Science.gov

Sample records for dependent dna conductivity

  1. Internal twisting motion dependent conductance of an aperiodic DNA molecule

    SciTech Connect

    Wiliyanti, Vandan Yudiarsah, Efta

    2016-04-19

    The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from a base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.

  2. Electrical conduction through DNA molecule.

    PubMed

    Abdalla, S

    2011-09-01

    Several disorder parameters, inside the DNA molecule, lead to localization of charge carriers inside potential wells in the lowest unoccupied and highest occupied molecular orbits (LUMO and HOMO) which affects drastically the electrical conduction through the molecule, and demonstrates that the band carriers play an essential role in the conduction mechanism. So, a model is presented to shed light on the role of electrons of the LUMO in the electrical conduction through the DNA molecule. DC-, AC-conductivity and dielectric permittivity experimental data are well fitted with the presented model giving evidence that the free carriers in the LUMO and HOMO are responsible to make the DNA molecule conductor, insulator or semiconductor. The obtained results show that the localized charge carriers in the DNA molecule are characterized by four different types of relaxation phenomena which are thermally activated by corresponding four activation energies at 0.56 eV, 0.33 eV, 0.24 eV, and 0.05 eV respectively. Moreover, the calculations after the model, at room temperature, show that the time of the relaxation times of the current carriers are in the order of 5 × 10(-2)s, 1.74 × 10(-4)s, 5 × 10(-7)s, and 1.6 × 10(-10)s, respectively.

  3. Conductance of Dry DNA: Role of Environment

    NASA Technical Reports Server (NTRS)

    Anantram, M. P.; Adessi, Ch.; S. Walch

    2003-01-01

    This paper presents viewgraphs on the conductance of dry DNA and its effect on the surrounding environment. The topics include: 1) Approach; 2) Influence of Counter Ions; 3) Conductance Versus DNA Length; 4) Intrinsic Resonant Tunneling in Engineered DNA Sequence; and 5) Transmission Versus Energy.

  4. Conductance of Dry DNA: Role of Environment

    NASA Technical Reports Server (NTRS)

    Anantram, M. P.; Adessi, Ch.; S. Walch

    2003-01-01

    This paper presents viewgraphs on the conductance of dry DNA and its effect on the surrounding environment. The topics include: 1) Approach; 2) Influence of Counter Ions; 3) Conductance Versus DNA Length; 4) Intrinsic Resonant Tunneling in Engineered DNA Sequence; and 5) Transmission Versus Energy.

  5. Gate-controlled conductance switching in DNA

    NASA Astrophysics Data System (ADS)

    Xiang, Limin; Palma, Julio L.; Li, Yueqi; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2017-02-01

    Extensive evidence has shown that long-range charge transport can occur along double helical DNA, but active control (switching) of single-DNA conductance with an external field has not yet been demonstrated. Here we demonstrate conductance switching in DNA by replacing a DNA base with a redox group. By applying an electrochemical (EC) gate voltage to the molecule, we switch the redox group between the oxidized and reduced states, leading to reversible switching of the DNA conductance between two discrete levels. We further show that monitoring the individual conductance switching allows the study of redox reaction kinetics and thermodynamics at single molecular level using DNA as a probe. Our theoretical calculations suggest that the switch is due to the change in the energy level alignment of the redox states relative to the Fermi level of the electrodes.

  6. Gate-controlled conductance switching in DNA

    PubMed Central

    Xiang, Limin; Palma, Julio L.; Li, Yueqi; Mujica, Vladimiro; Ratner, Mark A.; Tao, Nongjian

    2017-01-01

    Extensive evidence has shown that long-range charge transport can occur along double helical DNA, but active control (switching) of single-DNA conductance with an external field has not yet been demonstrated. Here we demonstrate conductance switching in DNA by replacing a DNA base with a redox group. By applying an electrochemical (EC) gate voltage to the molecule, we switch the redox group between the oxidized and reduced states, leading to reversible switching of the DNA conductance between two discrete levels. We further show that monitoring the individual conductance switching allows the study of redox reaction kinetics and thermodynamics at single molecular level using DNA as a probe. Our theoretical calculations suggest that the switch is due to the change in the energy level alignment of the redox states relative to the Fermi level of the electrodes. PMID:28218275

  7. Environment and Structure Influence in DNA Conduction

    NASA Technical Reports Server (NTRS)

    Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan (Technical Monitor)

    2002-01-01

    Results for transmission through the poly(G) DNA molecule are presented. We show that (i) periodically arranged sodium counter-ions in close proximity to dry DNA gives rise to a new conduction channel and aperiodicity in the counter-ion sequence can lead to a significant reduction in conduction, (ii) modification of the rise of B-DNA induces a change in the width of the transmission window, and (iii) specifically designed sequences are predicted to show intrinsic resonant tunneling behavior.

  8. Structure and Environment Influence in DNA Conduction

    NASA Technical Reports Server (NTRS)

    Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

    2002-01-01

    Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

  9. Inhomogeneous DNA: Conducting exons and insulating introns

    NASA Astrophysics Data System (ADS)

    Krokhin, A. A.; Bagci, V. M. K.; Izrailev, F. M.; Usatenko, O. V.; Yampol'Skii, V. A.

    2009-08-01

    Parts of DNA sequences known as exons and introns play very different roles in coding and storage of genetic information. Here we show that their conducting properties are also very different. Taking into account long-range correlations among four basic nucleotides that form double-stranded DNA sequence, we calculate electron localization length for exon and intron regions. Analyzing different DNA molecules, we obtain that the exons have narrow bands of extended states, unlike the introns where all the states are well localized. The band of extended states is due to a specific form of the binary correlation function of the sequence of basic DNA nucleotides.

  10. Influence of Disorder on DNA Conductance

    NASA Technical Reports Server (NTRS)

    Adessi, Christophe; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

    2003-01-01

    Disorder along a DNA strand due to non uniformity associated with the counter ion type and location, and in rise and twist are investigated using density functional theory. We then model the conductance through a poly(G) DNA strand by including the influence of disorder. We show that the conductance drops by a few orders of magnitude between typical lengths of 10 and 100 nm. Such a decrease occurs with on-site potential disorder that is larger than 100 meV.

  11. DNA sequencing using electrical conductance measurements of a DNA polymerase

    NASA Astrophysics Data System (ADS)

    Chen, Yu-Shiun; Lee, Chia-Hui; Hung, Meng-Yen; Pan, Hsu-An; Chiou, Jin-Chern; Huang, G. Steven

    2013-06-01

    The development of personalized medicine--in which medical treatment is customized to an individual on the basis of genetic information--requires techniques that can sequence DNA quickly and cheaply. Single-molecule sequencing technologies, such as nanopores, can potentially be used to sequence long strands of DNA without labels or amplification, but a viable technique has yet to be established. Here, we show that single DNA molecules can be sequenced by monitoring the electrical conductance of a phi29 DNA polymerase as it incorporates unlabelled nucleotides into a template strand of DNA. The conductance of the polymerase is measured by attaching it to a protein transistor that consists of an antibody molecule (immunoglobulin G) bound to two gold nanoparticles, which are in turn connected to source and drain electrodes. The electrical conductance of the DNA polymerase exhibits well-separated plateaux that are ~3 pA in height. Each plateau corresponds to an individual base and is formed at a rate of ~22 nucleotides per second. Additional spikes appear on top of the plateaux and can be used to discriminate between the four different nucleotides. We also show that the sequencing platform works with a variety of DNA polymerases and can sequence difficult templates such as homopolymers.

  12. Pressure dependence of electrical conductivity in forsterite

    NASA Astrophysics Data System (ADS)

    Yoshino, Takashi; Zhang, Baohua; Rhymer, Brandon; Zhao, Chengcheng; Fei, Hongzhan

    2017-01-01

    Electrical conductivity of dry forsterite has been measured in muli-anvil apparatus to investigate the pressure dependence of ionic conduction in forsterite. The starting materials for the conductivity experiments were a synthetic forsterite single crystal and a sintered forsterite aggregate synthesized from oxide mixture. Electrical conductivities were measured at 3.5, 6.7, 9.6, 12.1, and 14.9 GPa between 1300 and 2100 K. In the measured temperature range, the conductivity of single crystal forsterite decreases in the order of [001], [010], and [100]. In all cases, the conductivity decreases with increasing pressure and then becomes nearly constant for [100] and [001] and slightly increases above 7 GPa for [010] orientations and a polycrystalline forsterite sample. Pressure dependence of forsterite conductivity was considered as a change of the dominant conduction mechanism composed of migration of both magnesium and oxygen vacancies in forsterite. The activation energy (ΔE) and activation volume (ΔV) for ionic conduction due to migration of Mg vacancy were 1.8-2.7 eV and 5-19 cm3/mol, respectively, and for that due to O vacancy were 2.2-3.1 eV and -1.1 to 0.3 cm3/mol, respectively. The olivine conductivity model combined with small polaron conduction suggests that the most part of the upper mantle is controlled by ionic conduction rather than small polaron conduction. The previously observed negative pressure dependence of the conductivity of olivine with low iron content (Fo90) can be explained by ionic conduction due to migration of Mg vacancies, which has a large positive activation volume.

  13. Probing radiation damage by alternated current conductivity as a method to characterize electron hopping conduction in DNA molecules

    SciTech Connect

    Gomes, Paulo J.; Coelho, Margarida; Antonio Ribeiro, Paulo; Raposo, Maria; Dionisio, Madalena

    2012-09-17

    Analysis of AC electrical conductivity of deoxyribonucleic acid (DNA) thin films, irradiated with ultraviolet (UV) light, revealed that electrical conduction arises from DNA chain electron hopping between base-pairs and phosphate groups. The hopping distance calculated from correlated barrier hopping model equals the distance between DNA base-pairs, which is consistent with the loss of conductivity with irradiation time arising from a decrease in phosphates groups. In the high frequency regime, at a given frequency, real part of conductivity strongly depends on irradiation time particularly for low dose levels suggesting the use of DNA based films for UV radiation sensors.

  14. Conductance of DNA molecules: Effects of decoherence and bonding

    NASA Astrophysics Data System (ADS)

    Zilly, Matías; Ujsághy, Orsolya; Wolf, Dietrich E.

    2010-09-01

    The influence of decoherence and bonding on the linear conductance of single double-stranded DNA molecules is examined by fitting a phenomenological statistical model developed recently [M. Zilly, O. Ujsághy, and D. E. Wolf, Eur. Phys. J. B 68, 237 (2009)10.1140/epjb/e2009-00101-0] to experimental results. The DNA molecule itself is described by a tight-binding ladder model with parameters obtained from published ab initio calculations [K. Senthilkumar, F. C. Grozema, C. F. Guerra, F. M. Bickelhaupt, F. D. Lewis, Y. A. Berlin, M. A. Ratner, and L. D. A. Siebbeles, J. Am. Chem. Soc. 127, 14894 (2005)10.1021/ja054257e]. The good agreement with the experiments on sequence and length dependence gives a hint on the nature of conduction in DNA and at the same time provides a crucial test of the model.

  15. Conformation-dependent DNA attraction

    NASA Astrophysics Data System (ADS)

    Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

    2014-05-01

    Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

  16. Temperature dependence of DNA translocations through solid-state nanopores.

    PubMed

    Verschueren, Daniel V; Jonsson, Magnus P; Dekker, Cees

    2015-06-12

    In order to gain a better physical understanding of DNA translocations through solid-state nanopores, we study the temperature dependence of λ-DNA translocations through 10 nm diameter silicon nitride nanopores, both experimentally and theoretically. The measured ionic conductance G, the DNA-induced ionic-conductance blockades [Formula: see text] and the event frequency Γ all increase with increasing temperature while the DNA translocation time τ decreases. G and [Formula: see text] are accurately described when bulk and surface conductances of the nanopore are considered and access resistance is incorporated appropriately. Viscous drag on the untranslocated part of the DNA coil is found to dominate the temperature dependence of the translocation times and the event rate is well described by a balance between diffusion and electrophoretic motion. The good fit between modeled and measured properties of DNA translocations through solid-state nanopores in this first comprehensive temperature study, suggest that our model captures the relevant physics of the process.

  17. The contact area dependent interfacial thermal conductance

    SciTech Connect

    Liu, Chenhan; Wei, Zhiyong; Bi, Kedong; Yang, Juekuan; Chen, Yunfei; Wang, Jian

    2015-12-15

    The effects of the contact area on the interfacial thermal conductance σ are investigated using the atomic Green’s function method. Different from the prediction of the heat diffusion transport model, we obtain an interesting result that the interfacial thermal conductance per unit area Λ is positively dependent on the contact area as the area varies from a few atoms to several square nanometers. Through calculating the phonon transmission function, it is uncovered that the phonon transmission per unit area increases with the increased contact area. This is attributed to that each atom has more neighboring atoms in the counterpart of the interface with the increased contact area, which provides more channels for phonon transport.

  18. Stimuli dependent impedance of conductive magnetorheological elastomers

    NASA Astrophysics Data System (ADS)

    Wang, Yu; Xuan, Shouhu; Dong, Bo; Xu, Feng; Gong, Xinglong

    2016-02-01

    The structure dependent impedance of conductive magnetorheological elastomers (MREs) under different loads and magnetic fields has been studied in this work. By increasing the weight fraction of iron particles, the conductivity of the MREs increased. Dynamic mechanical measurements and synchrotron radiation x-ray computed tomography (SR-CT) were used and they provided reasons for the electrical properties changing significantly under pressure and magnetic field stimulation. The high sensitivity of MREs to external stimuli renders them suitable for application in force or magnetic field sensors. The equivalent circuit model was proposed to analyze the impedance response of MREs and it fits the experimental results very well. Each circuit component reflected the change of the inner interface under different conditions, thus relative changes in the microstructure could be distinguished. This method could be used not only to detect the structural changes in the MRE but also to provide a great deal of valuable information for the further understanding of the MR mechanism.

  19. Temperature Dependence of DNA Charge Transport

    NASA Astrophysics Data System (ADS)

    Wohlgamuth, Chris; McWilliams, Marc; Slinker, Jason

    2011-10-01

    Charge transport (CT) through DNA has been extensively studied, and yet the mechanism of this process is still not yet fully understood. DNA CT has been utilized in sensing proteins and DNA fragments, and it has been postulated that it may assist DNA damage prevention and repair. Besides the benefits of understanding charge transport through this fundamental molecule, further understanding of this process will elucidate the biological implications of DNA CT and advance sensing technology. Therefore, we have investigated the temperature dependence of DNA CT by measuring the electrochemistry of DNA monolayers modified with a redox-active probe. By using multiplexed electrodes on silicon chips, we compare the cyclic and square wave voltammetry of distinct DNA sequences under identical experimental conditions. Accordingly, we compare well matched DNA duplexes to those containing a single base pair mismatch, which has been shown to attenuate CT. The yield of CT is shown to follow Arrhenius behavior, with increased activation energies for mismatches that structurally distort the duplex. These observations suggest that charge transport is thermally activated and highly dependent upon DNA conformation.

  20. Counterintuitive DNA Sequence Dependence in Supercoiling-Induced DNA Melting

    PubMed Central

    Vlijm, Rifka; v.d. Torre, Jaco; Dekker, Cees

    2015-01-01

    The metabolism of DNA in cells relies on the balance between hybridized double-stranded DNA (dsDNA) and local de-hybridized regions of ssDNA that provide access to binding proteins. Traditional melting experiments, in which short pieces of dsDNA are heated up until the point of melting into ssDNA, have determined that AT-rich sequences have a lower binding energy than GC-rich sequences. In cells, however, the double-stranded backbone of DNA is destabilized by negative supercoiling, and not by temperature. To investigate what the effect of GC content is on DNA melting induced by negative supercoiling, we studied DNA molecules with a GC content ranging from 38% to 77%, using single-molecule magnetic tweezer measurements in which the length of a single DNA molecule is measured as a function of applied stretching force and supercoiling density. At low force (<0.5pN), supercoiling results into twisting of the dsDNA backbone and loop formation (plectonemes), without inducing any DNA melting. This process was not influenced by the DNA sequence. When negative supercoiling is introduced at increasing force, local melting of DNA is introduced. We measured for the different DNA molecules a characteristic force Fchar, at which negative supercoiling induces local melting of the dsDNA. Surprisingly, GC-rich sequences melt at lower forces than AT-rich sequences: Fchar = 0.56pN for 77% GC but 0.73pN for 38% GC. An explanation for this counterintuitive effect is provided by the realization that supercoiling densities of a few percent only induce melting of a few percent of the base pairs. As a consequence, denaturation bubbles occur in local AT-rich regions and the sequence-dependent effect arises from an increased DNA bending/torsional energy associated with the plectonemes. This new insight indicates that an increased GC-content adjacent to AT-rich DNA regions will enhance local opening of the double-stranded DNA helix. PMID:26513573

  1. Electrical conduction measurement of thiol modified DNA molecules

    NASA Astrophysics Data System (ADS)

    Hwang, J. S.; Hwang, S. W.; Ahn, D.

    2003-09-01

    We present a novel transport measurement of 60 base pairs of poly(dG)-poly(dC) DNA molecules. Thiol-terminated DNA molecules are chemically anchored at the surface of a Au nanoparticle and this DNA attached Au nanoparticle is self-trapped in between Au nanoelectrodes to make an electrical conduction channel. It provides an automatic electrical conduction channel consisting of electrode-DNA-nanoparticle-DNA-electrode. Due to robust bonding of thiol and Au, this transport channel is stable and reliable. The current-voltage characteristics measured from our device show a nonlinear behavior with voltage gaps comparable to previous experiment using the same molecules.

  2. Large-Conductance Transmembrane Porin Made from DNA Origami.

    PubMed

    Göpfrich, Kerstin; Li, Chen-Yu; Ricci, Maria; Bhamidimarri, Satya Prathyusha; Yoo, Jejoong; Gyenes, Bertalan; Ohmann, Alexander; Winterhalter, Mathias; Aksimentiev, Aleksei; Keyser, Ulrich F

    2016-09-27

    DNA nanotechnology allows for the creation of three-dimensional structures at nanometer scale. Here, we use DNA to build the largest synthetic pore in a lipid membrane to date, approaching the dimensions of the nuclear pore complex and increasing the pore-area and the conductance 10-fold compared to previous man-made channels. In our design, 19 cholesterol tags anchor a megadalton funnel-shaped DNA origami porin in a lipid bilayer membrane. Confocal imaging and ionic current recordings reveal spontaneous insertion of the DNA porin into the lipid membrane, creating a transmembrane pore of tens of nanosiemens conductance. All-atom molecular dynamics simulations characterize the conductance mechanism at the atomic level and independently confirm the DNA porins' large ionic conductance.

  3. Large-Conductance Transmembrane Porin Made from DNA Origami

    PubMed Central

    2016-01-01

    DNA nanotechnology allows for the creation of three-dimensional structures at nanometer scale. Here, we use DNA to build the largest synthetic pore in a lipid membrane to date, approaching the dimensions of the nuclear pore complex and increasing the pore-area and the conductance 10-fold compared to previous man-made channels. In our design, 19 cholesterol tags anchor a megadalton funnel-shaped DNA origami porin in a lipid bilayer membrane. Confocal imaging and ionic current recordings reveal spontaneous insertion of the DNA porin into the lipid membrane, creating a transmembrane pore of tens of nanosiemens conductance. All-atom molecular dynamics simulations characterize the conductance mechanism at the atomic level and independently confirm the DNA porins’ large ionic conductance. PMID:27504755

  4. Theory of electron conductance across a DNA basepair

    NASA Astrophysics Data System (ADS)

    Lee, Myeong; Sankey, Otto

    2008-03-01

    In recent years, research on electron tunneling through DNA basepairs has become more important due to its potential application in DNA sequencing technology. The goal is to recognize and identify a specific DNA base by measuring the hydrogen bond mediated tunneling current across a DNA basepair junction. In this talk, we discuss the results of density functional theory on the intrinsic conduction through DNA basepairs (Watson-Crick basepairs, Wobble basepairs, etc), and in particular the role of the hydrogen bond on the tunneling current.

