was obtained from 35 eyes that underwent accelerated CXL (KXLII, 9 mW/cm for 10 min). Using corneal topography, epithelium over the cone and periphery was obtained separately from each subject. The ratio of gene expression for lysyl oxidase (LOX), matrix metalloproteinase 9 (MMP9), bone morphogenic protein 7, tissue inhibitor of metalloproteinase 1, collagen, type I, alpha 1, and collagen, type IV, alpha 1 (COL IVA1) from the cone and peripheral cornea was correlated with the outcome of cross-linking surgery. Patients were assessed for visual acuity, keratometry, refraction, and corneal densitometry before and 6 months after surgery. Based on the change in corneal flattening indicated by ΔKmax, the outcomes were classified as a higher response or lower response. Reduction in keratometric indices correlated with improved spherical equivalent after CXL. Preoperative levels of cone-specific LOX expression in cases with a higher response were significant (P = 0.001). COL IVA1, bone morphogenic protein 7, and tissue inhibitor of metalloproteinase 1 gene expressions were reduced in the cones of the subjects with a lower response. MMP9 levels were relatively lower in cases with a higher response compared with those with a lower response. Our study demonstrates that preoperative levels of molecular factors such as LOX, MMP9, and COL IVA1 aid in understanding CXL outcomes at the tissue level.

Doping dose of salbutamol and exercise training: impact on the skeleton of ovariectomized rats.

PubMed

Bonnet, N; Laroche, N; Beaupied, H; Vico, L; Dolleans, E; Benhamou, C L; Courteix, D

2007-08-01

Previous studies in healthy rats have demonstrated a deleterious bone impact of beta-agonist treatment. The purpose of this study was to examine the trabecular and cortical effects of beta(2)-agonists at doping dose on treadmill exercising rats with estrogen deficiency. Adult female rats were ovariectomized (OVX; n = 44) or sham operated (n = 12). Then, OVX rats received a subcutaneous injection of salbutamol (SAB) or vehicle with (EXE) or without treadmill exercise for 10 wk. Bone mineral density (BMD) was analyzed by densitometry. Microcomputed tomography and histomorphometric analysis were performed to study trabecular bone structure and bone cell activities. After 10 wk, SAB rats presented a much more marked decrease of BMD and trabecular parameters. Exercise did not change the high level of bone resorption in OVX EXE SAB compared with OVX SAB group (both on COOH-terminal collagen cross-links and osteoclast number). These results confirm the deleterious effect of beta(2)-agonists on bone quantity (femoral BMD gain: OVX EXE, +6.8%, vs. OVX EXE SAB, -1.8%; P < 0.01) and quality (-8.0% of femoral trabecular thickness in OVX EXE SAB vs. OVX EXE), indicating that SAB suppresses the effect of EXE in OVX rats. Furthermore, we notice that the slight beneficial effect of exercise was mainly localized in the tibia. These findings indicate the presence of a bone alteration threshold below which there is no more alteration in structural bone quantity and quality. The negative effects of SAB on bone observed in this study in trained rats may indicate potential complications in doping female athletes with exercise-induced amenorrhea.

Please Don't Move-Evaluating Motion Artifact From Peripheral Quantitative Computed Tomography Scans Using Textural Features.

PubMed

Rantalainen, Timo; Chivers, Paola; Beck, Belinda R; Robertson, Sam; Hart, Nicolas H; Nimphius, Sophia; Weeks, Benjamin K; McIntyre, Fleur; Hands, Beth; Siafarikas, Aris

Most imaging methods, including peripheral quantitative computed tomography (pQCT), are susceptible to motion artifacts particularly in fidgety pediatric populations. Methods currently used to address motion artifact include manual screening (visual inspection) and objective assessments of the scans. However, previously reported objective methods either cannot be applied on the reconstructed image or have not been tested for distal bone sites. Therefore, the purpose of the present study was to develop and validate motion artifact classifiers to quantify motion artifact in pQCT scans. Whether textural features could provide adequate motion artifact classification performance in 2 adolescent datasets with pQCT scans from tibial and radial diaphyses and epiphyses was tested. The first dataset was split into training (66% of sample) and validation (33% of sample) datasets. Visual classification was used as the ground truth. Moderate to substantial classification performance (J48 classifier, kappa coefficients from 0.57 to 0.80) was observed in the validation dataset with the novel texture-based classifier. In applying the same classifier to the second cross-sectional dataset, a slight-to-fair (κ = 0.01-0.39) classification performance was observed. Overall, this novel textural analysis-based classifier provided a moderate-to-substantial classification of motion artifact when the classifier was specifically trained for the measurement device and population. Classification based on textural features may be used to prescreen obviously acceptable and unacceptable scans, with a subsequent human-operated visual classification of any remaining scans. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Methods for assessing fracture risk prediction models: experience with FRAX in a large integrated health care delivery system.

PubMed

Pressman, Alice R; Lo, Joan C; Chandra, Malini; Ettinger, Bruce

2011-01-01

Area under the receiver operating characteristics (AUROC) curve is often used to evaluate risk models. However, reclassification tests provide an alternative assessment of model performance. We performed both evaluations on results from FRAX (World Health Organization Collaborating Centre for Metabolic Bone Diseases, University of Sheffield, UK), a fracture risk tool, using Kaiser Permanente Northern California women older than 50yr with bone mineral density (BMD) measured during 1997-2003. We compared FRAX performance with and without BMD in the model. Among 94,489 women with mean follow-up of 6.6yr, 1579 (1.7%) sustained a hip fracture. Overall, AUROCs were 0.83 and 0.84 for FRAX without and with BMD, suggesting that BMD did not contribute to model performance. AUROC decreased with increasing age, and BMD contributed significantly to higher AUROC among those aged 70yr and older. Using an 81% sensitivity threshold (optimum level from receiver operating characteristic curve, corresponding to 1.2% cutoff), 35% of those categorized above were reassigned below when BMD was added. In contrast, only 10% of those categorized below were reassigned to the higher risk category when BMD was added. The net reclassification improvement was 5.5% (p<0.01). Two versions of this risk tool have similar AUROCs, but alternative assessments indicate that addition of BMD improves performance. Multiple methods should be used to evaluate risk tool performance with less reliance on AUROC alone. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Rod Photopigment Kinetics After Photodisruption of the Retinal Pigment Epithelium

PubMed Central

Masella, Benjamin D.; Hunter, Jennifer J.; Williams, David R.

2014-01-01

Purpose. Advances in retinal imaging have led to the discovery of long-lasting retinal changes caused by light exposures below published safety limits, including disruption of the RPE. To investigate the functional consequences of RPE disruption, we combined adaptive optics ophthalmoscopy with retinal densitometry. Methods. A modified adaptive optics scanning light ophthalmoscope (AOSLO) measured the apparent density and regeneration rate of rhodopsin in two macaques before and after four different 568-nm retinal radiant exposures (RREs; 400–3200 J/cm2). Optical coherence tomography (OCT) was used to measure the optical path length through the photoreceptor outer segments before and after RPE disruption. Results. All tested RREs caused visible RPE disruption. Apparent rhodopsin density was significantly reduced following 1600 (P = 0.01) and 3200 J/cm2 (P = 0.007) exposures. No significant change in apparent density was observed in response to 800 J/cm2. Surprisingly, exposure to 400 J/cm2 showed a significant increase in apparent density (P = 0.047). Rhodopsin recovery rate was not significantly affected by these RREs. Optical coherence tomography measurements showed a significant decrease in the optical path length through the photoreceptor outer segments for RREs above 800 J/cm2 (P < 0.001). Conclusions. At higher RREs, optical path length through the outer segments was reduced. However, the rate of photopigment regeneration was unchanged. While some ambiguity remains as to the correlation between measured reflectivity and absolute rhodopsin density; at the lowest RREs, RPE disruption appears not to be accompanied by a loss of apparent rhodopsin density, which would have been indicative of functional loss. PMID:25316724

Downregulation of cell surface molecules during noncytopathic infection of T cells with human immunodeficiency virus.

PubMed Central

Stevenson, M; Zhang, X H; Volsky, D J

1987-01-01

Noncytopathic infection of human T-lymphoid cell line CR-10 with human immunodeficiency virus (HIV) (CEM-N1T isolate) resulted in a gradual loss of cell surface receptors for OKT4/OKT4A (HIV receptor), OKT8, OKT3, and OKT11 but not for OKT9 (transferrin receptor) within 10 days after infection. Surface receptor decline was accompanied by a rapid increase in HIV antigens and mRNA expression. Multireceptor downregulation was also observed in three T-lymphoid cell lines (MT-4, CEM, and HBD-1) cytopathically infected with the HIV/N1T virus and in HUT-78 cells infected with the HIV/SF-2 isolate. HIV-infected and uninfected CR-10 cells contained similar levels of mRNAs coding for T3, T8, T9, T11, HLA-A2, and HLA-B7 proteins. By densitometry, fully infected CR-10 cells showed approximately 75% reduction in T4 and tubulin (beta chain) mRNA levels when compared with uninfected CR-10 cells. No such reduction was detected in HIV-infected MT-4 and HBD-1 cells. A T-cell receptor gene (beta chain) rearrangement study revealed that no distinct CR-10 subpopulation was selected out upon infection with HIV. Our results suggest that the reduction in cell surface receptors observed between 1 and 2 weeks postinfection cannot be directly attributed to similar reductions in mRNA levels coding for these receptor proteins. We conclude that HIV infection induces posttranscriptional downregulation of several T-cell surface receptors. Images PMID:3500327

Chinese Herbal Medicine for Osteoporosis: A Meta-analysis of Randomized Controlled Trials.

