Sample records for dependent dna conductivity

  1. Ionic Conductivity, Structural Deformation and Programmable Anisotropy of DNA Origami in Electric Field

    PubMed Central

    Li, Chen-Yu; Hemmig, Elisa A.; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia

    2015-01-01

    The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules—a DNA origami plate— placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg2+ ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA. PMID:25623807

  2. Ionic conductivity, structural deformation, and programmable anisotropy of DNA origami in electric field.

    PubMed

    Li, Chen-Yu; Hemmig, Elisa A; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia; Keyser, Ulrich F; Aksimentiev, Aleksei

    2015-02-24

    The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules, a DNA origami plate, placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg(2+) ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA.

  3. AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

    PubMed

    Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

    2015-06-01

    In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

  4. Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

    PubMed

    Chen, Xiang

    2013-09-01

    A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

  5. Conformational gating of DNA conductance

    PubMed Central

    Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M. P.; Hihath, Joshua

    2015-01-01

    DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature. PMID:26648400

  6. Conformational gating of DNA conductance.

    PubMed

    Artés, Juan Manuel; Li, Yuanhui; Qi, Jianqing; Anantram, M P; Hihath, Joshua

    2015-12-09

    DNA is a promising molecule for applications in molecular electronics because of its unique electronic and self-assembly properties. Here we report that the conductance of DNA duplexes increases by approximately one order of magnitude when its conformation is changed from the B-form to the A-form. This large conductance increase is fully reversible, and by controlling the chemical environment, the conductance can be repeatedly switched between the two values. The conductance of the two conformations displays weak length dependencies, as is expected for guanine-rich sequences, and can be fit with a coherence-corrected hopping model. These results are supported by ab initio electronic structure calculations that indicate that the highest occupied molecular orbital is more disperse in the A-form DNA case. These results demonstrate that DNA can behave as a promising molecular switch for molecular electronics applications and also provide additional insights into the huge dispersion of DNA conductance values found in the literature.

  7. Bilayer-Spanning DNA Nanopores with Voltage-Switching between Open and Closed State

    PubMed Central

    2014-01-01

    Membrane-spanning nanopores from folded DNA are a recent example of biomimetic man-made nanostructures that can open up applications in biosensing, drug delivery, and nanofluidics. In this report, we generate a DNA nanopore based on the archetypal six-helix-bundle architecture and systematically characterize it via single-channel current recordings to address several fundamental scientific questions in this emerging field. We establish that the DNA pores exhibit two voltage-dependent conductance states. Low transmembrane voltages favor a stable high-conductance level, which corresponds to an unobstructed DNA pore. The expected inner width of the open channel is confirmed by measuring the conductance change as a function of poly(ethylene glycol) (PEG) size, whereby smaller PEGs are assumed to enter the pore. PEG sizing also clarifies that the main ion-conducting path runs through the membrane-spanning channel lumen as opposed to any proposed gap between the outer pore wall and the lipid bilayer. At higher voltages, the channel shows a main low-conductance state probably caused by electric-field-induced changes of the DNA pore in its conformation or orientation. This voltage-dependent switching between the open and closed states is observed with planar lipid bilayers as well as bilayers mounted on glass nanopipettes. These findings settle a discrepancy between two previously published conductances. By systematically exploring a large space of parameters and answering key questions, our report supports the development of DNA nanopores for nanobiotechnology. PMID:25338165

  8. Bilayer-spanning DNA nanopores with voltage-switching between open and closed state.

    PubMed

    Seifert, Astrid; Göpfrich, Kerstin; Burns, Jonathan R; Fertig, Niels; Keyser, Ulrich F; Howorka, Stefan

    2015-02-24

    Membrane-spanning nanopores from folded DNA are a recent example of biomimetic man-made nanostructures that can open up applications in biosensing, drug delivery, and nanofluidics. In this report, we generate a DNA nanopore based on the archetypal six-helix-bundle architecture and systematically characterize it via single-channel current recordings to address several fundamental scientific questions in this emerging field. We establish that the DNA pores exhibit two voltage-dependent conductance states. Low transmembrane voltages favor a stable high-conductance level, which corresponds to an unobstructed DNA pore. The expected inner width of the open channel is confirmed by measuring the conductance change as a function of poly(ethylene glycol) (PEG) size, whereby smaller PEGs are assumed to enter the pore. PEG sizing also clarifies that the main ion-conducting path runs through the membrane-spanning channel lumen as opposed to any proposed gap between the outer pore wall and the lipid bilayer. At higher voltages, the channel shows a main low-conductance state probably caused by electric-field-induced changes of the DNA pore in its conformation or orientation. This voltage-dependent switching between the open and closed states is observed with planar lipid bilayers as well as bilayers mounted on glass nanopipettes. These findings settle a discrepancy between two previously published conductances. By systematically exploring a large space of parameters and answering key questions, our report supports the development of DNA nanopores for nanobiotechnology.

  9. The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

    NASA Astrophysics Data System (ADS)

    Lee, Sunhee; Hedin, Eric; Joe, Yong

    2010-03-01

    The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

  10. Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

    PubMed

    Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-01

    Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

  11. CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Characteristics of alternating current hopping conductivity in DNA sequences

    NASA Astrophysics Data System (ADS)

    Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui

    2009-08-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.

  12. Modeling hole transport in wet and dry DNA.

    PubMed

    Pavanello, Michele; Adamowicz, Ludwik; Volobuyev, Maksym; Mennucci, Benedetta

    2010-04-08

    We present a DFT/classical molecular dynamics model of DNA charge conductivity. The model involves a temperature-driven, hole-hopping charge transfer and includes the time-dependent nonequilibrium interaction of DNA with its molecular environment. We validate our method against a variety of hole transport experiments. The method predicts a significant hole-transfer slowdown of approximately 35% from dry to wet DNA with and without electric field bias. In addition, in agreement with experiments, it also predicts an insulating behavior of (GC)(N) oligomers for 40 < N < 1000, depending on the experimental setup.

  13. Characterization of polymer, DNA-based, and silk thin film resistivities and of DNA-based films prepared for enhanced electrical conductivity

    NASA Astrophysics Data System (ADS)

    Yaney, Perry P.; Ouchen, Fahima; Grote, James G.

    2009-08-01

    DC resistivity studies were carried out on biopolymer films of DNA-CTMA and silk fibroin, and on selected traditional polymer films, including PMMA and APC. Films of DNA-CTMA versus molecular weight and with conductive dopants PCBM, BAYTRON P and ammonium tetrachloroplatinate are reported. The films were spin coated on glass slides configured for measurements of volume dc resistance. The measurements used the alternating polarity method to record the applied voltage-dependent current independent of charging and background currents. The Arrhenius equation plus a constant was fitted to the conductivity versus temperature data of the polymers and the non-doped DNA-based biopolymers with activation energies ranging from 0.8 to 1.4 eV.

  14. cGAS Conducts Micronuclei DNA Surveillance.

    PubMed

    de Oliveira Mann, Carina C; Kranzusch, Philip J

    2017-10-01

    DNA damage elicits a potent proinflammatory immune response. A collection of four papers now reveals that micronuclear DNA is a new cell intrinsic immunostimulatory molecule, and that accumulation of the immune sensor cyclic GMP-AMP synthase (cGAS) in micronuclei leads to a cell-cycle-dependent proinflammatory response following DNA damage. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Charge transport through DNA based electronic barriers

    NASA Astrophysics Data System (ADS)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  16. DNA in the material world: electrical properties and nano-applications.

    PubMed

    Triberis, Georgios P; Dimakogianni, Margarita

    2009-01-01

    Contradictory experimental findings and theoretical interpretations have spurred intense debate over the electrical properties of the DNA double helix. In the present review article the various factors responsible for these divergences are discussed. The enlightenment of this issue could improve long range chemistry of oxidative DNA damage and repair processes, monitoring protein-DNA interactions and possible applications in nano-electronic circuit technology. The update experimental situation concerning measurements of the electrical conductivity is given. The character of the carriers responsible for the electrical conductivity measured in DNA is investigated. A theoretical model for the temperature dependence of the electrical conductivity of DNA is presented, based on microscopic models and percolation theoretical arguments. The theoretical results, excluding or including correlation effects, are applied to recent experimental findings for DNA, considering it as a one dimensional molecular wire. The results indicate that correlation effects are probably responsible for large hopping distances in DNA samples. Other theoretical conductivity models proposed for the interpretation of the responsible transport mechanism are also reviewed. Some of the most known and pioneering works on DNA's nano-applications, future developments and perspectives along with current technological limitations and patents are presented and discussed.

  17. Hole Transport in A-form DNA/RNA Hybrid Duplexes

    NASA Astrophysics Data System (ADS)

    Wong, Jiun Ru; Shao, Fangwei

    2017-01-01

    DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

  18. Hole Transport in A-form DNA/RNA Hybrid Duplexes

    PubMed Central

    Wong, Jiun Ru; Shao, Fangwei

    2017-01-01

    DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

  19. Theory of electron transfer and molecular state in DNA

    NASA Astrophysics Data System (ADS)

    Endres, Robert Gunter

    2002-09-01

    In this thesis, a mechanism for long-range electron transfer in DNA and a systematic search for high conductance DNA are developed. DNA is well known for containing the genetic code of all living species. On the other hand, there are some experimental indications that DNA can mediate effectively long-range electron transfer leading to the concept of chemistry at a distance. This can be important for DNA damage and healing. In the first part of the thesis, a possible mechanism for long-range electron transfer is introduced. The weak distance dependent electron transfer was experimentally observed using transition metal intercalators for donor and acceptor. In our model calculations, the transfer is mediated by the molecular analogue of a Kondo bound state well known from solid state physics of mixed-valence rare-earth compounds. We believe this is quite realistic, since localized d orbitals of the transition metal ions could function as an Anderson impurity embedded in a reservoir of rather delocalized molecular orbitals of the intercalator ligands and DNA pi orbitals. The effective Anderson model is solved with a physically intuitive variational ansatz as well as with the essentially exact DMRG method. The electronic transition matrix element, which is important because it contains the donor-acceptor distance dependence, is obtained with the Mulliken-Hush algorithm as well as from Born-Oppenheimer potential energy surfaces. Our possible explanation of long-range electron transfer is put in context to other more conventional mechanisms which also could lead to similar behavior. Another important issue of DNA is its possible use for nano-technology. Although DNA's mechanical properties are excellent, the question whether it can be conducting and be used for nano-wires is highly controversial. Experimentally, DNA shows conducting, semi-conducting and insulating properties. Motivated by these wide ranging experimental results on the conductivity of DNA, we have embarked on a theoretical effort to ascertain what conditions might induce such remarkable behavior. We use a combination of an ab initio density functional theory method and a parameterized Huckel-Slater-Koster model. Our focus here is to examine whether any likely DNA structures or environments can yield reduced activation gaps to conduction or enhanced electronic overlaps. In particular, we study a hypothetical stretched ribbon structure, A-, and B-form DNA, and the effects of counterions and humidity. Unlike solids, DNA and other molecules are considered soft condensed matter. Hence, we study the influence of vibrations upon the electronic structure of DNA. We calculate parameters for charge transfer rates between adjacent bases. We find good agreement between our estimated rates and recent experimental data assuming that torsional vibrations limit the charge transfer most significantly.

  20. Electronic Activation of a DNA Nanodevice Using a Multilayer Nanofilm.

    PubMed

    Jeong, Hyejoong; Ranallo, Simona; Rossetti, Marianna; Heo, Jiwoong; Shin, Jooseok; Park, Kwangyong; Ricci, Francesco; Hong, Jinkee

    2016-10-01

    A method to control activation of a DNA nanodevice by supplying a complementary DNA (cDNA) strand from an electro-responsive nanoplatform is reported. To develop functional nanoplatform, hexalayer nanofilm is precisely designed by layer-by-layer assembly technique based on electrostatic interaction with four kinds of materials: Hydrolyzed poly(β-amino ester) can help cDNA release from the film. A cDNA is used as a key building block to activate DNA nanodevice. Reduced graphene oxides (rGOs) and the conductive polymer provide conductivity. In particular, rGOs efficiently incorporate a cDNA in the film via several interactions and act as a barrier. Depending on the types of applied electronic stimuli (reductive and oxidative potentials), a cDNA released from the electrode can quantitatively control the activation of DNA nanodevice. From this report, a new system is successfully demonstrated to precisely control DNA release on demand. By applying more advanced form of DNA-based nanodevices into multilayer system, the electro-responsive nanoplatform will expand the availability of DNA nanotechnology allowing its improved application in areas such as diagnosis, biosensing, bioimaging, and drug delivery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

  2. Quantum interference in DNA bases probed by graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Jeong, Heejeong; Seul Kim, Han; Lee, Sung-Hoon; Lee, Dongho; Hoon Kim, Yong; Huh, Nam

    2013-07-01

    Based on first-principles nonequilibrium Green's function calculations, we demonstrate quantum interference (QI) effects on the tunneling conductance of deoxyribonucleic acid bases placed between zigzag graphene nanoribbon electrodes. With the analogy of QI in hydrocarbon ring structures, we hypothesize that QI can be well preserved in the π-π coupling between the carbon-based electrode and a single DNA base. We demonstrate indications of QI, such as destructively interfered anti-resonance or Fano-resonance, that affect the variation of tunneling conductance depending on the orientation of a base. We find that guanine, with a 10-fold higher transverse conductance, can be singled out from the other bases.

  3. A novel single-stranded DNA detection method based on organic semiconductor heterojunction

    NASA Astrophysics Data System (ADS)

    Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun

    2016-12-01

    We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.

  4. Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

    NASA Astrophysics Data System (ADS)

    Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

    1996-06-01

    cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

  5. BioWires: Conductive DNA Nanowires in a Computationally-Optimized, Synthetic Biological Platform for Nanoelectronic Fabrication

    NASA Technical Reports Server (NTRS)

    Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom

    2017-01-01

    DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.

  6. Temperature gating and competing temperature-dependent effects in DNA molecular wires

    NASA Astrophysics Data System (ADS)

    Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

    2017-02-01

    While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

  7. Resolving DNA-ligand intercalation in the entropic stretching regime

    NASA Astrophysics Data System (ADS)

    Almaqwashi, Ali A.

    Single molecule studies of DNA intercalation are typically conducted by applying stretching forces to obtain force-dependent DNA elongation measurements. The zero-force properties of DNA intercalation are determined by equilibrium and kinetic force-analysis. However, the applied stretching forces that are above the entropic regime (>5 pN) prevent DNA-DNA contact which may eliminate competitive DNA-ligand interactions. In particular, it is noted that cationic mono-intercalators investigated by single molecule force spectroscopy are mostly found to intercalate DNA with single rate, while bulk studies reported additional slower rates. Here, a proposed framework quantifies DNA intercalation by cationic ligands in competition with relatively rapid kinetic DNA-ligand aggregation. At a constant applied force in the entropic stretching regime, the analysis illustrates that DNA intercalation would be measurably optimized only within a narrow range of low ligand concentrations. As DNA intercalators are considered for potential DNA-targeted therapeutics, this analysis provides insights in tuning ligand concertation to maximize therapeutics efficiency.

  8. Measurement of changes in impedance of DNA nanowires due to radiation induced structural damage. A novel approach for a DNA-based radiosensitive device

    NASA Astrophysics Data System (ADS)

    Heimbach, Florian; Arndt, Alexander; Nettelbeck, Heidi; Langner, Frank; Giesen, Ulrich; Rabus, Hans; Sellner, Stefan; Toppari, Jussi; Shen, Boxuan; Baek, Woon Yong

    2017-08-01

    The ability of DNA to conduct electric current has been the topic of numerous investigations over the past few decades. Those investigations indicate that this ability is dependent on the molecular structure of the DNA. Radiation-induced damages, which lead to an alteration of the molecular structure, should therefore change the electrical impedance of a DNA molecule. In this paper, the damage due to ionising radiation is shown to have a direct effect on the electrical transport properties of DNA. Impedance measurements of DNA samples were carried out by an AC impedance spectrometer before, during and after irradiation. The samples comprised of DNA segments, which were immobilized between gold electrodes with a gap of 12 μm. The impedance of all DNA samples exhibited rising capacitive behaviour with increasing absorbed dose.

  9. Quantum Mechanical Modeling of Ballistic MOSFETs

    NASA Technical Reports Server (NTRS)

    Svizhenko, Alexei; Anantram, M. P.; Govindan, T. R.; Biegel, Bryan (Technical Monitor)

    2001-01-01

    The objective of this project was to develop theory, approximations, and computer code to model quasi 1D structures such as nanotubes, DNA, and MOSFETs: (1) Nanotubes: Influence of defects on ballistic transport, electro-mechanical properties, and metal-nanotube coupling; (2) DNA: Model electron transfer (biochemistry) and transport experiments, and sequence dependence of conductance; and (3) MOSFETs: 2D doping profiles, polysilicon depletion, source to drain and gate tunneling, understand ballistic limit.

  10. Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.

    PubMed

    Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng

    2015-05-22

    Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.

  11. Quinolone resistance-associated amino acid substitutions affect enzymatic activity of Mycobacterium leprae DNA gyrase.

    PubMed

    Yamaguchi, Tomoyuki; Yokoyama, Kazumasa; Nakajima, Chie; Suzuki, Yasuhiko

    2017-07-01

    Quinolones are important antimicrobials for treatment of leprosy, a chronic infectious disease caused by Mycobacterium leprae. Although it is well known that mutations in DNA gyrase are responsible for quinolone resistance, the effect of those mutations on the enzymatic activity is yet to be studied in depth. Hence, we conducted in vitro assays to observe supercoiling reactions of wild type and mutated M. leprae DNA gyrases. DNA gyrase with amino acid substitution Ala91Val possessed the highest activity among the mutants. DNA gyrase with Gly89Cys showed the lowest level of activity despite being found in clinical strains, but it supercoiled DNA like the wild type does if applied at a sufficient concentration. In addition, patterns of time-dependent conversion from relaxed circular DNA into supercoiled DNA by DNA gyrases with clinically unreported Asp95Gly and Asp95Asn were observed to be distinct from those by the other DNA gyrases.

  12. Experimental transport studies of yttrium barium copper oxide and lambda-DNA

    NASA Astrophysics Data System (ADS)

    Zhang, Yuexing

    This dissertation consists of two parts. In Part I, we focus on the quasi-particle transport properties in the high temperature superconductor YBa2Cu3O7-delta (YBCO), probed by the thermal Hall conductivity (kappa xy). The thermal Hall conductivity selectively reflects the transport behaviors of the charge carriers. By measuring kappaxy in the normal state YBCO, we established a new method to determine the Wiedemann-Franz (WF) ratio in cuprates. We determined the Hall-channel WF ratio kappa xy/sigmaxyT in Cu and YBCO. In the latter, we uncovered a T-linear dependence and suppression of the Hallchannel WF ratio. The suppression of the Hall-channel WF ratio in systems with predominant electron-electron scattering will be discussed. Thermal transport behaviors of the quasi-particles in the mixed state were studied by measuring kappaxx and kappa xy in a high-purity YBCO crystal. From the field-dependence of the thermal conductivity kappaxx, we separated the quasi particle contribution (kappae) from the phonon background. In the Hall channel, we observed that the (weak-field) kappa xy increased 103-fold between T c (90 K) and 30 K, implying a 100-fold enhancement of the quasi-particle lifetime. We found that kappaxy exhibited a specific scaling behavior below ˜30 K. The implication of the scaling behavior will be discussed. In Part II, we describe an experiment on determining the electrical conductivity of the bacteriophage lambda-DNA, an issue currently under intense debate. We covalently bonded the DNA to Au electrodes by incorporating thiol modified dTTP into the 'sticky' ends of the lambda-DNA. Two-probe measurements on such molecules provided a lower bound for the resistivity rho > 10 6 mum at bias potentials up to 20 V, in conflict with recent claims of moderate to high conductivity. We stress the importance of eliminating salt residues in these measurements.

  13. DNA Physical Properties and Nucleosome Positions Are Major Determinants of HIV-1 Integrase Selectivity

    PubMed Central

    Naughtin, Monica; Haftek-Terreau, Zofia; Xavier, Johan; Meyer, Sam; Silvain, Maud; Jaszczyszyn, Yan; Levy, Nicolas; Miele, Vincent; Benleulmi, Mohamed Salah; Ruff, Marc; Parissi, Vincent; Vaillant, Cédric; Lavigne, Marc

    2015-01-01

    Retroviral integrases (INs) catalyse the integration of the reverse transcribed viral DNA into the host cell genome. This process is selective, and chromatin has been proposed to be a major factor regulating this step in the viral life cycle. However, the precise underlying mechanisms are still under investigation. We have developed a new in vitro integration assay using physiologically-relevant, reconstituted genomic acceptor chromatin and high-throughput determination of nucleosome positions and integration sites, in parallel. A quantitative analysis of the resulting data reveals a chromatin-dependent redistribution of the integration sites and establishes a link between integration sites and nucleosome positions. The co-activator LEDGF/p75 enhanced integration but did not modify the integration sites under these conditions. We also conducted an in cellulo genome-wide comparative study of nucleosome positions and human immunodeficiency virus type-1 (HIV-1) integration sites identified experimentally in vivo. These studies confirm a preferential integration in nucleosome-covered regions. Using a DNA mechanical energy model, we show that the physical properties of DNA probed by IN binding are important in determining IN selectivity. These novel in vitro and in vivo approaches confirm that IN has a preference for integration into a nucleosome, and suggest the existence of two levels of IN selectivity. The first depends on the physical properties of the target DNA and notably, the energy required to fit DNA into the IN catalytic pocket. The second depends on the DNA deformation associated with DNA wrapping around a nucleosome. Taken together, these results indicate that HIV-1 IN is a shape-readout DNA binding protein. PMID:26075397

  14. In vitro effect of the antimalarial drug proguanil hydrochloride on viability and DNA damage in human peripheral blood lymphocytes.

    PubMed

    Gajski, Goran; Dinter, Domagoj; Garaj-Vrhovac, Vera

    2010-11-01

    This study aimed to evaluate the effect of proguanil, a chemical substance used for treatment and prevention of malaria on viability and DNA integrity in human lymphocytes in vitro. Two different concentrations of proguanil obtained from the plasma concentrations were used: 130ng/ml used for prophylactic treatment and 520ng/ml used in treatment of malaria. Testing was done with and without metabolic activation. Viability of lymphocytes decreased in time and dose dependent manner. Comet assay parameters showed similar effects, indicating that some damage to DNA molecule can occur. Frequency of sister chromatid exchanges did not show significant deviation from the control samples. As for the proliferation kinetics no significant changes were noticed. Since majority of DNA damaging effect is induced after metabolic activation it is to be concluded that activity of proguanil is dependent upon the active metabolite cycloguanil and that monitoring should be conducted especially among frequent travellers. Copyright © 2010 Elsevier B.V. All rights reserved.

  15. The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

    NASA Astrophysics Data System (ADS)

    Ashhadi, M.

    2018-07-01

    We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

  16. Mechanochemical regulations of RPA's binding to ssDNA

    NASA Astrophysics Data System (ADS)

    Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie

    2015-03-01

    Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

  17. DNA-dependent protein kinase catalytic subunit functions in metastasis and influences survival in advanced-stage laryngeal squamous cell carcinoma.

    PubMed

    He, Sha-Sha; Chen, Yong; Shen, Xiao-Ming; Wang, Hong-Zhi; Sun, Peng; Dong, Jun; Guo, Gui-Fang; Chen, Ju-Gao; Xia, Liang-Ping; Hu, Pei-Li; Qiu, Hui-Juan; Liu, Shou-Sheng; Zhou, Yi-Xin; Wang, Wei; Hu, Wei-Han; Cai, Xiu-Yu

    2017-01-01

    Background: DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is known to function in several types of cancer. In this study, we investigated the expression and clinicopathologic significance of DNA-PKcs in laryngeal squamous cell carcinoma (LSCC). Methods: We conducted a retrospective study of 208 patients with advanced-stage LSCC treated at Sun Yat-sen University Cancer Center, Guangzhou, China. We assessed DNA-PKcs and p16INK4a (p16) status using immunohistochemistry. We examined the association between DNA-PKcs expression and clinicopathologic features and survival outcomes. To evaluate the independent prognostic relevance of DNA-PKcs, we used univariate and multivariate Cox regression models. We estimated overall survival (OS) and distant metastasis-free survival (DMFS) using the Kaplan-Meier method. Results: Immunohistochemical analyses revealed that 163/208 (78.4%) of the LSCC tissue samples exhibited high DNA-PKcs expression. High DNA-PKcs expression was significantly associated with survival outcomes ( P = 0.016) and distant metastasis ( P = 0.02; chi-squared test). High DNA-PKcs expression was associated with a significantly shorter OS and DMFS than low DNA-PKcs expression ( P = 0.029 and 0.033, respectively; log-rank test), and was associated with poor OS in the p16-positive subgroup ( P = 0.047). Multivariate analysis identified DNA-PKcs as an independent prognostic indicator of OS and DMFS in all patients ( P = 0.039 and 0.037, respectively). Conclusions : Our results suggest that patients with LSCC in whom DNA-PKcs expression is elevated have a higher incidence of distant metastasis and a poorer prognosis. DNA-PKcs may represent a marker of tumor progression in patients with p16-positive LSCC.

  18. Optimization of the molecular dynamics method for simulations of DNA and ion transport through biological nanopores.

    PubMed

    Wells, David B; Bhattacharya, Swati; Carr, Rogan; Maffeo, Christopher; Ho, Anthony; Comer, Jeffrey; Aksimentiev, Aleksei

    2012-01-01

    Molecular dynamics (MD) simulations have become a standard method for the rational design and interpretation of experimental studies of DNA translocation through nanopores. The MD method, however, offers a multitude of algorithms, parameters, and other protocol choices that can affect the accuracy of the resulting data as well as computational efficiency. In this chapter, we examine the most popular choices offered by the MD method, seeking an optimal set of parameters that enable the most computationally efficient and accurate simulations of DNA and ion transport through biological nanopores. In particular, we examine the influence of short-range cutoff, integration timestep and force field parameters on the temperature and concentration dependence of bulk ion conductivity, ion pairing, ion solvation energy, DNA structure, DNA-ion interactions, and the ionic current through a nanopore.

  19. Quercetin-Iron Complex: Synthesis, Characterization, Antioxidant, DNA Binding, DNA Cleavage, and Antibacterial Activity Studies.

    PubMed

    Raza, Aun; Xu, Xiuquan; Xia, Li; Xia, Changkun; Tang, Jian; Ouyang, Zhen

    2016-11-01

    Quercetin-iron (II) complex was synthesized and characterized by elemental analysis, ultraviolet-visible spectrophotometry, fourier transform infrared spectroscopy, mass spectrometry, proton nuclear magnetic resonance spectroscopy, thermogravimetry and differential scanning calorimetry, scanning electron micrography and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal:ligand) of the complex. Antioxidant study of the quercetin and its metal complex against 2, 2-di-phenyl-1-picryl hydrazyl radical showed that the complex has much more radical scavenging activity than free quercetin. The interaction of quercetin-iron (II) complex with DNA was determined using ultraviolet visible spectra, fluorescence spectra and agarose gel electrophoresis. The results showed that quercetin-iron (II) complex can intercalate moderately with DNA, quench a strong intercalator ethidium bromide and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form to nicked circular form and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was an oxidative cleavage pathway. These results revealed the potential nuclease activity of complex to cleave DNA. In addition, antibacterial activity of complex on E.coli and S. aureus was also investigated. The results showed that complex has higher antibacterial activity than ligand.

  20. New Application of the Comet Assay

    PubMed Central

    Cortés-Gutiérrez, Elva I.; Dávila-Rodríguez, Martha I.; Fernández, José Luís; López-Fernández, Carmen; Gosálbez, Altea; Gosálvez, Jaime

    2011-01-01

    The comet assay is a well-established, simple, versatile, visual, rapid, and sensitive tool used extensively to assess DNA damage and DNA repair quantitatively and qualitatively in single cells. The comet assay is most frequently used to analyze white blood cells or lymphocytes in human biomonitoring studies, although other cell types have been examined, including buccal, nasal, epithelial, and placental cells and even spermatozoa. This study was conducted to design a protocol that can be used to generate comets in subnuclear units, such as chromosomes. The new technique is based on the chromosome isolation protocols currently used for whole chromosome mounting in electron microscopy, coupled to the alkaline variant of the comet assay, to detect DNA damage. The results show that migrant DNA fragments can be visualized in whole nuclei and isolated chromosomes and that they exhibit patterns of DNA migration that depend on the level of DNA damage produced. This protocol has great potential for the highly reproducible study of DNA damage and repair in specific chromosomal domains. PMID:21540337

  1. Effects of cytotoxic cis- and trans-diammine monochlorido platinum(II) complexes on selenium-dependent redox enzymes and DNA.

    PubMed

    Lemmerhirt, Heidi; Behnisch, Steven; Bodtke, Anja; Lillig, Christopher H; Pazderova, Lucia; Kasparkova, Jana; Brabec, Viktor; Bednarski, Patrick J

    2018-01-01

    Here we present the preparation of 14 pairs of cis- and trans-diammine monochlorido platinum(II) complexes, coordinated to heterocycles (i.e., imidazole, 2-methylimidazole and pyrazole) and linked to various acylhydrazones, which were designed as potential inhibitors of the selenium-dependent enzymes glutathione peroxidase 1 (GPx-1) and thioredoxin reductase 1 (TrxR-1). However, no inhibition of bovine GPx-1 and only weak inhibition of murine TrxR-1 was observed in in vitro assays. Nonetheless, the cis configured diammine monochlorido Pt(II) complexes exhibited cytotoxic and apoptotic properties on various human cancer cell lines, whereas the trans configured complexes generally showed weaker potency with a few exceptions. On the other hand, the trans complexes were generally more likely to lack cross-resistance to cisplatin than the cis analogues. Platinum was found bound to the nuclear DNA of cancer cells treated with representative Pt complexes, suggesting that DNA might be a possible target. Thus, detailed in vitro binding experiments with DNA were conducted. Interactions of the compounds with calf thymus DNA were investigated, including Pt binding kinetics, circular dichroism (CD) spectral changes, changes in DNA melting temperatures, unwinding of supercoiled plasmids and ethidium bromide displacement in DNA. The CD results indicate that the most active cis configured pyrazole-derived complex causes unique structural changes in the DNA compared to the other complexes as well as to those caused by cisplatin, suggesting a denaturation of the DNA structure. This may be important for the antiproliferative activity of this compound in the cancer cells. Copyright © 2017. Published by Elsevier Inc.

  2. Detection on emamectin benzoate-induced apoptosis and DNA damage in Spodoptera frugiperda Sf-9 cell line.

    PubMed

    Wu, Xiwei; Zhang, Lei; Yang, Chao; Zong, Mimi; Huang, Qingchun; Tao, Liming

    2016-01-01

    Emamectin benzoate (EMB), an important macrocyclic lactone insecticide that belongs to the avermectin family and possesses excellent potency in controlling pests, is non-carcinogenic and non-mutagenic conducted in rats and mice, but EMB-induced cytotoxicity and genotoxicity in arthropod insect have been seldom reported yet. In the present paper, we quantified the cytotoxicity of EMB through the detections on cell viability, DNA damage, and cell apoptosis in Spodoptera frugiperda Sf-9 cells in vitro. The results showed that EMB caused a concentration- and time-dependent reduction on the viability of Sf-9 cells, and the median inhibitory concentrations (IC50) were 3.34μM at 72h of exposure. The dual acridine orange/ethidium bromide staining showed that exposure to EMB induced a significant time- and concentration-dependent increase on cell apoptosis. The alkaline comet assay revealed that EMB induced significant increases on single-strand DNA breaks, and the percentage of γH2AX-positive cells represented a time- and concentration-dependent formation of DNA double-strand breaks in Sf-9 cells. Interestingly, the similar cytotoxic actions of EMB also went for the human cancerous HeLa cells as a control cell group. Data demonstrated the potential cytotoxic effect of EMB on Sf-9 cells that was significantly greater than the effect of hydrogen peroxide at the same concentrations. Copyright © 2015 Elsevier Inc. All rights reserved.

  3. Comparison of three DNA extraction kits to establish maximum yield and quality of coral-associated microbial DNA

    USGS Publications Warehouse

    Baker, Erin J.; Kellogg, Christina A.

    2014-01-01

    Coral microbiology is an expanding field, yet there is no standard DNA extraction protocol. Although many researchers depend on commercial extraction kits, no specific kit has been optimized for use with coral samples. Both soil and plant DNA extraction kits from MO BIO Laboratories, Inc., have been used by many research groups for this purpose. MO BIO recently replaced their PowerPlant® kit with an improved PowerPlantPro kit, but it was unclear how these changes would affect the kit’s use with coral samples. In order to determine which kit produced the best results, we conducted a comparison between the original PowerPlant kit, the new PowerPlantPro kit, and an alternative kit, PowerSoil, using samples from several different coral genera. The PowerPlantPro kit had the highest DNA yields, but the lack of 16S rRNA gene amplification in many samples suggests that much of the yield may be coral DNA rather than microbial DNA. The most consistent positive amplifications came from the PowerSoil kit.

  4. Modular development of a prototype point of care molecular diagnostic platform for sexually transmitted infections.

    PubMed

    Branavan, Manoharanehru; Mackay, Ruth E; Craw, Pascal; Naveenathayalan, Angel; Ahern, Jeremy C; Sivanesan, Tulasi; Hudson, Chris; Stead, Thomas; Kremer, Jessica; Garg, Neha; Baker, Mark; Sadiq, Syed T; Balachandran, Wamadeva

    2016-08-01

    This paper presents the design of a modular point of care test platform that integrates a proprietary sample collection device directly with a microfluidic cartridge. Cell lysis, within the cartridge, is conducted using a chemical method and nucleic acid purification is done on an activated cellulose membrane. The microfluidic device incorporates passive mixing of the lysis-binding buffers and sample using a serpentine channel. Results have shown extraction efficiencies for this new membrane of 69% and 57% compared to the commercial Qiagen extraction method of 85% and 59.4% for 0.1ng/µL and 100ng/µL salmon sperm DNA respectively spiked in phosphate buffered solution. Extraction experiments using the serpentine passive mixer cartridges incorporating lysis and nucleic acid purification showed extraction efficiency around 80% of the commercial Qiagen kit. Isothermal amplification was conducted using thermophillic helicase dependant amplification and recombinase polymerase amplification. A low cost benchtop real-time isothermal amplification platform has been developed capable of running six amplifications simultaneously. Results show that the platform is capable of detecting 1.32×10(6) of sample DNA through thermophillic helicase dependant amplification and 1×10(5) copy numbers Chlamydia trachomatis genomic DNA within 10min through recombinase polymerase nucleic acid amplification tests. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  5. Evaluation of the RBC Pig-a and PIGRET assays using single doses of hydroxyurea and melphalan in rats.

    PubMed

    Adachi, Hideki; Uematsu, Yasuaki; Yamada, Toru

    2016-11-15

    To evaluate the suitability of the rat Pig-a assay on reticulocytes (PIGRET assay) as a short-term test, red blood cell (RBC) Pig-a and PIGRET assays after single doses with hydroxyurea (HU) and melphalan (L-PAM) were conducted and the results of both assays were compared. HU was administered once orally to male SD rats at 250, 500 and 1000mg/kg, and both assays were conducted using peripheral blood withdrawn from the jugular vein at 1, 2 and 4 weeks after dosing. L-PAM was administered at 1.25, 2.5 and 5mg/kg in the same manner. L-PAM produced significant dose-dependent increases in mutant frequencies in the PIGRET assay after single oral doses, but did not produce dose-dependent increases in mutant frequencies in the RBC Pig-a assay. These results suggest that the PIGRET assay is more sensitive for the evaluation of the mutagenic potential of L-PAM than the RBC Pig-a assay. In contrast, HU, a clastogenic but not DNA-reactive compound, gave negative results in both assays. The results with these 2 chemicals indicate that the single-dose PIGRET assay in rats has the potential to properly detect DNA-reactive compounds that directly cause DNA damage in a short-term assay. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Analysis of the putative regulatory region of the gastric inhibitory polypeptide receptor gene in food-dependent Cushing's syndrome.

    PubMed

    Antonini, S R; N'Diaye, N; Baldacchino, V; Hamet, P; Tremblay, J; Lacroix, A

    2004-07-01

    Gastric inhibitory polypeptide (GIP)-dependent Cushing's syndrome (CS) results from the ectopic expression of non-mutated GIP receptor (hGIPR) in the adrenal cortex. We evaluated whether mutations or polymorphisms in the regulatory region of the GIPR gene could lead to this aberrant expression. We studied 9.0kb upstream and 1.3kb downstream of the GIPR gene putative promoter (pProm) by sequencing leukocyte DNA from controls and from adrenal tissues of GIP- and non-GIP-dependent CS patients. The putative proximal promoter region (800 bp) and the first exon and intron of the hGIPR gene were sequenced on adrenal DNA from nine GIP-dependent CS, as well as on leukocyte DNA of nine normal controls. Three variations found in this region were found in all patients and controls; at position -4/-5, an insertion of a T was seen in four out of nine patients and in five out of nine controls. Transient transfection studies conducted in rat GC and mouse Y1 cells showed that the TT allele confers loss of 40% in the promoter activity. The analysis of the 8-kb distal pProm region revealed eight distal single nucleotide polymorphisms (SNPs) without probable association with the disease, since frequencies in patients and controls were very similar. In conclusion, mutations or SNPs in the regulatory region of the GIPR gene are unlikely to underlie GIP-dependent CS. Copyright 2004 Elsevier Ltd.

  7. An effect of couterion in STM imaging process of DNA on Cu(111)

    NASA Astrophysics Data System (ADS)

    Furukawa, Masashi; Nishimura, Makoto; Tanaka, Hiroyuki; Kawai, Tomoji

    2002-03-01

    In order to elucidate electrical conduction mechanism of DNA, which is still under debate over the last decade, we have performed local electronic structure measurement of single- and double-stranded DNA molecules adsorbed onto Cu(111) surfaces using scanning tunneling microscope (STM). Bias-voltage-dependent STM images (from -5 V to +5 V) have shown that the molecular corrugation height in STM increases gradually at positive bias voltage region (empty state). Despite the theoretical assumption in which their 1st-LUMO states are localized at π plane of DNA bases, one cannot conclude its origin as the existence of their LUMO states, based on the results of relevant control measurements, DNA base molecules/Cu(111) [1] and NaCl/Cu(111). In fact, we found almost identical bias dependencies in the latter case (NaCl/Cu(111)), indicating that the feature of π* states of DNA bases should be buried in an additional channel that opens up by the onset of its unoccupied overlayer state in the tunneling process [2]. This study implies a potential difficulty in direct comparison of the obtained data with those characterized by XAS, in which π* states is located at ca. -1 eV relative to the Fermi level [3]. [1]M. Furukawa et al., submitted to Surf. Sci. [2] J. Kliewer et al., Surf. Sci. 477 (2001) 250.; A. Carlsson et al., Phys. Rev. B. 56 (1997) 1593. [3] M. Furukawa et al., submitted to Phys. Rev. B.

  8. Factors influencing detection of eDNA from a stream-dwelling amphibian

    USGS Publications Warehouse

    Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

    2013-01-01

    Environmental DNA (eDNA) methods for detecting and estimating abundance of aquatic species are emerging rapidly, but little is known about how processes such as secretion rate, environmental degradation, and time since colonization or extirpation from a given site affect eDNA measurements. Using stream-dwelling salamanders and quantitative PCR (qPCR) analysis, we conducted three experiments to assess eDNA: (i) production rate; (ii) persistence time under different temperature and light conditions; and (iii) detectability and concentration through time following experimental introduction and removal of salamanders into previously unoccupied streams. We found that 44–50 g individuals held in aquaria produced 77 ng eDNA/h for 2 h, after which production either slowed considerably or began to equilibrate with degradation. eDNA in both full-sun and shaded treatments degraded exponentially to 2) and when samples were collected within 5 m of the animals. Concentrations of eDNA detected were very low and increased steadily from 6–24 h after introduction, reaching 0.0022 ng/L. Within 1 h of removing salamanders from the stream, eDNA was no longer detectable. These results suggest that eDNA detectability and concentration depend on production rates of individuals, environmental conditions, density of animals, and their residence time.

  9. Functional Analysis of a Type-I Ribosome Inactivating Protein Balsamin from Momordica balsamina with Anti-Microbial and DNase Activity.

    PubMed

    Ajji, Parminder Kaur; Walder, Ken; Puri, Munish

    2016-09-01

    Ribosome inactivating proteins (RIPs) have received considerable attention in biomedical research because of their unique activities towards tumor and virus-infected cells. We extracted balsamin, a type-I RIP, from Momordica balsamina. In the present study, a detailed investigation on DNase activity, antioxidant capacity and antibacterial activity was conducted using purified balsamin. DNase-like activity of balsamin towards plasmid DNA was pH, incubation time and temperature dependent. Moreover, the presence of Mg(2+) (10-50 mM) influenced the DNA cleavage activity. Balsamin also demonstrated reducing power and a capacity to scavenge free radicals in a dose dependent manner. Furthermore, the protein exhibited antibacterial activity against Staphylococcus aureus, Salmonella enterica, Staphylococcus epidermidis and Escherichia coli, which suggests potential utility of balsamin as a nutraceutical.

  10. Submolecular Structure and Orientation of Oligonucleotide Duplexes Tethered to Gold Electrodes Probed by Infrared Reflection Absorption Spectroscopy: Effect of the Electrode Potentials.

    PubMed

    Kékedy-Nagy, László; Ferapontova, Elena E; Brand, Izabella

    2017-02-23

    Unique electronic and ligand recognition properties of the DNA double helix provide basis for DNA applications in biomolecular electronic and biosensor devices. However, the relation between the structure of DNA at electrified interfaces and its electronic properties is still not well understood. Here, potential-driven changes in the submolecular structure of DNA double helices composed of either adenine-thymine (dAdT) 25 or cytosine-guanine (dGdC) 20 base pairs tethered to the gold electrodes are for the first time analyzed by in situ polarization modulation infrared reflection absorption spectroscopy (PM IRRAS) performed under the electrochemical control. It is shown that the conformation of the DNA duplexes tethered to gold electrodes via the C 6 alkanethiol linker strongly depends on the nucleic acid sequence composition. The tilt of purine and pyrimidine rings of the complementary base pairs (dAdT and dGdC) depends on the potential applied to the electrode. By contrast, neither the conformation nor orientation of the ionic in character phosphate-sugar backbone is affected by the electrode potentials. At potentials more positive than the potential of zero charge (pzc), a gradual tilting of the double helix is observed. In this tilted orientation, the planes of the complementary purine and pyrimidine rings lie ideally parallel to each other. These potentials do not affect the integral stability of the DNA double helix at the charged interface. At potentials more negative than the pzc, DNA helices adopt a vertical to the gold surface orientation. Tilt of the purine and pyrimidine rings depends on the composition of the double helix. In monolayers composed of (dAdT) 25 molecules the rings of the complementary base pairs lie parallel to each other. By contrast, the tilt of purine and pyrimidine rings in (dGdC) 20 helices depends on the potential applied to the electrode. Such potential-induced mobility of the complementary base pairs can destabilize the helix structure at a submolecular level. These pioneer results on the potential-driven changes in the submolecular structure of double stranded DNA adsorbed on conductive supports contribute to further understanding of the potential-driven sequence-specific electronic properties of surface-tethered oligonucleotides.

  11. D-glucose derived novel gemini surfactants: synthesis and study of their surface properties, interaction with DNA, and cytotoxicity.

    PubMed

    Kumar, Vikash; Chatterjee, Amrita; Kumar, Nupur; Ganguly, Anasuya; Chakraborty, Indranil; Banerjee, Mainak

    2014-10-09

    Four new D-glucose derived m-s-m type gemini surfactants with variable spacer and tail length have been synthesized by a simple and efficient synthetic methodology utilizing the free C-3 hydroxy group of diisopropylidene glucose. The synthetic route to these gemini surfactants with a quaternary ammonium group as polar head group involves a sequence of simple reactions including alkylation, imine formation, quaternization of amine etc. The surface properties of the new geminis were evaluated by surface tension and conductivity measurements. These gemini surfactants showed low cytotoxicity by MTT assay on HeLa cell line. The DNA binding capabilities of these surfactants were determined by agarose gel electrophoresis, fluorescence titration, and DLS experiments. The preliminary studies by agarose gel electrophoresis indicated chain length dependent DNA binding abilities, further supported by ethidium bromide exclusion experiments. Two of the D-glucose derived gemini surfactants showed effective binding with pET-28a plasmid DNA (pDNA) at relatively low N/P ratio (i.e., cationic nitrogen/DNA phosphate molar ratio). Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. DNA Looping Facilitates Targeting of a Chromatin Remodeling Enzyme

    PubMed Central

    Yadon, Adam N; Singh, Badri Nath; Hampsey, Michael; Tsukiyama, Toshio

    2013-01-01

    Summary ATP-dependent chromatin remodeling enzymes are highly abundant and play pivotal roles regulating DNA-dependent processes. The mechanisms by which they are targeted to specific loci have not been well understood on a genome-wide scale. Here we present evidence that a major targeting mechanism for the Isw2 chromatin remodeling enzyme to specific genomic loci is through sequence-specific transcription factor (TF)-dependent recruitment. Unexpectedly, Isw2 is recruited in a TF-dependent fashion to a large number of loci without TF binding sites. Using the 3C assay, we show that Isw2 can be targeted by Ume6- and TFIIB-dependent DNA looping. These results identify DNA looping as a previously unknown mechanism for the recruitment of a chromatin remodeling enzyme and defines a novel function for DNA looping. We also present evidence suggesting that Ume6-dependent DNA looping is involved in chromatin remodeling and transcriptional repression, revealing a mechanism by which the three-dimensional folding of chromatin affects DNA-dependent processes. PMID:23478442

  13. Comparison of cellular lethality in DNA repair-proficient or -deficient cell lines resulting from exposure to 70 MeV/n protons or 290 MeV/n carbon ions.

    PubMed

    Genet, Stefan C; Maeda, Junko; Fujisawa, Hiroshi; Yurkon, Charles R; Fujii, Yoshihiro; Romero, Ashley M; Genik, Paula C; Fujimori, Akira; Kitamura, Hisashi; Kato, Takamitsu A

    2012-11-01

    Charged particle therapy utilizing protons or carbon ions has been rapidly intensifying over recent years. The present study was designed to jointly investigate these two charged particle treatment modalities with respect to modeled anatomical depth-dependent dose and linear energy transfer (LET) deliveries to cells with either normal or compromised DNA repair phenotypes. We compared cellular lethality in response to dose, LET and Bragg peak location for accelerated protons and carbon ions at 70 and 290 MeV/n, respectively. A novel experimental live cell irradiation OptiCell™ in vitro culture system using three different Chinese hamster ovary (CHO) cells as a mammalian model was conducted. A wild-type DNA repair-competent CHO cell line (CHO 10B2) was compared to two other CHO cell lines (51D1 and xrs5), each genetically deficient with respect to one of the two major DNA repair pathways (homologous recombination and non-homologous end joining pathways, respectively) following genotoxic insults. We found that wild-type and homologous recombination-deficient (Rad51D) cellular lethality was dependent on both the dose and LET of the carbon ions, whereas it was only dependent on dose for protons. The non-homologous end joining deficient cell line (Ku80 mutant) showed nearly identical dose-response profiles for both carbon ions and protons. Our results show that the increasingly used modality of carbon ions as charged particle therapy is advantageous to protons in a radiotherapeutic context, primarily for tumor cells proficient in non-homologous end joining DNA repair where cellular lethality is dependent not only on the dose as in the case of more common photon therapeutic modalities, but more importantly on the carbon ion LETs. Genetic characterization of patient tumors would be key to individualize and optimize the selection of radiation modality, clinical outcome and treatment cost.

  14. Tying a molecular knot with optical tweezers

    NASA Astrophysics Data System (ADS)

    Arai, Yasuharu; Yasuda, Ryohei; Akashi, Ken-Ichirou; Harada, Yoshie; Miyata, Hidetake; Kinosita, Kazuhiko; Itoh, Hiroyasu

    1999-06-01

    Filamentous structures are abundant in cells. Relatively rigid filaments, such as microtubules and actin, serve as intracellular scaffolds that support movement and force, and their mechanical properties are crucial to their function in the cell. Some aspects of the behaviour of DNA, meanwhile, depend critically on its flexibility-for example, DNA-binding proteins can induce sharp bends in the helix. The mechanical characterization of such filaments has generally been conducted without controlling the filament shape, by the observation of thermal motions or of the response to external forces or flows. Controlled buckling of a microtubule has been reported, but the analysis of the buckled shape was complicated. Here we report the continuous control of the radius of curvature of a molecular strand by tying a knot in it, using optical tweezers to manipulate the strand's ends. We find that actin filaments break at the knot when the knot diameter falls below 0.4µm. The pulling force at breakage is around 1pN, two orders of magnitude smaller than the tensile stress of a straight filament. The flexural rigidity of the filament remained unchanged down to this diameter. We have also knotted a single DNA molecule, opening up the possibility of studying curvature-dependent interactions with associated proteins. We find that the knotted DNA is stronger than actin.

  15. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance

    PubMed Central

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-01-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. PMID:25389272

  16. Conductance of Dry DNA: Role of Environment

    NASA Technical Reports Server (NTRS)

    Anantram, M. P.; Adessi, Ch.; S. Walch

    2003-01-01

    This paper presents viewgraphs on the conductance of dry DNA and its effect on the surrounding environment. The topics include: 1) Approach; 2) Influence of Counter Ions; 3) Conductance Versus DNA Length; 4) Intrinsic Resonant Tunneling in Engineered DNA Sequence; and 5) Transmission Versus Energy.

  17. DNA replication depends on photosynthetic electron transport in cyanobacteria.

    PubMed

    Ohbayashi, Ryudo; Watanabe, Satoru; Kanesaki, Yu; Narikawa, Rei; Chibazakura, Taku; Ikeuchi, Masahiko; Yoshikawa, Hirofumi

    2013-07-01

    The freshwater cyanobacterium Synechococcus elongatus PCC 7942 exhibits light-dependent growth. Although it has been reported that DNA replication also depends on light irradiation in S. elongatus 7942, the involvement of the light in the regulation of DNA replication remains unclear. To elucidate the regulatory pathway of DNA replication by light, we studied the effect of several inhibitors, including two electron transport inhibitors, 3-(3,4-dichlorophenyl)-1,1-dimethylurea (DCMU) and 2,5-dibromo-3-methyl-6-isopropyl-p-benzoquinone (DBMIB), on DNA replication in S. elongatus 7942. DCMU inhibited only DNA replication initiation, whereas DBMIB blocked both the initiation and progression of DNA replication. These results suggest that DNA replication depends on the photosynthetic electron transport activity and initiation and progression of DNA replication are regulated in different ways. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  18. Phylogenetic analysis of Columbid herpesvirus-1 in rock pigeons, birds of prey and non-raptorial birds in Poland

    PubMed Central

    2013-01-01

    Background The identity of herpesviruses isolated in Europe from domestic pigeons (Columbid herpesvirus-1 - CoHV-1) as well as falcons and owls remains unknown. All these herpesviruses are antigenically and genetically related. The falcons and owls are thought to have become infected during the ingestion of pigeon meat thus suggesting the virus’s capacity to infect a wide range of hosts. The aim of the conducted study was to detect the occurrence of CoHV-1 and estimating the similarities and differences in the DNA-dependent DNA polymerase gene of herpesviruses isolated from domestic pigeons, birds of prey and non-raptorial free-ranging birds in Poland. Results The study has shown the presence of CoHV-1 in 20.4% (18/88) in the examined birds. In case of one CoHV-1, infected Peregrine Falcon (Falco peregrinus), neurological signs were observed. Nucleotide sequencing of the DNA-dependent DNA polymerase gene, showed a high similarity among Polish strains (100%), independently from the species of the affected birds. Only one compared CoHV-1 strain - KP 21/23 originating from Germany showed a slightly lower similarity at a level of 99.1%. Further analysis has shown the identity of DNA-dependent DNA polymerase of CoHV-1 strains and other herpesviruses present in poultry as well as other birds ranged from 35.4 to 44.9%. Interestingly CoHV-1 infection was also confirmed for the first time in four non-raptorial birds. Conclusions The current study has shown a high similarity of CoHV-1 strains and the possible transmission of herpesviruses between domestic rock pigeons and free-ranging birds including raptors and non-raptorial birds. Further studies focused on cloning and the analysis of the whole CoHV-1 genome which is needed to explain the role of the observed similarities and differences between field strains of columbid herpesviruses. PMID:23517888

  19. Effect of interstitial palladium on plasmon-driven charge transfer in nanoparticle dimers.

    PubMed

    Lerch, Sarah; Reinhard, Björn M

    2018-04-23

    Capacitive plasmon coupling between noble metal nanoparticles (NPs) is characterized by an increasing red-shift of the bonding dipolar plasmon mode (BDP) in the classical electromagnetic coupling regime. This model breaks down at short separations where plasmon-driven charge transfer induces a gap current between the NPs with a magnitude and separation dependence that can be modulated if molecules are present in the gap. Here, we use gap contained DNA as a scaffold for the growth of palladium (Pd) NPs in the gap between two gold NPs and investigate the effect of increasing Pd NP concentration on the BDP mode. Consistent with enhanced plasmon-driven charge transfer, the integration of discrete Pd NPs depolarizes the capacitive BDP mode over longer interparticle separations than is possible in only DNA-linked Au NPs. High Pd NP densities in the gap increases the gap conductance and induces the transition from capacitive to conductive coupling.

  20. Structure-guided Mutational Analysis of the OB, HhH, and BRCT Domains of Escherichia coli DNA Ligase*S⃞

    PubMed Central

    Wang, Li Kai; Nair, Pravin A.; Shuman, Stewart

    2008-01-01

    NAD+-dependent DNA ligases (LigAs) are ubiquitous in bacteria and essential for growth. LigA enzymes have a modular structure in which a central catalytic core composed of nucleotidyltransferase and oligonucleotide-binding (OB) domains is linked via a tetracysteine zinc finger to distal helix-hairpin-helix (HhH) and BRCT (BRCA1-like C-terminal) domains. The OB and HhH domains contribute prominently to the protein clamp formed by LigA around nicked duplex DNA. Here we conducted a structure-function analysis of the OB and HhH domains of Escherichia coli LigA by alanine scanning and conservative substitutions, entailing 43 mutations at 22 amino acids. We thereby identified essential functional groups in the OB domain that engage the DNA phosphodiester backbone flanking the nick (Arg333); penetrate the minor grove and distort the nick (Val383 and Ile384); or stabilize the OB fold (Arg379). The essential constituents of the HhH domain include: four glycines (Gly455, Gly489, Gly521, Gly553), which bind the phosphate backbone across the minor groove at the outer margins of the LigA-DNA interface; Arg487, which penetrates the minor groove at the outer margin on the 3 ®-OH side of the nick; and Arg446, which promotes protein clamp formation via contacts to the nucleotidyltransferase domain. We find that the BRCT domain is required in its entirety for effective nick sealing and AMP-dependent supercoil relaxation. PMID:18515356

  1. Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

    PubMed Central

    Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

    2012-01-01

    Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

  2. Structure-guided mutational analysis of the OB, HhH, and BRCT domains of Escherichia coli DNA ligase.

    PubMed

    Wang, Li Kai; Nair, Pravin A; Shuman, Stewart

    2008-08-22

    NAD(+)-dependent DNA ligases (LigAs) are ubiquitous in bacteria and essential for growth. LigA enzymes have a modular structure in which a central catalytic core composed of nucleotidyltransferase and oligonucleotide-binding (OB) domains is linked via a tetracysteine zinc finger to distal helix-hairpin-helix (HhH) and BRCT (BRCA1-like C-terminal) domains. The OB and HhH domains contribute prominently to the protein clamp formed by LigA around nicked duplex DNA. Here we conducted a structure-function analysis of the OB and HhH domains of Escherichia coli LigA by alanine scanning and conservative substitutions, entailing 43 mutations at 22 amino acids. We thereby identified essential functional groups in the OB domain that engage the DNA phosphodiester backbone flanking the nick (Arg(333)); penetrate the minor grove and distort the nick (Val(383) and Ile(384)); or stabilize the OB fold (Arg(379)). The essential constituents of the HhH domain include: four glycines (Gly(455), Gly(489), Gly(521), Gly(553)), which bind the phosphate backbone across the minor groove at the outer margins of the LigA-DNA interface; Arg(487), which penetrates the minor groove at the outer margin on the 3 (R)-OH side of the nick; and Arg(446), which promotes protein clamp formation via contacts to the nucleotidyltransferase domain. We find that the BRCT domain is required in its entirety for effective nick sealing and AMP-dependent supercoil relaxation.

  3. Escherichia coli STb toxin induces apoptosis in intestinal epithelial cell lines.

    PubMed

    Syed, H Claudia; Dubreuil, J Daniel

    2012-09-01

    A previous study conducted in our laboratory demonstrated that cells having internalized Escherichia coli STb toxin display apoptotic-like morphology. We therefore investigated if STb could induce programmed cell death in both a human and an animal intestinal epithelial cell lines. HRT-18 (Human Colon Tumor) and IEC-18 (Rat Ileum Epithelial Cells) cell lines were used. As STb is frequently tested in a rat model, the IEC-18 cell line was most relevant to our work. The cell lines were treated with various amounts of purified STb (nanomole range) for a period of 24 h after which cells were harvested and examined for apoptotic characteristics. Caspase-9, the initiator of mitochondrion-mediated apoptosis, and caspase-3, an effector of caspase-9, were both activated following STb intoxication of HRT-18 and IEC-18 cells whereas caspase-8, the initiator caspase of the extrinsic pathway, was not activated. For both cell lines, agarose gel electrophoresis of the cell DNA content reveals laddering of DNA, resulting from DNA fragmentation, a characteristic of apoptosis. Hoechst 33342-stained DNA of STb-treated cell lines, observed using fluorescence microscopy, revealed condensation and fragmentation of the nuclei. Apoptotic indexes calculated from fragmented nuclei of Hoechst 33342-stained DNA for HRT-18 and IEC-18 cells showed an STb dose-dependent response. Overall, these data indicate that STb toxin induces a mitochondrion-mediated caspase-dependent apoptotic pathway. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    PubMed

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Gate-controlled conductance switching in DNA

    PubMed Central

    Xiang, Limin; Palma, Julio L.; Li, Yueqi; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2017-01-01

    Extensive evidence has shown that long-range charge transport can occur along double helical DNA, but active control (switching) of single-DNA conductance with an external field has not yet been demonstrated. Here we demonstrate conductance switching in DNA by replacing a DNA base with a redox group. By applying an electrochemical (EC) gate voltage to the molecule, we switch the redox group between the oxidized and reduced states, leading to reversible switching of the DNA conductance between two discrete levels. We further show that monitoring the individual conductance switching allows the study of redox reaction kinetics and thermodynamics at single molecular level using DNA as a probe. Our theoretical calculations suggest that the switch is due to the change in the energy level alignment of the redox states relative to the Fermi level of the electrodes. PMID:28218275

  6. Metal-conductive polymer hybrid nanostructures: preparation and electrical properties of palladium-polyimidazole nanowires

    NASA Astrophysics Data System (ADS)

    Al-Hinai, Mariam; Hassanien, Reda; Watson, Scott M. D.; Wright, Nicholas G.; Houlton, Andrew; Horrocks, Benjamin R.

    2016-03-01

    A simple, convenient method for the formation of hybrid metal/conductive polymer nanostructures is described. Polyimidazole (PIm) has been templated on λ-DNA via oxidative polymerisation of imidazole using FeCl3 to produce conductive PIm/DNA nanowires. The PIm/DNA nanowires were decorated with Pd (Pd/PIm/DNA) by electroless reduction of {{{{PdCl}}}4}2- with NaBH4 in the presence of PIm/DNA; the choice of imidazole was motivated by the potential Pd(II) binding site at the pyridinic N atom. The formation of PIm/DNA and the presence of metallic Pd on Pd/PIm/DNA nanowires were verified by FTIR, UV-vis and XPS spectroscopy techniques. AFM studies show that the nanowires have diameters in the range 5-45 nm with a slightly greater mean diameter (17.1 ± 0.75 nm) for the Pd-decorated nanowires than the PIm/DNA nanowires (14.5 ± 0.89 nm). After incubation for 24 h in the polymerisation solution, the PIm/DNA nanowires show a smooth, uniform morphology, which is retained after decoration with Pd. Using a combination of scanned conductance microscopy, conductive AFM and two-terminal measurements we show that both types of nanowire are conductive and that it is possible to discriminate different possible mechanisms of transport. The conductivity of the Pd/PIm/DNA nanowires, (0.1-1.4 S cm-1), is comparable to the PIm/DNA nanowires (0.37 ± 0.029 S cm-1). In addition, the conductance of Pd/PIm/DNA nanowires exhibits Arrhenius behaviour (E a = 0.43 ± 0.02 eV) as a function of temperature in contrast to simple Pd/DNA nanowires. These results indicate that although the Pd crystallites on Pd/PIm/DNA nanowires decorate the PIm polymer, the major current pathway is through the polymer rather than the Pd.