  5. Temperature dependence of DNA translocations through solid-state nanopores

    PubMed Central

    Verschueren, Daniel V.; Jonsson, Magnus P.; Dekker, Cees

    2015-01-01

    In order to gain a better physical understanding of DNA translocations through solid-state nanopores, we study the temperature dependence of λ-DNA translocations through 10 nm-in-diameter silicon-nitride nanopores, both experimentally and theoretically. The measured ionic conductance G, the DNA-induced ionic-conductance blockades ΔG and the event frequency Γ all increase with increasing temperature while the DNA translocation time τ decreases. G and ΔG are accurately described when bulk and surface conductances of the nanopore are considered and access resistance is incorporated appropriately. Viscous drag on the untranslocated part of the DNA coil is found to dominate the temperature dependence of the translocation times and the event rate is well described by a balance between diffusion and electrophoretic motion. The good fit between modeled and measured properties of DNA translocations through solid-state nanopores in this first comprehensive temperature study, suggest that our model captures the relevant physics of the process. PMID:25994084

  6. Temperature dependence of circular DNA topological states

    NASA Astrophysics Data System (ADS)

    Chen, Hu; Liu, Yanhui; Zhou, Zhen; Hu, Lin; Ou-Yang, Zhong-Can; Yan, Jie

    2009-04-01

    Circular double-stranded DNA has different topological states which are defined by their linking numbers. Equilibrium distribution of linking numbers can be obtained by closing a linear DNA into a circle by ligase. Using Monte Carlo simulation, we predict the temperature dependence of the linking number distribution of small circular DNAs. Our predictions are based on flexible defect excitations that resulted from local melting or unstacking of DNA base pairs. We found that the reduced bending rigidity alone can lead to measurable changes of the variance of linking number distribution of short circular DNAs. If the defect is accompanied by local unwinding, the effect becomes much more prominent. The predictions can be easily investigated in experiments, providing a new method to study the micromechanics of sharply bent DNAs and the thermal stability of specific DNA sequences. Furthermore, the predictions are directly applicable to the studies of binding of DNA-distorting proteins that can locally reduce DNA rigidity, form DNA kinks, or introduce local unwinding.

  7. Temperature dependence of circular DNA topological states.

    PubMed

    Chen, Hu; Liu, Yanhui; Zhou, Zhen; Hu, Lin; Ou-Yang, Zhong-Can; Yan, Jie

    2009-04-01

    Circular double-stranded DNA has different topological states which are defined by their linking numbers. Equilibrium distribution of linking numbers can be obtained by closing a linear DNA into a circle by ligase. Using Monte Carlo simulation, we predict the temperature dependence of the linking number distribution of small circular DNAs. Our predictions are based on flexible defect excitations that resulted from local melting or unstacking of DNA base pairs. We found that the reduced bending rigidity alone can lead to measurable changes of the variance of linking number distribution of short circular DNAs. If the defect is accompanied by local unwinding, the effect becomes much more prominent. The predictions can be easily investigated in experiments, providing a new method to study the micromechanics of sharply bent DNAs and the thermal stability of specific DNA sequences. Furthermore, the predictions are directly applicable to the studies of binding of DNA-distorting proteins that can locally reduce DNA rigidity, form DNA kinks, or introduce local unwinding.

  8. Thickness dependent thermal conductivity of gallium nitride

    NASA Astrophysics Data System (ADS)

    Ziade, Elbara; Yang, Jia; Brummer, Gordie; Nothern, Denis; Moustakas, Theodore; Schmidt, Aaron J.

    2017-01-01

    As the size of gallium nitride (GaN) transistors is reduced in order to reach higher operating frequencies, heat dissipation becomes the critical bottleneck in device performance and longevity. Despite the importance of characterizing the physics governing the thermal transport in thin GaN films, the literature is far from conclusive. In this letter, we report measurements of thermal conductivity in a GaN film with thickness ranging from 15-1000 nm grown on 4H-SiC without a transition layer. Additionally, we measure the thermal conductivity in the GaN film when it is 1 μm-thick in the temperature range of 300 < T < 600 K and use a phonon transport model to explain the thermal conductivity in this film.

  9. Size dependent polaronic conduction in hematite

    NASA Astrophysics Data System (ADS)

    Sharma, Monika; Banday, Azeem; Murugavel, Sevi

    2016-05-01

    Lithium Ion Batteries have been attracted as the major renewable energy source for all portable electronic devices because of its advantages like superior energy density, high theoretical capacity, high specific energy, stable cycling and less memory effects. Recently, α-Fe2O3 has been considered as a potential anode material due to high specific capacity, low cost, high abundance and environmental benignity. We have synthesized α-Fe2O3 with various sizes by using the ball milling and sol-gel procedure. Here, we report the dc conductivity measurement for the crystallite size ranging from 15 nm to 50nm. It has been observed that the enhancement in the polaronic conductivity nearly two orders in magnitude while reducing the crystallite size from bulk into nano scale level. The enhancement in the conductivity is due to the augmented to compressive strain developed in the material which leads to pronounced decrease in the hopping length of polarons. Thus, nanocrystaline α-Fe2O3 may be a better alternative anode material for lithium ion batteries than earlier reported systems.

  10. Size dependent polaronic conduction in hematite

    SciTech Connect

    Sharma, Monika; Banday, Azeem; Murugavel, Sevi

    2016-05-23

    Lithium Ion Batteries have been attracted as the major renewable energy source for all portable electronic devices because of its advantages like superior energy density, high theoretical capacity, high specific energy, stable cycling and less memory effects. Recently, α-Fe{sub 2}O{sub 3} has been considered as a potential anode material due to high specific capacity, low cost, high abundance and environmental benignity. We have synthesized α-Fe{sub 2}O{sub 3} with various sizes by using the ball milling and sol-gel procedure. Here, we report the dc conductivity measurement for the crystallite size ranging from 15 nm to 50 nm. It has been observed that the enhancement in the polaronic conductivity nearly two orders in magnitude while reducing the crystallite size from bulk into nano scale level. The enhancement in the conductivity is due to the augmented to compressive strain developed in the material which leads to pronounced decrease in the hopping length of polarons. Thus, nanocrystaline α-Fe{sub 2}O{sub 3} may be a better alternative anode material for lithium ion batteries than earlier reported systems.

  11. Finite-element technique applied to heat conduction in solids with temperature dependent thermal conductivity

    NASA Technical Reports Server (NTRS)

    Aguirre-Ramirez, G.; Oden, J. T.

    1969-01-01

    Finite element method applied to heat conduction in solids with temperature dependent thermal conductivity, using nonlinear constitutive equation for heat ABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGHIABCDEFGH

  12. Ionic conductivity, structural deformation, and programmable anisotropy of DNA origami in electric field.

    PubMed

    Li, Chen-Yu; Hemmig, Elisa A; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia; Keyser, Ulrich F; Aksimentiev, Aleksei

    2015-02-24

    The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules, a DNA origami plate, placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg(2+) ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA.

  13. Ionic Conductivity, Structural Deformation and Programmable Anisotropy of DNA Origami in Electric Field

    PubMed Central

    Li, Chen-Yu; Hemmig, Elisa A.; Kong, Jinglin; Yoo, Jejoong; Hernández-Ainsa, Silvia

    2015-01-01

    The DNA origami technique can enable functionalization of inorganic structures for single-molecule electric current recordings. Experiments have shown that several layers of DNA molecules—a DNA origami plate— placed on top of a solid-state nanopore is permeable to ions. Here, we report a comprehensive characterization of the ionic conductivity of DNA origami plates by means of all-atom molecular dynamics (MD) simulations and nanocapillary electric current recordings. Using the MD method, we characterize the ionic conductivity of several origami constructs, revealing the local distribution of ions, the distribution of the electrostatic potential and contribution of different molecular species to the current. The simulations determine the dependence of the ionic conductivity on the applied voltage, the number of DNA layers, the nucleotide content and the lattice type of the plates. We demonstrate that increasing the concentration of Mg2+ ions makes the origami plates more compact, reducing their conductivity. The conductance of a DNA origami plate on top of a solid-state nanopore is determined by the two competing effects: bending of the DNA origami plate that reduces the current and separation of the DNA origami layers that increases the current. The latter is produced by the electro-osmotic flow and is reversible at the time scale of a hundred nanoseconds. The conductance of a DNA origami object is found to depend on its orientation, reaching maximum when the electric field aligns with the direction of the DNA helices. Our work demonstrates feasibility of programming the electrical properties of a self-assembled nanoscale object using DNA. PMID:25623807

  14. Humidity dependence of charge transport through DNA revealed by silicon-based nanotweezers manipulation.

    PubMed

    Yamahata, Christophe; Collard, Dominique; Takekawa, Tetsuya; Kumemura, Momoko; Hashiguchi, Gen; Fujita, Hiroyuki

    2008-01-01

    The study of the electrical properties of DNA has aroused increasing interest since the last decade. So far, controversial arguments have been put forward to explain the electrical charge transport through DNA. Our experiments on DNA bundles manipulated with silicon-based actuated tweezers demonstrate undoubtedly that humidity is the main factor affecting the electrical conduction in DNA. We explain the quasi-Ohmic behavior of DNA and the exponential dependence of its conductivity with relative humidity from the adsorption of water on the DNA backbone. We propose a quantitative model that is consistent with previous studies on DNA and other materials, like porous silicon, subjected to different humidity conditions.

  15. Recombination-dependent concatemeric viral DNA replication.

    PubMed

    Lo Piano, Ambra; Martínez-Jiménez, María I; Zecchi, Lisa; Ayora, Silvia

    2011-09-01

    The initiation of viral double stranded (ds) DNA replication involves proteins that recruit and load the replisome at the replication origin (ori). Any block in replication fork progression or a programmed barrier may act as a factor for ori-independent remodelling and assembly of a new replisome at the stalled fork. Then replication initiation becomes dependent on recombination proteins, a process called recombination-dependent replication (RDR). RDR, which is recognized as being important for replication restart and stability in all living organisms, plays an essential role in the replication cycle of many dsDNA viruses. The SPP1 virus, which infects Bacillus subtilis cells, serves as a paradigm to understand the links between replication and recombination in circular dsDNA viruses. SPP1-encoded initiator and replisome assembly proteins control the onset of viral replication and direct the recruitment of host-encoded replisomal components at viral oriL. SPP1 uses replication fork reactivation to switch from ori-dependent θ-type (circle-to-circle) replication to σ-type RDR. Replication fork arrest leads to a double strand break that is processed by viral-encoded factors to generate a D-loop into which a new replisome is assembled, leading to σ-type viral replication. SPP1 RDR proteins are compared with similar proteins encoded by other viruses and their possible in vivo roles are discussed.

  16. DNA origami metallized site specifically to form electrically conductive nanowires.

    PubMed

    Pearson, Anthony C; Liu, Jianfei; Pound, Elisabeth; Uprety, Bibek; Woolley, Adam T; Davis, Robert C; Harb, John N

    2012-09-06

    DNA origami is a promising tool for use as a template in the design and fabrication of nanoscale structures. The ability to engineer selected staple strands on a DNA origami structure provides a high density of addressable locations across the structure. Here we report a method using site-specific attachment of gold nanoparticles to modified staple strands and subsequent metallization to fabricate conductive wires from DNA origami templates. We have modified DNA origami structures by lengthening each staple strand in select regions with a 10-base nucleotide sequence and have attached DNA-modified gold nanoparticles to the lengthened staple strands via complementary base-pairing. The high density of extended staple strands allowed the gold nanoparticles to pack tightly in the modified regions of the DNA origami, where the measured median gap size between neighboring particles was 4.1 nm. Gold metallization processes were optimized so that the attached gold nanoparticles grew until gaps between particles were filled and uniform continuous nanowires were formed. Finally, electron beam lithography was used to pattern electrodes in order to measure the electrical conductivity of metallized DNA origami, which showed an average resistance of 2.4 kΩ per metallized structure.

  17. Molecular conductance of double-stranded DNA evaluated by electrochemical capacitance spectroscopy

    NASA Astrophysics Data System (ADS)

    Ribeiro, W. C.; Gonçalves, L. M.; Liébana, S.; Pividori, M. I.; Bueno, P. R.

    2016-04-01

    Conductance was measured in two different double stranded DNA (both with 20 bases), the more conducting poly(dG)-poly(dC) (ds-DNAc) and the less conducting poly(dA)-poly(dT) (ds-DNAi), by means of Electrochemical Capacitance Spectroscopy (ECS). The use of the ECS approach, exemplified herein with DNA nanowires, is equally a suitable and time-dependent advantageous alternative for conductance measurement of molecular systems, additionally allowing better understanding of the alignment existing between molecular scale conductance and electron transfer rate.Conductance was measured in two different double stranded DNA (both with 20 bases), the more conducting poly(dG)-poly(dC) (ds-DNAc) and the less conducting poly(dA)-poly(dT) (ds-DNAi), by means of Electrochemical Capacitance Spectroscopy (ECS). The use of the ECS approach, exemplified herein with DNA nanowires, is equally a suitable and time-dependent advantageous alternative for conductance measurement of molecular systems, additionally allowing better understanding of the alignment existing between molecular scale conductance and electron transfer rate. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01076h

  18. A combined DFT/Green’s function study on electrical conductivity through DNA duplex between Au electrodes

    NASA Astrophysics Data System (ADS)

    Tsukamoto, Takayuki; Ishikawa, Yasuyuki; Sengoku, Yasuo; Kurita, Noriyuki

    2009-06-01

    Electrical conducting properties of DNA duplexes sandwiched between Au electrodes have been investigated by use of first-principles molecular simulation based on DFT and Green's function to elucidate the origin of their base sequence dependence. The theoretically simulated effects of DNA base sequence on the electrical conducting properties are in qualitative agreement with experiment. The HOMOs localized on Guanine bases have the major contribution to the electrical conductivity through DNA duplexes.

  19. Sequence-Dependent Persistence Lengths of DNA.

    PubMed

    Mitchell, Jonathan S; Glowacki, Jaroslaw; Grandchamp, Alexandre E; Manning, Robert S; Maddocks, John H

    2017-04-11

    A Monte Carlo code applied to the cgDNA coarse-grain rigid-base model of B-form double-stranded DNA is used to predict a sequence-averaged persistence length of lF = 53.5 nm in the sense of Flory, and of lp = 160 bp or 53.5 nm in the sense of apparent tangent-tangent correlation decay. These estimates are slightly higher than the consensus experimental values of 150 bp or 50 nm, but we believe the agreement to be good given that the cgDNA model is itself parametrized from molecular dynamics simulations of short fragments of length 10-20 bp, with no explicit fit to persistence length. Our Monte Carlo simulations further predict that there can be substantial dependence of persistence lengths on the specific sequence [Formula: see text] of a fragment. We propose, and confirm the numerical accuracy of, a simple factorization that separates the part of the apparent tangent-tangent correlation decay [Formula: see text] attributable to intrinsic shape, from a part [Formula: see text] attributable purely to stiffness, i.e., a sequence-dependent version of what has been called sequence-averaged dynamic persistence length l̅d (=58.8 nm within the cgDNA model). For ensembles of both random and λ-phage fragments, the apparent persistence length [Formula: see text] has a standard deviation of 4 nm over sequence, whereas our dynamic persistence length [Formula: see text] has a standard deviation of only 1 nm. However, there are notable dynamic persistence length outliers, including poly(A) (exceptionally straight and stiff), poly(TA) (tightly coiled and exceptionally soft), and phased A-tract sequence motifs (exceptionally bent and stiff). The results of our numerical simulations agree reasonably well with both molecular dynamics simulation and diverse experimental data including minicircle cyclization rates and stereo cryo-electron microscopy images.

  20. Microwave synthesis of electrically conductive gold nanowires on DNA scaffolds.

    PubMed

    Kundu, Subrata; Liang, Hong

    2008-09-02

    Biological molecules, in particular DNA, have shown great potential to be used as interconnects of nanodevices and computational elements. In this research, we synthesized electrically conductive gold nanowires for the first time exploiting an electroless and microwave heating method for 120-180 s. Our results indicate that DNA serves as a reducing and nonspecific capping agent for the growth of nanowires. The current voltage ( I- V) characteristics of the Au nanowires are continuous, exhibiting Ohmic behavior having low contact resistance with the gold electrodes. The nanowires have a diameter of 10-15 nm in solution and of 20-30 nm in immobilized DNA with resistivity comparable to pure metals. The method is highly selective with deposition confined to the DNA itself. The nanowires we fabricated can be used as building blocks for functional nanodevices, sensors, and optoelectronics.

  1. Sequence dependent hole evolution in DNA.

    PubMed

    Lakhno, V D

    2004-06-01

    The paper examines thedynamical behavior of a radical cation(G(+*)) generated in adouble stranded DNA for differentoligonucleotide sequences. The resonancehole tunneling through an oligonucleotidesequence is studied by the method ofnumerical integration of self-consistentquantum-mechanical equations. The holemotion is considered quantum mechanicallyand nucleotide base oscillations aretreated classically. The results obtaineddemonstrate a strong dependence of chargetransfer on the type of nucleotidesequence. The rates of the hole transferare calculated for different nucleotidesequences and compared with experimentaldata on the transfer from (G(+*))to a GGG unit.

  2. Absence of intrinsic electric conductivity in single dsDNA molecules.

    PubMed

    Kleine, H; Wilke, R; Pelargus, Ch; Rott, K; Pühler, A; Reiss, G; Ros, R; Anselmetti, D

    2004-08-26

    The intrinsic dc conductivity of long, individual lambda phage dsDNA molecules has been investigated by ultrasensitive low current-voltage-spectroscopy (IV) under ambient conditions and controlled low humidity inert gas atmosphere on microfabricated metal-insulator-metal gap structures. We found a strong dependence of the measured conductivity on the apparent humidity, which we attribute to capillary condensation of water to the immobilized DNA molecules, giving rise to additional ionic currents. Additional IV-spectroscopy experiments under controlled argon atmosphere always revealed a significant drop in electrical conductivity to 4 x 10(-15)AV(-1)microm(-1), indicating almost no considerable contribution of electrical long range charge transport.

  3. DNA strand breaks: the DNA template alterations that trigger p53-dependent DNA damage response pathways.

    PubMed Central

    Nelson, W G; Kastan, M B

    1994-01-01

    The tumor suppressor protein p53 serves as a critical regulator of a G1 cell cycle checkpoint and of apoptosis following exposure of cells to DNA-damaging agents. The mechanism by which DNA-damaging agents elevate p53 protein levels to trigger G1/S arrest or cell death remains to be elucidated. In fact, whether damage to the DNA template itself participates in transducing the signal leading to p53 induction has not yet been demonstrated. We exposed human cell lines containing wild-type p53 alleles to several different DNA-damaging agents and found that agents which rapidly induce DNA strand breaks, such as ionizing radiation, bleomycin, and DNA topoisomerase-targeted drugs, rapidly triggered p53 protein elevations. In addition, we determined that camptothecin-stimulated trapping of topoisomerase I-DNA complexes was not sufficient to elevate p53 protein levels; rather, replication-associated DNA strand breaks were required. Furthermore, treatment of cells with the antimetabolite N(phosphonoacetyl)-L-aspartate (PALA) did not cause rapid p53 protein increases but resulted in delayed increases in p53 protein levels temporally correlated with the appearance of DNA strand breaks. Finally, we concluded that DNA strand breaks were sufficient for initiating p53-dependent signal transduction after finding that introduction of nucleases into cells by electroporation stimulated rapid p53 protein elevations. While DNA strand breaks appeared to be capable of triggering p53 induction, DNA lesions other than strand breaks did not. Exposure of normal cells and excision repair-deficient xeroderma pigmentosum cells to low doses of UV light, under conditions in which thymine dimers appear but DNA replication-associated strand breaks were prevented, resulted in p53 induction attributable to DNA strand breaks associated with excision repair. Our data indicate that DNA strand breaks are sufficient and probably necessary for p53 induction in cells with wild-type p53 alleles exposed to DNA

  4. Alcohol dependence and conduct disorder among Navajo Indians.

    PubMed

    Kunitz, S J; Gabriel, K R; Levy, J E; Henderson, E; Lampert, K; McCloskey, J; Quintero, G; Russell, S; Vince, A

    1999-03-01

    The purpose of this study is to examine the association between conduct disorder before age 15 and subsequent alcohol dependence, and to describe the lifetime prevalence of alcohol dependence among Navajo Indian women and men. This was a case-control design which included both men (n = 735) and women (n = 351) and in which the Diagnostic Interview Schedule was used for the diagnosis of the lifetime history of alcohol dependence and conduct disorder. Alcohol dependent cases were selected from inpatient and outpatient treatment programs (204 men, 148 women). Whenever possible, controls were matched for age, sex and community of residence and were randomly selected and interviewed until a nonalcohol dependent individual was found. Among the men, there were 374 alcohol dependent controls and 157 nonalcohol dependent controls. Among the women, the figures were 60 and 143, respectively. When combined, the controls comprise samples of the adult male and female populations from which estimates of lifetime prevalence of alcohol dependence, and of the amount of alcohol dependence in the population attributable to conduct disorder, may be inferred. Conduct disorder is a risk factor for alcohol dependence among both men and women. Lifetime prevalence of alcohol dependence in this population is high (70.4% for men and 29.6% for women), but the amount of alcohol dependence in the population attributable to conduct disorder is low. On the other hand, among the alcohol dependent, those with conduct disorder had the most severe alcohol- and nonalcohol-related problems. The potential limitations of the study are those common to case-control designs, especially biased recall by cases. There are also potential sampling biases among the controls. It is shown that none of the potential biases invalidate the findings, which support the hypothesis that in this population conduct disorder is a risk for alcohol dependence. The implications for primary prevention of alcohol dependence are

  5. Electrically conductive gold- and copper-metallized DNA origami nanostructures.

    PubMed

    Geng, Yanli; Pearson, Anthony C; Gates, Elisabeth P; Uprety, Bibek; Davis, Robert C; Harb, John N; Woolley, Adam T

    2013-03-12

    This work demonstrates the use of a circuit-like DNA origami structure as a template to fabricate conductive gold and copper nanostructures on Si surfaces. We improved over previous results by using multiple Pd seeding steps to increase seed uniformity and density. Our process has also been characterized through atomic force microscopy, particle size distribution analysis, and scanning electron microscopy. We found that four successive Pd seeding steps yielded the best results for electroless metal plating on DNA origami. Electrical resistance measurements were done on both Au- and Cu-metallized nanostructures, with each showing ohmic behavior. Gold-plated DNA origami structures made under optimal conditions had an average resistivity of 7.0 × 10(-5) Ω·m, whereas copper-metallized structures had a resistivity as low as 3.6 × 10(-4) Ω·m. Importantly, this is the first demonstration of electrically conductive Cu nanostructures fabricated on either DNA or DNA origami templates. Although resistivities for both gold and copper samples were larger than those of the bulk metal, these metal nanostructures have the potential for use in electrically connecting small structures. In addition, these metallized objects might find use in surface-enhanced Raman scattering experiments.