PubMed

Jin, Yong-Xiang; Wu, Peng; Mao, Yi-Fan; Wang, Bo; Zhang, Jia-Feng; Chen, Wen-Liang; Liu, Zhong; Shi, Xiao-Lin

Osteoporosis is a major public health problem in the elderly population. Several studies have suggested that Chinese herbal medicine has antiosteoporotic activities that might be beneficial for osteoporosis. This study aimed to assess the effectiveness of Chinese herbal medicine in osteoporosis patients. We comprehensively searched for randomized controlled trials (until December 2016) that compared Chinese herbal medicine with Western medicine in adults with osteoporosis and reported bone mineral densities (BMDs). A total of 10 randomized controlled trials were included. The pooled results suggested that the increased spine BMD was lower but not significant in the Chinese herbal medicine group than in the Western drug group (standard mean difference [SMD] = -0.11, 95% confidence interval [CI]: -0.62 to 0.39, p > 0.05). In the subgroup analysis, in postmenopausal women, Chinese herbal medicine also showed a insignificantly higher increment in BMD than the control group (SMD = 0.22, 95% CI: -0.00 to 0.43, p = 0.05). For different treatment durations, subgroups over 6 mo (SMD = 0.09, 95% CI: -0.24 to 0.41, p > 0.05) and less than 6 mo (SMD = -0.25, 95% CI: -1.14 to 0.64, p > 0.05) showed comparable BMDs between the 2 therapies. Our study demonstrated that Chinese herbal medicine alone did not significantly increase lumbar spine BMD. Further studies with better adherence to the intervention are needed to confirm the results of this meta-analysis. Copyright © 2017 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Low bone mineral density in Greek patients with inflammatory bowel disease: prevalence and risk factors.

PubMed

Koutroubakis, Ioannis E; Zavos, Christos; Damilakis, John; Papadakis, Georgios Z; Neratzoulakis, John; Karkavitsas, Nikolaos; Kouroumalis, Elias A

2011-01-01

A high prevalence of osteopenia and osteoporosis is observed in patients with inflammatory bowel disease (IBD). Various risk factors of bone loss have been suggested in IBD. The aim of the present study was to investigate the prevalence of low bone mineral density (BMD) and to identify related risk factors in Greek patients with IBD. One hundred and eighteen consecutive IBD patients were included. All patients underwent bone densitometry by dual energy X-ray absorptiometry at the femoral neck and lumbar spine levels. Serum levels of 25 hydroxyvitamin D (25 OH D), 1.25 dihydroxyvitamin D (1.25 OH 2D), osteocalcin, calcitonin and homocysteine were measured in all participants. Forty (33.9%) patients were normal, 55 (46.6%) were osteopenic, and 23 (19.5%) were osteoporotic. No significant differences between IBD patients with osteopenia or osteoporosis and those with normal BMD concerning the use of steroids and the examined biochemical markers were found. Statistically significant differences among the three groups were found for body mass index (BMI), age and disease duration (P=0.002, P<0.0001 and P=0.03 respectively). Multivariate analysis revealed that the most significant factors associated with BMD were age and BMI (P<0.0001). A weak but statistically significant correlation was also found for disease duration (P=0.04). There is a high prevalence of osteopenia and osteoporosis in Greek patients with IBD. Low BMI, age and disease duration are the most important independent risk factors for osteoporosis in Greek IBD patients.

Three-genome mosses: complex double allopolyploid origins for triploid gametophytes in Sphagnum.

PubMed

Karlin, Eric F; Boles, S B; Ricca, M; Temsch, E M; Greilhuber, J; Shaw, A J

2009-04-01

This paper documents the occurrence of allotriploidy (having three differentiated genomes) in gametophytes of two Southern Hemisphere Sphagnum species (S. australe, S. falcatulum). The pattern of microsatellite alleles indicates that both species are composed of a complex of allodiploid and allotriploid gametophytes, with the latter resulting from two allopolyploidization events. No haploid (n = x) gametophytes were found for either species. The ploidal levels suggested by the pattern of microsatellite alleles were confirmed by flow cytometry and Feulgen DNA image densitometry. For both S. australe and S. falcatulum, the respective allodiploid plants (or their ancestors) are one of the parent species of the allotriploid plants. This is the first report of triploidy in Sphagnum gametophytes occurring in nature and also the first report of the presence of three differentiated genomes in any bryophyte. It is also the first report of intersectional allopolyploidy in Sphagnum, with S. australe appearing to have parental species from Sphagnum sections Rigida and Sphagnum, and S. falcatulum having parental species from Sphagnum sections Cuspidata and Subsecunda. In both species, the allotriploid cytotypes were the most prevalent cytotype on the South Island of New Zealand. The pattern of microsatellite alleles shows the presence of two genetically distinct populations of allodiploid S. australe, possibly indicating multiple origins of polyploidy for that allodiploid cytotype. Morphological evidence is also highly indicative of recurrent polyploidy in the allotriploid cytotype of S. falcatulum. Allopolyploidy has clearly played a major evolutionary role in these two Southern Hemisphere taxa. This study, in conjunction with other recent research, indicates that allopolyploidy is a common, if not the predominant, form of polyploidy in Sphagnum.

Establishing an integrated gastroenterology service between a medical center and the community.

PubMed

Niv, Yaron; Dickman, Ram; Levi, Zohar; Neumann, Gadi; Ehrlich, Dorit; Bitterman, Haim; Dreiher, Jacob; Cohen, Arnon; Comaneshter, Doron; Halpern, Eyran

2015-02-21

To combine community and hospital services in order to enable improvements in patient management, an integrated gastroenterology service (IGS) was established. Referral patterns to specialist clinics were optimized; open access route for endoscopic procedures (including esophago-gastro-duodenoscopy, sigmoidoscopy and colonoscopy) was established; family physicians' knowledge and confidence were enhanced; direct communication lines between experts and primary care physicians were opened. Continuing education, guidelines and agreed instructions for referral were promoted by the IGS. Six quality indicators were developed by the Delphi method, rigorously designed and regularly monitored. Improvement was assessed by comparing 2010, 2011 and 2012 indicators. An integrated delivery system in a specific medical field may provide a solution to a fragmented healthcare system impaired by a lack of coordination. In this paper we describe a new integrated gastroenterology service established in April 2010. Waiting time for procedures decreased: 3 mo in April 30th 2010 to 3 wk in April 30th 2011 and stayed between 1-3 wk till December 30th 2012. Average cost for patient's visit decreased from 691 to 638 NIS (a decrease of 7.6%). Six health indicators were improved significantly comparing 2010 to 2012, 2.5% to 67.5%: Bone densitometry for patients with inflammatory bowel disease, preventive medications for high risk patients on aspirin/NSAIDs, colonoscopy following positive fecal occult blood test, gastroscopy in Barrett's esophagus, documentation of family history of colorectal cancer, and colonoscopy in patients with a family history of colorectal cancer. Establishment of an IGS was found to effectively improve quality of care, while being cost-effective.

Protective effect of myo-inositol hexaphosphate (phytate) on bone mass loss in postmenopausal women.

PubMed

López-González, Angel A; Grases, Félix; Monroy, Nieves; Marí, Bartolome; Vicente-Herrero, Ma Teófila; Tur, Fernando; Perelló, Joan

2013-03-01

The objective of this paper was to evaluate the relationship between urinary concentrations of InsP6, bone mass loss and risk fracture in postmenopausal women. A total of 157 postmenopausal women were included in the study: 70 had low (≤0.76 μM), 42 intermediate (0.76-1.42 μM) and 45 high (≥1.42 μM) urinary phytate concentrations. Densitometry values for neck were measured at enrollment and after 12 months (lumbar spine and femoral neck), and 10-year risk fracture was calculated using the tool FRAX(®). Individuals with low InsP6 levels had significantly greater bone mass loss in the lumbar spine (3.08 ± 0.65 % vs. 0.43 ± 0.55 %) than did those with high phytate levels. Moreover, a significantly greater percentage of women with low than with high InsP6 levels showed more than 2 % of bone mass loss in the lumbar spine (55.6 vs. 20.7 %). The 10-year fracture probability was also significantly higher in the low-phytate group compared to the high-phytate group, both in hip (0.37 ± 0.06 % vs 0.18 ± 0.04 %) and major osteoporotic fracture (2.45 ± 0.24 % vs 1.83 ± 0.11 %). It can be concluded that high urinary phytate concentrations are correlated with reduced bone mass loss in lumbar spine over 12 months and with reduced 10-year probability of hip and major osteoporotic fracture, indicating that increased phytate consumption can prevent development of osteoporosis.

Definition of osteoporosis by bone density criteria in men: effect of using female instead of male young reference data depends on skeletal site and densitometer manufacturer.