  7. DNA Dendrimer: An Efficient Nanocarrier of Functional Nucleic Acids for Intracellular Molecular Sensing

    PubMed Central

    2015-01-01

    Functional nucleic acid (FNA)-based sensing systems have been developed for efficient detection of a wide range of biorelated analytes by employing DNAzymes or aptamers as recognition units. However, their intracellular delivery has always been a concern, mainly in delivery efficiency, kinetics, and the amount of delivered FNAs. Here we report a DNA dendrimer scaffold as an efficient nanocarrier to deliver FNAs and to conduct in situ monitoring of biological molecules in living cells. A histidine-dependent DNAzyme and an anti-ATP aptamer were chosen separately as the model FNAs to make the FNA dendrimer. The FNA-embedded DNA dendrimers maintained the catalytic activity of the DNAzyme or the aptamer recognition function toward ATP in the cellular environment, with no change in sensitivity or specificity. Moreover, these DNA dendrimeric nanocarriers show excellent biocompatibility, high intracellular delivery efficiency, and sufficient stability in a cellular environment. This FNA dendrimeric nanocarrier may find a broad spectrum of applications in biomedical diagnosis and therapy. PMID:24806614

  8. Oxidative stress and DNA damage induced by imidacloprid in zebrafish (Danio rerio).

    PubMed

    Ge, Weili; Yan, Saihong; Wang, Jinhua; Zhu, Lusheng; Chen, Aimei; Wang, Jun

    2015-02-18

    Imidacloprid is a neonicotinoid insecticide that can have negative effects on nontarget animals. The present study was conducted to assess the toxicity of various imidacloprid doses (0.3, 1.25, and 5 mg/mL) on zebrafish sampled after 7, 14, 21, and 28 days of exposure. The levels of catalase (CAT), superoxide dismutase (SOD), reactive oxygen species (ROS), glutathione-S-transferase (GST), and malondialdehyde (MDA) and the extent of DNA damage were measured to evaluate the toxicity of imidacloprid on zebrafish. SOD and GST activities were noticeably increased during early exposure but were inhibited toward the end of the exposure period. In addition, the CAT levels decreased to the control level following their elevation during early exposure. High concentrations of imidacloprid (1.25 and 5 mg/L) induced excessive ROS production and markedly increased MDA content on the 21st day of exposure. DNA damage was dose- and time-dependent. In conclusion, the present study showed that imidacloprid can induce oxidative stress and DNA damage in zebrafish.

  9. Assessment of gamma ray-induced DNA damage in Lasioderma serricorne using the comet assay

    NASA Astrophysics Data System (ADS)

    Kameya, Hiromi; Miyanoshita, Akihiro; Imamura, Taro; Todoriki, Setsuko

    2012-03-01

    We attempted a DNA comet assay under alkaline conditions to verify the irradiation treatment of pests. Lasioderma serricorne (Fabricius) were chosen as test insects and irradiated with gamma rays from a 60Co source at 1 kGy. We conducted the comet assay immediately after irradiation and over time for 7 day. Severe DNA fragmentation in L. serricorne cells was observed just after irradiation and the damage was repaired during the post-irradiation period in a time-dependent manner. The parameters of the comet image analysis were calculated, and the degree of DNA damage and repair were evaluated. Values for the Ratio (a percentage determined by fluorescence in the damaged area to overall luminance, including intact DNA and the damaged area of a comet image) of individual cells showed that no cells in the irradiated group were included in the Ratio<0.1 category, the lowest grade. This finding was observed consistently throughout the 7-day post-irradiation period. We suggest that the Ratio values of individual cells can be used as an index of irradiation history and conclude that the DNA comet assay under alkaline conditions, combined with comet image analysis, can be used to identify irradiation history.

  10. Loss of ATRX, associated with DNA methylation pattern of chromosome end, impacted biological behaviors of astrocytic tumors

    PubMed Central

    Zhang, Wei; Yang, Pei; Zhang, Chuanbao; Li, Mingyang; Yao, Kun; Wang, Hongjun; Li, Qingbin; Jiang, Chuanlu; Jiang, Tao

    2015-01-01

    Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with astrocytic tumors to study whether ATRX expression was associated with DNA methylation level in astrocytic tumors and in which cellular functions it participated. We observed that astrocytic tumors with lower ATRX expression harbored higher DNA methylation level at chromatin end and astrocytic tumors with ATRX-low had distinct gene expression profile and DNA methylation profile compared with ATRX-high tumors. Then, we uncovered that several ATRX associated biological functions in the DNA methylation and mRNA expression profile (GEP), including apoptotic process, DNA-dependent positive regulation of transcription, chromatin modification, and observed that ATRX expression was companied by MGMT methylation and expression. We also found that loss of ATRX caused by siRNA induced apoptotic cells increasing, reduced tumor cell proliferation and repressed the cell migration in glioma cells. Our results showed ATRX-related regulatory functions of the combined profiles from DNA methylation and mRNA expression in astrocytic tumors, and delineated that loss of ATRX impacted biological behaviors of astrocytic tumor cells, providing important resources for future dissection of ATRX role in glioma. PMID:25971279

  11. Loss of ATRX, associated with DNA methylation pattern of chromosome end, impacted biological behaviors of astrocytic tumors.

    PubMed

    Cai, Jinquan; Chen, Jing; Zhang, Wei; Yang, Pei; Zhang, Chuanbao; Li, Mingyang; Yao, Kun; Wang, Hongjun; Li, Qingbin; Jiang, Chuanlu; Jiang, Tao

    2015-07-20

    Loss of ATRX leads to epigenetic alterations, including abnormal levels of DNA methylation at repetitive elements such as telomeres in murine cells. We conducted an extensive DNA methylation and mRNA expression profile study on a cohort of 82 patients with astrocytic tumors to study whether ATRX expression was associated with DNA methylation level in astrocytic tumors and in which cellular functions it participated. We observed that astrocytic tumors with lower ATRX expression harbored higher DNA methylation level at chromatin end and astrocytic tumors with ATRX-low had distinct gene expression profile and DNA methylation profile compared with ATRX-high tumors. Then, we uncovered that several ATRX associated biological functions in the DNA methylation and mRNA expression profile (GEP), including apoptotic process, DNA-dependent positive regulation of transcription, chromatin modification, and observed that ATRX expression was companied by MGMT methylation and expression. We also found that loss of ATRX caused by siRNA induced apoptotic cells increasing, reduced tumor cell proliferation and repressed the cell migration in glioma cells. Our results showed ATRX-related regulatory functions of the combined profiles from DNA methylation and mRNA expression in astrocytic tumors, and delineated that loss of ATRX impacted biological behaviors of astrocytic tumor cells, providing important resources for future dissection of ATRX role in glioma.

  12. In vitro and in vivo gene delivery using chitosan/hyaluronic acid nanoparticles: Influences of molecular mass of hyaluronic acid and lyophilization on transfection efficiency.

    PubMed

    Sato, Toshinori; Nakata, Mitsuhiro; Yang, Zhihong; Torizuka, Yu; Kishimoto, Satoko; Ishihara, Masayuki

    2017-08-01

    Lyophilization is an effective method for preserving nonviral gene vectors. To improve the stability and transgene expression of lyophilized plasmid DNA (pDNA) complexes, we coated the surfaces of pDNA/chitosan complexes with hyaluronic acid (HA) of varying molecular masses. The transgene expression of pDNA/chitosan/HA ternary complexes was characterized in vitro and in vivo. pDNA complexes were lyophilized overnight and the resultant products with spongy, porous consistencies were stored at -30, 4 or 25°C for 2 weeks. Rehydrated complexes were characterized using gel retardation assays, aiming to confirm complex formation, measure particle size and evaluate zeta potential, as well as conduct luciferase gene reporter assays. The anti-tumor effects of pDNA ternary complexes were evaluated using suicide gene (pTK) coding thymidine kinase in Huh7-implanted mice. Transfection efficiencies of pDNA/chitosan/HA ternary complexes were dependent on the average molecular masses of HA. The coating of pDNA/chitosan complexes with HA maintained the cellular transfection efficiencies of lyophilized pDNA ternary complexes. Furthermore, intratumoral injection of lyophilized, rehydrated pDNA ternary complexes into tumor-bearing mice showed a significant suppression of tumor growth. The coating of pDNA/chitosan complexes with high-molecular-weight HA augmented the stability and cellular transfection ability of the complexes after lyophilization-rehydration. Copyright © 2017 John Wiley & Sons, Ltd.

  13. Deregulation of DNA-dependent protein kinase catalytic subunit contributes to human hepatocarcinogenesis development and has a putative prognostic value.

    PubMed

    Evert, M; Frau, M; Tomasi, M L; Latte, G; Simile, M M; Seddaiu, M A; Zimmermann, A; Ladu, S; Staniscia, T; Brozzetti, S; Solinas, G; Dombrowski, F; Feo, F; Pascale, R M; Calvisi, D F

    2013-11-12

    The DNA-repair gene DNA-dependent kinase catalytic subunit (DNA-PKcs) favours or inhibits carcinogenesis, depending on the cancer type. Its role in human hepatocellular carcinoma (HCC) is unknown. DNA-dependent protein kinase catalytic subunit, H2A histone family member X (H2AFX) and heat shock transcription factor-1 (HSF1) levels were assessed by immunohistochemistry and/or immunoblotting and qRT-PCR in a collection of human HCC. Rates of proliferation, apoptosis, microvessel density and genomic instability were also determined. Heat shock factor-1 cDNA or DNA-PKcs-specific siRNA were used to explore the role of both genes in HCC. Activator protein 1 (AP-1) binding to DNA-PKcs promoter was evaluated by chromatin immunoprecipitation. Kaplan-Meier curves and multivariate Cox model were used to study the impact on clinical outcome. Total and phosphorylated DNA-PKcs and H2AFX were upregulated in HCC. Activated DNA-PKcs positively correlated with HCC proliferation, genomic instability and microvessel density, and negatively with apoptosis and patient's survival. Proliferation decline and massive apoptosis followed DNA-PKcs silencing in HCC cell lines. Total and phosphorylated HSF1 protein, mRNA and activity were upregulated in HCC. Mechanistically, we demonstrated that HSF1 induces DNA-PKcs upregulation through the activation of the MAPK/JNK/AP-1 axis. DNA-dependent protein kinase catalytic subunit transduces HSF1 effects in HCC cells, and might represent a novel target and prognostic factor in human HCC.

  14. Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

    PubMed Central

    Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

    2016-01-01

    Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

  15. DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

    PubMed Central

    Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

    2014-01-01

    As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

  16. Blood micronutrients and DNA damage in children.

    PubMed

    Milne, Elizabeth; Greenop, Kathryn R; Ramankutty, Padmaja; Miller, Margaret; de Klerk, Nicholas H; Armstrong, Bruce K; Almond, Theodora; O'Callaghan, Nathan J; Fenech, Michael

    2015-10-01

    Maintenance of normal cellular phenotype depends largely on accurate DNA replication and repair. DNA damage causes gene mutations and predisposes to cancer and other chronic diseases. Growing evidence indicates that nutritional factors are associated with DNA damage in adults; here, we investigate these associations in children. We conducted a cross-sectional study among 462 healthy children 3, 6, and 9 years of age. Blood was collected and micronutrient levels were measured. The cytokinesis-block micronucleus cytome assay was used to measure chromosomal DNA damage (micronuclei, nucleoplasmic bridges, and nuclear buds) in lymphocytes. Cell apoptosis, necrosis, and the nuclear division index were also measured. Nine loci in genes involved in folate metabolism and DNA repair were genotyped. Data were analyzed using linear regression with adjustment for potential confounders. Plasma calcium was positively associated with micronuclei and necrosis, and α-tocopherol negatively associated with apoptosis, nuclear division index, and nucleoplasmic bridges; lutein was positively associated with nucleoplasmic bridges. α-tocopherol was positively associated with necrosis. DNA damage in healthy children may be influenced by blood micronutrient levels and certain genotypes. Further investigation of associations between nutritional status and genomic integrity in children is needed to shed additional light on potential mechanisms. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

    PubMed

    Weterings, Eric; Chen, David J

    2007-10-22

    The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

  18. Expression and permeation properties of the K(+) channel Kir7.1 in the retinal pigment epithelium.

    PubMed

    Shimura, M; Yuan, Y; Chang, J T; Zhang, S; Campochiaro, P A; Zack, D J; Hughes, B A

    2001-03-01

    Bovine Kir7.1 clones were obtained from a retinal pigment epithelium (RPE)-subtracted cDNA library. Human RPE cDNA library screening resulted in clones encoding full-length human Kir7.1. Northern blot analysis indicated that bovine Kir7.1 is highly expressed in the RPE. Human Kir7.1 channels were expressed in Xenopus oocytes and studied using the two-electrode voltage-clamp technique. The macroscopic Kir7.1 conductance exhibited mild inward rectification and an inverse dependence on extracellular K+ concentration ([K+]o). The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.013) > Na+ (0.003) approximately Li+ (0.001) and the sequence based on conductance ratios was Rb+ (9.5) > K+ (1.0) > Na+ (0.458) > Cs+ (0.331) > Li+ (0.139). Non-stationary noise analysis of Rb+ currents in cell-attached patches yielded a unitary conductance for Kir7.1 of approximately 2 pS. In whole-cell recordings from freshly isolated bovine RPE cells, the predominant current was a mild inwardly rectifying K+ current that exhibited an inverse dependence of conductance on [K+]o. The selectivity sequence based on permeability ratios was K+ (1.0) approximately Rb+ (0.89) > Cs+ (0.021) > Na+ (0.003) approximately Li+ (0.002) and the sequence based on conductance ratios was Rb+ (8.9) > K+ (1.0) > Na+ (0.59) > Cs+ (0.23) > Li+ (0.08). In cell-attached recordings with Rb+ in the pipette, inwardly rectifying currents were observed in nine of 12 patches of RPE apical membrane but in only one of 13 basolateral membrane patches. Non-stationary noise analysis of Rb+ currents in cell-attached apical membrane patches yielded a unitary conductance for RPE Kir of approximately 2 pS. On the basis of this molecular and electrophysiological evidence, we conclude that Kir7.1 channel subunits comprise the K+ conductance of the RPE apical membrane.

  19. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko

    2014-09-26

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the processmore » by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.« less

  20. A Nonconventional Approach to Patterned Nanoarrays of DNA Strands for Template-Assisted Assembly of Polyfluorene Nanowires.

    PubMed

    Bae, Dong Geun; Jeong, Ji-Eun; Kang, Seok Hee; Byun, Myunghwan; Han, Dong-Wook; Lin, Zhiqun; Woo, Han Young; Hong, Suck Won

    2016-08-01

    DNA molecules have been widely recognized as promising building blocks for constructing functional nanostructures with two main features, that is, self-assembly and rich chemical functionality. The intrinsic feature size of DNA makes it attractive for creating versatile nanostructures. Moreover, the ease of access to tune the surface of DNA by chemical functionalization offers numerous opportunities for many applications. Herein, a simple yet robust strategy is developed to yield the self-assembly of DNA by exploiting controlled evaporative assembly of DNA solution in a unique confined geometry. Intriguingly, depending on the concentration of DNA solution, highly aligned nanostructured fibrillar-like arrays and well-positioned concentric ring-like superstructures composed of DNAs are formed. Subsequently, the ring-like negatively charged DNA superstructures are employed as template to produce conductive organic nanowires on a silicon substrate by complexing with a positively charged conjugated polyelectrolyte poly[9,9-bis(6'-N,N,N-trimethylammoniumhexyl)fluorene dibromide] (PF2) through the strong electrostatic interaction. Finally, a monolithic integration of aligned arrays of DNA-templated PF2 nanowires to yield two DNA/PF2-based devices is demonstrated. It is envisioned that this strategy can be readily extended to pattern other biomolecules and may render a broad range of potential applications from the nucleotide sequence and hybridization as recognition events to transducing elements in chemical sensors. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Theoretical rate constants of super-exchange hole transfer and thermally induced hopping in DNA.

    PubMed

    Shimazaki, Tomomi; Asai, Yoshihiro; Yamashita, Koichi

    2005-01-27

    Recently, the electronic properties of DNA have been extensively studied, because its conductivity is important not only to the study of fundamental biological problems, but also in the development of molecular-sized electronics and biosensors. We have studied theoretically the reorganization energies, the activation energies, the electronic coupling matrix elements, and the rate constants of hole transfer in B-form double-helix DNA in water. To accommodate the effects of DNA nuclear motions, a subset of reaction coordinates for hole transfer was extracted from classical molecular dynamics (MD) trajectories of DNA in water and then used for ab initio quantum chemical calculations of electron coupling constants based on the generalized Mulliken-Hush model. A molecular mechanics (MM) method was used to determine the nuclear Franck-Condon factor. The rate constants for two types of mechanisms of hole transfer-the thermally induced hopping (TIH) and the super-exchange mechanisms-were determined based on Marcus theory. We found that the calculated matrix elements are strongly dependent on the conformations of the nucleobase pairs of hole-transferable DNA and extend over a wide range of values for the "rise" base-step parameter but cluster around a particular value for the "twist" parameter. The calculated activation energies are in good agreement with experimental results. Whereas the rate constant for the TIH mechanism is not dependent on the number of A-T nucleobase pairs that act as a bridge, the rate constant for the super-exchange process rapidly decreases when the length of the bridge increases. These characteristic trends in the calculated rate constants effectively reproduce those in the experimental data of Giese et al. [Nature 2001, 412, 318]. The calculated rate constants were also compared with the experimental results of Lewis et al. [Nature 2000, 406, 51].

  2. Sequence-dependent DNA deformability studied using molecular dynamics simulations.

    PubMed

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.

  3. Highly Conductive Thin Uniform Gold-Coated DNA Nanowires.

    PubMed

    Stern, Avigail; Eidelshtein, Gennady; Zhuravel, Roman; Livshits, Gideon I; Rotem, Dvir; Kotlyar, Alexander; Porath, Danny

    2018-06-01

    Over the past decades, DNA, the carrier of genetic information, has been used by researchers as a structural template material. Watson-Crick base pairing enables the formation of complex 2D and 3D structures from DNA through self-assembly. Various methods have been developed to functionalize these structures for numerous utilities. Metallization of DNA has attracted much attention as a means of forming conductive nanostructures. Nevertheless, most of the metallized DNA wires reported so far suffer from irregularity and lack of end-to-end electrical connectivity. An effective technique for formation of thin gold-coated DNA wires that overcomes these drawbacks is developed and presented here. A conductive atomic force microscopy setup, which is suitable for measuring tens to thousands of nanometer long molecules and wires, is used to characterize these DNA-based nanowires. The wires reported here are the narrowest gold-coated DNA wires that display long-range conductivity. The measurements presented show that the conductivity is limited by defects, and that thicker gold coating reduces the number of defects and increases the conductive length. This preparation method enables the formation of molecular wires with dimensions and uniformity that are much more suitable for DNA-based molecular electronics. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    PubMed

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  5. Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression

    PubMed Central

    Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

    2016-01-01

    Half of human genome is made of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using Bacterial Artificial Chromosomes (BACs) in Xenopus laevis egg extract. Using this approach we characterized chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication dependent enrichment of a network of DNA repair factors among which the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to inability of single stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of Topoisomerase I dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications on our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions. PMID:27111843

  6. DNA-Templated Molecular Silver Fluorophores

    PubMed Central

    Petty, Jeffrey T.; Story, Sandra P.; Hsiang, Jung-Cheng; Dickson, Robert M.

    2013-01-01

    Conductive and plasmon-supporting noble metals exhibit an especially wide range of size-dependent properties, with discrete electronic levels, strong optical absorption, and efficient radiative relaxation dominating optical behavior at the ~10-atom cluster scale. In this Perspective, we describe the formation and stabilization of silver clusters using DNA templates and highlight the distinct spectroscopic and photophysical properties of the resulting hybrid fluorophores. Strong visible to near-IR emission from DNA-encapsulated silver clusters ranging in size from 5–11 atoms has been produced and characterized. Importantly, this strong Ag cluster fluorescence can be directly modulated and selectively recovered by optically controlling the dark state residence, even when faced with an overwhelming background. The strength and sequence sensitivity of the oligonucleotide-Ag interaction suggests strategies for fine tuning and stabilizing cluster-based emitters in a host of sensing and biolabeling applications that would benefit from brighter, more photostable, and quantifiable emitters in high background environments. PMID:23745165

  7. Early zygote-specific nuclease in mitochondria of the true slime mold Physarum polycephalum.

    PubMed

    Moriyama, Yohsuke; Yamazaki, Tomokazu; Nomura, Hideo; Sasaki, Narie; Kawano, Shigeyuki

    2005-11-01

    The active, selective digestion of mtDNA from one parent is a possible molecular mechanism for the uniparental inheritance of mtDNA. In Physarum polycephalum, mtDNA is packed by DNA-binding protein Glom, which packs mtDNA into rod-shaped mt-nucleoids. After the mating, mtDNA from one parent is selectively digested, and the Glom began to disperse. Dispersed Glom was retained for at least 6 h after mtDNA digestion, but disappeared completely by about 12 h after mixing two strains. We identified two novel nucleases using DNA zymography with native-PAGE and SDS-PAGE. One is a Ca2+-dependent, high-molecular-weight nuclease complex (about 670 kDa), and the other is a Mn2+-dependent, high-molecular-weight nuclease complex (440-670 kDa); the activity of the latter was detected as a Mn2+-dependent, 13-kDa DNase band on SDS-PAGE. All mitochondria isolated from myxamoebae had mt-nucleoids, whereas half of the mitochondria isolated from the zygotes at 12 h after mixing had lost the mt-nucleoids. The activity of the Mn2+-dependent nuclease in the isolated mitochondria was detected at least 8 h after mixing of two strains. The timing and localization of the Mn2+-dependent DNase activity matched the selective digestion of mtDNA.

  8. DNA Stimulates ATP-Dependent Proteolysis and Protein-Dependent ATPase Activity of Protease La from Escherichia coli

    NASA Astrophysics Data System (ADS)

    Chung, Chin Ha; Goldberg, Alfred L.

    1982-02-01

    The product of the lon gene in Escherichia coli is an ATP-dependent protease, protease La, that also binds strongly to DNA. Addition of double-stranded or single-stranded DNA to the protease in the presence of ATP was found to stimulate the hydrolysis of casein or globin 2- to 7-fold, depending on the DNA concentration. Native DNA from several sources (plasmid pBR322, phage T7, or calf thymus) had similar effects, but after denaturation the DNA was 20-100% more effective than the native form. Although poly(rA), globin mRNA, and various tRNAs did not stimulate proteolysis, poly(rC) and poly(rU) were effective. Poly(dT) was stimulatory but (dT)10 was not. In the presence of DNA as in its absence, proteolysis required concomitant ATP hydrolysis, and the addition of DNA also enhanced ATP hydrolysis by protease La 2-fold, but only in the presence of casein. At much higher concentrations, DNA inhibited proteolysis as well as ATP cleavage. Thus, association of this enzyme with DNA may regulate the degradation of cell proteins in vivo.

  9. Structure of the adenylation domain of NAD[superscript +]-dependent DNA ligase from Staphylococcus aureus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Han, Seungil; Chang, Jeanne S.; Griffor, Matt

    DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3''-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD{sup +}-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD{sup +}-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD{sup +}-binding pocket and the 'C2more » tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.« less

  10. Helicase-dependent amplification of nucleic acids.

    PubMed

    Cao, Yun; Kim, Hyun-Jin; Li, Ying; Kong, Huimin; Lemieux, Bertrand

    2013-10-11

    Helicase-dependent amplification (HDA) is a novel method for the isothermal in vitro amplification of nucleic acids. The HDA reaction selectively amplifies a target sequence by extension of two oligonucleotide primers. Unlike the polymerase chain reaction (PCR), HDA uses a helicase enzyme to separate the deoxyribonucleic acid (DNA) strands, rather than heat denaturation. This allows DNA amplification without the need for thermal cycling. The helicase used in HDA is a helicase super family II protein obtained from a thermophilic organism, Thermoanaerobacter tengcongensis (TteUvrD). This thermostable helicase is capable of unwinding blunt-end nucleic acid substrates at elevated temperatures (60° to 65°C). The HDA reaction can also be coupled with reverse transcription for ribonucleic acid (RNA) amplification. The products of this reaction can be detected during the reaction using fluorescent probes when incubations are conducted in a fluorimeter. Alternatively, products can be detected after amplification using a disposable amplicon containment device that contains an embedded lateral flow strip. Copyright © 2013 John Wiley & Sons, Inc.

  11. Enhancing the efficiency of polymerase chain reaction using graphene nanoflakes.

    PubMed

    Abdul Khaliq, R; Kafafy, Raed; Salleh, Hamzah Mohd; Faris, Waleed Fekry

    2012-11-16

    The effect of the recently developed graphene nanoflakes (GNFs) on the polymerase chain reaction (PCR) has been investigated in this paper. The rationale behind the use of GNFs is their unique physical and thermal properties. Experiments show that GNFs can enhance the thermal conductivity of base fluids and results also revealed that GNFs are a potential enhancer of PCR efficiency; moreover, the PCR enhancements are strongly dependent on GNF concentration. It was found that GNFs yield DNA product equivalent to positive control with up to 65% reduction in the PCR cycles. It was also observed that the PCR yield is dependent on the GNF size, wherein the surface area increases and augments thermal conductivity. Computational fluid dynamics (CFD) simulations were performed to analyze the heat transfer through the PCR tube model in the presence and absence of GNFs. The results suggest that the superior thermal conductivity effect of GNFs may be the main cause of the PCR enhancement.

  12. Molecular Toxicology of Chromatin

    DTIC Science & Technology

    1992-01-01

    towards the DNA analogs used as coenzymes suggests that the maximal activation by spermine , that depends on coDNA, may involve DNA structures which...evidence for the participation of spermine in an ADPRT-mediated regulatory system that can modify DNA structures , it seems plausible to assume tnat ADPRT may...DNA-dependent manner. The binding properties of spermine -, polylysine- and p olyarginine-Sepharose 4B affinity matrices were also determined. The

  13. DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase

    PubMed Central

    Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

    2014-01-01

    Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026

  14. On the Stability of DNA Origami Nanostructures in Low-Magnesium Buffers.

    PubMed

    Kielar, Charlotte; Xin, Yang; Shen, Boxuan; Kostiainen, Mauri A; Grundmeier, Guido; Linko, Veikko; Keller, Adrian

    2018-05-25

    DNA origami have great potential as functional platforms in various biomedical applications. Many applications, however, are incompatible with the high Mg2+ concentrations commonly believed to be a prerequisite for maintaining DNA origami integrity. Here, we investigate DNA origami stability in low-Mg2+ buffers. DNA origami stability is found to crucially depend on the availability of residual Mg2+ ions for screening electrostatic repulsion. The presence of EDTA and phosphate ions may thus facilitate DNA origami denaturation by displacing Mg2+ ions from the DNA backbone and reducing the strength of the Mg2+-DNA interaction, respectively. Most remarkably, these buffer dependencies are affected by DNA origami superstructure. However, by rationally selecting buffer components and considering superstructure-dependent effects, the structural integrity of a given DNA origami nanostructure can be maintained in conventional buffers even at Mg2+ concentrations in the low-μM range. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Temperature-Dependent Charge Transport through Individually Contacted DNA Origami-Based Au Nanowires.

    PubMed

    Teschome, Bezu; Facsko, Stefan; Schönherr, Tommy; Kerbusch, Jochen; Keller, Adrian; Erbe, Artur

    2016-10-11

    DNA origami nanostructures have been used extensively as scaffolds for numerous applications such as for organizing both organic and inorganic nanomaterials, studying single molecule reactions, and fabricating photonic devices. Yet, little has been done toward the integration of DNA origami nanostructures into nanoelectronic devices. Among other challenges, the technical difficulties in producing well-defined electrical contacts between macroscopic electrodes and individual DNA origami-based nanodevices represent a serious bottleneck that hinders the thorough characterization of such devices. Therefore, in this work, we have developed a method to electrically contact individual DNA origami-based metallic nanowires using electron beam lithography. We then characterize the charge transport of such nanowires in the temperature range from room temperature down to 4.2 K. The room temperature charge transport measurements exhibit ohmic behavior, whereas at lower temperatures, multiple charge transport mechanisms such as tunneling and thermally assisted transport start to dominate. Our results confirm that charge transport along metallized DNA origami nanostructures may deviate from pure metallic behavior due to several factors including partial metallization, seed inhomogeneities, impurities, and weak electronic coupling among AuNPs. Besides, this study further elucidates the importance of variable temperature measurements for determining the dominant charge transport mechanisms for conductive nanostructures made by self-assembly approaches.

  16. Optical properties and electronic transitions of DNA oligonucleotides as a function of composition and stacking sequence.

    PubMed

    Schimelman, Jacob B; Dryden, Daniel M; Poudel, Lokendra; Krawiec, Katherine E; Ma, Yingfang; Podgornik, Rudolf; Parsegian, V Adrian; Denoyer, Linda K; Ching, Wai-Yim; Steinmetz, Nicole F; French, Roger H

    2015-02-14

    The role of base pair composition and stacking sequence in the optical properties and electronic transitions of DNA is of fundamental interest. We present and compare the optical properties of DNA oligonucleotides (AT)10, (AT)5(GC)5, and (AT-GC)5 using both ab initio methods and UV-vis molar absorbance measurements. Our data indicate a strong dependence of both the position and intensity of UV absorbance features on oligonucleotide composition and stacking sequence. The partial densities of states for each oligonucleotide indicate that the valence band edge arises from a feature associated with the PO4(3-) complex anion, and the conduction band edge arises from anti-bonding states in DNA base pairs. The results show a strong correspondence between the ab initio and experimentally determined optical properties. These results highlight the benefit of full spectral analysis of DNA, as opposed to reductive methods that consider only the 260 nm absorbance (A260) or simple purity ratios, such as A260/A230 or A260/A280, and suggest that the slope of the absorption edge onset may provide a useful metric for the degree of base pair stacking in DNA. These insights may prove useful for applications in biology, bioelectronics, and mesoscale self-assembly.

  17. Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression.

    PubMed

    Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

    2016-06-01

    Half of the human genome is made up of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using bacterial artificial chromosomes in Xenopus laevis egg extract. Using this approach we characterized the chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication-dependent enrichment of a network of DNA repair factors including the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR-dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to the inability of the single-stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of topoisomerase I-dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications for our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions.

  18. Probing the salt dependence of the torsional stiffness of DNA by multiplexed magnetic torque tweezers

    PubMed Central

    Kriegel, Franziska; Ermann, Niklas; Forbes, Ruaridh; Dulin, David; Dekker, Nynke H.

    2017-01-01

    Abstract The mechanical properties of DNA fundamentally constrain and enable the storage and transmission of genetic information and its use in DNA nanotechnology. Many properties of DNA depend on the ionic environment due to its highly charged backbone. In particular, both theoretical analyses and direct single-molecule experiments have shown its bending stiffness to depend on salt concentration. In contrast, the salt-dependence of the twist stiffness of DNA is much less explored. Here, we employ optimized multiplexed magnetic torque tweezers to study the torsional stiffness of DNA under varying salt conditions as a function of stretching force. At low forces (<3 pN), the effective torsional stiffness is ∼10% smaller for high salt conditions (500 mM NaCl or 10 mM MgCl2) compared to lower salt concentrations (20 mM NaCl and 100 mM NaCl). These differences, however, can be accounted for by taking into account the known salt dependence of the bending stiffness. In addition, the measured high-force (6.5 pN) torsional stiffness values of C = 103 ± 4 nm are identical, within experimental errors, for all tested salt concentration, suggesting that the intrinsic torsional stiffness of DNA does not depend on salt. PMID:28460037

  19. Hormonal induction of transfected genes depends on DNA topology.

    PubMed Central

    Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M

    1990-01-01

    Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920

  20. Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

    PubMed

    Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

    2016-05-19

    Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

  1. Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

    PubMed

    Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

    2012-09-05

    The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

  2. Effects of Ionic Dependence of DNA Persistence Length on the DNA Condensation at Room Temperature

    NASA Astrophysics Data System (ADS)

    Mao, Wei; Liu, Yan-Hui; Hu, Lin; Xu, Hou-Qiang

    2016-05-01

    DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. A series of experiments pointed out that, in the DNA condensation process by multivalent cations, the condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in ionic concentration. At the same time, single molecule experiments carried out in solution with multivalent cations (such as spermidine, spermine) indicated that DNA persistence length strongly depends on the ionic concentration. In order to revolve the effects of ionic concentration dependence of persistence length on DNA condensation, a model including the ionic concentration dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the ionic concentration dependence of toroidal conformations. With an increase in ion concentration, the first periodic oscillation contained in the autocorrelation function shifts, the number of segment contained in the first periodic oscillation decreases gradually. According to the experiments, the average long-axis length is defined to estimate the ionic concentration dependence of condensation process further. The relation between long-axis length and ionic concentration matches the experimental results qualitatively. Supported by National Natural Science Foundation of China under Grant Nos. 11047022, 11204045, 11464004 and 31360215; The Research Foundation from Ministry of Education of China (212152), Guizhou Provincial Tracking Key Program of Social Development (SY20123089, SZ20113069); The General Financial Grant from the China Postdoctoral Science Foundation (2014M562341); The Research Foundation for Young University Teachers from Guizhou University (201311); The West Light Foundation (2015) and College Innovation Talent Team of Guizhou Province, (2014) 32

  3. The Role of Cytosine Methylation on Charge Transport through a DNA Strand

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qi, Jianqing; Govind, Niranjan; Anantram, M. P.

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modifi-cation remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Buttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. Specifically, we compare the results generated with the widely used B3LYP exchange-correlation (XC) functional and CAM-B3LYP based tuned range-separated hybrid density functional. We first analyze the effectmore » of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that with both functionals, the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and interstrand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital (HOMO) level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with both functionals. We also study the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit. Our results suggest that the effect of the two different functionals is to alter the on-site energies of the DNA bases at the HOMO level, while the transport properties don't depend much on the two functionals.« less

  4. Differential reporting of mixed DNA profiles and its impact on jurists' evaluation of evidence. An international analysis.

    PubMed

    de Keijser, Jan W; Malsch, Marijke; Luining, Egge T; Weulen Kranenbarg, Marleen; Lenssen, Dominique J H M

    2016-07-01

    While DNA analysis is considered by many the gold standard in forensic science, there is ample room for variation in interpretation and reporting. This seems especially the case when working with (complex) mixed DNA profiles. Two consecutive studies on differential DNA reporting were conducted. In Study 1, we first examined type and magnitude of differences when forensic DNA experts across institutes and jurisdictions are handed an identical forensic case with mixed profiles. In Study 2, we explore the impact of the observed differential reporting on jurists' evaluation of the DNA evidence. 19 DNA expert reports from forensic institutes across Western jurisdictions were obtained. Differences between the reports were many and include extensiveness of the reports, explanations of technical issues, use of explanatory appendices, level of reporting, use of context information, and, most markedly, type and substantive content of the conclusions. In Study 2, a group of criminal law students judged a selection of these reports in a quasi experimental study design. Findings show that these differing reports have quite different evidentiary value for jurists, depending on which expert authored the report. It is argued that the impact of differential reporting on jurists' evaluation was so fundamental and substantive that it is seems reasonable to claim that in an actual court case it could make the difference between acquittal and conviction. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  5. ssDNA damage dependence from singlet oxygen concentration at photodynamic interaction

    NASA Astrophysics Data System (ADS)

    Klimenko, V. V.; Kaydanov, N. E.; Emelyanov, A. K.; Bogdanov, A. A.

    2017-11-01

    Single stranded DNA damage at photodynamic treatment with Radachlorin photosensitizer was investigated. Chemical trap method was used to evaluate generation of singlet oxygen in water solution. Interaction of singlet oxygen with ssDNA resulted into decrease of the replication activity of ssDNA. DNA stopped replicating during PCR at irradiation doses greater than 15 J/cm2 and concentration of photosensitizer [PS] = 3.8 μM. The dependence of replication activity of ssDNA on generated singlet oxygen concentration was identified.

  6. CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation.

    PubMed

    Smith, Rebecca; Sellou, Hafida; Chapuis, Catherine; Huet, Sébastien; Timinszky, Gyula

    2018-05-04

    One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

  7. Ni-DNA-based nanowires and nanodevices

    NASA Astrophysics Data System (ADS)

    Chang, Chia-Ching; Yuan, Chiun-Jye; Jian, Wen-Bin; Chen, Yu-Chang; di Ventra, Massimiliano

    DNA is a highly versatile biopolymer that has been a recent focus in the field of nanomachines and nanoelectronics. DNA exhibits high stability, adjustable conductance, self-organizing capability, programmability and vast information storage. It is an ideal material in the applications of nanodevices, nanoelectronics, and molecular computing. Low conductance of native DNA renders applications difficult. However, doping with nickel ions tunes the DNA into a conducting polymer. Further studies showed that nickel ions containing DNA (Ni-DNA) nanowires exhibit characteristics of memristor and memcapacitor making them a potential mass information storage system. In summary, Ni-DNA has promising applications in a variety of fields, including nanoelectronics, biosensors and memcomputing. This study was supported in part by the Ministry of Science and Technology (MOST), Taiwan (ROC) MOST 103-2112-M-009-011 -MY3, and MOST 105-2627-M-009-006.

  8. Environment and Structure Influence in DNA Conduction

    NASA Technical Reports Server (NTRS)

    Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan (Technical Monitor)

    2002-01-01

    Results for transmission through the poly(G) DNA molecule are presented. We show that (i) periodically arranged sodium counter-ions in close proximity to dry DNA gives rise to a new conduction channel and aperiodicity in the counter-ion sequence can lead to a significant reduction in conduction, (ii) modification of the rise of B-DNA induces a change in the width of the transmission window, and (iii) specifically designed sequences are predicted to show intrinsic resonant tunneling behavior.

  9. Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors

    NASA Astrophysics Data System (ADS)

    Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.

    2011-09-01

    DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

  10. Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins

    NASA Astrophysics Data System (ADS)

    Dahlke, K.; Sing, C. E.

    2018-02-01

    Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.

  11. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    PubMed Central

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  12. Probing the salt dependence of the torsional stiffness of DNA by multiplexed magnetic torque tweezers.

    PubMed

    Kriegel, Franziska; Ermann, Niklas; Forbes, Ruaridh; Dulin, David; Dekker, Nynke H; Lipfert, Jan

    2017-06-02

    The mechanical properties of DNA fundamentally constrain and enable the storage and transmission of genetic information and its use in DNA nanotechnology. Many properties of DNA depend on the ionic environment due to its highly charged backbone. In particular, both theoretical analyses and direct single-molecule experiments have shown its bending stiffness to depend on salt concentration. In contrast, the salt-dependence of the twist stiffness of DNA is much less explored. Here, we employ optimized multiplexed magnetic torque tweezers to study the torsional stiffness of DNA under varying salt conditions as a function of stretching force. At low forces (<3 pN), the effective torsional stiffness is ∼10% smaller for high salt conditions (500 mM NaCl or 10 mM MgCl2) compared to lower salt concentrations (20 mM NaCl and 100 mM NaCl). These differences, however, can be accounted for by taking into account the known salt dependence of the bending stiffness. In addition, the measured high-force (6.5 pN) torsional stiffness values of C = 103 ± 4 nm are identical, within experimental errors, for all tested salt concentration, suggesting that the intrinsic torsional stiffness of DNA does not depend on salt. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

    PubMed

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

    2014-06-25

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

  14. Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. IV. Influence of DNA replication and excision repair on REV2 dependent UV-mutagenesis and repair.

    PubMed

    Siede, W; Eckardt, F

    1986-01-01

    A double mutant being thermoconditionally defective in mutation induction as well as in repair of pre-lethal UV-induced DNA damage (rev2ts) and deficient in excision repair (rad3-2) was studied in temperature-shift experiments. The influence of inhibitors of DNA replication (hydroxyurea, aphidicolin) was determined. Additionally, an analysis of the dose-response pattern of mutation induction ("mutation kinetics") at several ochre alleles was carried out. It was concluded that the UV-inducible REV2 dependent mutagenic repair process is not induced in excision-deficient cells. In excision-deficient cells, REV2 dependent mutation fixation is slow and mostly post-replicative though not dependent on DNA replication. The REV2 mediated mutagenic process could be separated from the repair function.

  15. Self-catalytic growth of unmodified gold nanoparticles as conductive bridges mediated gap-electrical signal transduction for DNA hybridization detection.

    PubMed

    Zhang, Jing; Nie, Huagui; Wu, Zhan; Yang, Zhi; Zhang, Lijie; Xu, Xiangju; Huang, Shaoming

    2014-01-21

    A simple and sensitive gap-electrical biosensor based on self-catalytic growth of unmodified gold nanoparticles (AuNPs) as conductive bridges has been developed for amplifying DNA hybridization events. In this strategy, the signal amplification degree of such conductive bridges is closely related to the variation of the glucose oxidase (GOx)-like catalytic activity of AuNPs upon interaction with single- and double-stranded DNA (ssDNA and dsDNA), respectively. In the presence of target DNA, the obtained dsDNA product cannot adsorb onto the surface of AuNPs due to electrostatic interaction, which makes the unmodified AuNPs exhibit excellent GOx-like catalytic activity. Such catalytic activity can enlarge the diameters of AuNPs in the glucose and HAuCl4 solution and result in a connection between most of the AuNPs and a conductive gold film formation with a dramatically increased conductance. For the control sample, the catalytic activity sites of AuNPs are fully blocked by ssDNA due to the noncovalent interaction between nucleotide bases and AuNPs. Thus, the growth of the assembled AuNPs will not happen and the conductance between microelectrodes will be not changed. Under the optimal experimental conditions, the developed strategy exhibited a sensitive response to target DNA with a high signal-to-noise ratio. Moreover, this strategy was also demonstrated to provide excellent differentiation ability for single-nucleotide polymorphism. Such performances indicated the great potential of this label-free electrical strategy for clinical diagnostics and genetic analysis under real biological sample separation.

  16. cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

    PubMed

    De Bruin, Lennart; Maddocks, John H

    2018-06-14

    The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

  17. Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

    PubMed Central

    Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

    2008-01-01

    Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

  18. A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

    PubMed Central

    Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

    2015-01-01

    Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

  19. Ab initio electron propagator calculations of transverse conduction through DNA nucleotide bases in 1-nm nanopore corroborate third generation sequencing.

    PubMed

    Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V

    2016-01-01

    The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)

  20. Inhibition of DNA-Dependent Protein Kinase Activity for Breast Cancer Therapy

    DTIC Science & Technology

    2002-06-01

    Dependent Protein Kinase Activity for Breast Cancer Therapy PRINCIPAL INVESTIGATOR: Chin-Rang Yang, Ph.D. CONTRACTING ORGANIZATION: University of Rochester...Activity for Breast Cancer Therapy 6. AUTHOR(S) Chin-Rang Yang, Ph.D. 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT...The formation of DNA double strand breaks (DSBs) correlates well with lethality of cancer cells following ionizing radiation (IR). The DNA-dependent

  1. Heterochromatic siRNAs and DDM1 Independently Silence Aberrant 5S rDNA Transcripts in Arabidopsis

    PubMed Central

    Blevins, Todd; Pontes, Olga; Pikaard, Craig S.; Meins, Frederick

    2009-01-01

    5S ribosomal RNA gene repeats are arranged in heterochromatic arrays (5S rDNA) situated near the centromeres of Arabidopsis chromosomes. The chromatin remodeling factor DDM1 is known to maintain 5S rDNA methylation patterns while silencing transcription through 5S rDNA intergenic spacers (IGS). We mapped small-interfering RNAs (siRNA) to a composite 5S rDNA repeat, revealing a high density of siRNAs matching silenced IGS transcripts. IGS transcript repression requires proteins of the heterochromatic siRNA pathway, including RNA polymerase IV (Pol IV), RNA-DEPENDENT RNA POLYMERASE 2 (RDR2) and DICER-LIKE 3 (DCL3). Using molecular and cytogenetic approaches, we show that the DDM1 and siRNA-dependent silencing effects are genetically independent. DDM1 suppresses production of the siRNAs, however, thereby limiting RNA-directed DNA methylation at 5S rDNA repeats. We conclude that DDM1 and siRNA-dependent silencing are overlapping processes that both repress aberrant 5S rDNA transcription and contribute to the heterochromatic state of 5S rDNA arrays. PMID:19529764

  2. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis

    PubMed Central

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A.; De Wever, Veerle; Morrice, Nick A.; Meek, Katheryn; Lees-Miller, Susan P.

    2014-01-01

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs’ role in mitosis may be mechanistically distinct from its well-established role in NHEJ. PMID:24844881

  3. DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

    PubMed

    Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

    2016-04-01

    RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

  4. Molecular scatology as a tool to study diet: analysis of prey DNA in scats from captive Steller sea lions.

    PubMed

    Deagle, B E; Tollit, D J; Jarman, S N; Hindell, M A; Trites, A W; Gales, N J

    2005-05-01

    The DNA of prey present in animal scats may provide a valuable source of information for dietary studies. We conducted a captive feeding trial to test whether prey DNA could be reliably detected in scat samples from Steller sea lions (Eumetopias jubatus). Two sea lions were fed a diet of fish (five species) and squid (one species), and DNA was extracted from the soft component of collected scats. Most of the DNA obtained came from the predator, but prey DNA could be amplified using prey-specific primers. The four prey species fed in consistent daily proportions throughout the trial were detected in more than 90% of the scat DNA extractions. Squid and sockeye salmon, which were fed as a relatively small percentage of the daily diet, were detected as reliably as the more abundant diet items. Prey detection was erratic in scats collected when the daily diet was fed in two meals that differed in prey composition, suggesting that prey DNA is passed in meal specific pulses. Prey items that were removed from the diet following one day of feeding were only detected in scats collected within 48 h of ingestion. Proportions of fish DNA present in eight scat samples (evaluated through the screening of clone libraries) were roughly proportional to the mass of prey items consumed, raising the possibility that DNA quantification methods could provide semi-quantitative diet composition data. This study should be of broad interest to researchers studying diet since it highlights an approach that can accurately identify prey species and is not dependent on prey hard parts surviving digestion.

  5. Metabolic, hormonal and immunological associations with global DNA methylation among postmenopausal women.

    PubMed

    Ulrich, Cornelia M; Toriola, Adetunji T; Koepl, Lisel M; Sandifer, Tracy; Poole, Elizabeth M; Duggan, Catherine; McTiernan, Anne; Issa, Jean-Pierre J

    2012-09-01

    DNA methylation is an epigenetic modification essential for the regulation of gene expression that has been implicated in many diseases, including cancer. Few studies have investigated the wide range of potential predictors of global DNA methylation, including biomarkers. Here, we investigated associations between DNA methylation and dietary factors, sex-steroid hormones, metabolic, lipid, inflammation, immune and one-carbon biomarkers. Data and baseline biomarker measurements were obtained from 173 overweight/obese postmenopausal women. Global DNA methylation in lymphocyte DNA was measured using the pyrosequencing assay for LINE-1 repeats. We used correlations and linear regression analyses to investigate associations between continuous data and DNA methylation, while t-tests were used for categorical data. Secondary analyses stratified by serum folate levels and multivitamin use were also conducted. There was little variability in LINE-1 methylation (66.3-79.5%). Mean LINE-1 methylation was significantly higher among women with elevated glucose levels. Mean LINE-1 methylation was also higher among women with high CD4+/CD8+ ratio, and lower among women with elevated vitamin B6, but neither reached statistical significance. In analyses stratified by folate status, DNA methylation was negatively associated with sex hormone concentrations (estrone, estradiol, testosterone and sex hormone binding globulin) among women with low serum folate levels (n = 53). Conversely, among women with high serum folate levels (n = 53), DNA methylation was positively associated with several immune markers (CD4/CD8 ratio, NK1656/lymphocytes and IgA). Results from this screening suggest that global DNA methylation is generally stable, with differential associations for sex hormones and immune markers depending on one-carbon status.

  6. Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

    PubMed Central

    Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

    2013-01-01

    Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

  7. Functions of Fun30 Chromatin Remodeler in Regulating Cellular Resistance to Genotoxic Stress

    PubMed Central

    Bi, Xin; Yu, Qun; Siler, Jasmine; Li, Chong; Khan, Ali

    2015-01-01

    The Saccharomyces cerevisiae Fun30 chromatin remodeler has recently been shown to facilitate long-range resection of DNA double strand break (DSB) ends, which proceeds homologous recombination (HR). This is believed to underlie the role of Fun30 in promoting cellular resistance to DSB inducing agent camptothecin. We show here that Fun30 also contributes to cellular resistance to genotoxins methyl methanesulfonate (MMS) and hydroxyurea (HU) that can stall the progression of DNA replication. We present evidence implicating DNA end resection in Fun30-dependent MMS-resistance. On the other hand, we show that Fun30 deletion suppresses the MMS- and HU-sensitivity of cells lacking the Rad5/Mms2/Ubc13-dependent error-free DNA damage tolerance mechanism. This suppression is not the result of a reduction in DNA end resection, and is dependent on the key HR component Rad51. We further show that Fun30 negatively regulates the recovery of rad5Δ mutant from MMS induced G2/M arrest. Therefore, Fun30 has two functions in DNA damage repair: one is the promotion of cellular resistance to genotoxic stress by aiding in DNA end resection, and the other is the negative regulation of a Rad51-dependent, DNA end resection-independent mechanism for countering replicative stress. The latter becomes manifest when Rad5 dependent DNA damage tolerance is impaired. In addition, we find that the putative ubiquitin-binding CUE domain of Fun30 serves to restrict the ability of Fun30 to hinder MMS- and HU-tolerance in the absence of Rad5. PMID:25806814

  8. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity

    PubMed Central

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick

    2017-01-01

    Abstract Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. PMID:27899652

  9. Footprint traversal by adenosine-triphosphate-dependent chromatin remodeler motor.

    PubMed

    Garai, Ashok; Mani, Jesrael; Chowdhury, Debashish

    2012-04-01

    Adenosine-triphosphate (ATP)-dependent chromatin remodeling enzymes (CREs) are biomolecular motors in eukaryotic cells. These are driven by a chemical fuel, namely, ATP. CREs actively participate in many cellular processes that require accessibility of specific segments of DNA which are packaged as chromatin. The basic unit of chromatin is a nucleosome where 146 bp ∼ 50 nm of a double-stranded DNA (dsDNA) is wrapped around a spool formed by histone proteins. The helical path of histone-DNA contact on a nucleosome is also called "footprint." We investigate the mechanism of footprint traversal by a CRE that translocates along the dsDNA. Our two-state model of a CRE captures effectively two distinct chemical (or conformational) states in the mechanochemical cycle of each ATP-dependent CRE. We calculate the mean time of traversal. Our predictions on the ATP dependence of the mean traversal time can be tested by carrying out in vitro experiments on mononucleosomes.

  10. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  11. A discriminatory function for prediction of protein-DNA interactions based on alpha shape modeling.

    PubMed

    Zhou, Weiqiang; Yan, Hong

    2010-10-15

    Protein-DNA interaction has significant importance in many biological processes. However, the underlying principle of the molecular recognition process is still largely unknown. As more high-resolution 3D structures of protein-DNA complex are becoming available, the surface characteristics of the complex become an important research topic. In our work, we apply an alpha shape model to represent the surface structure of the protein-DNA complex and developed an interface-atom curvature-dependent conditional probability discriminatory function for the prediction of protein-DNA interaction. The interface-atom curvature-dependent formalism captures atomic interaction details better than the atomic distance-based method. The proposed method provides good performance in discriminating the native structures from the docking decoy sets, and outperforms the distance-dependent formalism in terms of the z-score. Computer experiment results show that the curvature-dependent formalism with the optimal parameters can achieve a native z-score of -8.17 in discriminating the native structure from the highest surface-complementarity scored decoy set and a native z-score of -7.38 in discriminating the native structure from the lowest RMSD decoy set. The interface-atom curvature-dependent formalism can also be used to predict apo version of DNA-binding proteins. These results suggest that the interface-atom curvature-dependent formalism has a good prediction capability for protein-DNA interactions. The code and data sets are available for download on http://www.hy8.com/bioinformatics.htm kenandzhou@hotmail.com.

  12. Improved electro-transformation of highly DNA-restrictive corynebacteria with DNA extracted from starved Escherichia coli.

    PubMed

    Ankri, S; Reyes, O; Leblon, G

    1996-07-01

    Differences of up to 33 000-fold in electro-transformability of highly DNA restrictive corynebacteria are observed in the DNA of a shuttle plasmid extracted from Escherichia coli hosts propagated in different nutritional conditions. Growth of the host in minimal medium increases plasmid transformability, whereas growth on rich media decreases it. In the E. coli DH5 alpha host, the starvation-dependent increase DNA transformability is reverted by supplementing with methionine, an obligate 5-adenosyl-methionine (SAM) precursor. This suggests that an E. coli nutritionally modulated SAM-dependent DNA-methyltransferase may be involved in this phenomenon.

  13. Electron Nuclear Dynamics Simulations of Proton Cancer Therapy Reactions: Water Radiolysis and Proton- and Electron-Induced DNA Damage in Computational Prototypes.

    PubMed

    Teixeira, Erico S; Uppulury, Karthik; Privett, Austin J; Stopera, Christopher; McLaurin, Patrick M; Morales, Jorge A

    2018-05-06

    Proton cancer therapy (PCT) utilizes high-energy proton projectiles to obliterate cancerous tumors with low damage to healthy tissues and without the side effects of X-ray therapy. The healing action of the protons results from their damage on cancerous cell DNA. Despite established clinical use, the chemical mechanisms of PCT reactions at the molecular level remain elusive. This situation prevents a rational design of PCT that can maximize its therapeutic power and minimize its side effects. The incomplete characterization of PCT reactions is partially due to the health risks associated with experimental/clinical techniques applied to human subjects. To overcome this situation, we are conducting time-dependent and non-adiabatic computer simulations of PCT reactions with the electron nuclear dynamics (END) method. Herein, we present a review of our previous and new END research on three fundamental types of PCT reactions: water radiolysis reactions, proton-induced DNA damage and electron-induced DNA damage. These studies are performed on the computational prototypes: proton + H₂O clusters, proton + DNA/RNA bases and + cytosine nucleotide, and electron + cytosine nucleotide + H₂O. These simulations provide chemical mechanisms and dynamical properties of the selected PCT reactions in comparison with available experimental and alternative computational results.

  14. Surface plasmon resonance imaging reveals multiple binding modes of Agrobacterium transformation mediator VirE2 to ssDNA.

    PubMed

    Kim, Sanghyun; Zbaida, David; Elbaum, Michael; Leh, Hervé; Nogues, Claude; Buckle, Malcolm

    2015-07-27

    VirE2 is the major secreted protein of Agrobacterium tumefaciens in its genetic transformation of plant hosts. It is co-expressed with a small acidic chaperone VirE1, which prevents VirE2 oligomerization. After secretion into the host cell, VirE2 serves functions similar to a viral capsid in protecting the single-stranded transferred DNA en route to the nucleus. Binding of VirE2 to ssDNA is strongly cooperative and depends moreover on protein-protein interactions. In order to isolate the protein-DNA interactions, imaging surface plasmon resonance (SPRi) studies were conducted using surface-immobilized DNA substrates of length comparable to the protein-binding footprint. Binding curves revealed an important influence of substrate rigidity with a notable preference for poly-T sequences and absence of binding to both poly-A and double-stranded DNA fragments. Dissociation at high salt concentration confirmed the electrostatic nature of the interaction. VirE1-VirE2 heterodimers also bound to ssDNA, though by a different mechanism that was insensitive to high salt. Neither VirE2 nor VirE1-VirE2 followed the Langmuir isotherm expected for reversible monomeric binding. The differences reflect the cooperative self-interactions of VirE2 that are suppressed by VirE1. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Exploring mechanisms of transport and persistence of environmental DNA (eDNA)

    NASA Astrophysics Data System (ADS)

    Shogren, A.; Tank, J. L.; Riis, T.; Rosi, E. J.; Bolster, D.

    2017-12-01

    Sampling for eDNA is a non-intrusive method to detect species presence without direct observation, which allows for earlier detection and more rapid response than conventional sampling methods. However, our current understanding of how eDNA is transported and persists in flowing waters (e.g., streams and rivers) remains imprecise; in flowing waters, the target organism may be some distance away from where the eDNA in water is collected. It is uncertain how the unique transport properties of suspended eDNA or the inherent heterogeneity of natural flowing systems may impact the probability of downstream eDNA detection. To improve understanding of eDNA fate, we first conducted experimental releases and modeled the impact of benthic substrate heterogeneity and size on eDNA transport and retention in streams. We also used recirculating artificial streams to constrain estimates of eDNA degradation in systems with varying flow and microbial biofilm coverage. We found that eDNA retention in streams is substrate-specific, and that streambed hydraulics have significant influence on how far eDNA is transported downstream. Through the degradation experiments, we found that eDNA degradation is strongly context dependent, but even in systems with low velocity, eDNA can remain detectable in the water column >24hrs after introduction. This differential persistence of eDNA particles confirms that eDNA dynamics in flowing waters are not constant along a spatial continuum, which complicates interpretation of a positive detection in flowing waters, which presents a scaling problem for future modeling efforts to support transport predictions. To test our experimental results in a natural system, we compared our previous estimates for eDNA transport, retention, and degradation to field data collected during a longitudinal field survey for zebra mussel eDNA on the Gudena River in Silkeborg, Denmark. We found that though heterogeneity indeed complicates scaling efforts to extrapolate results from small experimental streams to larger natural systems, we can use the small-scale experiments to improve how we interpret spatial variation in eDNA signal in larger scale flowing systems.

  16. Heat exposure enhances radiosensitivity by depressing DNA-PK kinase activity during double strand break repair.

    PubMed

    Ihara, Makoto; Takeshita, Satoshi; Okaichi, Kumio; Okumura, Yutaka; Ohnishi, Takeo

    2014-03-01

    From the role of double strand DNA dependent protein kinase (DNA-PKcs) activity of non-homologous end joining (NHEJ) repair for DNA double strand breaks (DSBs), we aim to define possible associations between thermo-sensitisation and the enzyme activities in X-ray irradiated cells. DNA-PKcs deficient mouse, Chinese hamster and human cultured cells were compared to the parental wild-type cells. The radiosensitivities, the number of DSBs and DNA-PKcs activities after heat-treatment were measured. Both DNA-PKcs deficient cells and the wild-type cells showed increased radiosensitivities after heat-treatment. The wild-type cells have two repair processes; fast repair and slow repair. In contrast, DNA-PKcs deficient cells have only the slow repair process. The fast repair component apparently disappeared by heat-treatment in the wild-type cells. In both cell types, additional heat exposure enhanced radiosensitivities. Although DNA-PKcs activity was depressed by heat, the inactivated DNA-PKcs activity recovered during an incubation at 37 °C. DSB repair efficiency was dependent on the reactivation of DNA-PKcs activity. It was suggested that NHEJ is the major process used to repair X-ray-induced DSBs and utilises DNA-PKcs activity, but homologous recombination repair provides additional secondary levels of DSB repair. The thermo-sensitisation in X-ray-irradiated cells depends on the inhibition of NHEJ repair through the depression of DNA-PKcs activities.

  17. Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

    PubMed

    Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

    1997-08-01

    Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

  18. Unifying the DNA End-processing Roles of the Artemis Nuclease

    PubMed Central

    Chang, Howard H. Y.; Watanabe, Go; Lieber, Michael R.

    2015-01-01

    Artemis is a member of the metallo-β-lactamase protein family of nucleases. It is essential in vertebrates because, during V(D)J recombination, the RAG complex generates hairpins when it creates the double strand breaks at V, D, and J segments, and Artemis is required to open the hairpins so that they can be joined. Artemis is a diverse endo- and exonuclease, and creating a unified model for its wide range of nuclease properties has been challenging. Here we show that Artemis resects iteratively into blunt DNA ends with an efficiency that reflects the AT-richness of the DNA end. GC-rich ends are not cut by Artemis alone because of a requirement for DNA end breathing (and confirmed using fixed pseudo-Y structures). All DNA ends are cut when both the DNA-dependent protein kinase catalytic subunit and Ku accompany Artemis but not when Ku is omitted. These are the first biochemical data demonstrating a Ku dependence of Artemis action on DNA ends of any configuration. The action of Artemis at blunt DNA ends is slower than at overhangs, consistent with a requirement for a slow DNA end breathing step preceding the cut. The AT sequence dependence, the order of strand cutting, the length of the cuts, and the Ku-dependence of Artemis action at blunt ends can be reconciled with the other nucleolytic properties of both Artemis and Artemis·DNA-PKcs in a model incorporating DNA end breathing of blunt ends to form transient single to double strand boundaries that have structural similarities to hairpins and fixed 5′ and 3′ overhangs. PMID:26276388

  19. DNA-Templated Pd Conductive Metallic Nanowires

    NASA Astrophysics Data System (ADS)

    Nguyen, K.; Monteverde, M.; Lyonnais, S.; Campidelli, S.; Bourgoin, J.-Ph.; Filoramo, A.