  6. Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

    PubMed Central

    Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

    2015-01-01

    Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

  7. Frequency-dependent conductivity in bismuth-vanadate glassy semiconductors

    NASA Astrophysics Data System (ADS)

    Ghosh, Aswini

    1990-01-01

    The first measurements are reported for the frequency-dependent (ac) conductivity (real as well as imaginary parts) for various compositions of the bismuth-vanadate glassy semiconductors in the frequency range 102-105 Hz and in the temperature range 77-420 K. The behavior of the ac conductivity is broadly similar to what has been observed previously in many other types of amorphous semiconductors, namely, nearly linear frequency dependence and weak temperature dependence. The experimental results are analyzed with reference to various theoretical models based on quantum-mechanical tunneling and classical hopping over barriers. The analysis shows that the temperature dependence of the ac conductivity is consistent with the simple quantum-mechanical tunneling model at low temperatures; however, this model completely fails to predict the observed temperature dependence of the frequency exponent. The overlapping-large-polaron tunneling model can explain the temperature dependence of the frequency exponent at low temperatures. Fitting of this model to the low-temperature data yields a reasonable value of the wave-function decay constant. However, this model predicts the temperature dependence of the ac conductivity much higher than what actual data showed. The correlated barrier hopping model is consistent with the temperature dependence of both the ac conductivity and its frequency exponent. This model provides reasonable values of the maximum barrier heights but higher values of characteristic relaxation times.

  8. DNA-sensors based on functionalized conducting polymers and quantum dots

    NASA Astrophysics Data System (ADS)

    Kjällman, Tanja; Peng, Hui; Travas-Sejdic, Jadranka; Soeller, Christian

    2007-12-01

    The availability of rapid and specific biosensors is of great importance for many areas of biomedical research and modern biotechnology. This includes a need for DNA sensors where the progress of molecular biology demands routine detection of minute concentrations of specific gene fragments. A promising alternative approach to traditional DNA essays utilizes novel smart materials, including conducting polymers and nanostructured materials such as quantum dots. We have constructed a number of DNA sensors based on smart materials that allow rapid one-step detection of unlabeled DNA fragments with high specificity. These sensors are based on functionalized conducting polymers derived from polypyrrole (PPy) and poly(p-phenylenevinylene) (PPV). PPy based sensors provide intrinsic electrical readout via cyclic voltammetry and electrochemical impedance spectroscopy. The performance of these sensors is compared to a novel self-assembled monolayer-PNA construct on a gold electrode. Characterization of the novel PNA based sensor shows that it has comparable performance to the PPy based sensors and can also be read out effectively using AC cyclic voltammetry. Complementary to such solid substrate sensors we have developed a novel optical DNA essay based on a new PPV derived cationic conducting polymer. DNA detection in this essay results from sample dependent fluorescence resonance energy transfer changes between the cationic conducting polymer and Cy3 labeled probe oligonucleotides. As an alternative to such fluorochrome based sensors we discuss the use of inorganic nanocrystals ('quantum dots') and present data from water soluble CdTe quantum dots synthesized in an aqueous environment.

  9. Magnetic and conductive magnetite nanowires by DNA-templating.

    PubMed

    Mohamed, Hasan Daw A; Watson, Scott M D; Horrocks, Benjamin R; Houlton, Andrew

    2012-09-28

    The synthesis of nanowires made of magnetite (Fe(3)O(4)) phase iron oxide was achieved using DNA as a template to direct formation of the metal oxide and confine its growth in two dimensions. This simple solution-based approach involves initial association of Fe(2+) and Fe(3+) to the DNA "template" molecules, and subsequent co-precipitation of the Fe(3)O(4) material, upon increasing the solution pH, to give the final metal oxide nanowires. Analysis of the DNA-templated material, using a combination of FTIR, XRD, XPS, and Raman spectroscopy, confirmed the iron oxide formed to be the Fe(3)O(4) crystal phase. Investigation of the structural character of the nanowires, carried out by AFM, revealed the metal oxide to form regular coatings of nanometre-scale thickness around the DNA templates. Statistical analysis showed the size distribution of the nanowires to follow a trimodal model, with the modal diameter values identified as 5-6 nm, 14-15 nm, and 23-24 nm. Additional scanning probe microscopy techniques (SCM, MFM) were also used to verify that the nanowire structures are electrically conducting and exhibit magnetic behaviour. Such properties, coupled with the small dimensions of these materials, make them potentially good candidates for application in a host of future nanoscale device technologies.

  10. Sequence and Structure Dependent DNA-DNA Interactions

    NASA Astrophysics Data System (ADS)

    Kopchick, Benjamin; Qiu, Xiangyun

    Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

  11. Frequency dependence of ionic conductivity of electrolyte solutions

    NASA Astrophysics Data System (ADS)

    Chandra, Amalendu; Bagchi, Biman

    2000-01-01

    A theory for the frequency dependence of ionic conductivity of an electrolyte solution is presented. In this theory contributions to the conductivity from both the ion atmosphere relaxation and the electrophoretic effects are included in a self-consistent fashion. Mode coupling theory, combined with time-dependent density functional theory of ion atmosphere fluctuations, leads to expressions for these two contributions at finite frequencies. These expressions need to be solved self-consistently for the frequency dependence of the electrolyte friction and the ion conductivity at varying ion concentrations. In the limit of low concentration, the present theory reduces exactly to the well-known Debye-Falkenhagen (DF) expression of the frequency-dependent electrolyte friction when the non-Markovian effects in the ion atmosphere relaxation are ignored and in addition the ions are considered to be pointlike. The present theory also reproduces the expressions of the frequency-dependent conductivity derived by Chandra, Wei, and Patey when appropriate limiting situations are considered. We have carried out detailed numerical solutions of the self-consistent equations for concentrated solutions of a 1:1 electrolyte by using the expressions of pair correlation functions given by Attard. Numerical results reveal that the frequency dependence of the electrolyte friction at finite concentration can be quite different from that given by the DF expression. With the increase of ion concentration, the dispersion of the friction is found to occur at a higher frequency because of faster relaxation of the ion atmosphere. At low frequency, the real part of the conductivity shows a small increase with frequency which can be attributed to the well-known Debye-Falkenhagen effect. At high frequency, the conductivity decreases as expected. The extensions of the present theory to treat frequency-dependent diffusivities of charged colloid suspensions and conductivity of a dilute

  12. Using DNA looping to measure sequence dependent DNA elasticity

    NASA Astrophysics Data System (ADS)

    Kandinov, Alan; Raghunathan, Krishnan; Meiners, Jens-Christian

    2012-10-01

    We are using tethered particle motion (TPM) microscopy to observe protein-mediated DNA looping in the lactose repressor system in DNA constructs with varying AT / CG content. We use these data to determine the persistence length of the DNA as a function of its sequence content and compare the data to direct micromechanical measurements with constant-force axial optical tweezers. The data from the TPM experiments show a much smaller sequence effect on the persistence length than the optical tweezers experiments.

  13. Frequency-dependent effective hydraulic conductivity of strongly heterogeneous media.

    PubMed

    Caspari, E; Gurevich, B; Müller, T M

    2013-10-01

    The determination of the transport properties of heterogeneous porous rocks, such as an effective hydraulic conductivity, arises in a range of geoscience problems, from groundwater flow analysis to hydrocarbon reservoir modeling. In the presence of formation-scale heterogeneities, nonstationary flows, induced by pumping tests or propagating elastic waves, entail localized pressure diffusion processes with a characteristic frequency depending on the pressure diffusivity and size of the heterogeneity. Then, on a macroscale, a homogeneous equivalent medium exists, which has a frequency-dependent effective conductivity. The frequency dependence of the conductivity can be analyzed with Biot's equations of poroelasticity. In the quasistatic frequency regime of this framework, the slow compressional wave is a proxy for pressure diffusion processes. This slow compressional wave is associated with the out-of-phase motion of the fluid and solid phase, thereby creating a relative fluid-solid displacement vector field. Decoupling of the poroelasticity equations gives a diffusion equation for the fluid-solid displacement field valid in a poroelastic medium with spatial fluctuations in hydraulic conductivity. Then, an effective conductivity is found by a Green's function approach followed by a strong-contrast perturbation theory suggested earlier in the context of random dielectrics. This theory leads to closed-form expressions for the frequency-dependent effective conductivity as a function of the one- and two-point probability functions of the conductivity fluctuations. In one dimension, these expressions are consistent with exact solutions in both low- and high-frequency limits for arbitrary conductivity contrast. In 3D, the low-frequency limit depends on the details of the microstructure. However, the derived approximation for the effective conductivity is consistent with the Hashin-Shtrikman bounds.

  14. DNA nanosensor surface grafting and salt dependence

    NASA Astrophysics Data System (ADS)

    Carvalho, B. G.; Fagundes, J.; Martin, A. A.; Raniero, L.; Favero, P. P.

    2013-02-01

    In this paper we investigated the Paracoccidoides brasiliensis fungus nanosensor by simulations of simple strand DNA grafting on gold nanoparticle. In order to improve the knowledge of nanoparticle environment, the addiction of salt solution was studied at the models proposed by us. Nanoparticle and DNA are represented by economic models validated by us in this paper. In addition, the DNA grafting and salt influences are evaluated by adsorption and bond energies calculations. This theoretical evaluation gives support to experimental diagnostics techniques of diseases.

  15. Temperature dependence of thermal conductivity of biological tissues.

    PubMed

    Bhattacharya, A; Mahajan, R L

    2003-08-01

    In this paper, we present our experimental results on the determination of the thermal conductivity of biological tissues using a transient technique based on the principles of the cylindrical hot-wire method. A novel, 1.45 mm diameter, 50 mm long hot-wire probe was deployed. Initial measurements were made on sponge, gelatin and Styrofoam insulation to test the accuracy of the probe. Subsequent experiments conducted on sheep collagen in the range of 25 degrees C < T < 55 degrees C showed the thermal conductivity to be a linear function of temperature. Further, these changes in the thermal conductivity were found to be reversible. However, when the tissue was heated beyond 55 degrees C, irreversible changes in thermal conductivity were observed. Similar experiments were also conducted for determining the thermal conductivity of cow liver. In this case, the irreversible effects were found to set in much later at around 90 degrees C. Below this temperature, in the range of 25 degrees C < T < 90 degrees C, the thermal conductivity, as for sheep collagen, varied linearly with temperature. In the second part of our study, in vivo measurements were taken on the different organs of a living pig. Comparison with reported values for dead tissues shows the thermal conductivities of living organs to be higher, indicating thereby the dominant role played by blood perfusion in enhancing the net heat transfer in living tissues. The degree of enhancement is different in different organs and shows a direct dependence on the blood flow rate.

  16. Sequence dependent proton conduction in self-assembled peptide nanostructures.

    PubMed

    Lerner Yardeni, Jenny; Amit, Moran; Ashkenasy, Gonen; Ashkenasy, Nurit

    2016-01-28

    The advancement of diverse electrochemistry technologies depends on the development of novel proton conducting polymers. Inspired by the efficacy of proton transport through proteins, we show in this work that self-assembling peptide nanostructures may be a promising alternative for such organic proton conducting materials. We demonstrate that aromatic amino acids, which participate in charge transport in nature, unprecedentedly promote proton conduction under both high and low relative humidity conditions for d,l α-cyclic peptide nanotubes. For dehydrated networks long-range order of the assemblies, induced by the aromatic side chains, is shown to be a dominating factor for promoting conductivity. However, for hydrated networks this order of effect is less significant and conductivity can be improved by the introduction of proton donating carboxylic acid peptide side chains in addition to the aromatic side chains despite the lower order of the assemblies. Based on these observations, a novel cyclic peptide that incorporates non-natural naphthyl side chains was designed. Self-assembled nanotubes of this peptide show greatly improved dehydrated conductivity, while maintaining high conductivity under hydrated conditions. We envision that the demonstrated modularity and versatility of these bio inspired nanostructures will make them extremely attractive building blocks for the fabrication of devices for energy conversion and storage applications, as well as other applications that involve proton transport, whether dry or wet conductivity is desired.

  17. Universal Size-Dependent Conductance Fluctuations in Disordered Organic Semiconductors

    NASA Astrophysics Data System (ADS)

    Massé, A.; Coehoorn, R.; Bobbert, P. A.

    2014-09-01

    Numerically exact results of hopping charge transport in disordered organic semiconductors show for uncorrelated and dipole-correlated Gaussian energy disorder a universal, power-law, and non-power-law dependence, respectively, of the relative conductance fluctuations on the size of the considered region. Data collapse occurs upon scaling with a characteristic length having a power-law temperature dependence. Below this length, which can be as high as 100 nm for correlated disorder in a realistic case, fluctuations dominate and a continuum description of charge transport breaks down.

  18. Universal size-dependent conductance fluctuations in disordered organic semiconductors.

    PubMed

    Massé, A; Coehoorn, R; Bobbert, P A

    2014-09-12

    Numerically exact results of hopping charge transport in disordered organic semiconductors show for uncorrelated and dipole-correlated Gaussian energy disorder a universal, power-law, and non-power-law dependence, respectively, of the relative conductance fluctuations on the size of the considered region. Data collapse occurs upon scaling with a characteristic length having a power-law temperature dependence. Below this length, which can be as high as 100 nm for correlated disorder in a realistic case, fluctuations dominate and a continuum description of charge transport breaks down.

  19. Helix-Dependent Spin Filtering through the DNA Duplex.

    PubMed

    Zwang, Theodore J; Hürlimann, Sylvia; Hill, Michael G; Barton, Jacqueline K

    2016-12-07

    Recent work suggests that electrons can travel through DNA and other chiral molecules in a spin-selective manner, but little is known about the origin of this spin selectivity. Here we describe experiments on magnetized DNA-modified electrodes to explore spin-selective electron transport through hydrated duplex DNA. Our results show that the two spins migrate through duplex DNA with a different yield and that spin selectivity requires charge transport through the DNA duplex. Significantly, shifting the same duplex DNA between right-handed B- and left-handed Z-forms leads to a diode-like switch in spin selectivity; which spin moves more efficiently through the duplex depends upon the DNA helicity. With DNA, the supramolecular organization of chiral moieties, rather than the chirality of the individual monomers, determines the selectivity in spin, and thus a conformational change can switch the spin selectivity.

  20. The voltage dependence of the chloride conductance of frog muscle

    PubMed Central

    Hutter, O. F.; Warner, Anne E.

    1972-01-01

    1. The effect of extracellular pH changes on the voltage—current relation of frog muscle membrane has been studied using intracellular microelectrodes. To reduce the cation conductance of the membrane, potassium in Ringer solution was replaced by rubidium. 2. When the relatively impermeant methyl sulphate ion replaced extracellular chloride the membrane conductance was low, time independent and little influenced by extracellular pH changes. The voltage—current relation was linear at both high and low pH values. 3. In rubidium Ringer solution at pH 7·4 the membrane conductance fell as the inside of the fibre was made more negative, in a manner consistent with the predictions of the constant field theory. 4. At a high pH value (9·8) the resting conductance was high, but it fell steeply as the membrane potential was increased; for large hyperpolarizing voltages the membrane current tended to a limiting value. The voltage—current relation crossed those recorded at pH 7·4 and 5·0. 5. In acid Ringer solution (pH 5·0) the resting membrane conductance was low and remained constant until the membrane potential was hyperpolarized more than 30 mV beyond the resting value; the conductance then rose as the membrane potential was further increased. For large hyperpolarizations the membrane conductance was higher at pH 5·0 than at pH 9·8. 6. Experiments using two successive, identical, constant current pulses suggested that the membrane conductance altered during the passage of current across the membrane; in alkaline solution the conductance fell with time, in acid solution it rose. 7. Because no time or voltage dependence of the membrane conductance was seen in the absence of chloride ions it is inferred that the movements of chloride ions across the muscle membrane are responsible for both the time and voltage dependent alterations in membrane conductance seen at different pH values. PMID:4539587

  1. Doping level dependent space charge limited conduction in polyaniline nanoparticles

    NASA Astrophysics Data System (ADS)

    Nath, Chandrani; Kumar, A.

    2012-11-01

    Spherical shaped polyaniline nanoparticles of average diameter ˜4 nm were doped with different concentration of hydrochloric acid. The x-ray diffraction studies reveal an increase in crystallinity with doping. Temperature dependent current-voltage measurements on the different nanoparticle samples indicate the prevalence of bulk-controlled space charge limited conduction (SCLC) mechanism in the high voltage (>1 V) region while the ohmic conduction dominates at the lower voltage (<1 V) region. With increasing doping the nature of SCLC changes from trap-free SCLC to Child-Langmuir type SCLC via exponential trap-limited SCLC. Moreover, the field and temperature dependence of mobility exhibits the universal Poole-Frenkel behavior. The energetic disorder parameter, spatial disorder parameter, inter-site distance, and localization length have been extracted employing the uncorrelated and the correlated Gaussian disorder model.

  2. Voltage-dependent properties of DNA origami nanopores.

    PubMed

    Hernández-Ainsa, Silvia; Misiunas, Karolis; Thacker, Vivek V; Hemmig, Elisa A; Keyser, Ulrich F

    2014-03-12

    We show DNA origami nanopores that respond to high voltages by a change in conformation on glass nanocapillaries. Our DNA origami nanopores are voltage sensitive as two distinct states are found as a function of the applied voltage. We suggest that the origin of these states is a mechanical distortion of the DNA origami. A simple model predicts the voltage dependence of the structural change. We show that our responsive DNA origami nanopores can be used to lower the frequency of DNA translocation by 1 order of magnitude.

  3. DNA-DEPENDENT CONFORMATIONAL CHANGES IN THE KU HETERODIMER

    PubMed Central

    Lehman, Jason A.; Hoelz, Derek J.; Turchi, John J.