PubMed

Schousboe, John T; Tanner, S Bobo; Leslie, William D

2014-01-01

Whether to use young male or young female reference data to calculate bone mineral density (BMD) T-scores in men remains controversial. The third National Health and Nutrition Examination and Survey (NHANES III) data show that the mean and standard deviation of femoral neck and total hip BMD is greater in young men than young women, and therefore differences in T-scores at these sites using NHANES III female vs male norms becomes less as BMD decreases. In contrast, manufacturer-specific reference databases generally assume similar standard deviations of BMD in men and women. Using NHANES III reference data for the femoral neck and total hip, respectively we found that men with T-scores of -2.5 when young male norms are used have T-scores of -2.4 and -2.3 when young female norms are used. Using manufacturer-specific reference data, we found that men with T-scores of -2.5 when young male norms are used at the femoral neck, total hip, lumbar spine, or one-third of the forearm would have T-scores ranging from -2.4 to -0.4 when young female norms are used, depending on skeletal site and densitometer manufacturer. The change of proportions of men diagnosed with osteoporosis when young female norms are used instead of young male reference data differs substantially according to skeletal site and densitometer manufacturer. Copyright © 2014 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Methods and application of bone densitometry in clinical diagnosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wahner, H.W.; Riggs, B.L.

1986-01-01

With the awareness of osteoporosis as a major health problem for an aging population, there is great interest in early recognition and treatment of abnormal bone loss. Effective prevention of bone loss has to occur prior to the occurrence of irreparable damage. Standard radiographic procedures are not sensitive enough for the task. Therefore, a number of alternative procedures to estimate bone loss have been developed over the years, ranging from efforts to quantitate information obtained from radiographic images to sophisticated procedures such as neutron activation analysis or procedures based on the Compton scatter phenomenon. Only two procedures, photon absorptiometry andmore » computed tomography (CT), have emerged as applicable for routine clinical use. In photon absorptiometry the entire bone mineral (cortical and trabecular bone) of a specific skeletal site is measured. CT allows measuring of bone mineral of trabecular or cortical bone alone. Normally, bone mass reaches a maximum in the third decade and then continuously declines. This age-related bone loss is greater in women in whom an accelerated rate of loss occurs at the menopause. When bone density reaches a critical fracture threshold, skeletal fractures occur (spine, hip, and distal long bones). The age at which this critical fracture threshold is reached depends on the maximal bone mass achieved in early adulthood and the rate of loss with increasing age. With the exception of NaF, present-day therapeutic efforts only retard or prevent bone loss but do not significantly add bone mineral to the skeleton. Recognition of high-risk groups and early treatment are therefore required. 79 references.« less

Radiocarbon Dating and Wood Density Chronologies of Mangrove Trees in Arid Western Australia

PubMed Central

Santini, Nadia S.; Hua, Quan; Schmitz, Nele; Lovelock, Catherine E.

2013-01-01

Mangrove trees tend to be larger and mangrove communities more diverse in tropical latitudes, particularly where there is high rainfall. Variation in the structure, growth and productivity of mangrove forests over climatic gradients suggests they are sensitive to variations in climate, but evidence of changes in the structure and growth of mangrove trees in response to climatic variation is scarce. Bomb-pulse radiocarbon dating provides accurate dates of recent wood formation and tree age of tropical and subtropical tree species. Here, we used radiocarbon techniques combined with X-ray densitometry to develop a wood density chronology for the mangrove Avicennia marina in the Exmouth Gulf, Western Australia (WA). We tested whether wood density chronologies of A. marina were sensitive to variation in the Pacific Decadal Oscillation Index, which reflects temperature fluctuations in the Pacific Ocean and is linked to the instrumental rainfall record in north WA. We also determined growth rates in mangrove trees from the Exmouth Gulf, WA. We found that seaward fringing A. marina trees (∼10 cm diameter) were 48±1 to 89±23 years old (mean ± 1σ) and that their growth rates ranged from 4.08±2.36 to 5.30±3.33 mm/yr (mean ±1σ). The wood density of our studied mangrove trees decreased with increases in the Pacific Decadal Oscillation Index. Future predicted drying of the region will likely lead to further reductions in wood density and their associated growth rates in mangrove forests in the region. PMID:24265797

Succination of Thiol Groups in Adipose Tissue Proteins in Diabetes

PubMed Central

Frizzell, Norma; Rajesh, Mathur; Jepson, Matthew J.; Nagai, Ryoji; Carson, James A.; Thorpe, Suzanne R.; Baynes, John W.

2009-01-01

S-(2-Succinyl)cysteine (2SC) is formed by reaction of the Krebs cycle intermediate fumarate with cysteine residues in protein, a process termed succination of protein. Both fumarate and succination of proteins are increased in adipocytes cultured in high glucose medium (Nagai, R., Brock, J. W., Blatnik, M., Baatz, J. E., Bethard, J., Walla, M. D., Thorpe, S. R., Baynes, J. W., and Frizzell, N. (2007) J. Biol. Chem. 282, 34219–34228). We show here that succination of protein is also increased in epididymal, mesenteric, and subcutaneous adipose tissue of diabetic (db/db) mice and that adiponectin is a major target for succination in both adipocytes and adipose tissue. Cys-39, which is involved in cross-linking of adiponectin monomers to form trimers, was identified as a key site of succination of adiponectin in adipocytes. 2SC was detected on two of seven monomeric forms of adiponectin immunoprecipitated from adipocytes and epididymal adipose tissue. Based on densitometry, 2SC-adiponectin accounted for ∼7 and 8% of total intracellular adiponectin in cells and tissue, respectively. 2SC was found only in the intracellular, monomeric forms of adiponectin and was not detectable in polymeric forms of adiponectin in cell culture medium or plasma. We conclude that succination of adiponectin blocks its incorporation into trimeric and higher molecular weight, secreted forms of adiponectin. We propose that succination of proteins is a biomarker of mitochondrial stress and accumulation of Krebs cycle intermediates in adipose tissue in diabetes and that succination of adiponectin may contribute to the decrease in plasma adiponectin in diabetes. PMID:19592500

Augmented Reality for Real-Time Detection and Interpretation of Colorimetric Signals Generated by Paper-Based Biosensors.

PubMed

Russell, Steven M; Doménech-Sánchez, Antonio; de la Rica, Roberto

2017-06-23

Colorimetric tests are becoming increasingly popular in point-of-need analyses due to the possibility of detecting the signal with the naked eye, which eliminates the utilization of bulky and costly instruments only available in laboratories. However, colorimetric tests may be interpreted incorrectly by nonspecialists due to disparities in color perception or a lack of training. Here we solve this issue with a method that not only detects colorimetric signals but also interprets them so that the test outcome is understandable for anyone. It consists of an augmented reality (AR) app that uses a camera to detect the colored signals generated by a nanoparticle-based immunoassay, and that yields a warning symbol or message when the concentration of analyte is higher than a certain threshold. The proposed method detected the model analyte mouse IgG with a limit of detection of 0.3 μg mL -1 , which was comparable to the limit of detection afforded by classical densitometry performed with a nonportable device. When adapted to the detection of E. coli, the app always yielded a "hazard" warning symbol when the concentration of E. coli in the sample was above the infective dose (10 6 cfu mL -1 or higher). The proposed method could help nonspecialists make a decision about drinking from a potentially contaminated water source by yielding an unambiguous message that is easily understood by anyone. The widespread availability of smartphones along with the inexpensive paper test that requires no enzymes to generate the signal makes the proposed assay promising for analyses in remote locations and developing countries.

Ocular forward light scattering and corneal backward light scattering in patients with dry eye.

PubMed

Koh, Shizuka; Maeda, Naoyuki; Ikeda, Chikako; Asonuma, Sanae; Mitamura, Hayato; Oie, Yoshinori; Soma, Takeshi; Tsujikawa, Motokazu; Kawasaki, Satoshi; Nishida, Kohji

2014-09-18

To evaluate ocular forward light scattering and corneal backward light scattering in patients with dry eye. Thirty-five eyes in 35 patients with dry eye and 20 eyes of 20 healthy control subjects were enrolled. The 35 dry eyes were classified into two groups according to whether superficial punctate keratopathy in the central 6-mm corneal zone (cSPK) was present or not. Ocular forward light scattering was quantified with a straylight meter. Corneal backward light scattering from the anterior, middle, and posterior corneal parts was assessed with a corneal densitometry program using the Scheimpflug imaging system. Both dry eye groups had significantly higher intraocular forward light scattering than the control group (both P<0.05). The dry eye group with cSPK had significantly higher values in anterior and total corneal backward light scattering than the other two groups. Moderate positive correlations were observed between the cSPK score and corneal backward light scattering from the anterior cornea (R=0.60, P<0.001) and corneal backward light scattering from the total cornea (R=0.54, P<0.001); however, no correlation was found between cSPK score and ocular forward light scattering (R=0.01, P=0.932). Ocular forward light scattering and corneal backward light scattering from the anterior cornea were greater in dry eyes than in normal eyes. Increased corneal backward light scattering in dry eye at least partially results from cSPK overlying the optical zone. Copyright 2014 The Association for Research in Vision and Ophthalmology, Inc.

Human placental peroxisome proliferator-activated receptor delta and gamma expression in healthy pregnancy and in preeclampsia and intrauterine growth restriction.