    2008-10-01

    Because of its unique recognition properties, its size and the sub-nanometric resolution, DNA is of particular interest for positioning and organizing nanomaterials. However, in DNA-directed nanoelectronic it can be envisioned to use DNA not only as a positioning scaffold, but also as a support for the conducting element. To ensure this function a metallization process is necessary and among the various DNA metallization methods the Pd based ones are of particular interest for carbon nanotube transistor connections. In this field, the major drawback of the existing methods is the fast kinetics of the process which lead to a stochastic growth. Here, we present a novel approach to DNA Pd metalization where the DNA molecule is previously deposited on a dry substrate in a typical nanodevice configuration. In our approach the progressive growth of nanowires is achieved by the slow and selective precipitation of PdO, followed by a subsequent reduction step. Thanks to this strategy we fabricated homogeneous, continuous and conductive Pd nanowires on the DNA scaffolds of very thin diameter (20-25 nm).

  20. Genotoxic effects of boric acid and borax in zebrafish, Danio rerio using alkaline comet assay

    PubMed Central

    Gülsoy, Nagihan; Yavas, Cüneyd; Mutlu, Özal

    2015-01-01

    The present study is conducted to determine the potential mechanisms of Boron compounds, boric acid (BA) and borax (BX), on genotoxicity of zebrafish Danio rerio for 24, 48, 72 and 96-hours acute exposure (level:1, 4, 16, 64 mg/l BA and BX) in semi-static bioassay experiment. For that purpose, peripheral erythrocytes were drawn from caudal vein and Comet assay was applied to assess genotoxicity. Acute (96 hours) exposure and high concentrations of boric acid and borax increases % tail DNA and Olive tail moment. Genotoxicity was found for BA as concentration-dependent and BX as concentration and time dependent manner. In general, significant effects (P < 0,05) on both concentrations and exposure times were observed in experimental groups. DNA damage was highest at 96 h and 24 h for all BX and BA concentrations, respectively in peripheral blood of D. rerio. For the first time, our study demonstrates the effect of waterborne BA and BX exposure on genotoxicity at the molecular level, which may contribute to understanding the mechanism of boric acid and borax-induced genotoxicity in fish. PMID:26862320

  1. Genotoxic effects of boric acid and borax in zebrafish, Danio rerio using alkaline comet assay.

    PubMed

    Gülsoy, Nagihan; Yavas, Cüneyd; Mutlu, Özal

    2015-01-01

    The present study is conducted to determine the potential mechanisms of Boron compounds, boric acid (BA) and borax (BX), on genotoxicity of zebrafish Danio rerio for 24, 48, 72 and 96-hours acute exposure (level:1, 4, 16, 64 mg/l BA and BX) in semi-static bioassay experiment. For that purpose, peripheral erythrocytes were drawn from caudal vein and Comet assay was applied to assess genotoxicity. Acute (96 hours) exposure and high concentrations of boric acid and borax increases % tail DNA and Olive tail moment. Genotoxicity was found for BA as concentration-dependent and BX as concentration and time dependent manner. In general, significant effects (P < 0,05) on both concentrations and exposure times were observed in experimental groups. DNA damage was highest at 96 h and 24 h for all BX and BA concentrations, respectively in peripheral blood of D. rerio. For the first time, our study demonstrates the effect of waterborne BA and BX exposure on genotoxicity at the molecular level, which may contribute to understanding the mechanism of boric acid and borax-induced genotoxicity in fish.

  2. Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

    PubMed

    Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

    2016-11-01

    A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

  3. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation.

    PubMed

    Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos

    2017-01-01

    Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.

  4. DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation

    PubMed Central

    Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.

    2017-01-01

    Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077

  5. Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

    PubMed Central

    Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

    2015-01-01

    Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

  6. The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

    NASA Astrophysics Data System (ADS)

    Sharipov, T. I.; Bakhtizin, R. Z.

    2017-10-01

    An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

  7. DNA bipedal motor walking dynamics: an experimental and theoretical study of the dependency on step size

    PubMed Central

    Khara, Dinesh C; Berger, Yaron; Ouldridge, Thomas E

    2018-01-01

    Abstract We present a detailed coarse-grained computer simulation and single molecule fluorescence study of the walking dynamics and mechanism of a DNA bipedal motor striding on a DNA origami. In particular, we study the dependency of the walking efficiency and stepping kinetics on step size. The simulations accurately capture and explain three different experimental observations. These include a description of the maximum possible step size, a decrease in the walking efficiency over short distances and a dependency of the efficiency on the walking direction with respect to the origami track. The former two observations were not expected and are non-trivial. Based on this study, we suggest three design modifications to improve future DNA walkers. Our study demonstrates the ability of the oxDNA model to resolve the dynamics of complex DNA machines, and its usefulness as an engineering tool for the design of DNA machines that operate in the three spatial dimensions. PMID:29294083

  8. Bioenergetic metabolites regulate base excision repair dependent cell death in response to DNA damage

    PubMed Central

    Tang, Jiang-bo; Goellner, Eva M.; Wang, Xiao-hong; Trivedi, Ram N.; Croix, Claudette M. St; Jelezcova, Elena; Svilar, David; Brown, Ashley R.; Sobol, Robert W.

    2009-01-01

    Base excision repair (BER) protein expression is important for resistance to DNA damage-induced cytotoxicity. Conversely, BER imbalance (Polß deficiency or repair inhibition) enhances cytotoxicity of radiation and chemotherapeutic DNA-damaging agents. Whereas inhibition of critical steps in the BER pathway result in the accumulation of cytotoxic DNA double-strand breaks, we report that DNA damage-induced cytotoxicity due to deficiency in the BER protein Polß triggers cell death dependent on PARP activation yet independent of poly(ADP-ribose) (PAR)-mediated AIF nuclear translocation or PARG, suggesting that cytotoxicity is not from PAR or PAR-catabolite signaling. Cell death is rescued by the NAD+ metabolite NMN and is synergistic with inhibition of NAD+ biosynthesis, demonstrating that DNA damage-induced cytotoxicity mediated via BER inhibition is primarily dependent on cellular metabolite bioavailability. We offer a mechanistic justification for the elevated alkylation-induced cytotoxicity of Polß deficient cells, suggesting a linkage between DNA repair, cell survival and cellular bioenergetics. PMID:20068071

  9. Evaluation of HPV DNA positivity in colorectal cancer patients in Kerman, Southeast Iran

    PubMed

    Malekpour Afshar, Reza; Deldar, Zeinab; Mollaei, Hamid Reza; Arabzadeh, Seyed Alimohammad; Iranpour, Maryam

    2018-01-27

    Background: The HPV virus is known to be oncogenic and associations with many cancers has been proven. Although many studies have been conducted on the possible relationship with colorectal cancer (CRC), a definitive role of the virus has yet to be identified. Method: In this cross-sectional study, the frequency of HPV positivity in CRC samples in Kerman was assessed in 84 cases with a mean age of 47.7 ± 12.5 years over two years. Qualitative real time PCR was performed using general primers for the L1 region of HPV DNA. Results: Out of 84 CRC samples, 19 (22.6%), proved positive for HPV DNA. Genotyping of positive samples showed all of these to be of high risk HPV type. Prevalence of HPV infection appears to depend geographic region, life style, diet and other factors. Conclusion: In our location frequency of CRC is low, and this limited the sample size for evaluation of HPV DNA. The most prevalent types were HPV types 51 and 56. While HPV infection may play an important role in colorectal carcinogenesis, this needs to be assessed in future studies. Creative Commons Attribution License

  10. A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

    PubMed

    Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

    2015-06-09

    Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Interdependence of the kinetics of NTP hydrolysis and the stability of the RecA-ssDNA complex.

    PubMed

    Katz, F S; Bryant, F R

    2001-09-18

    The ssDNA-dependent NTP hydrolysis activity of the RecA protein was examined using a series of dTn oligomers ranging in size from dT10 to dT2000 as the ssDNA effector. There were three distinct manifestations of the dTn-dependent NTP hydrolysis reaction, depending on the length of the dTn effector that was used. With longer dTn oligomers, NTP hydrolysis occurred with a turnover number of 20-25 min(-1) and the observed S0.5 value for the NTP was independent of the concentration of the dTn oligomer (DNA concentration-independent hydrolysis). With dTn oligomers of intermediate length, NTP hydrolysis still occurred with a turnover number of 20-25 min(-1), but the observed S0.5 for the NTP decreased with increasing dTn concentration until reaching a value similar to that obtained with the longer dTn oligomers (DNA concentration-dependent hydrolysis). With shorter dTn oligomers, the NTP hydrolysis activity was effectively eliminated. Although this general progression of kinetic behavior was observed for the three structurally related NTPs (dATP, ATP, and GTP), the dTn oligomer length at which DNA concentration-independent, DNA concentration-dependent, and no NTP hydrolysis was observed depended on the NTP being considered. For example, dATP (S0.5 = 35 microM) was hydrolyzed in the presence of dT20, whereas ATP (S0.5 = 70 microM) and GTP (S0.5 = 1200 microM) required at least dT50 and dT200 for hydrolysis, respectively. These results are discussed in terms of a kinetic model in which the stability of the RecA-ssDNA-NTP complex is dependent on the intrinsic S0.5 value of the NTP being hydrolyzed.

  12. Flow cytometric sex sorting affects CD4 membrane distribution and binding of exogenous DNA on bovine sperm cells.

    PubMed

    Domingues, William Borges; da Silveira, Tony Leandro Rezende; Komninou, Eliza Rossi; Monte, Leonardo Garcia; Remião, Mariana Härter; Dellagostin, Odir Antônio; Corcini, Carine Dahl; Varela Junior, Antônio Sergio; Seixas, Fabiana Kömmling; Collares, Tiago; Campos, Vinicius Farias

    2017-08-01

    Bovine sex-sorted sperm have been commercialized and successfully used for the production of transgenic embryos of the desired sex through the sperm-mediated gene transfer (SMGT) technique. However, sex-sorted sperm show a reduced ability to internalize exogenous DNA. The interaction between sperm cells and the exogenous DNA has been reported in other species to be a CD4-like molecule-dependent process. The flow cytometry-based sex-sorting process subjects the spermatozoa to different stresses causing changes in the cell membrane. The aim of this study was to elucidate the relationship between the redistribution of CD4-like molecules and binding of exogenous DNA to sex-sorted bovine sperm. In the first set of experiments, the membrane phospholipid disorder and the redistribution of the CD4 were evaluated. The second set of experiments was conducted to investigate the effect of CD4 redistribution on the mechanism of binding of exogenous DNA to sperm cells and the efficiency of lipofection in sex-sorted bovine sperm. Sex-sorting procedure increased the membrane phospholipid disorder and induced the redistribution of CD4-like molecules. Both X-sorted and Y-sorted sperm had decreased DNA bound to membrane in comparison with the unsorted sperm; however, the binding of the exogenous DNA was significantly increased with the addition of liposomes. Moreover, we demonstrated that the number of sperm-bound exogenous DNA was decreased when these cells were preincubated with anti-bovine CD4 monoclonal antibody, supporting our hypothesis that CD4-like molecules indeed play a crucial role in the process of exogenous DNA/bovine sperm cells interaction.

  13. Persistence of DNA on clothes after exposure to water for different time periods-a study on bathtub, pond, and river.

    PubMed

    Helmus, Janine; Zorell, Sarah; Bajanowski, Thomas; Poetsch, Micaela

    2018-01-01

    DNA traces on clothes of drowned bodies can provide important evidence for police investigations, especially in cases of suspected suicides or homicides. However, it is generally assumed that the water "erodes" a large part of the DNA depending especially on the exposure time. In forensic casework, DNA of suspects could be found frequently on clothes of drowned bodies after hours, sometimes days of exposure to water. This study was conducted to attempt a general statement about the conditions under which sufficient DNA remains can be expected for molecular genetic analysis. For this purpose, different scenarios were designed including DNA from three to five people, different types of waters (tap, pond, bathtub and river) for various time periods, with higher water pressure, different temperature, and soapy water (bathtub). Epithelial cells and blood cells were mounted on cotton cloths, and the DNA left after exposure was analyzed using the Powerplex® ESX17fast kit. In the indoor experiments, complete profiles could be seen even after 10 min rinsing of clothes under the tap and after 1 week in the bathtub. Outdoors, the results differed considerably between summer and winter as well as between pond and river. The longest exposure time still resulting in a complete profile was 2 weeks for a sample with skin cells in the pond during winter. In summer, the time period for erasing the bulk of DNA was 4 hours regarding epithelial samples and more than 1 day for blood samples in pond and river environments. All in all, the results demonstrate that DNA could still be recovered from clothes exposed to water for more than 1 week.

  14. Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

    PubMed

    Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

    2004-03-22

    DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

  15. Structure and Environment Influence in DNA Conduction

    NASA Technical Reports Server (NTRS)

    Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

    2002-01-01

    Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

  16. simulation of the DNA force-extension curve

    NASA Astrophysics Data System (ADS)

    Shinaberry, Gregory; Mikhaylov, Ivan; Balaeff, Alexander

    A molecular dynamics simulation study of the force-extension curve of double-stranded DNA is presented. Extended simulations of the DNA at multiple points along the force-extension curve are conducted with DNA end-to-end length constrained at each point. The calculated force-extension curve qualitatively reproduces the experimental one. The DNA conformational ensemble at each extension shows that the famous plateau of the force-extension curve results from B-DNA melting, whereas the formation of the earlier-predicted novel DNA conformation called 'zip-DNA' takes place at extensions past the plateau. An extensive analysis of the DNA conformational ensemble in terms of base configuration, backbone configuration, solvent interaction energy, etc., is conducted in order to elucidate the physical origin of DNA elasticity and the main interactions responsible for the shape of the force-extension curve.

  17. Kinetics and thermodynamics of DNA polymerases with exonuclease proofreading

    NASA Astrophysics Data System (ADS)

    Gaspard, Pierre

    2016-04-01

    Kinetic theory and thermodynamics are applied to DNA polymerases with exonuclease activity, taking into account the dependence of the rates on the previously incorporated nucleotide. The replication fidelity is shown to increase significantly thanks to this dependence at the basis of the mechanism of exonuclease proofreading. In particular, this dependence can provide up to a 100-fold lowering of the error probability under physiological conditions. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  18. The organophosphate insecticide chlorpyrifos confers its genotoxic effects by inducing DNA damage and cell apoptosis.

    PubMed

    Li, Diqiu; Huang, Qingchun; Lu, Miaoqing; Zhang, Lei; Yang, Zhichuan; Zong, Mimi; Tao, Liming

    2015-09-01

    The organophosphate insecticide chlorpyrifos (CPF) is known to induce neurological effects, malformation and micronucleus formation, persistent developmental disorders, and maternal toxicity in rats and mice. The binding of chlorpyrifos with DNA to produce DNA adducts leads to an increasing social concern about the genotoxic risk of CPF in human, but CPF-induced cytotoxicity through DNA damage and cell apoptosis is not well understood. Here, we quantified the cytotoxicity and potential genotoxicity of CPF using the alkaline comet assay, γH2AX foci formation, and the DNA laddering assay in order to detect DNA damage and apoptosis in human HeLa and HEK293 cells in vitro. Drosophila S2 cells were used as a positive control. The alkaline comet assay showed that sublethal concentrations of CPF induced significant concentration-dependent increases in single-strand DNA breaks in the treated cells compared with the control. The percentage of γH2AX-positive HeLa cells revealed that CPF also causes DNA double-strand breaks in a time-dependent manner. Moreover, DNA fragmentation analysis demonstrated that exposure to CPF induced a significant concentration- and time-dependent increase in cell apoptosis. We conclude that CPF is a strongly genotoxic agent that induces DNA damage and cell apoptosis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. DNA-PKcs phosphorylates hnRNP-A1 to facilitate the RPA-to-POT1 switch and telomere capping after replication.

    PubMed

    Sui, Jiangdong; Lin, Yu-Fen; Xu, Kangling; Lee, Kyung-Jong; Wang, Dong; Chen, Benjamin P C

    2015-07-13

    The heterogeneous nuclear ribonucleoprotein A1 (hnRNP-A1) has been implicated in telomere protection and telomerase activation. Recent evidence has further demonstrated that hnRNP-A1 plays a crucial role in maintaining newly replicated telomeric 3' overhangs and facilitating the switch from replication protein A (RPA) to protection of telomeres 1 (POT1). The role of hnRNP-A1 in telomere protection also involves DNA-dependent protein kinase catalytic subunit (DNA-PKcs), although the detailed regulation mechanism has not been clear. Here we report that hnRNP-A1 is phosphorylated by DNA-PKcs during the G2 and M phases and that DNA-PK-dependent hnRNP-A1 phosphorylation promotes the RPA-to-POT1 switch on telomeric single-stranded 3' overhangs. Consequently, in cells lacking hnRNP-A1 or DNA-PKcs-dependent hnRNP-A1 phosphorylation, impairment of the RPA-to-POT1 switch results in DNA damage response at telomeres during mitosis as well as induction of fragile telomeres. Taken together, our results indicate that DNA-PKcs-dependent hnRNP-A1 phosphorylation is critical for capping of the newly replicated telomeres and prevention of telomeric aberrations. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Current-voltage characteristics of double stranded versus single stranded DNA molecules

    NASA Astrophysics Data System (ADS)

    Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

    2004-03-01

    Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

  1. Controlling charge transport mechanisms in molecular junctions: Distilling thermally induced hopping from coherent-resonant conduction.

    PubMed

    Kim, Hyehwang; Segal, Dvira

    2017-04-28

    The electrical conductance of molecular junctions may depend strongly on the temperature and weakly on molecular length, under two distinct mechanisms: phase-coherent resonant conduction, with charges proceeding via delocalized molecular orbitals, and incoherent thermally assisted multi-step hopping. While in the case of coherent conduction, the temperature dependence arises from the broadening of the Fermi distribution in the metal electrodes, in the latter case it corresponds to electron-vibration interaction effects on the junction. With the objective to distill the thermally activated hopping component, thus exposing intrinsic electron-vibration interaction phenomena on the junction, we suggest the design of molecular junctions with "spacers," extended anchoring groups that act to filter out phase-coherent resonant electrons. Specifically, we study the electrical conductance of fixed-gap and variable-gap junctions that include a tunneling block, with spacers at the boundaries. Using numerical simulations and analytical considerations, we demonstrate that in our design, resonant conduction is suppressed. As a result, the electrical conductance is dominated by two (rather than three) mechanisms: superexchange (deep tunneling) and multi-step thermally induced hopping. We further exemplify our analysis on DNA junctions with an A:T block serving as a tunneling barrier. Here, we show that the electrical conductance is insensitive to the number of G:C base-pairs at the boundaries. This indicates that the tunneling-to-hopping crossover revealed in such sequences truly corresponds to the properties of the A:T barrier.

  2. Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments.

    PubMed

    Kolinjivadi, Arun Mouli; Sannino, Vincenzo; De Antoni, Anna; Zadorozhny, Karina; Kilkenny, Mairi; Técher, Hervé; Baldi, Giorgio; Shen, Rong; Ciccia, Alberto; Pellegrini, Luca; Krejci, Lumir; Costanzo, Vincenzo

    2017-09-07

    Brca2 deficiency causes Mre11-dependent degradation of nascent DNA at stalled forks, leading to cell lethality. To understand the molecular mechanisms underlying this process, we isolated Xenopus laevis Brca2. We demonstrated that Brca2 protein prevents single-stranded DNA gap accumulation at replication fork junctions and behind them by promoting Rad51 binding to replicating DNA. Without Brca2, forks with persistent gaps are converted by Smarcal1 into reversed forks, triggering extensive Mre11-dependent nascent DNA degradation. Stable Rad51 nucleofilaments, but not RPA or Rad51 T131P mutant proteins, directly prevent Mre11-dependent DNA degradation. Mre11 inhibition instead promotes reversed fork accumulation in the absence of Brca2. Rad51 directly interacts with the Pol α N-terminal domain, promoting Pol α and δ binding to stalled replication forks. This interaction likely promotes replication fork restart and gap avoidance. These results indicate that Brca2 and Rad51 prevent formation of abnormal DNA replication intermediates, whose processing by Smarcal1 and Mre11 predisposes to genome instability. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  3. Nucleotide excision repair-dependent DNA double-strand break formation and ATM signaling activation in mammalian quiescent cells.

    PubMed

    Wakasugi, Mitsuo; Sasaki, Takuma; Matsumoto, Megumi; Nagaoka, Miyuki; Inoue, Keiko; Inobe, Manabu; Horibata, Katsuyoshi; Tanaka, Kiyoji; Matsunaga, Tsukasa

    2014-10-10

    Histone H2A variant H2AX is phosphorylated at Ser(139) in response to DNA double-strand break (DSB) and single-stranded DNA (ssDNA) formation. UV light dominantly induces pyrimidine photodimers, which are removed from the mammalian genome by nucleotide excision repair (NER). We previously reported that in quiescent G0 phase cells, UV induces ATR-mediated H2AX phosphorylation plausibly caused by persistent ssDNA gap intermediates during NER. In this study, we have found that DSB is also generated following UV irradiation in an NER-dependent manner and contributes to an earlier fraction of UV-induced H2AX phosphorylation. The NER-dependent DSB formation activates ATM kinase and triggers the accumulation of its downstream factors, MRE11, NBS1, and MDC1, at UV-damaged sites. Importantly, ATM-deficient cells exhibited enhanced UV sensitivity under quiescent conditions compared with asynchronously growing conditions. Finally, we show that the NER-dependent H2AX phosphorylation is also observed in murine peripheral T lymphocytes, typical nonproliferating quiescent cells in vivo. These results suggest that in vivo quiescent cells may suffer from NER-mediated secondary DNA damage including ssDNA and DSB. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Sequence-dependent modelling of local DNA bending phenomena: curvature prediction and vibrational analysis.

    PubMed

    Vlahovicek, K; Munteanu, M G; Pongor, S

    1999-01-01

    Bending is a local conformational micropolymorphism of DNA in which the original B-DNA structure is only distorted but not extensively modified. Bending can be predicted by simple static geometry models as well as by a recently developed elastic model that incorporate sequence dependent anisotropic bendability (SDAB). The SDAB model qualitatively explains phenomena including affinity of protein binding, kinking, as well as sequence-dependent vibrational properties of DNA. The vibrational properties of DNA segments can be studied by finite element analysis of a model subjected to an initial bending moment. The frequency spectrum is obtained by applying Fourier analysis to the displacement values in the time domain. This analysis shows that the spectrum of the bending vibrations quite sensitively depends on the sequence, for example the spectrum of a curved sequence is characteristically different from the spectrum of straight sequence motifs of identical basepair composition. Curvature distributions are genome-specific, and pronounced differences are found between protein-coding and regulatory regions, respectively, that is, sites of extreme curvature and/or bendability are less frequent in protein-coding regions. A WWW server is set up for the prediction of curvature and generation of 3D models from DNA sequences (http:@www.icgeb.trieste.it/dna).

  5. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells

    PubMed Central

    Fernández, Agustín F.; Bayón, Gustavo F.; Urdinguio, Rocío G.; Toraño, Estela G.; García, María G.; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M.; Riancho, José A.; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A.

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type–independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. PMID:25271306

  6. Experience-Dependent Epigenomic Reorganization in the Hippocampus

    ERIC Educational Resources Information Center

    Duke, Corey G.; Kennedy, Andrew J.; Gavin, Cristin F.; Day, Jeremy J.; Sweatt, J. David

    2017-01-01

    Using a hippocampus-dependent contextual threat learning and memory task, we report widespread, coordinated DNA methylation changes in CA1 hippocampus of Sprague-Dawley rats specific to threat learning at genes involved in synaptic transmission. Experience-dependent alternations in gene expression and DNA methylation were observed as early as 1 h…

  7. Long-Range Charge Transport in Adenine-Stacked RNA:DNA Hybrids.

    PubMed

    Li, Yuanhui; Artés, Juan M; Hihath, Joshua

    2016-01-27

    An extremely important biological component, RNA:DNA can also be used to design nanoscale structures such as molecular wires. The conductance of single adenine-stacked RNA:DNA hybrids is rapidly and reproducibly measured using the break junction approach. The conductance decreases slightly over a large range of molecular lengths, suggesting that RNA:DNA can be used as an oligonucleotide wire. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. 28 CFR 28.25 - Exceptions based on a defendant's conduct.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    .... 28.25 Section 28.25 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM... DNA testing in a court proceeding conducted after the date of enactment, i.e., after October 30, 2004. Hence, for example, if a defendant waives DNA testing in the context of a plea agreement, in a pretrial...

  9. 28 CFR 28.25 - Exceptions based on a defendant's conduct.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    .... 28.25 Section 28.25 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM... DNA testing in a court proceeding conducted after the date of enactment, i.e., after October 30, 2004. Hence, for example, if a defendant waives DNA testing in the context of a plea agreement, in a pretrial...

  10. 28 CFR 28.25 - Exceptions based on a defendant's conduct.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    .... 28.25 Section 28.25 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM... DNA testing in a court proceeding conducted after the date of enactment, i.e., after October 30, 2004. Hence, for example, if a defendant waives DNA testing in the context of a plea agreement, in a pretrial...

  11. 28 CFR 28.25 - Exceptions based on a defendant's conduct.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    .... 28.25 Section 28.25 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM... DNA testing in a court proceeding conducted after the date of enactment, i.e., after October 30, 2004. Hence, for example, if a defendant waives DNA testing in the context of a plea agreement, in a pretrial...

  12. 28 CFR 28.25 - Exceptions based on a defendant's conduct.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    .... 28.25 Section 28.25 Judicial Administration DEPARTMENT OF JUSTICE DNA IDENTIFICATION SYSTEM... DNA testing in a court proceeding conducted after the date of enactment, i.e., after October 30, 2004. Hence, for example, if a defendant waives DNA testing in the context of a plea agreement, in a pretrial...

  13. In the Absence of Writhe, DNA Relieves Torsional Stress with Localized, Sequence-Dependent Structural Failure to Preserve B-form

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Randall, Graham L.; Zechiedrich, E. L.; Pettitt, Bernard M.

    2009-09-01

    To understand how underwinding and overwinding the DNA helix affects its structure, we simulated 19 independent DNA systems with fixed degrees of twist using molecular dynamics in a system that does not allow writhe. Underwinding DNA induced spontaneous, sequence-dependent base flipping and local denaturation, while overwinding DNA induced the formation of Pauling-like DNA (P-DNA). The winding resulted in a bimodal state simultaneously including local structural failure and B-form DNA for both underwinding and extreme overwinding. Our simulations suggest that base flipping and local denaturation may provide a landscape influencing protein recognition of DNA sequence to affect, for examples, replication, transcriptionmore » and recombination. Additionally, our findings help explain results from singlemolecule experiments and demonstrate that elastic rod models are strictly valid on average only for unstressed or overwound DNA up to P-DNA formation. Finally, our data support a model in which base flipping can result from torsional stress.« less

  14. Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

    PubMed

    Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

    2015-11-19

    We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

  15. Influence of Disorder on DNA Conductance

    NASA Technical Reports Server (NTRS)

    Adessi, Christophe; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

    2003-01-01

    Disorder along a DNA strand due to non uniformity associated with the counter ion type and location, and in rise and twist are investigated using density functional theory. We then model the conductance through a poly(G) DNA strand by including the influence of disorder. We show that the conductance drops by a few orders of magnitude between typical lengths of 10 and 100 nm. Such a decrease occurs with on-site potential disorder that is larger than 100 meV.

  16. [Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].

    PubMed

    Shematorova, E K; Shpakovskiĭ, G V

    2002-01-01

    In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.

  17. Defined-size DNA triple crossover construct for molecular electronics: modification, positioning and conductance properties.

    PubMed

    Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi

    2011-07-08

    We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.

  18. cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA.

    PubMed

    Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H

    2014-11-10

    cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Production of DNA minicircles less than 250 base pairs through a novel concentrated DNA circularization assay enabling minicircle design with NF-κB inhibition activity.

    PubMed

    Thibault, Thomas; Degrouard, Jeril; Baril, Patrick; Pichon, Chantal; Midoux, Patrick; Malinge, Jean-Marc

    2017-03-17

    Double-stranded DNA minicircles of less than 1000 bp in length have great interest in both fundamental research and therapeutic applications. Although minicircles have shown promising activity in gene therapy thanks to their good biostability and better intracellular trafficking, minicircles down to 250 bp in size have not yet been investigated from the test tube to the cell for lack of an efficient production method. Herein, we report a novel versatile plasmid-free method for the production of DNA minicircles comprising fewer than 250 bp. We designed a linear nicked DNA double-stranded oligonucleotide blunt-ended substrate for efficient minicircle production in a ligase-mediated and bending protein-assisted circularization reaction at high DNA concentration of 2 μM. This one pot multi-step reaction based-method yields hundreds of micrograms of minicircle with sequences of any base composition and position and containing or not a variety of site-specifically chemical modifications or physiological supercoiling. Biochemical and cellular studies were then conducted to design a 95 bp minicircle capable of binding in vitro two NF-κB transcription factors per minicircle and to efficiently inhibiting NF-κB-dependent transcriptional activity in human cells. Therefore, our production method could pave the way for the design of minicircles as new decoy nucleic acids. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Heteroleptic Copper(I) Complexes of "Scorpionate" Bis-pyrazolyl Carboxylate Ligand with Auxiliary Phosphine as Potential Anticancer Agents: An Insight into Cytotoxic Mode.

    PubMed

    Khan, Rais Ahmad; Usman, Mohammad; Dhivya, Rajakumar; Balaji, Perumalsamy; Alsalme, Ali; AlLohedan, Hamad; Arjmand, Farukh; AlFarhan, Khalid; Akbarsha, Mohammad Abdulkader; Marchetti, Fabio; Pettinari, Claudio; Tabassum, Sartaj

    2017-03-24

    New copper(I) complexes [CuCl(PPh 3 )(L)] (1: L = L A  = 4-carboxyphenyl)bis(3,5-dimethylpyrazolyl)methane; (2: L = L B  = 3-carboxyphenyl)bis(3,5-dimethylpyrazolyl)methane) were prepared and characterised by elemental analysis and various spectroscopic techniques such as FT-IR, NMR, UV-Vis, and ESI-MS. The molecular structures of complexes 1 and 2 were analyzed by theoretical B3LYP/DFT method. Furthermore, in vitro DNA binding studies were carried out to check the ability of complexes 1 and 2 to interact with native calf thymus DNA (CT-DNA) using absorption titration, fluorescence quenching and circular dichroism, which is indicative of more avid binding of the complex 1. Moreover, DNA mobility assay was also conducted to study the concentration-dependent cleavage pattern of pBR322 DNA by complex 1, and the role of ROS species to have a mechanistic insight on the cleavage pattern, which ascertained substantial roles by both hydrolytic and oxidative pathways. Additionally, we analyzed the potential of the interaction of complex 1 with DNA and enzyme (Topo I and II) with the aid of molecular modeling. Furthermore, cytotoxic activity of complex 1 was tested against HepG2 cancer cell lines. Thus, the potential of the complex 1 is promising though further in vivo investigations may be required before subjecting it to clinical trials.

  1. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

    PubMed

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

    2015-03-31

    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

  2. RNF8- and Ube2S-Dependent Ubiquitin Lysine 11-Linkage Modification in Response to DNA Damage.

    PubMed

    Paul, Atanu; Wang, Bin

    2017-05-18

    Ubiquitin modification of proteins plays pivotal roles in the cellular response to DNA damage. Given the complexity of ubiquitin conjugation due to the formation of poly-conjugates of different linkages, functional roles of linkage-specific ubiquitin modification at DNA damage sites are largely unclear. We identify that Lys11-linkage ubiquitin modification occurs at DNA damage sites in an ATM-dependent manner, and ubiquitin-modifying enzymes, including Ube2S E2-conjugating enzyme and RNF8 E3 ligase, are responsible for the assembly of Lys11-linkage conjugates on damaged chromatin, including histone H2A/H2AX. We show that RNF8- and Ube2S-dependent Lys11-linkage ubiquitin conjugation plays an important role in regulating DNA damage-induced transcriptional silencing, distinct from the role of Lys63-linkage ubiquitin in the recruitment of DNA damage repair proteins 53BP1 and BRCA1. Thus, our study highlights the importance of linkage-specific ubiquitination at DNA damage sites, and it reveals that Lys11-linkage ubiquitin modification plays a crucial role in the DNA damage response. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Single Molecule Study of DNA Organization and Recombination

    NASA Astrophysics Data System (ADS)

    Xiao, Botao

    We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force, which depends on salt concentration. We also report experiments with the recombinase Hin mutant H107Y. The synapse formation is demonstrated with single DNA containing two hix sites. We further show preliminary data for cleavage and subunit rotation from a braiding assay. These direct observations elucidate the recombination mechanism.

  4. Modulation of DNA-Polyamide Interaction by β-alanine Substitutions: A Study of Positional Effects on Binding Affinity, Kinetics and Thermodynamics

    PubMed Central

    Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.

    2014-01-01

    Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096

  5. Targeting the FANCJ–BRCA1 interaction promotes a switch from recombination to polη-dependent bypass

    PubMed Central

    Xie, J; Litman, R; Wang, S; Peng, M; Guillemette, S; Rooney, T; Cantor, SB

    2010-01-01

    BRCA1 and the DNA helicase FANCJ (also known as BACH1 or BRIP1) have common functions in breast cancer suppression and DNA repair. However, the functional significance of the direct interaction between BRCA1 and FANCJ remains unclear. Here, we have discovered that BRCA1 binding to FANCJ regulates DNA damage repair choice. Thus, when FANCJ binding to BRCA1 is ablated, the molecular mechanism chosen for the repair of damaged DNA is dramatically altered. Specifically, a FANCJ protein that cannot be phosphorylated at serine 990 or bind BRCA1 inhibits DNA repair via homologous recombination and promotes polη-dependent bypass. Furthermore, the polη-dependent bypass promoted by FANCJ requires the direct binding to the mismatch repair (MMR) protein, MLH1. Together, our findings implicate that in human cells BRCA1 binding to FANCJ is critical to regulate DNA repair choice and promote genomic stability. Moreover, unregulated FANCJ function could be associated with cancer and/or chemoresistance. PMID:20173781

  6. Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

    PubMed

    Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

  7. Changes in DnaA-dependent gene expression contribute to the transcriptional and developmental response of Bacillus subtilis to manganese limitation in Luria-Bertani medium.

    PubMed

    Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F

    2010-08-01

    The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.

  8. The distribution of DNA damage is defined by region-specific susceptibility to DNA damage formation rather than repair differences.

    PubMed

    Strand, Janne M; Scheffler, Katja; Bjørås, Magnar; Eide, Lars

    2014-06-01

    The cellular genomes are continuously damaged by reactive oxygen species (ROS) from aerobic processes. The impact of DNA damage depends on the specific site as well as the cellular state. The steady-state level of DNA damage is the net result of continuous formation and subsequent repair, but it is unknown to what extent heterogeneous damage distribution is caused by variations in formation or repair of DNA damage. Here, we used a restriction enzyme/qPCR based method to analyze DNA damage in promoter and coding regions of four nuclear genes: the two house-keeping genes Gadph and Tbp, and the Ndufa9 and Ndufs2 genes encoding mitochondrial complex I subunits, as well as mt-Rnr1 encoded by mitochondrial DNA (mtDNA). The distribution of steady-state levels of damage varied in a site-specific manner. Oxidative stress induced damage in nDNA to a similar extent in promoter and coding regions, and more so in mtDNA. The subsequent removal of damage from nDNA was efficient and comparable with recovery times depending on the initial damage load, while repair of mtDNA was delayed with subsequently slower repair rate. The repair was furthermore found to be independent of transcription or the transcription-coupled repair factor CSB, but dependent on cellular ATP. Our results demonstrate that the capacity to repair DNA is sufficient to remove exogenously induced damage. Thus, we conclude that the heterogeneous steady-state level of DNA damage in promoters and coding regions is caused by site-specific DNA damage/modifications that take place under normal metabolism. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Changes in DnaA-Dependent Gene Expression Contribute to the Transcriptional and Developmental Response of Bacillus subtilis to Manganese Limitation in Luria-Bertani Medium▿ †

    PubMed Central

    Hoover, Sharon E.; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F.

    2010-01-01

    The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress. PMID:20511500

  10. Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

    PubMed Central

    Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100–300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK. PMID:23227178

  11. The Molecular Origin of the MMR-dependent Apoptosis Pathway from Dynamics Analysis of MutSα-DNA Complexes

    PubMed Central

    Negureanu, Lacramioara; Salsbury, Freddie R.

    2012-01-01

    The cellular response to DNA damage signaling by MMR proteins is incompletely understood. It is generally accepted that MMR-dependent apoptosis pathway in response to DNA damage detection is independent of MMR's DNA repair function. In this study we investigate correlated motions in response to the binding of mismatched and PCL DNA fragments by MutSα, as derived from 50 ns molecular dynamics simulations. The protein dynamics in response to the mismatched and damaged DNA recognition suggests that MutSα signals their recognition through independent pathways providing evidence for the molecular origin of the MMR-dependent apoptosis. MSH2 subunit is indicated to play a key role in signaling both mismatched and damaged DNA recognition; localized and collective motions within the protein allow identifying sites on the MSH2 surface possible involved in recruiting proteins responsible for downstream events. Unlike in the mismatch complex, predicted key communication sites specific for the damage recognition are on the list of known cancer causing mutations or deletions. This confirms MSH2's role in signaling DNA-damage induced apoptosis and suggests that defects in MMR alone is sufficient to trigger tumorigenesis, supporting the experimental evidence that MMR-damage response function could protect from the early occurrence of tumors. Identifying these particular communication sites may have implications for the treatment of cancers that are not defective for MMR, but are unable to function optimally for MMR-dependent responses following DNA damage such as the case of resistance to cisplatin. PMID:22712459

  12. BCR/ABL downregulates DNA-PK(CS)-dependent and upregulates backup non-homologous end joining in leukemic cells.

    PubMed

    Poplawski, Tomasz; Blasiak, Janusz

    2010-06-01

    Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.

  13. Direct observation of iron-induced conformational changes of mitochondrial DNA by high-resolution field-emission in-lens scanning electron microscopy.

    PubMed Central

    Yaffee, M; Walter, P; Richter, C; Müller, M

    1996-01-01

    When respiring rat liver mitochondria are incubated in the presence of Fe(III) gluconate, their DNA (mtDNA) relaxes from the supercoiled to the open circular form dependent on the iron dose. Anaerobiosis or antioxidants fail to completely inhibit the unwinding. High-resolution field-emission in-lens scanning electron microscopy imaging, in concert with backscattered electron detection, pinpoints nanometer-range iron colloids bound to mtDNA isolated from iron-exposed mitochondria. High-resolution field-emission in-lens scanning electron microscopy with backscattered electron detection imaging permits simultaneous detailed visual analysis of DNA topology, iron dose-dependent mtDNA unwinding, and assessment of iron colloid formation on mtDNA strands. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:8643576

  14. Effects of pH, conductivity, host cell protein, and DNA size distribution on DNA clearance in anion exchange chromatography media

    PubMed Central

    Stone, Melani C.; Borman, Jon; Ferreira, Gisela

    2017-01-01

    Flowthrough anion exchange chromatography is commonly used as a polishing step in downstream processing of monoclonal antibodies and other therapeutic proteins to remove process‐related impurities and contaminants such as host cell DNA, host cell proteins, endotoxin, and viruses. DNA with a wide range of molecular weight distributions derived from Chinese Hamster Ovary cells was used to advance the understanding of DNA binding behavior in selected anion exchange media using the resin (Toyopearl SuperQ‐650M) and membranes (Mustang® Q and Sartobind® Q) through DNA spiking studies. The impacts of the process parameters pH (6–8), conductivity (2–15 mS/cm), and the potential binding competition between host cell proteins and host cell DNA were studied. Studies were conducted at the least and most favorable experimental conditions for DNA binding based on the anticipated electrostatic interactions between the host cell DNA and the resin ligand. The resin showed 50% higher DNA binding capacity compared to the membrane media. Spiking host cell proteins in the load material showed no impact on the DNA clearance capability of the anion exchange media. DNA size distributions were characterized based on a “size exclusion qPCR assay.” Results showed preferential binding of larger DNA fragments (>409 base pairs). © 2017 The Authors Biotechnology Progress published by Wiley Periodicals, Inc. on behalf of American Institute of Chemical Engineers Biotechnol. Prog., 34:141–149, 2018 PMID:28884511

  15. Jatropha curcas leaf and bark fractions protect against ultraviolet radiation-B induced DNA damage in human peripheral blood lymphocytes.

    PubMed

    Sundari, J; Selvaraj, R; Rajendra Prasad, N; Elumalai, R

    2013-11-01

    The present study is conducted to investigate the antioxidant potential of Jatropha curcas root bark extract (RB4 fraction) and leaf extract (L1 fraction), and to study their effects on UVB-radiation-induced DNA damage in cultured human blood lymphocytes. In this study, J. curcas showed strong antioxidant property in different free radical scavenging systems. Both the fractions effectively scavenged hydroxyl (OH), superoxide anion (O₂(·-)), 1,1-diphenyl-2-picrylhydrazyl (DPPH·) and 2,2-azino-bis-3-ethylbenzothiazoline-6-sulphonic acid radical cation (ABTS(·+)) in a concentration-dependent manner. The IC₅₀ (Inhibitory Concentration 50) values of J. curcas fractions were compared to standard ascorbic acid used in this study. The antioxidant potential of a compound was directly proportional to the photoprotective effect. In this study, human peripheral blood lymphocytes (HPBL) were exposed to UVB-radiation and there was an increase in comet attributes (% tail DNA, tail length, tail movement and Olive tail moment). Jatropha curcas RB4 fraction and L1 fraction treatment before UVB-irradiation significantly decreased the % tail DNA, tail length, tail moment and Olive tail moment in irradiated HPBL. These results suggested that J. curcas exhibited strong antioxidant property and RB4 and L1 fractions protected UVB-radiation-induced DNA damage in HPBL. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Combination of Pim kinase inhibitor SGI-1776 and bendamustine in B-cell lymphoma.

    PubMed

    Yang, Qingshan; Chen, Lisa S; Neelapu, Sattva S; Gandhi, Varsha

    2013-09-01

    SGI-1776 is a small-molecule Pim kinase inhibitor that primarily targets c-MYC-driven transcription and cap-dependent translation in mantle cell lymphoma (MCL) cells. Bendamustine is an alkylating chemotherapeutic agent approved for use in B-cell lymphoma that is known to induce DNA damage and initiate response to repair. Our studies were conducted in MCL cell lines JeKo-1 and Mino, as well as primary B-cell lymphoma samples of MCL and splenic marginal zone lymphoma (SMZL), where we treated cells with SGI-1776 and bendamustine. We measured levels of cellular apoptosis, macromolecule synthesis inhibition, and DNA damage induced by drug treatments. Both SGI-1776 and bendamustine effectively induced apoptosis as single agents, and when used in combination, an additive effect in cell killing was observed in MCL cell lines JeKo-1 and Mino, as well as in MCL and SMZL primary cells. As expected, SGI-1776 was effective in inducing a decrease of global RNA and protein synthesis, and bendamustine significantly inhibited DNA synthesis and generated a DNA damage response. When used in combination, the effects were intensified in DNA, RNA, and protein synthesis inhibition compared with single-agent treatments. These data provide a foundation and suggest the feasibility of using Pim kinase inhibitors in combination with chemotherapeutic agents such as bendamustine in B-cell lymphoma. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Recombination-dependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA.

    PubMed

    Ling, Feng; Shibata, Takehiko

    2002-09-02

    Yeast mhr1-1 was isolated as a defective mutation in mitochondrial DNA (mtDNA) recombination. About half of mhr1-1 cells lose mtDNA during growth at a higher temperature. Here, we show that mhr1-1 exhibits a defect in the partitioning of nascent mtDNA into buds and is a base-substitution mutation in MHR1 encoding a mitochondrial matrix protein. We found that the Mhr1 protein (Mhr1p) has activity to pair single-stranded DNA and homologous double-stranded DNA to form heteroduplex joints in vitro, and that mhr1-1 causes the loss of this activity, indicating its role in homologous mtDNA recombination. While the majority of the mtDNA in the mother cells consists of head-to-tail concatemers, more than half of the mtDNA in the buds exists as genome-sized monomers. The mhr1-1 deltacce1 double mutant cells do not maintain any mtDNA, indicating the strict dependence of mtDNA maintenance on recombination functions. These results suggest a mechanism for mtDNA inheritance similar to that operating in the replication and packaging of phage DNA.

  18. Interleukin-22 drives nitric oxide-dependent DNA damage and dysplasia in a murine model of colitis-associated cancer

    PubMed Central

    Sheh, A; Muthupalani, S; Bryant, EM; Puglisi, DA; Holcombe, H; Conaway, EA; Parry, NAP; Bakthavatchalu, V; Short, SP; Williams, CS; Wogan, GN; Tannenbaum, SR; Fox, JG; Horwitz, BH

    2017-01-01

    The risk of colon cancer is increased in patients with Crohn's disease and ulcerative colitis. Inflammation-induced DNA damage could be an important link between inflammation and cancer, although the pathways that link inflammation and DNA damage are incompletely defined. RAG2-deficient mice infected with Helicobacter hepaticus (Hh) develop colitis that progresses to lower bowel cancer. This process depends on nitric oxide (NO), a molecule with known mutagenic potential. We have previously hypothesized that production of NO by macrophages could be essential for Hh-driven carcinogenesis, however, whether Hh-infection induces DNA damage in this model and whether this depends on NO has not been determined. Here, we demonstrate that Hh infection of RAG2-deficient mice rapidly induces expression of iNOS and the development of DNA double-stranded breaks (DSBs) specifically in proliferating crypt epithelial cells. Generation of DSBs depended on iNOS activity, and further, induction of iNOS, the generation of DSBs, and the subsequent development of dysplasia were inhibited by depletion of the Hh-induced cytokine IL-22. These results demonstrate a strong association between Hh-induced DNA damage and the development of dysplasia, and further suggest that IL-22 dependent induction of iNOS within crypt epithelial cells rather than macrophages is a driving force in this process. PMID:28198364

  19. Sequence periodicity in nucleosomal DNA and intrinsic curvature.

    PubMed

    Nair, T Murlidharan

    2010-05-17

    Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA.

  20. Mapping protein-DNA and protein-protein interactions of ATP-dependent chromatin remodelers.

    PubMed

    Hota, Swetansu K; Dechassa, Mekonnen Lemma; Prasad, Punit; Bartholomew, Blaine

    2012-01-01

    Chromatin plays a key regulatory role in several DNA-dependent processes as it regulates DNA access to different protein factors. Several multisubunit protein complexes interact, modify, or mobilize nucleosomes: the basic unit of chromatin, from its original location in an ATP-dependent manner to facilitate processes, such as transcription, replication, repair, and recombination. Knowledge of the interactions of chromatin remodelers with nucleosomes is a crucial requirement to understand the mechanism of chromatin remodeling. Here, we describe several methods to analyze the interactions of multisubunit chromatin-remodeling enzymes with nucleosomes.

  1. Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

    PubMed

    Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

    2001-04-15

    We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

  2. HARP preferentially co-purifies with RPA bound to DNA-PK and blocks RPA phosphorylation.

    PubMed

    Quan, Jinhua; Yusufzai, Timur

    2014-05-01

    The HepA-related protein (HARP/SMARCAL1) is an ATP-dependent annealing helicase that is capable of rewinding DNA structures that are stably unwound due to binding of the single-stranded DNA (ssDNA)-binding protein Replication Protein A (RPA). HARP has been implicated in maintaining genome integrity through its role in DNA replication and repair, two processes that generate RPA-coated ssDNA. In addition, mutations in HARP cause a rare disease known as Schimke immuno-osseous dysplasia. In this study, we purified HARP containing complexes with the goal of identifying the predominant factors that stably associate with HARP. We found that HARP preferentially interacts with RPA molecules that are bound to the DNA-dependent protein kinase (DNA-PK). We also found that RPA is phosphorylated by DNA-PK in vitro, while the RPA-HARP complexes are not. Our results suggest that, in addition to its annealing helicase activity, which eliminates the natural binding substrate for RPA, HARP blocks the phosphorylation of RPA by DNA-PK.

  3. Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

    PubMed

    Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

    2014-11-01

    DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

  4. RPA and Rad51 constitute a cell intrinsic mechanism to protect the cytosol from self DNA.

    PubMed

    Wolf, Christine; Rapp, Alexander; Berndt, Nicole; Staroske, Wolfgang; Schuster, Max; Dobrick-Mattheuer, Manuela; Kretschmer, Stefanie; König, Nadja; Kurth, Thomas; Wieczorek, Dagmar; Kast, Karin; Cardoso, M Cristina; Günther, Claudia; Lee-Kirsch, Min Ae

    2016-05-27

    Immune recognition of cytosolic DNA represents a central antiviral defence mechanism. Within the host, short single-stranded DNA (ssDNA) continuously arises during the repair of DNA damage induced by endogenous and environmental genotoxic stress. Here we show that short ssDNA traverses the nuclear membrane, but is drawn into the nucleus by binding to the DNA replication and repair factors RPA and Rad51. Knockdown of RPA and Rad51 enhances cytosolic leakage of ssDNA resulting in cGAS-dependent type I IFN activation. Mutations in the exonuclease TREX1 cause type I IFN-dependent autoinflammation and autoimmunity. We demonstrate that TREX1 is anchored within the outer nuclear membrane to ensure immediate degradation of ssDNA leaking into the cytosol. In TREX1-deficient fibroblasts, accumulating ssDNA causes exhaustion of RPA and Rad51 resulting in replication stress and activation of p53 and type I IFN. Thus, the ssDNA-binding capacity of RPA and Rad51 constitutes a cell intrinsic mechanism to protect the cytosol from self DNA.

  5. Proline dehydrogenase promotes senescence through the generation of reactive oxygen species.

    PubMed

    Nagano, Taiki; Nakashima, Akio; Onishi, Kengo; Kawai, Kosuke; Awai, Yuto; Kinugasa, Mizuki; Iwasaki, Tetsushi; Kikkawa, Ushio; Kamada, Shinji

    2017-04-15

    Cellular senescence is a complex stress response characterized by permanent loss of proliferative capacity and is implicated in age-related disorders. Although the transcriptional activity of p53 (encoded by TP53 ) is known to be vital for senescence induction, the downstream effector genes critical for senescence remain unsolved. Recently, we have identified the proline dehydrogenase gene ( PRODH ) to be upregulated specifically in senescent cells in a p53-dependent manner, and the functional relevance of this to senescence is yet to be defined. Here, we conducted functional analyses to explore the relationship between PRODH and the senescence program. We found that genetic and pharmacological inhibition of PRODH suppressed senescent phenotypes induced by DNA damage. Furthermore, ectopic expression of wild-type PRODH, but not enzymatically inactive forms, induced senescence associated with the increase in reactive oxygen species (ROS) and the accumulation of DNA damage. Treatment with N-acetyl-L-cysteine, a ROS scavenger, prevented senescence induced by PRODH overexpression. These results indicate that PRODH plays a causative role in DNA damage-induced senescence through the enzymatic generation of ROS. © 2017. Published by The Company of Biologists Ltd.

  6. Neurophysiological profile of peripheral neuropathy associated with childhood mitochondrial disease.

    PubMed

    Menezes, Manoj P; Rahman, Shamima; Bhattacharya, Kaustuv; Clark, Damian; Christodoulou, John; Ellaway, Carolyn; Farrar, Michelle; Pitt, Matthew; Sampaio, Hugo; Ware, Tyson L; Wedatilake, Yehani; Thorburn, David R; Ryan, Monique M; Ouvrier, Robert

    2016-09-01

    Peripheral nerve involvement is common in mitochondrial disease but often unrecognised due to the prominent central nervous system features. Identification of the underlying neuropathy may assist syndrome classification, targeted genetic testing and rehabilitative interventions. Clinical data and the results of nerve conduction studies were obtained retrospectively from the records of four tertiary children's hospital metabolic disease, neuromuscular or neurophysiology services. Nerve conductions studies were also performed prospectively on children attending a tertiary metabolic disease service. Results were classified and analysed according to the underlying genetic cause. Nerve conduction studies from 27 children with mitochondrial disease were included in the study (mitochondrial DNA (mtDNA) - 7, POLG - 7, SURF1 - 10, PDHc deficiency - 3). Four children with mtDNA mutations had a normal study while three had mild abnormalities in the form of an axonal sensorimotor neuropathy when not acutely unwell. One child with MELAS had a severe acute axonal motor neuropathy during an acute stroke-like episode that resolved over 12months. Five children with POLG mutations and disease onset beyond infancy had a sensory ataxic neuropathy with an onset in the second decade of life, while the two infants with POLG mutations had a demyelinating neuropathy. Seven of the 10 children with SURF1 mutations had a demyelinating neuropathy. All three children with PDHc deficiency had an axonal sensorimotor neuropathy. Unlike CMT, the neuropathy associated with mitochondrial disease was not length-dependent. This is the largest study to date of peripheral neuropathy in genetically- classified childhood mitochondrial disease. Characterising the underlying neuropathy may assist with the diagnosis of the mitochondrial syndrome and should be an integral part of the assessment of children with suspected mitochondrial disease. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  7. H3K4me1 marks DNA regions hypomethylated during aging in human stem and differentiated cells.

    PubMed

    Fernández, Agustín F; Bayón, Gustavo F; Urdinguio, Rocío G; Toraño, Estela G; García, María G; Carella, Antonella; Petrus-Reurer, Sandra; Ferrero, Cecilia; Martinez-Camblor, Pablo; Cubillo, Isabel; García-Castro, Javier; Delgado-Calle, Jesús; Pérez-Campo, Flor M; Riancho, José A; Bueno, Clara; Menéndez, Pablo; Mentink, Anouk; Mareschi, Katia; Claire, Fabian; Fagnani, Corrado; Medda, Emanuela; Toccaceli, Virgilia; Brescianini, Sonia; Moran, Sebastián; Esteller, Manel; Stolzing, Alexandra; de Boer, Jan; Nisticò, Lorenza; Stazi, Maria A; Fraga, Mario F

    2015-01-01

    In differentiated cells, aging is associated with hypermethylation of DNA regions enriched in repressive histone post-translational modifications. However, the chromatin marks associated with changes in DNA methylation in adult stem cells during lifetime are still largely unknown. Here, DNA methylation profiling of mesenchymal stem cells (MSCs) obtained from individuals aged 2 to 92 yr identified 18,735 hypermethylated and 45,407 hypomethylated CpG sites associated with aging. As in differentiated cells, hypermethylated sequences were enriched in chromatin repressive marks. Most importantly, hypomethylated CpG sites were strongly enriched in the active chromatin mark H3K4me1 in stem and differentiated cells, suggesting this is a cell type-independent chromatin signature of DNA hypomethylation during aging. Analysis of scedasticity showed that interindividual variability of DNA methylation increased during aging in MSCs and differentiated cells, providing a new avenue for the identification of DNA methylation changes over time. DNA methylation profiling of genetically identical individuals showed that both the tendency of DNA methylation changes and scedasticity depended on nongenetic as well as genetic factors. Our results indicate that the dynamics of DNA methylation during aging depend on a complex mixture of factors that include the DNA sequence, cell type, and chromatin context involved and that, depending on the locus, the changes can be modulated by genetic and/or external factors. © 2015 Fernández et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Utilizing DNA analysis to combat the world wide plague of present day slavery – trafficking in persons

    PubMed Central

    Palmbach, Timothy; Blom, Jeffrey; Hoynes, Emily; Primorac, Dragan; Gaboury, Mario

    2014-01-01

    A study was conducted to determine if modern forensic DNA typing methods can be properly employed throughout the world with a final goal of increasing arrests, prosecutions, and convictions of perpetrators of modern day trafficking in persons while concurrently reducing the burden of victim testimony in legal proceedings. Without interruption of investigations, collection of samples containing DNA was conducted in a variety of settings. Evidentiary samples were analyzed on the ANDE Rapid DNA system. Many of the collected swabs yielded informative short tandem repeat profiles with Rapid DNA technology. PMID:24577820

  9. Utilizing DNA analysis to combat the world wide plague of present day slavery--trafficking in persons.

    PubMed

    Palmbach, Timothy M; Blom, Jeffrey; Hoynes, Emily; Primorac, Dragan; Gaboury, Mario

    2014-02-01

    A study was conducted to determine if modern forensic DNA typing methods can be properly employed throughout the world with a final goal of increasing arrests, prosecutions, and convictions of perpetrators of modern day trafficking in persons while concurrently reducing the burden of victim testimony in legal proceedings. Without interruption of investigations, collection of samples containing DNA was conducted in a variety of settings. Evidentiary samples were analyzed on the ANDE Rapid DNA system. Many of the collected swabs yielded informative short tandem repeat profiles with Rapid DNA technology.

  10. Kinetics and thermodynamics of exonuclease-deficient DNA polymerases

    NASA Astrophysics Data System (ADS)

    Gaspard, Pierre

    2016-04-01

    A kinetic theory is developed for exonuclease-deficient DNA polymerases, based on the experimental observation that the rates depend not only on the newly incorporated nucleotide, but also on the previous one, leading to the growth of Markovian DNA sequences from a Bernoullian template. The dependencies on nucleotide concentrations and template sequence are explicitly taken into account. In this framework, the kinetic and thermodynamic properties of DNA replication, in particular, the mean growth velocity, the error probability, and the entropy production are calculated analytically in terms of the rate constants and the concentrations. Theory is compared with numerical simulations for the DNA polymerases of T7 viruses and human mitochondria.

  11. Doping Level of Boron-Doped Diamond Electrodes Controls the Grafting Density of Functional Groups for DNA Assays.

    PubMed

    Švorc, Ĺubomír; Jambrec, Daliborka; Vojs, Marian; Barwe, Stefan; Clausmeyer, Jan; Michniak, Pavol; Marton, Marián; Schuhmann, Wolfgang

    2015-09-02

    The impact of different doping levels of boron-doped diamond on the surface functionalization was investigated by means of electrochemical reduction of aryldiazonium salts. The grafting efficiency of 4-nitrophenyl groups increased with the boron levels (B/C ratio from 0 to 20,000 ppm). Controlled grafting of nitrophenyldiazonium was used to adjust the amount of immobilized single-stranded DNA strands at the surface and further on the hybridization yield in dependence on the boron doping level. The grafted nitro functions were electrochemically reduced to the amine moieties. Subsequent functionalization with a succinic acid introduced carboxyl groups for subsequent binding of an amino-terminated DNA probe. DNA hybridization significantly depends on the probe density which is in turn dependent on the boron doping level. The proposed approach opens new insights for the design and control of doped diamond surface functionalization for the construction of DNA hybridization assays.

  12. Initiation of DNA replication requires actin dynamics and formin activity.

    PubMed

    Parisis, Nikolaos; Krasinska, Liliana; Harker, Bethany; Urbach, Serge; Rossignol, Michel; Camasses, Alain; Dewar, James; Morin, Nathalie; Fisher, Daniel

    2017-11-02

    Nuclear actin regulates transcriptional programmes in a manner dependent on its levels and polymerisation state. This dynamics is determined by the balance of nucleocytoplasmic shuttling, formin- and redox-dependent filament polymerisation. Here, using Xenopus egg extracts and human somatic cells, we show that actin dynamics and formins are essential for DNA replication. In proliferating cells, formin inhibition abolishes nuclear transport and initiation of DNA replication, as well as general transcription. In replicating nuclei from transcriptionally silent Xenopus egg extracts, we identified numerous actin regulators, and disruption of actin dynamics abrogates nuclear transport, preventing NLS (nuclear localisation signal)-cargo release from RanGTP-importin complexes. Nuclear formin activity is further required to promote loading of cyclin-dependent kinase (CDK) and proliferating cell nuclear antigen (PCNA) onto chromatin, as well as initiation and elongation of DNA replication. Therefore, actin dynamics and formins control DNA replication by multiple direct and indirect mechanisms. © 2017 The Authors.

  13. Distance, flow and PCR inhibition: eDNA dynamics in two headwater streams

    Treesearch

    Stephen F. Jane; Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Michael K. Schwartz; Winsor H. Lowe; Benjamin H. Letcher; Andrew R. Whiteley

    2014-01-01

    Environmental DNA (eDNA) detection has emerged as a powerful tool for monitoring aquatic organisms, but much remains unknown about the dynamics of aquatic eDNA over a range of environmental conditions. DNA concentrations in streams and rivers will depend not only on the equilibrium between DNA entering the water and DNA leaving the system through degradation, but also...