    2008-01-01

    Ionizing radiation induces DNA double-strand breaks which are repaired by the non-homologous end joining (NHEJ) pathway. NHEJ is initiated upon Ku binding to the DNA ends and facilitating an interaction with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). This heterotrimeric DNA-PK complex is then active as a serine/threonine protein kinase. The molecular mechanisms involved in DNA-PK activation are unknown. Considering the crucial role of Ku in this process, we therefore determined the influence of DNA binding on the structure of the Ku heterodimer. Chemical modification with NHS-biotin and mass spectrometry was used to identify sites of modification. Biotinylation of free Ku revealed several reactive lysines on Ku70 and Ku80 which were reduced or eliminated upon DNA binding. Interestingly, in the predicted C-terminus SAP domain of Ku70, biotinylation patterns were observed which suggest a structural change in this region of the protein induced by DNA binding. Limited proteolytic digests of free and DNA-bound Ku revealed a series of unique peptides, again, indicative of a change in the accessibility of the Ku70 and Ku80 C-terminal domains. A 10 kDa peptide was also identified which was preferentially generated under non-DNA bound conditions and mapped to the Ku70 C-terminus. These results indicate a DNA-dependent movement or structural change in the C-terminal domains of Ku70 and Ku80 that may contribute to DNA-PKcs binding and activation. These results represent the first demonstration of DNA-induced changes in Ku structure and provide a framework for analysis of DNA-PKcs and the mechanism of DNA-PK activation. PMID:18355052

  4. Sequence dependent proton conduction in self-assembled peptide nanostructures

    NASA Astrophysics Data System (ADS)

    Lerner Yardeni, Jenny; Amit, Moran; Ashkenasy, Gonen; Ashkenasy, Nurit

    2016-01-01

    The advancement of diverse electrochemistry technologies depends on the development of novel proton conducting polymers. Inspired by the efficacy of proton transport through proteins, we show in this work that self-assembling peptide nanostructures may be a promising alternative for such organic proton conducting materials. We demonstrate that aromatic amino acids, which participate in charge transport in nature, unprecedentedly promote proton conduction under both high and low relative humidity conditions for d,l α-cyclic peptide nanotubes. For dehydrated networks long-range order of the assemblies, induced by the aromatic side chains, is shown to be a dominating factor for promoting conductivity. However, for hydrated networks this order of effect is less significant and conductivity can be improved by the introduction of proton donating carboxylic acid peptide side chains in addition to the aromatic side chains despite the lower order of the assemblies. Based on these observations, a novel cyclic peptide that incorporates non-natural naphthyl side chains was designed. Self-assembled nanotubes of this peptide show greatly improved dehydrated conductivity, while maintaining high conductivity under hydrated conditions. We envision that the demonstrated modularity and versatility of these bio inspired nanostructures will make them extremely attractive building blocks for the fabrication of devices for energy conversion and storage applications, as well as other applications that involve proton transport, whether dry or wet conductivity is desired.The advancement of diverse electrochemistry technologies depends on the development of novel proton conducting polymers. Inspired by the efficacy of proton transport through proteins, we show in this work that self-assembling peptide nanostructures may be a promising alternative for such organic proton conducting materials. We demonstrate that aromatic amino acids, which participate in charge transport in nature

  5. Interplay between Ku, Artemis, and the DNA-dependent protein kinase catalytic subunit at DNA ends.

    PubMed

    Drouet, Jérôme; Frit, Philippe; Delteil, Christine; de Villartay, Jean-Pierre; Salles, Bernard; Calsou, Patrick

    2006-09-22

    Repair of DNA double strand breaks (DSB) by the nonhomologous end-joining pathway in mammals requires at least seven proteins involved in a simplified two-step process: (i) recognition and synapsis of the DNA ends dependent on the DNA-dependent protein kinase (DNA-PK) formed by the Ku70/Ku80 heterodimer and the catalytic subunit DNA-PKcs in association with Artemis; (ii) ligation dependent on the DNA ligase IV.XRCC4.Cernunnos-XLF complex. The Artemis protein exhibits exonuclease and endonuclease activities that are believed to be involved in the processing of a subclass of DSB. Here, we have analyzed the interactions of Artemis and nonhomologous end-joining pathway proteins both in a context of human nuclear cell extracts and in cells. DSB-inducing agents specifically elicit the mobilization of Artemis to damaged chromatin together with DNA-PK and XRCC4/ligase IV proteins. DNA-PKcs is necessary for the loading of Artemis on damaged DNA and is the main kinase that phosphorylates Artemis in cells damaged with highly efficient DSB producers. Under kinase-preventive conditions, both in vitro and in cells, Ku-mediated assembly of DNA-PK on DNA ends is responsible for a dissociation of the DNA-PKcs. Artemis complex. Conversely, DNA-PKcs kinase activity prevents Artemis dissociation from the DNA-PK.DNA complex. Altogether, our data allow us to propose a model in which a DNA-PKcs-mediated phosphorylation is necessary both to activate Artemis endonuclease activity and to maintain its association with the DNA end site. This tight functional coupling between the activation of both DNA-PKcs and Artemis may avoid improper processing of DNA.

  6. Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.

    PubMed

    Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi

    2016-05-01

    Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.

  7. Electrical conductance of DNA molecules with varied density of itinerant pi electrons.

    PubMed

    Gao, Xu-Tuan; Fu, Xue; Mei, Liang-Mo; Xie, Shi-Jie

    2006-06-21

    The electrical transport of DNA is closely related to the density of itinerant pi electrons because of the strong electron-lattice interaction. The resistivities of two typical DNA molecules [poly(dG)-poly(dC) and lambda-DNA] with varied densities of itinerant pi electrons are calculated. It is found that the dependence of the resistivity on the density of itinerant pi electrons is symmetrical about the half-filling state of itinerant pi electrons in poly(dG)-poly(dC). At the half-filling state, the Peierls phase transition takes place and poly(dG)-poly(dC) has a large resistivity. When the density of itinerant pi electrons departs far from the half-filling state, the resistivity of poly(dG)-poly(dC) becomes small. For lambda-DNA, there is no Peierls phase transition due to the aperiodicity of its base pair arrangement. The resistivity of poly(dG)-poly(dC) decreases with increasing length of the molecular chain, but the resistivity of lambda-DNA increases with increasing length. The conducting mechanisms for poly(dG)-poly(dC) and a few lambda-DNA molecules with varied densities of itinerant pi electrons are analyzed.

  8. Temperature dependence of DNA condensation at high ionic concentration

    NASA Astrophysics Data System (ADS)

    Mao, Wei; Gao, Qingqing; Liu, Yanhui; Fan, Yangtao; Hu, Lin; Xu, Houqiang

    2016-08-01

    A series of experiments pointed out that compact states of DNA condensed by multivalent cation prefer higher temperature. The condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in temperature. At the same time, a recent experimental work carried out in buffer solution without multivalent cation points out that DNA persistence length strongly depends on the temperature. DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. It is necessary to revolve the effects of temperature dependence of persistence length on DNA condensation, and a model including the temperature dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the temperature dependence of toroid conformations. With an increase in temperature, the first periodic oscillation in the autocorrelation function shifts left and the number of segments containing the first periodic oscillation decreases gradually. According to the experiments mentioned above, the long-axis length is defined to estimate the temperature dependence of condensation process further. At the temperatures defined in experiments mentioned above, the relation between long-axis length and temperature matches the experimental results.

  9. CROSS-DISCIPLINARY PHYSICS AND RELATED AREAS OF SCIENCE AND TECHNOLOGY: Characteristics of alternating current hopping conductivity in DNA sequences

    NASA Astrophysics Data System (ADS)

    Ma, Song-Shan; Xu, Hui; Wang, Huan-You; Guo, Rui

    2009-08-01

    This paper presents a model to describe alternating current (AC) conductivity of DNA sequences, in which DNA is considered as a one-dimensional (1D) disordered system, and electrons transport via hopping between localized states. It finds that AC conductivity in DNA sequences increases as the frequency of the external electric field rises, and it takes the form of øac(ω) ~ ω2 ln2(1/ω). Also AC conductivity of DNA sequences increases with the increase of temperature, this phenomenon presents characteristics of weak temperature-dependence. Meanwhile, the AC conductivity in an off-diagonally correlated case is much larger than that in the uncorrelated case of the Anderson limit in low temperatures, which indicates that the off-diagonal correlations in DNA sequences have a great effect on the AC conductivity, while at high temperature the off-diagonal correlations no longer play a vital role in electric transport. In addition, the proportion of nucleotide pairs p also plays an important role in AC electron transport of DNA sequences. For p < 0.5, the conductivity of DNA sequence decreases with the increase of p, while for p >= 0.5, the conductivity increases with the increase of p.

  10. Conformation dependent electronic transport in a DNA double-helix

    SciTech Connect

    Kundu, Sourav Karmakar, S. N.

    2015-10-15

    We present a tight-binding study of conformation dependent electronic transport properties of DNA double-helix including its helical symmetry. We have studied the changes in the localization properties of DNA as we alter the number of stacked bases within every pitch of the double-helix keeping fixed the total number of nitrogen bases within the DNA molecule. We take three DNA sequences, two of them are periodic and one is random and observe that in all the cases localization length increases as we increase the radius of DNA double-helix i.e., number of nucleobases within a pitch. We have also investigated the effect of backbone energetic on the I-V response of the system and found that in presence of helical symmetry, depending on the interplay of conformal variation and disorder, DNA can be found in either metallic, semiconducting and insulating phases, as observed experimentally.

  11. Sea salt dependent electrical conduction in polar ice

    SciTech Connect

    Moore, J.; Paren, J. ); Oerter, H. )

    1992-12-10

    A 45 m length of ice core from Dolleman Island, Antarctic Peninsula has been dielectrically analyzed at 5 cm resolution using the dielectric profiling (DEP) technique. The core has also been chemically analyzed for major ionic impurities. A statistical analysis of the measurements shows that the LF (low frequency) conductivity is determined both by neutral salt and acid concentrations. The statistical relationships have been compared with results from laboratory experiments on ice doped with HF (hydrogen fluoride). Salts (probably dispersed throughout the ice fabric) determine the dielectric conductivity. The salt conduction mechanism is probably due to Bjerrum L defects alone, created by the incorporation of chloride ions in the lattice. Samples of ice from beneath the Filchner-Ronne Ice Shelf were also measured and display a similar conduction mechanism below a solubility limit of about 400 [mu]M of chloride. The temperature dependence of the neutral salt, acid and pure ice contributions to the LF conductivity of natural ice between [approximately] 70[degrees]C and 0[degrees]C is discussed. These results allow a comprehensive comparison of dielectric and chemical data from natural ice.

  12. Universality and the thermal dependence of the conductance of nanodevices

    NASA Astrophysics Data System (ADS)

    Oliveira, Luiz N.; Seridonio, Antonio C.; Yoshida, Makoto

    2008-03-01

    The conductance of a quantum wire side-coupled to a quantum dot will be discussed. In this device, plots of the conductance G vs. the gate voltage Vg applied to the dot display Fano antiresonances due to the interference between the current traversing the wire and the flux of electrons that hop to the dot to bypass the adjacent section of the wire; at fixed Vg's, the interference accounts for a variety of thermal dependences G(T). Analytical renormalization-group arguments will be presented that map G(T) to the universal curve g(T/TK) for the conductance of the spin-degenerate Anderson impurity Hamiltonian, with temperatures normalized by the Kondo temperature TK. This linear, universal mapping will be shown to (i) generate curves in excellent agreement with the measurements of Sato et al. [Phys. Rev. Lett. 95, 066801 (2005)] and justify those authors' phenomenological description of their data; (ii) fit novel numerical renormalization-group data for the conductance of the side-coupled device; and (iii) link G(T) to the conductance of the single-electron transistor.

  13. A context dependent role for DNA methylation in bivalves.

    PubMed

    Gavery, Mackenzie R; Roberts, Steven B

    2014-05-01

    The function of DNA methylation in species such as bivalves where the limited amount of DNA methylation is predominantly found in gene bodies remains unclear. An emerging possible explanation is that the role of gene body DNA methylation is dependent on gene function, a potential phenomenon that has arisen from selective pressure on lineage-specific life history traits. In genes contributing to phenotypes that benefit from increased plasticity, the absence of DNA methylation could contribute to stochastic transcriptional opportunities and increased transposable element activity. In genes where regulated control of activity is essential, DNA methylation may also play a role in targeted, predictable genome regulation. Here, we review the current knowledge concerning DNA methylation in bivalves and explore the putative role of DNA methylation in both an evolutionary and ecological context. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  14. Xenopus transcription factor IIIA-dependent DNA renaturation.

    PubMed

    Fiser-Littell, R M; Hanas, J S

    1988-11-15

    Kinetic and titration analyses are used to elucidate the mechanism by which Xenopus transcription factor IIIA (TFIIIA), a protein required for 5 S RNA synthesis by RNA polymerase III, promotes DNA renaturation. TFIIIA promotes 50% renaturation of complementary strands (303 bases) in 45 s. Analyses of the renaturation kinetics indicate the rate-limiting step in this TFIIIA-dependent reaction is first order. TFIIIA-dependent DNA renaturation is a stoichiometric rather than a catalytic process. The renaturation rates for specific and nonspecific DNA are very similar, indicating lack of sequence specificity in this TFIIIA-dependent process. In the nanomolar concentration range of protein and DNA, renaturation occurs at a ratio of about one TFIIIA molecule/single strand (303 bases). Elevated reaction temperatures strongly stimulate TFIIIA-dependent DNA renaturation; at 45 degrees C, renaturation of the 303-base pair fragment nears completion in about 5 s. The ability of TFIIIA to rapidly promote DNA renaturation is unique when compared with Escherichia coli recA protein, single-stranded DNA binding protein, or bacteriophage T4 gene 32 protein. This mechanism by which TFIIIA promotes DNA renaturation is compatible with features of 5 S RNA gene transcription.

  15. Sequence-dependent DNA deformability studied using molecular dynamics simulations

    PubMed Central

    Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori

    2007-01-01

    Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein–DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein–DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids. PMID:17766249

  16. A time dependent anatomically detailed model of cardiac conduction

    NASA Technical Reports Server (NTRS)

    Saxberg, B. E.; Grumbach, M. P.; Cohen, R. J.

    1985-01-01

    In order to understand the determinants of transitions in cardiac electrical activity from normal patterns to dysrhythmias such as ventricular fibrillation, we are constructing an anatomically and physiologically detailed finite element simulation of myocardial electrical propagation. A healthy human heart embedded in paraffin was sectioned to provide a detailed anatomical substrate for model calculations. The simulation of propagation includes anisotropy in conduction velocity due to fiber orientation as well as gradients in conduction velocities, absolute and relative refractory periods, action potential duration and electrotonic influence of nearest neighbors. The model also includes changes in the behaviour of myocardial tissue as a function of the past local activity. With this model, we can examine the significance of fiber orientation and time dependence of local propagation parameters on dysrhythmogenesis.

  17. A time dependent anatomically detailed model of cardiac conduction

    NASA Technical Reports Server (NTRS)

    Saxberg, B. E.; Grumbach, M. P.; Cohen, R. J.

    1985-01-01

    In order to understand the determinants of transitions in cardiac electrical activity from normal patterns to dysrhythmias such as ventricular fibrillation, we are constructing an anatomically and physiologically detailed finite element simulation of myocardial electrical propagation. A healthy human heart embedded in paraffin was sectioned to provide a detailed anatomical substrate for model calculations. The simulation of propagation includes anisotropy in conduction velocity due to fiber orientation as well as gradients in conduction velocities, absolute and relative refractory periods, action potential duration and electrotonic influence of nearest neighbors. The model also includes changes in the behaviour of myocardial tissue as a function of the past local activity. With this model, we can examine the significance of fiber orientation and time dependence of local propagation parameters on dysrhythmogenesis.

  18. Mode dependent lattice thermal conductivity of single layer graphene

    SciTech Connect

    Wei, Zhiyong; Yang, Juekuan; Bi, Kedong; Chen, Yunfei

    2014-10-21

    Molecular dynamics simulation is performed to extract the phonon dispersion and phonon lifetime of single layer graphene. The mode dependent thermal conductivity is calculated from the phonon kinetic theory. The predicted thermal conductivity at room temperature exhibits important quantum effects due to the high Debye temperature of graphene. But the quantum effects are reduced significantly when the simulated temperature is as high as 1000 K. Our calculations show that out-of-plane modes contribute about 41.1% to the total thermal conductivity at room temperature. The relative contribution of out-of-plane modes has a little decrease with the increase of temperature. Contact with substrate can reduce both the total thermal conductivity of graphene and the relative contribution of out-of-plane modes, in agreement with previous experiments and theories. Increasing the coupling strength between graphene and substrate can further reduce the relative contribution of out-of-plane modes. The present investigations also show that the relative contribution of different mode phonons is not sensitive to the grain size of graphene. The obtained phonon relaxation time provides useful insight for understanding the phonon mean free path and the size effects in graphene.

  19. Dependence of thermal conductivity on structural parameters in porous samples

    NASA Astrophysics Data System (ADS)

    Miettinen, L.; Kekäläinen, P.; Turpeinen, T.; Hyväluoma, J.; Merikoski, J.; Timonen, J.

    2012-03-01

    The in-plane thermal conductivity of porous sintered bronze plates was studied both experimentally and numerically. We developed and validated an experimental setup, where the sample was placed in vacuum and heated while its time-dependent temperature field was measured with an infrared camera. The porosity and detailed three-dimensional structure of the samples were determined by X-ray microtomography. Lattice-Boltzmann simulations of thermal conductivity in the tomographic reconstructions of the samples were used to correct the contact area between bronze particles as determined by image analysis from the tomographic reconstructions. Small openings in the apparent contacts could not be detected with the imaging resolution used, and they caused an apparent thermal contact resistance between particles. With this correction included, the behavior of the measured thermal conductivity was successfully explained by an analytical expression, originally derived for regular structures, which involves three structural parameters of the porous structures. There was no simple relationship between heat conductivity and porosity.

  20. Hormonal induction of transfected genes depends on DNA topology.

    PubMed Central

    Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M

    1990-01-01

    Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920

  1. The calcium-dependent potassium conductance in rat sympathetic neurones.

    PubMed Central

    Belluzzi, O; Sacchi, O

    1990-01-01

    1. Adult and intact sympathetic neurones of isolated rat superior cervical ganglia were subjected to a two-electrode voltage-clamp analysis at 37 degrees C in order to investigate the Ca2(+)-dependent K+ conductance. 2. At each potential a Ca2(+)-dependent K+ current, IKCa, was determined as the difference between the current that could be attributed to the voltage-dependent K+ current, IKV, following Ca2+ channel blockade by Cd2+ and the total current generated. The final IKCa curves were obtained after correcting the experimental tracings for the underlying ICa current component. 3. IKCa became detectable during commands to -30 mV. About 3.6 x 10(5) Ca2+ ions are required to enter the cell before IKCa is initiated. The current was modelled on the basis of a 0.4-0.6 ms delay followed by an exponential activation of a fast component, IKCaf, simultaneously with a much slower exponential activation, IKCas. Experiments indicate a sigmoidal activation curve for the fast conductance, gKCf, with half-maximal activation at -13.0 mV and a slope factor of 4.7 mV (for 5 mM-Ca2+ in the bath). The associated time constant, tau kcf, ranged from 0.8 to 2.0 ms. The slow conductance exhibited a similar steady-state activation curve but an activation time constant in the 48-280 ms range. The maximum mean gKC was 0.32 microS per neurone for either the fast or slow component. 4. Excess K+ ions accumulate in the perineuronal space during K+ current flow giving rise to rapidly occurring, large K+ reversal potential (EK) modifications (up to -45 mV for the largest currents). The kinetics of K+ extracellular load can be described satisfactorily by a simple exponential function (tau = 0.9-2.8 ms). The characteristics of K+ wash-out appear similar to those of accumulation. 5. The immediate effect of such an extracellular K+ build-up is to make the apparent IKCa activation kinetics faster and to reduce (up to 50%) the true value of the K+ conductance. We simulated the predictions of a K

  2. Anti-DNA antibody mediated catalysis is isotype dependent.

    PubMed

    Xia, Yumin; Eryilmaz, Ertan; Zhang, Qiuting; Cowburn, David; Putterman, Chaim

    2016-01-01

    Anti-DNA antibodies are the serological hallmark of systemic lupus erythematosus, and participate in the pathogenesis of lupus nephritis by cross-reacting with multiple renal antigens. Previously, using a panel of murine anti-DNA IgGs that share identical variable regions but that differ in the constant regions, we demonstrated that the cross-reaction and renal pathogenicity of anti-DNA antibodies are isotype dependent. In this study, we investigated the catalytic potential of this anti-DNA antibody panel, and determined its isotype dependency. The three isotype switch variants (IgG1, IgG2a, IgG2b) and the parent IgG3 PL9-11 anti-DNA antibodies were compared in their catalysis of 500 base pair linear double stranded DNA and a 12-mer peptide (ALWPPNLHAWVP), by gel analysis, MALDI-TOF mass spectrometry, and nuclear magnetic resonance spectroscopy. The binding affinity of anti-DNA antibodies to double stranded DNA and peptide antigens were assessed by ELISA and surface plasmon resonance. We found that the PL9-11 antibody isotypes vary significantly in their potential to catalyze the cleavage of both linear and double stranded DNA and the proteolysis of peptides. The degree of the cleavage and proteolysis increases with the incubation temperature and time. While different PL9-11 isotypes have the same initial attack sites within the ALWPPNLHAWVP peptide, there was no correlation between binding affinity to the peptide and proteolysis rates. In conclusion, the catalytic properties of anti-DNA antibodies are isotype dependent. This finding provides further evidence that antibodies that share the same variable region, but which have different constant regions, are functionally distinct. The catalytic effects modulated by antibody constant regions need to be considered in the design of therapeutic antibodies (abzymes) and peptides designed to block pathogenic autoantibodies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Anti-DNA antibody mediated catalysis is isotype dependent

    PubMed Central

    Xia, Yumin; Eryilmaz, Ertan; Zhang, Qiuting; Cowburn, David; Putterman, Chaim

    2015-01-01

    Anti-DNA antibodies are the serological hallmark of systemic lupus erythematosus, and participate in the pathogenesis of lupus nephritis by cross-reacting with multiple renal antigens. Previously, using a panel of murine anti-DNA IgGs that share identical variable regions but that differ in the constant regions, we demonstrated that the cross-reaction and renal pathogenicity of anti-DNA antibodies are isotype dependent. In this study, we investigated the catalytic potential of this anti-DNA antibody panel, and determined its isotype dependency. The three isotype switch variants (IgG1, IgG2a, IgG2b) and the parent IgG3 PL9-11 anti-DNA antibodies were compared in their catalysis of 500 base pair linear double stranded DNA and a 12-mer peptide (ALWPPNLHAWVP), by gel analysis, MALDI-TOF mass spectrometry, and nuclear magnetic resonance spectroscopy. The binding affinity of anti-DNA antibodies to double stranded DNA and peptide antigens were assessed by ELISA and surface plasmon resonance. We found that the PL9-11 antibody isotypes vary significantly in their potential to catalyze the cleavage of both linear and double stranded DNA and the proteolysis of peptides. The degree of the cleavage and proteolysis increases with the incubation temperature and time. While different PL9-11 isotypes have the same initial attack sites within the ALWPPNLHAWVP peptide, there was no correlation between binding affinity to the peptide and proteolysis rates. In conclusion, the catalytic properties of anti-DNA antibodies are isotype dependent. This finding provides further evidence that antibodies that share the same variable region, but which have different constant regions, are functionally distinct. The catalytic effects modulated by antibody constant regions need to be considered in the design of therapeutic antibodies (abzymes) and peptides designed to block pathogenic autoantibodies. PMID:26655427

  4. Universal frequency-dependent conduction of electron glasses

    NASA Astrophysics Data System (ADS)

    Amir, Ariel

    2014-03-01

    Characterizing the frequency-dependent response of amorphous systems and glasses can provide important insights into their physics. Here, we study the response of an electronic glass, where Coulomb interactions are important and have previously been shown to significantly modify the conductance and lead to memory effects and aging. We propose a model which allows us to take the interactions into account in a self-consistent way, and explore the transport properties at all frequencies. Within the model, the response maps exactly to a (linear) network of resistors, self-capacitances and mutual capacitances. The response of this equivalent electric circuit is found numerically, and is shown to obey the universal scaling which is experimentally observed for a large class of amorphous solids.