PubMed

Rodie, Vanessa A; Young, Anne; Jordan, Fiona; Sattar, Naveed; Greer, Ian A; Freeman, D J

2005-07-01

Human and animal studies have demonstrated that peroxisome proliferator-activated receptors (PPARs) are important in placental development and play key roles in metabolism and inflammation. We studied placental PPARdelta, PPARgamma, and retinoid X receptor alpha (RXRalpha) expression in healthy pregnancy and in preeclampsia (PET) and intrauterine growth restriction (IUGR). Using immunocytochemistry, PPARdelta, PPARgamma, and RXRalpha were localized to the cyto- and syncytiotrophoblast and invading trophoblast columns in first and second trimester placentas. Third trimester placentas from healthy pregnancy, and in PET and IUGR, demonstrated PPARdelta, PPARgamma, and RXRalpha staining within the syncytium, and localization within isolated cells in the stroma. In uncomplicated pregnancies, PPARdelta mRNA expression (PPARdelta:18s ratio, third trimester median 0.43 [interquartile (IQ) range 0.26-0.52] vs first trimester 0.20 [0.00-0.26], P = .03) and PPARdelta protein expression (third trimester 3.94 [2.45-4.68] vs first trimester 1.29 [0.78-2.29] optical densitometry [OD] mm(2), P = .04) were higher in the third trimester than in the first trimester. There were no consistent differences in PPARdelta, PPARgamma, or RXRalpha mRNA and protein expression among PET or IUGR placentas and controls. PPARdelta expression is up-regulated between the first and third trimester, indicating a role for this nuclear receptor in placental function. We found no evidence that placental PPARdelta, PPARgamma, and RXRalpha expression is changed in PET or IUGR. This suggests that changes in total placental PPAR expression are not involved in the pathophysiology of these conditions.

Comparison of endogenous feline leukemia virus RNA content in feline vaccine and nonvaccine site-associated sarcomas.

PubMed

Kidney, B A; Ellis, J A; Haines, D M; Jackson, M L

2001-12-01

To determine whether feline vaccine site-associated sarcomas (VSS) contain a higher amount of endogenous FeLV (enFeLV) RNA, compared with feline nonvaccine site-associated sarcomas (non-VSS). Formalin-fixed paraffin-embedded (FFPE) tissues from 50 VSS and 50 cutaneous non-VSS. RNA was extracted from FFPE sections of each tumor, and regions of the long terminal repeat (LTR) and envelope (env) gene of enFeLV were amplified by use of reverse transcriptase-polymerase chain reaction (RT-PCR). The density of each RT-PCR product band for enFeLV was compared with that of a constitutively expressed gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). An integrated density value (IDV) was determined by use of densitometry, and the IDV ratio for enFeLV to GAPDH was calculated for each enFeLV primer set. The median (interquartile range) of the IDV ratio for the enFeLV LTR primer set was 0.52 (0.26 to 1.17) for the VSS group and 0.84 (0.21 to 1.53) for the non-VSS group. The median (interquartile range) of the IDV ratio for the enFeLV env primer set was 0.60 (0.37 to 0.91) for the VSS group and 0.59 (0.36 to 1.09) for the non-VSS group. Because the amount of enFeLV RNA within the LTR and env gene was not significantly different between the VSS and non-VSS groups, enFeLV replication or expression is unlikely to be involved in VSS development.

Falls, fractures and bone density in Parkinson's disease - a cross-sectional study.

PubMed

Tassorelli, Cristina; Berlangieri, Mariangela; Buscone, Simona; Bolla, Monica; De Icco, Roberto; Baricich, Alessio; Pacchetti, Claudio; Cisari, Carlo; Sandrini, Giorgio

2017-04-01

Evidence suggests that falls and associated bone fractures are more frequent in patients suffering from Parkinson's disease (PD) than in the general population. In this cross-sectional study we evaluated the clinical and biochemical characteristics that are associated to falls, fractures and bone health in a population of PD subjects. Forty-two consecutive subjects suffering from idiopathic PD (mild-to-moderate severity) with/without falls in the previous year were included. They were characterized as regards functional independence, balance, fear of falling, bone density (ultrasound densitometry) and plasma levels of vitamin D. Twenty-one age- and sex-matched healthy subjects were evaluated as controls. We detected a greater degree of osteoporosis in PD subjects as compared to controls, more pronounced in males than in females (Z-score: M -3.8 ± 1.6, F -2.28 ± 0.92, p = 0.0006). A positive correlation was found between independence levels and bone density or vitamin D levels. Twenty seven patients (64%) reported falls in the previous year. These were associated to post-traumatic fractures in 16 subjects (59% of fallers). Women fell more than men (fallers: 20 F/7 M; non fallers: 4 F/11 M, χ² test p = 0.02), although the occurrence of post-traumatic fractures among fallers did not differ between sexes (F 11/9, M 5/2, χ² test p > 0.05). Fallers with post-traumatic fractures showed higher degrees of motor impairment. These findings confirm that falls and osteoporosis represent major health issues in PD, already in the middle stages of disease.

Osteoporosis in men.

PubMed

Binkley, Neil

2006-08-01

Osteoporosis is defined as "a systemic skeletal disease characterized by low bone mass and microarchitectural deterioration of bone tissue with a consequent increase in bone fragility and susceptibility to fracture". Approximately 40-50% of women sustain osteoporotic fractures in their lifetime; as such, it is appropriate that studies initially focused upon females. Despite an increased recognition of osteoporotic fractures in men, there continues to be neglect of this disease in males. This ongoing neglect is inappropriate as 25-33% of men in some populations will sustain osteoporotic fractures in their lifetime. Testosterone plays an important role in male skeletal health. However, recent data suggest that estrogen may in fact be the dominant hormone regulating skeletal status in both men and women. BMD measurement may be utilized for osteoporosis diagnosis and to assist with fracture risk prediction in men prior to their sustaining a fracture. Recognizing this need, the International Society for Clinical Densitometry (ISCD) recommended and recently reaffirmed use of a BMD T-score of -2.5 or below be utilized to diagnose osteoporosis in men. Androgen therapy of hypogonadal men may be considered with the caveat that data do not exist to document that this treatment reduces fracture risk. At this time, the data is inadequate to support use of androgen treatment in eugonadal men with osteoporosis. Parathyroid hormone treatment does increase BMD; existing studies have not been of adequate size or duration to document fracture reduction efficacy. Bisphosphonate therapy increases BMD, reduces vertebral fracture risk and is considered the standard of care for osteoporotic men at this point in time.

DXA in the assessment of subchondral bone mineral density in knee osteoarthritis--A semi-standardized protocol after systematic review.

PubMed

Sepriano, Alexandre; Roman-Blas, Jorge A; Little, Robert D; Pimentel-Santos, Fernando; Arribas, Jose María; Largo, Raquel; Branco, Jaime C; Herrero-Beaumont, Gabriel

2015-12-01

Subchondral bone mineral density (sBMD) contributes to the initiation and progression of knee osteoarthritis (OA). Reliable methods to assess sBMD status may predict the response of specific OA phenotypes to targeted therapies. While dual-energy X-ray absorptiometry (DXA) of the knee can determine sBMD, no consensus exists regarding its methodology. Construct a semi-standardized protocol for knee DXA to measure sBMD in patients with OA of the knee by evaluating the varying methodologies present in existing literature. We performed a systematic review of original papers published in PubMed and Web of Science from their inception to July 2014 using the following search terms: subchondral bone, osteoarthritis, and bone mineral density. DXA of the knee can be performed with similar reproducibility values to those proposed by the International Society for Clinical Densitometry for the hip and spine. We identified acquisition view, hip rotation, knee positioning and stabilization, ROI location and definition, and the type of analysis software as important sources of variation. A proposed knee DXA protocol was constructed taking into consideration the results of the review. DXA of the knee can be reliably performed in patients with knee OA. Nevertheless, we found substantial methodological variation across previous studies. Methodological standardization may provide a foundation from which to establish DXA of the knee as a valid tool for identification of SB changes and as an outcome measure in clinical trials of disease modifying osteoarthritic drugs. Copyright © 2015 Elsevier Inc. All rights reserved.

Analysis of fracture healing in osteopenic bone caused by disuse: experimental study.

PubMed

Paiva, A G; Yanagihara, G R; Macedo, A P; Ramos, J; Issa, J P M; Shimano, A C

2016-03-01

Osteoporosis has become a serious global public health issue. Hence, osteoporotic fracture healing has been investigated in several previous studies because there is still controversy over the effect osteoporosis has on the healing process. The current study aimed to analyze two different periods of bone healing in normal and osteopenic rats. Sixty, 7-week-old female Wistar rats were randomly divided into four groups: unrestricted and immobilized for 2 weeks after osteotomy (OU2), suspended and immobilized for 2 weeks after osteotomy (OS2), unrestricted and immobilized for 6 weeks after osteotomy (OU6), and suspended and immobilized for 6 weeks after osteotomy (OS6). Osteotomy was performed in the middle third of the right tibia 21 days after tail suspension, when the osteopenic condition was already set. The fractured limb was then immobilized by orthosis. Tibias were collected 2 and 6 weeks after osteotomy, and were analyzed by bone densitometry, mechanical testing, and histomorphometry. Bone mineral density values from bony calluses were significantly lower in the 2-week post-osteotomy groups compared with the 6-week post-osteotomy groups (multivariate general linear model analysis, P<0.000). Similarly, the mechanical properties showed that animals had stronger bones 6 weeks after osteotomy compared with 2 weeks after osteotomy (multivariate general linear model analysis, P<0.000). Histomorphometry indicated gradual bone healing. Results showed that osteopenia did not influence the bone healing process, and that time was an independent determinant factor regardless of whether the fracture was osteopenic. This suggests that the body is able to compensate for the negative effects of suspension.

A high-fat diet can affect bone healing in growing rats.