  14. Disintegration of cruciform and G-quadruplex structures during the course of helicase-dependent amplification (HDA).

    PubMed

    Li, Dawei; Lv, Bei; Zhang, Hao; Lee, Jasmine Yiqin; Li, Tianhu

    2015-04-15

    Unlike chemical damages on DNA, physical alterations of B-form of DNA occur commonly in organisms that serve as signals for specified cellular events. Although the modes of action for repairing of chemically damaged DNA have been well studied nowadays, the repairing mechanisms for physically altered DNA structures have not yet been understood. Our current in vitro studies show that both breakdown of stable non-B DNA structures and resumption of canonical B-conformation of DNA can take place during the courses of isothermal helicase-dependent amplification (HDA). The pathway that makes the non-B DNA structures repairable is presumably the relieving of the accumulated torsional stress that was caused by the positive supercoiling. Our new findings suggest that living organisms might have evolved this distinct and economical pathway for repairing their physically altered DNA structures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Sequence-dependent DNA flexibility mediates DNase I cleavage.

    PubMed

    Heddi, Brahim; Abi-Ghanem, Josephine; Lavigne, Marc; Hartmann, Brigitte

    2010-01-08

    Understanding the preference of nonspecific proteins for certain DNA structural features requires an accurate description of the properties of free DNA, especially regarding their possible predisposition to adopt a conformation that favors the formation of a complex. Exploiting previous exhaustive NMR studies performed on free DNA oligomers, we investigated the molecular basis of DNase I sensitivity under conditions where DNase I binding limits the probability of cleavage. We showed that cleavage intensity was correlated with adjacent 3' phosphate linkage flexibility, monitored by (31)P chemical shifts. Examining NMR-refined DNA structures highlighted that sequence-dependent flexible phosphates were associated with large minor groove variations that may promote the affinity of DNase I, according to relevant DNA-protein complexes. In sum, this work demonstrates that specificity in DNA-DNase I interaction is mediated by DNA flexibility, which influences the induced-fit transitions required to form productive complexes.

  16. Inhibition of gamma-radiation induced DNA damage in plasmid pBR322 by TMG, a water-soluble derivative of vitamin E.

    PubMed

    Rajagopalan, Rema; Wani, Khalida; Huilgol, Nagaraj G; Kagiya, Tsutomu V; Nair, Cherupally K Krishnan

    2002-06-01

    Alpha-tocopherol monoglucoside (TMG), a water-soluble derivative of alpha-tocopherol, has been examined for its ability to protect DNA against radiation-induced strand breaks. Gamma radiation, up to a dose of 6 Gy (dose rate, 0.7 Gy/minute), induced a dose-dependent increase in single strand breaks (SSBs) in plasmid pBR322 DNA. TMG inhibited the formation of gamma-radiation induced DNA single strand breaks (SSBs) in a concentration-dependent manner; 500 microM of TMG protected the single strand breaks completely. It also protected thymine glycol formation induced by gamma-radiation in a dose-dependent manner, based on an estimation of thymine glycol by HPLC.

  17. Inhibition of the HDAC/Suv39/G9a pathway restores the expression of DNA damage-dependent major histocompatibility complex class I-related chain A and B in cancer cells.

    PubMed

    Nakajima, Nakako Izumi; Niimi, Atsuko; Isono, Mayu; Oike, Takahiro; Sato, Hiro; Nakano, Takashi; Shibata, Atsushi

    2017-08-01

    Immunotherapy is expected to be promising as a next generation cancer therapy. Immunoreceptors are often activated constitutively in cancer cells, however, such levels of ligand expression are not effectively recognized by the native immune system due to tumor microenvironmental adaptation. Studies have demonstrated that natural-killer group 2, member D (NKG2D), a major activating immunoreceptor, responds to DNA damage. The upregulation of major histocompatibility complex class I-related chain A and B (MICA/B) (members of NKG2D ligands) expression after DNA damage is associated with NK cell-mediated killing of cancer cells. However, the regulation of DNA damage-induced MICA/B expression has not been fully elucidated in the context of the types of cancer cell lines. In the present study, we found that MICA/B expression varied between cancer cell lines after DNA damage. Screening in terms of chromatin remodeling identified that inhibitors related to chromatin relaxation via post-translational modification on histone H3K9, i.e. HDAC, Suv39 or G9a inhibition, restored DNA damage-dependent MICA/B expression in insensitive cells. In addition, we revealed that the restored MICA/B expression was dependent on ATR as well as E2F1, a transcription factor. We further revealed that low‑dose treatment of an HDAC inhibitor was sufficient to restore MICA/B expression in insensitive cells. Finally, we demonstrated that HDAC inhibition restored DNA damage‑dependent cytotoxic NK activity against insensitive cells. Thus, the present study revealed that DNA damage‑dependent MICA/B expression in insensitive cancer cells can be restored by chromatin relaxation via the HDAC/Suv39/G9a pathway. Collectively, manipulation of chromatin status by therapeutic cancer drugs may potentiate the antitumor effect by enhancing immune activation following radiotherapy and DNA damage-associated chemotherapy.

  18. Review of Chromium (VI) Apoptosis, Cell-Cycle-Arrest, and Carcinogenesis

    PubMed Central

    Chiu, A; Shi, J; Lee, WKP; Hill, R; Wakeman, TP; Katz, A; Xu, B; Dalal, NS; Robertson, JD; Chen, C; Chiu, N; Donehower, L

    2014-01-01

    Hexavalent chromium combines with glutathione in chloride intracellular channel carrier to form tetravalent and pentavelent chromium in plasma and organelle membranes. It also combines with NADH/NADPH to form pentavalent chromium in mitochondria. Tetravalent- and pentavalent- chromium (directly and indirectly) mediated DNA double strand breaks activate DNA damage signaling sensors: DNA-dependent-protein-kinase signals p53-dependent intrinsic mitochorndrial apoptosis, and ataxia-telangiectasia-mutated and ataxia-telangiectasia-Rad3-related signal cell-arrest for DNA repair. Tetravalent chromium may be the most potent species since it causes DNA breaks and somatic recombination, but not apoptosis. Upon further failure of apoptosis and senescence/DNA-repair, damaged cells may become immortal with loss-of-heterozygosity and genetic plasticity. PMID:20859824

  19. Dielectrophoretic trapping of multilayer DNA origami nanostructures and DNA origami-induced local destruction of silicon dioxide.

    PubMed

    Shen, Boxuan; Linko, Veikko; Dietz, Hendrik; Toppari, J Jussi

    2015-01-01

    DNA origami is a widely used method for fabrication of custom-shaped nanostructures. However, to utilize such structures, one needs to controllably position them on nanoscale. Here we demonstrate how different types of 3D scaffolded multilayer origamis can be accurately anchored to lithographically fabricated nanoelectrodes on a silicon dioxide substrate by DEP. Straight brick-like origami structures, constructed both in square (SQL) and honeycomb lattices, as well as curved "C"-shaped and angular "L"-shaped origamis were trapped with nanoscale precision and single-structure accuracy. We show that the positioning and immobilization of all these structures can be realized with or without thiol-linkers. In general, structural deformations of the origami during the DEP trapping are highly dependent on the shape and the construction of the structure. The SQL brick turned out to be the most robust structure under the high DEP forces, and accordingly, its single-structure trapping yield was also highest. In addition, the electrical conductivity of single immobilized plain brick-like structures was characterized. The electrical measurements revealed that the conductivity is negligible (insulating behavior). However, we observed that the trapping process of the SQL brick equipped with thiol-linkers tended to induce an etched "nanocanyon" in the silicon dioxide substrate. The nanocanyon was formed exactly between the electrodes, that is, at the location of the DEP-trapped origami. The results show that the demonstrated DEP-trapping technique can be readily exploited in assembling and arranging complex multilayered origami geometries. In addition, DNA origamis could be utilized in DEP-assisted deformation of the substrates onto which they are attached. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Electronic fingerprints of DNA bases on graphene.

    PubMed

    Ahmed, Towfiq; Kilina, Svetlana; Das, Tanmoy; Haraldsen, Jason T; Rehr, John J; Balatsky, Alexander V

    2012-02-08

    We calculate the electronic local density of states (LDOS) of DNA nucleotide bases (A,C,G,T), deposited on graphene. We observe significant base-dependent features in the LDOS in an energy range within a few electronvolts of the Fermi level. These features can serve as electronic fingerprints for the identification of individual bases in scanning tunneling spectroscopy (STS) experiments that perform image and site dependent spectroscopy on biomolecules. Thus the fingerprints of DNA-graphene hybrid structures may provide an alternative route to DNA sequencing using STS. © 2012 American Chemical Society

  1. Methionine increases BDNF DNA methylation and improves memory in epilepsy.

    PubMed

    Parrish, R Ryley; Buckingham, Susan C; Mascia, Katherine L; Johnson, Jarvis J; Matyjasik, Michal M; Lockhart, Roxanne M; Lubin, Farah D

    2015-04-01

    Temporal lobe epilepsy (TLE) patients exhibit signs of memory impairments even when seizures are pharmacologically controlled. Surprisingly, the underlying molecular mechanisms involved in TLE-associated memory impairments remain elusive. Memory consolidation requires epigenetic transcriptional regulation of genes in the hippocampus; therefore, we aimed to determine how epigenetic DNA methylation mechanisms affect learning-induced transcription of memory-permissive genes in the epileptic hippocampus. Using the kainate rodent model of TLE and focusing on the brain-derived neurotrophic factor (Bdnf) gene as a candidate of DNA methylation-mediated transcription, we analyzed DNA methylation levels in epileptic rats following learning. After detection of aberrant DNA methylation at the Bdnf gene, we investigated functional effects of altered DNA methylation on hippocampus-dependent memory formation in our TLE rodent model. We found that behaviorally driven BdnfDNA methylation was associated with hippocampus-dependent memory deficits. Bisulfite sequencing revealed that decreased BdnfDNA methylation levels strongly correlated with abnormally high levels of BdnfmRNA in the epileptic hippocampus during memory consolidation. Methyl supplementation via methionine (Met) increased BdnfDNA methylation and reduced BdnfmRNA levels in the epileptic hippocampus during memory consolidation. Met administration reduced interictal spike activity, increased theta rhythm power, and reversed memory deficits in epileptic animals. The rescue effect of Met treatment on learning-induced BdnfDNA methylation, Bdnf gene expression, and hippocampus-dependent memory, were attenuated by DNA methyltransferase blockade. Our findings suggest that manipulation of DNA methylation in the epileptic hippocampus should be considered as a viable treatment option to ameliorate memory impairments associated with TLE.

  2. DNA origami metallized site specifically to form electrically conductive nanowires.

    PubMed

    Pearson, Anthony C; Liu, Jianfei; Pound, Elisabeth; Uprety, Bibek; Woolley, Adam T; Davis, Robert C; Harb, John N

    2012-09-06

    DNA origami is a promising tool for use as a template in the design and fabrication of nanoscale structures. The ability to engineer selected staple strands on a DNA origami structure provides a high density of addressable locations across the structure. Here we report a method using site-specific attachment of gold nanoparticles to modified staple strands and subsequent metallization to fabricate conductive wires from DNA origami templates. We have modified DNA origami structures by lengthening each staple strand in select regions with a 10-base nucleotide sequence and have attached DNA-modified gold nanoparticles to the lengthened staple strands via complementary base-pairing. The high density of extended staple strands allowed the gold nanoparticles to pack tightly in the modified regions of the DNA origami, where the measured median gap size between neighboring particles was 4.1 nm. Gold metallization processes were optimized so that the attached gold nanoparticles grew until gaps between particles were filled and uniform continuous nanowires were formed. Finally, electron beam lithography was used to pattern electrodes in order to measure the electrical conductivity of metallized DNA origami, which showed an average resistance of 2.4 kΩ per metallized structure.

  3. DNA-Templated Fabrication of Arbitrary-Structured Porous Carbon Materials

    DTIC Science & Technology

    2016-07-11

    same as the DNA nanostructure. Conductive AFM measurement shows that the carbon nanostructures are electrically conductive. These research activities ...surface chemistry. These research activities revealed a rich These research activities have resulted in 24 peer reviewed journal articles (23 published...of the intrinsic wettability of graphitic materials; and (c) high temperature carbonization of DNA. These activities are detailed below (Note that

  4. DNA Shape Dominates Sequence Affinity in Nucleosome Formation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2014-10-01

    Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

  5. Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

    PubMed

    Berglund, Anna-Karin; Navarrete, Clara; Engqvist, Martin K M; Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W; Gustafsson, Claes M; Falkenberg, Maria; Clausen, Anders R

    2017-02-01

    Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

  6. RPA coordinates DNA end resection and prevents formation of DNA hairpins.

    PubMed

    Chen, Huan; Lisby, Michael; Symington, Lorraine S

    2013-05-23

    Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

  7. Long-range energy transfer in self-assembled quantum dot-DNA cascades

    NASA Astrophysics Data System (ADS)

    Goodman, Samuel M.; Siu, Albert; Singh, Vivek; Nagpal, Prashant

    2015-11-01

    The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films.The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr04778a

  8. Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

    PubMed

    Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

    2017-09-01

    Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

  9. Small terminase couples viral DNA-binding to genome-packaging ATPase activity

    PubMed Central

    Roy, Ankoor; Bhardwaj, Anshul; Datta, Pinaki; Lander, Gabriel C.; Cingolani, Gino

    2012-01-01

    SUMMARY Packaging of viral genomes into empty procapsids is powered by a large DNA-packaging motor. In most viruses, this machine is composed of a large (L) and a small (S) terminase subunit complexed with a dodecamer of portal protein. Here, we describe the 1.75 Å crystal structure of the bacteriophage P22 S-terminase in a nonameric conformation. The structure presents a central channel ~23 Å in diameter, sufficiently large to accommodate hydrated B-DNA. The last 23 residues of S-terminase are essential for binding to DNA and assembly to L-terminase. Upon binding to its own DNA, S-terminase functions as a specific activator of L-terminase ATPase activity. The DNA-dependent stimulation of ATPase activity thus rationalizes the exclusive specificity of genome-packaging motors for viral DNA in the crowd of host DNA, ensuring fidelity of packaging and avoiding wasteful ATP hydrolysis. This posits a model for DNA-dependent activation of genome-packaging motors of general interest in virology. PMID:22771211

  10. Structure-guided Mutational Analysis of the Nucleotidyltransferase Domain of Escherichia coli DNA Ligase (LigA).

    PubMed

    Wang, Li Kai; Zhu, Hui; Shuman, Stewart

    2009-03-27

    NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria, where they are essential for growth and present attractive targets for antimicrobial drug discovery. LigA has a distinctive modular structure in which a nucleotidyltransferase catalytic domain is flanked by an upstream NMN-binding module and by downstream OB-fold, zinc finger, helix-hairpin-helix, and BRCT domains. Here we conducted a structure-function analysis of the nucleotidyltransferase domain of Escherichia coli LigA, guided by the crystal structure of the LigA-DNA-adenylate intermediate. We tested the effects of 29 alanine and conservative mutations at 15 amino acids on ligase activity in vitro and in vivo. We thereby identified essential functional groups that coordinate the reactive phosphates (Arg(136)), contact the AMP adenine (Lys(290)), engage the phosphodiester backbone flanking the nick (Arg(218), Arg(308), Arg(97) plus Arg(101)), or stabilize the active domain fold (Arg(171)). Finer analysis of the mutational effects revealed step-specific functions for Arg(136), which is essential for the reaction of LigA with NAD(+) to form the covalent ligase-AMP intermediate (step 1) and for the transfer of AMP to the nick 5'-PO(4) to form the DNA-adenylate intermediate (step 2) but is dispensable for phosphodiester formation at a preadenylylated nick (step 3).

  11. Mobile small RNAs regulate genome-wide DNA methylation.

    PubMed

    Lewsey, Mathew G; Hardcastle, Thomas J; Melnyk, Charles W; Molnar, Attila; Valli, Adrián; Urich, Mark A; Nery, Joseph R; Baulcombe, David C; Ecker, Joseph R

    2016-02-09

    RNA silencing at the transcriptional and posttranscriptional levels regulates endogenous gene expression, controls invading transposable elements (TEs), and protects the cell against viruses. Key components of the mechanism are small RNAs (sRNAs) of 21-24 nt that guide the silencing machinery to their nucleic acid targets in a nucleotide sequence-specific manner. Transcriptional gene silencing is associated with 24-nt sRNAs and RNA-directed DNA methylation (RdDM) at cytosine residues in three DNA sequence contexts (CG, CHG, and CHH). We previously demonstrated that 24-nt sRNAs are mobile from shoot to root in Arabidopsis thaliana and confirmed that they mediate DNA methylation at three sites in recipient cells. In this study, we extend this finding by demonstrating that RdDM of thousands of loci in root tissues is dependent upon mobile sRNAs from the shoot and that mobile sRNA-dependent DNA methylation occurs predominantly in non-CG contexts. Mobile sRNA-dependent non-CG methylation is largely dependent on the DOMAINS REARRANGED METHYLTRANSFERASES 1/2 (DRM1/DRM2) RdDM pathway but is independent of the CHROMOMETHYLASE (CMT)2/3 DNA methyltransferases. Specific superfamilies of TEs, including those typically found in gene-rich euchromatic regions, lose DNA methylation in a mutant lacking 22- to 24-nt sRNAs (dicer-like 2, 3, 4 triple mutant). Transcriptome analyses identified a small number of genes whose expression in roots is associated with mobile sRNAs and connected to DNA methylation directly or indirectly. Finally, we demonstrate that sRNAs from shoots of one accession move across a graft union and target DNA methylation de novo at normally unmethylated sites in the genomes of root cells from a different accession.

  12. The Dynamics of Entangled DNA Networks using Single-Molecule Methods

    NASA Astrophysics Data System (ADS)

    Chapman, Cole David

    Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

  13. The yeast Fun30 and human SMARCAD1 chromatin remodelers promote DNA end resection

    PubMed Central

    Costelloe, Thomas; Louge, Raphaël; Tomimatsu, Nozomi; Mukherjee, Bipasha; Martini, Emmanuelle; Khadaroo, Basheer; Dubois, Kenny; Wiegant, Wouter W.; Thierry, Agnès; Burma, Sandeep; van Attikum, Haico; Llorente, Bertrand

    2012-01-01

    Several homology-dependent pathways can repair potentially lethal DNA double-strand breaks (DSBs). The first step common to all homologous recombination reactions is the 5′-3′ degradation of DSB ends that yields 3′ single-stranded DNA (ssDNA) required for loading of checkpoint and recombination proteins. The Mre11-Rad50-Xrs2/NBS1 complex and Sae2/CtIP initiate end resection while long-range resection depends on the exonuclease Exo1 or the helicase-topoisomerase complex Sgs1-Top3-Rmi1 with the endonuclease Dna21-6. DSBs occur in the context of chromatin, but how the resection machinery navigates through nucleosomal DNA is a process that is not well understood7. Here, we show that the yeast S. cerevisiae Fun30 protein and its human counterpart SMARCAD18, two poorly characterized ATP-dependent chromatin remodelers of the Snf2 ATPase family, are novel factors that are directly involved in the DSB response. Fun30 physically associates with DSB ends and directly promotes both Exo1- and Sgs1-dependent end resection through a mechanism involving its ATPase activity. The function of Fun30 in resection facilitates repair of camptothecin (CPT)-induced DNA lesions, and it becomes dispensable when Exo1 is ectopically overexpressed. Interestingly, SMARCAD1 is also recruited to DSBs and the kinetics of recruitment is similar to that of Exo1. Loss of SMARCAD1 impairs end resection, recombinational DNA repair and renders cells hypersensitive to DNA damage resulting from CPT or PARP inhibitor treatments. These findings unveil an evolutionarily conserved role for the Fun30 and SMARCAD1 chromatin remodelers in controlling end resection, homologous recombination and genome stability in the context of chromatin. PMID:22960744

  14. Sequence periodicity in nucleosomal DNA and intrinsic curvature

    PubMed Central

    2010-01-01

    Background Most eukaryotic DNA contained in the nucleus is packaged by wrapping DNA around histone octamers. Histones are ubiquitous and bind most regions of chromosomal DNA. In order to achieve smooth wrapping of the DNA around the histone octamer, the DNA duplex should be able to deform and should possess intrinsic curvature. The deformability of DNA is a result of the non-parallelness of base pair stacks. The stacking interaction between base pairs is sequence dependent. The higher the stacking energy the more rigid the DNA helix, thus it is natural to expect that sequences that are involved in wrapping around the histone octamer should be unstacked and possess intrinsic curvature. Intrinsic curvature has been shown to be dictated by the periodic recurrence of certain dinucleotides. Several genome-wide studies directed towards mapping of nucleosome positions have revealed periodicity associated with certain stretches of sequences. In the current study, these sequences have been analyzed with a view to understand their sequence-dependent structures. Results Higher order DNA structures and the distribution of molecular bend loci associated with 146 base nucleosome core DNA sequence from C. elegans and chicken have been analyzed using the theoretical model for DNA curvature. The curvature dispersion calculated by cyclically permuting the sequences revealed that the molecular bend loci were delocalized throughout the nucleosome core region and had varying degrees of intrinsic curvature. Conclusions The higher order structures associated with nucleosomes of C.elegans and chicken calculated from the sequences revealed heterogeneity with respect to the deviation of the DNA axis. The results points to the possibility of context dependent curvature of varying degrees to be associated with nucleosomal DNA. PMID:20487515

  15. Physical interaction between bacterial heat shock protein (Hsp) 90 and Hsp70 chaperones mediates their cooperative action to refold denatured proteins.

    PubMed

    Nakamoto, Hitoshi; Fujita, Kensaku; Ohtaki, Aguru; Watanabe, Satoru; Narumi, Shoichi; Maruyama, Takahiro; Suenaga, Emi; Misono, Tomoko S; Kumar, Penmetcha K R; Goloubinoff, Pierre; Yoshikawa, Hirofumi

    2014-02-28

    In eukaryotes, heat shock protein 90 (Hsp90) is an essential ATP-dependent molecular chaperone that associates with numerous client proteins. HtpG, a prokaryotic homolog of Hsp90, is essential for thermotolerance in cyanobacteria, and in vitro it suppresses the aggregation of denatured proteins efficiently. Understanding how the non-native client proteins bound to HtpG refold is of central importance to comprehend the essential role of HtpG under stress. Here, we demonstrate by yeast two-hybrid method, immunoprecipitation assays, and surface plasmon resonance techniques that HtpG physically interacts with DnaJ2 and DnaK2. DnaJ2, which belongs to the type II J-protein family, bound DnaK2 or HtpG with submicromolar affinity, and HtpG bound DnaK2 with micromolar affinity. Not only DnaJ2 but also HtpG enhanced the ATP hydrolysis by DnaK2. Although assisted by the DnaK2 chaperone system, HtpG enhanced native refolding of urea-denatured lactate dehydrogenase and heat-denatured glucose-6-phosphate dehydrogenase. HtpG did not substitute for DnaJ2 or GrpE in the DnaK2-assisted refolding of the denatured substrates. The heat-denatured malate dehydrogenase that did not refold by the assistance of the DnaK2 chaperone system alone was trapped by HtpG first and then transferred to DnaK2 where it refolded. Dissociation of substrates from HtpG was either ATP-dependent or -independent depending on the substrate, indicating the presence of two mechanisms of cooperative action between the HtpG and the DnaK2 chaperone system.

  16. Smooth DNA transport through a narrowed pore geometry.

    PubMed

    Carson, Spencer; Wilson, James; Aksimentiev, Aleksei; Wanunu, Meni

    2014-11-18

    Voltage-driven transport of double-stranded DNA through nanoscale pores holds much potential for applications in quantitative molecular biology and biotechnology, yet the microscopic details of translocation have proven to be challenging to decipher. Earlier experiments showed strong dependence of transport kinetics on pore size: fast regular transport in large pores (> 5 nm diameter), and slower yet heterogeneous transport time distributions in sub-5 nm pores, which imply a large positional uncertainty of the DNA in the pore as a function of the translocation time. In this work, we show that this anomalous transport is a result of DNA self-interaction, a phenomenon that is strictly pore-diameter dependent. We identify a regime in which DNA transport is regular, producing narrow and well-behaved dwell-time distributions that fit a simple drift-diffusion theory. Furthermore, a systematic study of the dependence of dwell time on DNA length reveals a single power-law scaling of 1.37 in the range of 35-20,000 bp. We highlight the resolution of our nanopore device by discriminating via single pulses 100 and 500 bp fragments in a mixture with >98% accuracy. When coupled to an appropriate sequence labeling method, our observation of smooth DNA translocation can pave the way for high-resolution DNA mapping and sizing applications in genomics.

  17. Mhr1p-dependent concatemeric mitochondrial DNA formation for generating yeast mitochondrial homoplasmic cells.

    PubMed

    Ling, Feng; Shibata, Takehiko

    2004-01-01

    Mitochondria carry many copies of mitochondrial DNA (mtDNA), but mt-alleles quickly segregate during mitotic growth through unknown mechanisms. Consequently, all mtDNA copies are often genetically homogeneous within each individual ("homoplasmic"). Our previous study suggested that tandem multimers ("concatemers") formed mainly by the Mhr1p (a yeast nuclear gene-encoded mtDNA-recombination protein)-dependent pathway are required for mtDNA partitioning into buds with concomitant monomerization. The transmission of a few randomly selected clones (as concatemers) of mtDNA into buds is a possible mechanism to establish homoplasmy. The current study provides evidence for this hypothesis as follows: the overexpression of MHR1 accelerates mt-allele-segregation in growing heteroplasmic zygotes, and mhr1-1 (recombination-deficient) causes its delay. The mt-allele-segregation rate correlates with the abundance of concatemers, which depends on Mhr1p. In G1-arrested cells, concatemeric mtDNA was labeled by [14C]thymidine at a much higher density than monomers, indicating concatemers as the immediate products of mtDNA replication, most likely in a rolling circle mode. After releasing the G1 arrest in the absence of [14C]thymidine, the monomers as the major species in growing buds of dividing cells bear a similar density of 14C as the concatemers in the mother cells, indicating that the concatemers in mother cells are the precursors of the monomers in buds.

  18. Aprataxin resolves adenylated RNA–DNA junctions to maintain genome integrity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tumbale, Percy; Williams, Jessica S.; Schellenberg, Matthew J.

    2013-12-22

    Faithful maintenance and propagation of eukaryotic genomes is ensured by three-step DNA ligation reactions used by ATP-dependent DNA ligases. Paradoxically, when DNA ligases encounter nicked DNA structures with abnormal DNA termini, DNA ligase catalytic activity can generate and/or exacerbate DNA damage through abortive ligation that produces chemically adducted, toxic 5'-adenylated (5'-AMP) DNA lesions. Aprataxin (APTX) reverses DNA adenylation but the context for deadenylation repair is unclear. Here we examine the importance of APTX to RNase-H2-dependent excision repair (RER) of a lesion that is very frequently introduced into DNA, a ribonucleotide. We show that ligases generate adenylated 5' ends containing amore » ribose characteristic of RNase H2 incision. APTX efficiently repairs adenylated RNA–DNA, and acting in an RNA–DNA damage response (RDDR), promotes cellular survival and prevents S-phase checkpoint activation in budding yeast undergoing RER. Structure–function studies of human APTX–RNA–DNA–AMP–Zn complexes define a mechanism for detecting and reversing adenylation at RNA–DNA junctions. This involves A-form RNA binding, proper protein folding and conformational changes, all of which are affected by heritable APTX mutations in ataxia with oculomotor apraxia 1. Together, these results indicate that accumulation of adenylated RNA–DNA may contribute to neurological disease.« less

  19. ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage

    PubMed Central

    Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

    2014-01-01

    The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein–protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage. PMID:24675884

  20. ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage.

    PubMed

    Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

    2014-01-01

    The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein-protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage.

  1. CgII cleaves DNA using a mechanism distinct from other ATP-dependent restriction endonucleases

    PubMed Central

    Toliusis, Paulius; Silanskas, Arunas; Szczelkun, Mark D.

    2017-01-01

    Abstract The restriction endonuclease CglI from Corynebacterium glutamicum recognizes an asymmetric 5′-GCCGC-3′ site and cleaves the DNA 7 and 6/7 nucleotides downstream on the top and bottom DNA strands, respectively, in an NTP-hydrolysis dependent reaction. CglI is composed of two different proteins: an endonuclease (R.CglI) and a DEAD-family helicase-like ATPase (H.CglI). These subunits form a heterotetrameric complex with R2H2 stoichiometry. However, the R2H2·CglI complex has only one nuclease active site sufficient to cut one DNA strand suggesting that two complexes are required to introduce a double strand break. Here, we report studies to evaluate the DNA cleavage mechanism of CglI. Using one- and two-site circular DNA substrates we show that CglI does not require two sites on the same DNA for optimal catalytic activity. However, one-site linear DNA is a poor substrate, supporting a mechanism where CglI complexes must communicate along the one-dimensional DNA contour before cleavage is activated. Based on experimental data, we propose that adenosine triphosphate (ATP) hydrolysis by CglI produces translocation on DNA preferentially in a downstream direction from the target, although upstream translocation is also possible. Our results are consistent with a mechanism of CglI action that is distinct from that of other ATP-dependent restriction-modification enzymes. PMID:28854738

  2. Unique Helicase Determinants in the Essential Conjugative TraI Factor from Salmonella enterica Serovar Typhimurium Plasmid pCU1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLaughlin, K. J.; Nash, R. P.; Redinbo, M. R.

    The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. Inmore » this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity.« less

  3. Synthesis and characterization of nitrile functionalized silver(I)-N-heterocyclic carbene complexes: DNA binding, cleavage studies, antibacterial properties and mosquitocidal activity against the dengue vector, Aedes albopictus.

    PubMed

    Asekunowo, Patrick O; Haque, Rosenani A; Razali, Mohd R; Avicor, Silas W; Wajidi, Mustafa F F

    2018-04-25

    A series of four benzimidazolium based nitrile-functionalized mononuclear-Ag(I)-N-heterocyclic carbene and binuclear-Ag(I)-N-heterocyclic carbene (Ag(I)-NHC) hexafluorophosphate complexes (5b-8b) were synthesized by reacting the corresponding hexafluorophosphate salts (1b-4b) with Ag 2 O in acetonitrile, respectively. These compounds were characterized by 1 H NMR, 13 C NMR, IR, UV-visible spectroscopic techniques, elemental analyses and molar conductivity. Additionally, 8b was structurally characterized by single crystal X-ray diffraction technique. Preliminary in vitro antibacterial evaluation was conducted for all the compounds against two standard bacteria; gram-positive (Staphylococcus aureus) and gram-negative (Escherichia coli) bacterial strains. Most of the Ag(I)-NHC complexes (5b-8b) showed moderate to good antibacterial activity with MIC values in the range of 12.5-100 μg/mL. Especially, compound 8b exhibited promising anti-Staphylococcus aureus activity with a low MIC value (12.5 μg/mL). However, all the hexafluorophosphate salts (1b-4b) were inactive against the bacteria strains. The preliminary interactive investigation revealed that the most active compound, 8b, could effectively intercalate into DNA to form 8b-DNA complex which shows a better binding ability for DNA (K b  = 3.627 × 10 6 ) than the complexes 5b-7b (2.177 × 10 6 , 8.672 × 10 5 and 6.665 × 10 5 , respectively). Nuclease activity of the complexes on plasmid DNA and Aedes albopictus genomic DNA was time-dependent, although minimal. The complexes were larvicidal to the mosquito, with 5b, 6b and 8b being highly active. Developmental progression from the larval to the adult stage was affected by the complexes, progressively being toxic to the insect's development with increasing concentration. These indicate the potential use of these complexes as control agents against bacteria and the dengue mosquito Ae. albopictus. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  4. Sequence-Dependent Persistence Length of Long DNA

    NASA Astrophysics Data System (ADS)

    Chuang, Hui-Min; Reifenberger, Jeffrey G.; Cao, Han; Dorfman, Kevin D.

    2017-12-01

    Using a high-throughput genome-mapping approach, we obtained circa 50 million measurements of the extension of internal human DNA segments in a 41 nm ×41 nm nanochannel. The underlying DNA sequences, obtained by mapping to the reference human genome, are 2.5-393 kilobase pairs long and contain percent GC contents between 32.5% and 60%. Using Odijk's theory for a channel-confined wormlike chain, these data reveal that the DNA persistence length increases by almost 20% as the percent GC content increases. The increased persistence length is rationalized by a model, containing no adjustable parameters, that treats the DNA as a statistical terpolymer with a sequence-dependent intrinsic persistence length and a sequence-independent electrostatic persistence length.

  5. DNA methylation in memory formation: Emerging insights

    PubMed Central

    Heyward, Frankie D.; Sweatt, J. David

    2016-01-01

    The establishment of synaptic plasticity and long-term memory requires lasting cellular and molecular modifications that, as a whole, must endure despite the rapid turnover of their constituent parts. Such a molecular feat must be mediated by a stable, self-perpetuating, cellular information storage mechanism. DNA methylation, being the archetypal cellular information storage mechanism, has been heavily implicated as being necessary for stable activity-dependent transcriptional alterations within the central nervous system (CNS). This review details the foundational discoveries from both gene-targeted, as well as whole-genome sequencing, studies that have successfully brought DNA methylation to our attention as a chief regulator of activity- and experience-dependent transcriptional alterations within the CNS. We present a hypothetical framework with which the disparate experimental findings dealing with distinct manipulations of the DNA methylation, and their effect on memory, might be resolved while taking into account the unique impact activity-dependent alterations in DNA methylation potentially have on both memory promoting and memory-suppressing gene expression. And last, we discuss potential avenues for future inquiry into the role of DNA methylation during remote memory formation. PMID:25832671

  6. DNA assisted self-assembly of PAMAM dendrimers.

    PubMed

    Mandal, Taraknath; Kumar, Mattaparthi Venkata Satish; Maiti, Prabal K

    2014-10-09

    We report DNA assisted self-assembly of polyamidoamine (PAMAM) dendrimers using all atom Molecular Dynamics (MD) simulations and present a molecular level picture of a DNA-linked PAMAM dendrimer nanocluster, which was first experimentally reported by Choi et al. (Nano Lett., 2004, 4, 391-397). We have used single stranded DNA (ssDNA) to direct the self-assembly process. To explore the effect of pH on this mechanism, we have used both the protonated (low pH) and nonprotonated (high pH) dendrimers. In all cases studied here, we observe that the DNA strand on one dendrimer unit drives self-assembly as it binds to the complementary DNA strand present on the other dendrimer unit, leading to the formation of a DNA-linked dendrimer dimeric complex. However, this binding process strongly depends on the charge of the dendrimer and length of the ssDNA. We observe that the complex with a nonprotonated dendrimer can maintain a DNA length dependent inter-dendrimer distance. In contrast, for complexes with a protonated dendrimer, the inter-dendrimer distance is independent of the DNA length. We attribute this observation to the electrostatic complexation of a negatively charged DNA strand with the positively charged protonated dendrimer.

  7. Unraveling DNA dynamics using atomic force microscopy.

    PubMed

    Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio

    2011-01-01

    The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.

  8. DNA damage in haemocytes and midgut gland cells of Steatoda grossa (Theridiidae) spiders exposed to food contaminated with cadmium.

    PubMed

    Stalmach, Monika; Wilczek, Grażyna; Wilczek, Piotr; Skowronek, Magdalena; Mędrzak, Monika

    2015-03-01

    The aim of this study was to assess the genotoxic effects of Cd on haemocytes and midgut gland cells of web-building spiders, Steatoda grossa (Theridiidae), exposed to the metal under laboratory conditions. Analyzes were conducted on adult females and males, fed for four weeks with cadmium-contaminated Drosophila hydei flies, grown on a medium suplemented with 0.25 mM CdCl2. The comet assay, providing a quantitative measure of DNA strand breaks, was used to evaluate the DNA damage caused by the metal. Cadmium content was measured in whole spider bodies by the AAS method. Metal body burden was significantly lower in females (0.25 µgg(-1) dry weight) than in males (3.03 µgg(-1) dry weight), suggesting that females may have more effective mechanisms controlling the uptake of metal, via the digestive tract, or its elimination from the body. Irrespectively of sex, spiders fed prey contaminated with cadmium showed significantly higher values of comet parameters: tail DNA (TDNA), tail length (TL) and olive tail moment (OTM), in comparison with the control. In midgut gland cells, the level of DNA damage was higher for males than females, while in haemocytes the genotoxic effect of cadmium was greater in females. The obtained results indicate that in spiders cadmium displays strong genotoxic effects and may cause DNA damage even at low concentrations, however the severity of damage seems to be sex- and internal organ-dependent. The comet assay can be considered a sensitive tool for measuring the deleterious effect of cadmium on DNA integrity in spiders. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. A dual switch controls bacterial enhancer-dependent transcription

    PubMed Central

    Wiesler, Simone C.; Burrows, Patricia C.; Buck, Martin

    2012-01-01

    Bacterial RNA polymerases (RNAPs) are targets for antibiotics. Myxopyronin binds to the RNAP switch regions to block structural rearrangements needed for formation of open promoter complexes. Bacterial RNAPs containing the major variant σ54 factor are activated by enhancer-binding proteins (bEBPs) and transcribe genes whose products are needed in pathogenicity and stress responses. We show that (i) enhancer-dependent RNAPs help Escherichia coli to survive in the presence of myxopyronin, (ii) enhancer-dependent RNAPs partially resist inhibition by myxopyronin and (iii) ATP hydrolysis catalysed by bEBPs is obligatory for functional interaction of the RNAP switch regions with the transcription start site. We demonstrate that enhancer-dependent promoters contain two barriers to full DNA opening, allowing tight regulation of transcription initiation. bEBPs engage in a dual switch to (i) allow propagation of nucleated DNA melting from an upstream DNA fork junction and (ii) complete the formation of the transcription bubble and downstream DNA fork junction at the RNA synthesis start site, resulting in switch region-dependent RNAP clamp closure and open promoter complex formation. PMID:22965125

  10. Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

    PubMed

    Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

    2017-09-12

    Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Presequence-Independent Mitochondrial Import of DNA Ligase Facilitates Establishment of Cell Lines with Reduced mtDNA Copy Number

    PubMed Central

    Spadafora, Domenico; Kozhukhar, Natalia; Alexeyev, Mikhail F.

    2016-01-01

    Due to the essential role played by mitochondrial DNA (mtDNA) in cellular physiology and bioenergetics, methods for establishing cell lines with altered mtDNA content are of considerable interest. Here, we report evidence for the existence in mammalian cells of a novel, low- efficiency, presequence-independent pathway for mitochondrial protein import, which facilitates mitochondrial uptake of such proteins as Chlorella virus ligase (ChVlig) and Escherichia coli LigA. Mouse cells engineered to depend on this pathway for mitochondrial import of the LigA protein for mtDNA maintenance had severely (up to >90%) reduced mtDNA content. These observations were used to establish a method for the generation of mouse cell lines with reduced mtDNA copy number by, first, transducing them with a retrovirus encoding LigA, and then inactivating in these transductants endogenous Lig3 with CRISPR-Cas9. Interestingly, mtDNA depletion to an average level of one copy per cell proceeds faster in cells engineered to maintain mtDNA at low copy number. This makes a low-mtDNA copy number phenotype resulting from dependence on mitochondrial import of DNA ligase through presequence-independent pathway potentially useful for rapidly shifting mtDNA heteroplasmy through partial mtDNA depletion. PMID:27031233

  12. SHPRH regulates rRNA transcription by recognizing the histone code in an mTOR-dependent manner.

    PubMed

    Lee, Deokjae; An, Jungeun; Park, Young-Un; Liaw, Hungjiun; Woodgate, Roger; Park, Jun Hong; Myung, Kyungjae

    2017-04-25

    Many DNA repair proteins have additional functions other than their roles in DNA repair. In addition to catalyzing PCNA polyubiquitylation in response to the stalling of DNA replication, SHPRH has the additional function of facilitating rRNA transcription by localizing to the ribosomal DNA (rDNA) promoter in the nucleoli. SHPRH was recruited to the rDNA promoter using its plant homeodomain (PHD), which interacts with histone H3 when the fourth lysine of H3 is not trimethylated. SHPRH enrichment at the rDNA promoter was inhibited by cell starvation, by treatment with actinomycin D or rapamycin, or by depletion of CHD4. SHPRH also physically interacted with the RNA polymerase I complex. Taken together, we provide evidence that SHPRH functions in rRNA transcription through its interaction with histone H3 in a mammalian target of rapamycin (mTOR)-dependent manner.

  13. ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

    PubMed

    Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

    2017-10-05

    Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

  14. Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces

    NASA Astrophysics Data System (ADS)

    Elder, Robert M.

    Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.

  15. Inhibition of DNA-dependent protein kinase catalytic subunit by small molecule inhibitor NU7026 sensitizes human leukemic K562 cells to benzene metabolite-induced apoptosis.

    PubMed

    You, Hao; Kong, Meng-meng; Wang, Li-ping; Xiao, Xiao; Liao, Han-lin; Bi, Zhuo-yue; Yan, Hong; Wang, Hong; Wang, Chun-hong; Ma, Qiang; Liu, Yan-qun; Bi, Yong-yi

    2013-02-01

    Benzene is an established leukotoxin and leukemogen in humans. We have previously reported that exposure of workers to benzene and to benzene metabolite hydroquinone in cultured cells induced DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to mediate the cellular response to DNA double strand break (DSB) caused by DNA-damaging metabolites. In this study, we used a new, small molecule, a selective inhibitor of DNA-PKcs, 2-(morpholin-4-yl)-benzo[h]chomen-4-one (NU7026), as a probe to analyze the molecular events and pathways in hydroquinone-induced DNA DSB repair and apoptosis. Inhibition of DNA-PKcs by NU7026 markedly potentiated the apoptotic and growth inhibitory effects of hydroquinone in proerythroid leukemic K562 cells in a dose-dependent manner. Treatment with NU7026 did not alter the production of reactive oxygen species and oxidative stress by hydroquinone but repressed the protein level of DNA-PKcs and blocked the induction of the kinase mRNA and protein expression by hydroquinone. Moreover, hydroquinone increased the phosphorylation of Akt to activate Akt, whereas co-treatment with NU7026 prevented the activation of Akt by hydroquinone. Lastly, hydroquinone and NU7026 exhibited synergistic effects on promoting apoptosis by increasing the protein levels of pro-apoptotic proteins Bax and caspase-3 but decreasing the protein expression of anti-apoptotic protein Bcl-2. Taken together, the findings reveal a central role of DNA-PKcs in hydroquinone-induced hematotoxicity in which it coordinates DNA DSB repair, cell cycle progression, and apoptosis to regulate the response to hydroquinone-induced DNA damage.

  16. Densely ionizing radiation affects DNA methylation of selective LINE-1 elements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Prior, Sara; Miousse, Isabelle R.

    Long Interspersed Nucleotide Element 1 (LINE-1) retrotransposons are heavily methylated and are the most abundant transposable elements in mammalian genomes. Here, we investigated the differential DNA methylation within the LINE-1 under normal conditions and in response to environmentally relevant doses of sparsely and densely ionizing radiation. We demonstrate that DNA methylation of LINE-1 elements in the lungs of C57BL6 mice is dependent on their evolutionary age, where the elder age of the element is associated with the lower extent of DNA methylation. Exposure to 5-aza-2′-deoxycytidine and methionine-deficient diet affected DNA methylation of selective LINE-1 elements in an age- and promotermore » type-dependent manner. Exposure to densely IR, but not sparsely IR, resulted in DNA hypermethylation of older LINE-1 elements, while the DNA methylation of evolutionary younger elements remained mostly unchanged. We also demonstrate that exposure to densely IR increased mRNA and protein levels of LINE-1 via the loss of the histone H3K9 dimethylation and an increase in the H3K4 trimethylation at the LINE-1 5′-untranslated region, independently of DNA methylation. Our findings suggest that DNA methylation is important for regulation of LINE-1 expression under normal conditions, but histone modifications may dictate the transcriptional activity of LINE-1 in response to exposure to densely IR. - Highlights: • DNA methylation of LINE-1 elements is dependent on their evolutionary age. • Densely ionizing radiation affects DNA methylation of selective LINE-1 elements. • Radiation-induced reactivation of LINE-1 is DNA methylation-independent. • Histone modifications dictate the transcriptional activity of LINE-1.« less

  17. Translocation of double strand DNA into a biological nanopore

    NASA Astrophysics Data System (ADS)

    Chatkaew, Sunita; Mlayeh, Lamia; Leonetti, Marc; Homble, Fabrice

    2009-03-01

    Translocation of double strand DNA across a unique mitochondrial biological nanopore (VDAC) is observed by an electrophysiological method. Characteristics of opened and sub-conductance states of VDAC are studied. When the applied electric potential is beyond ± 20 mV, VDAC transits to a sub-conductance state. Plasmids (circular double strand DNA) with a diameter greater than that of the channel shows the current reduction into the channel during the interaction but the state with zero-current is not observed. On the contrary, the interaction of linear double strand DNA with the channel shows the current reduction along with the zero-current state. These show the passages of linear double strand DNA across the channel and the electrostatic effect due to the surface charges of double strand DNA and channel for circular and linear double strand DNA.

  18. A DNA enzyme with Mg(2+)-Dependent RNA Phosphoesterase Activity

    NASA Technical Reports Server (NTRS)

    Breaker, Ronald R.; Joyce, Gerald F.

    1995-01-01

    Previously we demonstrated that DNA can act as an enzyme in the Pb(2+)-dependent cleavage of an RNA phosphoester. This is a facile reaction, with an uncatalyzed rate for a typical RNA phosphoester of approx. 10(exp -4)/ min in the presence of 1 mM Pb(OAc)2 at pH 7.0 and 23 C. The Mg(2+) - dependent reaction is more difficult, with an uncatalyzed rate of approx. 10(exp -7)/ min under comparable conditions. Mg(2+) - dependent cleavage has special relevance to biology because it is compatible with intracellular conditions. Using in vitro selection, we sought to develop a family of phosphoester-cleaving DNA enzymes that operate in the presence of various divalent metals, focusing particularly on the Mg(2+) - dependent reaction. Results: We generated a population of greater than 10(exp 13) DNAs containing 40 random nucleotides and carried out repeated rounds of selective amplification, enriching for molecules that cleave a target RNA phosphoester in the presence of 1 mM Mg(2+), Mn(2+), Zn(2+) or Pb(2+). Examination of individual clones from the Mg(2+) lineage after the sixth round revealed a catalytic motif comprised of a three-stem junction.This motif was partially randomized and subjected to seven additional rounds of selective amplification, yielding catalysts with a rate of 0.01/ min. The optimized DNA catalyst was divided into separate substrate and enzyme domains and shown to have a similar level of activity under multiple turnover conditions. Conclusions: We have generated a Mg(2+) - dependent DNA enzyme that cleaves a target RNA phosphoester with a catalytic rate approx. 10(exp 5) - fold greater than that of the uncatalyzed reaction. This activity is compatible with intracellular conditions, raising the possibility that DNA enzymes might be made to operate in vivo.

  19. Exposure-dependent incorporation of trifluridine into DNA of tumors and white blood cells in tumor-bearing mouse.

    PubMed

    Yamashita, Fumiaki; Komoto, Ikumi; Oka, Hiroaki; Kuwata, Keizo; Takeuchi, Mayuko; Nakagawa, Fumio; Yoshisue, Kunihiro; Chiba, Masato

    2015-08-01

    Trifluridine (TFT) is an antitumor component of a novel nucleoside antitumor agent, TAS-102, which consists of TFT and tipiracil hydrochloride (thymidine phosphorylase inhibitor). Incorporation of TFT into DNA is a probable mechanism of antitumor activity and hematological toxicity. The objective of this study was to examine the TFT incorporation into tumor- and white blood cell-DNA, and to elucidate the mechanism of TFT-related effect and toxicity. TFT effect on the colony formation of mouse bone marrow cells was also investigated. Pharmacokinetics of TFT was determined in nude mice after single oral administration of TAS-102, while the antitumor activity and body weight change were evaluated in the tumor-bearing nude mice after multiple oral administrations for 2 weeks. TFT concentrations in the blood- and tumor-DNA were determined by LC/MS/MS. The colony formation was evaluated by CFU-GM assay. TFT systemic exposure in plasma increased dose-dependently. The tumor growth rate and body weight gain decreased dose-dependently, but TFT concentrations in the DNA of tumor tissues and white blood cells increased dose-dependently. TFT inhibited colony formation of bone marrow cells in a concentration-dependent manner. A significant relationship between systemic exposure of TFT and pharmacological effects including the antitumor activity and body weight change was well explained by the TFT incorporation into DNA. TFT inhibited proliferations of mouse bone marrow cells and human colorectal carcinoma cells implanted to nude mice dose-dependently. The highest tolerable TFT exposure provides the highest antitumor activity, and the hematological toxicity may serve as a potential surrogate indicator of TAS-102 efficacy.

  20. Stimulation of NADH-dependent microsomal DNA strand cleavage by rifamycin SV.

    PubMed

    Kukiełka, E; Cederbaum, A I

    1995-04-15

    Rifamycin SV is an antibiotic anti-bacterial agent used in the treatment of tuberculosis. This drug can autoxidize, especially in the presence of metals, and generate reactive oxygen species. A previous study indicated that rifamycin SV can increase NADH-dependent microsomal production of reactive oxygen species. The current study evaluated the ability of rifamycin SV to interact with iron and increase microsomal production of hydroxyl radical, as detected by conversion of supercoiled plasmid DNA into the relaxed open circular state. The plasmid used was pBluescript II KS(-), and the forms of DNA were separated by agarose-gel electrophoresis. Incubation of rat liver microsomes with plasmid plus NADH plus ferric-ATP caused DNA strand cleavage. The addition of rifamycin SV produced a time- and concentration-dependent increase in DNA-strand cleavage. No stimulation by rifamycin SV occurred in the absence of microsomes, NADH or ferric-ATP. Stimulation occurred with other ferric complexes besides ferric-ATP, e.g. ferric-histidine, ferric-citrate, ferric-EDTA, and ferric-(NH4)2SO4. Rifamycin SV did not significantly increase the high rates of DNA strand cleavage found with NADPH as the microsomal reductant. The stimulation of NADH-dependent microsomal DNA strand cleavage was completely blocked by catalase, superoxide dismutase, GSH and a variety of hydroxyl-radical-scavenging agents, but not by anti-oxidants that prevent microsomal lipid peroxidation. Redox cycling agents, such as menadione and paraquat, in contrast with rifamycin SV, stimulated the NADPH-dependent reaction; menadione and rifamycin SV were superior to paraquat in stimulating the NADH-dependent reaction. These results indicate that rifamycin SV can, in the presence of an iron catalyst, increase microsomal production of reactive oxygen species which can cause DNA-strand cleavage. In contrast with other redox cycling agents, the stimulation by rifamycin SV is more pronounced with NADH than with NADPH as the microsomal reductant. Interactions between rifamycin SV, iron and NADH generating hydroxyl-radical-like species may play a role in some of the hepatotoxic effects associated with the use of this antibacterial antibiotic.

  1. Dependence of the Linker Histone and Chromatin Condensation on the Nucleosome Environment.

    PubMed

    Perišić, Ognjen; Schlick, Tamar

    2017-08-24

    The linker histone (LH), an auxiliary protein that can bind to chromatin and interact with the linker DNA to form stem motifs, is a key element of chromatin compaction. By affecting the chromatin condensation level, it also plays an active role in gene expression. However, the presence and variable concentration of LH in chromatin fibers with different DNA linker lengths indicate that its folding and condensation are highly adaptable and dependent on the immediate nucleosome environment. Recent experimental studies revealed that the behavior of LH in mononucleosomes markedly differs from that in small nucleosome arrays, but the associated mechanism is unknown. Here we report a structural analysis of the behavior of LH in mononucleosomes and oligonucleosomes (2-6 nucleosomes) using mesoscale chromatin simulations. We show that the adapted stem configuration heavily depends on the strength of electrostatic interactions between LH and its parental DNA linkers, and that those interactions tend to be asymmetric in small oligonucleosome systems. Namely, LH in oligonucleosomes dominantly interacts with one DNA linker only, as opposed to mononucleosomes where LH has similar interactions with both linkers and forms a highly stable nucleosome stem. Although we show that the LH condensation depends sensitively on the electrostatic interactions with entering and exiting DNA linkers, other interactions, especially by nonparental cores and nonparental linkers, modulate the structural condensation by softening LH and thus making oligonucleosomes more flexible, in comparison to to mono- and dinucleosomes. We also find that the overall LH/chromatin interactions sensitively depend on the linker length because the linker length determines the maximal nucleosome stem length. For mononucleosomes with DNA linkers shorter than LH, LH condenses fully, while for DNA linkers comparable or longer than LH, the LH extension in mononucleosomes strongly follows the length of DNA linkers, unhampered by neighboring linker histones. Thus, LH is more condensed for mononucleosomes with short linkers, compared to oligonucleosomes, and its orientation is variable and highly environment-dependent. More generally, the work underscores the agility of LH whose folding dynamics critically controls genomic packaging and gene expression.

  2. Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

    PubMed

    Olson, Wilma K; Swigon, David; Coleman, Bernard D

    2004-07-15

    Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

  3. Circulating tumor DNA changes for early monitoring of anti-PD1 immunotherapy: a proof-of-concept study.

    PubMed

    Cabel, L; Riva, F; Servois, V; Livartowski, A; Daniel, C; Rampanou, A; Lantz, O; Romano, E; Milder, M; Buecher, B; Piperno-Neumann, S; Bernard, V; Baulande, S; Bieche, I; Pierga, J Y; Proudhon, C; Bidard, F-C

    2017-08-01

    Recent clinical results support the use of new immune checkpoint blockers (ICB), such as anti-PD-1 (e.g. nivolumab and pembrolizumab) and anti-PD-L1 antibodies. Radiological evaluation of ICB efficacy during therapy is challenging due to tumor immune infiltration. Changes of circulating tumor DNA (ctDNA) levels during therapy could be a promising tool for very accurate monitoring of treatment efficacy, but data are lacking with ICB. This prospective pilot study was conducted in patients with nonsmall cell lung cancer, uveal melanoma, or microsatellite-instable colorectal cancer treated by nivolumab or pembrolizumab monotherapy at Institut Curie. ctDNA levels were assessed at baseline and after 8 weeks (w8) by bidirectional pyrophosphorolysis-activated polymerization, droplet digital PCR or next-generation sequencing depending on the mutation type. Radiological evaluation of efficacy of treatment was carried out by using immune-related response criteria. ctDNA was detected at baseline in 10 out of 15 patients. At w8, a significant correlation (r = 0.86; P = 0.002) was observed between synchronous changes in ctDNA levels and tumor size. Patients in whom ctDNA levels became undetectable at w8 presented a marked and lasting response to therapy. ctDNA detection at w8 was also a significant prognostic factor in terms of progression-free survival (hazard ratio = 10.2; 95% confidence interval 2.5-41, P < 0.001) and overall survival (hazard ratio = 15; 95% confidence interval 2.5-94.9, P = 0.004). This proof-of-principle study is the first to demonstrate that quantitative ctDNA monitoring is a valuable tool to assess tumor response in patients treated with anti-PD-1 drugs. © The Author 2017. Published by Oxford University Press on behalf of the European Society for Medical Oncology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  4. Regulation of a Viral Proteinase by a Peptide and DNA in One-dimensional Space

    PubMed Central

    Blainey, Paul C.; Graziano, Vito; Pérez-Berná, Ana J.; McGrath, William J.; Flint, S. Jane; San Martín, Carmen; Xie, X. Sunney; Mangel, Walter F.

    2013-01-01

    Precursor proteins used in the assembly of adenovirus virions must be processed by the virally encoded adenovirus proteinase (AVP) before the virus particle becomes infectious. An activated adenovirus proteinase, the AVP-pVIc complex, was shown to slide along viral DNA with an extremely fast one-dimensional diffusion constant, 21.0 ± 1.9 × 106 bp2/s. In principle, one-dimensional diffusion can provide a means for DNA-bound proteinases to locate and process DNA-bound substrates. Here, we show that this is correct. In vitro, AVP-pVIc complexes processed a purified virion precursor protein in a DNA-dependent reaction; in a quasi in vivo environment, heat-disrupted ts-1 virions, AVP-pVIc complexes processed five different precursor proteins in DNA-dependent reactions. Sliding of AVP-pVIc complexes along DNA illustrates a new biochemical mechanism by which a proteinase can locate its substrates, represents a new paradigm for virion maturation, and reveals a new way of exploiting the surface of DNA. PMID:23043138

  5. Dimorphic DNA methylation during temperature-dependent sex determination in the sea turtle Lepidochelys olivacea.

    PubMed

    Venegas, Daniela; Marmolejo-Valencia, Alejandro; Valdes-Quezada, Christian; Govenzensky, Tzipe; Recillas-Targa, Félix; Merchant-Larios, Horacio

    2016-09-15

    Sex determination in vertebrates depends on the expression of a conserved network of genes. Sea turtles such as Lepidochelys olivacea have temperature-dependent sex determination. The present work analyses some of the epigenetic processes involved in this. We describe sexual dimorphism in global DNA methylation patterns between ovaries and testes of L. olivacea and show that the differences may arise from a combination of DNA methylation and demethylation events that occur during sex determination. Irrespective of incubation temperature, 5-hydroxymethylcytosine was abundant in the bipotential gonad; however, following sex determination, this modification was no longer found in pre-Sertoli cells in the testes. These changes correlate with the establishment of the sexually dimorphic DNA methylation patterns, down regulation of Sox9 gene expression in ovaries and irreversible gonadal commitment towards a male or female differentiation pathway. Thus, DNA methylation changes may be necessary for the stabilization of the gene expression networks that drive the differentiation of the bipotential gonad to form either an ovary or a testis in L. olivacea and probably among other species that manifest temperature-dependent sex determination. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Chk2 and REGγ-dependent DBC1 regulation in DNA damage induced apoptosis

    PubMed Central

    Magni, Martina; Ruscica, Vincenzo; Buscemi, Giacomo; Kim, Ja-Eun; Nachimuthu, Benjamin Tamilselvan; Fontanella, Enrico; Delia, Domenico; Zannini, Laura

    2014-01-01

    Human DBC1 (Deleted in Breast Cancer 1; KIAA1967; CCAR2) is a protein implicated in the regulation of apoptosis, transcription and histone modifications. Upon DNA damage, DBC1 is phosphorylated by ATM/ATR on Thr454 and this modification increases its inhibitory interaction with SIRT1, leading to p53 acetylation and p53-dependent apoptosis. Here, we report that the inhibition of SIRT1 by DBC1 in the DNA damage response (DDR) also depends on Chk2, the transducer kinase that is activated by ATM upon DNA lesions and contributes to the spreading of DNA damage signal. Indeed we found that inactivation of Chk2 reduces DBC1-SIRT1 binding, thus preventing p53 acetylation and DBC1-induced apoptosis. These events are mediated by Chk2 phosphorylation of the 11S proteasome activator REGγ on Ser247, which increases REGγ-DBC1 interaction and SIRT1 inhibition. Overall our results clarify the mechanisms underlying the DBC1-dependent SIRT1 inhibition and link, for the first time, Chk2 and REGγ to the ATM-DBC1-SIRT1 axis. PMID:25361978

  7. Pharmacological activation of a novel p53-dependent S-phase checkpoint involving CHK-1

    PubMed Central

    Ahmed, A; Yang, J; Maya-Mendoza, A; Jackson, D A; Ashcroft, M

    2011-01-01

    We have recently shown that induction of the p53 tumour suppressor protein by the small-molecule RITA (reactivation of p53 and induction of tumour cell apoptosis; 2,5-bis(5-hydroxymethyl-2-thienyl)furan) inhibits hypoxia-inducible factor-1α and vascular endothelial growth factor expression in vivo and induces p53-dependent tumour cell apoptosis in normoxia and hypoxia. Here, we demonstrate that RITA activates the canonical ataxia telangiectasia mutated/ataxia telangiectasia and Rad3-related DNA damage response pathway. Interestingly, phosphorylation of checkpoint kinase (CHK)-1 induced in response to RITA was influenced by p53 status. We found that induction of p53, phosphorylated CHK-1 and γH2AX proteins was significantly increased in S-phase. Furthermore, we found that RITA stalled replication fork elongation, prolonged S-phase progression and induced DNA damage in p53 positive cells. Although CHK-1 knockdown did not significantly affect p53-dependent DNA damage or apoptosis induced by RITA, it did block the ability for DNA integrity to be maintained during the immediate response to RITA. These data reveal the existence of a novel p53-dependent S-phase DNA maintenance checkpoint involving CHK-1. PMID:21593792

  8. Activation of cGAS-dependent antiviral responses by DNA intercalating agents

    PubMed Central

    Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J.; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G.; Williams, Bryan R.G.; Gantier, Michael P.