  5. Water percolation governs polymorphic transitions and conductivity of DNA.

    PubMed

    Brovchenko, Ivan; Krukau, Aliaksei; Oleinikova, Alla; Mazur, Alexey K

    2006-09-29

    We report on the first computer simulation studies of the percolation transition of water at the surface of the DNA double helix. With increased hydration, the ensemble of small clusters merges into a spanning water network via a quasi-two-dimensional percolation transition. This transition occurs strikingly close to the hydration level where the B form of DNA becomes stable in experiment. Formation of spanning water networks results in sigmoidlike acceleration of long-range ion transport in good agreement with experiment.

  6. RNF111-dependent neddylation activates DNA damage-induced ubiquitination

    PubMed Central

    Ma, Teng; Chen, Yibin; Zhang, Feng; Yang, Chao-Yie; Wang, Shaomeng; Yu, Xiaochun

    2013-01-01

    Summary Ubiquitin-like proteins have been shown to be covalently conjugated to targets. However, the functions of these ubiquitin-like proteins are largely unknown. Here, we have screened most known ubiquitin-like proteins after DNA damage and found that NEDD8 is involved in the DNA damage response. Following various DNA damage stimuli, NEDD8 accumulated at DNA damage sites, and this accumulation was dependent on an E2 enzyme UBE2M and an E3 ubiquitin ligase RNF111. We further found that histone H4 was polyneddylated in response to DNA damage, and NEDD8 was conjugated to the N-terminal lysine residues of H4. Interestingly, the DNA damage-induced polyneddylation chain could be recognized by the MIU (Motif Interacting with Ubiquitin) domain of RNF168. Loss of DNA damage-induced neddylation negatively regulated DNA damage-induced foci formation of RNF168 and its downstream functional partners, such as 53BP1 and BRCA1, thus affecting the normal DNA damage repair process. PMID:23394999

  7. Boundary formulations for shape sensitivity of temperature dependent conductivity problems

    NASA Technical Reports Server (NTRS)

    Kane, James H.; Wang, Hua

    1992-01-01

    Used in concert with the Kirchhoff transformation, implicit differentiation of the discretized boundary integral equations governing the conduction of heat in solids with temperature dependent thermal conductivity is shown to generate an accurate and economical approach for computation of shape sensitivities. For problems with specified temperature and heat flux boundary conditions, a linear problem results for both the analysis and sensitivity analysis. In problems with either convection or radiation boundary conditions, a nonlinear problem is generated. Several iterative strategies are presented for the solution of the resulting sets of nonlinear equations and the computational performances examined in detail. Multizone analysis and zone condensation strategies are demonstrated to provide substantive computational economies in this process for models with either localized nonlinear boundary conditions or regions of geometric insensitivity to design variables. A series of nonlinear example problems is presented that have closed form solutions. Exact analytical expressions for the shape sensitivities associated with these problems are developed and these are compared with the sensitivities computed using the boundary element formulation.

  8. Isolation of Circular DNA Molecules from Whole Cellular DNA by Use of ATP-Dependent Deoxyribonuclease

    PubMed Central

    Mukai, Tsunehiro; Matsubara, Kenichi; Takagi, Yasuyuki

    1973-01-01

    A technique is described for isolation of plasmid DNA in closed and open circular double-stranded forms from bacterial cells, by use of ATP-dependent deoxyribonuclease purified from Micrococcus luteus. This DNase, acting only upon linear DNA molecules, degrades all bacterial chromosomal DNA extracted in the linear form. Circular plasmid DNAs are left intact, and are then separated by sedimentation through a sucrose gradient. Unlike previous techniques for analysis of plasmid DNA, this technique can be used to isolate not only closed circular DNA but also open circular DNA. Several plasmids, such as those from phage (λdv1 and λdv21), a colicinogenic factor (Col E2), a sex factor (F8′ gal), and “minicircles” in Escherichia coli 15, in both the open and closed circular forms, were well separated from chromosomal DNA by this technique. PMID:4355370

  9. p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner

    SciTech Connect

    Miller, S.D.; Farmer, G.; Prives, C.

    1995-12-01

    This report discusses new findings that the tumor supressor gene product p53 may play a role as a DNA-binding-dependent regulator of DNA replication. The results were obtained using polyomavirus in replication assays. Details regarding effects on cell growth arrest and transcriptional activation are discussed. 61 refs., 7 figs.

  10. Protein-dependent conformational behavior of DNA in chromatin.

    PubMed

    Riehm, M R; Harrington, R E

    1987-05-19

    Information from circular dichroism (CD) and DNA thermal denaturation has been used in concert to study the conformational behavior of DNA in the extended 11-nm fiber of chromatin isolated from HeLa nuclei. The histone-dependent conformational states of the system were investigated by selectively removing the hydrophilic histone domains with trypsin. These were compared to acetylated chromatin from the same source. The integrated intensity of the positive CD band for DNA above 260 nm is found to increase with the content of relatively unstressed B-form DNA. This same increase is observed along the series of whole, H1-stripped, and trypsinized chromatin samples as protein is removed. Hence, the ratio of percent hyperchromicity to integrated CD band intensity of the respective melting transitions provides useful information on the conformational state of DNA in the three principal regions of the chromatin fiber: the central loop and flanking nucleosomal regions and the linker. Results from this study suggest that central loop DNA in both hyperacetylated and control chromatin relaxes as protein is removed. However, hyperacetylated chromatin shows significantly less dependence than control chromatin upon core histone hydrophilic domains in the flanking and linker regions. Thus, histone hyperacetylation evidently relaxes DNA in chromatin with no major overall conformational changes. A possible role of histone hyperacetylation may therefore be to reduce cooperativity in the unfolding transition in chromatin and thus provide for greater localized control of unfolding during transcription.

  11. Empowering Malaysian dentists to tobacco dependence treatment conduct.

    PubMed

    Nordin, Amer Siddiq Amer; Kadir, Rahimah Abdul; Yahya, Nurul Asyikin; Zakaria, Hazli; Rashid, Rusdi Abdul; Habil, Mohamed Hussain

    2014-08-01

    As a signatory to the World Health Organisation 2003 Framework Convention on Tobacco Control, Malaysia has policies in place and funded 300 public Quit clinics. Unfortunately, government dentists are not included to run tobacco dependence treatment. A cross-sectional exploratory survey was carried out to seek Malaysian dentists' opinion on their knowledge, perception and willingness to conduct tobacco dependence treatment. Participation was voluntary from those who attended a specially designed one-day, four-module workshop on tobacco cessation intervention. Data were collected using the Audience-Response-System equipment which tracked immediate responses covering four domains namely: smoking as a public health problem, smoking as an addiction, the role of dentists in the programme and confidence in conducting smoking cessation in the clinic. Sample comprised more female dentists (73.5%), mean age 33.6 (SD 8.99) years and with more than 3 years working experience. Findings indicated that the majority agreed Malaysia has a rising problem in the prevalence of smoking (71.6%) and predicted that it will affect mostly the young (81.9%). Only half of the dentists surveyed (58.9%) routinely recorded their patients' smoking habits. The majority (71.6%) believed that dentists are effective in helping their patient to stop smoking and 76.3% agreed that dentists should discuss the smoking habit with their patients; however, 60% agreed that doing so is too time consuming. In addition, only 24.7% knew of more ways to treat a smoking habit. The majority felt comfortable giving advice to patients about changing their habits (76.5%) or discussing treatment options (60.5%): 75% would opt for a combined programme of counselling and use of medication if they have to do, 15% would choose to go on counselling only, while 8% did not want to treat. In conclusion, the findings suggest that dentists have a strong potential to contribute significantly to providing smoking cessation

  12. DNA-protein recognition and sequence-dependent variations of DNA conformational properties

    NASA Astrophysics Data System (ADS)

    Vologodskii, Alexander

    2015-03-01

    Parameters of B-DNA, the major form of the double helix, depend on its sequence. This dependence can contribute to the recognition of specific DNA sequences by proteins. Here we try to analyze this contribution quantitatively. In the first approach to this goal we used experimental data on the sequence dependence of DNA bending rigidity and its helical repeat. The solution data on these parameters of B-DNA were derived from the experiments on cyclization of short DNA fragments with specially designed sequences. The data allowed calculating the sequence variations of DNA bending energy, as well as the variations of the energy of torsional deformation of the double helix associated with a protein binding. The results show that DNA conformational parameters can have very limited influence on the sequence specificity of protein binding. In the second approach we analyzed the experimental data on the binding affinity of the nucleosome core with DNA fragments of different sequences. The conclusions derived in these two approaches are in a good agreement with one another.

  13. Substrate dependent stability of conducting polymer coatings on medical electrodes.

    PubMed

    Green, Rylie A; Hassarati, Rachelle T; Bouchinet, Lucie; Lee, Chaekyung S; Cheong, Gin L M; Yu, Jin F; Dodds, Christopher W; Suaning, Gregg J; Poole-Warren, Laura A; Lovell, Nigel H

    2012-09-01

    Conducting polymer (CP) coatings on medical electrodes have the potential to provide superior performance when compared to conventional metallic electrodes, but their stability is strongly dependant on the substrate properties. The aim of this study was to examine the effect of laser roughening of underlying platinum (Pt) electrode surfaces on the mechanical, electrical and biological performance of CP coatings. In addition, the impact of dopant type on electrical performance and stability was assessed. The CP poly(ethylene dioxythiophene) (PEDOT) was coated on Pt microelectrode arrays, with three conventional dopant ions. The in vitro electrical characteristics were assessed by cyclic voltammetry and biphasic stimulation. Results showed that laser roughening of the underlying substrate did not affect the charge injection limit of the coated material, but significantly improved the passive stability and chronic stimulation lifetime without failure of the coating. Accelerated material ageing and long-term biphasic stimulus studies determined that some PEDOT variants experienced delamination within as little as 10 days when the underlying Pt was smooth, but laser roughening to produce a surface index of 2.5 improved stability, such that more than 1.3 billion stimulation cycles could be applied without evidence of failure. PEDOT doped with paratoluene sulfonate (PEDOT/pTS) was found to be the most stable CP on roughened Pt, and presented a surface topography which encouraged neural cell attachment.

  14. Conductance hysteresis in the voltage-dependent anion channel.

    PubMed

    Rappaport, Shay M; Teijido, Oscar; Hoogerheide, David P; Rostovtseva, Tatiana K; Berezhkovskii, Alexander M; Bezrukov, Sergey M

    2015-09-01

    Hysteresis in the conductance of voltage-sensitive ion channels is observed when the transmembrane voltage is periodically varied with time. Although this phenomenon has been used in studies of gating of the voltage-dependent anion channel, VDAC, from the outer mitochondrial membrane for nearly four decades, full hysteresis curves have never been reported, because the focus was solely on the channel opening branches of the hysteresis loops. We studied the hysteretic response of a multichannel VDAC system to a triangular voltage ramp the frequency of which was varied over three orders of magnitude, from 0.5 mHz to 0.2 Hz. We found that in this wide frequency range the area encircled by the hysteresis curves changes by less than a factor of three, suggesting broad distribution of the characteristic times and strongly non-equilibrium behavior. At the same time, quasi-equilibrium two-state behavior is observed for hysteresis branches corresponding to VDAC opening. This enables calculation of the usual equilibrium gating parameters, gating charge and voltage of equipartitioning, which were found to be almost insensitive to the ramp frequency. To rationalize this peculiarity, we hypothesize that during voltage-induced closure and opening the system explores different regions of the complex free energy landscape, and, in the opening branch, follows quasi-equilibrium paths.

  15. Temperature dependence of electrical conductivity and lunar temperatures

    NASA Technical Reports Server (NTRS)

    Olhoeft, G. R.; Strangway, D. W.; Sharpe, H.; Frisillo, A. L.

    1974-01-01

    Metallic conduction mechanicsms are probably not important in lunar materials because of the small amounts of free metal and metallic oxides present. This is confirmed by the extremely low conductivities measured to date and the fact that the conductivity increases with temperature. The major conduction mechanicsm appears to be ionic. This conduction mechanism is very strongly controlled by temperature, by deviations from stoichiometry, by electric field strengths, and by oxygen fugacity.

  16. On the electrical conductivity of lambda DNA at micron length-scales

    NASA Astrophysics Data System (ADS)

    Zhang, Y.; Austin, R. H.; Ong, N. P.; Cox, E. C.

    2002-03-01

    Recent experiments on the DC electrical conductivity of DNA yield a baffling array of results, from metallic conductivity to insulating behavior. We have concentrated on optimizing by chemical methods the direct binding of lambda DNA molecules to Au electrodes for two-probe I-V measurements. To achieve direct binding of the DNA base-pair stack to Au, we incorporated thiol-modified nucleotides into both DNA ends using a DNA polymerase modified to eliminate its exonuclease activities (the Klenow fragment, 3'arrow 5' exo-). We will show videos of DNA bound to electrodes in a flowing buffer solution, and evidence for and against specific chemical binding between the DNA and Au. Our present result is that, at room temperature, lambda DNA is an insulator on the micron scale ( ρ > 10^6 Ω \\cdot cm ).

  17. Cation charge dependence of the forces driving DNA assembly.

    PubMed

    DeRouchey, Jason; Parsegian, V Adrian; Rau, Donald C

    2010-10-20

    Understanding the strength and specificity of interactions among biologically important macromolecules that control cellular functions requires quantitative knowledge of intermolecular forces. Controlled DNA condensation and assembly are particularly critical for biology, with separate repulsive and attractive intermolecular forces determining the extent of DNA compaction. How these forces depend on the charge of the condensing ion has not been determined, but such knowledge is fundamental for understanding the basis of DNA-DNA interactions. Here, we measure DNA force-distance curves for a homologous set of arginine peptides. All forces are well fit as the sum of two exponentials with 2.4- and 4.8-Å decay lengths. The shorter-decay-length force is always repulsive, with an amplitude that varies slightly with length or charge. The longer-decay-length force varies strongly with cation charge, changing from repulsion with Arg¹ to attraction with Arg². Force curves for a series of homologous polyamines and the heterogeneous protein protamine are quite similar, demonstrating the universality of these forces for DNA assembly. Repulsive amplitudes of the shorter-decay-length force are species-dependent but nearly independent of charge within each species. A striking observation was that the attractive force amplitudes for all samples collapse to a single curve, varying linearly with the inverse of the cation charge.

  18. Concentration and length dependence of DNA looping in transcriptional regulation.

    PubMed

    Han, Lin; Garcia, Hernan G; Blumberg, Seth; Towles, Kevin B; Beausang, John F; Nelson, Philip C; Phillips, Rob

    2009-05-25

    In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage), to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least) two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.

  19. Effects of DNA nucleotide adsorption on the conductance of graphene nanoribbons from first principles

    NASA Astrophysics Data System (ADS)

    Lee, Eun-Cheol

    2012-04-01

    The effects of DNA nucleotide adsorption on the conductance of graphene nanoribbons are investigated through first-principles calculations. We find that, for the adsorption of a single nucleotide, the negatively charged phosphate produces conductance dips associated with quasibound states, reducing the hole conductance. The conductance of conduction electrons is also reduced by electron scattering at the Coulomb potential barriers produced by the phosphate, with no noticeable conductance dips near the Fermi level. Our results indicate that graphene nanoribbon is promising for the application to DNA sensor utilizing quantum carrier conductance.

  20. Structure Dependent Binding of Arylimidamides to the DNA Minor Groove

    PubMed Central

    Chai, Yun; Munde, Manoj; Kumar, Arvind; Mickelson, Leah; Lin, Sen; Campbell, Nancy H.; Banerjee, Moloy; Akay, Senol; Liu, Zongying; Farahat, Abdelbasset A.; Nhili, Raja; Depauw, Sabine; David-Cordonnier, Marie-Hélène; Neidle, Stephen

    2014-01-01

    Heterocyclic diamidines are strong DNA minor groove binders and have excellent antiparasitic activity. To extend the biological activity of these compounds, a series of arylimidamides (AIAs) analogs, which have better uptake properties in Leishmania and T. cruizi than diamidines, was prepared. The binding of the AIAs to DNA was investigated by Tm, fluorescence displacement titration, circular dichroism, DNase I footprinting, biosensor surface plasmon resonance, X-ray Crystallography and molecular modeling. These compounds form 1:1 complexes with AT sequences in the DNA minor groove and the binding strength varies with substituent size, charge and polarity. This substituent dependent structure and properties provide a SAR that can be used to estimate K values for binding to DNA in this series. The structural results and molecular modeling studies provide an explanation for the differences in binding affinities for AIAs. PMID:24323836

  1. Molecular mechanics of DNA bricks: in situ structure, mechanical properties and ionic conductivity

    NASA Astrophysics Data System (ADS)

    Slone, Scott Michael; Li, Chen-Yu; Yoo, Jejoong; Aksimentiev, Aleksei

    2016-05-01

    The DNA bricks method exploits self-assembly of short DNA fragments to produce custom three-dimensional objects with subnanometer precision. In contrast to DNA origami, the DNA brick method permits a variety of different structures to be realized using the same library of DNA strands. As a consequence of their design, however, assembled DNA brick structures have fewer interhelical connections in comparison to equivalent DNA origami structures. Although the overall shape of the DNA brick objects has been characterized and found to conform to the features of the target designs, the microscopic properties of DNA brick objects remain yet to be determined. Here, we use the all-atom molecular dynamics method to directly compare the structure, mechanical properties and ionic conductivity of DNA brick and DNA origami structures different only by internal connectivity of their consistituent DNA strands. In comparison to equivalent DNA origami structures, the DNA brick structures are found to be less rigid and less dense and have a larger cross-section area normal to the DNA helix direction. At the microscopic level, the junction in the DNA brick structures are found to be right-handed, similar to the structure of individual Holliday junctions (HJ) in solution, which contrasts with the left-handed structure of HJ in DNA origami. Subject to external electric field, a DNA brick plate is more leaky to ions than an equivalent DNA origami plate because of its lower density and larger cross-section area. Overall, our results indicate that the structures produced by the DNA brick method are fairly similar in their overall appearance to those created by the DNA origami method but are more compliant when subject to external forces, which likely is a consequence of their single crossover design.