PubMed

Yamanaka, Jéssica Suzuki; Yanagihara, Gabriela Rezende; Carlos, Bruna Leonel; Ramos, Júnia; Brancaleon, Brígida Batista; Macedo, Ana Paula; Issa, João Paulo Mardegan; Shimano, Antônio Carlos

2018-05-01

A high-fat diet (HFD) can have a negative effect on bone quality in young and old people. Although bone healing in children is normally efficient, there is no evidence that children who have a diet rich in fat have compromised bone fracture regeneration compared with children with recommended dietary fat levels. The purpose of the present study was to evaluate the effects of an HFD on bone healing in growing female rats. Twenty-six postweaning female Wistar rats were divided into two groups (13 animals per group): a standard diet (SD) group and an HFD (with 60% of energy from fat) group. The rats received the assigned diets for 5 weeks, and in the third week they were submitted to an osteotomy procedure of the left tibia. Body mass and feed intake were recorded during the experiment. One day before euthanasia, an insulin tolerance test was performed. After euthanasia, the tibiae were removed and analyzed by densitometry, mechanical testing, histomorphometry, stereology and immunohistochemistry. An HFD caused an adaptive response to maintain energetic balance by decreasing feed intake and causing insulin insensitivity. There was no change in bone mineral density, collagen amount and immunostaining for bone formation, but maximal load and stiffness were decreased in the HFD group. In addition, bone volume had a tendency to be higher in the SD group than in the HFD group. Compared with rats receiving an SD, growing rats receiving an HFD for 5 weeks had similar bone mineral density but altered mechanical properties at the osteotomy defect site.

Measurement of percent oxyhemoglobin by optical densitometry in perfluorocarbon supplemented blood.

PubMed

Murrah, C P; Agnihotri, A K; Spruell, R D; Clymer-Hawk, J J; Ferguson, E R; Wiley, J H; Holman, W L

1996-01-01

A new generation of perfluorocarbon emulsions is being clinically evaluated as erythrocyte substitutes. However, the effect of perfluorocarbon emulsions on optical densitometric measurements of percent oxyhemoglobin (%O2Hb) has not been fully characterized. The purpose of this study is to quantify the effect of blood perfluorochemical concentration and hematocrit (Hct) on %O2Hb measurements. The authors hypothesize that perfluorocarbon emulsions affect the accuracy of %O2Hb measurements, and that the effect of perfluorochemical concentration and Hct on these measurements can be mathematically described. Porcine blood was used in this experiment. Blood with a Hct of 18% or 9% was mixed with a perfluorocarbon emulsion (Oxygent [AF0142]; Alliance Pharmaceutical Corporation, San Diego, CA). The concentrations tested were 0 g (Group I; n = 69 measurements for a Hct of 18%, and n = 35 measurements for a Hct of 9%), 0.73 g (Group II; n = 47 at 18%, n = 33 at 9%), 1.45 g (Group III; n = 46 at 18%, n = 30 at 9%), and 2.90 g (Group IV; n = 45 at 18%, n = 31 at 9%) of perfluorochemical per deciliter of blood (g PFC/dl). A tonometer was used to establish a range of oxygen tensions within each group while maintaining physiologic pH and PCO2. Error in %O2Hb measurements increases with higher perfluorochemical concentrations and lower Hct values. These errors in %O2Hb measurements are predictable; as such, an equation for correcting %O2Hb measurements in perfluorocarbon supplemented blood can be generated.

Astaxanthin modulates osteopontin and transforming growth factor β1 expression levels in a rat model of nephrolithiasis: a comparison with citrate administration.

PubMed

Alex, Manju; Sauganth Paul, M V; Abhilash, M; Mathews, Varghese V; Anilkumar, T V; Nair, R Harikumaran

2014-09-01

To evaluate the effect of astaxanthin on renal angiotensin-I converting enzyme (ACE) levels, osteopontin (OPN) and transforming growth factor β1 (TGF-β1) expressions and the extent of crystal deposition in experimentally induced calcium oxalate kidney stone disease in a male Wistar rat model. To compare the efficacy of astaxanthin treatment with a currently used treatment strategy (citrate administration) for kidney stones. The expression of OPN was assessed by immunohistochemistry. One step reverse transcriptase polymerase chain reaction followed by densitometry was used to assess renal OPN and TGF-β1 levels. Renal ACE levels were quantified by an enzyme-linked immunosorbent assay method. Crystal deposition in kidney was analysed by scanning electron microscopic (SEM)-energy-dispersive X-ray (EDX). The renal ACE levels and the expression of OPN and TGF-β1 were upregulated in the nephrolithiasis-induced rats. Astaxanthin treatment reduced renal ACE levels and the expression OPN and TGF-β1. SEM-EDX analysis showed that crystal deposition was reduced in the astaxanthin-treated nephrolithiatic group. Astaxanthin treatment was more effective than citrate administration in the regulation of renal ACE levels, OPN and TGF-β1 expressions. Astaxanthin administration reduced renal calcium oxalate crystal deposition possibly by modulating the renal renin-angiotensin system (RAS), which reduced the expression of OPN and TGF-β1 levels. Astaxanthin administration was more effective than citrate treatment in reducing crystal deposition and down-regulating the expression of OPN and TGF-β1. © 2013 The Authors. BJU International © 2013 BJU International.

Prenatal exposure to valproic acid leads to reduced expression of synaptic adhesion molecule neuroligin 3 in mice.

PubMed

Kolozsi, E; Mackenzie, R N; Roullet, F I; deCatanzaro, D; Foster, J A

2009-11-10

In rodents, a single administration of valproic acid (VPA) in utero leads to developmental delays and lifelong deficits in motor performance, social behavior, and anxiety-like behavior in the offspring. Recently, we have demonstrated that VPA mice show alterations in postnatal growth and development, and deficits in olfactory discrimination and social behavior early in development. Based on behavioral and molecular parallels between VPA rodents and individuals with autism, maternal challenge with VPA has been suggested to be a good animal model of autism. Neuroligins (NLGN) are a family of postsynaptic cell-adhesion molecules that play a role in synaptic maturation through association with their presynaptic partners, the neurexins (NRXN). Both NLGNs and NRXN members have been implicated in genetic studies of autism. In the present study, we examined changes at the level of expression of NLGN and NRXN mRNAs in the adult brain from mice exposed in utero to VPA. Mouse brain tissue was processed using in situ hybridization and analyzed with densitometry to examine expression of three NLGN genes (NLGN1, NLGN2, and NLGN3) and three NRXN genes (NRXN1, NRXN2, and NRXN3). Expression levels of NLGN1, NLGN2, NRXN1, NRXN2, and NRXN3 were observed to be similar in VPA and control mice. NLGN3 mRNA expression was found to be significantly lower in the VPA mice relative to control animals in hippocampal subregions, cornu ammonis (CA1) and dentate gyrus, and somatosensory cortex. This lowered expression may be linked to autistic-like behavioral phenotype observed in the VPA mice.

Handball Practice Enhances Bone Mass in Specific Sites Among Prepubescent Boys.

PubMed

Missawi, Kawther; Zouch, Mohamed; Chakroun, Yosra; Chaari, Hamada; Tabka, Zouhair; Bouajina, Elyès

2016-01-01

This investigation's purpose is to focus on the effects of practicing handball for at least 2 yr on bone acquisition among prepubescent boys. One hundred prepubescent boys aged 10.68 ± 0.85 yr were divided into 2 groups: 50 handball players (HP group) and 50 controls (C group). Bone mineral density (BMD), bone mineral content (BMC), and bone area (BA) were evaluated by using dual-photon X-ray absorptiometry on the whole body, lumbar spine (L2-L4), legs, arms, femoral necks, hips and radiuses. Results showed greater values of BMD in both right and left femoral neck and total hip in handball players than in controls. In addition, handball players had higher values of legs and right total hip BMC than controls without any obvious variation of BA measurement in all sites between groups. All results of the paired t-test displayed an obviously marked variation of bone mass parameters between the left and right sides in the trained group without any marked variation among controls. Data showed an increased BMD of the supporting sites between the left and the right leg among handball players. However, "BMC" results exhibited higher values in the right than in the left total hip, and in the right total radius than in the left correspondent site. In addition, differences in the "BA" measurements were observed in the left total hip and in the right arm. Specific bone sites are markedly stimulated by handball training in prepubescent boys. Copyright © 2016 International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Increasing incidence of hip fracture in Chiang Mai, Thailand.

PubMed

Wongtriratanachai, Prasit; Luevitoonvechkij, Sirichai; Songpatanasilp, Thawee; Sribunditkul, Siripoj; Leerapun, Taninnit; Phadungkiat, Sompant; Rojanasthien, Sattaya

2013-01-01

Hip fracture is a major health problem in Thailand. This study attempted to examine the incidence, related factors, and trends of hip fracture in Chiang Mai, Thailand. All hip fracture data among patients aged 50 yr or older were collected from hospitals in Chiang Mai, Thailand from August 1, 2006 to July 3, 2007. Data from the 1997 Chiang Mai hip fracture study were used for comparison. In the study period, 690 hip fractures were reported: 203 males and 487 females (male to female ratio was 1 to 2.4), with a mean age of 76.7 yr. The estimated cumulative incidence was 181.0 per 100,000, and the adjusted incidence was 253.3 (males: 135.9; females: 367.9). A simple fall was the most common mechanism (79%) of fracture, and 80% of the hip fractures occurred in patients aged 70 yr or older. The highest incidence of hip fracture was observed in patients older than 85 yr (1239). At 6 mo postfracture, most patients (61%) used a walking aid. Compared with the 1997 data, hip fracture incidence had increased by an average of 2% per yr, and the incidence of hip fracture had increased significantly from August 1, 2006 to July 31, 2007, especially in patients older than 75 yr. In patients older than 84 yr, the incidence increased by a factor of 2. Urgent strategies for the prevention and treatment of osteoporosis, and hence hip fracture, are needed. Copyright © 2013 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Evaluation of factors related to bone disease in Polish children and adolescents with cystic fibrosis.