    2017-01-01

    Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. PMID:27694309

  9. Suppression of the DHX9 Helicase Induces Premature Senescence in Human Diploid Fibroblasts in a p53-dependent Manner*

    PubMed Central

    Lee, Teresa; Di Paola, Domenic; Malina, Abba; Mills, John R.; Kreps, Amina; Grosse, Frank; Tang, Hengli; Zannis-Hadjopoulos, Maria; Larsson, Ola; Pelletier, Jerry

    2014-01-01

    DHX9 is an ATP-dependent DEXH box helicase with a multitude of cellular functions. Its ability to unwind both DNA and RNA, as well as aberrant, noncanonical polynucleotide structures, has implicated it in transcriptional and translational regulation, DNA replication and repair, and maintenance of genome stability. We report that loss of DHX9 in primary human fibroblasts results in premature senescence, a state of irreversible growth arrest. This is accompanied by morphological defects, elevation of senescence-associated β-galactosidase levels, and changes in gene expression closely resembling those encountered during replicative (telomere-dependent) senescence. Activation of the p53 signaling pathway was found to be essential to this process. ChIP analysis and investigation of nascent DNA levels revealed that DHX9 is associated with origins of replication and that its suppression leads to a reduction of DNA replication. Our results demonstrate an essential role of DHX9 in DNA replication and normal cell cycle progression. PMID:24990949

  10. Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA

    PubMed Central

    Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W.; Gustafsson, Claes M.; Falkenberg, Maria

    2017-01-01

    Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication. PMID:28207748

  11. Novel DNA lesions generated by the interaction between therapeutic thiopurines and UVA light.

    PubMed

    Zhang, Xiaohong; Jeffs, Graham; Ren, Xiaolin; O'Donovan, Peter; Montaner, Beatriz; Perrett, Conal M; Karran, Peter; Xu, Yao-Zhong

    2007-03-01

    The therapeutic effect of the thiopurines, 6-thioguanine (6-TG), 6-mercaptopurine, and its prodrug azathioprine, depends on the incorporation of 6-TG into cellular DNA. Unlike normal DNA bases, 6-TG absorbs UVA radiation, and UVA-mediated photochemical damage of DNA 6-TG has potentially harmful side effects. When free 6-TG is UVA irradiated in solution in the presence of molecular oxygen, reactive oxygen species are generated and 6-TG is oxidized to guanine-6-sulfonate (G(SO3)) and guanine-6-thioguanine in reactions involving singlet oxygen. This conversion is prevented by antioxidants, including the dietary vitamin ascorbate. DNA G(SO3) is also the major photoproduct of 6-TG in DNA and it can be selectively introduced into DNA or oligonucleotides in vitro by mild chemical oxidation. Thermal stability measurements indicate that G(SO3) does not form stable base pairs with any of the normal DNA bases in duplex oligonucleotides and is a powerful block for elongation by Klenow DNA polymerase in primer extension experiments. In cultured human cells, DNA damage produced by 6-TG and UVA treatment is associated with replication inhibition and provokes a p53-dependent DNA damage response.

  12. A Sequence-Dependent DNA Condensation Induced by Prion Protein

    PubMed Central

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

  13. A Sequence-Dependent DNA Condensation Induced by Prion Protein.

    PubMed

    Bera, Alakesh; Biring, Sajal

    2018-01-01

    Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

  14. Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

    DOE PAGES

    Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...

    2011-01-01

    We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less

  15. Tobacco Smoking Leads to Extensive Genome-Wide Changes in DNA Methylation

    PubMed Central

    Zeilinger, Sonja; Kühnel, Brigitte; Klopp, Norman; Baurecht, Hansjörg; Kleinschmidt, Anja; Gieger, Christian; Weidinger, Stephan; Lattka, Eva; Adamski, Jerzy; Peters, Annette; Strauch, Konstantin

    2013-01-01

    Environmental factors such as tobacco smoking may have long-lasting effects on DNA methylation patterns, which might lead to changes in gene expression and in a broader context to the development or progression of various diseases. We conducted an epigenome-wide association study (EWAs) comparing current, former and never smokers from 1793 participants of the population-based KORA F4 panel, with replication in 479 participants from the KORA F3 panel, carried out by the 450K BeadChip with genomic DNA obtained from whole blood. We observed wide-spread differences in the degree of site-specific methylation (with p-values ranging from 9.31E-08 to 2.54E-182) as a function of tobacco smoking in each of the 22 autosomes, with the percent of variance explained by smoking ranging from 1.31 to 41.02. Depending on cessation time and pack-years, methylation levels in former smokers were found to be close to the ones seen in never smokers. In addition, methylation-specific protein binding patterns were observed for cg05575921 within AHRR, which had the highest level of detectable changes in DNA methylation associated with tobacco smoking (–24.40% methylation; p = 2.54E-182), suggesting a regulatory role for gene expression. The results of our study confirm the broad effect of tobacco smoking on the human organism, but also show that quitting tobacco smoking presumably allows regaining the DNA methylation state of never smokers. PMID:23691101

  16. Tobacco smoking leads to extensive genome-wide changes in DNA methylation.

    PubMed

    Zeilinger, Sonja; Kühnel, Brigitte; Klopp, Norman; Baurecht, Hansjörg; Kleinschmidt, Anja; Gieger, Christian; Weidinger, Stephan; Lattka, Eva; Adamski, Jerzy; Peters, Annette; Strauch, Konstantin; Waldenberger, Melanie; Illig, Thomas

    2013-01-01

    Environmental factors such as tobacco smoking may have long-lasting effects on DNA methylation patterns, which might lead to changes in gene expression and in a broader context to the development or progression of various diseases. We conducted an epigenome-wide association study (EWAs) comparing current, former and never smokers from 1793 participants of the population-based KORA F4 panel, with replication in 479 participants from the KORA F3 panel, carried out by the 450K BeadChip with genomic DNA obtained from whole blood. We observed wide-spread differences in the degree of site-specific methylation (with p-values ranging from 9.31E-08 to 2.54E-182) as a function of tobacco smoking in each of the 22 autosomes, with the percent of variance explained by smoking ranging from 1.31 to 41.02. Depending on cessation time and pack-years, methylation levels in former smokers were found to be close to the ones seen in never smokers. In addition, methylation-specific protein binding patterns were observed for cg05575921 within AHRR, which had the highest level of detectable changes in DNA methylation associated with tobacco smoking (-24.40% methylation; p = 2.54E-182), suggesting a regulatory role for gene expression. The results of our study confirm the broad effect of tobacco smoking on the human organism, but also show that quitting tobacco smoking presumably allows regaining the DNA methylation state of never smokers.

  17. Association and family studies of DRD2 gene polymorphisms in alcohol dependence syndrome.

    PubMed

    Małecka, Iwona; Jasiewicz, Andrzej; Suchanecka, Aleksandra; Samochowiec, Jerzy; Grzywacz, Anna

    2014-11-06

    The human dopamine receptor 2 gene DRD2 plays a central role in susceptibility to Alcohol Dependence Syndrome (ADS). The aim of this study was to evaluate 3 single nucleotide polymorphisms: D2 (rs1076560), Tag1D (rs1800498), Tag1B (rs1079597) located in dopamine receptor 2 DRD2 gene and its role in alcohol dependence. DNA was provided from alcohol dependent (AD) patients (n=171) and healthy control subjects (n=160) all of Polish descent. The history of alcoholism was obtained using the Polish version of the SSAGA (Semi-Structured Assessment for the Genetics of Alcoholism). We conducted case-control association study and transmission disequilibrium test (TDT). Samples were genotyped using real-time PCR method. We did not confirm the association between studied polymorphisms and alcohol dependence syndrome. TDT reveled an adequate transmission of both alleles in the group of alcohol families. The lack of association of studied polymorphisms and ADS does not preclude its participation in the pathogenesis. Further research is needed to determine the actual contribution of DRD2 gene in the pathogenesis of alcoholism.

  18. Kinetic mechanism of human DNA ligase I reveals magnesium-dependent changes in the rate-limiting step that compromise ligation efficiency.

    PubMed

    Taylor, Mark R; Conrad, John A; Wahl, Daniel; O'Brien, Patrick J

    2011-07-01

    DNA ligase I (LIG1) catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing. We used steady state and pre-steady state kinetics to characterize the minimal mechanism for DNA ligation catalyzed by human LIG1. The ATP dependence of the reaction indicates that LIG1 requires multiple Mg(2+) ions for catalysis and that an essential Mg(2+) ion binds more tightly to ATP than to the enzyme. Further dissection of the magnesium ion dependence of individual reaction steps revealed that the affinity for Mg(2+) changes along the reaction coordinate. At saturating concentrations of ATP and Mg(2+) ions, the three chemical steps occur at similar rates, and the efficiency of ligation is high. However, under conditions of limiting Mg(2+), the nick-sealing step becomes rate-limiting, and the adenylylated DNA intermediate is prematurely released into solution. Subsequent adenylylation of enzyme prevents rebinding to the adenylylated DNA intermediate comprising an Achilles' heel of LIG1. These ligase-generated 5'-adenylylated nicks constitute persistent breaks that are a threat to genomic stability if they are not repaired. The kinetic and thermodynamic framework that we have determined for LIG1 provides a starting point for understanding the mechanism and specificity of mammalian DNA ligases.

  19. Chemo-mechanical pushing of proteins along single-stranded DNA.

    PubMed

    Sokoloski, Joshua E; Kozlov, Alexander G; Galletto, Roberto; Lohman, Timothy M

    2016-05-31

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3'-Cy3-labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5' to 3' ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5' to 3') pushing of the SSB toward the 3' ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3' to 5') direction, are observed with EcRep and EcUvrD (both 3' to 5' ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA.

  20. Smooth DNA Transport through a Narrowed Pore Geometry

    PubMed Central

    Carson, Spencer; Wilson, James; Aksimentiev, Aleksei; Wanunu, Meni

    2014-01-01

    Voltage-driven transport of double-stranded DNA through nanoscale pores holds much potential for applications in quantitative molecular biology and biotechnology, yet the microscopic details of translocation have proven to be challenging to decipher. Earlier experiments showed strong dependence of transport kinetics on pore size: fast regular transport in large pores (> 5 nm diameter), and slower yet heterogeneous transport time distributions in sub-5 nm pores, which imply a large positional uncertainty of the DNA in the pore as a function of the translocation time. In this work, we show that this anomalous transport is a result of DNA self-interaction, a phenomenon that is strictly pore-diameter dependent. We identify a regime in which DNA transport is regular, producing narrow and well-behaved dwell-time distributions that fit a simple drift-diffusion theory. Furthermore, a systematic study of the dependence of dwell time on DNA length reveals a single power-law scaling of 1.37 in the range of 35–20,000 bp. We highlight the resolution of our nanopore device by discriminating via single pulses 100 and 500 bp fragments in a mixture with >98% accuracy. When coupled to an appropriate sequence labeling method, our observation of smooth DNA translocation can pave the way for high-resolution DNA mapping and sizing applications in genomics. PMID:25418307

  1. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  2. Pnc1p-Mediated Nicotinamide Clearance Modifies the Epigenetic Properties of rDNA Silencing in Saccharomyces cerevisiae

    PubMed Central

    McClure, Julie M.; Gallo, Christopher M.; Smith, Daniel L.; Matecic, Mirela; Hontz, Robert D.; Buck, Stephen W.; Racette, Frances G.; Smith, Jeffrey S.

    2008-01-01

    The histone deacetylase activity of Sir2p is dependent on NAD+ and inhibited by nicotinamide (NAM). As a result, Sir2p-regulated processes in Saccharomyces cerevisiae such as silencing and replicative aging are susceptible to alterations in cellular NAD+ and NAM levels. We have determined that high concentrations of NAM in the growth medium elevate the intracellular NAD+ concentration through a mechanism that is partially dependent on NPT1, an important gene in the Preiss–Handler NAD+ salvage pathway. Overexpression of the nicotinamidase, Pnc1p, prevents inhibition of Sir2p by the excess NAM while maintaining the elevated NAD+ concentration. This growth condition alters the epigenetics of rDNA silencing, such that repression of a URA3 reporter gene located at the rDNA induces growth on media that either lacks uracil or contains 5-fluoroorotic acid (5-FOA), an unusual dual phenotype that is reminiscent of telomeric silencing (TPE) of URA3. Despite the similarities to TPE, the modified rDNA silencing phenotype does not require the SIR complex. Instead, it retains key characteristics of typical rDNA silencing, including RENT and Pol I dependence, as well as a requirement for the Preiss–Handler NAD+ salvage pathway. Exogenous nicotinamide can therefore have negative or positive impacts on rDNA silencing, depending on the PNC1 expression level. PMID:18780747

  3. Tunable graphene quantum point contact transistor for DNA detection and characterization

    PubMed Central

    Girdhar, Anuj; Sathe, Chaitanya; Schulten, Klaus; Leburton, Jean-Pierre

    2015-01-01

    A graphene membrane conductor containing a nanopore in a quantum point contact (QPC) geometry is a promising candidate to sense, and potentially sequence, DNA molecules translocating through the nanopore. Within this geometry, the shape, size, and position of the nanopore as well as the edge configuration influences the membrane conductance caused by the electrostatic interaction between the DNA nucleotides and the nanopore edge. It is shown that the graphene conductance variations resulting from DNA translocation can be enhanced by choosing a particular geometry as well as by modulating the graphene Fermi energy, which demonstrates the ability to detect conformational transformations of a double-stranded DNA, as well as the passage of individual base pairs of a single-stranded DNA molecule through the nanopore. PMID:25765702

  4. Unique helicase determinants in the essential conjugative TraI factor from Salmonella enterica serovar Typhimurium plasmid pCU1.

    PubMed

    McLaughlin, Krystle J; Nash, Rebekah P; Redinbo, Mathew R

    2014-09-01

    The widespread development of multidrug-resistant bacteria is a major health emergency. Conjugative DNA plasmids, which harbor a wide range of antibiotic resistance genes, also encode the protein factors necessary to orchestrate the propagation of plasmid DNA between bacterial cells through conjugative transfer. Successful conjugative DNA transfer depends on key catalytic components to nick one strand of the duplex DNA plasmid and separate the DNA strands while cell-to-cell transfer occurs. The TraI protein from the conjugative Salmonella plasmid pCU1 fulfills these key catalytic roles, as it contains both single-stranded DNA-nicking relaxase and ATP-dependent helicase domains within a single, 1,078-residue polypeptide. In this work, we unraveled the helicase determinants of Salmonella pCU1 TraI through DNA binding, ATPase, and DNA strand separation assays. TraI binds DNA substrates with high affinity in a manner influenced by nucleic acid length and the presence of a DNA hairpin structure adjacent to the nick site. TraI selectively hydrolyzes ATP, and mutations in conserved helicase motifs eliminate ATPase activity. Surprisingly, the absence of a relatively short (144-residue) domain at the extreme C terminus of the protein severely diminishes ATP-dependent strand separation. Collectively, these data define the helicase motifs of the conjugative factor TraI from Salmonella pCU1 and reveal a previously uncharacterized C-terminal functional domain that uncouples ATP hydrolysis from strand separation activity. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  5. Orchestration of DNA Damage Checkpoint Dynamics across the Human Cell Cycle.

    PubMed

    Chao, Hui Xiao; Poovey, Cere E; Privette, Ashley A; Grant, Gavin D; Chao, Hui Yan; Cook, Jeanette G; Purvis, Jeremy E

    2017-11-22

    Although molecular mechanisms that prompt cell-cycle arrest in response to DNA damage have been elucidated, the systems-level properties of DNA damage checkpoints are not understood. Here, using time-lapse microscopy and simulations that model the cell cycle as a series of Poisson processes, we characterize DNA damage checkpoints in individual, asynchronously proliferating cells. We demonstrate that, within early G1 and G2, checkpoints are stringent: DNA damage triggers an abrupt, all-or-none cell-cycle arrest. The duration of this arrest correlates with the severity of DNA damage. After the cell passes commitment points within G1 and G2, checkpoint stringency is relaxed. By contrast, all of S phase is comparatively insensitive to DNA damage. This checkpoint is graded: instead of halting the cell cycle, increasing DNA damage leads to slower S phase progression. In sum, we show that a cell's response to DNA damage depends on its exact cell-cycle position and that checkpoints are phase-dependent, stringent or relaxed, and graded or all-or-none. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Dynamics and control of DNA sequence amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Marimuthu, Karthikeyan; Chakrabarti, Raj, E-mail: raj@pmc-group.com, E-mail: rajc@andrew.cmu.edu; Division of Fundamental Research, PMC Advanced Technology, Mount Laurel, New Jersey 08054

    2014-10-28

    DNA amplification is the process of replication of a specified DNA sequence in vitro through time-dependent manipulation of its external environment. A theoretical framework for determination of the optimal dynamic operating conditions of DNA amplification reactions, for any specified amplification objective, is presented based on first-principles biophysical modeling and control theory. Amplification of DNA is formulated as a problem in control theory with optimal solutions that can differ considerably from strategies typically used in practice. Using the Polymerase Chain Reaction as an example, sequence-dependent biophysical models for DNA amplification are cast as control systems, wherein the dynamics of the reactionmore » are controlled by a manipulated input variable. Using these control systems, we demonstrate that there exists an optimal temperature cycling strategy for geometric amplification of any DNA sequence and formulate optimal control problems that can be used to derive the optimal temperature profile. Strategies for the optimal synthesis of the DNA amplification control trajectory are proposed. Analogous methods can be used to formulate control problems for more advanced amplification objectives corresponding to the design of new types of DNA amplification reactions.« less

  7. Time-Resolved Small-Angle X-ray Scattering Reveals Millisecond Transitions of a DNA Origami Switch.

    PubMed

    Bruetzel, Linda K; Walker, Philipp U; Gerling, Thomas; Dietz, Hendrik; Lipfert, Jan

    2018-04-11

    Self-assembled DNA structures enable creation of specific shapes at the nanometer-micrometer scale with molecular resolution. The construction of functional DNA assemblies will likely require dynamic structures that can undergo controllable conformational changes. DNA devices based on shape complementary stacking interactions have been demonstrated to undergo reversible conformational changes triggered by changes in ionic environment or temperature. An experimentally unexplored aspect is how quickly conformational transitions of large synthetic DNA origami structures can actually occur. Here, we use time-resolved small-angle X-ray scattering to monitor large-scale conformational transitions of a two-state DNA origami switch in free solution. We show that the DNA device switches from its open to its closed conformation upon addition of MgCl 2 in milliseconds, which is close to the theoretical diffusive speed limit. In contrast, measurements of the dimerization of DNA origami bricks reveal much slower and concentration-dependent assembly kinetics. DNA brick dimerization occurs on a time scale of minutes to hours suggesting that the kinetics depend on local concentration and molecular alignment.

  8. Donor-bridge-acceptor energetics determine the distance dependence of electron tunneling in DNA

    NASA Astrophysics Data System (ADS)

    Lewis, Frederick D.; Liu, Jianqin; Weigel, Wilfried; Rettig, Wolfgang; Kurnikov, Igor V.; Beratan, David N.

    2002-10-01

    Electron transfer (ET) processes in DNA are of current interest because of their involvement in oxidative strand cleavage reactions and their relevance to the development of molecular electronics. Two mechanisms have been identified for ET in DNA, a single-step tunneling process and a multistep charge-hopping process. The dynamics of tunneling reactions depend on both the distance between the electron donor and acceptor and the nature of the molecular bridge separating the donor and acceptor. In the case of protein and alkane bridges, the distance dependence is not strongly dependent on the properties of the donor and acceptor. In contrast, we show here that the distance decay of DNA ET rates varies markedly with the energetics of the donor and acceptor relative to the bridge. Specifically, we find that an increase in the energy of the bridge states by 0.25 eV (1 eV = 1.602 × 1019 J) relative to the donor and acceptor energies for photochemical oxidation of nucleotides, without changing the reaction free energy, results in an increase in the characteristic exponential distance decay constant for the ET rates from 0.71 to 1.1 Å1. These results show that, in the small tunneling energy gap regime of DNA ET, the distance dependence is not universal; it varies strongly with the tunneling energy gap. These DNA ET reactions fill a "missing link" or transition regime between the large barrier (rapidly decaying) tunneling regime and the (slowly decaying) hopping regime in the general theory of bridge-mediated ET processes.

  9. Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure.

    PubMed

    Rautava, Samuli; Walker, W Allan; Lu, Lei

    2016-06-01

    The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. Copyright © 2016 the American Physiological Society.

  10. Hydrocortisone-induced anti-inflammatory effects in immature human enterocytes depend on the timing of exposure

    PubMed Central

    Rautava, Samuli; Lu, Lei

    2016-01-01

    The immature human gut has a propensity to exaggerated inflammatory responses that are thought to play a role in the pathogenesis of necrotizing enterocolitis (NEC). Prenatal exposure to corticosteroids has been reported to reduce the risk of NEC, while postnatal dexamethasone treatment is associated with adverse neurodevelopmental outcomes in preterm infants. The aim of this study was to investigate the direct role of hydrocortisone in gene expression patterns and inflammatory responses in immature human enterocytes. Time-dependent hydrocortisone effects in nontransformed primary human fetal intestinal epithelial cell line H4 were investigated by cDNA microarray. Fetal intestinal organ culture and cell culture experiments were conducted. Inflammatory responses were induced by stimulation with IL-1β and TNF-α with and without hydrocortisone. IL-8 and IL-6 expression and secretion were measured as functional readout. Here we report time-dependent hydrocortisone-induced changes in gene expression patterns detected by cDNA microarray. Hydrocortisone significantly attenuated IL-1β-induced inflammatory responses in the immature human gut when administered at the time of the proinflammatory insult: IL-1β-induced IL-8 and IL-6 secretion in the fetal ileum as well as H4 cells were significantly reduced. Hydrocortisone also inhibited IL-8 secretion in response to TNF-α. In contrast, TNF-α-induced IL-8 secretion was not reduced in cells treated with hydrocortisone for 48 h before stimulation. Our observations provide a physiological basis for understanding the differential clinical effects of corticosteroids in the immature human gut depending on the timing of treatment. PMID:27056727

  11. Human ISWI complexes are targeted by SMARCA5 ATPase and SLIDE domains to help resolve lesion-stalled transcription

    PubMed Central

    Aydin, Özge Z.; Marteijn, Jurgen A.; Ribeiro-Silva, Cristina; Rodríguez López, Aida; Wijgers, Nils; Smeenk, Godelieve; van Attikum, Haico; Poot, Raymond A.; Vermeulen, Wim; Lans, Hannes

    2014-01-01

    Chromatin compaction of deoxyribonucleic acid (DNA) presents a major challenge to the detection and removal of DNA damage. Helix-distorting DNA lesions that block transcription are specifically repaired by transcription-coupled nucleotide excision repair, which is initiated by binding of the CSB protein to lesion-stalled RNA polymerase II. Using live cell imaging, we identify a novel function for two distinct mammalian ISWI adenosine triphosphate (ATP)-dependent chromatin remodeling complexes in resolving lesion-stalled transcription. Human ISWI isoform SMARCA5/SNF2H and its binding partners ACF1 and WSTF are rapidly recruited to UV-C induced DNA damage to specifically facilitate CSB binding and to promote transcription recovery. SMARCA5 targeting to UV-C damage depends on transcription and histone modifications and requires functional SWI2/SNF2-ATPase and SLIDE domains. After initial recruitment to UV damage, SMARCA5 re-localizes away from the center of DNA damage, requiring its HAND domain. Our studies support a model in which SMARCA5 targeting to DNA damage-stalled transcription sites is controlled by an ATP-hydrolysis-dependent scanning and proofreading mechanism, highlighting how SWI2/SNF2 chromatin remodelers identify and bind nucleosomes containing damaged DNA. PMID:24990377

  12. Roles of human POLD1 and POLD3 in genome stability

    PubMed Central

    Tumini, Emanuela; Barroso, Sonia; -Calero, Carmen Pérez; Aguilera, Andrés

    2016-01-01

    DNA replication is essential for cellular proliferation. If improperly controlled it can constitute a major source of genome instability, frequently associated with cancer and aging. POLD1 is the catalytic subunit and POLD3 is an accessory subunit of the replicative Pol δ polymerase, which also functions in DNA repair, as well as the translesion synthesis polymerase Pol ζ, whose catalytic subunit is REV3L. In cells depleted of POLD1 or POLD3 we found a differential but general increase in genome instability as manifested by DNA breaks, S-phase progression impairment and chromosome abnormalities. Importantly, we showed that both proteins are needed to maintain the proper amount of active replication origins and that POLD3-depletion causes anaphase bridges accumulation. In addition, POLD3-associated DNA damage showed to be dependent on RNA-DNA hybrids pointing toward an additional and specific role of this subunit in genome stability. Interestingly, a similar increase in RNA-DNA hybrids-dependent genome instability was observed in REV3L-depleted cells. Our findings demonstrate a key role of POLD1 and POLD3 in genome stability and S-phase progression revealing RNA-DNA hybrids-dependent effects for POLD3 that might be partly due to its Pol ζ interaction. PMID:27974823

  13. Application of a time-dependent coalescence process for inferring the history of population size changes from DNA sequence data.

    PubMed

    Polanski, A; Kimmel, M; Chakraborty, R

    1998-05-12

    Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.

  14. The Midblastula Transition Defines the Onset of Y RNA-Dependent DNA Replication in Xenopus laevis ▿

    PubMed Central

    Collart, Clara; Christov, Christo P.; Smith, James C.; Krude, Torsten

    2011-01-01

    Noncoding Y RNAs are essential for the initiation of chromosomal DNA replication in mammalian cell extracts, but their role in this process during early vertebrate development is unknown. Here, we use antisense morpholino nucleotides (MOs) to investigate Y RNA function in Xenopus laevis and zebrafish embryos. We show that embryos in which Y RNA function is inhibited by MOs develop normally until the midblastula transition (MBT) but then fail to replicate their DNA and die before gastrulation. Consistent with this observation, Y RNA function is not required for DNA replication in Xenopus egg extracts but is required for replication in a post-MBT cell line. Y RNAs do not bind chromatin in karyomeres before MBT, but they associate with interphase nuclei after MBT in an origin recognition complex (ORC)-dependent manner. Y RNA-specific MOs inhibit the association of Y RNAs with ORC, Cdt1, and HMGA1a proteins, suggesting that these molecular associations are essential for Y RNA function in DNA replication. The MBT is thus a transition point between Y RNA-independent and Y RNA-dependent control of vertebrate DNA replication. Our data suggest that in vertebrates Y RNAs function as a developmentally regulated layer of control over the evolutionarily conserved eukaryotic DNA replication machinery. PMID:21791613

  15. Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

    PubMed Central

    Calloway, Cassandra

    2016-01-01

    BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P < 0.001, respectively). ΔmtDNA4977 was increased in the presence of either liver iron concentration > 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* < 20 ms) was present in 0%, 22%, and 46% of subjects with ΔmtDNA4977 frequency < 20, 20–40, and > 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

  16. Targeted Inactivation of DNA Photolyase Genes in Medaka Fish (Oryzias latipes).

    PubMed

    Ishikawa-Fujiwara, Tomoko; Shiraishi, Eri; Fujikawa, Yoshihiro; Mori, Toshio; Tsujimura, Tohru; Todo, Takeshi

    2017-01-01

    Proteins of the cryptochrome/photolyase family (CPF) exhibit sequence and structural conservation, but their functions are divergent. Photolyase is a DNA repair enzyme that catalyzes the light-dependent repair of ultraviolet (UV)-induced photoproducts, whereas cryptochrome acts as a photoreceptor or circadian clock protein. Two types of DNA photolyase exist: CPD photolyase, which repairs cyclobutane pyrimidine dimers (CPDs), and 6-4 photolyase, which repairs 6-4 pyrimidine-pyrimidone photoproducts (6-4PPs). Although the Cry-DASH protein is classified as a cryptochrome, it also has light-dependent DNA repair activity. To determine the significance of the three light-dependent repair enzymes in recovering from solar UV-induced DNA damage at the organismal level, we generated mutants in each gene in medaka using the CRISPR genome editing technique. The light-dependent repair activity of the mutants was examined in vitro in cultured cells and in vivo in skin tissue. Light-dependent repair of CPD was lost in the CPD photolyase-deficient mutant, whereas weak repair activity against 6-4PPs persisted in the 6-4 photolyase-deficient mutant. These results suggest the existence of a heretofore unknown 6-4PP repair pathway and thus improve our understanding of the mechanisms of defense against solar UV in vertebrates. © 2016 The Authors. Photochemistry and Photobiology published by Wiley Periodicals, Inc. on behalf of American Society for Photobiology.

  17. TDP2 suppresses chromosomal translocations induced by DNA topoisomerase II during gene transcription.

    PubMed

    Gómez-Herreros, Fernando; Zagnoli-Vieira, Guido; Ntai, Ioanna; Martínez-Macías, María Isabel; Anderson, Rhona M; Herrero-Ruíz, Andrés; Caldecott, Keith W

    2017-08-10

    DNA double-strand breaks (DSBs) induced by abortive topoisomerase II (TOP2) activity are a potential source of genome instability and chromosome translocation. TOP2-induced DNA double-strand breaks are rejoined in part by tyrosyl-DNA phosphodiesterase 2 (TDP2)-dependent non-homologous end-joining (NHEJ), but whether this process suppresses or promotes TOP2-induced translocations is unclear. Here, we show that TDP2 rejoins DSBs induced during transcription-dependent TOP2 activity in breast cancer cells and at the translocation 'hotspot', MLL. Moreover, we find that TDP2 suppresses chromosome rearrangements induced by TOP2 and reduces TOP2-induced chromosome translocations that arise during gene transcription. Interestingly, however, we implicate TDP2-dependent NHEJ in the formation of a rare subclass of translocations associated previously with therapy-related leukemia and characterized by junction sequences with 4-bp of perfect homology. Collectively, these data highlight the threat posed by TOP2-induced DSBs during transcription and demonstrate the importance of TDP2-dependent non-homologous end-joining in protecting both gene transcription and genome stability.DNA double-strand breaks (DSBs) induced by topoisomerase II (TOP2) are rejoined by TDP2-dependent non-homologous end-joining (NHEJ) but whether this promotes or suppresses translocations is not clear. Here the authors show that TDP2 suppresses chromosome translocations from DSBs introduced during gene transcription.

  18. Origin recognition is the predominant role for DnaA-ATP in initiation of chromosome replication.

    PubMed

    Grimwade, Julia E; Rozgaja, Tania A; Gupta, Rajat; Dyson, Kyle; Rao, Prassanna; Leonard, Alan C

    2018-05-25

    In all cells, initiation of chromosome replication depends on the activity of AAA+ initiator proteins that form complexes with replication origin DNA. In bacteria, the conserved, adenosine triphosphate (ATP)-regulated initiator protein, DnaA, forms a complex with the origin, oriC, that mediates DNA strand separation and recruitment of replication machinery. Complex assembly and origin activation requires DnaA-ATP, which differs from DnaA-ADP in its ability to cooperatively bind specific low affinity sites and also to oligomerize into helical filaments. The degree to which each of these activities contributes to the DnaA-ATP requirement for initiation is not known. In this study, we compared the DnaA-ATP dependence of initiation from wild-type Escherichia coli oriC and a synthetic origin (oriCallADP), whose multiple low affinity DnaA sites bind DnaA-ATP and DnaA-ADP similarly. OriCallADP was fully occupied and unwound by DnaA-ADP in vitro, and, in vivo, oriCallADP suppressed lethality of DnaA mutants defective in ATP binding and ATP-specific oligomerization. However, loss of preferential DnaA-ATP binding caused over-initiation and increased sensitivity to replicative stress. The findings indicate both DnaA-ATP and DnaA-ADP can perform most of the mechanical functions needed for origin activation, and suggest that a key reason for ATP-regulation of DnaA is to control replication initiation frequency.

  19. Motivations for Undertaking DNA Sequencing-Based Non-Invasive Prenatal Testing for Fetal Aneuploidy: A Qualitative Study with Early Adopter Patients in Hong Kong

    PubMed Central

    Yi, Huso; Hallowell, Nina; Griffiths, Sian; Yeung Leung, Tak

    2013-01-01

    Background A newly introduced cell-free fetal DNA sequencing based non-invasive prenatal testing (DNA-NIPT) detects Down syndrome with sensitivity of 99% at early gestational stage without risk of miscarriage. Attention has been given to its public health implications; little is known from consumer perspectives. This qualitative study aimed to explore women’s motivations for using, and perceptions of, DNA-NIPT in Hong Kong. Methods and Findings In-depth interviews were conducted with 45 women who had undertaken DNA-NIPT recruited by purposive sampling based on socio-demographic and clinical characteristics. The sample included 31 women identified as high-risk from serum and ultrasound based Down syndrome screening (SU-DSS). Thematic narrative analysis examined informed-decision making of the test and identified the benefits and needs. Women outlined a number of reasons for accessing DNA-NIPT: reducing the uncertainty associated with risk probability-based results from SU-DSS, undertaking DNA-NIPT as a comprehensive measure to counteract risk from childbearing especially at advanced age, perceived predictive accuracy and absence of risk of harm to fetus. Accounts of women deemed high-risk or not high-risk are distinctive in a number of respects. High-risk women accessed DNA-NIPT to get a clearer idea of their risk. This group perceived SU-DSS as an unnecessary and confusing procedure because of its varying, protocol-dependent detection rates. Those women not deemed high-risk, in contrast, undertook DNA-NIPT for psychological assurance and to reduce anxiety even after receiving the negative result from SU-DSS. Conclusions DNA-NIPT was regarded positively by women who chose this method of screening over the routine, less expensive testing options. Given its perceived utility, health providers need to consider whether DNA-NIPT should be offered as part of universal routine care to women at high-risk for fetal aneuploidy. If this is the case, then further development of guidelines and quality assurance will be needed to provide a service suited to patients’ needs. PMID:24312358

  20. The Regulatory Interactions of p21 and PCNA in Human Breast Cancer

    DTIC Science & Technology

    2002-07-01

    Proliferating cell nuclear antigen (PCNA) is a multifunctional enzyme involved in multiple cellular processes including DNA replication and repair...During DNA replication , PCNA function as an accessory factor- for the DNA polymerases E arid and are part of a multiprotein DNA replication complex...a cyclin-dependent kinase inhibitor, p21WAF1 ability to inhibit DNA replication in response to DNA damage has been wall characterized. Interestingly

  1. Identification of hydrolyzable tannins (punicalagin, punicalin and geraniin) as novel inhibitors of hepatitis B virus covalently closed circular DNA

    PubMed Central

    Liu, Chunlan; Cai, Dawei; Zhang, Lin; Tang, Wei; Yan, Ran

    2017-01-01

    The development of new agents to target HBV cccDNA is urgently needed because of the limitations of current available drugs for treatment of hepatitis B. By using a cell-based assay in which the production of HBeAg is in a cccDNA-dependent manner, we screened a compound library derived from Chinese herbal remedies for inhibitors against HBV cccDNA. Three hydrolyzable tannins, specifically punicalagin, punicalin and geraniin, emerged as novel anti-HBV agents. These compounds significantly reduced the production of secreted HBeAg and cccDNA in a dose-dependent manner in our assay, without dramatic alteration of viral DNA replication. Furthermore, punicalagin did not affect precore/core promoter activity, pgRNA transcription, core protein expression, or HBsAg secretion. By employing the cell-based cccDNA accumulation and stability assay, we found that these tannins significantly inhibited the establishment of cccDNA and modestly facilitated the degradation of preexisting cccDNA. Collectively, our results suggest that hydrolyzable tannins inhibit HBV cccDNA production via a dual mechanism through preventing the formation of cccDNA and promoting cccDNA decay, although the latter effect is rather minor. These hydrolyzable tannins may serve as lead compounds for the development of new agents to cure HBV infection. PMID:27591143

  2. Chromatin Remodeling and Plant Immunity.

    PubMed

    Chen, W; Zhu, Q; Liu, Y; Zhang, Q

    Chromatin remodeling, an important facet of the regulation of gene expression in eukaryotes, is performed by two major types of multisubunit complexes, covalent histone- or DNA-modifying complexes, and ATP-dependent chromosome remodeling complexes. Snf2 family DNA-dependent ATPases constitute the catalytic subunits of ATP-dependent chromosome remodeling complexes, which accounts for energy supply during chromatin remodeling. Increasing evidence indicates a critical role of chromatin remodeling in the establishment of long-lasting, even transgenerational immune memory in plants, which is supported by the findings that DNA methylation, histone deacetylation, and histone methylation can prime the promoters of immune-related genes required for disease defense. So what are the links between Snf2-mediated ATP-dependent chromosome remodeling and plant immunity, and what mechanisms might support its involvement in disease resistance? © 2017 Elsevier Inc. All rights reserved.

  3. Stacked-unstacked equilibrium at the nick site of DNA.

    PubMed

    Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D

    2004-09-17

    Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.

  4. DNA adducts and liver DNA replication in rats during chronic exposure to N-nitrosodimethylamine (NDMA) and their relationships to the dose-dependence of NDMA hepatocarcinogenesis.

    PubMed

    Souliotis, Vassilis L; Henneman, John R; Reed, Carl D; Chhabra, Saranjit K; Diwan, Bhalchandra A; Anderson, Lucy M; Kyrtopoulos, Soterios A

    2002-03-20

    Exposure of rats to the hepatocarcinogen N-nitrosodimethylamine (NDMA) (0.2-2.64 ppm in the drinking water) for up to 180 days resulted in rapid accumulation of N7- and O6-methylguanine in liver and white blood cell DNA, maximum adduct levels being reached within 1-7 days, depending on the dose. The levels of both adducts remained constant up to treatment day 28, subsequently declining slowly to about 40% of maximal levels for the liver and 60% for white blood cells by day 180. In order to elucidate the role of DNA replication in NDMA hepatocarcinogenesis, changes in liver cell labeling index (LI) were also measured on treatment days 21, 120 and 180. Although the time- and dose-dependence of the observed effects were complex, a clear trend towards increased rates of hepatocyte LI, as indicated by BrdU incorporation, with increasing NDMA doses was evident, particularly above 1 ppm, a concentration above which NDMA hepatocarcinogenicity is known to increase sharply. In contrast, no increase in Kupffer cell DNA replication was found at any of the doses employed, in accordance with the low susceptibility of these cells to NDMA-induced carcinogenesis. No significant increase in the occurrence of necrotic or apoptotic cells was noted under the treatment conditions employed. These results suggest that, in addition to the accumulation of DNA damage, alterations in hepatocyte DNA replication during the chronic NDMA exposure may influence the dose-dependence of its carcinogenic efficacy.

  5. Histone H1 functions as a stimulatory factor in backup pathways of NHEJ

    PubMed Central

    Rosidi, Bustanur; Wang, Minli; Wu, Wenqi; Sharma, Aparna; Wang, Huichen; Iliakis, George

    2008-01-01

    DNA double-strand breaks (DSBs) induced in the genome of higher eukaryotes by ionizing radiation (IR) are predominantly removed by two pathways of non-homologous end-joining (NHEJ) termed D-NHEJ and B-NHEJ. While D-NHEJ depends on the activities of the DNA-dependent protein kinase (DNA-PK) and DNA ligase IV/XRCC4/XLF, B-NHEJ utilizes, at least partly, DNA ligase III/XRCC1 and PARP-1. Using in vitro end-joining assays and protein fractionation protocols similar to those previously applied for the characterization of DNA ligase III as an end-joining factor, we identify here histone H1 as an additional putative NHEJ factor. H1 strongly enhances DNA-end joining and shifts the product spectrum from circles to multimers. While H1 enhances the DNA-end-joining activities of both DNA Ligase IV and DNA Ligase III, the effect on ligase III is significantly stronger. Histone H1 also enhances the activity of PARP-1. Since histone H1 has been shown to counteract D-NHEJ, these observations and the known functions of the protein identify it as a putative alignment factor operating preferentially within B-NHEJ. PMID:18250087

  6. RAE1 ligands for the NKG2D receptor are regulated by STING-dependent DNA sensor pathways in lymphoma.

    PubMed

    Lam, Adeline R; Bert, Nina Le; Ho, Samantha Sw; Shen, Yu J; Tang, Li Fm; Xiong, Gordon M; Croxford, John L; Koo, Christine X; Ishii, Ken J; Akira, Shizuo; Raulet, David H; Gasser, Stephan

    2014-04-15

    The immunoreceptor NKG2D originally identified in natural killer (NK) cells recognizes ligands that are upregulated on tumor cells. Expression of NKG2D ligands (NKG2DL) is induced by the DNA damage response (DDR), which is often activated constitutively in cancer cells, revealing them to NK cells as a mechanism of immunosurveillance. Here, we report that the induction of retinoic acid early transcript 1 (RAE1) ligands for NKG2D by the DDR relies on a STING-dependent DNA sensor pathway involving the effector molecules TBK1 and IRF3. Cytosolic DNA was detected in lymphoma cell lines that express RAE1 and its occurrence required activation of the DDR. Transfection of DNA into ligand-negative cells was sufficient to induce RAE1 expression. Irf3(+/-);Eμ-Myc mice expressed lower levels of RAE1 on tumor cells and showed a reduced survival rate compared with Irf3(+/+);Eμ-Myc mice. Taken together, our results suggest that genomic damage in tumor cells leads to activation of STING-dependent DNA sensor pathways, thereby activating RAE1 and enabling tumor immunosurveillance. ©2014 AACR.

  7. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint

    PubMed Central

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-01-01

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1–2 and 7–8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1–2 and 4–5. The BRCT domains 4–5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1. PMID:20871591

  8. TopBP1 functions with 53BP1 in the G1 DNA damage checkpoint.

    PubMed

    Cescutti, Rachele; Negrini, Simona; Kohzaki, Masaoki; Halazonetis, Thanos D

    2010-11-03

    TopBP1 is a checkpoint protein that colocalizes with ATR at sites of DNA replication stress. In this study, we show that TopBP1 also colocalizes with 53BP1 at sites of DNA double-strand breaks (DSBs), but only in the G1-phase of the cell cycle. Recruitment of TopBP1 to sites of DNA replication stress was dependent on BRCT domains 1-2 and 7-8, whereas recruitment to sites of DNA DSBs was dependent on BRCT domains 1-2 and 4-5. The BRCT domains 4-5 interacted with 53BP1 and recruitment of TopBP1 to sites of DNA DSBs in G1 was dependent on 53BP1. As TopBP1 contains a domain important for ATR activation, we examined whether it contributes to the G1 cell cycle checkpoint. By monitoring the entry of irradiated G1 cells into S-phase, we observed a checkpoint defect after siRNA-mediated depletion of TopBP1, 53BP1 or ATM. Thus, TopBP1 may mediate the checkpoint function of 53BP1 in G1.

  9. Atomic force microscopy of chromatin arrays reveal non-monotonic salt dependence of array compaction in solution

    PubMed Central

    Krzemien, Katarzyna M.; Beckers, Maximilian; Quack, Salina; Michaelis, Jens

    2017-01-01

    Compaction of DNA in chromatin is a hallmark of the eukaryotic cell and unravelling its structure is required for an understanding of DNA involving processes. Despite strong experimental efforts, many questions concerning the DNA packing are open. In particular, it is heavily debated whether an ordered structure referred to as the “30 nm fibre” exist in vivo. Scanning probe microscopy has become a cutting edge technology for the high-resolution imaging of DNA- protein complexes. Here, we perform high-resolution atomic force microscopy of non-cross-linked chromatin arrays in liquid, under different salt conditions. A statistical analysis of the data reveals that array compaction is salt dependent in a non-monotonic fashion. A simple physical model can qualitatively explain the observed findings due to the opposing effects of salt dependent stiffening of DNA, nucleosome stability and histone-histone interactions. While for different salt concentrations different compaction states are observed, our data do not provide support for the existence of regular chromatin fibres. Our studies add new insights into chromatin structure, and with that contribute to a further understanding of the DNA condensation. PMID:28296908

  10. ASCIZ regulates lesion-specific Rad51 focus formation and apoptosis after methylating DNA damage

    PubMed Central

    McNees, Carolyn J; Conlan, Lindus A; Tenis, Nora; Heierhorst, Jörg

    2005-01-01

    Nuclear Rad51 focus formation is required for homology-directed repair of DNA double-strand breaks (DSBs), but its regulation in response to non-DSB lesions is poorly understood. Here we report a novel human SQ/TQ cluster domain-containing protein termed ASCIZ that forms Rad51-containing foci in response to base-modifying DNA methylating agents but not in response to DSB-inducing agents. ASCIZ foci seem to form prior to Rad51 recruitment, and an ASCIZ core domain can concentrate Rad51 in focus-like structures independently of DNA damage. ASCIZ depletion dramatically increases apoptosis after methylating DNA damage and impairs Rad51 focus formation in response to methylating agents but not after ionizing radiation. ASCIZ focus formation and increased apoptosis in ASCIZ-depleted cells depend on the mismatch repair protein MLH1. Interestingly, ASCIZ foci form efficiently during G1 phase, when sister chromatids are unavailable as recombination templates. We propose that ASCIZ acts as a lesion-specific focus scaffold in a Rad51-dependent pathway that resolves cytotoxic repair intermediates, most likely single-stranded DNA gaps, resulting from MLH1-dependent processing of base lesions. PMID:15933716

  11. ASCIZ regulates lesion-specific Rad51 focus formation and apoptosis after methylating DNA damage.

    PubMed

    McNees, Carolyn J; Conlan, Lindus A; Tenis, Nora; Heierhorst, Jörg

    2005-07-06

    Nuclear Rad51 focus formation is required for homology-directed repair of DNA double-strand breaks (DSBs), but its regulation in response to non-DSB lesions is poorly understood. Here we report a novel human SQ/TQ cluster domain-containing protein termed ASCIZ that forms Rad51-containing foci in response to base-modifying DNA methylating agents but not in response to DSB-inducing agents. ASCIZ foci seem to form prior to Rad51 recruitment, and an ASCIZ core domain can concentrate Rad51 in focus-like structures independently of DNA damage. ASCIZ depletion dramatically increases apoptosis after methylating DNA damage and impairs Rad51 focus formation in response to methylating agents but not after ionizing radiation. ASCIZ focus formation and increased apoptosis in ASCIZ-depleted cells depend on the mismatch repair protein MLH1. Interestingly, ASCIZ foci form efficiently during G1 phase, when sister chromatids are unavailable as recombination templates. We propose that ASCIZ acts as a lesion-specific focus scaffold in a Rad51-dependent pathway that resolves cytotoxic repair intermediates, most likely single-stranded DNA gaps, resulting from MLH1-dependent processing of base lesions.

  12. The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

    PubMed Central

    Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

    2013-01-01

    DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

  13. HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

    PubMed Central

    Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

    2008-01-01

    Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

  14. Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

    PubMed

    Kachhap, Sangita; Singh, Balvinder

    2015-01-01

    In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

  15. The association of DNA-dependent protein kinase activity of peripheral blood lymphocytes with prognosis of cancer

    PubMed Central

    Someya, M; Sakata, K-i; Matsumoto, Y; Kamdar, R P; Kai, M; Toyota, M; Hareyama, M

    2011-01-01

    Background: Repair of various types of DNA damages is critical for genomic stability. DNA-dependent protein kinase (DNA-PK) has an important role in DNA double-strand break repair. We examined whether there may be a correlation between DNA-PK activity in peripheral blood lymphocytes (PBLs) and survival percentages in various cancer patients. We also investigated the changes of DNA-PK activity in PBLs after radiotherapy. Methods: A total of 167 of untreated cancer patients participated in this study. Peripheral blood was collected, separated, and centrifuged. DNA-PK activity was measured by DNA-pull-down assay. Chromosomal aberrations were examined by cytogenetic methods. Results: DNA-PK activity of PBLs in advanced cancer patients was significantly lower than that in early stage. The patients with lower DNA-PK activity in PBLs tended to have the lower disease-specific survivals and distant metastasis-free survivals than those with higher DNA-PK activity in advanced stages. There was also a tendency of inverse correlation between DNA-PK activity and excess fragments. The DNA-PK activity of PBLs in most patients decreased in response to radiation as the equivalent whole-body dose increased. Conclusion: Cancer patients in advanced stage, with lower DNA-PK activity of PBLs might have higher distant metastasis and exhibit poorer prognosis. Therefore, DNA-PK activity in PBLs could be used as a marker to predict the chromosomal instability and poorer prognosis. PMID:21559021

  16. Regulation of ATM-Dependent DNA Damage Responses in Breast Cancer by the RhoGEF Net1

    DTIC Science & Technology

    2013-04-01

    Science 279: 509-514. 5. Jaffe AB. et al., (2010) RhoGTPases: Biochemistry and Biology. Annu. Rev. Cell Dev. Biol. 21:247-269. 6. Rossman KL, et al...exchange factor Net1 is regulated by nuclear sequestration. J. Biol. Chem. 277:17, 14581-14588. 17. Harper JW, et al., (2007) The DNA Damage Response: Ten...Research (AACR) Annual Meeting and 2013 Annual Cancer Research Biochemistry Retreat Regulation of ATM-dependent DNA damage signaling in human breast

  17. Role of allosteric switch residue histidine 195 in maintaining active-site asymmetry in presynaptic filaments of bacteriophage T4 UvsX recombinase.

    PubMed

    Farb, Joshua N; Morrical, Scott W

    2009-01-16

    Recombinases of the highly conserved RecA/Rad51 family play central roles in homologous recombination and DNA double-stranded break repair. RecA/Rad51 enzymes form presynaptic filaments on single-stranded DNA (ssDNA) that are allosterically activated to catalyze ATPase and DNA strand-exchange reactions. Information is conveyed between DNA- and ATP-binding sites, in part, by a highly conserved glutamine residue (Gln194 in Escherichia coli RecA) that acts as an allosteric switch. The T4 UvsX protein is a divergent RecA ortholog and contains histidine (His195) in place of glutamine at the allosteric switch position. UvsX and RecA catalyze similar strand-exchange reactions, but differ in other properties. UvsX produces both ADP and AMP as products of its ssDNA-dependent ATPase activity--a property that is unique among characterized recombinases. Details of the kinetics of ssDNA-dependent ATP hydrolysis reactions indicate that UvsX-ssDNA presynaptic filaments are asymmetric and contain two classes of ATPase active sites: one that generates ADP, and another that generates AMP. Active-site asymmetry is reduced by mutations at the His195 position, since UvsX-H195Q and UvsX-H195A mutants both exhibit stronger ssDNA-dependent ATPase activity, with lower cooperativity and markedly higher ADP/AMP product ratios, than wild-type UvsX. Reduced active-site asymmetry correlates strongly with reduced ssDNA-binding affinity and DNA strand-exchange activity in both H195Q and H195A mutants. These and other results support a model in which allosteric switch residue His195 controls the formation of an asymmetric conformation of UvsX-ssDNA filaments that is active in DNA strand exchange. The implications of our findings for UvsX recombination functions, and for RecA functions in general, are discussed.

  18. Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

    PubMed

    Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

    2016-05-01

    The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

  19. Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.

    PubMed

    Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R

    2005-11-01

    The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

  20. Requirement of the Saccharomyces cerevisiae APN1 Gene for the Repair of Mitochondrial DNA Alkylation Damage

    PubMed Central

    Acevedo-Torres, Karina; Fonseca-Williams, Sharon; Ayala-Torres, Sylvette; Torres-Ramos, Carlos A.

    2010-01-01

    The Saccharomyces cerevisiae APN1 gene that participates in base excision repair has been localized both in the nucleus and the mitochondria. APN1 deficient cells (apn1Δ) show increased mutation frequencies in mitochondrial DNA (mtDNA) suggesting that APN1 is also important for mtDNA stability. To understand APN1-dependent mtDNA repair processes we studied the formation and repair of mtDNA lesions in cells exposed to methyl methanesulfonate (MMS). We show that MMS induces mtDNA damage in a dose-dependent fashion and that deletion of the APN1 gene enhances the susceptibility of mtDNA to MMS. Repair kinetic experiments demonstrate that in wild-type cells (WT) it takes 4 hr to repair the damage induced by 0.1% MMS, whereas in the apn1Δ strain there is a lag in mtDNA repair that results in significant differences in the repair capacity between the two yeast strains. Analysis of lesions in nuclear DNA (nDNA) after treatment with 0.1% MMS shows a significant difference in the amount of nDNA lesions between WT and apn1Δ cells. Interestingly, comparisons between nDNA and mtDNA damage show that nDNA is more sensitive to the effects of MMS treatment. However, both strains are able to repair the nDNA lesions, contrary to mtDNA repair, which is compromised in the apn1Δ mutant strain. Therefore, although nDNA is more sensitive than mtDNA to the effects of MMS, deletion of APN1 has a stronger phenotype in mtDNA repair than in nDNA. These results highlight the prominent role of APN1 in the repair of environmentally induced mtDNA damage. PMID:19197988

  1. Increased recovery of touch DNA evidence using FTA paper compared to conventional collection methods.

    PubMed

    Kirgiz, Irina A; Calloway, Cassandra

    2017-04-01

    Tape lifting and FTA paper scraping methods were directly compared to traditional double swabbing for collecting touch DNA from car steering wheels (n = 70 cars). Touch DNA was collected from the left or right side of each steering wheel (randomized) using two sterile cotton swabs, while the other side was sampled using water-soluble tape or FTA paper cards. DNA was extracted and quantified in duplicate using qPCR. Quantifiable amounts of DNA were detected for 100% of the samples (n = 140) collected independent of the method. However, the DNA collection yield was dependent on the collection method. A statistically significant difference in DNA yield was observed between FTA scraping and double swabbing methods (p = 0.0051), with FTA paper collecting a two-fold higher amount. Statistical analysis showed no significant difference in DNA yields between the double swabbing and tape lifting techniques (p = 0.21). Based on the DNA concentration required for 1 ng input, 47% of the samples collected using FTA paper would be expected to yield a short tandem repeat (STR) profile compared to 30% and 23% using double swabbing or tape, respectively. Further, 55% and 77% of the samples collected using double swabbing or tape, respectively, did not yield a high enough DNA concentration for the 0.5 ng of DNA input recommended for conventional STR kits and would be expected to result in a partial or no profile compared to 35% of the samples collected using FTA paper. STR analysis was conducted for a subset of the higher concentrated samples to confirm that the DNA collected from the steering wheel was from the driver. 32 samples were selected with DNA amounts of at least 1 ng total DNA (100 pg/μl when concentrated if required). A mixed STR profile was observed for 26 samples (88%) and the last driver was the major DNA contributor for 29 samples (94%). For one sample, the last driver was the minor DNA contributor. A full STR profile of the last driver was observed for 21 samples (69%) and a partial profile was observed for nine samples (25%); STR analysis failed for two samples collected using tape (6%). In conclusion, we show that the FTA paper scraping method has the potential to collect higher DNA yields from touch DNA evidence deposited on non-porous surfaces often encountered in criminal cases compared to conventional methods. Copyright © 2017 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  2. Environmental DNA particle size distribution from Brook Trout (Salvelinus fontinalis)

    Treesearch

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Winsor H. Lowe; Michael K. Schwartz

    2015-01-01

    Environmental DNA (eDNA) sampling has become a widespread approach for detecting aquatic animals with high potential for improving conservation biology. However, little research has been done to determine the size of particles targeted by eDNA surveys. In this study, we conduct particle distribution analysis of eDNA from a captive Brook Trout (Salvelinus fontinalis) in...

  3. Separase is recruited to mitotic chromosomes to dissolve sister chromatid cohesion in a DNA-dependent manner.

    PubMed

    Sun, Yuxiao; Kucej, Martin; Fan, Heng-Yu; Yu, Hong; Sun, Qing-Yuan; Zou, Hui

    2009-04-03

    Sister chromatid separation is triggered by the separase-catalyzed cleavage of cohesin. This process is temporally controlled by cell-cycle-dependent factors, but its biochemical mechanism and spatial regulation remain poorly understood. We report that cohesin cleavage by human separase requires DNA in a sequence-nonspecific manner. Separase binds to DNA in vitro, but its proteolytic activity, measured by its autocleavage, is not stimulated by DNA. Instead, biochemical characterizations suggest that DNA mediates cohesin cleavage by bridging the interaction between separase and cohesin. In human cells, a fraction of separase localizes to the mitotic chromosome. The importance of the chromosomal DNA in cohesin cleavage is further demonstrated by the observation that the cleavage of the chromosome-associated cohesins is sensitive to nuclease treatment. Our observations explain why chromosome-associated cohesins are specifically cleaved by separase and the soluble cohesins are left intact in anaphase.

  4. Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

    PubMed

    Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

    2007-11-02

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kundu, Sourav, E-mail: sourav.kundu@saha.ac.in; Karmakar, S. N., E-mail: sachindranath.karmakar@saha.ac.in

    We present a tight-binding study of conformation dependent electronic transport properties of DNA double-helix including its helical symmetry. We have studied the changes in the localization properties of DNA as we alter the number of stacked bases within every pitch of the double-helix keeping fixed the total number of nitrogen bases within the DNA molecule. We take three DNA sequences, two of them are periodic and one is random and observe that in all the cases localization length increases as we increase the radius of DNA double-helix i.e., number of nucleobases within a pitch. We have also investigated the effectmore » of backbone energetic on the I-V response of the system and found that in presence of helical symmetry, depending on the interplay of conformal variation and disorder, DNA can be found in either metallic, semiconducting and insulating phases, as observed experimentally.« less

  6. Recruitment of TRF2 to laser-induced DNA damage sites.

    PubMed

    Huda, Nazmul; Abe, Satoshi; Gu, Ling; Mendonca, Marc S; Mohanty, Samarendra; Gilley, David

    2012-09-01

    Several lines of evidence suggest that the telomere-associated protein TRF2 plays critical roles in the DNA damage response. TRF2 is rapidly and transiently phosphorylated by an ATM-dependent pathway in response to DNA damage and this DNA damage-induced phosphoryation is essential for the DNA-PK-dependent pathway of DNA double-strand break repair (DSB). However, the type of DNA damage that induces TRF2 localization to the damage sites, the requirement for DNA damage-induced phosphorylation of TRF2 for its recruitment, as well as the detailed kinetics of TRF2 accumulation at DNA damage sites have not been fully investigated. In order to address these questions, we used an ultrafast femtosecond multiphoton laser and a continuous wave 405-nm single photon laser to induce DNA damage at defined nuclear locations. Our results showed that DNA damage produced by a femtosecond multiphoton laser was sufficient for localization of TRF2 to these DNA damage sites. We also demonstrate that ectopically expressed TRF2 was recruited to DNA lesions created by a 405-nm laser. Our data suggest that ATM and DNA-PKcs kinases are not required for TRF2 localization to DNA damage sites. Furthermore, we found that phosphorylation of TRF2 at residue T188 was not essential for its recruitment to laser-induced DNA damage sites. Thus, we provide further evidence that a protein known to function in telomere maintenance, TRF2, is recruited to sites of DNA damage and plays critical roles in the DNA damage response. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

    PubMed Central

    Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

    2002-01-01

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

  8. DNA Replication Is Required for Circadian Clock Function by Regulating Rhythmic Nucleosome Composition.

    PubMed

    Liu, Xiao; Dang, Yunkun; Matsu-Ura, Toru; He, Yubo; He, Qun; Hong, Christian I; Liu, Yi

    2017-07-20

    Although the coupling between circadian and cell cycles allows circadian clocks to gate cell division and DNA replication in many organisms, circadian clocks were thought to function independently of cell cycle. Here, we show that DNA replication is required for circadian clock function in Neurospora. Genetic and pharmacological inhibition of DNA replication abolished both overt and molecular rhythmicities by repressing frequency (frq) gene transcription. DNA replication is essential for the rhythmic changes of nucleosome composition at the frq promoter. The FACT complex, known to be involved in histone disassembly/reassembly, is required for clock function and is recruited to the frq promoter in a replication-dependent manner to promote replacement of histone H2A.Z by H2A. Finally, deletion of H2A.Z uncoupled the dependence of the circadian clock on DNA replication. Together, these results establish circadian clock and cell cycle as interdependent coupled oscillators and identify DNA replication as a critical process in the circadian mechanism. Published by Elsevier Inc.

  9. [Effect of Mn(II) on the error-prone DNA polymerase iota activity in extracts from human normal and tumor cells].

    PubMed

    Lakhin, A V; Efremova, A S; Makarova, I V; Grishina, E E; Shram, S I; Tarantul, V Z; Gening, L V

    2013-01-01

    The DNA polymerase iota (Pol iota), which has some peculiar features and is characterized by an extremely error-prone DNA synthesis, belongs to the group of enzymes preferentially activated by Mn2+ instead of Mg2+. In this work, the effect of Mn2+ on DNA synthesis in cell extracts from a) normal human and murine tissues, b) human tumor (uveal melanoma), and c) cultured human tumor cell lines SKOV-3 and HL-60 was tested. Each group displayed characteristic features of Mn-dependent DNA synthesis. The changes in the Mn-dependent DNA synthesis caused by malignant transformation of normal tissues are described. It was also shown that the error-prone DNA synthesis catalyzed by Pol iota in extracts of all cell types was efficiently suppressed by an RNA aptamer (IKL5) against Pol iota obtained in our work earlier. The obtained results suggest that IKL5 might be used to suppress the enhanced activity of Pol iota in tumor cells.