  2. Aven-dependent activation of ATM following DNA damage

    PubMed Central

    Guo, Jessie Yanxiang; Yamada, Ayumi; Kajino, Taisuke; Wu, Judy Qiju; Tang, Wanli; Freel, Christopher D.; Feng, Junjie; Chau, B. Nelson; Wang, Michael Zhuo; Margolis, Seth; Yoo, Hae Yong; Wang, Xiao-Fan; Dunphy, William G.; Irusta, Pablo M.; Hardwick, J. Marie; Kornbluth, Sally

    2009-01-01

    Summary Background In response to DNA damage, cells either undergo cell cycle arrest or apoptosis, depending on the extent of damage and the cell’s capacity for DNA repair. Cell cycle arrest induced by double-stranded DNA breaks depends on activation of the ataxia-telangiectasia (ATM) protein kinase, which phosphorylates cell cycle effectors such as Chk2 and p53 to inhibit cell cycle progression. ATM is recruited to double stranded DNA breaks by a complex of sensor proteins including Mre11/Rad50/Nbs1, resulting in autophosphorylation, monomerization, and activation of ATM kinase. Results In characterizing Aven protein, a previously reported apoptotic inhibitor, we have found that Aven can function as an ATM activator to inhibit G2/M progression. Aven bound to ATM and Aven overexpression in cycling Xenopus egg extracts prevented mitotic entry and induced phosphorylation of ATM and its substrates. Immunodepletion of endogenous Aven allowed mitotic entry even in the presence of damaged DNA, and RNAi-mediated knock-down of Aven in human cells prevented autophosphorylation of ATM at an activating site (S1981) in response to DNA damage. Interestingly, Aven is also a substrate of the ATM kinase. Mutation of ATM-mediated phosphorylation sites on Aven reduced its ability to activate ATM, suggesting that Aven activation of ATM following DNA damage is enhanced by ATM-mediated Aven phosphorylation. Conclusions These results identify Aven as a new ATM activator and describe a positive feedback loop operating between Aven and ATM. In aggregate, these findings place Aven, a known apoptotic inhibitor, as a critical transducer of the DNA damage signal. PMID:18571408

  3. Mean free path dependent phonon contributions to interfacial thermal conductance

    NASA Astrophysics Data System (ADS)

    Tao, Yi; Liu, Chenhan; Chen, Weiyu; Cai, Shuang; Chen, Chen; Wei, Zhiyong; Bi, Kedong; Yang, Juekuan; Chen, Yunfei

    2017-06-01

    Interfacial thermal conductance as an accumulation function of the phonon mean free path is rigorously derived from the thermal conductivity accumulation function. Based on our theoretical model, the interfacial thermal conductance accumulation function between Si/Ge is calculated. The results show that the range of mean free paths (MFPs) for phonons contributing to the interfacial thermal conductance is far narrower than that for phonons contributing to the thermal conductivity. The interfacial thermal conductance is mainly contributed by phonons with shorter MFPs, and the size effects can be observed only for an interface constructed by nanostructures with film thicknesses smaller than the MFPs of those phonons mainly contributing to the interfacial thermal conductance. This is why most experimental measurements cannot detect size effects on interfacial thermal conductance. A molecular dynamics simulation is employed to verify our proposed model.

  4. RNA-dependent DNA-polymerase activity in human milk.

    PubMed

    McFarlane, E S; Ryan, S M; Mann, E

    1975-08-01

    A simple method is described for testing milk specimens from nursing mothers for the presence of RNA-dependent DNA-polymerase activity. Positive results were obtained in five of 137 women (3.6%) without a family history of breast cancer, and in six of 31 women (19.3%) with a family history of breast cancer.

  5. Radiation Fluence dependent variation in Electrical conductivity of Cu nanowires

    SciTech Connect

    Gehlawat, Devender; Chauhan, R. P.; Sonkawade, R. G.

    2011-07-15

    Electrical conductivity of Cu nanowires varies with diameter of nanowires. However, keeping the diameter of nanowires constant, a variation in their electrical conductivity is observed after they irradiated with gamma rays and neutrons. On the basis of I-V characteristics drawn at room temperature, decrease in the conductivity of Cu nanowires is observed, as compared to that of pristine nanowires.

  6. Ku stimulation of DNA ligase IV-dependent ligation requires inward movement along the DNA molecule.

    PubMed

    Kysela, Boris; Doherty, Aidan J; Chovanec, Miroslav; Stiff, Thomas; Ameer-Beg, Simon M; Vojnovic, Borivoj; Girard, Pierre-Marie; Jeggo, Penny A

    2003-06-20

    The DNA ligase IV.XRCC4 complex (LX) functions in DNA non-homologous-end joining, the main pathway for double-strand break repair in mammalian cells. We show that, in contrast to ligation by T4 ligase, the efficiency of LX ligation of double-stranded (ds) ends is critically dependent upon the length of the DNA substrate. The effect is specific for ds ligation, and LX/DNA binding is not influenced by the substrate length. Ku stimulates LX ligation at concentrations resulting in 1-2 Ku molecules bound per substrate, whereas multiply Ku-bound DNA molecules inhibit ds ligation. The combined footprint of DNA with Ku and LX bound is the sum of each individual footprint suggesting that the two complexes are located in tandem at the DNA end. Inhibition of Ku translocation by the presence of cis-platinum adducts on the DNA substrate severely inhibits ligation by LX. Fluorescence resonance energy transfer analysis using fluorophore-labeled Ku and DNA molecules showed that, as expected, Ku makes close contact with the DNA end and that addition of LX can disrupt this close contact. Finally, we show that recruitment of LX by Ku is impaired in an adenylation-defective mutant providing further evidence that LX interacts directly with the DNA end, possibly via the 5'-phosphate as shown for prokaryotic ligases. Taken together, our results suggest that, when LX binds to a Ku-bound DNA molecule, it causes inward translocation of Ku and that freedom to move inward on the DNA is essential to Ku stimulation of LX activity.

  7. The DnaE polymerase from Deinococcus radiodurans features RecA-dependent DNA polymerase activity

    PubMed Central

    Randi, Lorenzo; Perrone, Alessandro; Maturi, Mirko; Dal Piaz, Fabrizio; Camerani, Michela; Hochkoeppler, Alejandro

    2016-01-01

    We report in the present study on the catalytic properties of the Deinococcus radiodurans DNA polymerase III α subunit (αDr). The αDr enzyme was overexpressed in Escherichia coli, both in soluble form and as inclusion bodies. When purified from soluble protein extracts, αDr was found to be tightly associated with E. coli RNA polymerase, from which αDr could not be dissociated. On the contrary, when refolded from inclusion bodies, αDr was devoid of E. coli RNA polymerase and was purified to homogeneity. When assayed with different DNA substrates, αDr featured slower DNA extension rates when compared with the corresponding enzyme from E. coli (E. coli DNA Pol III, αEc), unless under high ionic strength conditions or in the presence of manganese. Further assays were performed using a ssDNA and a dsDNA, whose recombination yields a DNA substrate. Surprisingly, αDr was found to be incapable of recombination-dependent DNA polymerase activity, whereas αEc was competent in this action. However, in the presence of the RecA recombinase, αDr was able to efficiently extend the DNA substrate produced by recombination. Upon comparing the rates of RecA-dependent and RecA-independent DNA polymerase activities, we detected a significant activation of αDr by the recombinase. Conversely, the activity of αEc was found maximal under non-recombination conditions. Overall, our observations indicate a sharp contrast between the catalytic actions of αDr and αEc, with αDr more performing under recombination conditions, and αEc preferring DNA substrates whose extension does not require recombination events. PMID:27789781

  8. Effects of Ionic Dependence of DNA Persistence Length on the DNA Condensation at Room Temperature

    NASA Astrophysics Data System (ADS)

    Mao, Wei; Liu, Yan-Hui; Hu, Lin; Xu, Hou-Qiang

    2016-05-01

    DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. A series of experiments pointed out that, in the DNA condensation process by multivalent cations, the condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in ionic concentration. At the same time, single molecule experiments carried out in solution with multivalent cations (such as spermidine, spermine) indicated that DNA persistence length strongly depends on the ionic concentration. In order to revolve the effects of ionic concentration dependence of persistence length on DNA condensation, a model including the ionic concentration dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the ionic concentration dependence of toroidal conformations. With an increase in ion concentration, the first periodic oscillation contained in the autocorrelation function shifts, the number of segment contained in the first periodic oscillation decreases gradually. According to the experiments, the average long-axis length is defined to estimate the ionic concentration dependence of condensation process further. The relation between long-axis length and ionic concentration matches the experimental results qualitatively. Supported by National Natural Science Foundation of China under Grant Nos. 11047022, 11204045, 11464004 and 31360215; The Research Foundation from Ministry of Education of China (212152), Guizhou Provincial Tracking Key Program of Social Development (SY20123089, SZ20113069); The General Financial Grant from the China Postdoctoral Science Foundation (2014M562341); The Research Foundation for Young University Teachers from Guizhou University (201311); The West Light Foundation (2015) and College

  9. A DNA enzyme with Mg(2+)-Dependent RNA Phosphoesterase Activity

    NASA Technical Reports Server (NTRS)

    Breaker, Ronald R.; Joyce, Gerald F.

    1995-01-01

    Previously we demonstrated that DNA can act as an enzyme in the Pb(2+)-dependent cleavage of an RNA phosphoester. This is a facile reaction, with an uncatalyzed rate for a typical RNA phosphoester of approx. 10(exp -4)/ min in the presence of 1 mM Pb(OAc)2 at pH 7.0 and 23 C. The Mg(2+) - dependent reaction is more difficult, with an uncatalyzed rate of approx. 10(exp -7)/ min under comparable conditions. Mg(2+) - dependent cleavage has special relevance to biology because it is compatible with intracellular conditions. Using in vitro selection, we sought to develop a family of phosphoester-cleaving DNA enzymes that operate in the presence of various divalent metals, focusing particularly on the Mg(2+) - dependent reaction. Results: We generated a population of greater than 10(exp 13) DNAs containing 40 random nucleotides and carried out repeated rounds of selective amplification, enriching for molecules that cleave a target RNA phosphoester in the presence of 1 mM Mg(2+), Mn(2+), Zn(2+) or Pb(2+). Examination of individual clones from the Mg(2+) lineage after the sixth round revealed a catalytic motif comprised of a three-stem junction.This motif was partially randomized and subjected to seven additional rounds of selective amplification, yielding catalysts with a rate of 0.01/ min. The optimized DNA catalyst was divided into separate substrate and enzyme domains and shown to have a similar level of activity under multiple turnover conditions. Conclusions: We have generated a Mg(2+) - dependent DNA enzyme that cleaves a target RNA phosphoester with a catalytic rate approx. 10(exp 5) - fold greater than that of the uncatalyzed reaction. This activity is compatible with intracellular conditions, raising the possibility that DNA enzymes might be made to operate in vivo.

  10. DNA-dependent protease activity of human Spartan facilitates replication of DNA-protein crosslink-containing DNA.

    PubMed

    Mórocz, Mónika; Zsigmond, Eszter; Tóth, Róbert; Enyedi, Márton Zs; Pintér, Lajos; Haracska, Lajos

    2017-04-07

    Mutations in SPARTAN are associated with early onset hepatocellular carcinoma and progeroid features. A regulatory function of Spartan has been implicated in DNA damage tolerance pathways such as translesion synthesis, but the exact function of the protein remained unclear. Here, we reveal the role of human Spartan in facilitating replication of DNA-protein crosslink-containing DNA. We found that purified Spartan has a DNA-dependent protease activity degrading certain proteins bound to DNA. In concert, Spartan is required for direct DPC removal in vivo; we also show that the protease Spartan facilitates repair of formaldehyde-induced DNA-protein crosslinks in later phases of replication using the bromodeoxyuridin (BrdU) comet assay. Moreover, DNA fibre assay indicates that formaldehyde-induced replication stress dramatically decreases the speed of replication fork movement in Spartan-deficient cells, which accumulate in the G2/M cell cycle phase. Finally, epistasis analysis mapped these Spartan functions to the RAD6-RAD18 DNA damage tolerance pathway. Our results reveal that Spartan facilitates replication of DNA-protein crosslink-containing DNA enzymatically, as a protease, which may explain its role in preventing carcinogenesis and aging. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Biomaterial-based Memory Device Development by Conducting Metallic DNA

    DTIC Science & Technology

    2013-05-28

    basis of the redshift of UV absorption spectra, we think that the incorporation of metal ions may result in a reduction of the original DNA band gap...memristor based on the changing of the boundary between the high-resistance and low-resistance layers of titanium dioxide TiO2 and TiO2 -x13. Their...electrode cell. These electrodes included a modified Au electrode (working electrode), a coiled platinum wire (counter electrode), and an Ag /AgCl

  12. DNA Template Dependent Accuracy Variation of Nucleotide Selection in Transcription

    PubMed Central

    Mellenius, Harriet; Ehrenberg, Måns

    2015-01-01

    It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts. PMID:25799551

  13. DNA template dependent accuracy variation of nucleotide selection in transcription.

    PubMed

    Mellenius, Harriet; Ehrenberg, Måns

    2015-01-01

    It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

  14. Nonmonotonic DNA-length-dependent mobility in pluronic gels

    NASA Astrophysics Data System (ADS)

    You, Seungyong; Wei, Ling; Shanbhag, Sachin; Van Winkle, David H.

    2017-04-01

    Two-dimensional electrophoresis was used to analyze the mobility of DNA fragments in micellar gels of pluronic F127 (E O100P O70E O100 ) and pluronic P123 (E O20P O70E O20 ) . The 20-3500 base pair DNA fragments were separated by size first in agarose gels, and then in pluronic gels at room temperature. In agarose gels, the DNA mobility decreases monotonically with increasing DNA length. In pluronic gels, however, the mobility varies nonmonotonically according to fragment lengths that are strongly correlated with the diameter of the spherical micelles. Brownian dynamics (BD) simulations with short-ranged intra-DNA hydrodynamic interactions were performed to numerically calculate the length-dependent mobility in pluronic lattices. The rising and falling trends, as well as the oscillations of mobility, were captured by the coarse-grained BD simulations. Molecular dynamics simulations in pluronic F127, with explicitly modeled micelle coronas, justified that the hydrodynamic interactions mediated by the complex fluid of hydrated poly(ethylene oxide) are a possible reason for the initial rise of mobility with DNA length.

  15. STING manifests self DNA-dependent inflammatory disease.

    PubMed

    Ahn, Jeonghyun; Gutman, Delia; Saijo, Shinobu; Barber, Glen N

    2012-11-20

    Inflammatory autoimmune diseases such as systemic lupus erythematosus (SLE) and polyarthritis are characterized by chronic cytokine overproduction, suggesting that the stimulation of host innate immune responses, speculatively by persistent infection or self nucleic acids, plays a role in the manifestation of these disorders. Mice lacking DNase II die during embryonic development through comparable inflammatory disease because phagocytosed DNA from apoptotic cells cannot be adequately digested and intracellular host DNA sensor pathways are engaged, resulting in the production of a variety of cytokines including type I IFN. The cellular sensor pathway(s) responsible for triggering DNA-mediated inflammation aggravated autoimmune disease remains to be determined. However, we report here that Stimulator of IFN Genes (STING) is responsible for inflammation-related embryonic death in DNase II defective mice initiated by self DNA. DNase II-dependent embryonic lethality was rescued by loss of STING function, and polyarthritis completely prevented because cytosolic DNA failed to robustly trigger cytokine production through STING-controlled signaling pathways. Our data provides significant molecular insight into the causes of DNA-mediated inflammatory disorders and affords a target that could plausibly be therapeutically controlled to help prevent such diseases.

  16. Thickness dependent ion conductivity of lithium borate network glasses

    NASA Astrophysics Data System (ADS)

    Berkemeier, F.; Shoar Abouzari, M.; Schmitz, G.

    2007-03-01

    Lithium borate network glasses are possible candidates for separator membranes in all-solid-state batteries. Thin films of a Li2O-borate glass were produced by argon beam sputtering and their specific ionic conductivities were measured by impedance spectroscopy. The conductivity of as-sputtered films is about two orders of magnitude higher compared to the conductivity of bulk glasses produced from the melt. Furthermore, thin films with a thickness of 7-125nm reveal a remarkable finite size effect after annealing: with decreasing thickness the specific dc conductivity increases about three orders of magnitude.

  17. The conductive properties of single DNA molecules studied by torsion tunneling atomic force microscopy.

    PubMed

    Wang, W; Niu, D X; Jiang, C R; Yang, X J

    2014-01-17

    The conductive properties of single natural λ-DNA molecules are studied by torsion tunneling atomic force microscopy (TR-TUNA). The currents both parallel to and perpendicular to the DNA chains are investigated, but only weak or even no current signals are detected by TR-TUNA. To improve the conductance of DNA molecules, silver and copper metallized DNAs are fabricated and their conductivities are checked by TR-TUNA. It is found that for both Cu- and Ag-DNAs, the conductivity perpendicular to the DNA chain is enhanced significantly as the metal clusters are attached to the DNA chains. But parallel to the chain the electrical transport is still weak, most probably due to the 'beads-on-a-string' constructions of metallized DNAs.

  18. The conductive properties of single DNA molecules studied by torsion tunneling atomic force microscopy

    NASA Astrophysics Data System (ADS)

    Wang, W.; Niu, D. X.; Jiang, C. R.; Yang, X. J.

    2014-01-01

    The conductive properties of single natural λ-DNA molecules are studied by torsion tunneling atomic force microscopy (TR-TUNA). The currents both parallel to and perpendicular to the DNA chains are investigated, but only weak or even no current signals are detected by TR-TUNA. To improve the conductance of DNA molecules, silver and copper metallized DNAs are fabricated and their conductivities are checked by TR-TUNA. It is found that for both Cu- and Ag-DNAs, the conductivity perpendicular to the DNA chain is enhanced significantly as the metal clusters are attached to the DNA chains. But parallel to the chain the electrical transport is still weak, most probably due to the ‘beads-on-a-string’ constructions of metallized DNAs.

  19. Tyrosine-dependent oxidative DNA damage induced by carcinogenic tetranitromethane.

    PubMed

    Murata, Mariko; Kurimoto, Saori; Kawanishi, Shosuke

    2006-10-01

    Tetranitromethane (TNM) is used as an oxidizer in rocket propellants and explosives and as an additive to increase the cetane number of diesel fuel. TNM was reported to induce pulmonary adenocarcinomas and squamous cell carcinomas in mice and rats. However, the mechanisms underlying carcinogenesis induced by TNM has not yet been clarified. We previously revealed that nitroTyr and nitroTyr-containing peptides caused Cu(II)-dependent DNA damage in the presence of P450 reductase, which is considered to yield nitroreduction. Since TNM is a reagent for nitration of Tyr in proteins and peptides, we have hypothesized that TNM-treated Tyr and Tyr-containing peptides induce DNA damage by the modification of Tyr. We examined DNA damage induced by TNM-treated amino acids or peptides using (32)P-5'-end-labeled DNA fragments obtained from the human p53 tumor suppressor gene and the c-Ha-ras-1 protooncogene. TNM-treated Tyr and Lys-Tyr-Lys induced DNA damage including the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine in the presence of Cu(II) and NADH. DNA damage was inhibited by catalase and bathocuproine, indicating the involvement of H(2)O(2) and Cu(I). The cytosine residue of the ACG sequence complementary to codon 273, well-known hotspots of the p53 gene, was cleaved with piperidine and Fpg treatments. On the other hand, nitroTyr and Lys-nitroTyr-Lys did not induce DNA damage in the presence of Cu(II) and NADH. Time-of-flight mass spectrometry confirmed that reactions between Lys-Tyr-Lys and TNM yielded not only Lys-nitroTyr-Lys but also Lys-nitrosoTyr-Lys. Therefore, it is speculated that the nitrosotyrosine residue can induce oxidative DNA damage in the presence of Cu(II) and NADH. It is concluded that Tyr-dependent DNA damage may play an important role in the carcinogenicity of TNM. TNM is a new type of carcinogen that induces DNA damage not by itself but via Tyr modification.

  20. The impact of DNA intercalators on DNA and DNA-processing enzymes elucidated through force-dependent binding kinetics

    PubMed Central

    Biebricher, Andreas S.; Heller, Iddo; Roijmans, Roel F. H.; Hoekstra, Tjalle P.; Peterman, Erwin J. G.; Wuite, Gijs J. L.

    2015-01-01

    DNA intercalators are widely used as fluorescent probes to visualize DNA and DNA transactions in vivo and in vitro. It is well known that they perturb DNA structure and stability, which can in turn influence DNA-processing by proteins. Here we elucidate this perturbation by combining single-dye fluorescence microscopy with force spectroscopy and measuring the kinetics of DNA intercalation by the mono- and bis-intercalating cyanine dyes SYTOX Orange, SYTOX Green, SYBR Gold, YO-PRO-1, YOYO-1 and POPO-3. We show that their DNA-binding affinity is mainly governed by a strongly tension-dependent dissociation rate. These rates can be tuned over a range of seven orders of magnitude by changing DNA tension, intercalating species and ionic strength. We show that optimizing these rates minimizes the impact of intercalators on strand separation and enzymatic activity. These new insights provide handles for the improved use of intercalators as DNA probes with minimal perturbation and maximal efficacy. PMID:26084388

  1. The DNA damage response kinases DNA-dependent protein kinase (DNA-PK) and ataxia telangiectasia mutated (ATM) Are stimulated by bulky adduct-containing DNA.