PubMed

Sands, Dorota; Mielus, Monika; Umławska, Wioleta; Lipowicz, Anna; Oralewska, Beata; Walkowiak, Jarosław

2015-09-01

The aim of the study was to evaluate factors related to bone formation and resorption in Polish children and adolescents with cystic fibrosis and to examine the effect of nutritional status, biochemical parameters and clinical status on bone mineral density. The study group consisted of 100 children and adolescents with cystic fibrosis with a mean age 13.4 years old. Anthropometric measurements, included body height, body mass and body mass index (BMI); bone mineral densitometry and biochemical testing were performed. Bone mineral density was measured using a dual-energy X-ray absorption densitometer. Biochemical tests included serum calcium, phosphorus, parathyroid hormone and vitamin D concentrations, as well as 24-h urine calcium and phosphorus excretion. Pulmonary function was evaluated using FEV1%, and clinical status was estimated using the Shwachman-Kulczycki score. Standardized body height, body mass and BMI were significantly lower than in the reference population. Mean serum vitamin D concentration was decreased. Pulmonary disease was generally mild, with a mean FEV1% of 81%. Multivariate linear regression revealed that the only factors that had a significant effect on bone marrow density were BMI and FEV1%. There were no significant correlations between bone mineral density and the results of any of the biochemical tests performed. Nutritional status and bone mineral density were significantly decreased in children and adolescents with cystic fibrosis. In spite of abnormalities in biochemical testing, the factors that were found to have the strongest effect on bone mineral density were standardized BMI and clinical status. Copyright © 2015. Published by Elsevier Urban & Partner Sp. z o.o.

The soy isoflavones for reducing bone loss study: 3-yr effects on pQCT bone mineral density and strength measures in postmenopausal women.

PubMed

Shedd-Wise, Kristine M; Alekel, D Lee; Hofmann, Heike; Hanson, Kathy B; Schiferl, Dan J; Hanson, Laura N; Van Loan, Marta D

2011-01-01

Soy isoflavones exert inconsistent bone density-preserving effects, but the bone strength-preserving effects in humans are unknown. Our double-blind randomized controlled trial examined 2 soy isoflavone doses (80 or 120mg/d) vs placebo tablets on volumetric bone mineral density (vBMD) and strength (by means of peripheral quantitative computed tomography) in healthy postmenopausal women (46-63yr). We measured 3-yr changes in cortical BMD (CtBMD), cortical thickness (CtThk), periosteal circumference (PC), endosteal circumference (EC), and strength-strain index (SSI) at 1/3 midshaft femur (N=171), and trabecular BMD (TbBMD), PC, and SSI at 4% distal tibia (N=162). We found no treatment effect on femur CtThk, PC, or EC, or tibia TbBMD or PC. The strongest predictors (negative) of tibia TbBMD and SSI and femur CtBMD were timepoint and bone resorption; whole-body fat mass was protective of SSI. As time since last menstrual period (TLMP) increased (p=0.012), 120-mg/d dose was protective of CtBMD. The strongest predictors of femur SSI were timepoint, bone resorption, and TLMP (protective). Isoflavone tablets were negative predictors of SSI, but 80-mg/d dose became protective as bone turnover increased (p=0.011). Soy isoflavone treatment for 3yr was modestly beneficial for midshaft femur vBMD as TLMP increased and for midshaft femur SSI as bone turnover increased. Copyright © 2011 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

An ultrasound wearable system for the monitoring and acceleration of fracture healing in long bones.

PubMed

Protopappas, Vasilios C; Baga, Dina A; Fotiadis, Dimitrios I; Likas, Aristidis C; Papachristos, Athanasios A; Malizos, Konstantinos N

2005-09-01

An ultrasound wearable system for remote monitoring and acceleration of the healing process in fractured long bones is presented. The so-called USBone system consists of a pair of ultrasound transducers, implanted into the fracture region, a wearable device and a centralized unit. The wearable device is responsible to carry out ultrasound measurements using the axial-transmission technique and initiate therapy sessions of low-intensity pulsed ultrasound. The acquired measurements and other data are wirelessly transferred from the patient-site to the centralized unit, which is located in a clinical setting. The evaluation of the system on an animal tibial osteotomy model is also presented. A dataset was constructed for monitoring purposes consisting of serial ultrasound measurements, follow-up radiographs, quantitative computed tomography-based densitometry and biomechanical data. The animal study demonstrated the ability of the system to collect ultrasound measurements in an effective and reliable fashion and participating orthopaedic surgeons accepted the system for future clinical application. Analysis of the acquired measurements showed that the pattern of evolution of the ultrasound velocity through healing bones over the postoperative period monitors a dynamic healing process. Furthermore, the ultrasound velocity of radiographically healed bones returns to 80% of the intact bone value, whereas the correlation coefficient of the velocity with the material and mechanical properties of the healing bone ranges from 0.699 to 0.814. The USBone system constitutes the first telemedicine system for the out-hospital management of patients sustained open fractures and treated with external fixation devices.

Radiographic morphometry and densitometry predict strength of cadaveric proximal humeri more reliably than age and DXA scan density.

PubMed

Skedros, John G; Knight, Alex N; Pitts, Todd C; O'Rourke, Peter J; Burkhead, Wayne Z

2016-02-01

Methods are needed for identifying poorer quality cadaver proximal humeri to ensure that they are not disproportionately segregated into experimental groups for fracture studies. We hypothesized that measurements made from radiographs of cadaveric proximal humeri are stronger predictors of fracture strength than chronological age or bone density values derived from dual-energy x-ray absorptiometry (DXA) scans. Thirty-three proximal humeri (range: 39-78 years) were analyzed for: (1) bone mineral density (BMD, g/cm(2)) using DXA, (2) bulk density (g/cm(3)) using DXA and volume displacement, (3) regional bone density in millimeters of aluminum (mmAl) using radiographs, and (4) regional mean (medial+lateral) cortical thickness and cortical index (CI) using radiographs. The bones were then fractured simulating a fall. Strongest correlations with ultimate fracture load (UFL) were: mean cortical thickness at two diaphyseal locations (r = 0.71; p < 0.001), and mean mmAl in the humeral head (r = 0.70; p < 0.001). Weaker correlations were found between UFL and DXA-BMD (r = 0.60), bulk density (r = 0.43), CI (r = 0.61), and age (r = -0.65) (p values <0.01). Analyses between UFL and the product of any two characteristics showed six combinations with r-values >0.80, but none included DXA-derived density, CI, or age. Radiographic morphometric and densitometric measurements from radiographs are therefore stronger predictors of UFL than age, CI, or DXA-derived density measurements. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Effect of age and disease on bone mass in Japanese patients with schizophrenia.

PubMed

Sugawara, Norio; Yasui-Furukori, Norio; Umeda, Takashi; Tsuchimine, Shoko; Fujii, Akira; Sato, Yasushi; Saito, Manabu; Furukori, Hanako; Danjo, Kazuma; Matsuzaka, Masashi; Takahashi, Ippei; Kaneko, Sunao

2012-02-20

There have been a limited number of studies comparing bone mass between patients with schizophrenia and the general population. The aim of this study was to compare the bone mass of schizophrenia patients with that of healthy subjects in Japan. We recruited patients (n = 362), aged 48.8 ± 15.4 (mean ± SD) years who were diagnosed with schizophrenia or schizoaffective disorder based on the Diagnostic and Statistical Manual of Mental Disorders, fourth edition (DSM-IV). Bone mass was measured using quantitative ultrasound densitometry of the calcaneus. The osteosono-assessment index (OSI) was calculated as a function of the speed of sound and the transmission index. For comparative analysis, OSI data from 832 adults who participated in the Iwaki Health Promotion Project 2009 was used as representative of the general community. Mean OSI values among male schizophrenic patients were lower than those in the general population in the case of individuals aged 40 and older. In females, mean OSI values among schizophrenic patients were lower than those in the general community in those aged 60 and older. In an analysis using the general linear model, a significant interaction was observed between subject groups and age in males. Older schizophrenic patients exhibit lower bone mass than that observed in the general population. Our data also demonstrate gender and group differences among schizophrenic patients and controls with regard to changes in bone mass associated with aging. These results indicate that intervention programs designed to delay or prevent decreased bone mass in schizophrenic patients might be tailored according to gender.

Rhodnius prolixus lipophorin: lipid composition and effect of high temperature on physiological role.