  10. Regulated Eukaryotic DNA Replication Origin Firing with Purified Proteins

    PubMed Central

    Yeeles, Joseph T.P.; Deegan, Tom D.; Janska, Agnieszka; Early, Anne; Diffley, John F. X.

    2016-01-01

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric MCM complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45, MCM, GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4 dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication. PMID:25739503

  11. Regulated eukaryotic DNA replication origin firing with purified proteins.

    PubMed

    Yeeles, Joseph T P; Deegan, Tom D; Janska, Agnieszka; Early, Anne; Diffley, John F X

    2015-03-26

    Eukaryotic cells initiate DNA replication from multiple origins, which must be tightly regulated to promote precise genome duplication in every cell cycle. To accomplish this, initiation is partitioned into two temporally discrete steps: a double hexameric minichromosome maintenance (MCM) complex is first loaded at replication origins during G1 phase, and then converted to the active CMG (Cdc45-MCM-GINS) helicase during S phase. Here we describe the reconstitution of budding yeast DNA replication initiation with 16 purified replication factors, made from 42 polypeptides. Origin-dependent initiation recapitulates regulation seen in vivo. Cyclin-dependent kinase (CDK) inhibits MCM loading by phosphorylating the origin recognition complex (ORC) and promotes CMG formation by phosphorylating Sld2 and Sld3. Dbf4-dependent kinase (DDK) promotes replication by phosphorylating MCM, and can act either before or after CDK. These experiments define the minimum complement of proteins, protein kinase substrates and co-factors required for regulated eukaryotic DNA replication.

  12. SIRT6 stabilizes DNA-dependent Protein Kinase at chromatin for DNA double-strand break repair

    PubMed Central

    McCord, Ronald A.; Michishita, Eriko; Hong, Tao; Berber, Elisabeth; Boxer, Lisa D.; Kusumoto, Rika; Guan, Shenheng; Shi, Xiaobing; Gozani, Or; Burlingame, Alma L.; Bohr, Vilhelm A.; Chua, Katrin F.

    2009-01-01

    The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor with chromatin impacts on the efficiency of repair, and establish a link between chromatin regulation, DNA repair, and a mammalian Sir2 factor. PMID:20157594

  13. Mitochondrial fusion increases the mitochondrial DNA copy number in budding yeast.

    PubMed

    Hori, Akiko; Yoshida, Minoru; Ling, Feng

    2011-05-01

    Mitochondrial fusion plays an important role in mitochondrial DNA (mtDNA) maintenance, although the underlying mechanisms are unclear. In budding yeast, certain levels of reactive oxygen species (ROS) can promote recombination-mediated mtDNA replication, and mtDNA maintenance depends on the homologous DNA pairing protein Mhr1. Here, we show that the fusion of isolated yeast mitochondria, which can be monitored by the bimolecular fluorescence complementation-derived green fluorescent protein (GFP) fluorescence, increases the mtDNA copy number in a manner dependent on Mhr1. The fusion event, accompanied by the degradation of dissociated electron transport chain complex IV and transient reductions in the complex IV subunits by the inner membrane AAA proteases such as Yme1, increases ROS levels. Analysis of the initial stage of mitochondrial fusion in early log-phase cells produced similar results. Moreover, higher ROS levels in mitochondrial fusion-deficient mutant cells increased the amount of newly synthesized mtDNA, resulting in increases in the mtDNA copy number. In contrast, reducing ROS levels in yme1 null mutant cells significantly decreased the mtDNA copy number, leading to an increase in cells lacking mtDNA. Our results indicate that mitochondrial fusion induces mtDNA synthesis by facilitating ROS-triggered, recombination-mediated replication and thereby prevents the generation of mitochondria lacking DNA. © 2011 The Authors. Journal compilation © 2011 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  14. KDM1A triggers androgen-induced miRNA transcription via H3K4me2 demethylation and DNA oxidation.

    PubMed

    Yang, Shu; Zhang, Jiyuan; Zhang, Yalong; Wan, Xuechao; Zhang, Congzhe; Huang, Xiaohui; Huang, Wenhua; Pu, Honglei; Pei, Chaohan; Wu, Hai; Huang, Yan; Huang, Shengdong; Li, Yao

    2015-06-15

    Androgen receptor (AR) is a ligand dependent transcription factor that regulates the transcription of target genes. AR activity is closely involved in the maintenance and progression of prostate cancer. After the binding with androgen, AR moves into nucleus and binds to DNA sequence containing androgen response elements (ARE). Flavin-dependent monoamine oxidase KDM1A is necessary for AR driven transcription while the mechanism remains unclear. The association between androgen-dependent transcription and oxidation was tested through pharmaceutical inhibitions and siRNA knockdown of DNA oxidation repair components in prostate cancer cells. The recruitment of involved proteins and the histone methylation dynamics on ARE region was explored by chromatin immunoprecipitation (ChIP). Oxidation inhibition reduced AR dependent expression of KLK3, TMPRSS2, hsa-miR-125b2, and hsa-miR-133b. And such reduction could be restored by H2 O2 treatment. KDM1A recruitment and H3K4me2 demethylation on ARE regions, which produce H2 O2 , are associated with AR targets transcription. AR targets transcription and coupled oxidation recruit 8-oxoguanine-DNA glycosylase (OGG1) and the nuclease APEX1 to ARE regions. Such recruitment depends on KDM1A, and is necessary for AR targets transcription. Our work underlined the importance of histone demethylation and DNA oxidation/repairing machinery in androgen-dependent transcription. The present finds have implications for research into new druggable targets for prostate cancer relying on the cascade of AR activity regulation. © 2015 Wiley Periodicals, Inc.

  15. Induction of a G1-S checkpoint in fission yeast.

    PubMed

    Bøe, Cathrine A; Krohn, Marit; Rødland, Gro Elise; Capiaghi, Christoph; Maillard, Olivier; Thoma, Fritz; Boye, Erik; Grallert, Beáta

    2012-06-19

    Entry into S phase is carefully regulated and, in most organisms, under the control of a G(1)-S checkpoint. We have previously described a G(1)-S checkpoint in fission yeast that delays formation of the prereplicative complex at chromosomal replication origins after exposure to UV light (UVC). This checkpoint absolutely depends on the Gcn2 kinase. Here, we explore the signal for activation of the Gcn2-dependent G(1)-S checkpoint in fission yeast. If some form of DNA damage can activate the checkpoint, deficient DNA repair should affect the length of the checkpoint-induced delay. We find that the cell-cycle delay differs in repair-deficient mutants from that in wild-type cells. However, the duration of the delay depends not only on the repair capacity of the cells, but also on the nature of the repair deficiency. First, the delay is abolished in cells that are deficient in the early steps of repair. Second, the delay is prolonged in repair mutants that fail to complete repair after the incision stage. We conclude that the G(1)-S delay depends on damage to the DNA and that the activating signal derives not from the initial DNA damage, but from a repair intermediate(s). Surprisingly, we find that activation of Gcn2 does not depend on the processing of DNA damage and that activated Gcn2 alone is not sufficient to delay entry into S phase in UVC-irradiated cells. Thus, the G(1)-S delay depends on at least two different inputs.

  16. The dual effects of polar methanolic extract of Hypericum perforatum L. in bladder cancer cells

    NASA Astrophysics Data System (ADS)

    Nseyo, U. O.; Nseyo, O. U.; Shiverick, K. T.; Medrano, T.; Mejia, M.; Stavropoulos, N.; Tsimaris, I.; Skalkos, D.

    2007-02-01

    Introduction and background: We have reported on the polar methanolic fraction (PMF) of Hypericum Perforatum L as a novel photosensitizing agent for photodynamic therapy (PDT) and photodynamic diagnosis (PDD). PMF has been tested in human leukemic cells, HL-60 cells, cord blood hemopoietic progenitor cells, bladder cancers derived from metastatic lymph node (T-24) and primary papillary bladder lesion (RT-4). However, the mechanisms of the effects of PMF on these human cell lines have not been elucidated. We have investigated mechanisms of PMF + light versus PMF-alone (dark experiment) in T-24 human bladder cancer cells. Methods: PMF was prepared from an aerial herb of HPL which was brewed in methanol and extracted with ether and methanol. Stock solutions of PMF were made in DSMO and stored in dark conditions. PMF contains 0.57% hypericin and 2.52% hyperforin. The T24 cell line was obtained from American Type Culture Collection (ATCC). In PDT treatment, PMF (60μg/ml) was incubated with cells, which were excited with laser light (630nm) 24 hours later. Apoptosis was determined by DNA fragmentation/laddering assay. DNA isolation was performed according to the manufacture's instructions with the Kit (Oncogene Kit#AM41). Isolated DNA samples were separated by electrophoresis in 1.5% in agarose gels and bands were visualized by ethidium bromide labeling. The initial cell cycle analysis and phase distribution was by flow cytometry. DNA synthesis was measured by [3H] thymidine incorporation, and cell cycle regulatory proteins were assayed by Western immunoblot. Results: The results of the flow cytometry showed PMF +light induced significant (40%) apoptosis in T24 cells, whereas Light or PMF alone produced little apoptosis. The percentage of cells in G 0/G I phase was decreased by 25% and in G2/M phase by 38%. The main impact was observed on the S phase which was blocked by 78% from the specific photocytotoxic process. DNA laddering analysis showed that PMF (60μg/ml) + light at 630nm induced DNA fragmentation in a light dose-dependent manner; in contrast, PMF or light alone did not induce DNA fragmentation. In separate experiments, PMF alone treatment produced a dose-dependent DNA synthesis with a 90% inhibition at a concentration of 25μg/ml (IC90 = 25μg/ml). Expression of p53 and p27 cell cycle regulatory proteins was not altered by PMF alone, however, a dose-dependent increase in p21 expression was observed that correlates with PMF concentrations. Cyclin A and cyclin B protein levels showed a clear decrease inverse to the concentration of PMF. In the absence of light treatment, flow cytometry analysis showed that PMF alone results in G 0/G I cell cycle arrest, with a 2-fold increase in G 0/G I cells concomitant with 50% decrease in cells in both S and G II/M phases. However, flow cytometry on PMF alone-treated cells did not show sub G 0/G I peak, further evidence of the lack of apoptosis as a mechanism of effect of PMF in the dark. Conclusions: With respect to light treatment, apoptosis appears to play a vital role in PDT-induced cytotoxicity. The flow cytometry and DNA laddering results revealed that T24 cells demonstrated apoptotic responses in PMF-mediated PDT. Experiments conducted with PMF alone showed a dose-dependent inhibition of DNA synthesis associated with G 0/G I cell cycle arrest and the extract is able to coordinate changes in key cell cycle regulatory proteins in human bladder cancer cells. Both experimental conditions suggest PMF as a potent and effect anti-proliferative agent in cancer chemoprevention and therapy of human urothelial carcinoma cells.

  17. Repatriation and Identification of Finnish World War II Soldiers

    PubMed Central

    Palo, Jukka U.; Hedman, Minttu; Söderholm, Niklas; Sajantila, Antti

    2007-01-01

    Aim To present a summary of the organization, field search, repatriation, forensic anthropological examination, and DNA analysis for the purpose of identification of Finnish soldiers with unresolved fate in World War II. Methods Field searches were organized, executed, and financed by the Ministry of Education and the Association for Cherishing the Memory of the Dead of the War. Anthropological examination conducted on human remains retrieved in the field searches was used to establish the minimum number of individuals and description of the skeletal diseases, treatment, anomalies, or injuries. DNA tests were performed by extracting DNA from powdered bones and blood samples from relatives. Mitochondrial DNA (mtDNA) sequence comparisons, together with circumstantial evidence, were used to connect the remains to the putative family members. Results At present, the skeletal remains of about a thousand soldiers have been found and repatriated. In forensic anthropological examination, several injuries related to death were documented. For the total of 181 bone samples, mtDNA HVR-1 and HVR-2 sequences were successfully obtained for 167 (92.3%) and 148 (81.8%) of the samples, respectively. Five samples yielded no reliable sequence data. Our data suggests that mtDNA preserves at least for 60 years in the boreal acidic soil. The quality of the obtained mtDNA sequence data varied depending on the sample bone type, with long compact bones (femur, tibia and humerus) having significantly better (90.0%) success rate than other bones (51.2%). Conclusion Although more than 60 years have passed since the World War II, our experience is that resolving the fate of soldiers missing in action is still of uttermost importance for people having lost their relatives in the war. Although cultural and individual differences may exist, our experience presented here gives a good perspective on the importance of individual identification performed by forensic professionals. PMID:17696308

  18. Hypoxia induced DNA damage in children with isolated septal defect and septal defect with great vessel anomaly of heart.

    PubMed

    G, Vidya; H Y, Suma; Bhat B, Vishnu; Chand, Parkash; Rao K, Ramachandra

    2014-04-01

    In Congenital Heart Disease (CHD), shunting of blood occurs through the anatomical defects which lead to mixing of oxygenated and deoxygenated blood. Chronic hypoxia which occurs due to the above said mechanism has the potency to cause DNA damage in children with CHD. In chronic hypoxia, there is a liberation of Reactive Oxygen Species (ROS) due to tissue injury as a result of ischemia and induction of hypoxia inducible factor - 1HIF-1 and p53 which in turn activates pro-apoptotic factors leading to alteration in the regulation of pro-apoptotic gene Blc-2 to be involved in causing the DNA damage. The extent of chronic hypoxia and the DNA damage depends on the nature of the anatomical heart defect. Hence, the present case-control study was conducted to find out the DNA damage in children with isolated septal defect and septal defect with great vessel anomaly of heart and to compare the same. The study group was categorized into those with isolated septal defects and septal defects associated with great vessel anomaly based on echo-cardiogram. Age and sex matched healthy children were taken as controls. Single-cell gel electrophoresis - Comet Assay of Alkaline Version was performed conventionally and the comets were analyzed using comet score software. The comet metrics was found to be statistically significant in children with isolated septal defect and septal defect with great vessel anomaly when compared with that of the controls. In addition, comet metrics also showed significantly increased DNA damage among children with septal defects associated with great vessel anomaly when compared to isolated septal defects. The data strongly suggests a linear correlation of severity of the anomaly involved with the degree of DNA damage as evidenced by lesser extent of DNA damage in isolated septal defect and greater in septal defect with great vessel anomaly.

  19. Regulating DNA Self-assembly by DNA-Surface Interactions.

    PubMed

    Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

    2017-12-14

    DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Chemo-mechanical pushing of proteins along single-stranded DNA

    PubMed Central

    Sokoloski, Joshua E.; Kozlov, Alexander G.; Galletto, Roberto; Lohman, Timothy M.

    2016-01-01

    Single-stranded (ss)DNA binding (SSB) proteins bind with high affinity to ssDNA generated during DNA replication, recombination, and repair; however, these SSBs must eventually be displaced from or reorganized along the ssDNA. One potential mechanism for reorganization is for an ssDNA translocase (ATP-dependent motor) to push the SSB along ssDNA. Here we use single molecule total internal reflection fluorescence microscopy to detect such pushing events. When Cy5-labeled Escherichia coli (Ec) SSB is bound to surface-immobilized 3′-Cy3–labeled ssDNA, a fluctuating FRET signal is observed, consistent with random diffusion of SSB along the ssDNA. Addition of Saccharomyces cerevisiae Pif1, a 5′ to 3′ ssDNA translocase, results in the appearance of isolated, irregularly spaced saw-tooth FRET spikes only in the presence of ATP. These FRET spikes result from translocase-induced directional (5′ to 3′) pushing of the SSB toward the 3′ ssDNA end, followed by displacement of the SSB from the DNA end. Similar ATP-dependent pushing events, but in the opposite (3′ to 5′) direction, are observed with EcRep and EcUvrD (both 3′ to 5′ ssDNA translocases). Simulations indicate that these events reflect active pushing by the translocase. The ability of translocases to chemo-mechanically push heterologous SSB proteins along ssDNA provides a potential mechanism for reorganization and clearance of tightly bound SSBs from ssDNA. PMID:27185951

  1. The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

    PubMed

    Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

    1999-05-01

    Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

  2. Importin-7 Mediates Nuclear Trafficking of DNA in Mammalian Cells

    PubMed Central

    Dhanoya, Arjun; Wang, Tse; Keshavarz-Moore, Eli; Fassati, Ariberto; Chain, Benjamin M

    2013-01-01

    Eukaryotic cells have the ability to uptake and transport endogenous and exogenous DNA in their nuclei, however little is known about the specific pathways involved. Here we show that the nuclear transport receptor importin 7 (imp7) supports nuclear import of supercoiled plasmid DNA and human mitochondrial DNA in a Ran and energy-dependent way. The imp7-dependent pathway was specifically competed by excess DNA but not by excess of maltose-binding protein fused with the classical nuclear localizing signal (NLS) or the M9 peptides. Transport of DNA molecules complexed with poly-l-lysine was impaired in intact cells depleted of imp7, and DNA complexes remained localized in the cytoplasm. Poor DNA nuclear import in cells depleted of imp7 directly correlated with lower gene expression levels in these cells compared to controls. Inefficient nuclear import of transfected DNA induced greater upregulation of the interferon pathway, suggesting that rapid DNA nuclear import may prevent uncontrolled activation of the innate immune response. Our results provide evidence that imp7 is a non-redundant component of an intrinsic pathway in mammalian cells for efficient accumulation of exogenous and endogenous DNA in the nucleus, which may be critical for the exchange of genetic information between mitochondria and nuclear genomes and to control activation of the innate immune response. PMID:23067392

  3. Experimental mapping of DNA duplex shape enabled by global lineshape analyses of a nucleotide-independent nitroxide probe

    PubMed Central

    Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.

    2014-01-01

    Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920

  4. Sequence2Vec: a novel embedding approach for modeling transcription factor binding affinity landscape.

    PubMed

    Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

    2017-11-15

    An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  5. An ATR-dependent function for the Ddx19 RNA helicase in nuclear R-loop metabolism.

    PubMed

    Hodroj, Dana; Recolin, Bénédicte; Serhal, Kamar; Martinez, Susan; Tsanov, Nikolay; Abou Merhi, Raghida; Maiorano, Domenico

    2017-05-02

    Coordination between transcription and replication is crucial in the maintenance of genome integrity. Disturbance of these processes leads to accumulation of aberrant DNA:RNA hybrids (R-loops) that, if unresolved, generate DNA damage and genomic instability. Here we report a novel, unexpected role for the nucleopore-associated mRNA export factor Ddx19 in removing nuclear R-loops formed upon replication stress or DNA damage. We show, in live cells, that Ddx19 transiently relocalizes from the nucleopore to the nucleus upon DNA damage, in an ATR/Chk1-dependent manner, and that Ddx19 nuclear relocalization is required to clear R-loops. Ddx19 depletion induces R-loop accumulation, proliferation-dependent DNA damage and defects in replication fork progression. Further, we show that Ddx19 resolves R-loops in vitro via its helicase activity. Furthermore, mutation of a residue phosphorylated by Chk1 in Ddx19 disrupts its interaction with Nup214 and allows its nuclear relocalization. Finally, we show that Ddx19 operates in resolving R-loops independently of the RNA helicase senataxin. Altogether these observations put forward a novel, ATR-dependent function for Ddx19 in R-loop metabolism to preserve genome integrity in mammalian cells. © 2017 The Authors.

  6. Plasticity of BRCA2 Function in Homologous Recombination: Genetic Interactions of the PALB2 and DNA Binding Domains

    PubMed Central

    Siaud, Nicolas; Lam, Isabel; Christ, Nicole; Schlacher, Katharina; Xia, Bing; Jasin, Maria

    2011-01-01

    The breast cancer suppressor BRCA2 is essential for the maintenance of genomic integrity in mammalian cells through its role in DNA repair by homologous recombination (HR). Human BRCA2 is 3,418 amino acids and is comprised of multiple domains that interact with the RAD51 recombinase and other proteins as well as with DNA. To gain insight into the cellular function of BRCA2 in HR, we created fusions consisting of various BRCA2 domains and also introduced mutations into these domains to disrupt specific protein and DNA interactions. We find that a BRCA2 fusion peptide deleted for the DNA binding domain and active in HR is completely dependent on interaction with the PALB2 tumor suppressor for activity. Conversely, a BRCA2 fusion peptide deleted for the PALB2 binding domain is dependent on an intact DNA binding domain, providing a role for this conserved domain in vivo; mutagenesis suggests that both single-stranded and double-stranded DNA binding activities in the DNA binding domain are required for its activity. Given that PALB2 itself binds DNA, these results suggest alternative mechanisms to deliver RAD51 to DNA. In addition, the BRCA2 C terminus contains both RAD51-dependent and -independent activities which are essential to HR in some contexts. Finally, binding the small peptide DSS1 is essential for activity when its binding domain is present, but not when it is absent. Our results reveal functional redundancy within the BRCA2 protein and emphasize the plasticity of this large protein built for optimal HR function in mammalian cells. The occurrence of disease-causing mutations throughout BRCA2 suggests sub-optimal HR from a variety of domain modulations. PMID:22194698

  7. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  8. Significance of phosphatase and tensin homologue (PTEN), O(6)-methylguanine-DNA methyltransferase (MGMT), and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) protein expression in gynaecomastia.

    PubMed

    Zhu, L; Liu, Z; Yang, J; Cai, J

    2009-01-01

    This study was designed to investigate the pathogenesis of gynaecomastia by measuring phosphatase and tensin homologue (PTEN), O(6)-methylguanine-DNA methyltransferase (MGMT) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) protein in breast tissue specimens from 68 patients with gynaecomastia and 24 normal male controls using immunohistochemical staining. The gynaecomastia cases were divided into three different histological types: florid, intermediate and fibrous. The PTEN, MGMT and DNA-PKcs proteins were detected in both gynaecomastia and normal breast tissue, but the levels of immunohistochemical staining of each protein were significantly lower in gynaecomastia breast tissue than in normal breast tissue. There were also significant differences in the levels of immunohistochemical staining for the three proteins according to gynaecomastia histological type. These results suggest that abnormally low levels of PTEN, MGMT and DNA-PKcs protein in gynaecomastia breast tissue may play a role in the development of gynaecomastia. Further research is required to elucidate fully their individual roles in the pathophysiology of gynaecomastia.

  9. A functional cancer genomics screen identifies a druggable synthetic lethal interaction between MSH3 and PRKDC.

    PubMed

    Dietlein, Felix; Thelen, Lisa; Jokic, Mladen; Jachimowicz, Ron D; Ivan, Laura; Knittel, Gero; Leeser, Uschi; van Oers, Johanna; Edelmann, Winfried; Heukamp, Lukas C; Reinhardt, H Christian

    2014-05-01

    Here, we use a large-scale cell line-based approach to identify cancer cell-specific mutations that are associated with DNA-dependent protein kinase catalytic subunit (DNA-PKcs) dependence. For this purpose, we profiled the mutational landscape across 1,319 cancer-associated genes of 67 distinct cell lines and identified numerous genes involved in homologous recombination-mediated DNA repair, including BRCA1, BRCA2, ATM, PAXIP, and RAD50, as being associated with non-oncogene addiction to DNA-PKcs. Mutations in the mismatch repair gene MSH3, which have been reported to occur recurrently in numerous human cancer entities, emerged as the most significant predictors of DNA-PKcs addiction. Concordantly, DNA-PKcs inhibition robustly induced apoptosis in MSH3-mutant cell lines in vitro and displayed remarkable single-agent efficacy against MSH3-mutant tumors in vivo. Thus, we here identify a therapeutically actionable synthetic lethal interaction between MSH3 and the non-homologous end joining kinase DNA-PKcs. Our observations recommend DNA-PKcs inhibition as a therapeutic concept for the treatment of human cancers displaying homologous recombination defects.

  10. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-11-28

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  11. A-DNA and B-DNA: Comparing Their Historical X-Ray Fiber Diffraction Images

    ERIC Educational Resources Information Center

    Lucas, Amand A.

    2008-01-01

    A-DNA and B-DNA are two secondary molecular conformations (among other allomorphs) that double-stranded DNA drawn into a fiber can assume, depending on the relative water content and other chemical parameters of the fiber. They were the first two forms to be observed by X-ray fiber diffraction in the early 1950s, respectively by Wilkins and…

  12. A DNA enzyme that cleaves RNA

    NASA Technical Reports Server (NTRS)

    Breaker, R. R.; Joyce, G. F.; Hoyce, G. F. (Principal Investigator)

    1994-01-01

    BACKGROUND: Several types of RNA enzymes (ribozymes) have been identified in biological systems and generated in the laboratory. Considering the variety of known RNA enzymes and the similarity of DNA and RNA, it is reasonable to imagine that DNA might be able to function as an enzyme as well. No such DNA enzyme has been found in nature, however. We set out to identify a metal-dependent DNA enzyme using in vitro selection methodology. RESULTS: Beginning with a population of 10(14) DNAs containing 50 random nucleotides, we carried out five successive rounds of selective amplification, enriching for individuals that best promote the Pb(2+)-dependent cleavage of a target ribonucleoside 3'-O-P bond embedded within an otherwise all-DNA sequence. By the fifth round, the population as a whole carried out this reaction at a rate of 0.2 min-1. Based on the sequence of 20 individuals isolated from this population, we designed a simplified version of the catalytic domain that operates in an intermolecular context with a turnover rate of 1 min-1. This rate is about 10(5)-fold increased compared to the uncatalyzed reaction. CONCLUSIONS: Using in vitro selection techniques, we obtained a DNA enzyme that catalyzes the Pb(2+)-dependent cleavage of an RNA phosphoester in a reaction that proceeds with rapid turnover. The catalytic rate compares favorably to that of known RNA enzymes. We expect that other examples of DNA enzymes will soon be forthcoming.

  13. DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

    PubMed

    Keyamura, Kenji; Katayama, Tsutomu

    2011-08-19

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

  14. DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

    PubMed Central

    Keyamura, Kenji; Katayama, Tsutomu

    2011-01-01

    Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

  15. Surface Charge, Electroosmotic Flow and DNA Extension in Chemically Modified Thermoplastic Nanoslits and Nanochannels

    PubMed Central

    Uba, Franklin I.; Pullagurla, Swathi R.; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoonkyoung; Shin, Heungjoo; Soper, Steven A.

    2014-01-01

    Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels. PMID:25369728

  16. Surface charge, electroosmotic flow and DNA extension in chemically modified thermoplastic nanoslits and nanochannels.

    PubMed

    Uba, Franklin I; Pullagurla, Swathi R; Sirasunthorn, Nichanun; Wu, Jiahao; Park, Sunggook; Chantiwas, Rattikan; Cho, Yoon-Kyoung; Shin, Heungjoo; Soper, Steven A

    2015-01-07

    Thermoplastics have become attractive alternatives to glass/quartz for microfluidics, but the realization of thermoplastic nanofluidic devices has been slow in spite of the rather simple fabrication techniques that can be used to produce these devices. This slow transition has in part been attributed to insufficient understanding of surface charge effects on the transport properties of single molecules through thermoplastic nanochannels. We report the surface modification of thermoplastic nanochannels and an assessment of the associated surface charge density, zeta potential and electroosmotic flow (EOF). Mixed-scale fluidic networks were fabricated in poly(methylmethacrylate), PMMA. Oxygen plasma was used to generate surface-confined carboxylic acids with devices assembled using low temperature fusion bonding. Amination of the carboxylated surfaces using ethylenediamine (EDA) was accomplished via EDC coupling. XPS and ATR-FTIR revealed the presence of carboxyl and amine groups on the appropriately prepared surfaces. A modified conductance equation for nanochannels was developed to determine their surface conductance and was found to be in good agreement with our experimental results. The measured surface charge density and zeta potential of these devices were lower than glass nanofluidic devices and dependent on the surface modification adopted, as well as the size of the channel. This property, coupled to an apparent increase in fluid viscosity due to nanoconfinement, contributed to the suppression of the EOF in PMMA nanofluidic devices by an order of magnitude compared to the micro-scale devices. Carboxylated PMMA nanochannels were efficient for the transport and elongation of λ-DNA while these same DNA molecules were unable to translocate through aminated nanochannels.

  17. A Tool for Determining the Number of Contributors: Interpreting Complex, Compromised Low-Template Dna Samples

    DTIC Science & Technology

    2017-09-28

    SECURITY CLASSIFICATION OF: In forensic DNA analysis, the interpretation of a sample acquired from the environment may be dependent upon the...sample acquired from the environment may be dependent upon the assumption on the number of individuals from which the evidence arose. Degraded and...NOCIt results to those obtained when allele counting or maxiumum likelihood estimator (MLE) methods are employed. NOCIt does not depend upon an AT and

  18. Rad51 and RecA juxtapose dsDNA ends ready for DNA ligase-catalyzed end-joining under recombinase-suppressive conditions

    PubMed Central

    Konomura, Naoto; Arai, Naoto; Shinohara, Takeshi; Kobayashi, Jun; Iwasaki, Wakana; Ikawa, Shukuko; Kusano, Kohji; Shibata, Takehiko

    2017-01-01

    RecA-family recombinase-catalyzed ATP-dependent homologous joint formation is critical for homologous recombination, in which RecA or Rad51 binds first to single-stranded (ss)DNA and then interacts with double-stranded (ds)DNA. However, when RecA or Rad51 interacts with dsDNA before binding to ssDNA, the homologous joint-forming activity of RecA or Rad51 is quickly suppressed. We found that under these and adenosine diphosphate (ADP)-generating suppressive conditions for the recombinase activity, RecA or Rad51 at similar optimal concentrations enhances the DNA ligase-catalyzed dsDNA end-joining (DNA ligation) about 30- to 40-fold. The DNA ligation enhancement by RecA or Rad51 transforms most of the substrate DNA into multimers within 2–5 min, and for this enhancement, ADP is the common and best cofactor. Adenosine triphosphate (ATP) is effective for RecA, but not for Rad51. Rad51/RecA-enhanced DNA ligation depends on dsDNA-binding, as shown by a mutant, and is independent of physical interactions with the DNA ligase. These observations demonstrate the common and unique activities of RecA and Rad51 to juxtapose dsDNA-ends in preparation for covalent joining by a DNA ligase. This new in vitro function of Rad51 provides a simple explanation for our genetic observation that Rad51 plays a role in the fidelity of the end-joining of a reporter plasmid DNA, by yeast canonical non-homologous end-joining (NHEJ) in vivo. PMID:27794044

  19. Bifunctional alkylating agent-mediated MGMT-DNA cross-linking and its proteolytic cleavage in 16HBE cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Jin; Ye, Feng; Dan, Guorong

    Nitrogen mustard (NM), a bifunctional alkylating agent (BAA), contains two alkyl arms and can act as a cross-linking bridge between DNA and protein to form a DNA-protein cross-link (DPC). O{sup 6}-methylguanine–DNA methyltransferase (MGMT), a DNA repair enzyme for alkyl adducts removal, is found to enhance cell sensitivity to BAAs and to promote damage, possibly due to its stable covalent cross-linking with DNA mediated by BAAs. To investigate MGMT-DNA cross-link (mDPC) formation and its possible dual roles in NM exposure, human bronchial epithelial cell line 16HBE was subjected to different concentrations of HN2, a kind of NM, and we found mDPCmore » was induced by HN2 in a concentration-dependent manner, but the mRNA and total protein of MGMT were suppressed. As early as 1 h after HN2 treatment, high mDPC was achieved and the level maintained for up to 24 h. Quick total DPC (tDPC) and γ-H2AX accumulation were observed. To evaluate the effect of newly predicted protease DVC1 on DPC cleavage, we applied siRNA of MGMT and DVC1, MG132 (proteasome inhibitor), and NMS-873 (p97 inhibitor) and found that proteolysis plays a role. DVC1 was proven to be more important in the cleavage of mDPC than tDPC in a p97-dependent manner. HN2 exposure induced DVC1 upregulation, which was at least partially contributed to MGMT cleavage by proteolysis because HN2-induced mDPC level and DNA damage was closely related with DVC1 expression. Homologous recombination (HR) was also activated. Our findings demonstrated that MGMT might turn into a DNA damage promoter by forming DPC when exposed to HN2. Proteolysis, especially DVC1, plays a crucial role in mDPC repair. - Highlights: • Nitrogen mustard-induced MGMT-DNA cross-linking was detected in a living cell. • Concentration- and time-dependent manners of MGMT-DNA cross-linking were revealed. • Proteolysis played an important role in protein (MGMT)-DNA cross-linking repair. • DVC1 acts as a proteolytic enzyme in cross-linking repair in a p97-dependent manner.« less

  20. DNA-PKcs, a novel functional target of acriflavine, mediates acriflavine's p53-dependent synergistic anti-tumor efficiency with melphalan.

    PubMed

    Cao, Ji; Lin, Guanyu; Gong, Yanling; Pan, Peichen; Ma, Yaxi; Huang, Ping; Ying, Meidan; Hou, Tingjun; He, Qiaojun; Yang, Bo

    2016-12-01

    Acriflavine (ACF), a known antibacterial drug, has recently been recognized as a suitable candidate for cancer chemotherapy. However, the molecular target of ACF is not fully understood, which limits its application in cancer therapy. In this study, we established a structure-specific probe-based pull-down approach to comprehensively profile the potential target of ACF, and we identified DNA dependent protein kinase catalytic subunit (DNA-PKcs) as the direct target of ACF. Since DNA-PKcs facilitates the repair process following DNA double-strand breaks, we further developed a drug combination strategy that combined ACF with the bifunctional alkylating agent melphalan, which exerted a p53-dependent synergistic efficacy against human cancer cells both in vitro and in vivo. With these findings, our study demonstrated that structure-specific probe-based pull-down approaches can be used to identify new functional target of drug, and provided novel opportunities for the development of ACF-based antitumor chemotherapies. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  1. Activation of cGAS-dependent antiviral responses by DNA intercalating agents.

    PubMed

    Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

    2017-01-09

    Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

    PubMed Central

    Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

    2016-01-01

    Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

  3. UV Light Potentiates STING (Stimulator of Interferon Genes)-dependent Innate Immune Signaling through Deregulation of ULK1 (Unc51-like Kinase 1)*

    PubMed Central

    Kemp, Michael G.; Lindsey-Boltz, Laura A.; Sancar, Aziz

    2015-01-01

    The mechanism by which ultraviolet (UV) wavelengths of sunlight trigger or exacerbate the symptoms of the autoimmune disorder lupus erythematosus is not known but may involve a role for the innate immune system. Here we show that UV radiation potentiates STING (stimulator of interferon genes)-dependent activation of the immune signaling transcription factor interferon regulatory factor 3 (IRF3) in response to cytosolic DNA and cyclic dinucleotides in keratinocytes and other human cells. Furthermore, we find that modulation of this innate immune response also occurs with UV-mimetic chemical carcinogens and in a manner that is independent of DNA repair and several DNA damage and cell stress response signaling pathways. Rather, we find that the stimulation of STING-dependent IRF3 activation by UV is due to apoptotic signaling-dependent disruption of ULK1 (Unc51-like kinase 1), a pro-autophagic protein that negatively regulates STING. Thus, deregulation of ULK1 signaling by UV-induced DNA damage may contribute to the negative effects of sunlight UV exposure in patients with autoimmune disorders. PMID:25792739

  4. A "turn-on" fluorescent copper biosensor based on DNA cleavage-dependent graphene-quenched DNAzyme.

    PubMed

    Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

    2011-06-15

    A novel and promising "turn-on" fluorescent Cu(2+) biosensor is designed based on graphene-DNAzyme catalytic beacon. Due to the essential surface and quenching properties of two-dimensional graphene, it can function as both "scaffold" and "quencher" of the Cu(2+)-dependent DNAzyme, facilitating the formation of self-assembled graphene-quenched DNAzyme complex. However, Cu(2+)-induced catalytic reaction disturbs the graphene-DNAzyme conformation, which will produce internal DNA cleavage-dependent effect. In this case, the quenched fluorescence in graphene-DNAzyme is quickly recovered to a large extent in 15 min. Compared with common DNAzyme-based sensors, the presented graphene-based catalytic beacon greatly improves the signal-to-background ratio, hence increasing the sensitivity (LOD=0.365 nM). Furthermore, the controllable DNA cleavage reaction provides an original and alternative internal method to regulate the interaction between graphene and DNA relative to the previous external sequence-specific hybridization-dependent regulation, which will open new opportunities for nucleic studies and sensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Mitochondrial depolarization in yeast zygotes inhibits clonal expansion of selfish mtDNA.

    PubMed

    Karavaeva, Iuliia E; Golyshev, Sergey A; Smirnova, Ekaterina A; Sokolov, Svyatoslav S; Severin, Fedor F; Knorre, Dmitry A

    2017-04-01

    Non-identical copies of mitochondrial DNA (mtDNA) compete with each other within a cell and the ultimate variant of mtDNA present depends on their relative replication rates. Using yeast Saccharomyces cerevisiae cells as a model, we studied the effects of mitochondrial inhibitors on the competition between wild-type mtDNA and mutant selfish mtDNA in heteroplasmic zygotes. We found that decreasing mitochondrial transmembrane potential by adding uncouplers or valinomycin changes the competition outcomes in favor of the wild-type mtDNA. This effect was significantly lower in cells with disrupted mitochondria fission or repression of the autophagy-related genes ATG8 , ATG32 or ATG33 , implying that heteroplasmic zygotes activate mitochondrial degradation in response to the depolarization. Moreover, the rate of mitochondrially targeted GFP turnover was higher in zygotes treated with uncoupler than in haploid cells or untreated zygotes. Finally, we showed that vacuoles of zygotes with uncoupler-activated autophagy contained DNA. Taken together, our data demonstrate that mitochondrial depolarization inhibits clonal expansion of selfish mtDNA and this effect depends on mitochondrial fission and autophagy. These observations suggest an activation of mitochondria quality control mechanisms in heteroplasmic yeast zygotes. © 2017. Published by The Company of Biologists Ltd.

  6. Proteasome-dependent degradation of replisome components regulates faithful DNA replication.

    PubMed

    Roseaulin, Laura C; Noguchi, Chiaki; Noguchi, Eishi

    2013-08-15

    The replication machinery, or the replisome, collides with a variety of obstacles during the normal process of DNA replication. In addition to damaged template DNA, numerous chromosome regions are considered to be difficult to replicate owing to the presence of DNA secondary structures and DNA-binding proteins. Under these conditions, the replication fork stalls, generating replication stress. Stalled forks are prone to collapse, posing serious threats to genomic integrity. It is generally thought that the replication checkpoint functions to stabilize the replisome and replication fork structure upon replication stress. This is important in order to allow DNA replication to resume once the problem is solved. However, our recent studies demonstrated that some replisome components undergo proteasome-dependent degradation during DNA replication in the fission yeast Schizosaccharomyces pombe. Our investigation has revealed the involvement of the SCF(Pof3) (Skp1-Cullin/Cdc53-F-box) ubiquitin ligase in replisome regulation. We also demonstrated that forced accumulation of the replisome components leads to abnormal DNA replication upon replication stress. Here we review these findings and present additional data indicating the importance of replisome degradation for DNA replication. Our studies suggest that cells activate an alternative pathway to degrade replisome components in order to preserve genomic integrity.

  7. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    NASA Astrophysics Data System (ADS)

    Snodin, Benedict E. K.; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S.; Romano, Flavio; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.; Doye, Jonathan P. K.

    2015-06-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na+] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  8. The role of polymerase III in conjugation between E. coli K12 donor and recipient strains carrying dnaE ts mutation.

    PubMed

    Blinkowa, A

    1976-01-01

    The possible role of DNA polimerase III in conjugation was studied in a series of mutants temperature-sensitive for DNA polymerase III synthesis. The temperature-sensitive DNA mutation called dnaE 486 (ts) prohibits vegetative DNA replication at 41-45 degrees. Transfer of episome and chromosome from temperature-sensitive donor, carrying dnaE mutation to wild-type recipient strains, revertants and dnaE recipients was investigated. In the first two cases the number of Lac+ sexductants being even slightly higher at 43 degrees. Conjugational synthesis accompanying transfer involving the combination of dnaE (ts) thymine dependent and thymine independent donor and recipient strains measured by incorporation of 14C thymine was observed at the restrictive temperature. In the case of conjugation with temperaturesensitive recipient strains a drop of Lac+ sexductants and Pro+ recombinants may be as a result of disturbances in the synthesis of complementary strand in recipient, known to be dependent on pol III. However, the episome investigated by centrifugation in neutral CsC1 gradient after its transfer to the recipient with faulty polymerase III was double stranded (replicated) at the restrictive temperature.

  9. Force-dependent melting of supercoiled DNA at thermophilic temperatures.

    PubMed

    Galburt, E A; Tomko, E J; Stump, W T; Ruiz Manzano, A

    2014-01-01

    Local DNA opening plays an important role in DNA metabolism as the double-helix must be melted before the information contained within may be accessed. Cells finely tune the torsional state of their genomes to strike a balance between stability and accessibility. For example, while mesophilic life forms maintain negatively superhelical genomes, thermophilic life forms use unique mechanisms to maintain relaxed or even positively supercoiled genomes. Here, we use a single-molecule magnetic tweezers approach to quantify the force-dependent equilibrium between DNA melting and supercoiling at high temperatures populated by Thermophiles. We show that negatively supercoiled DNA denatures at 0.5 pN lower tension at thermophilic vs. mesophilic temperatures. This work demonstrates the ability to monitor DNA supercoiling at high temperature and opens the possibility to perform magnetic tweezers assays on thermophilic systems. The data allow for an estimation of the relative energies of base-pairing and DNA bending as a function of temperature and support speculation as to different general mechanisms of DNA opening in different environments. Lastly, our results imply that average in vivo DNA tensions range between 0.3 and 1.1 pN. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. CRISPR adaptation biases explain preference for acquisition of foreign DNA

    PubMed Central

    Yosef, Ido; Auster, Oren; Manor, Miriam; Amitai, Gil; Edgar, Rotem; Qimron, Udi; Sorek, Rotem

    2015-01-01

    In the process of CRISPR adaptation, short pieces of DNA (“spacers”) are acquired from foreign elements and integrated into the CRISPR array. It so far remained a mystery how spacers are preferentially acquired from the foreign DNA while the self chromosome is avoided. Here we show that spacer acquisition is replication-dependent, and that DNA breaks formed at stalled replication forks promote spacer acquisition. Chromosomal hotspots of spacer acquisition were confined by Chi sites, which are sequence octamers highly enriched on the bacterial chromosome, suggesting that these sites limit spacer acquisition from self DNA. We further show that the avoidance of “self” is mediated by the RecBCD dsDNA break repair complex. Our results suggest that in E. coli, acquisition of new spacers depends on RecBCD-mediated processing of dsDNA breaks occurring primarily at replication forks, and that the preference for foreign DNA is achieved through the higher density of Chi sites on the self chromosome, in combination with the higher number of forks on the foreign DNA. This model explains the strong preference to acquire spacers from both high copy plasmids and phages. PMID:25874675

  11. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including thosemore » corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.« less

  12. Phage Lambda P Protein: Trans-Activation, Inhibition Phenotypes and their Suppression

    PubMed Central

    Hayes, Sidney; Erker, Craig; Horbay, Monique A.; Marciniuk, Kristen; Wang, Wen; Hayes, Connie

    2013-01-01

    The initiation of bacteriophage λ replication depends upon interactions between the oriλ DNA site, phage proteins O and P, and E. coli host replication proteins. P exhibits a high affinity for DnaB, the major replicative helicase for unwinding double stranded DNA. The concept of P-lethality relates to the hypothesis that P can sequester DnaB and in turn prevent cellular replication initiation from oriC. Alternatively, it was suggested that P-lethality does not involve an interaction between P and DnaB, but is targeted to DnaA. P-lethality is assessed by examining host cells for transformation by ColE1-type plasmids that can express P, and the absence of transformants is attributed to a lethal effect of P expression. The plasmid we employed enabled conditional expression of P, where under permissive conditions, cells were efficiently transformed. We observed that ColE1 replication and plasmid establishment upon transformation is extremely sensitive to P, and distinguish this effect from P-lethality directed to cells. We show that alleles of dnaB protect the variant cells from P expression. P-dependent cellular filamentation arose in ΔrecA or lexA[Ind-] cells, defective for SOS induction. Replication propagation and restart could represent additional targets for P interference of E. coli replication, beyond the oriC-dependent initiation step. PMID:23389467

  13. Variety of DNA Replication Activity Among Cyanobacteria Correlates with Distinct Respiration Activity in the Dark.

    PubMed

    Ohbayashi, Ryudo; Yamamoto, Jun-Ya; Watanabe, Satoru; Kanesaki, Yu; Chibazakura, Taku; Miyagishima, Shin-Ya; Yoshikawa, Hirofumi

    2017-02-01

    Cyanobacteria exhibit light-dependent cell growth since most of their cellular energy is obtained by photosynthesis. In Synechococcus elongatus PCC 7942, one of the model cyanobacteria, DNA replication depends on photosynthetic electron transport. However, the critical signal for the regulatory mechanism of DNA replication has not been identified. In addition, conservation of this regulatory mechanism has not been investigated among cyanobacteria. To understand this regulatory signal and its dependence on light, we examined the regulation of DNA replication under both light and dark conditions among three model cyanobacteria, S. elongatus PCC 7942, Synechocystis sp. PCC 6803 and Anabaena sp. PCC 7120. Interestingly, DNA replication activity in Synechocystis and Anabaena was retained when cells were transferred to the dark, although it was drastically decreased in S. elongatus. Glycogen metabolism and respiration were higher in Synechocystis and Anabaena than in S. elongatus in the dark. Moreover, DNA replication activity in Synechocystis and Anabaena was reduced to the same level as that in S. elongatus by inhibition of respiratory electron transport after transfer to the dark. These results demonstrate that there is disparity in DNA replication occurring in the dark among cyanobacteria, which is caused by the difference in activity of respiratory electron transport. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. The budding yeast Rad9 checkpoint protein is subjected to Mec1/Tel1-dependent hyperphosphorylation and interacts with Rad53 after DNA damage.

    PubMed

    Vialard, J E; Gilbert, C S; Green, C M; Lowndes, N F

    1998-10-01

    The Saccharomyces cerevisiae RAD9 checkpoint gene is required for transient cell-cycle arrests and transcriptional induction of DNA repair genes in response to DNA damage. Polyclonal antibodies raised against the Rad9 protein recognized several polypeptides in asynchronous cultures, and in cells arrested in S or G2/M phases while a single form was observed in G1-arrested cells. Treatment with various DNA damaging agents, i.e. UV, ionizing radiation or methyl methane sulfonate, resulted in the appearance of hypermodified forms of the protein. All modifications detected during a normal cell cycle and after DNA damage were sensitive to phosphatase treatment, indicating that they resulted from phosphorylation. Damage-induced hyperphosphorylation of Rad9 correlated with checkpoint functions (cell-cycle arrest and transcriptional induction) and was cell-cycle stage- and progression-independent. In asynchronous cultures, Rad9 hyperphosphorylation was dependent on MEC1 and TEL1, homologues of the ATR and ATM genes. In G1-arrested cells, damage-dependent hyperphosphorylation required functional MEC1 in addition to RAD17, RAD24, MEC3 and DDC1, demonstrating cell-cycle stage specificity of the checkpoint genes in this response to DNA damage. Analysis of checkpoint protein interactions after DNA damage revealed that Rad9 physically associates with Rad53.

  15. Reactive oxygen species regulate DNA copy number in isolated yeast mitochondria by triggering recombination-mediated replication.

    PubMed

    Hori, Akiko; Yoshida, Minoru; Shibata, Takehiko; Ling, Feng

    2009-02-01

    Mitochondrial DNA (mtDNA) encodes proteins that are essential for cellular ATP production. Reactive oxygen species (ROS) are respiratory byproducts that damage mtDNA and other cellular components. In Saccharomyces cerevisiae, the oxidized base excision-repair enzyme Ntg1 introduces a double-stranded break (DSB) at the mtDNA replication origin ori5; this DSB initiates the rolling-circle mtDNA replication mediated by the homologous DNA pairing protein Mhr1. Thus, ROS may play a role in the regulation of mtDNA copy number. Here, we show that the treatment of isolated mitochondria with low concentrations of hydrogen peroxide increased mtDNA copy number in an Ntg1- and Mhr1-dependent manner. This treatment elevated the DSB levels at ori5 of hypersuppressive [rho(-)] mtDNA only if Ntg1 was active. In vitro Ntg1-treatment of hypersuppressive [rho(-)] mtDNA extracted from hydrogen peroxide-treated mitochondria revealed increased oxidative modifications at ori5 loci. We also observed that purified Ntg1 created breaks in single-stranded DNA harboring oxidized bases, and that ori5 loci have single-stranded character. Furthermore, chronic low levels of hydrogen peroxide increased in vivo mtDNA copy number. We therefore propose that ROS act as a regulator of mtDNA copy number, acting through the Mhr1-dependent initiation of rolling-circle replication promoted by Ntg1-induced DSB in the single-stranded regions at ori5.

  16. Identification of hydrolyzable tannins (punicalagin, punicalin and geraniin) as novel inhibitors of hepatitis B virus covalently closed circular DNA.

    PubMed

    Liu, Chunlan; Cai, Dawei; Zhang, Lin; Tang, Wei; Yan, Ran; Guo, Haitao; Chen, Xulin

    2016-10-01

    The development of new agents to target HBV cccDNA is urgently needed because of the limitations of current available drugs for treatment of hepatitis B. By using a cell-based assay in which the production of HBeAg is in a cccDNA-dependent manner, we screened a compound library derived from Chinese herbal remedies for inhibitors against HBV cccDNA. Three hydrolyzable tannins, specifically punicalagin, punicalin and geraniin, emerged as novel anti-HBV agents. These compounds significantly reduced the production of secreted HBeAg and cccDNA in a dose-dependent manner in our assay, without dramatic alteration of viral DNA replication. Furthermore, punicalagin did not affect precore/core promoter activity, pgRNA transcription, core protein expression, or HBsAg secretion. By employing the cell-based cccDNA accumulation and stability assay, we found that these tannins significantly inhibited the establishment of cccDNA and modestly facilitated the degradation of preexisting cccDNA. Collectively, our results suggest that hydrolyzable tannins inhibit HBV cccDNA production via a dual mechanism through preventing the formation of cccDNA and promoting cccDNA decay, although the latter effect is rather minor. These hydrolyzable tannins may serve as lead compounds for the development of new agents to cure HBV infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  18. Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

    PubMed Central

    Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

    2016-01-01

    The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele expression of WRB and ten neighboring genes in several tissues and that trisomy 21 alters DNA methylation in parent-of-origin-dependent and -independent manners. PMID:27100087

  19. Charge Transport in 2D DNA Tunnel Junction Diodes.

    PubMed

    Yoon, Minho; Min, Sung-Wook; Dugasani, Sreekantha Reddy; Lee, Yong Uk; Oh, Min Suk; Anthopoulos, Thomas D; Park, Sung Ha; Im, Seongil

    2017-12-01

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiO x junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiO x ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Electrochemical DNA hybridization sensors based on conducting polymers.

    PubMed

    Rahman, Md Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-02-05

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

  1. Biophysics of protein-DNA interactions and chromosome organization

    PubMed Central

    Marko, John F.

    2014-01-01

    The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039

  2. Self-reference and random sampling approach for label-free identification of DNA composition using plasmonic nanomaterials.

    PubMed

    Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu

    2018-05-09

    The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.

  3. RNA-DNA and DNA-DNA base-pairing at the upstream edge of the transcription bubble regulate translocation of RNA polymerase and transcription rate.

    PubMed

    KIreeva, Maria; Trang, Cyndi; Matevosyan, Gayane; Turek-Herman, Joshua; Chasov, Vitaly; Lubkowska, Lucyna; Kashlev, Mikhail

    2018-06-20

    Translocation of RNA polymerase (RNAP) along DNA may be rate-limiting for transcription elongation. The Brownian ratchet model posits that RNAP rapidly translocates back and forth until the post-translocated state is stabilized by NTP binding. An alternative model suggests that RNAP translocation is slow and poorly reversible. To distinguish between these two models, we take advantage of an observation that pyrophosphorolysis rates directly correlate with the abundance of the pre-translocated fraction. Pyrophosphorolysis by RNAP stabilized in the pre-translocated state by bacteriophage HK022 protein Nun was used as a reference point to determine the pre-translocated fraction in the absence of Nun. The stalled RNAP preferentially occupies the post-translocated state. The forward translocation rate depends, among other factors, on melting of the RNA-DNA base pair at the upstream edge of the transcription bubble. DNA-DNA base pairing immediately upstream from the RNA-DNA hybrid stabilizes the post-translocated state. This mechanism is conserved between E. coli RNAP and S. cerevisiae RNA polymerase II and is partially dependent on the lid domain of the catalytic subunit. Thus, the RNA-DNA hybrid and DNA reannealing at the upstream edge of the transcription bubble emerge as targets for regulation of the transcription elongation rate.

  4. Baicalin benefits the anti-HBV therapy via inhibiting HBV viral RNAs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Hai, E-mail: HHai3552@sina.cn

    Background: Although current antiviral treatments (nucleoside analogs, NAs) for chronic hepatitis B virus (HBV) infection are effective in suppressing HBV-DNA replication, their clinical outcomes can be compromised by the increasing drug resistance and the inefficiency in promoting HBsAg/HBeAg seroconversion. Objectives: In this study, we will explore possible effects and mechanism of a natural product baicalin (BA) with the anti-HBV efficacy of entecavir (ETV), a first-line anti-HBV drug, in HBV-DNA, HBsAg/HBeAg seroconversion and drug-resistance. Methods: The co-effects of BA and ETV were conducted in wild-type/NA-resistance mutant HBV cell lines and DHBV-infected duckling models. HBV-DNA/RNAs, HBsAg/HBeAg, host factors (hepatocyte nuclear factors) weremore » explored for possible anti-HBV mechanism. Results and discussion: BA could significantly enhance and reduced HBsAg and HBeAg in hepG2.2.15, a wild-type HBV cell line. Co-treatment of BA and ETV had a more dramatic effect in NA-resistant HBV{sup rtM204V/rtLl80M} transfected hepG2 cells. Our study further revealed that BA mainly inhibited the production of HBV RNAs (3.5, 2.4, 2.1 kb), the templates for viral proteins and HBV-DNA synthesis. BA blocked HBV RNAs transcription possibly by down-regulating transcription and expression of HBV replication dependent hepatocyte nuclear factors (HNF1α and HNF4α). Thus, BA may benefit the anti-HBV therapy via inhibiting HBV viral RNAs. - Highlights: • Baicalin benefits the anti-HBV therapy. • Baicalin enhances ETV antiviral efficacy and overcomes NA-resistant HBV mutation. • The anti-HBV effect of baicalin is achieved by inhibiting HBV RNAs. • Baicalin down-regulates HBV replication-dependent host factors HNF 1α and HNF 4α.« less

  5. Assessment of genotoxic effects of flumorph by the comet assay in mice organs.

    PubMed

    Zhang, T; Zhao, Q; Zhang, Y; Ning, J

    2014-03-01

    The present study investigated the genotoxic effects of flumorph in various organs (brain, liver, spleen, kidney and sperm) of mice. The DNA damage, measured as comet tail length (µm), was determined using the alkaline comet assay. The comet assay is a sensitive assay for the detection of genotoxicity caused by flumorph using mice as a model. Statistically significant increases in comet assay for both dose-dependent and duration-dependent DNA damage were observed in all the organs assessed. The organs exhibited the maximum DNA damage in 96 h at 54 mg/kg body weight. Brain showed maximum DNA damage followed by spleen > kidney > liver > sperm. Our data demonstrated that flumorph had induced systemic genotoxicity in mammals as it caused DNA damage in all tested vital organs, especially in brain and spleen.

  6. Recognition of the DNA sequence by an inorganic crystal surface

    PubMed Central

    Sampaolese, Beatrice; Bergia, Anna; Scipioni, Anita; Zuccheri, Giampaolo; Savino, Maria; Samorì, Bruno; De Santis, Pasquale

    2002-01-01

    The sequence-dependent curvature is generally recognized as an important and biologically relevant property of DNA because it is involved in the formation and stability of association complexes with proteins. When a DNA tract, intrinsically curved for the periodical recurrence on the same strand of A-tracts phased with the B-DNA periodicity, is deposited on a flat surface, it exposes to that surface either a T- or an A-rich face. The surface of a freshly cleaved mica crystal recognizes those two faces and preferentially interacts with the former one. Statistical analysis of scanning force microscopy (SFM) images provides evidence of this recognition between an inorganic crystal surface and nanoscale structures of double-stranded DNA. This finding could open the way toward the use of the sequence-dependent adhesion to specific crystal faces for nanotechnological purposes. PMID:12361979

  7. Site-Dependent Differences in DNA Methylation and Their Impact on Plant Establishment and Phosphorus Nutrition in Populus trichocarpa.

    PubMed

    Schönberger, Brigitte; Chen, Xiaochao; Mager, Svenja; Ludewig, Uwe

    2016-01-01

    The propagation via clonal stem cuttings is a frequent practice in tree plantations. Despite their clonal origin, the trees establish differently according to weather, temperature and nutrient availability, as well as the presence of various stresses. Here, clonal Populus trichocarpa (cv. Muhle Larson) cuttings from different sites were transferred into a common, fully nutrient supplied environment. Despite identical underlying genetics, stem cuttings derived from sites with lower phosphorus availability established worse, independent of phosphorus (P) level after transplantation. Differential growth of material from the sites was reflected in differences in the whole genome DNA methylome. Methylation differences were sequence context-dependent, but differentially methylated regions (DMRs) were apparently unrelated to P nutrition genes. Despite the undisputed negative general correlation of DNA promoter methylation with gene repression, only few of the top-ranked DMRs resulted in differential gene expression in roots or shoots. However, differential methylation was associated with site-dependent, different total amounts of microRNAs (miRNAs), with few miRNAs sequences directly targeted by differential methylation. Interestingly, in roots and shoots, the miRNA amount was dependent on the previous habitat and changed in roots in a habitat-dependent way under phosphate starvation conditions. Differentially methylated miRNAs, together with their target genes, showed P-dependent expression profiles, indicating miRNA expression differences as a P-related epigenetic modification in poplar. Together with differences in DNA methylation, such epigenetic mechanisms may explain habitat or seasonal memory in perennials and site-dependent growth performances.

  8. Influence of liquid medium and surface morphology on the response of QCM during immobilization and hybridization of short oligonucleotides.

    PubMed

    Ha, Tai Hwan; Kim, Sunhee; Lim, Geunbae; Kim, Kwan

    2004-09-15

    With the goal of developing a quartz crystal microbalance (QCM)-based DNA sensor, we have conducted an in situ QCM study along with fluorescence measurements using oligonucleotides (15-mer) as a model single-stranded DNA (ss-DNA) in two different aqueous buffer solutions; the sequence of 15-mer is a part of iduronate-2-sulphate exon whose mutation is known to cause Hunter syndrome, and the 15-mer is thiolated to be immobilized on the Au-coated quartz substrate. The fluorescence data indicate that the initial immobilization as well as the subsequent hybridization with a complementary strand is hardly dependent on the kind of buffer solution. In contrast, the mass increases deducible from the decrease of QCM frequency via the Sauerbrey equation are 2.7-6.2 and 3.0-4.4 times larger than the actual mass increases, as reflected in the fluorescence measurements, for the immobilization and the subsequent hybridization processes, respectively. Such an overestimation is attributed to the trapping of solvent as well as the formation of quite a rigid hydration layer associated with the higher viscosities and/or densities of the buffer solutions. Another noteworthy observation is the excessively large frequency change that occurs when the gold electrode is deposited in advance with Au nanoparticles. This clearly illustrates that the QCM detection of DNA hybridization is also affected greatly by the surface morphology of the electrode. These enlarged signals are altogether presumed to be advantageous when using a QCM system as an in situ probing device in DNA sensors.