    PubMed

    Kemp, Michael G; Lindsey-Boltz, Laura A; Sancar, Aziz

    2011-06-03

    A variety of environmental, carcinogenic, and chemotherapeutic agents form bulky lesions on DNA that activate DNA damage checkpoint signaling pathways in human cells. To identify the mechanisms by which bulky DNA adducts induce damage signaling, we developed an in vitro assay using mammalian cell nuclear extract and plasmid DNA containing bulky adducts formed by N-acetoxy-2-acetylaminofluorene or benzo(a)pyrene diol epoxide. Using this cell-free system together with a variety of pharmacological, genetic, and biochemical approaches, we identified the DNA damage response kinases DNA-dependent protein kinase (DNA-PK) and ataxia telangiectasia mutated (ATM) as bulky DNA damage-stimulated kinases that phosphorylate physiologically important residues on the checkpoint proteins p53, Chk1, and RPA. Consistent with these results, purified DNA-PK and ATM were directly stimulated by bulky adduct-containing DNA and preferentially associated with damaged DNA in vitro. Because the DNA damage response kinase ATM and Rad3-related (ATR) is also stimulated by bulky DNA adducts, we conclude that a common biochemical mechanism exists for activation of DNA-PK, ATM, and ATR by bulky adduct-containing DNA.

  2. Heat sensitivity of double-stranded DNA-dependent protein kinase (DNA-PK) activity.

    PubMed

    Ihara, M; Suwa, A; Komatsu, K; Shimasaki, T; Okaichi, K; Hendrickson, E A; Okumura, Y

    1999-02-01

    The heat sensitivity of DNA-PK activity in hybrid cells and the possible restoration of this activity with extracts from scid cells (defective in DNA-PKcs), sxi-3 cells (defective in Ku80) and V794 (sxi-3 parental wild-type cells) was analysed. Heat treatment of cells was performed in a water bath at 44 degrees C. The cell extract from scid cells or sxi-3 cells was added to heat-treated hybrid cell extracts, and the DNA-PK activity was assayed. When hybrid cells were heated at 44 degrees C for 15 min, DNA-PK activity was reduced to undetectable levels. The decreased DNA-PK activity could be restored in a concentration-dependent manner with the addition of scid cell extract. The sxi-3 cell extract could not restore heat-inactivated DNA-PK activity. DNA-PK was inactivated by heat treatment at 44 degrees C. Ku70/Ku80, but not Ku70 alone, could restore heat-inactivated DNA-PK.

  3. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  4. Temperature-dependent electrical conductivity of soda-lime glass

    NASA Technical Reports Server (NTRS)

    Bunnell, L. Roy; Vertrees, T. H.

    1993-01-01

    The objective of this educational exercise was to demonstrate the difference between the electrical conductivity of metals and ceramics. A list of the equipment and supplies and the procedure for the experiment are presented.

  5. Temperature-dependent electrical conductivity of soda-lime glass

    NASA Technical Reports Server (NTRS)

    Bunnell, L. Roy; Vertrees, T. H.

    1993-01-01

    The objective of this educational exercise was to demonstrate the difference between the electrical conductivity of metals and ceramics. A list of the equipment and supplies and the procedure for the experiment are presented.

  6. DnaK-Dependent Accelerated Evolutionary Rate in Prokaryotes

    PubMed Central

    Kadibalban, A. Samer; Bogumil, David; Landan, Giddy; Dagan, Tal

    2016-01-01

    Many proteins depend on an interaction with molecular chaperones in order to fold into a functional tertiary structure. Previous studies showed that protein interaction with the GroEL/GroES chaperonine and Hsp90 chaperone can buffer the impact of slightly deleterious mutations in the protein sequence. This capacity of GroEL/GroES to prevent protein misfolding has been shown to accelerate the evolution of its client proteins. Whether other bacterial chaperones have a similar effect on their client proteins is currently unknown. Here, we study the impact of DnaK (Hsp70) chaperone on the evolution of its client proteins. Evolutionary parameters were derived from comparison of the Escherichia coli proteome to 1,808,565 orthologous proteins in 1,149 proteobacterial genomes. Our analysis reveals a significant positive correlation between protein binding frequency with DnaK and evolutionary rate. Proteins with high binding affinity to DnaK evolve on average 4.3-fold faster than proteins in the lowest binding affinity class at the genus resolution. Differences in evolutionary rates of DnaK interactor classes are still significant after adjusting for possible effects caused by protein expression level. Furthermore, we observe an additive effect of DnaK and GroEL chaperones on the evolutionary rates of their common interactors. Finally, we found pronounced similarities in the physicochemical profiles that characterize proteins belonging to DnaK and GroEL interactomes. Our results thus implicate DnaK-mediated folding as a major component in shaping protein evolutionary dynamics in bacteria and supply further evidence for the long-term manifestation of chaperone-mediated folding on genome evolution. PMID:27189986

  7. pH-dependent specific binding and combing of DNA.

    PubMed Central

    Allemand, J F; Bensimon, D; Jullien, L; Bensimon, A; Croquette, V

    1997-01-01

    Recent developments in the rapid sequencing, mapping, and analysis of DNA rely on the specific binding of DNA to specially treated surfaces. We show here that specific binding of DNA via its unmodified extremities can be achieved on a great variety of surfaces by a judicious choice of the pH. On hydrophobic surfaces the best binding efficiency is reached at a pH of approximately 5.5. At that pH a approximately 40-kbp DNA is 10 times more likely to bind by an extremity than by a midsegment. A model is proposed to account for the differential adsorption of the molecule extremities and midsection as a function of pH. The pH-dependent specific binding can be used to align anchored DNA molecules by a receding meniscus, a process called molecular combing. The resulting properties of the combed molecules will be discussed. Images FIGURE 1 FIGURE 2 FIGURE 3 FIGURE 6 FIGURE 7 PMID:9336201

  8. Sequence dependence of transcription factor-mediated DNA looping.

    PubMed

    Johnson, Stephanie; Lindén, Martin; Phillips, Rob

    2012-09-01

    DNA is subject to large deformations in a wide range of biological processes. Two key examples illustrate how such deformations influence the readout of the genetic information: the sequestering of eukaryotic genes by nucleosomes and DNA looping in transcriptional regulation in both prokaryotes and eukaryotes. These kinds of regulatory problems are now becoming amenable to systematic quantitative dissection with a powerful dialogue between theory and experiment. Here, we use a single-molecule experiment in conjunction with a statistical mechanical model to test quantitative predictions for the behavior of DNA looping at short length scales and to determine how DNA sequence affects looping at these lengths. We calculate and measure how such looping depends upon four key biological parameters: the strength of the transcription factor binding sites, the concentration of the transcription factor, and the length and sequence of the DNA loop. Our studies lead to the surprising insight that sequences that are thought to be especially favorable for nucleosome formation because of high flexibility lead to no systematically detectable effect of sequence on looping, and begin to provide a picture of the distinctions between the short length scale mechanics of nucleosome formation and looping.

  9. Polarization and Angle Dependence of Fluorescence from Aligned DNA

    NASA Astrophysics Data System (ADS)

    Sridhar, Ashish; Bandler, Suri; Zhu, Ke; Gu, Yingzhan; Budassi, Julia; Sokolov, Jonathan

    2012-02-01

    DNA molecules can be deposited and aligned on various surfaces and imaged by confocal microscopy when labeled with fluorescent dyes. SyBr Gold dye, is known to possess a high angle and polarization dependence. We measured the emission intensity for various incident angles as a function of incident polarization angle. Samples were created by means of dipping PMMA-coated silicon wafers into dyed DNA solutions with DC electric field setup or drop evaporation. The blue laser as the imaging light source was mounted on an optical rail with a polarizer with rotatable half wave plate to change the incident polarization relative to the DNA molecular orientation. When applied to samples dyed using SyBr Gold, a clear change in the intensity of imaged DNA strands was observed though a range of input polarization angle. We have shown that it is possible to optimize the conditions in which aligned DNA is imaged using confocal microscopy by varying the polarization and angle of incidence of laser light on the sample. This study is supported by NSF-DMR-MRSEC program.

  10. Time resolved strain dependent morphological study of electrically conducting nanocomposites

    NASA Astrophysics Data System (ADS)

    Khan, Imran; Mitchell, Geoffrey; Mateus, Artur; Kamma-Lorger, Christina S.

    2015-10-01

    An efficient and reliable method is introduced to understand the network behaviour of nano-fillers in a polymeric matrix under uniaxial strain coupled with small angle x-ray scattering measurements. The nanoparticles (carbon nanotubes) are conductive and the particles form a percolating network that becomes apparent source of electrical conduction and consequently the samples behave as a bulk conductor. Polyurethane based nanocomposites containing 2% w/w multiwall carbon nanotubes are studied. The electrical conductivity of the nanocomposite was (3.28×10-5s/m).The sample was able to be extended to an extension ratio of 1.7 before fracture. A slight variation in the electrical conductivity is observed under uniaxial strain which we attribute to the disturbance of conductive pathways. Further, this work is coupled with in- situ time resolved small angle x-ray scattering measurements using a synchrotron beam line to enable its measurements to be made during the deformation cycle. We use a multiscale structure to model the small angle x-ray data. The results of the analysis are interpreted as the presence of aggregates which would also go some way towards understanding why there is no alignment of the carbon nanotubes.

  11. Base-sequence-dependent sliding of proteins on DNA.

    PubMed

    Barbi, M; Place, C; Popkov, V; Salerno, M

    2004-10-01

    The possibility that the sliding motion of proteins on DNA is influenced by the base sequence through a base pair reading interaction, is considered. Referring to the case of the T7 RNA-polymerase, we show that the protein should follow a noise-influenced sequence-dependent motion which deviate from the standard random walk usually assumed. The general validity and the implications of the results are discussed.

  12. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    PubMed Central

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

  13. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    NASA Astrophysics Data System (ADS)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

    2014-12-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5'-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 . 10-14 cm2 and 7.06 . 10-14 cm2. The highest cross section was found for 5'-TT(ATA)3TT and 5'-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy.

  14. BioWires: Conductive DNA Nanowires in a Computationally-Optimized, Synthetic Biological Platform for Nanoelectronic Fabrication

    NASA Technical Reports Server (NTRS)

    Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom

    2017-01-01

    DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.

  15. Dynamics and Context-Dependent Roles of DNA Methylation.

    PubMed

    Ambrosi, Christina; Manzo, Massimiliano; Baubec, Tuncay

    2017-05-19

    DNA methylation is one of the most extensively studied epigenetic marks. It is involved in transcriptional gene silencing and plays important roles during mammalian development. Its perturbation is often associated with human diseases. In mammalian genomes, DNA methylation is a prevalent modification that decorates the majority of cytosines. It is found at the promoters and enhancers of inactive genes, at repetitive elements, and within transcribed gene bodies. Its presence at promoters is dynamically linked to gene activity, suggesting that it could directly influence gene expression patterns and cellular identity. The genome-wide distribution and dynamic behaviour of this mark have been studied in great detail in a variety of tissues and cell lines, including early embryonic development and in embryonic stem cells. In combination with functional studies, these genome-wide maps of DNA methylation revealed interesting features of this mark and provided important insights into its dynamic nature and potential functional role in genome regulation. In this review, we discuss how these recent observations, in combination with insights obtained from biochemical and functional genetics studies, have expanded our current knowledge about the regulation and context-dependent roles of DNA methylation in mammalian genomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. DNA-protected silver emitters: charge dependent switching of fluorescence.

    PubMed

    Berdakin, Matías; Taccone, Martin I; Pino, Gustavo A; Sánchez, Cristián G

    2017-02-22

    The relationship between the state of charge and spectroscopy of DNA-protected silver emitters is not yet well understood. This remains one of the major issues to unveil in order to fully disentangle the spectroscopic features of these novel systems. It is a well known fact that a fluorescence response arises upon chemical reduction of silver cations attached to DNA, leading to neutral (or partially oxidized) "bright" clusters. It is important to note that the absence of fluorescence in completely ionic complexes is universal in the sense that it does not depend on any experimental variable. This suggests that its origin may be founded on the nature of the interaction between DNA bases and silver cations. Nevertheless, to the best of our knowledge, no explanation exists for this charge dependent switching between dark completely ionic complexes and bright (neutral or partially oxidized) clusters. In this brief report we address this experimental fact on the basis of the electronic structure of the complex as a function of its charge and quantum dynamical simulations of the processes following photoexcitation. These data provide a dynamical picture of the correlation between charge and fluorescence.

  17. A sequence-dependent rigid-base model of DNA

    NASA Astrophysics Data System (ADS)

    Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

    2013-02-01

    A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

  18. Potential Dependence of the Conductivity of Highly Oxidized Polythiophenes, Polypyrroles, and Polyaniline: Finite Windows of High Conductivity

    DTIC Science & Technology

    1990-05-16

    protonation/deprotonation mechanism . Conductivity increases by at least 108 upon oxidizing polyani-ine from neutral to maximally conducting, and decreases...reversible, potential dependent changes in conductivity in liquid S02/electrolyte in the apparent absence of a protonation/deprotonation mechanism ...polyaniline is similar in 0.5 M H2SO4 ,1 liquid S02 /electrolyte, and poly(vinyl alchohol )/H 3PO4.nH20.8 However, the positive potential limit in aqueous

  19. DNA length and concentration dependencies of anisotropic phase transitions of DNA solutions.

    PubMed Central

    Merchant, K; Rill, R L

    1997-01-01

    Critical concentrations for the isotropic to cholesteric phase transitions of double-stranded DNA fragments in simple buffered saline (0.1 M NaCl) solutions were determined as a function of DNA contour length ranging from approximately 50 nm to 2700 nm, by solid-state 31P NMR spectroscopy and polarized light microscopy. As expected for semirigid chains, the critical concentrations decrease sharply with increasing DNA length near the persistence length in the range from 50 to 110 nm, and approach a plateau when the contour length exceeds 190 nm. The biphasic region is substantially wider than observed for xanthan, another semirigid polyelectrolyte approximately twice as stiff as DNA, primarily because of low critical concentrations for first appearance of the anisotropic phase, C(i)*, in DNA samples > or =110 nm (320 base pairs) long. The limiting C(i)* for DNA > or =490 nm long is exceptionally low (only 13 mg/ml) and is substantially lower than the C(i)* of approximately 40 mg/ml reported for the stiffer xanthan polyelectrolyte. The much higher values of the critical concentrations, C(a)*, for the disappearance of the isotropic DNA phase (> or =67 mg/ml) are modestly higher than those observed for xanthan and are predicted reasonably well by a theory that has been applied to other semirigid polymers, if a DNA persistence length in the consensus range of 50-100 nm is assumed. By contrast, the broad biphasic region and low C(i)* values of DNA fragments > or =190 nm long could only be reconciled with theory by assuming persistence lengths of 200-400 nm. The latter discrepancies are presumed to reflect some combination of deficiencies in current theory as applied to chiral, strong polyelectrolytes such as DNA, and sequence-dependent variations in DNA properties such as flexibility, curvature, or interaction potential. The propensity of DNA to spontaneously self-order at low concentrations well in the physiological range may have biological significance. PMID:9414227

  20. DNA Sequence-Dependent Deformability Deduced from Protein-DNA Crystal Complexes

    NASA Astrophysics Data System (ADS)

    Olson, Wilma K.; Gorin, Andrey A.; Lu, Xiang-Jun; Hock, Lynette M.; Zhurkin, Victor B.

    1998-09-01

    The deformability of double helical DNA is critical for its packaging in the cell, recognition by other molecules, and transient opening during biochemically important processes. Here, a complete set of sequence-dependent empirical energy functions suitable for describing such behavior is extracted from the fluctuations and correlations of structural parameters in DNA-protein crystal complexes. These elastic functions provide useful stereochemical measures of the local base step movements operative in sequence-specific recognition and protein-induced deformations. In particular, the pyrimidine-purine dimers stand out as the most variable steps in the DNA-protein complexes, apparently acting as flexible ``hinges'' fitting the duplex to the protein surface. In addition to the angular parameters widely used to describe DNA deformations (i.e., the bend and twist angles), the translational parameters describing the displacements of base pairs along and across the helical axis are analyzed. The observed correlations of base pair bending and shearing motions are important for nonplanar folding of DNA in nucleosomes and other nucleoprotein complexes. The knowledge-based energies also offer realistic three-dimensional models for the study of long DNA polymers at the global level, incorporating structural features beyond the scope of conventional elastic rod treatments and adding a new dimension to literal analyses of genomic sequences.

  1. Complexity reduction in context-dependent DNA substitution models.

    PubMed

    Majoros, William H; Ohler, Uwe

    2009-01-15

    The modeling of conservation patterns in genomic DNA has become increasingly popular for a number of bioinformatic applications. While several systems developed to date incorporate context-dependence in their substitution models, the impact on computational complexity and generalization ability of the resulting higher order models invites the question of whether simpler approaches to context modeling might permit appreciable reductions in model complexity and computational cost, without sacrificing prediction accuracy. We formulate several alternative methods for context modeling based on windowed Bayesian networks, and compare their effects on both accuracy and computational complexity for the task of discriminating functionally distinct segments in vertebrate DNA. Our results show that substantial reductions in the complexity of both the model and the associated inference algorithm can be achieved without reducing predictive accuracy.

  2. High Electronic Conductance through Double-Helix DNA Molecules with Fullerene Anchoring Groups

    PubMed Central

    2017-01-01

    Determining the mechanism of charge transport through native DNA remains a challenge as different factors such as measuring conditions, molecule conformations, and choice of technique can significantly affect the final results. In this contribution, we have used a new approach to measure current flowing through isolated double-stranded DNA molecules, using fullerene groups to anchor the DNA to a gold substrate. Measurements were performed at room temperature in an inert environment using a conductive AFM technique. It is shown that the π-stacked B-DNA structure is conserved on depositing the DNA. As a result, currents in the nanoampere range were obtained for voltages ranging between ±1 V. These experimental results are supported by a theoretical model that suggests that a multistep hopping mechanism between delocalized domains is responsible for the long-range current flow through this specific type of DNA. PMID:28094940

  3. High Electronic Conductance through Double-Helix DNA Molecules with Fullerene Anchoring Groups.

    PubMed

    Jiménez-Monroy, Kathia L; Renaud, Nicolas; Drijkoningen, Jeroen; Cortens, David; Schouteden, Koen; van Haesendonck, Christian; Guedens, Wanda J; Manca, Jean V; Siebbeles, Laurens D A; Grozema, Ferdinand C; Wagner, Patrick H

    2017-02-16

    Determining the mechanism of charge transport through native DNA remains a challenge as different factors such as measuring conditions, molecule conformations, and choice of technique can significantly affect the final results. In this contribution, we have used a new approach to measure current flowing through isolated double-stranded DNA molecules, using fullerene groups to anchor the DNA to a gold substrate. Measurements were performed at room temperature in an inert environment using a conductive AFM technique. It is shown that the π-stacked B-DNA structure is conserved on depositing the DNA. As a result, currents in the nanoampere range were obtained for voltages ranging between ±1 V. These experimental results are supported by a theoretical model that suggests that a multistep hopping mechanism between delocalized domains is responsible for the long-range current flow through this specific type of DNA.

  4. Spin-dependent conductance of small graphene flakes

    NASA Astrophysics Data System (ADS)

    Tugrul Senger, R.; Sahin, Hasan; Ciraci, Salim

    2010-03-01

    Using ab initio density-functional theory and quantum transport calculations based on nonequilibrium Green's function formalism we study structural, electronic, and transport properties of small graphene flakes. Rectangular and triangular graphene flakes are stable, having magnetically ordered edge states. We show that a spin-polarized current can be produced in pure, hydrogenated, rectangular graphene flakes by exploiting the spatially separated edge states of the flake using asymmetric, nonmagnetic contacts (1). Sharp discontinuities in the transmission spectra which arise from Fano resonances of localized states in the flake are also predicted. Functionalization of the graphene flake with magnetic adatoms such as vanadium also leads to spin-polarized currents even with symmetric contacts. Ground state of triangular flakes have non-zero magnetic moments and their conductance are spin polarized. (1) H. Sahin and R. T. Senger, Phys. Rev. B 78, 205423 (2008).