PubMed

Majerowicz, David; Cezimbra, Milton P; Alves-Bezerra, Michele; Entringer, Petter F; Atella, Georgia C; Sola-Penna, Mauro; Meyer-Fernandes, José R; Gondim, Katia C

2013-03-01

Lipophorin is a major lipoprotein that transports lipids in insects. In Rhodnius prolixus, it transports lipids from midgut and fat body to the oocytes. Analysis by thin-layer chromatography and densitometry identified the major lipid classes present in the lipoprotein as diacylglycerol, hydrocarbons, cholesterol, and phospholipids (PLs), mainly phosphatidylethanolamine and phosphatidylcholine. The effect of preincubation at elevated temperatures on lipophorin capacity to deliver or receive lipids was studied. Transfer of PLs to the ovaries was only inhibited after preincubation of lipophorin at temperatures higher than 55 °C. When it was pretreated at 75 °C, maximal inhibition of phospholipid transfer was observed after 3-min heating and no difference was observed after longer times, up to 60 min. The same activity was also obtained when lipophorin was heated for 20 min at 75 °C at protein concentrations from 0.2 to 10 mg/ml. After preincubation at 55 °C, the same rate of lipophorin loading with PLs at the fat body was still present, and 30% of the activity was observed at 75 °C. The effect of temperature on lipophorin was also analyzed by turbidity and intrinsic fluorescence determinations. Turbidity of a lipophorin solution started to increase after preincubations at temperatures higher than 65 °C. Emission fluorescence spectra were obtained for lipophorin, and the spectral area decreased after preincubations at 85 °C or above. These data indicated no difference in the spectral center of mass at any tested temperature. Altogether, these results demonstrate that lipophorin from R. prolixus is very resistant to high temperatures. © 2013 Wiley Periodicals, Inc.

Obesity and Fractures in Postmenopausal Women: A Primary-care Cross-Sectional Study at Santa Maria, Brazil.

PubMed

Copês, Rafaela Martinez; Comim, Fabio Vasconcellos; Langer, Felipe Welter; Codevilla, Antonio Aurelio da Silveira; Sartori, Giovani Ruviaro; de Oliveira, Cristina; Cocco, Aline Rubin; de Almeida, Adriana Maria; de Almeida, Luciana Leiria; Dal Osto, Léo Canterle; Compston, Juliet Elizabeth; Premaor, Melissa Orlandin

2015-01-01

Obesity and osteoporosis are chronic disorders with increasing prevalence worldwide. The aim of this study was to investigate the association between obesity and fracture in postmenopausal women from Santa Maria, Brazil. A cross-sectional study was carried out at Santa Maria (parallel 29° south), Brazil. Postmenopausal women aged ≥55 yr who had at least 1 appointment at the primary care in the 2 years before the study were recruited from March 1, 2013 to August 31, 2013. The Global Longitudinal Study of Osteoporosis in Women study questionnaire was applied with permission of The Center for Outcomes Research, University of Massachusetts Medical School. Height and weight were measured according to the World Health Organization protocol. Bone fractures (excluding hand, feet, and head) that occurred after the age of 45 yr were considered as the outcome. Overall, 1057 women completed the study, of whom 984 had body mass index measured. The mean (standard deviation) age and body mass index of the women included in the study were 67.1 (7.6) yr and 29.2 (5.5) kg/m(2), respectively. The prevalence of fractures in obese and nonobese women was similar (17.3% vs 16.0%); 41.4% of all fractures occurred in obese women. Obese postmenopausal women make a substantial contribution to the overall burden of prevalent fractures in this population. Our results provide further evidence in support of the concept that obesity is not protective against fracture. Copyright © 2015 The International Society for Clinical Densitometry. Published by Elsevier Inc. All rights reserved.

Osteopathia striata with cranial sclerosis: clinical, radiological, and bone histological findings in an adolescent girl.

PubMed

Ward, L M; Rauch, F; Travers, R; Roy, M; Montes, J; Chabot, G; Glorieux, F H

2004-08-15

Osteopathia striata with cranial sclerosis (OS-CS) is a rare skeletal dysplasia characterized by linear striations of the long bones, osteosclerosis of the cranium, and extra-skeletal anomalies. We provide a comprehensive description of the skeletal phenotype in a French-Canadian girl with a moderate to severe form of sporadic OS-CS. Multiple medical problems, including anal stenosis and the Pierre-Robin sequence, were evident in the first few years of life. At 14 years, she was fully mobile, with normal intellect and stature. She suffered chronic lower extremity pain in the absence of fractures, as well as severe headaches, unilateral facial paralysis, and bilateral mixed hearing loss. Biochemical indices of bone and mineral metabolism were within normal limits. Bone densitometry showed increased areal bone mineral density in the skull, trunk, and pelvis, but not in the upper and lower extremities. An iliac bone biopsy specimen revealed an increased amount of trabecular bone. Trabeculae were abnormally thick, but there was no evidence of disturbed bone remodeling. In a cranial bone specimen, multiple layers of periosteal bone were found that covered a compact cortical compartment containing tightly packed haversian canals. Bone lamellation was normal in both the iliac and skull samples. Osteoclast differentiation studies showed that peripheral blood osteoclast precursors from this patient formed functional osteoclasts in vitro. Thus, studies of bone metabolism did not explain why bone mass is increased in most skeletal areas of this patient. Cranial histology points to exuberant periosteal bone formation as a potential cause of the cranial sclerosis.

Application of a novel bone osteotomy plate leads to reduction in heat-induced bone tissue necrosis in sheep.

PubMed

Bekić, Marijo; Davila, Slavko; Hrskanović, Mato; Bekić, Marijana; Seiwerth, Sven; Erdeljić, Viktorija; Capak, Darko; Butković, Vladimir

2008-12-01

Previous studies have shown substantial effect thermal damage can have on new bone formation following osteotomy. In this study we evaluated the extent of thermal damage which occurs in four different methods of osteotomy and the effects it can have on bone healing. We further wanted to test whether a special osteotomy plate we constructed can lead to diminished heat generation during osteotomy and enhanced bone healing. The four methods evaluated included osteotomy performed by chisel, a newly constructed osteotomy plate, Gigly and oscillating saw. Twelve adult sheep underwent osteotomy performed on both tibiae. Bone fragments were stabilized using a fixation plate. Callus size was assessed using standard radiographs. Densitometry and histological evaluation were performed at 8 weeks following osteotomy. Temperature measurements were performed both in vivo during the operation, and ex vivo on explanted tibiae. The defects healed without complications and showed typical course of secondary fracture healing with callus ingrowth into the osteotomy gap. Radiographic examination of bone healing showed a tendency towards more callus formation in bones osteotomized using Gigly and oscillating saw, but this difference lacked significance. Use of Gigly and oscillating saw elicited much higher temperatures at the bone cortex surface, which subsequently lead to slightly impaired bone healing according to histological analysis. BMD was equal among all bones. In conclusion, the time required for complete healing of the defect differed depended greatly on the instruments used. The newly constructed osteotomy plate showed best results based on histological findings of capillary and osteoblast density.

Establishing a method to measure bone structure using spectral CT

NASA Astrophysics Data System (ADS)

Ramyar, M.; Leary, C.; Raja, A.; Butler, A. P. H.; Woodfield, T. B. F.; Anderson, N. G.

2017-03-01

Combining bone structure and density measurement in 3D is required to assess site-specific fracture risk. Spectral molecular imaging can measure bone structure in relation to bone density by measuring macro and microstructure of bone in 3D. This study aimed to optimize spectral CT methodology to measure bone structure in excised bone samples. MARS CT with CdTe Medipix3RX detector was used in multiple energy bins to calibrate bone structure measurements. To calibrate thickness measurement, eight different thicknesses of Aluminium (Al) sheets were scanned one in air and the other around a falcon tube and then analysed. To test if trabecular thickness measurements differed depending on scan plane, a bone sample from sheep proximal tibia was scanned in two orthogonal directions. To assess the effect of air on thickness measurement, two parts of the same human femoral head were scanned in two conditions (in the air and in PBS). The results showed that the MARS scanner (with 90μm voxel size) is able to accurately measure the Al (in air) thicknesses over 200μm but it underestimates the thicknesses below 200μm because of partial volume effect in Al-air interface. The Al thickness measured in the highest energy bin is overestimated at Al-falcon tube interface. Bone scanning in two orthogonal directions gives the same trabecular thickness and air in the bone structure reduced measurement accuracy. We have established a bone structure assessment protocol on MARS scanner. The next step is to combine this with bone densitometry to assess bone strength.

Radiocarbon dating and wood density chronologies of mangrove trees in arid Western Australia.

PubMed

Santini, Nadia S; Hua, Quan; Schmitz, Nele; Lovelock, Catherine E

2013-01-01

Mangrove trees tend to be larger and mangrove communities more diverse in tropical latitudes, particularly where there is high rainfall. Variation in the structure, growth and productivity of mangrove forests over climatic gradients suggests they are sensitive to variations in climate, but evidence of changes in the structure and growth of mangrove trees in response to climatic variation is scarce. Bomb-pulse radiocarbon dating provides accurate dates of recent wood formation and tree age of tropical and subtropical tree species. Here, we used radiocarbon techniques combined with X-ray densitometry to develop a wood density chronology for the mangrove Avicennia marina in the Exmouth Gulf, Western Australia (WA). We tested whether wood density chronologies of A. marina were sensitive to variation in the Pacific Decadal Oscillation Index, which reflects temperature fluctuations in the Pacific Ocean and is linked to the instrumental rainfall record in north WA. We also determined growth rates in mangrove trees from the Exmouth Gulf, WA. We found that seaward fringing A. marina trees (~10 cm diameter) were 48 ± 1 to 89 ± 23 years old (mean ± 1 σ) and that their growth rates ranged from 4.08 ± 2.36 to 5.30 ± 3.33 mm/yr (mean ± 1 σ). The wood density of our studied mangrove trees decreased with increases in the Pacific Decadal Oscillation Index. Future predicted drying of the region will likely lead to further reductions in wood density and their associated growth rates in mangrove forests in the region.

Approach to the Child with Fractures

PubMed Central

Boyce, Alison M.