  9. Iron-chelating agent, deferasirox, inhibits neutrophil activation and extracellular trap formation.

    PubMed

    Kono, Mari; Saigo, Katsuyasu; Yamamoto, Shiori; Shirai, Kohei; Iwamoto, Shuta; Uematsu, Tomoko; Takahashi, Takayuki; Imoto, Shion; Hashimoto, Makoto; Minami, Yosuke; Wada, Atsushi; Takenokuchi, Mariko; Kawano, Seiji

    2016-10-01

    Iron-chelating agents, which are frequently prescribed to transfusion-dependent patients, have various useful biological effects in addition to chelation. Reactive oxygen species (ROS) produced by neutrophils can cause pulmonary endothelial cell damage, which can lead to acute lung injury (ALI). We previously reported that deferasirox (DFS), an iron-chelating agent, inhibits phorbol myristate acetate (PMA) or formyl-methionyl-leucyl-phenylalanine (fMLP)-induced ROS production in neutrophils, in vitro. Here, we investigate whether DFS inhibits vacuolization in neutrophils and neutrophil extracellular trap (NET) formation. Human neutrophils were incubated with DFS and stimulated with PMA or fMLP. Human neutrophils were separated from heparinized peripheral blood using density gradient centrifugation, and subsequently incubated with DFS. After 10 minutes, neutrophils were stimulated by PMA or fMLP. Vacuole formation was observed by electron microscopy. For observing NET formations using microscopes, immunohistological analyses using citrullinated histone H3 and myeloperoxidase antibodies, and SYTOX Green (an impermeable DNA detection dye) staining, were conducted. NET formation was measured as the quantity of double-stranded DNA (dsDNA), using the AccuBlue Broad Range dsDNA Quantitation Kit. DFS (50 μmol/L) inhibited vacuole formation in the cytoplasm and NET formation. Additionally, 5-100 μmol/L concentration of DFS inhibited the release of dsDNA in a dose-independent manner. We demonstrate that DFS inhibits not only ROS production but also vacuolization and NET formation in neutrophils. These results suggest the possibility of protective effects of DFS against NET-related adverse effects, including ALI and thrombosis. © 2016 John Wiley & Sons Australia, Ltd.

  10. A macroscopic and microscopic study of radon exposure using Geant4 and MCNPX to estimate dose rates and DNA damage

    NASA Astrophysics Data System (ADS)

    van den Akker, Mary Evelyn

    Radon is considered the second-leading cause of lung cancer after smoking. Epidemiological studies have been conducted in miner cohorts as well as general populations to estimate the risks associated with high and low dose exposures. There are problems with extrapolating risk estimates to low dose exposures, mainly that the dose-response curve at low doses is not well understood. Calculated dosimetric quantities give average energy depositions in an organ or a whole body, but morphological features of an individual can affect these values. As opposed to human phantom models, Computed Tomography (CT) scans provide unique, patient-specific geometries that are valuable in modeling the radiological effects of the short-lived radon progeny sources. Monte Carlo particle transport code Geant4 was used with the CT scan data to model radon inhalation in the main bronchial bifurcation. The equivalent dose rates are near the lower bounds of estimates found in the literature, depending on source volume. To complement the macroscopic study, simulations were run in a small tissue volume in Geant4-DNA toolkit. As an expansion of Geant4 meant to simulate direct physical interactions at the cellular level, the particle track structure of the radon progeny alphas can be analyzed to estimate the damage that can occur in sensitive cellular structures like the DNA molecule. These estimates of DNA double strand breaks are lower than those found in Geant4-DNA studies. Further refinements of the microscopic model are at the cutting edge of nanodosimetry research.

  11. eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-11-07

    We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

  12. Lack of a p21waf1/cip -dependent G1/S checkpoint in neural stem and progenitor cells after DNA damage in vivo.

    PubMed

    Roque, Telma; Haton, Céline; Etienne, Olivier; Chicheportiche, Alexandra; Rousseau, Laure; Martin, Ludovic; Mouthon, Marc-André; Boussin, François D

    2012-03-01

    The cyclin-dependent kinase inhibitor p21(waf1/cip) mediates the p53-dependent G1/S checkpoint, which is generally considered to be a critical requirement to maintain genomic stability after DNA damage. We used staggered 5-ethynyl-2'deoxyuridine/5-bromo-2'-deoxyuridine double-labeling in vivo to investigate the cell cycle progression and the role of p21(waf1/cip) in the DNA damage response of neural stem and progenitor cells (NSPCs) after exposure of the developing mouse cortex to ionizing radiation. We observed a radiation-induced p21-dependent apoptotic response in migrating postmitotic cortical cells. However, neural stem and progenitor cells (NSPCs) did not initiate a p21(waf1/cip1) -dependent G1/S block and continued to enter S-phase at a similar rate to the non-irradiated controls. The G1/S checkpoint is not involved in the mechanisms underlying the faithful transmission of the NSPC genome and/or the elimination of critically damaged cells. These processes typically involve intra-S and G2/M checkpoints that are rapidly activated after irradiation. p21 is normally repressed in neural cells during brain development except at the G1 to G0 transition. Lack of activation of a G1/S checkpoint and apoptosis of postmitotic migrating cells after DNA damage appear to depend on the expression of p21 in neural cells, since substantial cell-to-cell variations are found in the irradiated cortex. This suggests that repression of p21 during brain development prevents the induction of the G1/S checkpoint after DNA damage. Copyright © 2011 AlphaMed Press.

  13. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    PubMed

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  14. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

    PubMed

    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

    2009-01-01

    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  15. Computational Nanoelectronics: Applications to DNA, Carbon Nanotubes and Nanotransistors

    NASA Technical Reports Server (NTRS)

    Anantram, M. P.; Svizhenko, Alexei; Govindan, T. R.; Govindan, T. R.; Walch, S.; Mehrez, H.

    2003-01-01

    The topics covered by the panels of this viewgraph presentation include phonon scattering, layered structures, DNA as a device, the influence of twist and rise in the DNA molecule, counter-ions, conductance versus length, and intrinsic resonant tunneling.

  16. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy.

    PubMed

    Nayak, Alpana; Suresh, K A

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  17. Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Nayak, Alpana; Suresh, K. A.

    2008-08-01

    We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

  18. Accumulation of p21 proteins at DNA damage sites independent of p53 and core NHEJ factors following irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koike, Manabu, E-mail: m_koike@nirs.go.jp; Yutoku, Yasutomo; Graduate School of Science, Chiba University, Chiba 263-8522

    2011-08-19

    Highlights: {yields} p21 accumulated rapidly at laser-irradiated sites via its C-terminal region. {yields} p21 colocalized with the DSB marker {gamma}-H2AX and the DSB sensor Ku80. {yields} Accumulation of p21 is dependent on PCNA, but not p53 and the NHEJ core factors. {yields} Accumulation activity of p21 was conserved among human and animal cells. {yields} p21 is a useful tool as a detection marker of DNA damaged sites. -- Abstract: The cyclin-dependent kinase (CDK) inhibitor p21 plays key roles in p53-dependent DNA-damage responses, i.e., cell cycle checkpoints, senescence, or apoptosis. p21 might also play a role in DNA repair. p21 focimore » arise at heavy-ion-irradiated DNA-double-strand break (DSB) sites, which are mainly repaired by nonhomologous DNA-end-joining (NHEJ). However, no mechanisms of p21 accumulation at double-strand break (DSB) sites have been clarified in detail. Recent works indicate that Ku70 and Ku80 are essential for the accumulation of other NHEJ core factors, e.g., DNA-PKcs, XRCC4 and XLF, and other DNA damage response factors, e.g., BRCA1. Here, we show that p21 foci arise at laser-irradiated sites in cells from various tissues from various species. The accumulation of EGFP-p21 was detected in not only normal cells, but also transformed or cancer cells. Our results also showed that EGFP-p21 accumulated rapidly at irradiated sites, and colocalized with the DSB marker {gamma}-H2AX and with the DSB sensor protein Ku80. On the other hand, the accumulation occurred in Ku70-, Ku80-, or DNA-PKcs-deficient cell lines and in human papillomavirus 18-positive cells, whereas the p21 mutant without the PCNA-binding region (EGFP-p21(1-146)) failed to accumulate at the irradiated sites. These findings suggest that the accumulation of p21, but not functional p53 and the NHEJ core factors, is dependent on PCNA. These findings also suggest that the accumulation activity of p21 at DNA damaged sites is conserved among human and animal cells, and p21 is a useful tool as a detection marker of DNA damaged sites.« less

  19. Poly(ADP-Ribose) Polymerase-1 and DNA-Dependent Protein Kinase Have Equivalent Roles in Double Strand Break Repair Following Ionizing Radiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mitchell, Jody; Smith, Graeme; Curtin, Nicola J., E-mail: n.j.curtin@ncl.ac.u

    2009-12-01

    Purpose: Radiation-induced DNA double strand breaks (DSBs) are predominantly repaired by nonhomologous end joining (NHEJ), involving DNA-dependent protein kinase (DNA-PK). Poly(ADP-ribose) polymerase-1 (PARP-1), well characterized for its role in single strand break repair, may also facilitate DSB repair. We investigated the activation of these enzymes by differing DNA ends and their interaction in the cellular response to ionizing radiation (IR). Methods and Materials: The effect of PARP and DNA-PK inhibitors (KU-0058684 and NU7441) on repair of IR-induced DSBs was investigated in DNA-PK and PARP-1 proficient and deficient cells by measuring gammaH2AX foci and neutral comets. Complementary in vitro enzyme kineticsmore » assays demonstrated the affinities of DNA-PK and PARP-1 for DSBs with varying DNA termini. Results: DNA-PK and PARP-1 both promoted the fast phase of resolution of IR-induced DSBs in cells. Inactivation of both enzymes was not additive, suggesting that PARP-1 and DNA-PK cooperate within the same pathway to promote DSB repair. The affinities of the two enzymes for oligonucleotides with blunt, 3' GGG or 5' GGG overhanging termini were similar and overlapping (K{sub dapp} = 2.6-6.4nM for DNA-PK; 1.7-4.5nM for PARP-1). DNA-PK showed a slightly greater affinity for overhanging DNA and was significantly more efficient when activated by a 5' GGG overhang. PARP-1 had a preference for blunt-ended DNA and required a separate factor for efficient stimulation by a 5' GGG overhang. Conclusion: DNA-PK and PARP-1 are both required in a pathway facilitating the fast phase of DNA DSB repair.« less

  20. DNA Repair and the Evolution of Transformation in Bacillus Subtilis. II. Role of Inducible Repair

    PubMed Central

    Wojciechowski, M. F.; Hoelzer, M. A.; Michod, R. E.

    1989-01-01

    In Bacillus subtilis, DNA repair and recombination are intimately associated with competence, the physiological state in which the bacterium can bind, take up and recombine exogenous DNA. Previously, we have shown that the homologous DNA transformation rate (ratio of transformants to total cells) increases with increasing UV dosage if cells are transformed after exposure to UV radiation (UV-DNA), whereas the transformation rate decreases if cells are transformed before exposure to UV (DNA-UV). In this report, by using different DNA repair-deficient mutants, we show that the greater increase in transformation rate in UV-DNA experiments than in DNA-UV experiments does not depend upon excision repair or inducible SOS-like repair, although certain quantitative aspects of the response do depend upon these repair systems. We also show that there is no increase in the transformation rate in a UV-DNA experiment when repair and recombination proficient cells are transformed with nonhomologous plasmid DNA, although the results in a DNA-UV experiment are essentially unchanged by using plasmid DNA. We have used din operon fusions as a sensitive means of assaying for the expression of genes under the control of the SOS-like regulon in both competent and noncompetent cell subpopulations as a consequence of competence development and our subsequent experimental treatments. Results indicate that the SOS-like system is induced in both competent and noncompetent subpopulations in our treatments and so should not be a major factor in the differential response in transformation rate observed in UV-DNA and DNA-UV treatments. These results provide further support to the hypothesis that the evolutionary function of competence is to bring DNA into the cell for use as template in the repair of DNA damage. PMID:2497048

  1. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  2. Rad52/Rad59-dependent Recombination as a Means to Rectify Faulty Okazaki Fragment Processing*

    PubMed Central

    Lee, Miju; Lee, Chul-Hwan; Demin, Annie Albert; Munashingha, Palinda Ruvan; Amangyeld, Tamir; Kwon, Buki; Formosa, Tim; Seo, Yeon-Soo

    2014-01-01

    The correct removal of 5′-flap structures by Rad27 and Dna2 during Okazaki fragment maturation is crucial for the stable maintenance of genetic materials and cell viability. In this study, we identified RAD52, a key recombination protein, as a multicopy suppressor of dna2-K1080E, a lethal helicase-negative mutant allele of DNA2 in yeasts. In contrast, the overexpression of Rad51, which works conjointly with Rad52 in canonical homologous recombination, failed to suppress the growth defect of the dna2-K1080E mutation, indicating that Rad52 plays a unique and distinct role in Okazaki fragment metabolism. We found that the recombination-defective Rad52-QDDD/AAAA mutant did not rescue dna2-K1080E, suggesting that Rad52-mediated recombination is important for suppression. The Rad52-mediated enzymatic stimulation of Dna2 or Rad27 is not a direct cause of suppression observed in vivo, as both Rad52 and Rad52-QDDD/AAAA proteins stimulated the endonuclease activities of both Dna2 and Rad27 to a similar extent. The recombination mediator activity of Rad52 was dispensable for the suppression, whereas both the DNA annealing activity and its ability to interact with Rad59 were essential. In addition, we found that several cohesion establishment factors, including Rsc2 and Elg1, were required for the Rad52-dependent suppression of dna2-K1080E. Our findings suggest a novel Rad52/Rad59-dependent, but Rad51-independent recombination pathway that could ultimately lead to the removal of faulty flaps in conjunction with cohesion establishment factors. PMID:24711454

  3. Effect of storage and processing on plasmid, yeast and plant genomic DNA stability in juice from genetically modified oranges.

    PubMed

    Weiss, Julia; Ros-Chumillas, Maria; Peña, Leandro; Egea-Cortines, Marcos

    2007-01-30

    Recombinant DNA technology is an important tool in the development of plant varieties with new favourable features. There is strong opposition towards this technology due to the potential risk of horizontal gene transfer between genetically modified plant material and food-associated bacteria, especially if genes for antibiotic resistance are involved. Since horizontal transfer efficiency depends on size and length of homologous sequences, we investigated the effect of conditions required for orange juice processing on the stability of DNA from three different origins: plasmid DNA, yeast genomic DNA and endogenous genomic DNA from transgenic sweet orange (C. sinensis L. Osb.). Acidic orange juice matrix had a strong degrading effect on plasmid DNA which becomes apparent in a conformation change from supercoiled structure to nicked, linear structure within 5h of storage at 4 degrees C. Genomic yeast DNA was degraded during exposure to acidic orange juice matrix within 4 days, and also the genomic DNA of C. sinensis suffered degradation within 2 days of storage as indicated by amplification results from transgene markers. Standard pasteurization procedures affected DNA integrity depending on the method and time used. Our data show that the current standard industrial procedures to pasteurize orange juice as well as its acidic nature causes a strong degradation of both yeast and endogenous genomic DNA below sizes reported to be suitable for horizontal gene transfer.

  4. Organic extracts of coke oven emissions can induce genetic damage in metabolically competent HepG2 cells.

    PubMed

    Xin, Lili; Wang, Jianshu; Guo, Sifan; Wu, Yanhu; Li, Xiaohai; Deng, Huaxin; Kuang, Dan; Xiao, Wei; Wu, Tangchun; Guo, Huan

    2014-05-01

    Coke oven emissions (COEs) containing various carcinogenic polycyclic aromatic hydrocarbons (PAHs) represent the coal-burning pollution in the air. Organic pollutants in the aerosol and particulate matter of COEs were collected from the bottom, side, and top of a coke oven. The Comet assay and cytokinesis-block micronucleus cytome assay were conducted to analyze the genetic damage of extractable organic matter (EOM) of COEs on HepG2 cells. All the three EOMs could induce significant dose-dependent increases in Olive tail moment, tail DNA, and tail length, micronuclei, nucleoplasmic bridges, and nuclear buds frequencies, which were mostly positively correlated with the total PAHs concentration in each EOM. In conclusion, EOMs of COEs in the three typical working places of coke oven can induce DNA strand breaks and genomic instability in the metabolically competent HepG2 cells. The PAHs in EOMs may be important causative agents for the genotoxic effects of COEs. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Transcriptional response of mysid crustacean, Americamysis bahia, is affected by subchronic exposure to nonylphenol.

    PubMed

    Uchida, Masaya; Hirano, Masashi; Ishibashi, Hiroshi; Kobayashi, Jun; Kagami, Yoshihiro; Koyanagi, Akiko; Kusano, Teruhiko; Koga, Minoru; Arizono, Koji

    2016-11-01

    Nonylphenol (NP) has been classified as an endocrine-disrupting chemical. In this study, we conducted mysid DNA microarray analysis with which has 2240 oligo DNA probes to observe differential gene expressions in mysid crustacean (Americamysis bahia) exposed to 1, 3, 10 and 30 μg/l of NP for 14 days. As a result, we found 31, 27, 39 and 68 genes were differentially expressed in the respective concentrations. Among these genes, the expressions of five particular genes were regulated in a similar manner at all concentrations of the NP exposure. So, we focused on one gene encoding cuticle protein, and another encoding cuticular protein analogous to peritrophins 1-H precursor. These genes were down-regulated by NP exposure in a dose-dependent manner, and it suggested that they were related in a reduction of the number of molting in mysids. Thus, they might become useful molecular biomarker candidates to evaluate molting inhibition in mysids. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Primary DNA damage assessed with the comet assay and comparison to the absorbed dose of diagnostic X-rays in children.

    PubMed

    Milkovic, Durdica; Garaj-Vrhovac, Vera; Ranogajec-Komor, Mária; Miljanic, Saveta; Gajski, Goran; Knezevic, Zeljka; Beck, Natko

    2009-01-01

    The aim of this work is to assess DNA damage in peripheral blood lymphocytes of children prior to and following airway X-ray examinations of the chest using the alkaline comet assay and to compare data with the measured absorbed dose. Twenty children with pulmonary diseases, between the ages of 5 and 14 years, are assessed. Absorbed dose measurements are conducted for posterior-anterior projection on the forehead, thyroid gland, gonads, chest, and back. Doses are measured using thermoluminescent and radiophotoluminescent dosimetry systems. Differences between tail lengths, tail intensity, and tail moments as well as for the long-tailed nuclei before and after exposures are statistically significant and are dependent on the individual. The results demonstrate the usefulness of the comet assay as a measure of X-ray damage to lymphocytes in a clinical setting. Doses measured with both dosimeters show satisfactory agreement (0.01 mSv) and are suitable for dosimetric measurements in X-ray diagnostics.

  7. Metallization of Self-Assembled DNA Templates for Electronic Circuit Fabrication

    NASA Astrophysics Data System (ADS)

    Uprety, Bibek

    This work examines the deposition of metallic and semiconductor elements onto self-assembled DNA templates for the fabrication of nanodevices. Biological molecules like DNA self-assemble into a variety of 2- and 3-D architectures without the need for patterning tools. The templates can also be designed to controllably place functional nanomaterials with molecular precision. These characteristics make DNA an attractive template for fabricating electronic circuits. However, electrically conductive structures are needed for electronic applications. While metallized DNA nanostructures have been demonstrated, the ability to make thin, continuous wires that are electrically conductive still represents a formidable challenge. DNA-templated wires have generally been granular in appearance with a resistivity approximately two to three orders of magnitude higher than that of the bulk material. An improved method for the metallization of DNA origami is examined in this work that addresses these challenges of size, morphology and conductivity of the metallized structure. Specifically, we demonstrated a metallization process that uses gold nanorod seeds followed by anisotropic electroless (autocatalytic) plating to provide improved morphology and greater control of the final metallized width of conducting metal lines. Growth during electroless deposition occurs preferentially in the length direction at a rate that is approximately four times the growth rate in the width direction, which enables fabrication of narrow, continuous wires. The electrical properties of 49 nanowires with widths ranging from 13 nm to 29 nm were characterized, and resistivity values as low as 8.9 x 10-7 -m were measured, which represent some of the smallest nanowires and the lowest resistivity values reported in the literature. The metallization procedure developed on smaller templates was also successfully applied to metallize bigger DNA templates of tens of micrometers in length. In addition, a polymer-assisted annealing process was discovered to possibly improve the resistivity of DNA metal nanowires. Following metallization of bigger DNA origami structures, controlled placement of nanorods on a DNA breadboard to make rectangular, square and T-shaped metallic structures was also demonstrated. For site-specific placement, we modified the surface of the gold nanorods with single-stranded DNA. The rods were then attached to DNA templates via complementary base-pairing between the DNA on the nanorods and the attachment strands engineered into the DNA "breadboard" template. Gaps between the nanorods were then filled controllably via anisotropic plating to make 10 nm diameter continuous metallic structures. Finally, controlled placement of metal (gold) - semiconductor (tellurium) materials on a single DNA origami template was demonstrated. The combination of molecularly directed deposition of different nanomaterials and anisotropic metallization presented in this work represents important progress towards the creation of nanoelectronic devices from self-assembled biological templates.

  8. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  9. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

    PubMed Central

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-01-01

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

  10. Fluorescent DNA-templated silver nanoclusters

    NASA Astrophysics Data System (ADS)

    Lin, Ruoqian

    Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

  11. Environmental Factors Can Influence Mitochondrial Inheritance in the Saccharomyces Yeast Hybrids.

    PubMed

    Hsu, Yu-Yi; Chou, Jui-Yu

    2017-01-01

    Mitochondria play a critical role in the generation of metabolic energy and are crucial for eukaryotic cell survival and proliferation. In most sexual eukaryotes, mitochondrial DNA (mtDNA) is inherited from only one parent in non-Mendelian inheritance in contrast to the inheritance of nuclear DNA. The model organism Saccharomyces cerevisiae is commonly used to study mitochondrial biology. It has two mating types: MATa and MATα. Previous studies have suggested that the mtDNA inheritance patterns in hybrid diploid cells depend on the genetic background of parental strains. However, the underlying mechanisms remain unclear. To elucidate the mechanisms, we examined the effects of environmental factors on the mtDNA inheritance patterns in hybrids obtained by crossing S. cerevisiae with its close relative S. paradoxus. The results demonstrated that environmental factors can influence mtDNA transmission in hybrid diploids, and that the inheritance patterns are strain dependent. The fitness competition assay results showed that the fitness differences can explain the mtDNA inheritance patterns under specific conditions. However, in this study, we found that fitness differences cannot fully be explained by mitochondrial activity in hybrids under stress conditions.

  12. DNA Polymerase in Virions of a Reptilian Type C Virus

    PubMed Central

    Twardzik, Daniel R.; Papas, Takis S.; Portugal, Frank H.

    1974-01-01

    A study was made of the DNA polymerase of reptilian type C virus isolated from Russell's viper spleen cells. Simultaneous detection experiments demonstrated the presence of 70S RNA and RNA-dependent DNA polymerase activity in reptilian type C virions. The endogenous activity was dependent on the addition of all four deoxynucleotide triphosphates and demonstrated an absolute requirement for a divalent cation. The reptilian viral DNA polymerase elutes from phosphocellulose at 0.22 M salt. In this respect, it is similar to the avian (avian myeloblastosis virus; AMV) viral enzyme but is different from the mammalian (Rauscher leukemia virus; RLV) viral enzyme which elutes at 0.4 M salt. The molecular weight of the viper DNA polymerase as estimated from glycerol gradient centrifugation is 109,000. It is a smaller enzyme than the AMV DNA polymerase (180,000 daltons) and somewhat larger than the RLV enzyme (70,000 daltons). A comparison of other properties of the type C reptilian DNA polymerase with the enzyme found in other type C oncogenic viruses is made. PMID:4129837

  13. Competition between B-Z and B-L transitions in a single DNA molecule: Computational studies

    NASA Astrophysics Data System (ADS)

    Kwon, Ah-Young; Nam, Gi-Moon; Johner, Albert; Kim, Seyong; Hong, Seok-Cheol; Lee, Nam-Kyung

    2016-02-01

    Under negative torsion, DNA adopts left-handed helical forms, such as Z-DNA and L-DNA. Using the random copolymer model developed for a wormlike chain, we represent a single DNA molecule with structural heterogeneity as a helical chain consisting of monomers which can be characterized by different helical senses and pitches. By Monte Carlo simulation, where we take into account bending and twist fluctuations explicitly, we study sequence dependence of B-Z transitions under torsional stress and tension focusing on the interaction with B-L transitions. We consider core sequences, (GC) n repeats or (TG) n repeats, which can interconvert between the right-handed B form and the left-handed Z form, imbedded in a random sequence, which can convert to left-handed L form with different (tension dependent) helical pitch. We show that Z-DNA formation from the (GC) n sequence is always supported by unwinding torsional stress but Z-DNA formation from the (TG) n sequence, which are more costly to convert but numerous, can be strongly influenced by the quenched disorder in the surrounding random sequence.

  14. Construction of three-dimensional DNA hydrogels from linear building blocks.

    PubMed

    Nöll, Tanja; Schönherr, Holger; Wesner, Daniel; Schopferer, Michael; Paululat, Thomas; Nöll, Gilbert

    2014-08-04

    A three-dimensional DNA hydrogel was generated by self-assembly of short linear double-stranded DNA (dsDNA) building blocks equipped with sticky ends. The resulting DNA hydrogel is thermoresponsive and the length of the supramolecular dsDNA structures varies with temperature. The average diffusion coefficients of the supramolecular dsDNA structures formed by self-assembly were determined by diffusion-ordered NMR spectroscopy (DOSY NMR) for temperatures higher than 60 °C. Temperature-dependent rheological measurements revealed a gel point of 42±1 °C. Below this temperature, the resulting material behaved as a true gel of high viscosity with values for the storage modulus G' being significantly larger than that for the loss modulus G''. Frequency-dependent rheological measurements at 20 °C revealed a mesh size (ξ) of 15 nm. AFM analysis of the diluted hydrogel in the dry state showed densely packed structures of entangled chains, which are also expected to contain multiple interlocked rings and catenanes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Tumor Suppression by BRCA-1: A Critical Role at DNA Replication Forks

    DTIC Science & Technology

    2006-10-01

    replication defect. We wished to test the hypothesis that BRCA1/BARD1 function during DNA replication supporting DNA transactions at replication forks. We...are using cell-free extracts derived from Xenopus laevis eggs that support: 1. Semi-conservative, cell-cycle regulated DNA replication ; 2. Many facets...complex assembles to chromatin in a DNA replication -dependent manner. Finally, we show that BRCA1/BARD1 loading to chromatin does not dramatically

  16. Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

    PubMed

    Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

    2017-06-15

    Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Sequence-dependent base pair stepping dynamics in XPD helicase unwinding

    PubMed Central

    Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R

    2013-01-01

    Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615

  18. Accelerated age-related cognitive decline and neurodegeneration, caused by deficient DNA repair.

    PubMed

    Borgesius, Nils Z; de Waard, Monique C; van der Pluijm, Ingrid; Omrani, Azar; Zondag, Gerben C M; van der Horst, Gijsbertus T J; Melton, David W; Hoeijmakers, Jan H J; Jaarsma, Dick; Elgersma, Ype

    2011-08-31

    Age-related cognitive decline and neurodegenerative diseases are a growing challenge for our societies with their aging populations. Accumulation of DNA damage has been proposed to contribute to these impairments, but direct proof that DNA damage results in impaired neuronal plasticity and memory is lacking. Here we take advantage of Ercc1(Δ/-) mutant mice, which are impaired in DNA nucleotide excision repair, interstrand crosslink repair, and double-strand break repair. We show that these mice exhibit an age-dependent decrease in neuronal plasticity and progressive neuronal pathology, suggestive of neurodegenerative processes. A similar phenotype is observed in mice where the mutation is restricted to excitatory forebrain neurons. Moreover, these neuron-specific mutants develop a learning impairment. Together, these results suggest a causal relationship between unrepaired, accumulating DNA damage, and age-dependent cognitive decline and neurodegeneration. Hence, accumulated DNA damage could therefore be an important factor in the onset and progression of age-related cognitive decline and neurodegenerative diseases.

  19. Chromosome territories reposition during DNA damage-repair response

    PubMed Central

    2013-01-01

    Background Local higher-order chromatin structure, dynamics and composition of the DNA are known to determine double-strand break frequencies and the efficiency of repair. However, how DNA damage response affects the spatial organization of chromosome territories is still unexplored. Results Our report investigates the effect of DNA damage on the spatial organization of chromosome territories within interphase nuclei of human cells. We show that DNA damage induces a large-scale spatial repositioning of chromosome territories that are relatively gene dense. This response is dose dependent, and involves territories moving from the nuclear interior to the periphery and vice versa. Furthermore, we have found that chromosome territory repositioning is contingent upon double-strand break recognition and damage sensing. Importantly, our results suggest that this is a reversible process where, following repair, chromosome territories re-occupy positions similar to those in undamaged control cells. Conclusions Thus, our report for the first time highlights DNA damage-dependent spatial reorganization of whole chromosomes, which might be an integral aspect of cellular damage response. PMID:24330859

  20. Expression and characterization of a novel reverse transcriptase of the LTR retrotransposon Tf1.

    PubMed

    Kirshenboim, Noa; Hayouka, Zvi; Friedler, Assaf; Hizi, Amnon

    2007-09-30

    The LTR retrotransposon of Schizosacharomyces pombe, Tf1, has several distinctive properties that can be related to the unique properties of its reverse transcriptase (RT). Consequently, we expressed, purified and studied the recombinant Tf1 RT. This monomeric protein possesses all activities typical to RTs: DNA and RNA-dependent DNA polymerase as well as an inherent ribonuclease H. The DNA polymerase activity shows preference to Mn(+)(2) or Mg(+)(2), depending on the substrate used, whereas the ribonuclease H strongly prefers Mn(+)(2). The most outstanding feature of Tf1 RT is its capacity to add non-templated nucleotides to the 3'-ends of the nascent DNA. This is mainly apparent in the presence of Mn(+)(2), as is the noticeable low fidelity of DNA synthesis. In all, Tf1 RT has a marked infidelity in synthesizing DNA at template ends, a phenomenon that can explain, as discussed herein, some of the features of Tf1 replication in the host cells.

  1. The multifaceted influence of histone deacetylases on DNA damage signalling and DNA repair

    PubMed Central

    Roos, Wynand Paul; Krumm, Andrea

    2016-01-01

    Histone/protein deacetylases play multiple roles in regulating gene expression and protein activation and stability. Their deregulation during cancer initiation and progression cause resistance to therapy. Here, we review the role of histone deacetylases (HDACs) and the NAD+ dependent sirtuins (SIRTs) in the DNA damage response (DDR). These lysine deacetylases contribute to DNA repair by base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), non-homologous end joining (NHEJ), homologous recombination (HR) and interstrand crosslink (ICL) repair. Furthermore, we discuss possible mechanisms whereby these histone/protein deacetylases facilitate the switch between DNA double-strand break (DSB) repair pathways, how SIRTs play a central role in the crosstalk between DNA repair and cell death pathways due to their dependence on NAD+, and the influence of small molecule HDAC inhibitors (HDACi) on cancer cell resistance to genotoxin based therapies. Throughout the review, we endeavor to identify the specific HDAC targeted by HDACi leading to therapy sensitization. PMID:27738139

  2. Leucocytes DNA damage in mice exposed to JS-118 by the comet assay.

    PubMed

    Zhang, Tao; Hu, Jiye; Zhang, Yuchao; Zhao, Qianfei; Ning, Jun

    2011-09-01

    JS-118 is an extensively used insecticide in China. The present study investigated the genotoxic effect of JS-118 on whole blood at 24, 48, 72 and 96 h by using alkaline comet assay. Male Kunming mice were given 6.25, 12.5, 25, 50 and 100 mg/kg BW of JS-118 intraperitoneally. A statistically significant increase in all comet parameters indicating DNA damage was observed at 24 h post-treatment (p < 0.05). A clear concentration-dependent increase of DNA damage was revealed as evident by the OTM (arbitrary units), tail length (µm) and tail DNA (%). From 48 h post-treatment, a gradual decrease in mean comet parameters was noted. By 96 h of post-treatment, the mean comet tail length reached control levels indicating repair of damaged DNA. This study on mice showed different DNA damage depending on the concentration of JS-118 and the period of treatment. The present study provided further information of the potential risk of the genetic damage caused by JS-118.

  3. DNA nanoparticles with core-shell morphology.

    PubMed

    Chandran, Preethi L; Dimitriadis, Emilios K; Lisziewicz, Julianna; Speransky, Vlad; Horkay, Ferenc

    2014-10-14

    Mannobiose-modified polyethylenimines (PEI) are used in gene therapy to generate nanoparticles of DNA that can be targeted to the antigen-presenting cells of the immune system. We report that the sugar modification alters the DNA organization within the nanoparticles from homogenous to shell-like packing. The depth-dependent packing of DNA within the nanoparticles was probed using AFM nano-indentation. Unmodified PEI-DNA nanoparticles display linear elastic properties and depth-independent mechanics, characteristic of homogenous materials. Mannobiose-modified nanoparticles, however, showed distinct force regimes that were dependent on indentation depth, with 'buckling'-like response that is reproducible and not due to particle failure. By comparison with theoretical studies of spherical shell mechanics, the structure of mannobiosylated particles was deduced to be a thin shell with wall thickness in the order of few nanometers, and a fluid-filled core. The shell-core structure is also consistent with observations of nanoparticle denting in altered solution conditions, with measurements of nanoparticle water content from AFM images, and with images of DNA distribution in Transmission Electron Microscopy.

  4. Comparison of intracellular drug retention, DNA damage and cytotoxicity of derivatives of doxorubicin and daunorubicin in a human colon adenocarcinoma cell line (LoVo).

    PubMed

    Belvedere, G; Suarato, A; Geroni, C; Giuliani, F C; D'Incalci, M

    1989-11-01

    Formation of DNA single strand breaks (SSB) was assayed by alkaline elution in LoVo cells treated with doxorubicin, daunorubicin and six derivatives of these drugs modified either in the chromophore or the sugar. Seven compounds showed a biphasic relationship (initial increase and then a decrease) for the formation of DNA-SSB over the concentration range 0.05-10 micrograms/ml. At a drug concentration in the range causing an increase of DNA damage very fast repair of DNA-SSB was observed for 4'-deoxydoxorubicin and 4-demethoxydaunorubicin; the kinetics of DNA-SSB investigated after drug removal at a drug concentration reducing DNA-SSB showed a time dependent increase of DNA damage for both drugs although with different patterns. 4'-Deoxydoxorubicin reduced the effect of radiations on the rate of elution of DNA in a way resembling the formation of DNA interstrand cross links (ISC) at concentrations at which DNA-SSB were reduced. DNA-ISC were not produced by chemical reactions occurring during sample processing for alkaline elution and this derivative was not metabolized by LoVo cells. The IC50 of the anthracyclines were on a several log range, though for most of the derivatives the cytotoxicity curve showed a plateau at growth inhibition of about 15-30% at increasing intracellular drug levels. A relationship between DNA damage and cytotoxicity was observed only in a very small range of DNA-SSB. It is likely that the different effects of these anthracyclines on the formation of DNA-SSB depend on a qualitatively different interaction between drug-DNA and topoisomerase II when the drug concentration is raised.

  5. RING finger and WD repeat domain 3 (RFWD3) associates with replication protein A (RPA) and facilitates RPA-mediated DNA damage response.

    PubMed

    Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi

    2011-06-24

    DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.

  6. A study to evaluate the effect of nootropic drug-piracetam on DNA damage in leukocytes and macrophages.

    PubMed

    Singh, Sarika; Goswami, Poonam; Swarnkar, Supriya; Singh, Sheelendra Pratap; Wahajuddin; Nath, Chandishwar; Sharma, Sharad

    2011-11-27

    Piracetam is a nootropic drug that protects neurons in neuropathological and age-related diseases and the activation and modulation of peripheral blood cells in patients with neuropathological conditions is well known. Therefore, in the present study, in vivo, ex vivo, and in vitro tests were conducted to investigate the effect of piracetam on leukocytes and macrophages. Lipopolysaccharide (LPS) causes oxidative DNA damage; thus, in the present study, LPS was used as a tool to induce DNA damage. In vivo experiments were conducted on Sprague Dawley rats, and piracetam (600mg/kg, oral) was provided for five consecutive days. On the fifth day, a single injection of LPS (10mg/kg, i.p.) was administered. Three hours after LPS injection, blood leukocytes and peritoneal macrophages were collected and processed, and a variety of different assays were conducted. Ex vivo treatments were performed on isolated rat blood leukocytes, and in vitro experiments were conducted on rat macrophage cell line J774A.1. Cell viability and the level of reactive oxygen species (ROS), mitochondrial membrane potential (MMP) and DNA damage were estimated in untreated (control) and piracetam-, LPS- and LPS+piracetam-treated leukocytes and macrophages. In vivo experiments revealed that rats pretreated with piracetam were significantly protected against LPS-induced increases in ROS levels and DNA damage. Ex vivo isolated leukocytes and J774A.1 cells treated with LPS exhibited augmented ROS levels and DNA damage, which were attenuated with piracetam treatment. Thus, the present study revealed the salutary effect of piracetam against LPS-induced oxidative stress and DNA damage in leukocytes and macrophages. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Cleavage of an amide bond by a ribozyme

    NASA Technical Reports Server (NTRS)

    Dai, X.; De Mesmaeker, A.; Joyce, G. F.; Miller, S. L. (Principal Investigator)

    1995-01-01

    A variant form of a group I ribozyme, optimized by in vitro evolution for its ability to catalyze magnesium-dependent phosphoester transfer reactions involving DNA substrates, also catalyzes the cleavage of an unactivated alkyl amide when that linkage is presented in the context of an oligodeoxynucleotide analog. Substrates containing an amide bond that joins either two DNA oligos, or a DNA oligo and a short peptide, are cleaved in a magnesium-dependent fashion to generate the expected products. The first-order rate constant, kcat, is 0.1 x 10(-5) min-1 to 1 x 10(-5) min-1 for the DNA-flanked substrates, which corresponds to a rate acceleration of more than 10(3) as compared with the uncatalyzed reaction.

  8. Last stop on the road to repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.

    PubMed

    Nandakumar, Jayakrishnan; Nair, Pravin A; Shuman, Stewart

    2007-04-27

    NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria and essential for growth. Their distinctive substrate specificity and domain organization vis-a-vis human ATP-dependent ligases make them outstanding targets for anti-infective drug discovery. We report here the 2.3 A crystal structure of Escherichia coli LigA bound to an adenylylated nick, which captures LigA in a state poised for strand closure and reveals the basis for nick recognition. LigA envelopes the DNA within a protein clamp. Large protein domain movements and remodeling of the active site orchestrate progression through the three chemical steps of the ligation reaction. The structure inspires a strategy for inhibitor design.

  9. Inhibition of polyomavirus ori-dependent DNA replication by mSin3B.

    PubMed

    Xie, An-Yong; Folk, William R

    2002-12-01

    When tethered in cis to DNA, the transcriptional corepressor mSin3B inhibits polyomavirus (Py) ori-dependent DNA replication in vivo. Histone deacetylases (HDACs) appear not to be involved, since tethering class I and class II HDACs in cis does not inhibit replication and treating the cells with trichostatin A does not specifically relieve inhibition by mSin3B. However, the mSin3B L59P mutation that impairs mSin3B interaction with N-CoR/SMRT abrogates inhibition of replication, suggesting the involvement of N-CoR/SMRT. Py large T antigen interacts with mSin3B, suggesting an HDAC-independent mechanism by which mSin3B inhibits DNA replication.

  10. Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery

    PubMed Central

    Coelho-Castelo, AAM; Trombone, AP; Rosada, RS; Santos, RR; Bonato, VLD; Sartori, A; Silva, CL

    2006-01-01

    In order to assess a new strategy of DNA vaccine for a more complete understanding of its action in immune response, it is important to determine the in vivo biodistribution fate and antigen expression. In previous studies, our group focused on the prophylactic and therapeutic use of a plasmid DNA encoding the Mycobacterium leprae 65-kDa heat shock protein (Hsp65) and achieved an efficient immune response induction as well as protection against virulent M. tuberculosis challenge. In the present study, we examined in vivo tissue distribution of naked DNA-Hsp65 vaccine, the Hsp65 message, genome integration and methylation status of plasmid DNA. The DNA-Hsp65 was detectable in several tissue types, indicating that DNA-Hsp65 disseminates widely throughout the body. The biodistribution was dose-dependent. In contrast, RT-PCR detected the Hsp65 message for at least 15 days in muscle or liver tissue from immunized mice. We also analyzed the methylation status and integration of the injected plasmid DNA into the host cellular genome. The bacterial methylation pattern persisted for at least 6 months, indicating that the plasmid DNA-Hsp65 does not replicate in mammalian tissue, and Southern blot analysis showed that plasmid DNA was not integrated. These results have important implications for the use of DNA-Hsp65 vaccine in a clinical setting and open new perspectives for DNA vaccines and new considerations about the inoculation site and delivery system. PMID:16445866

  11. Significance of DNA bond strength in programmable nanoparticle thermodynamics and dynamics.

    PubMed

    Yu, Qiuyan; Hu, Jinglei; Hu, Yi; Wang, Rong

    2018-04-04

    Assembly of nanoparticles (NPs) coated with complementary DNA strands leads to novel crystals with nanosized basic units rather than classic atoms, ions or molecules. The assembly process is mediated by hybridization of DNA via specific base pairing interaction, and is kinetically linked to the disassociation of DNA duplexes. DNA-level physiochemical quantities, both thermodynamic and kinetic, are key to understanding this process and essential for the design of DNA-NP crystals. The melting transition properties are helpful to judge the thermostability and sensitivity of relative DNA probes or other applications. Three different cases are investigated by changing the linker length and the spacer length on which the melting properties depend using the molecular dynamics method. Melting temperature is determined by sigmoidal melting curves based on hybridization percentage versus temperature and the Lindemann melting rule simultaneously. We provide a computational strategy based on a coarse-grained model to estimate the hybridization enthalpy, entropy and free energy from percentages of hybridizations which are readily accessible in experiments. Importantly, the lifetime of DNA bond dehybridization based on temperature and the activation energy depending on DNA bond strength are also calculated. The simulation results are in good agreement with the theoretical analysis and the present experimental data. Our study provides a good strategy to predict the melting temperature which is important for the DNA-directed nanoparticle system, and bridges the dynamics and thermodynamics of DNA-directed nanoparticle systems by estimating the equilibrium constant from the hybridization of DNA bonds quantitatively.

  12. Cost-effectiveness of human papillomavirus DNA testing in the United Kingdom, The Netherlands, France, and Italy.

    PubMed

    Kim, Jane J; Wright, Thomas C; Goldie, Sue J

    2005-06-15

    European countries with established cytology-based screening programs for cervical cancer will soon face decisions about whether to incorporate human papillomavirus (HPV) DNA testing and what strategies will be most cost-effective. We assessed the cost-effectiveness of incorporating HPV DNA testing into existing cervical cancer screening programs in the United Kingdom, The Netherlands, France, and Italy. We created a computer-based model of the natural history of cervical carcinogenesis for each using country-specific data on cervical cancer risk and compared each country's current screening policy with two new strategies: 1) cytology throughout a woman's lifetime, using HPV DNA testing as a triage strategy for equivocal cytology results ("HPV triage"), as well as 2) cytology until age 30 years and HPV DNA testing in combination with cytology in women more than 30 years of age ("combination testing"). Outcomes included reduction in lifetime cervical cancer risk, increase in life expectancy, lifetime costs, and incremental cost-effectiveness ratios, expressed as cost per year of life saved. We explored alternative protocols and conducted sensitivity analysis on key parameters of the model over a relevant range of values to identify the most cost-effective options for each country. Both HPV DNA testing strategies, HPV triage and combination testing, were more effective than each country's status quo screening policy. Incremental cost-effectiveness ratios for HPV triage were less than $13,000 per year of life saved, whereas those for combination testing ranged from $9800 to $75,900 per year of life saved, depending on screening interval. We identified options that would be very cost-effective (i.e., cost-effectiveness ratio less than the gross domestic product per capita) in each of the four countries. HPV DNA testing has the potential to improve health benefits at a reasonable cost compared with current screening policies in four European countries.

  13. Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

    PubMed

    Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

  14. Ligand-activated PPARα-dependent DNA demethylation regulates the fatty acid β-oxidation genes in the postnatal liver.

    PubMed

    Ehara, Tatsuya; Kamei, Yasutomi; Yuan, Xunmei; Takahashi, Mayumi; Kanai, Sayaka; Tamura, Erina; Tsujimoto, Kazutaka; Tamiya, Takashi; Nakagawa, Yoshimi; Shimano, Hitoshi; Takai-Igarashi, Takako; Hatada, Izuho; Suganami, Takayoshi; Hashimoto, Koshi; Ogawa, Yoshihiro

    2015-03-01

    The metabolic function of the liver changes sequentially during early life in mammals to adapt to the marked changes in nutritional environment. Accordingly, hepatic fatty acid β-oxidation is activated after birth to produce energy from breast milk lipids. However, how it is induced during the neonatal period is poorly understood. Here we show DNA demethylation and increased mRNA expression of the fatty acid β-oxidation genes in the postnatal mouse liver. The DNA demethylation does not occur in the fetal mouse liver under the physiologic condition, suggesting that it is specific to the neonatal period. Analysis of mice deficient in the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) and maternal administration of a PPARα ligand during the gestation and lactation periods reveal that the DNA demethylation is PPARα dependent. We also find that DNA methylation of the fatty acid β-oxidation genes are reduced in the adult human liver relative to the fetal liver. This study represents the first demonstration that the ligand-activated PPARα-dependent DNA demethylation regulates the hepatic fatty acid β-oxidation genes during the neonatal period, thereby highlighting the role of a lipid-sensing nuclear receptor in the gene- and life-stage-specific DNA demethylation of a particular metabolic pathway. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  15. Characterization of DNA polymerase X from Thermus thermophilus HB8 reveals the POLXc and PHP domains are both required for 3'-5' exonuclease activity.

    PubMed

    Nakane, Shuhei; Nakagawa, Noriko; Kuramitsu, Seiki; Masui, Ryoji

    2009-04-01

    The X-family DNA polymerases (PolXs) comprise a highly conserved DNA polymerase family found in all kingdoms. Mammalian PolXs are known to be involved in several DNA-processing pathways including repair, but the cellular functions of bacterial PolXs are less known. Many bacterial PolXs have a polymerase and histidinol phosphatase (PHP) domain at their C-termini in addition to a PolX core (POLXc) domain, and possess 3'-5' exonuclease activity. Although both domains are highly conserved in bacteria, their molecular functions, especially for a PHP domain, are unknown. We found Thermus thermophilus HB8 PolX (ttPolX) has Mg(2+)/Mn(2+)-dependent DNA/RNA polymerase, Mn(2+)-dependent 3'-5' exonuclease and DNA-binding activities. We identified the domains of ttPolX by limited proteolysis and characterized their biochemical activities. The POLXc domain was responsible for the polymerase and DNA-binding activities but exonuclease activity was not detected for either domain. However, the POLXc and PHP domains interacted with each other and a mixture of the two domains had Mn(2+)-dependent 3'-5' exonuclease activity. Moreover, site-directed mutagenesis revealed catalytically important residues in the PHP domain for the 3'-5' exonuclease activity. Our findings provide a molecular insight into the functional domain organization of bacterial PolXs, especially the requirement of the PHP domain for 3'-5' exonuclease activity.

  16. Scanning fluorescence correlation spectroscopy techniques to quantify the kinetics of DNA double strand break repair proteins after γ-irradiation and bleomycin treatment

    PubMed Central

    Abdisalaam, Salim; Davis, Anthony J.; Chen, David J.; Alexandrakis, George

    2014-01-01

    A common feature of DNA repair proteins is their mobilization in response to DNA damage. The ability to visualizing and quantifying the kinetics of proteins localizing/dissociating from DNA double strand breaks (DSBs) via immunofluorescence or live cell fluorescence microscopy have been powerful tools in allowing insight into the DNA damage response, but these tools have some limitations. For example, a number of well-established DSB repair factors, in particular those required for non-homologous end joining (NHEJ), do not form discrete foci in response to DSBs induced by ionizing radiation (IR) or radiomimetic drugs, including bleomycin, in living cells. In this report, we show that time-dependent kinetics of the NHEJ factors Ku80 and DNA-dependent protein kinase catalytic subunits (DNA–PKcs) in response to IR and bleomycin can be quantified by Number and Brightness analysis and Raster-scan Image Correlation Spectroscopy. Fluorescent-tagged Ku80 and DNA–PKcs quickly mobilized in response to IR and bleomycin treatments consistent with prior reports using laser-generated DSBs. The response was linearly dependent on IR dose, and blocking NHEJ enhanced immobilization of both Ku80 and DNA–PKcs after DNA damage. These findings support the idea of using Number and Brightness and Raster-scan Image Correlation Spectroscopy as methods to monitor kinetics of DSB repair proteins in living cells under conditions mimicking radiation and chemotherapy treatments. PMID:24137007

  17. A Dual Role of Caspase-8 in Triggering and Sensing Proliferation-Associated DNA Damage, a Key Determinant of Liver Cancer Development.

    PubMed

    Boege, Yannick; Malehmir, Mohsen; Healy, Marc E; Bettermann, Kira; Lorentzen, Anna; Vucur, Mihael; Ahuja, Akshay K; Böhm, Friederike; Mertens, Joachim C; Shimizu, Yutaka; Frick, Lukas; Remouchamps, Caroline; Mutreja, Karun; Kähne, Thilo; Sundaravinayagam, Devakumar; Wolf, Monika J; Rehrauer, Hubert; Koppe, Christiane; Speicher, Tobias; Padrissa-Altés, Susagna; Maire, Renaud; Schattenberg, Jörn M; Jeong, Ju-Seong; Liu, Lei; Zwirner, Stefan; Boger, Regina; Hüser, Norbert; Davis, Roger J; Müllhaupt, Beat; Moch, Holger; Schulze-Bergkamen, Henning; Clavien, Pierre-Alain; Werner, Sabine; Borsig, Lubor; Luther, Sanjiv A; Jost, Philipp J; Weinlich, Ricardo; Unger, Kristian; Behrens, Axel; Hillert, Laura; Dillon, Christopher; Di Virgilio, Michela; Wallach, David; Dejardin, Emmanuel; Zender, Lars; Naumann, Michael; Walczak, Henning; Green, Douglas R; Lopes, Massimo; Lavrik, Inna; Luedde, Tom; Heikenwalder, Mathias; Weber, Achim

    2017-09-11

    Concomitant hepatocyte apoptosis and regeneration is a hallmark of chronic liver diseases (CLDs) predisposing to hepatocellular carcinoma (HCC). Here, we mechanistically link caspase-8-dependent apoptosis to HCC development via proliferation- and replication-associated DNA damage. Proliferation-associated replication stress, DNA damage, and genetic instability are detectable in CLDs before any neoplastic changes occur. Accumulated levels of hepatocyte apoptosis determine and predict subsequent hepatocarcinogenesis. Proliferation-associated DNA damage is sensed by a complex comprising caspase-8, FADD, c-FLIP, and a kinase-dependent function of RIPK1. This platform requires a non-apoptotic function of caspase-8, but no caspase-3 or caspase-8 cleavage. It may represent a DNA damage-sensing mechanism in hepatocytes that can act via JNK and subsequent phosphorylation of the histone variant H2AX. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  18. Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

    PubMed Central

    Fox, K R; Waring, M J

    1986-01-01

    The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

  19. Hydrodynamic radius fluctuations in model DNA-grafted nanoparticles

    NASA Astrophysics Data System (ADS)

    Vargas-Lara, Fernando; Starr, Francis W.; Douglas, Jack F.

    2016-05-01

    We utilize molecular dynamics simulations (MD) and the path-integration program ZENO to quantify hydrodynamic radius (Rh) fluctuations of spherical symmetric gold nanoparticles (NPs) decorated with single-stranded DNA chains (ssDNA). These results are relevant to understanding fluctuation-induced interactions among these NPs and macromolecules such as proteins. In particular, we explore the effect of varying the ssDNA-grafted NPs structural parameters, such as the chain length (L), chain persistence length (lp), NP core size (R), and the number of chains (N) attached to the nanoparticle core. We determine Rh fluctuations by calculating its standard deviation (σRh) of an ensemble of ssDNA-grafted NPs configurations generated by MD. For the parameter space explored in this manuscript, σR h shows a peak value as a function of N, the amplitude of which depends on L, lp and R, while the broadness depends on R.

  20. Relationship Between Frequency and Deflection Angle in the DNA Prism

    PubMed Central

    Chen, Zhen; Dorfman, Kevin D.

    2013-01-01

    The DNA prism is a modification of the standard pulsed-field electrophoresis protocol to provide a continuous separation, where the DNA are deflected at an angle that depends on their molecular weight. The standard switchback model for the DNA prism predicts a monotonic increase in the deflection angle as a function of the frequency for switching the field until a plateau regime is reached. However, experiments indicate that the deflection angle achieves a maximum value before decaying to a size-independent value at high frequencies. Using Brownian dynamics simulations, we show that the maximum in the deflection angle is related to the reorientation time for the DNA and the decay in deflection angle at high frequencies is due to inadequate stretching. The generic features of the dependence of the deflection angle on molecular weight, switching frequency, and electric field strength explain a number of experimental phenomena. PMID:23410375

  1. Analysis of a four generation family reveals the widespread sequence-dependent maintenance of allelic DNA methylation in somatic and germ cells

    PubMed Central

    Tang, Aifa; Huang, Yi; Li, Zesong; Wan, Shengqing; Mou, Lisha; Yin, Guangliang; Li, Ning; Xie, Jun; Xia, Yudong; Li, Xianxin; Luo, Liya; Zhang, Junwen; Chen, Shen; Wu, Song; Sun, Jihua; Sun, Xiaojuan; Jiang, Zhimao; Chen, Jing; Li, Yingrui; Wang, Jian; Wang, Jun; Cai, Zhiming; Gui, Yaoting

    2016-01-01

    Differential methylation of the homologous chromosomes, a well-known mechanism leading to genomic imprinting and X-chromosome inactivation, is widely reported at the non-imprinted regions on autosomes. To evaluate the transgenerational DNA methylation patterns in human, we analyzed the DNA methylomes of somatic and germ cells in a four-generation family. We found that allelic asymmetry of DNA methylation was pervasive at the non-imprinted loci and was likely regulated by cis-acting genetic variants. We also observed that the allelic methylation patterns for the vast majority of the cis-regulated loci were shared between the somatic and germ cells from the same individual. These results demonstrated the interaction between genetic and epigenetic variations and suggested the possibility of widespread sequence-dependent transmission of DNA methylation during spermatogenesis. PMID:26758766

  2. The role of Pif1p, a DNA helicase in Saccharomyces cerevisiae, in maintaining mitochondrial DNA.

    PubMed

    Cheng, Xin; Dunaway, Stephen; Ivessa, Andreas S

    2007-05-01

    Mitochondrial DNA (mtDNA) is highly susceptible to oxidative and chemically induced damage, and these insults lead to a number of diseases. In Saccharomyces cerevisiae, the DNA helicase Pif1p is localized to the nucleus and mitochondria. We show that pif1 mutant cells are sensitive to ethidium bromide-induced damage and this mtDNA is prone to fragmentation. We also show that Pif1p associates with mtDNA. In pif1 mutant cells, mtDNA breaks at specific sites that exhibit Pif1-dependent recombination. We conclude that Pif1p participates in the protection from double-stranded (ds) DNA breaks or alternatively in the repair process of dsDNA breaks in mtDNA.

  3. Population Dynamics of Viral Inactivation

    NASA Astrophysics Data System (ADS)

    Freeman, Krista; Li, Dong; Behrens, Manja; Streletzky, Kiril; Olsson, Ulf; Evilevitch, Alex

    We have investigated the population dynamics of viral inactivation in vitrousing time-resolved cryo electron microscopy combined with light and X-ray scattering techniques. Using bacteriophage λ as a model system for pressurized double-stranded DNA viruses, we found that virions incubated with their cell receptor eject their genome in a stochastic triggering process. The triggering of DNA ejection occurs in a non synchronized manner after the receptor addition, resulting in an exponential decay of the number of genome-filled viruses with time. We have explored the characteristic time constant of this triggering process at different temperatures, salt conditions, and packaged genome lengths. Furthermore, using the temperature dependence we determined an activation energy for DNA ejections. The dependences of the time constant and activation energy on internal DNA pressure, affected by salt conditions and encapsidated genome length, suggest that the triggering process is directly dependent on the conformational state of the encapsidated DNA. The results of this work provide insight into how the in vivo kinetics of the spread of viral infection are influenced by intra- and extra cellular environmental conditions. This material is based upon work supported by the National Science Foundation Graduate Research Fellowship under Grant No. DGE-1252522.

  4. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    PubMed Central

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  5. Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

    PubMed Central

    On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

    2014-01-01

    Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

  6. Impact of point-mutations on the hybridization affinity of surface-bound DNA/DNA and RNA/DNA oligonucleotide-duplexes: Comparison of single base mismatches and base bulges

    PubMed Central

    Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht

    2008-01-01

    Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387

  7. 7 CFR 550.18 - Assurances/certifications.

    Code of Federal Regulations, 2011 CFR

    2011-01-01

    .... (f) Recombinant DNA research requirements. The Cooperator assures that it will assume primary responsibility for implementing proper conduct on recombinant DNA research and it will comply with the National Institute of Health Guidelines for Recombinant DNA Research, as revised. (1) If the Cooperator wishes to...

  8. 7 CFR 550.18 - Assurances/certifications.

    Code of Federal Regulations, 2012 CFR

    2012-01-01

    .... (f) Recombinant DNA research requirements. The Cooperator assures that it will assume primary responsibility for implementing proper conduct on recombinant DNA research and it will comply with the National Institute of Health Guidelines for Recombinant DNA Research, as revised. (1) If the Cooperator wishes to...

  9. 7 CFR 550.18 - Assurances/certifications.

    Code of Federal Regulations, 2013 CFR

    2013-01-01

    .... (f) Recombinant DNA research requirements. The Cooperator assures that it will assume primary responsibility for implementing proper conduct on recombinant DNA research and it will comply with the National Institute of Health Guidelines for Recombinant DNA Research, as revised. (1) If the Cooperator wishes to...

  10. 7 CFR 550.18 - Assurances/certifications.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    .... (f) Recombinant DNA research requirements. The Cooperator assures that it will assume primary responsibility for implementing proper conduct on recombinant DNA research and it will comply with the National Institute of Health Guidelines for Recombinant DNA Research, as revised. (1) If the Cooperator wishes to...

  11. Interaction of BRCA1 With the DNA-Dependent Protein Kinase

    DTIC Science & Technology

    2004-09-01

    involved in mounting an innate immune response to bacterial DNA and to viral infection. For a detailed review see (1). The most important role of DNA-PK...arise within the cell, DNA double-strand breaks (DSBs) are particularly dangerous as they can lead to cell death or cancer if improperly repaired...DNA-PK is known to associate with and phosphorylate (Shao et al., 1999). Methods Cell culture and drug treatments HeLa and normal human skin

  12. Negative supercoiling of DNA by gyrase is inhibited in Salmonella enterica serovar Typhimurium during adaptation to acid stress.

    PubMed

    Colgan, Aoife M; Quinn, Heather J; Kary, Stefani C; Mitchenall, Lesley A; Maxwell, Anthony; Cameron, Andrew D S; Dorman, Charles J

    2018-03-01

    DNA in intracellular Salmonella enterica serovar Typhimurium relaxes during growth in the acidified (pH 4-5) macrophage vacuole and DNA relaxation correlates with the upregulation of Salmonella genes involved in adaptation to the macrophage environment. Bacterial ATP levels did not increase during adaptation to acid pH unless the bacterium was deficient in MgtC, a cytoplasmic-membrane-located inhibitor of proton-driven F 1 F 0 ATP synthase activity. Inhibiting ATP binding by DNA gyrase and topo IV with novobiocin enhanced the effect of low pH on DNA relaxation. Bacteria expressing novobiocin-resistant (Nov R ) derivatives of gyrase or topo IV also exhibited DNA relaxation at acid pH, although further relaxation with novobiocin was not seen in the strain with Nov R gyrase. Thus, inhibition of the negative supercoiling activity of gyrase was the primary cause of enhanced DNA relaxation in drug-treated bacteria. The Salmonella cytosol reaches pH 5-6 in response to an external pH of 4-5: the ATP-dependent DNA supercoiling activity of purified gyrase was progressively inhibited by lowering the pH in this range, as was the ATP-dependent DNA relaxation activity of topo IV. We propose that DNA relaxation in Salmonella within macrophage is due to acid-mediated impairment of the negative supercoiling activity of gyrase. © 2018 John Wiley & Sons Ltd.