2011-01-01

Evaluation of the child with fractures is challenging, as no clear guidelines exist to distinguish traumatic from pathological fractures. Although most fractures in childhood are benign, recurrent fractures may be associated with a wide variety of primary skeletal diseases as well as secondary causes, necessitating a careful history and physical exam to guide the evaluation. There is no “gold standard” for the evaluation and treatment of children with fractures and low bone mineral density (BMD); therefore, the diagnosis of osteoporosis in a pediatric patient should be made using a combination of clinical and radiographic features. Interpretation of bone densitometry in growing patients presents a unique set of challenges because areal BMD measured by dual-energy x-ray absorptiometry depends on multiple dynamic variables. Interpretation of pediatric dual-energy x-ray absorptiometry should be based on Z-scores (sd scores compared to age, sex, and ethnicity-matched controls), using normative databases specific to the brand of densitometer and the patient population. Given the skeleton's ability to recover from low BMD through modeling and remodeling, optimizing management of underlying conditions leading to bone fragility is the initial step. Conservative measures including calcium and vitamin D supplementation and weight-bearing physical activity are important interventions that should not be overlooked. The use of bisphosphonates in children and adolescents is controversial due to lack of long-term efficacy and safety data and should be limited to clinical trials and compassionate therapy in children with significantly compromised quality of life. Close monitoring is required, and further study is necessary to assess their long-term safety and efficacy in children. PMID:21734001

Characterization of articular cartilage by combining microscopic analysis with a fibril-reinforced finite-element model.

PubMed

Julkunen, Petro; Kiviranta, Panu; Wilson, Wouter; Jurvelin, Jukka S; Korhonen, Rami K

2007-01-01

Load-bearing characteristics of articular cartilage are impaired during tissue degeneration. Quantitative microscopy enables in vitro investigation of cartilage structure but determination of tissue functional properties necessitates experimental mechanical testing. The fibril-reinforced poroviscoelastic (FRPVE) model has been used successfully for estimation of cartilage mechanical properties. The model includes realistic collagen network architecture, as shown by microscopic imaging techniques. The aim of the present study was to investigate the relationships between the cartilage proteoglycan (PG) and collagen content as assessed by quantitative microscopic findings, and model-based mechanical parameters of the tissue. Site-specific variation of the collagen network moduli, PG matrix modulus and permeability was analyzed. Cylindrical cartilage samples (n=22) were harvested from various sites of the bovine knee and shoulder joints. Collagen orientation, as quantitated by polarized light microscopy, was incorporated into the finite-element model. Stepwise stress-relaxation experiments in unconfined compression were conducted for the samples, and sample-specific models were fitted to the experimental data in order to determine values of the model parameters. For comparison, Fourier transform infrared imaging and digital densitometry were used for the determination of collagen and PG content in the same samples, respectively. The initial and strain-dependent fibril network moduli as well as the initial permeability correlated significantly with the tissue collagen content. The equilibrium Young's modulus of the nonfibrillar matrix and the strain dependency of permeability were significantly associated with the tissue PG content. The present study demonstrates that modern quantitative microscopic methods in combination with the FRPVE model are feasible methods to characterize the structure-function relationships of articular cartilage.

Molecular composition and extinction coefficient of native botulinum neurotoxin complex produced by Clostridium botulinum hall A strain.

PubMed

Bryant, Anne-Marie; Davis, Jenny; Cai, Shuowei; Singh, Bal Ram

2013-02-01

Seven distinct strains of Clostridium botulinum (type A to G) each produce a stable complex of botulinum neurotoxin (BoNT) along with neurotoxin-associated proteins (NAPs). Type A botulinum neurotoxin (BoNT/A) is produced with a group of NAPs and is commercially available for the treatment of numerous neuromuscular disorders and cosmetic purposes. Previous studies have indicated that BoNT/A complex composition is specific to the strain, the method of growth and the method of purification; consequently, any variation in composition of NAPs could have significant implications to the effectiveness of BoNT based therapeutics. In this study, a standard analytical technique using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and densitometry analysis was developed to accurately analyze BoNT/A complex from C. botulinum type A Hall strain. Using 3 batches of BoNT/A complex the molar ratio was determined as neurotoxin binding protein (NBP, 124 kDa), heavy chain (HC, 90 kDa), light chain (LC, 53 kDa), NAP-53 (50 kDa), NAP-33 (36 kDa), NAP-22 (24 kDa), NAP-17 (17 kDa) 1:1:1:2:3:2:2. With Bradford, Lowry, bicinchoninic acid (BCA) and spectroscopic protein estimation methods, the extinction coefficient of BoNT/A complex was determined as 1.54 ± 0.26 (mg/mL)(-1)cm(-1). These findings of a reproducible BoNT/A complex composition will aid in understanding the molecular structure and function of BoNT/A and NAPs.

An experimental and theoretical study of the thermal decomposition of C 4H 6 isomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lockhart, James P. A.; Goldsmith, C. Franklin; Randazzo, John B.

The chemistry of small unsaturated hydrocarbons, such as 1,3–butadiene (1,3–C 4H 6), 1,2–butadiene (1,2–C 4H 6), 2–butyne (2–C 4H 6) and 1–butyne (1–C 4H 6), is of central importance to the modeling of combustion systems. These species are important intermediates in combustion processes, and yet their high-temperature chemistry remains poorly understood, with various dissociation and isomerization pathways proposed in the literature. Here we investigate the thermal decompositions of 1,3–C 4H 6, 1,2–C 4H 6, 2–C 4H 6 and 1–C 4H 6 inside a diaphragmless shock tube, at post shock total pressures of 26–261 Torr and temperatures ranging from 1428–2354 K,more » using laser schlieren densitometry. The experimental work has been complemented by high-level ab initio calculations, which collectively provide strong evidence that formally direct dissociation is the major channel for pyrolysis of 1,3–C 4H 6 and 2–C 4H 6; these paths have not been previously reported but are critical to reconciling the current work and disparate literature reports. The reaction mechanism presented here simulates the current experiments and experimental data from the literature very well. As a result, pressure and temperature dependent rate coefficients are given for the isomerization, formally direct and direct dissociation paths.« less

Iron and neurodegeneration in the multiple sclerosis brain

PubMed Central

Hametner, Simon; Wimmer, Isabella; Haider, Lukas; Pfeifenbring, Sabine; Brück, Wolfgang; Lassmann, Hans

2013-01-01

Objective Iron may contribute to the pathogenesis and progression of multiple sclerosis (MS) due to its accumulation in the human brain with age. Our study focused on nonheme iron distribution and the expression of the iron-related proteins ferritin, hephaestin, and ceruloplasmin in relation to oxidative damage in the brain tissue of 33 MS and 30 control cases. Methods We performed (1) whole-genome microarrays including 4 MS and 3 control cases to analyze the expression of iron-related genes, (2) nonheme iron histochemistry, (3) immunohistochemistry for proteins of iron metabolism, and (4) quantitative analysis by digital densitometry and cell counting in regions representing different stages of lesion maturation. Results We found an age-related increase of iron in the white matter of controls as well as in patients with short disease duration. In chronic MS, however, there was a significant decrease of iron in the normal-appearing white matter (NAWM) corresponding with disease duration, when corrected for age. This decrease of iron in oligodendrocytes and myelin was associated with an upregulation of iron-exporting ferroxidases. In active MS lesions, iron was apparently released from dying oligodendrocytes, resulting in extracellular accumulation of iron and uptake into microglia and macrophages. Iron-containing microglia showed signs of cell degeneration. At lesion edges and within centers of lesions, iron accumulated in astrocytes and axons. Interpretation Iron decreases in the NAWM of MS patients with increasing disease duration. Cellular degeneration in MS lesions leads to waves of iron liberation, which may propagate neurodegeneration together with inflammatory oxidative burst. PMID:23868451

Malnutrition and chronic inflammation as risk factors for sarcopenia in elderly patients with hip fracture.

PubMed

Yoo, Jun-Il; Ha, Yong-Chan; Choi, Hana; Kim, Kyu-Hwang; Lee, Young-Kyun; Koo, Kyung-Hoi; Park, Ki-Soo

2018-01-01

To evaluate malnutrition and chronic inflammation as risk factors for sarcopenia in elderly patients with hip fractures, as defined by the criteria of the Asian Working Group on Sarcopenia (AWGS). A total of 327 elderly patients with hip fractures were enrolled in this retrospective observational study. The main outcome measure was the nutritional status and nutritional risk factors for sarcopenia in elderly patients. Diagnosis of sarcopenia was made according to the guidelines of the AWGS. Whole body densitometry analysis was used to measure skeletal muscle mass, and muscle strength was evaluated by handgrip testing. Multivariable regression analysis was utilized to analyze the nutritional risk factors for sarcopenia in patients with hip fractures. Of 327 patients with hip fractures (78 men and 249 women), the prevalence of sarcopenia was 60.3% and 30.1% in men and women, respectively. The rates of three indicators of malnutrition in men and women (low BMI, hypoalbuminemia, and hypoproteinemia) in sarcopenia patients with hip fractures were 23.4%, 31.9%, and 53.2% and 21.3%, 21.3%, and 37.3%, respectively. The prevalence of markers of chronic inflammation (increased CRP and ESR) in men and women with sarcopenia and hip fractures were 74.9% and 52.2%, and 49.3% and 85.1%, respectively. After adjusting for covariates, low BMI and hypoproteinemia in women were associated with a 2.9- and 2.1-fold greater risk of sarcopenia than non-sarcopenia, respectively. The present study revealed a strong relationship between sarcopenia and malnutrition and chronic inflammatory factors in elderly patients with hip fractures.