  13. DNA recombination activity in soybean mitochondria.

    PubMed

    Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

    2006-02-17

    Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

  14. Bacterial DNA induces pulmonary damage via TLR-9 through cross-talk with neutrophils.

    PubMed

    Itagaki, Kiyoshi; Adibnia, Yasaman; Sun, Shiqin; Zhao, Cong; Sursal, Tolga; Chen, Yu; Junger, Wolfgang; Hauser, Carl J

    2011-12-01

    Bacterial DNA (bDNA) contains hypomethylated "CpG" repeats that can be recognized by Toll-like receptor 9 (TLR-9) as a pathogen-associated molecular pattern. The ability of bDNA to initiate lung injury via TLR-9 has been inferred on the basis of studies using artificial CpG DNA. But the role of authentic bDNA in lung injury is still unknown. Moreover, the mechanisms by which CpG DNA species can lead to pulmonary injury are unknown, although neutrophils (PMNs) are thought to play a key role in the genesis of septic acute lung injury. We evaluated the effects of bDNA on PMN-endothelial cell (EC) interactions thought critical for initiation of acute lung injury. Using a biocapacitance system to monitor real-time changes in endothelial permeability, we demonstrate here that bDNA causes EC permeability in a dose-dependent manner uniquely in the presence of PMNs. These permeability changes are inhibited by chloroquine, suggesting TLR-9 dependency. When PMNs were preincubated with bDNA and applied to ECs or when bDNA was applied to ECs without PMNs, no permeability changes were detected. To study the underlying mechanisms, we evaluated the effects of bDNA on PMN-EC adherence. Bacterial DNA significantly increased PMN adherence to ECs in association with upregulated adhesion molecules in both cell types. Taken together, our results strongly support the conclusion that bDNA can initiate lung injury by stimulating PMN-EC adhesive interactions predisposing to endothelial permeability. Bacterial DNA stimulation of TLR-9 appears to promote enhanced gene expression of adhesion molecules in both cell types. This leads to PMN-EC cross-talk, which is required for injury to occur.

  15. DNA-dependent protein kinase (DNA-PK)-deficient human glioblastoma cells are preferentially sensitized by Zebularine

    PubMed Central

    Meador, Jarah A.; Su, Yanrong; Ravanat, Jean-Luc; Balajee, Adayabalam S.

    2010-01-01

    Brain tumor cells respond poorly to radiotherapy and chemotherapy due to inherently efficient anti-apoptotic and DNA repair mechanisms. This necessitates the development of new strategies for brain cancer therapy. Here, we report that the DNA-demethylating agent Zebularine preferentially sensitizes the killing of human glioblastomas deficient in DNA-dependent protein kinase (DNA-PK). In contrast to DNA-PK-proficient human glioblastoma cells (MO59K), cytotoxicity assay with increasing Zebularine concentrations up to 300 μM resulted in a specific elevation of cell killing in DNA-PK-deficient MO59J cells. Further, an elevated frequency of polyploid cells observed in MO59J cells after Zebularine treatment pointed out a deficiency in mitotic checkpoint control. Existence of mitotic checkpoint deficiency in MO59J cells was confirmed by the abnormal centrosome number observed in Zebularine-treated MO59J cells. Although depletion of DNA methyltransferase 1 by Zebularine occurred at similar levels in both cell lines, MO59J cells displayed increased extent of DNA demethylation detected both at the gene promoter-specific level and at the genome overall level. Consistent with increased sensitivity, deoxy-Zebularine adduct level in the genomic DNA was 3- to 6-fold higher in MO59J than in MO59K cells. Elevated micronuclei frequency observed after Zebularine treatment in MO59J cells indicates the impairment of DNA repair response in MO59J cells. Collectively, our study suggests that DNA-PK is the major determining factor for cellular response to Zebularine. PMID:19933707

  16. Site-Dependent Differences in DNA Methylation and Their Impact on Plant Establishment and Phosphorus Nutrition in Populus trichocarpa

    PubMed Central

    Schönberger, Brigitte; Chen, Xiaochao; Mager, Svenja

    2016-01-01

    The propagation via clonal stem cuttings is a frequent practice in tree plantations. Despite their clonal origin, the trees establish differently according to weather, temperature and nutrient availability, as well as the presence of various stresses. Here, clonal Populus trichocarpa (cv. Muhle Larson) cuttings from different sites were transferred into a common, fully nutrient supplied environment. Despite identical underlying genetics, stem cuttings derived from sites with lower phosphorus availability established worse, independent of phosphorus (P) level after transplantation. Differential growth of material from the sites was reflected in differences in the whole genome DNA methylome. Methylation differences were sequence context-dependent, but differentially methylated regions (DMRs) were apparently unrelated to P nutrition genes. Despite the undisputed negative general correlation of DNA promoter methylation with gene repression, only few of the top-ranked DMRs resulted in differential gene expression in roots or shoots. However, differential methylation was associated with site-dependent, different total amounts of microRNAs (miRNAs), with few miRNAs sequences directly targeted by differential methylation. Interestingly, in roots and shoots, the miRNA amount was dependent on the previous habitat and changed in roots in a habitat-dependent way under phosphate starvation conditions. Differentially methylated miRNAs, together with their target genes, showed P-dependent expression profiles, indicating miRNA expression differences as a P-related epigenetic modification in poplar. Together with differences in DNA methylation, such epigenetic mechanisms may explain habitat or seasonal memory in perennials and site-dependent growth performances. PMID:27992519

  17. --RNA Polymerase II Transcription Attenuation at the Yeast DNA Repair Gene, DEF1, Involves Sen1-Dependent and Polyadenylation Site-Dependent Termination.

    PubMed

    Whalen, Courtney; Tuohy, Christine; Tallo, Thomas; Kaufman, James W; Moore, Claire; Kuehner, Jason N

    2018-04-23

    Termination of RNA Polymerase II (Pol II) activity serves a vital cellular function by separating ubiquitous transcription units and influencing RNA fate and function. In the yeast Saccharomyces cerevisiae , Pol II termination is carried out by cleavage and polyadenylation factor (CPF-CF) and Nrd1-Nab3-Sen1 (NNS) complexes, which operate primarily at mRNA and non-coding RNA genes, respectively. Premature Pol II termination (attenuation) contributes to gene regulation, but there is limited knowledge of its prevalence and biological significance. In particular, it is unclear how much crosstalk occurs between CPF-CF and NNS complexes and how Pol II attenuation is modulated during stress adaptation. In this study, we have identified an attenuator in the DEF1 DNA repair gene, which includes a portion of the 5'-untranslated region (UTR) and upstream open reading frame (ORF). Using a plasmid-based reporter gene system, we conducted a genetic screen of 14 termination mutants and their ability to confer Pol II read-through defects. The DEF1 attenuator behaved as a hybrid terminator, relying heavily on CPF-CF and Sen1 but without Nrd1 and Nab3 involvement. Our genetic selection identified 22 cis -acting point mutations that clustered into four regions, including a polyadenylation site efficiency element that genetically interacts with its cognate binding-protein Hrp1. Outside of the reporter gene context, a DEF1 attenuator mutant increased mRNA and protein expression, exacerbating the toxicity of a constitutively active Def1 protein. Overall, our data support a biologically significant role for transcription attenuation in regulating DEF1 expression, which can be modulated during the DNA damage response. Copyright © 2018, G3: Genes, Genomes, Genetics.

  18. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay

    PubMed Central

    Nickson, Catherine M.; Parsons, Jason L.

    2014-01-01

    Base excision repair (BER) is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss, and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionizing radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation) in the regulation of cellular levels of BER proteins, and that subtle changes (∼20–50%) in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumor suppressor protein ARF, and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A–DDB1–STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA repair capacity. PMID:25076968

  19. Characterization of the human pH- and PKA-activated ClC-2G(2 alpha) Cl- channel.

    PubMed

    Sherry, A M; Stroffekova, K; Knapp, L M; Kupert, E Y; Cuppoletti, J; Malinowska, D H

    1997-08-01

    A ClC-2G(2 alpha) Cl- channel was identified to be present in human lung and stomach, and a partial cDNA for this Cl- channel was cloned from a human fetal lung library. A full-length expressible human ClC-2G(2 alpha) cDNA was constructed by ligation of mutagenized expressible rabbit ClC-2G(2 alpha) cDNA with the human lung ClC-2G(2 alpha) cDNA, expressed in oocytes, and characterized at the single-channel level. Adenosine 3',5'-cyclic monophosphate-dependent protein kinase (PKA) treatment increased the probability of opening of the channel (Po). After PKA activation, the channel exhibited a linear (r = 0.99) current-voltage curve with a slope conductance of 22.1 +/- 0.8 pS in symmetric 800 mM tetraethylammonium chloride (TEACl; pH 7.4). Under fivefold gradient conditions of TEACl, a reversal potential of +21.5 +/- 2.8 mV was measured demonstrating anion-to-cation discrimination. As previously demonstrated for the rabbit ClC-2G(2 alpha) Cl- channel, the human analog, hClC-2G(2 alpha), was active at pH 7.4 as well as when the pH of the extracellular face of the channel (trans side of the bilayer; pHtrans) was asymmetrically reduced to pH 3.0. The extent of PKA activation was dependent on pHtrans. With PKA treatment, Po increased fourfold with a pHtrans of 7.4 and eightfold with a pHtrans of 3.0. Effects of sequential PKA addition followed by pHtrans reduction on the same channel suggested that the PKA- and pH-dependent increases in channel Po were separable and cumulative. Northern analysis showed ClC-2G(2 alpha) mRNA to be present in human adult and fetal lung and adult stomach, and quantitative reverse transcriptase-polymerase chain reaction showed this channel to be present in the adult human lung and stomach at about one-half the level found in fetal lung. The findings of the present study suggest that the ClC-2G(2 alpha) Cl- channel may play an important role in Cl- transport in the fetal and adult human lung.

  20. Surface Coverage and Structure of Mixed DNA/Alkylthiol Monolayers on Gold: Characterization by XPS, NEXAFS, and Fluorescence Intensity Measurements

    PubMed Central

    Lee, Chi-Ying; Gong, Ping; Harbers, Gregory M.; Grainger, David W.; Castner, David G.; Gamble, Lara J.

    2006-01-01

    Self-assembly of thiol-terminated single-stranded DNA (HS-ssDNA) on gold has served as an important model system for DNA immobilization at surfaces. Here, we report a detailed study of the surface composition and structure of mixed self-assembled DNA monolayers containing a short alkylthiol surface diluent [11-mercapto-1-undecanol (MCU)] on gold supports. These mixed DNA monolayers were studied with X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine structure spectroscopy (NEXAFS), and fluorescence intensity measurements. XPS results on sequentially adsorbed DNA/MCU monolayers on gold indicated that adsorbed MCU molecules first incorporate into the HS-ssDNA monolayer and, upon longer MCU exposures, displace adsorbed HS-ssDNA molecules from the surface. Thus, HS-ssDNA surface coverage steadily decreased with MCU exposure time. Polarization-dependent NEXAFS and fluorescence results both show changes in signals consistent with changes in DNA orientation after only 30 min of MCU exposure. NEXAFS polarization dependence (followed by monitoring the N 1s → π* transition) of the mixed DNA monolayers indicated that the DNA nucleotide base ring structures are oriented more parallel to the gold surface compared to DNA bases in pure HS-ssDNA monolayers. This indicates that HS-ssDNA oligomers reorient toward a more-upright position upon MCU incorporation. Fluorescence intensity results using end-labeled DNA probes on gold show little observable fluorescence on pure HS-ssDNA monolayers, likely due to substrate quenching effects between the fluorophore and the gold. MCU diluent incorporation into HS-ssDNA monolayers initially increases DNA fluorescence signal by densifying the chemisorbed monolayer, prompting an upright orientation of the DNA, and moving the terminal fluorophore away from the substrate. Immobilized DNA probe density and DNA target hybridization in these mixed DNA monolayers, as well as effects of MCU diluent on DNA hybridization in complex milieu (i.e., serum) were characterized by surface plasmon resonance (SPR) and 32P-radiometric assays and reported in a related study PMID:16689533

  1. Repair kinetics of DNA double-strand breaks and incidence of apoptosis in mouse neural stem/progenitor cells and their differentiated neurons exposed to ionizing radiation.

    PubMed

    Kashiwagi, Hiroki; Shiraishi, Kazunori; Sakaguchi, Kenta; Nakahama, Tomoya; Kodama, Seiji

    2018-05-01

    Neuronal loss leads to neurodegenerative disorders, including Alzheimer's disease, Parkinson's disease and Huntington's disease. Because of their long lifespans, neurons are assumed to possess highly efficient DNA repair ability and to be able to protect themselves from deleterious DNA damage such as DNA double-strand breaks (DSBs) produced by intrinsic and extrinsic sources. However, it remains largely unknown whether the DSB repair ability of neurons is more efficient compared with that of other cells. Here, we investigated the repair kinetics of X-ray-induced DSBs in mouse neural cells by scoring the number of phosphorylated 53BP1 foci post irradiation. We found that p53-independent apoptosis was induced time dependently during differentiation from neural stem/progenitor cells (NSPCs) into neurons in culture for 48 h. DSB repair in neurons differentiated from NSPCs in culture was faster than that in mouse embryonic fibroblasts (MEFs), possibly due to the higher DNA-dependent protein kinase activity, but it was similar to that in NSPCs. Further, the incidence of p53-dependent apoptosis induced by X-irradiation in neurons was significantly higher than that in NSPCs. This difference in response of X-ray-induced apoptosis between neurons and NSPCs may reflect a difference in the fidelity of non-homologous end joining or a differential sensitivity to DNA damage other than DSBs.

  2. Caffeine inhibits gene conversion by displacing Rad51 from ssDNA

    PubMed Central

    Tsabar, Michael; Mason, Jennifer M.; Chan, Yuen-Ling; Bishop, Douglas K.; Haber, James E.

    2015-01-01

    Efficient repair of chromosomal double-strand breaks (DSBs) by homologous recombination relies on the formation of a Rad51 recombinase filament that forms on single-stranded DNA (ssDNA) created at DSB ends. This filament facilitates the search for a homologous donor sequence and promotes strand invasion. Recently caffeine treatment has been shown to prevent gene targeting in mammalian cells by increasing non-productive Rad51 interactions between the DSB and random regions of the genome. Here we show that caffeine treatment prevents gene conversion in yeast, independently of its inhibition of the Mec1ATR/Tel1ATM-dependent DNA damage response or caffeine's inhibition of 5′ to 3′ resection of DSB ends. Caffeine treatment results in a dosage-dependent eviction of Rad51 from ssDNA. Gene conversion is impaired even at low concentrations of caffeine, where there is no discernible dismantling of the Rad51 filament. Loss of the Rad51 filament integrity is independent of Srs2's Rad51 filament dismantling activity or Rad51's ATPase activity and does not depend on non-specific Rad51 binding to undamaged double-stranded DNA. Caffeine treatment had similar effects on irradiated HeLa cells, promoting loss of previously assembled Rad51 foci. We conclude that caffeine treatment can disrupt gene conversion by disrupting Rad51 filaments. PMID:26019181

  3. Bipartite recognition of target RNAs activates DNA cleavage by the Type III-B CRISPR–Cas system

    PubMed Central

    Elmore, Joshua R.; Sheppard, Nolan F.; Ramia, Nancy; Deighan, Trace; Li, Hong; Terns, Rebecca M.; Terns, Michael P.

    2016-01-01

    CRISPR–Cas systems eliminate nucleic acid invaders in bacteria and archaea. The effector complex of the Type III-B Cmr system cleaves invader RNAs recognized by the CRISPR RNA (crRNA ) of the complex. Here we show that invader RNAs also activate the Cmr complex to cleave DNA. As has been observed for other Type III systems, Cmr eliminates plasmid invaders in Pyrococcus furiosus by a mechanism that depends on transcription of the crRNA target sequence within the plasmid. Notably, we found that the target RNA per se induces DNA cleavage by the Cmr complex in vitro. DNA cleavage activity does not depend on cleavage of the target RNA but notably does require the presence of a short sequence adjacent to the target sequence within the activating target RNA (rPAM [RNA protospacer-adjacent motif]). The activated complex does not require a target sequence (or a PAM) in the DNA substrate. Plasmid elimination by the P. furiosus Cmr system also does not require the Csx1 (CRISPR-associated Rossman fold [CARF] superfamily) protein. Plasmid silencing depends on the HD nuclease and Palm domains of the Cmr2 (Cas10 superfamily) protein. The results establish the Cmr complex as a novel DNA nuclease activated by invader RNAs containing a crRNA target sequence and a rPAM. PMID:26848045

  4. The constant region affects antigen binding of antibodies to DNA by altering secondary structure.

    PubMed

    Xia, Yumin; Janda, Alena; Eryilmaz, Ertan; Casadevall, Arturo; Putterman, Chaim

    2013-11-01

    We previously demonstrated an important role of the constant region in the pathogenicity of anti-DNA antibodies. To determine the mechanisms by which the constant region affects autoantibody binding, a panel of isotype-switch variants (IgG1, IgG2a, IgG2b) was generated from the murine PL9-11 IgG3 autoantibody. The affinity of the PL9-11 antibody panel for histone was measured by surface plasmon resonance (SPR). Tryptophan fluorescence was used to determine wavelength shifts of the antibody panel upon binding to DNA and histone. Finally, circular dichroism spectroscopy was used to measure changes in secondary structure. SPR analysis revealed significant differences in histone binding affinity between members of the PL9-11 panel. The wavelength shifts of tryptophan fluorescence emission were found to be dependent on the antibody isotype, while circular dichroism analysis determined that changes in antibody secondary structure content differed between isotypes upon antigen binding. Thus, the antigen binding affinity is dependent on the particular constant region expressed. Moreover, the effects of antibody binding to antigen were also constant region dependent. Alteration of secondary structures influenced by constant regions may explain differences in fine specificity of anti-DNA antibodies between antibodies with similar variable regions, as well as cross-reactivity of anti-DNA antibodies with non-DNA antigens. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Defect of Fe-S cluster binding by DNA polymerase δ in yeast suppresses UV-induced mutagenesis, but enhances DNA polymerase ζ - dependent spontaneous mutagenesis.

    PubMed

    Stepchenkova, E I; Tarakhovskaya, E R; Siebler, H M; Pavlov, Y I

    2017-01-01

    Eukaryotic genomes are duplicated by a complex machinery, utilizing high fidelity replicative B-family DNA polymerases (pols) α, δ and ε. Specialized error-prone pol ζ, the fourth B-family member, is recruited when DNA synthesis by the accurate trio is impeded by replication stress or DNA damage. The damage tolerance mechanism dependent on pol ζ prevents DNA/genome instability and cell death at the expense of increased mutation rates. The pol switches occurring during this specialized replication are not fully understood. The loss of pol ζ results in the absence of induced mutagenesis and suppression of spontaneous mutagenesis. Disruption of the Fe-S cluster motif that abolish the interaction of the C-terminal domain (CTD) of the catalytic subunit of pol ζ with its accessory subunits, which are shared with pol δ, leads to a similar defect in induced mutagenesis. Intriguingly, the pol3-13 mutation that affects the Fe-S cluster in the CTD of the catalytic subunit of pol δ also leads to defective induced mutagenesis, suggesting the possibility that Fe-S clusters are essential for the pol switches during replication of damaged DNA. We confirmed that yeast strains with the pol3-13 mutation are UV-sensitive and defective in UV-induced mutagenesis. However, they have increased spontaneous mutation rates. We found that this increase is dependent on functional pol ζ. In the pol3-13 mutant strain with defective pol δ, there is a sharp increase in transversions and complex mutations, which require functional pol ζ, and an increase in the occurrence of large deletions, whose size is controlled by pol ζ. Therefore, the pol3-13 mutation abrogates pol ζ-dependent induced mutagenesis, but allows for pol ζ recruitment for the generation of spontaneous mutations and prevention of larger deletions. These results reveal differential control of the two major types of pol ζ-dependent mutagenesis by the Fe-S cluster present in replicative pol δ. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Cftr gene targeting in mouse embryonic stem cells mediated by Small Fragment Homologous Replacement (SFHR).

    PubMed

    Sangiuolo, Federica; Scaldaferri, Maria Lucia; Filareto, Antonio; Spitalieri, Paola; Guerra, Lorenzo; Favia, Maria; Caroppo, Rosa; Mango, Ruggiero; Bruscia, Emanuela; Gruenert, Dieter C; Casavola, Valeria; De Felici, Massimo; Novelli, Giuseppe

    2008-01-01

    Different gene targeting approaches have been developed to modify endogenous genomic DNA in both human and mouse cells. Briefly, the process involves the targeting of a specific mutation in situ leading to the gene correction and the restoration of a normal gene function. Most of these protocols with therapeutic potential are oligonucleotide based, and rely on endogenous enzymatic pathways. One gene targeting approach, "Small Fragment Homologous Replacement (SFHR)", has been found to be effective in modifying genomic DNA. This approach uses small DNA fragments (SDF) to target specific genomic loci and induce sequence and subsequent phenotypic alterations. This study shows that SFHR can stably introduce a 3-bp deletion (deltaF508, the most frequent cystic fibrosis (CF) mutation) into the Cftr (CF Transmembrane Conductance Regulator) locus in the mouse embryonic stem (ES) cell genome. After transfection of deltaF508-SDF into murine ES cells, SFHR-mediated modification was evaluated at the molecular levels on DNA and mRNA obtained from transfected ES cells. About 12% of transcript corresponding to deleted allele was detected, while 60% of the electroporated cells completely lost any measurable CFTR-dependent chloride efflux. The data indicate that the SFHR technique can be used to effectively target and modify genomic sequences in ES cells. Once the SFHR-modified ES cells differentiate into different cell lineages they can be useful for elucidating tissue-specific gene function and for the development of transplantation-based cellular and therapeutic protocols.

  7. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    PubMed Central

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  8. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    NASA Astrophysics Data System (ADS)

    Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant

    2015-02-01

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  9. S phase entry causes homocysteine-induced death while ataxia telangiectasia and Rad3 related protein functions anti-apoptotically to protect neurons.

    PubMed

    Ye, Weizhen; Blain, Stacy W

    2010-08-01

    A major phenotype seen in neurodegenerative disorders is the selective loss of neurons due to apoptotic death and evidence suggests that inappropriate re-activation of cell cycle proteins in post-mitotic neurons may be responsible. To investigate whether reactivation of the G1 cell cycle proteins and S phase entry was linked with apoptosis, we examined homocysteine-induced neuronal cell death in a rat cortical neuron tissue culture system. Hyperhomocysteinaemia is a physiological risk factor for a variety of neurodegenerative diseases, including Alzheimer's disease. We found that in response to homocysteine treatment, cyclin D1, and cyclin-dependent kinases 4 and 2 translocated to the nucleus, and p27 levels decreased. Both cyclin-dependent kinases 4 and 2 regained catalytic activity, the G1 gatekeeper retinoblastoma protein was phosphorylated and DNA synthesis was detected, suggesting transit into S phase. Double-labelling immunofluorescence showed a 95% co-localization of anti-bromodeoxyuridine labelling with apoptotic markers, demonstrating that those cells that entered S phase eventually died. Neurons could be protected from homocysteine-induced death by methods that inhibited G1 phase progression, including down-regulation of cyclin D1 expression, inhibition of cyclin-dependent kinases 4 or 2 activity by small molecule inhibitors, or use of the c-Abl kinase inhibitor, Gleevec, which blocked cyclin D and cyclin-dependent kinase 4 nuclear translocation. However, blocking cell cycle progression post G1, using DNA replication inhibitors, did not prevent apoptosis, suggesting that death was not preventable post the G1-S phase checkpoint. While homocysteine treatment caused DNA damage and activated the DNA damage response, its mechanism of action was distinct from that of more traditional DNA damaging agents, such as camptothecin, as it was p53-independent. Likewise, inhibition of the DNA damage sensors, ataxia-telangiectasia mutant and ataxia telangiectasia and Rad3 related proteins, did not rescue apoptosis and in fact exacerbated death, suggesting that the DNA damage response might normally function neuroprotectively to block S phase-dependent apoptosis induction. As cell cycle events appear to be maintained in vivo in affected neurons for weeks to years before apoptosis is observed, activation of the DNA damage response might be able to hold cell cycle-induced death in check.

  10. Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

    PubMed

    Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

    2015-04-28

    We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

  11. Maternal DNA hypomethylation and congenital heart defects

    PubMed Central

    Chowdhury, Shimul; Cleves, Mario A.; MacLeod, Stewart L.; James, S. Jill; Zhao, Weizhi; Hobbs, Charlotte A.

    2011-01-01

    Background Congenital heart defects (CHDs) are among the most prevalent and serious of birth defects. Multiple maternal factors are thought to contribute to CHD development including folate intake. Maternal DNA methylation, which is dependent on folate metabolism, may impact the risk of CHDs. Objective Our study was designed to determine whether maternal long interspersed nucleotide elements-1 (LINE-1) DNA hypomethylation is associated with increased occurrence of non-syndromic CHDs and whether maternal folate-dependent metabolites are correlated with DNA methylation status. Design Using a case-control study design, we measured global DNA methylation status among mothers whose pregnancies were affected by non-syndromic CHDs (n=180) and mothers of unaffected pregnancies (n=187). Methylation of LINE-1 was used as a surrogate marker of global DNA methylation status. The association between DNA methylation and CHD risk was determined while adjusting for selected lifestyle factors. Results LINE-1 DNA methylation was significantly lower in cases compared with controls (p=0.049). After covariate adjustments, a significant difference between cases and controls remained (p=0.010). Among women with LINE-1 methylation in the lowest decile of DNA methylation, the estimated risk of having a CHD-affected pregnancy was almost twice that of women in all other deciles (OR=1.91; 95% CI: 1.03, 3.58). Conclusions Our findings indicate that maternal LINE-1 DNA hypomethylation is associated with an increased risk of CHDs. Future studies investigating the association between maternal DNA methylation patterns and CHDs should be pursued. PMID:21254366

  12. DNA-Protein Cross-Links: Formation, Structural Identities, and Biological Outcomes.

    PubMed

    Tretyakova, Natalia Y; Groehler, Arnold; Ji, Shaofei

    2015-06-16

    Noncovalent DNA-protein interactions are at the heart of normal cell function. In eukaryotic cells, genomic DNA is wrapped around histone octamers to allow for chromosomal packaging in the nucleus. Binding of regulatory protein factors to DNA directs replication, controls transcription, and mediates cellular responses to DNA damage. Because of their fundamental significance in all cellular processes involving DNA, dynamic DNA-protein interactions are required for cell survival, and their disruption is likely to have serious biological consequences. DNA-protein cross-links (DPCs) form when cellular proteins become covalently trapped on DNA strands upon exposure to various endogenous, environmental and chemotherapeutic agents. DPCs progressively accumulate in the brain and heart tissues as a result of endogenous exposure to reactive oxygen species and lipid peroxidation products, as well as normal cellular metabolism. A range of structurally diverse DPCs are found following treatment with chemotherapeutic drugs, transition metal ions, and metabolically activated carcinogens. Because of their considerable size and their helix-distorting nature, DPCs interfere with the progression of replication and transcription machineries and hence hamper the faithful expression of genetic information, potentially contributing to mutagenesis and carcinogenesis. Mass spectrometry-based studies have identified hundreds of proteins that can become cross-linked to nuclear DNA in the presence of reactive oxygen species, carcinogen metabolites, and antitumor drugs. While many of these proteins including histones, transcription factors, and repair proteins are known DNA binding partners, other gene products with no documented affinity for DNA also participate in DPC formation. Furthermore, multiple sites within DNA can be targeted for cross-linking including the N7 of guanine, the C-5 methyl group of thymine, and the exocyclic amino groups of guanine, cytosine, and adenine. This structural complexity complicates structural and biological studies of DPC lesions. Two general strategies have been developed for creating DNA strands containing structurally defined, site-specific DPCs. Enzymatic methodologies that trap DNA modifying proteins on their DNA substrate are site specific and efficient, but do not allow for systematic studies of DPC lesion structure on their biological outcomes. Synthetic methodologies for DPC formation are based on solid phase synthesis of oligonucleotide strands containing protein-reactive unnatural DNA bases. The latter approach allows for a wider range of protein substrates to be conjugated to DNA and affords a greater flexibility for the attachment sites within DNA. In this Account, we outline the chemistry of DPC formation in cells, describe our recent efforts to identify the cross-linked proteins by mass spectrometry, and discuss various methodologies for preparing DNA strands containing structurally defined, site specific DPC lesions. Polymerase bypass experiments conducted with model DPCs indicate that the biological outcomes of these bulky lesions are strongly dependent on the peptide/protein size and the exact cross-linking site within DNA. Future studies are needed to elucidate the mechanisms of DPC repair and their biological outcomes in living cells.

  13. DNA-Protein Cross-links: Formation, Structural Identities, and Biological Outcomes

    PubMed Central

    Tretyakova, Natalia Y.; Groehler, Arnold; Ji, Shaofei

    2015-01-01

    CONSPECTUS Non-covalent DNA-protein interactions are at the heart of normal cell function. In eukaryotic cells, genomic DNA is wrapped around histone octamers to allow for chromosomal packaging in the nucleus. Binding of regulatory protein factors to DNA directs replication, controls transcription, and mediates cellular responses to DNA damage. Because of their fundamental significance in all cellular processes involving DNA, dynamic DNA-protein interactions are required for cell survival, and their disruption is likely to have serious biological consequences. DNA-protein cross-links (DPCs) form when cellular proteins become covalently trapped on DNA strands upon exposure to various endogenous, environmental and chemotherapeutic agents. DPCs progressively accumulate in the brain and heart tissues as a result of endogenous exposure to reactive oxygen species and lipid peroxidation products, as well as normal cellular metabolism. A range of structurally diverse DPCs are found following treatment with chemotherapeutic drugs, transition metal ions, and metabolically activated carcinogens. Because of their considerable size and their helix-distorting nature, DPCs interfere with the progression of replication and transcription machineries and hence hamper the faithful expression of genetic information, potentially contributing to mutagenesis and carcinogenesis. Mass spectrometry-based studies have identified hundreds of proteins that can become cross-linked to nuclear DNA in the presence of reactive oxygen species, carcinogen metabolites, and antitumor drugs. While many of these proteins including histones, transcription factors, and repair proteins are known DNA binding partners, other gene products with no documented affinity for DNA also participate in DPC formation. Furthermore, multiple sites within DNA can be targeted for cross-linking including the N7 of guanine, the C-5 methyl group of thymine, and the exocyclic amino groups of guanine, cytosine, and adenine. This structural complexity complicates structural and biological studies of DPC lesions. Two general strategies have been developed for creating DNA strands containing structurally defined, site-specific DPCs. Enzymatic methodologies that trap DNA modifying proteins on their DNA substrate are site specific and efficient, but do not allow for systematic studies of DPC lesion structure on their biological outcomes. Synthetic methodologies for DPC formation are based on solid phase synthesis of oligonucleotide strands containing protein-reactive unnatural DNA bases. The latter approach allows for a wider range of protein substrates to be conjugated to DNA and affords a greater flexibility for the attachment sites within DNA. In this Account, we outline the chemistry of DPC formation in cells, describe our recent efforts to identify the cross-linked proteins by mass spectrometry, and discuss various methodologies for preparing DNA strands containing structurally defined, site specific DPC lesions. Polymerase bypass experiments conducted with model DPCs indicate that the biological outcomes of these bulky lesions are strongly dependent on the peptide/protein size and the exact cross-linking site within DNA. Future studies are needed to elucidate the mechanisms of DPC repair and their biological outcomes in living cells. PMID:26032357

  14. Eukaryotic DNA Ligases: Structural and Functional Insights

    PubMed Central

    Ellenberger, Tom; Tomkinson, Alan E.

    2010-01-01

    DNA ligases are required for DNA replication, repair, and recombination. In eukaryotes, there are three families of ATP-dependent DNA ligases. Members of the DNA ligase I and IV families are found in all eukaryotes, whereas DNA ligase III family members are restricted to vertebrates. These enzymes share a common catalytic region comprising a DNA-binding domain, a nucleotidyltransferase (NTase) domain, and an oligonucleotide/oligosaccharide binding (OB)-fold domain. The catalytic region encircles nicked DNA with each of the domains contacting the DNA duplex. The unique segments adjacent to the catalytic region of eukaryotic DNA ligases are involved in specific protein-protein interactions with a growing number of DNA replication and repair proteins. These interactions determine the specific cellular functions of the DNA ligase isozymes. In mammals, defects in DNA ligation have been linked with an increased incidence of cancer and neurodegeneration. PMID:18518823

  15. Widespread Dependence of Backup NHEJ on Growth State: Ramifications for the Use of DNA-PK Inhibitors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singh, Satyendra K.; Wu Wenqi; Zhang Lihua

    2011-02-01

    Purpose: The backup pathway of nonhomologous end joining (B-NHEJ) enables cells to process DNA double-strand breaks (DSBs) when the DNA-PK-dependent pathway of NHEJ (D-NHEJ) is compromised. Our previous results show marked reduction in the activity of B-NHEJ when LIG4{sup -/-} mouse embryo fibroblasts (MEFs) cease to grow and enter a plateau phase. The dependence of B-NHEJ on growth state is substantially stronger than that of D-NHEJ and points to regulatory mechanisms or processing determinants that require elucidation. Because the different D-NHEJ mutants show phenotypes distinct in their details, it is necessary to characterize the dependence of their DSB repair capacitymore » on growth state and to explore species-specific responses. Methods and Materials: DSB repair was measured in cells of different genetic background from various species using pulsed-field gel electrophoresis, or the formation of {gamma}-H2AX foci, at different stages of growth. Results: Using pulsed-field gel electrophoresis, we report a marked reduction of B-NHEJ during the plateau phase of growth in KU and XRCC4, mouse or Chinese hamster, mutants. Notably, this reduction is only marginal in DNA-PKcs-deficient cells. However, reduced B-NHEJ is also observed in repair proficient, plateau-phase cells after treatment with DNA-PK inhibitors. The reduction of B-NHEJ activity in the plateau phase of growth does not derive from the reduced expression of participating proteins, is detectable by {gamma}-H2AX foci analysis, and leads to enhanced cell killing. Conclusions: These results further document the marked dependence on growth state of an essential DSB repair pathway and show the general nature of the effect. Molecular characterization of the mechanism underlying this response will help to optimize the administration of DNA repair inhibitors as adjuvants in radiation therapy.« less

  16. How do type II topoisomerases use ATP hydrolysis to simplify DNA topology beyond equilibrium? Investigating the relaxation reaction of non-supercoiling type II topoisomerases

    PubMed Central

    Stuchinskaya, Tanya; Mitchenall, Lesley A.; Schoeffler, Allyn J.; Corbett, Kevin D.; Berger, James M.; Bates, Andrew D.; Maxwell, Anthony

    2015-01-01

    DNA topoisomerases control the topology of DNA (e.g. the level of supercoiling) in all cells. Type IIA topoisomerases are ATP-dependent enzymes that have been shown to simplify the topology of their DNA substrates to a level beyond that expected at equilibrium (i.e. more relaxed than the product of relaxation by ATP-independent enzymes, such as type I topoisomerases, or a lower than equilibrium level of catenation). The mechanism of this effect is currently unknown, although several models have been suggested. We have analysed the DNA relaxation reactions of type II topoisomerases to further explore this phenomenon. We find that all type IIA topoisomerases tested exhibit the effect to a similar degree and that it is not dependent on the C-terminal domains of the enzymes. As recently reported, the type IIB topoisomerase, topo VI (which is only distantly related to the type IIA enzymes), does not exhibit topology simplification. We find that topology simplification is not significantly dependent on circle size in the range ~2–9 kbp, and is not altered by reducing the free energy available from ATP hydrolysis by varying the ATP:ADP ratio. A direct test of one model (DNA tracking, i.e. sliding of a protein clamp along DNA to trap supercoils) suggests that this is unlikely to be the explanation for the effect. We conclude that geometric selection of DNA segments by the enzymes is likely to be a primary source of the effect but that it is possible that other factors contribute. We also speculate whether topology simplification might simply be an evolutionary relic, with no adaptive significance. PMID:19094994

  17. How do type II topoisomerases use ATP hydrolysis to simplify DNA topology beyond equilibrium? Investigating the relaxation reaction of nonsupercoiling type II topoisomerases.

    PubMed

    Stuchinskaya, Tanya; Mitchenall, Lesley A; Schoeffler, Allyn J; Corbett, Kevin D; Berger, James M; Bates, Andrew D; Maxwell, Anthony

    2009-02-06

    DNA topoisomerases control the topology of DNA (e.g., the level of supercoiling) in all cells. Type IIA topoisomerases are ATP-dependent enzymes that have been shown to simplify the topology of their DNA substrates to a level beyond that expected at equilibrium (i.e., more relaxed than the product of relaxation by ATP-independent enzymes, such as type I topoisomerases, or a lower-than-equilibrium level of catenation). The mechanism of this effect is currently unknown, although several models have been suggested. We have analyzed the DNA relaxation reactions of type II topoisomerases to further explore this phenomenon. We find that all type IIA topoisomerases tested exhibit the effect to a similar degree and that it is not dependent on the supercoil-sensing C-terminal domains of the enzymes. As recently reported, the type IIB topoisomerase, topoisomerase VI (which is only distantly related to type IIA enzymes), does not exhibit topology simplification. We find that topology simplification is not significantly dependent on circle size in the range approximately 2-9 kbp and is not altered by reducing the free energy available from ATP hydrolysis by varying the ADP:ATP ratio. A direct test of one model (DNA tracking; i.e., sliding of a protein clamp along DNA to trap supercoils) suggests that this is unlikely to be the explanation for the effect. We conclude that geometric selection of DNA segments by the enzymes is likely to be a primary source of the effect, but that it is possible that other kinetic factors contribute. We also speculate whether topology simplification might simply be an evolutionary relic, with no adaptive significance.

  18. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  19. Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

    PubMed Central

    Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

    2015-01-01

    Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

  20. M-DNA: a self-assembling molecular wire for nanoelectronics and biosensing.

    PubMed

    Wettig, Shawn D; Li, Chen-Zhong; Long, Yi-Tao; Kraatz, Heinz-Bernhard; Lee, Jeremy S

    2003-01-01

    M-DNA is a complex between divalent metal ions such as Zn2+ and duplex DNA which forms at pH 8.5. Unlike B-DNA, M-DNA does not bind ethidium so that M-DNA formation can be monitored conveniently by an ethidium fluorescence assay. M-DNA was shown to be a better conductor than B-DNA by fluorometric measurements of electron transport in donor-acceptor labelled duplexes; by direct conductivity measurements of M-DNA bound between gold electrodes and by cyclic voltammetric studies on ferrocene labelled duplexes attached to gold microelectrodes. As is the case with B-DNA, M-DNA can self-assemble into a variety of structures and is anticipated to find widespread use in nanoelectronics and biosensing.

  1. Effect of leaf incubation temperature profiles on Agrobacterium tumefaciens-mediated transient expression.

    PubMed

    Jung, Sang-Kyu; McDonald, Karen A; Dandekar, Abhaya M

    2015-01-01

    Agrobacterium tumefaciens-mediated transient expression is known to be highly dependent on incubation temperature. Compared with early studies that were conducted at constant temperature, we examined the effect of variable leaf incubation temperature on transient expression. As a model system, synthetic endoglucanase (E1) and endoxylanase (Xyn10A) genes were transiently expressed in detached whole sunflower leaves via vacuum infiltration for biofuel applications. We found that the kinetics of transient expression strongly depended on timing of the temperature change as well as leaf incubation temperature. Surprisingly, we found that high incubation temperature (27-30 °C) which is suboptimal for T-DNA transfer, significantly enhanced transient expression if the high temperature was applied during the late phase (Day 3-6) of leaf incubation whereas incubation temperature in a range of 20-25 °C for an early phase (Day 0-2) resulted in higher production. On the basis of these results, we propose that transient expression is governed by both T-DNA transfer and protein synthesis in plant cells that have different temperature dependent kinetics. Because the phases were separated in time and had different optimal temperatures, we were then able to develop a novel two phase optimization strategy for leaf incubation temperature. Applying the time-varying temperature profile, we were able to increase the protein accumulation by fivefold compared with the control at a constant temperature of 20 °C. From our knowledge, this is the first report illustrating the effect of variable temperature profiling for improved transient expression. © 2015 American Institute of Chemical Engineers.

  2. cDNA cloning and functional characterization of the mouse Ca2+-gated K+ channel, mIK1. Roles in regulatory volume decrease and erythroid differentiation.

    PubMed

    Vandorpe, D H; Shmukler, B E; Jiang, L; Lim, B; Maylie, J; Adelman, J P; de Franceschi, L; Cappellini, M D; Brugnara, C; Alper, S L

    1998-08-21

    We have cloned from murine erythroleukemia (MEL) cells, thymus, and stomach the cDNA encoding the Ca2+-gated K+ (KCa) channel, mIK1, the mouse homolog of hIK1 (Ishii, T. M., Silvia, C., Hirschberg, B., Bond, C. T., Adelman, J. P., and Maylie, J. (1997) Proc. Natl. Acad. Sci.(U. S. A. 94, 11651-11656). mIK1 mRNA was detected at varied levels in many tissue types. mIK1 KCa channel activity expressed in Xenopus oocytes closely resembled the Kca of red cells (Gardos channel) and MEL cells in its single channel conductance, lack of voltage-sensitivity of activation, inward rectification, and Ca2+ concentration dependence. mIK1 also resembled the erythroid channel in its pharmacological properties, mediating whole cell and unitary currents sensitive to low nM concentrations of both clotrimazole (CLT) and its des-imidazolyl metabolite, 2-chlorophenyl-bisphenyl-methanol, and to low nM concentrations of iodocharybdotoxin. Whereas control oocytes subjected to hypotonic swelling remained swollen, mIK1 expression conferred on oocytes a novel, Ca2+-dependent, CLT-sensitive regulatory volume decrease response. Hypotonic swelling of voltage-clamped mIK1-expressing oocytes increased outward currents that were Ca2+-dependent, CLT-sensitive, and reversed near the K+ equilibrium potential. mIK1 mRNA levels in ES cells increased steadily during erythroid differentiation in culture, in contrast to other KCa mRNAs examined. Low nanomolar concentrations of CLT inhibited proliferation and erythroid differentiation of peripheral blood stem cells in liquid culture.

  3. Evidence for the role of DNA strand passage in the mechanism of action of microcin B17 on DNA gyrase.

    PubMed

    Pierrat, Olivier A; Maxwell, Anthony

    2005-03-22

    Microcin B17 (MccB17) is a DNA gyrase poison; in previous work, this bacterial toxin was found to slowly and incompletely inhibit the reactions of supercoiling and relaxation of DNA by gyrase and to stabilize the cleavage complex, depending on the presence of ATP and the DNA topology. We now show that the action of MccB17 on the gyrase ATPase reaction and cleavage complex formation requires a linear DNA fragment of more than 150 base pairs. MccB17 is unable to stimulate the ATPase reaction by stabilizing the weak interactions between short linear DNA fragments (70 base pairs or less) and gyrase, in contrast with the quinolone ciprofloxacin. However, MccB17 can affect the ATP-dependent relaxation of DNA by gyrase lacking its DNA-wrapping or ATPase domains. From these findings, we propose a mode of action of MccB17 requiring a DNA molecule long enough to allow the transport of a segment through the DNA gate of the enzyme. Furthermore, we suggest that MccB17 may trap a transient intermediate state of the gyrase reaction present only during DNA strand passage and enzyme turnover. The proteolytic signature of MccB17 from trypsin treatment of the full enzyme requires DNA and ATP and shows a protection of the C-terminal 47-kDa domain of gyrase, indicating the involvement of this domain in the toxin mode of action and consistent with its proposed role in the mechanism of DNA strand passage. We suggest that the binding site of MccB17 is in the C-terminal domain of GyrB.

  4. Novel Function of the Fanconi Anemia Group J or RECQ1 Helicase to Disrupt Protein-DNA Complexes in a Replication Protein A-stimulated Manner*

    PubMed Central

    Sommers, Joshua A.; Banerjee, Taraswi; Hinds, Twila; Wan, Bingbing; Wold, Marc S.; Lei, Ming; Brosh, Robert M.

    2014-01-01

    Understanding how cellular machinery deals with chromosomal genome complexity is an important question because protein bound to DNA may affect various cellular processes of nucleic acid metabolism. DNA helicases are at the forefront of such processes, yet there is only limited knowledge how they remodel protein-DNA complexes and how these mechanisms are regulated. We have determined that representative human RecQ and Fe-S cluster DNA helicases are potently blocked by a protein-DNA interaction. The Fanconi anemia group J (FANCJ) helicase partners with the single-stranded DNA-binding protein replication protein A (RPA) to displace BamHI-E111A bound to duplex DNA in a specific manner. Protein displacement was dependent on the ATPase-driven function of the helicase and unique properties of RPA. Further biochemical studies demonstrated that the shelterin proteins TRF1 and TRF2, which preferentially bind the telomeric repeat found at chromosome ends, effectively block FANCJ from unwinding the forked duplex telomeric substrate. RPA, but not the Escherichia coli single-stranded DNA-binding protein or shelterin factor Pot1, stimulated FANCJ ejection of TRF1 from the telomeric DNA substrate. FANCJ was also able to displace TRF2 from the telomeric substrate in an RPA-dependent manner. The stimulation of helicase-catalyzed protein displacement is also observed with the DNA helicase RECQ1, suggesting a conserved functional interaction of RPA-interacting helicases. These findings suggest that partnerships between RPA and interacting human DNA helicases may greatly enhance their ability to dislodge proteins bound to duplex DNA, an activity that is likely to be highly relevant to their biological roles in DNA metabolism. PMID:24895130

  5. 50 years of DNA ‘Breathing’: Reflections on Old and New Approaches

    PubMed Central

    von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.

    2015-01-01

    Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028

  6. Rapid DNA double-strand breaks resulting from processing of Cr-DNA cross-links by both MutS dimers.

    PubMed

    Reynolds, Mindy F; Peterson-Roth, Elizabeth C; Bespalov, Ivan A; Johnston, Tatiana; Gurel, Volkan M; Menard, Haley L; Zhitkovich, Anatoly

    2009-02-01

    Mismatch repair (MMR) strongly enhances cyto- and genotoxicity of several chemotherapeutic agents and environmental carcinogens. DNA double-strand breaks (DSB) formed after two replication cycles play a major role in MMR-dependent cell death by DNA alkylating drugs. Here, we examined DNA damage detection and the mechanisms of the unusually rapid induction of DSB by MMR proteins in response to carcinogenic chromium(VI). We found that MSH2-MSH6 (MutSalpha) dimer effectively bound DNA probes containing ascorbate-Cr-DNA and cysteine-Cr-DNA cross-links. Binary Cr-DNA adducts, the most abundant form of Cr-DNA damage, were poor substrates for MSH2-MSH6, and their toxicity in cells was weak and MMR independent. Although not involved in the initial recognition of Cr-DNA damage, MSH2-MSH3 (MutSbeta) complex was essential for the induction of DSB, micronuclei, and apoptosis in human cells by chromate. In situ fractionation of Cr-treated cells revealed MSH6 and MSH3 chromatin foci that originated in late S phase and did not require replication of damaged DNA. Formation of MSH3 foci was MSH6 and MLH1 dependent, whereas MSH6 foci were unaffected by MSH3 status. DSB production was associated with progression of cells from S into G(2) phase and was completely blocked by the DNA synthesis inhibitor aphidicolin. Interestingly, chromosome 3 transfer into MSH3-null HCT116 cells activated an alternative, MSH3-like activity that restored dinucleotide repeat stability and sensitivity to chromate. Thus, sequential recruitment and unprecedented cooperation of MutSalpha and MutSbeta branches of MMR in processing of Cr-DNA cross-links is the main cause of DSB and chromosomal breakage at low and moderate Cr(VI) doses.

  7. Resistance of Adenoviral DNA Replication to Aphidicolin Is Dependent on the 72-Kilodalton DNA-Binding Protein

    PubMed Central

    Foster, David A.; Hantzopoulos, Petros; Zubay, Geoffrey

    1982-01-01

    Aphidicolin is a highly specific inhibitor of DNA polymerase α and has been most useful for assessing the role of this enzyme in various replication processes (J. A. Huberman, Cell 23:647-648, 1981). Both nuclear DNA replication and simian virus 40 DNA replication are highly sensitive to this drug (Krokan et al., Biochemistry 18:4431-4443, 1979), whereas mitochondrial DNA synthesis is completely insensitive (Zimmerman et al., J. Biol. Chem. 255:11847-11852, 1980). Adenovirus DNA replication is sensitive to aphidicolin, but only at much higher concentrations. These patterns of sensitivity are seen both in vivo and in vitro (Krokan et al., Biochemistry 18:4431-4443, 1979). A temperature-sensitive mutant of adenovirus type 5 known as H5ts125 is able to complete but not initiate new rounds of replication at nonpermissive temperatures (P. C. van der Vliet and J. S. Sussenbach, Virology 67:415-426, 1975). When cells infected with H5ts125 were shifted from permissive (33°C) to nonpermissive (41°C) conditions, the residual DNA synthesis (elongation) showed a striking increase in sensitivity to aphidicolin. The temperature-sensitive mutation of H5ts125 is in the gene for the 72-kilodalton single-stranded DNA-binding protein. This demonstrated that the increased resistance to aphidicolin shown by adenovirus DNA replication was dependent on that protein. It also supports an elongation role for both DNA polymerase α and the 72-kilodalton single-stranded DNA-binding protein in adenovirus DNA replication. Further support for an elongation role of DNA polymerase α came from experiments with permissive temperature conditions and inhibiting levels of aphidicolin in which it was shown that newly initiated strands failed to elongate to completion. Images PMID:6809958

  8. DNA-based cryptographic methods for data hiding in DNA media.

    PubMed

    Marwan, Samiha; Shawish, Ahmed; Nagaty, Khaled

    2016-12-01

    Information security can be achieved using cryptography, steganography or a combination of them, where data is firstly encrypted using any of the available cryptography techniques and then hid into any hiding medium. Recently, the famous genomic DNA has been introduced as a hiding medium, known as DNA steganography, due to its notable ability to hide huge data sets with a high level of randomness and hence security. Despite the numerous cryptography techniques, to our knowledge only the vigenere cipher and the DNA-based playfair cipher have been combined with the DNA steganography, which keeps space for investigation of other techniques and coming up with new improvements. This paper presents a comprehensive analysis between the DNA-based playfair, vigenere, RSA and the AES ciphers, each combined with a DNA hiding technique. The conducted analysis reports the performance diversity of each combined technique in terms of security, speed, hiding capacity in addition to both key size and data size. Moreover, this paper proposes a modification of the current combined DNA-based playfair cipher technique, which makes it not only simple and fast but also provides a significantly higher hiding capacity and security. The conducted extensive experimental studies confirm such outstanding performance in comparison with all the discussed combined techniques. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Electrostatic contribution to twist rigidity of DNA.

    PubMed

    Mohammad-Rafiee, Farshid; Golestanian, Ramin

    2004-06-01

    The electrostatic contribution to the twist rigidity of DNA is studied, and it is shown that the Coulomb self-energy of the double-helical sugar-phosphate backbone makes a considerable contribution-the electrostatic twist rigidity of DNA is found to be C(elec) approximately 5 nm, which makes up about 7% of its total twist rigidity ( C(DNA) approximately 75 nm). The electrostatic twist rigidity is found, however, to depend only weakly on the salt concentration, because of a competition between two different screening mechanisms: (1) Debye screening by the salt ions in the bulk, and (2) structural screening by the periodic charge distribution along the backbone of the helical polyelectrolyte. It is found that, depending on the parameters, the electrostatic contribution to the twist rigidity could stabilize or destabilize the structure of a helical polyelectrolyte.

  10. DNA repair goes hip-hop: SMARCA and CHD chromatin remodellers join the break dance.

    PubMed

    Rother, Magdalena B; van Attikum, Haico

    2017-10-05

    Proper signalling and repair of DNA double-strand breaks (DSB) is critical to prevent genome instability and diseases such as cancer. The packaging of DNA into chromatin, however, has evolved as a mere obstacle to these DSB responses. Posttranslational modifications and ATP-dependent chromatin remodelling help to overcome this barrier by modulating nucleosome structures and allow signalling and repair machineries access to DSBs in chromatin. Here we recap our current knowledge on how ATP-dependent SMARCA- and CHD-type chromatin remodellers alter chromatin structure during the signalling and repair of DSBs and discuss how their dysfunction impacts genome stability and human disease.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Authors.

  11. Photothermal fabrication of microscale patterned DNA hydrogels

    NASA Astrophysics Data System (ADS)

    Shimomura, Suguru; Nishimura, Takahiro; Ogura, Yusuke; Tanida, Jun

    2018-02-01

    This paper introduces a method for fabricating microscale DNA hydrogels using irradiation with patterned light. Optical fabrication allows for the flexible and tunable formation of DNA hydrogels without changing the environmental conditions. Our scheme is based on local heat generation via the photothermal effect, which is induced by light irradiation on a quenching species. We demonstrate experimentally that, depending on the power and irradiation time, light irradiation enables the creation of local microscale DNA hydrogels, while the shapes of the DNA hydrogels are controlled by the irradiation patterns.

  12. Debye screening in single-molecule carbon nanotube field-effect sensors.

    PubMed

    Sorgenfrei, Sebastian; Chiu, Chien-Yang; Johnston, Matthew; Nuckolls, Colin; Shepard, Kenneth L

    2011-09-14

    Point-functionalized carbon nanotube field-effect transistors can serve as highly sensitive detectors for biomolecules. With a probe molecule covalently bound to a defect in the nanotube sidewall, two-level random telegraph noise (RTN) in the conductance of the device is observed as a result of a charged target biomolecule binding and unbinding at the defect site. Charge in proximity to the defect modulates the potential (and transmission) of the conductance-limiting barrier created by the defect. In this Letter, we study how these single-molecule electronic sensors are affected by ionic screening. Both charge in proximity to the defect site and buffer concentration are found to affect RTN amplitude in a manner that follows from simple Debye length considerations. RTN amplitude is also dependent on the potential of the electrolyte gate as applied to the reference electrode; at high enough gate potentials, the target DNA is completely repelled and RTN is suppressed.

  13. Debye screening in single-molecule carbon nanotube field-effect transistors

    PubMed Central

    Sorgenfrei, Sebastian; Chiu, Chien-yang; Johnston, Matthew; Nuckolls, Colin; Shepard, Kenneth L.

    2013-01-01

    Point-functionalized carbon nanotube field-effect transistors can serve as highly sensitive detectors for biomolecules. With a probe molecule covalently bound to a defect in the nanotube sidewall, two-level random telegraph noise (RTN) in the conductance of the device is observed as a result of a charged target biomolecule binding and unbinding at the defect site. Charge in proximity to the defect modulates the potential (and transmission) of the conductance-limiting barrier created by the defect. In this Letter, we study how these single-molecule electronic sensors are affected by ionic screening. Both charge in proximity to the defect site and buffer concentration are found to affect RTN amplitude in a manner that follows from simple Debye length considerations. RTN amplitude is also dependent on the potential of the electrolyte gate as applied to the reference electrode; at high enough repulsive potentials, the target DNA is completely repelled and RTN is suppressed. PMID:21806018

  14. Environmental chemicals and DNA methylation in adults: a systematic review of the epidemiologic evidence

    USDA-ARS?s Scientific Manuscript database

    Current evidence supports the notion that environmental exposures are associated with DNA-methylation and expression changes that can impact human health. Our objective was to conduct a systematic review of epidemiologic studies evaluating the association between environmental chemicals with DNA met...

  15. Unveiling the Mode of Interaction of Berberine Alkaloid in Different Supramolecular Confined Environments: Interplay of Surface Charge between Nano-Confined Charged Layer and DNA.

    PubMed

    Kundu, Niloy; Roy, Arpita; Banik, Debasis; Sarkar, Nilmoni

    2016-02-18

    In this Article, we demonstrate a detailed characterization of binding interaction of berberine chloride (BBCl) with calf-thymus DNA (CT-DNA) in buffer solution as well as in two differently charged reverse micelles (RMs). The photophyscial properties of this alkaloid have been modulated within these microheterogeneous bioassemblies. The mode of binding of this alkaloid with DNA is of debate to date. However, fluorescence spectroscopic measurements, circular dichroism (CD) measurement, and temperature-dependent study unambiguously establish that BBCl partially intercalates into the DNA base pairs. The nonplanarity imposed by partial saturation in their structure causes the nonclassical types of intercalation into DNA. Besides the intercalation, electrostatic interactions also play a significant role in the binding between BBCl and DNA. DNA structure turns into a condensed form after encapsulation into RMs, which is followed by the CD spectra and microscopy study. The probe location and dynamics in the nanopool of the RMs depended on the electrostatic interaction between the charged surfactants and cationic berberine. The structural alteration of CT-DNA from B form to condensed form and the interplay of surface charge between RMs and DNA determine the interaction between the alkaloid and DNA in RMs. Time-resolved study and fluorescence anisotropy measurements successfully provide the binding interaction of BBCl in the nanopool of the RMs in the absence and in the presence of DNA. This study motivates us to judge further the potential applicability of this alkaloid in other biological systems or other biomimicking organized assemblies.

  16. Environmental DNA reflects spatial and temporal jellyfish distribution

    PubMed Central

    Fukuda, Miho; Katsuhara, Koki R.; Fujiwara, Ayaka; Hidaka, Shunsuke; Yamamoto, Satoshi; Takahashi, Kohji; Masuda, Reiji

    2017-01-01

    Recent development of environmental DNA (eDNA) analysis allows us to survey underwater macro-organisms easily and cost effectively; however, there have been no reports on eDNA detection or quantification for jellyfish. Here we present the first report on an eDNA analysis of marine jellyfish using Japanese sea nettle (Chrysaora pacifica) as a model species by combining a tank experiment with spatial and temporal distribution surveys. We performed a tank experiment monitoring eDNA concentrations over a range of time intervals after the introduction of jellyfish, and quantified the eDNA concentrations by quantitative real-time PCR. The eDNA concentrations peaked twice, at 1 and 8 h after the beginning of the experiment, and became stable within 48 h. The estimated release rates of the eDNA in jellyfish were higher than the rates previously reported in fishes. A spatial survey was conducted in June 2014 in Maizuru Bay, Kyoto, in which eDNA was collected from surface water and sea floor water samples at 47 sites while jellyfish near surface water were counted on board by eye. The distribution of eDNA in the bay corresponded with the distribution of jellyfish inferred by visual observation, and the eDNA concentration in the bay was ~13 times higher on the sea floor than on the surface. The temporal survey was conducted from March to November 2014, in which jellyfish were counted by eye every morning while eDNA was collected from surface and sea floor water at three sampling points along a pier once a month. The temporal fluctuation pattern of the eDNA concentrations and the numbers of observed individuals were well correlated. We conclude that an eDNA approach is applicable for jellyfish species in the ocean. PMID:28245277

  17. Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen

    2014-08-01

    DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry ofmore » γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest. - Highlights: • Autophagy inhibitors enhanced the cytotoxicity of a DNA alkylating agent, BO-1012. • BO-1012-induced S phase arrest was a CHK1-dependent pro-survival response. • Autophagy inhibition enhanced BO-1012 cytotoxicity via disrupting the S phase arrest.« less

  18. ATR- and ATM-Mediated DNA Damage Response Is Dependent on Excision Repair Assembly during G1 but Not in S Phase of Cell Cycle.

    PubMed

    Ray, Alo; Blevins, Chessica; Wani, Gulzar; Wani, Altaf A

    2016-01-01

    Cell cycle checkpoint is mediated by ATR and ATM kinases, as a prompt early response to a variety of DNA insults, and culminates in a highly orchestrated signal transduction cascade. Previously, we defined the regulatory role of nucleotide excision repair (NER) factors, DDB2 and XPC, in checkpoint and ATR/ATM-dependent repair pathway via ATR and ATM phosphorylation and recruitment to ultraviolet radiation (UVR)-induced damage sites. Here, we have dissected the molecular mechanisms of DDB2- and XPC- mediated regulation of ATR and ATM recruitment and activation upon UVR exposures. We show that the ATR and ATM activation and accumulation to UVR-induced damage not only depends on DDB2 and XPC, but also on the NER protein XPA, suggesting that the assembly of an active NER complex is essential for ATR and ATM recruitment. ATR and ATM localization and H2AX phosphorylation at the lesion sites occur as early as ten minutes in asynchronous as well as G1 arrested cells, showing that repair and checkpoint-mediated by ATR and ATM starts early upon UV irradiation. Moreover, our results demonstrated that ATR and ATM recruitment and H2AX phosphorylation are dependent on NER proteins in G1 phase, but not in S phase. We reasoned that in G1 the UVR-induced ssDNA gaps or processed ssDNA, and the bound NER complex promote ATR and ATM recruitment. In S phase, when the UV lesions result in stalled replication forks with long single-stranded DNA, ATR and ATM recruitment to these sites is regulated by different sets of proteins. Taken together, these results provide evidence that UVR-induced ATR and ATM recruitment and activation differ in G1 and S phases due to the existence of distinct types of DNA lesions, which promote assembly of different proteins involved in the process of DNA repair and checkpoint activation.

  19. Capturing a DNA duplex under near-physiological conditions

    NASA Astrophysics Data System (ADS)

    Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.

    2010-10-01

    We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.

  20. Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Hillman, D.; Herbert, E.

    1986-05-01

    Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Top