  5. Conductive magnetorheological elastomer: fatigue dependent impedance-mechanic coupling properties

    NASA Astrophysics Data System (ADS)

    Wang, Yu; Xuan, Shouhu; Ge, Lin; Wen, Qianqian; Gong, Xinglong

    2017-01-01

    This work investigated the relationship between the impedance properties and dynamic mechanical properties of magnetorheological elastomers (MREs) under fatigue loading. The storage modulus and the impedance properties of MREs were highly influenced by the pressure and magnetic field. Under the same experimental condition, the two characteristics exhibited similar fatigue dependent change trends. When pressure was smaller than 10 N, the capacitance of MRE could be divided into four sections with the increase of the cyclic numbers. The relative equivalent circuit model was established to fit the experimental results of the impedance spectra. Each parameter of circuit element reflected the change of fatigue loading, relative microstructure of MRE, MRE-electrode interface layer, respectively. Based on the above analysis, the real-time and nondestructive impedance method was demonstrated to be high potential on detecting the fatigue of the MRE device.

  6. Measuring Cation Dependent DNA Polymerase Fidelity Landscapes by Deep Sequencing

    PubMed Central

    Kording, Konrad; Schmidt, Daniel; Martin-Alarcon, Daniel; Tyo, Keith; Boyden, Edward S.; Church, George

    2012-01-01

    High-throughput recording of signals embedded within inaccessible micro-environments is a technological challenge. The ideal recording device would be a nanoscale machine capable of quantitatively transducing a wide range of variables into a molecular recording medium suitable for long-term storage and facile readout in the form of digital data. We have recently proposed such a device, in which cation concentrations modulate the misincorporation rate of a DNA polymerase (DNAP) on a known template, allowing DNA sequences to encode information about the local cation concentration. In this work we quantify the cation sensitivity of DNAP misincorporation rates, making possible the indirect readout of cation concentration by DNA sequencing. Using multiplexed deep sequencing, we quantify the misincorporation properties of two DNA polymerases – Dpo4 and Klenow exo− – obtaining the probability and base selectivity of misincorporation at all positions within the template. We find that Dpo4 acts as a DNA recording device for Mn2+ with a misincorporation rate gain of ∼2%/mM. This modulation of misincorporation rate is selective to the template base: the probability of misincorporation on template T by Dpo4 increases >50-fold over the range tested, while the other template bases are affected less strongly. Furthermore, cation concentrations act as scaling factors for misincorporation: on a given template base, Mn2+ and Mg2+ change the overall misincorporation rate but do not alter the relative frequencies of incoming misincorporated nucleotides. Characterization of the ion dependence of DNAP misincorporation serves as the first step towards repurposing it as a molecular recording device. PMID:22928047

  7. Cre-dependent DNA recombination activates a STING-dependent innate immune response

    PubMed Central

    Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit; Gantier, Michael P.

    2016-01-01

    Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376

  8. ATPase-Dependent Quality Control of DNA Replication Origin Licensing

    PubMed Central

    Frigola, Jordi; Remus, Dirk; Mehanna, Amina; Diffley, John F. X.

    2013-01-01

    The regulated loading of the Mcm2-7 DNA helicase into pre-replicative complexes (pre-RCs) at multiple replication origins ensures precise once per cell cycle replication in eukaryotic cells. Origin Recognition Complex (ORC), Cdc6 and Cdt1 load Mcm2-7 into a double hexamer bound around duplex DNA in an ATP-dependent reaction, but the molecular mechanism of this origin ‘licensing’ is still poorly understood. Here we show that both Mcm2-7 hexamers are recruited to origins by an essential, conserved C-terminal domain of Mcm3 which interacts with and stimulates the ATPase activity of ORC•Cdc6. ATP hydrolysis can promote Mcm2-7 loading, but can also promote Mcm2-7 release if components are missing or if ORC has been inactivated by cyclin-dependent kinase phosphorylation. Our work provides new insights into how origins are licensed and reveals a novel ATPase-dependent mechanism contributing to precise once per cell cycle replication. PMID:23474987

  9. Neuroinflammation alters voltage-dependent conductance in striatal astrocytes

    PubMed Central

    Karpuk, Nikolay; Burkovetskaya, Maria

    2012-01-01

    Neuroinflammation has the capacity to alter normal central nervous system (CNS) homeostasis and function. The objective of the present study was to examine the effects of an inflammatory milieu on the electrophysiological properties of striatal astrocyte subpopulations with a mouse bacterial brain abscess model. Whole cell patch-clamp recordings were performed in striatal glial fibrillary acidic protein (GFAP)-green fluorescent protein (GFP)+ astrocytes neighboring abscesses at postinfection days 3 or 7 in adult mice. Cell input conductance (Gi) measurements spanning a membrane potential (Vm) surrounding resting membrane potential (RMP) revealed two prevalent astrocyte subsets. A1 and A2 astrocytes were identified by negative and positive Gi increments vs. Vm, respectively. A1 and A2 astrocytes displayed significantly different RMP, Gi, and cell membrane capacitance that were influenced by both time after bacterial exposure and astrocyte proximity to the inflammatory site. Specifically, the percentage of A1 astrocytes was decreased immediately surrounding the inflammatory lesion, whereas A2 cells were increased. These changes were particularly evident at postinfection day 7, revealing increased cell numbers with an outward current component. Furthermore, RMP was inversely modified in A1 and A2 astrocytes during neuroinflammation, and resting Gi was increased from 21 to 30 nS in the latter. In contrast, gap junction communication was significantly decreased in all astrocyte populations associated with inflamed tissues. Collectively, these findings demonstrate the heterogeneity of striatal astrocyte populations, which experience distinct electrophysiological modifications in response to CNS inflammation. PMID:22457466

  10. Proteasome inhibition enhances resistance to DNA damage via upregulation of Rpn4-dependent DNA repair genes.

    PubMed

    Karpov, Dmitry S; Spasskaya, Daria S; Tutyaeva, Vera V; Mironov, Alexander S; Karpov, Vadim L

    2013-09-17

    The 26S proteasome is an ATP-dependent multi-subunit protease complex and the major regulator of intracellular protein turnover and quality control. However, its role in the DNA damage response is controversial. We addressed this question in yeast by disrupting the transcriptional regulation of the PRE1 proteasomal gene. The mutant strain has decreased proteasome activity and is hyper-resistant to various DNA-damaging agents. We found that Rpn4-target genes MAG1, RAD23, and RAD52 are overexpressed in this strain due to Rpn4 stabilisation. These genes represent three different pathways of base excision, nucleotide excision and double strand break repair by homologous recombination (DSB-HR). Consistently, the proteasome mutant displays increased DSB-HR activity. Our data imply that the proteasome may have a negative role in DNA damage response.

  11. T-DNA integration into the Arabidopsis genome depends on sequences of pre-insertion sites

    PubMed Central

    Brunaud, Véronique; Balzergue, Sandrine; Dubreucq, Bertrand; Aubourg, Sébastien; Samson, Franck; Chauvin, Stéphanie; Bechtold, Nicole; Cruaud, Corinne; DeRose, Richard; Pelletier, Georges; Lepiniec, Loïc; Caboche, Michel; Lecharny, Alain

    2002-01-01

    A statistical analysis of 9000 flanking sequence tags characterizing transferred DNA (T-DNA) transformants in Arabidopsis sheds new light on T-DNA insertion by illegitimate recombination. T-DNA integration is favoured in plant DNA regions with an A-T-rich content. The formation of a short DNA duplex between the host DNA and the left end of the T-DNA sets the frame for the recombination. The sequence immediately downstream of the plant A-T-rich region is the master element for setting up the DNA duplex, and deletions into the left end of the integrated T-DNA depend on the location of a complementary sequence on the T-DNA. Recombination at the right end of the T-DNA with the host DNA involves another DNA duplex, 2–3 base pairs long, that preferentially includes a G close to the right end of the T-DNA. PMID:12446565

  12. Analysis of supercoiled DNA by agarose gel electrophoresis using low-conducting sodium threonine medium.

    PubMed

    Ishido, Tomomi; Ishikawa, Mitsuru; Hirano, Ken

    2010-05-01

    We describe a new low-ionic-strength sodium threonine (STh) medium with the advantage of avoiding relative DNA band migration changes following electrophoresis of supercoiled DNA in agarose gel when substituted for the standard conductive medium of TBE (Tris-boric acid-ethylenediaminetetraacetic acid [EDTA]) or TAE (Tris-acetic acid-EDTA) or the low-ionic-strength sodium boric acid medium. Low-ionic-strength STh medium provided better resolution, less heat generation, and prevention of relative migration order changes among linear, covalently closed circular-, and open circular-formed DNA in the range of 2-10 kilobase pairs in 1% agarose gel electrophoresis.

  13. A Device for Performing Lateral Conductance Measurements on Individual Double-Stranded DNA Molecules

    PubMed Central

    Menard, Laurent D.; Mair, Chad E.; Woodson, Michael E.; Alarie, Jean Pierre; Ramsey, J. Michael

    2012-01-01

    A nanofluidic device is described that is capable of electrically monitoring the driven translocation of DNA molecules through a nanochannel. This is achieved by intersecting a long transport channel with a shorter orthogonal nanochannel. The ionic conductance of this transverse nanochannel is monitored while DNA is electrokinetically driven through the transport channel. When DNA passes the intersection, the transverse conductance is altered, resulting in a transient current response. In 1 M KCl solutions, this was found to be a current enhancement of 5–25%, relative to the baseline transverse ionic current. Two different device geometries were investigated. In one device, the DNA was detected after it was fully inserted into and translocating through the transport nanochannel. In the other device, the DNA was detected while it was in the process of entering the nanochannel. It was found that these two conditions are characterized by different transport dynamics. Simultaneous optical and electrical monitoring of DNA translocation confirmed that the transient events originated from DNA transport through the nanochannel intersection. PMID:22950784

  14. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    PubMed

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Frequency-dependent conductivity contrast for tissue characterization using a dual-frequency range conductivity mapping magnetic resonance method.

    PubMed

    Kim, Dong-Hyun; Chauhan, Munish; Kim, Min-Oh; Jeong, Woo Chul; Kim, Hyung Joong; Sersa, Igor; Kwon, Oh In; Woo, Eung Je

    2015-02-01

    Electrical conductivities of biological tissues show frequency-dependent behaviors, and these values at different frequencies may provide clinically useful diagnostic information. MR-based tissue property mapping techniques such as magnetic resonance electrical impedance tomography (MREIT) and magnetic resonance electrical property tomography (MREPT) are widely used and provide unique conductivity contrast information over different frequency ranges. Recently, a new method for data acquisition and reconstruction for low- and high-frequency conductivity images from a single MR scan was proposed. In this study, we applied this simultaneous dual-frequency range conductivity mapping MR method to evaluate its utility in a designed phantom and two in vivo animal disease models. Magnetic flux density and B(1)(+) phase map for dual-frequency conductivity images were acquired using a modified spin-echo pulse sequence. Low-frequency conductivity was reconstructed from MREIT data by the projected current density method, while high-frequency conductivity was reconstructed from MREPT data by B(1)(+) mapping. Two different conductivity phantoms comprising varying ion concentrations separated by insulating films with or without holes were used to study the contrast mechanism of the frequency-dependent conductivities related to ion concentration and mobility. Canine brain abscess and ischemia were used as in vivo models to evaluate the capability of the proposed method to identify new electrical properties-based contrast at two different frequencies. The simultaneous dual-frequency range conductivity mapping MR method provides unique contrast information related to the concentration and mobility of ions inside tissues. This method has potential to monitor dynamic changes of the state of disease.

  16. Ancestry Dependent DNA Methylation and Influence of Maternal Nutrition

    PubMed Central

    Mozhui, Khyobeni; Smith, Alicia K.; Tylavsky, Frances A.

    2015-01-01

    There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112) and European American (EA; N = 91) participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood). Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition—specifically, plasma levels of vitamin D and folate during pregnancy—on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC). Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome. PMID:25742137

  17. Neutron energy-dependent initial DNA damage and chromosomal exchange.

    PubMed

    Tanaka, K; Gajendiran, N; Endo, S; Komatsu, K; Hoshi, M; Kamada, N

    1999-12-01

    This study was undertaken to investigate the biological effect of monoenergetic neutrons on human lymphocyte DNA and chromosomes. Monoenergetic neutrons of 2.3, 1.0, 0.79, 0.57, 0.37 and 0.186 MeV were generated, and 252Cf neutrons and 60Co gamma-rays were also used for comparison. Biological effect was evaluated two ways. The RBE values with the comet assay were estimated as 6.3 and 5.4 at 0.37 MeV and 0.57 MeV relative to that of 60Co gamma-rays, and chromosome aberration rates were also observed in these different levels of monoenergetic neutrons. The yield of chromosome aberrations per unit dose was high at lower neutron energies with a gradual decline with 0.186 MeV neutron energy. The RBE was increased to 10.7 at 0.57 MeV from 3.9 at 252Cf neutrons and reached 16.4 as the highest RBE at 0.37 MeV, but the value decreased to 11.2 at 0.186 MeV. The response patterns of initial DNA damage and chromosome exchange were quite similar to that of LET. These results show that the intensity of DNA damage and chromosomal exchange is LET dependent. RBE of low energy neutrons is higher than that of fission neutrons. Low energy neutrons containing Hiroshima atomic bomb radiation may have created a significantly higher incidence of biological effect in atomic bomb survivors.

  18. Intrinsic self-DNA triggers inflammatory disease dependent on STING.

    PubMed

    Ahn, Jeonghyun; Ruiz, Phillip; Barber, Glen N

    2014-11-01

    Inflammatory diseases such as Aicardi-Goutières syndrome and severe systemic lupus erythematosus are generally lethal disorders that have been traced to defects in the exonuclease TREX1 (DNase III). Mice lacking TREX1 similarly die at an early age through comparable symptoms, including inflammatory myocarditis, through chronic activation of the stimulator of IFN genes (STING) pathway. In this study, we demonstrate that phagocytes rather than myocytes are predominantly responsible for causing inflammation, an outcome that could be alleviated following adoptive transfer of normal bone marrow into TREX1(-/-) mice. TREX1(-/-) macrophages did not exhibit significant augmented ability to produce proinflammatory cytokines compared with normal macrophages following exposure to STING-dependent activators, but rather appeared chronically stimulated by genomic DNA. These results shed molecular insight into inflammation and provide concepts for the design of new therapies. Copyright © 2014 by The American Association of Immunologists, Inc.

  19. Charge conduction properties of a parallel-stranded DNA G-quadruplex: implications for chromosomal oxidative damage.

    PubMed

    Huang, Yu Chuan; Cheng, Alan K H; Yu, Hua-Zhong; Sen, Dipankar

    2009-07-28

    The charge-flow properties and concomitant guanine damage patterns of a number of intermolecular and wholly parallel-stranded DNA G-quadruplexes were investigated. The DNA constructs were structurally well-defined and consisted of the G-quadruplex sandwiched and stacked between two Watson-Crick base-paired duplexes. Such duplex-quadruplex-duplex constructs were designed to minimize torsional stress as well as steric crowding at the duplex-quadruplex junctions. When anthraquinone was used to induce charge flow within the constructs, it was found that the quadruplex served both as a sink and as a moderately good conductor of electron holes, relative to DNA duplexes. Most strikingly, the quadruplex suffered very little charge-flow generated oxidative damage relative to guanines in the duplex regions and, indeed, to guanines in antiparallel quadruplexes reported in prior studies. It is likely that these differences result from a combination of steric and electronic factors. A biological conclusion that may be drawn from these data is that if, as anticipated, G-quadruplex structures form in vivo at the telomeres and other loci in eukaryotic chromosomes, their ability to serve as protective sinks against chromosomal oxidative damage may depend on their specific character and topology. From a separate perspective, our results on the conduction properties of duplex-quadruplex-duplex DNA composites suggest the utility of G-quadruplexes as junction modules in the construction of DNA-based biosensors and nanocircuitry.

  20. Distance-Dependent Measurements of the Conductance of Porphyrin Nanorods Studied with Conductive Probe Atomic Force Microscopy.

    PubMed

    Zhai, Xianglin; Alexander, Denzel; Derosa, Pedro; Garno, Jayne C

    2017-02-07

    Protocols for nanopatterning porphyrins on Au(111) were developed based on immersion particle lithography. Porphyrins with and without a central metal ion, 5,10,15,20-tetraphenyl-21H,23H-porphyrin (TPP) and 5,10,15,20-tetraphenyl-21H,23H-porphyrin cobalt(II) (CoTPP), were selected for study, which spontaneously formed nanorod geometries depending on concentration parameters. The elongated shapes of the nanorods offers an opportunity for successive distance-dependent conductive probe atomic force microscopy (CP-AFM) measurements along the length of the nanorods. To prepare patterns of TPP and CoTPP nanorods, a mask of silica mesospheres was placed on gold substrates to generate nanoholes within an alkanethiol matrix film. The nanoholes prepared by particle lithography with an immersion step were backfilled with porphyrins by a second immersion step. By controlling the concentration and immersion interval, nanorods of porphyrins were generated with one end of the nanostructure attached to gold within a nanohole. The porphyrin nanorods exhibited slight differences in dimensions at the nanoscale to enable size-dependent measurements of conductive properties. The conductivity along the horizontal direction of the nanorods was evaluated with CP-AFM studies. Changes in conductivity were measured along the long axis of TPP and CoTPP nanorods. The TPP nanorods exhibited conductive profiles of an insulating material, and the CoTPP nanorods exhibited profiles of a semiconductor. The experiments demonstrate the applicability of particle lithography for preparing unique and functional surface platforms of porphyrins to measure distance-dependent conductive properties on gold.

  1. Nbs1-dependent binding of Mre11 to adenovirus E4 mutant viral DNA is important for inhibiting DNA replication

    SciTech Connect

    Mathew, Shomita S.; Bridge, Eileen

    2008-04-25

    Adenovirus (Ad) infections stimulate the activation of cellular DNA damage response and repair pathways. Ad early regulatory proteins prevent activation of DNA damage responses by targeting the MRN complex, composed of the Mre11, Rad50 and Nbs1 proteins, for relocalization and degradation. In the absence of these viral proteins, Mre11 colocalizes with viral DNA replication foci. Mre11 foci formation at DNA damage induced by ionizing radiation depends on the Nbs1 component of the MRN complex and is stabilized by the mediator of DNA damage checkpoint protein 1 (Mdc1). We find that Nbs1 is required for Mre11 localization at DNA replication foci in Ad E4 mutant infections. Mre11 is important for Mdc1 foci formation in infected cells, consistent with its role as a sensor of DNA damage. Chromatin immunoprecipitation assays indicate that both Mre11 and Mdc1 are physically bound to viral DNA, which could account for their localization in viral DNA containing foci. Efficient binding of Mre11 to E4 mutant DNA depends on the presence of Nbs1, and is correlated with a significant E4 mutant DNA replication defect. Our results are consistent with a model in which physical interaction of Mre11 with viral DNA is mediated by Nbs1, and interferes with viral DNA replication.

  2. Temperature dependence of dc electrical conductivity of activated carbon-metal oxide nanocomposites. Some insight into conduction mechanisms

    NASA Astrophysics Data System (ADS)

    Barroso-Bogeat, Adrián; Alexandre-Franco, María; Fernández-González, Carmen; Sánchez-González, José; Gómez-Serrano, Vicente

    2015-12-01

    From a commercial activated carbon (AC) and six metal oxide (Al2O3, Fe2O3, SnO2, TiO2, WO3 and ZnO) precursors, two series of AC-metal oxide nanocomposites are prepared by wet impregnation, oven-drying at 120 °C, and subsequent heat treatment at 200 or 850 °C in inert atmosphere. The temperature-dependent dc electrical conductivity of AC and the as-prepared nanocomposites is measured from room temperature up to ca. 200 °C in air atmosphere by the four-probe method. The decrease in conductivity for the hybrid materials as compared to AC is the result of a complex interplay between several factors, including not only the intrinsic conductivity, crystallite size, content and chemical nature of the supported nanoparticles, which ultimately depend on the precursor and heat treatment temperature, but also the adsorption of oxygen and water from the surrounding atmosphere. The conductivity data are discussed in terms of a thermally activated process. In this regard, both AC and the prepared nanocomposites behave as semiconductors, and the temperature-dependent conductivity data have been interpreted on the basis of the classical model proposed by Mott and Davis. Because of its high content of heteroatoms, AC may be considered as a heavily doped semiconductor, so that conduction of thermally excited carriers via acceptor or donor levels is expected to be the dominant mechanism. The activation energies for the hybrid materials suggest that the supported metal oxide nanoparticles strongly modify the electronic band structure of AC by introducing new trap levels in different positions along its band gap. Furthermore, the thermally activated conduction process satisfies the Meyer-Neldel rule, which is likely connected with the shift of the Fermi level due to the introduction of the different metal oxide nanoparticles in the AC matrix.

  3. Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

    PubMed

    Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

    2010-12-09

    The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

  4. Global strong solution to compressible Navier-Stokes equations with density dependent viscosity and temperature dependent heat conductivity

    NASA Astrophysics Data System (ADS)

    Duan, Ran; Guo, Ai; Zhu, Changjiang

    2017-04-01

    We obtain existence and uniqueness of global strong solution to one-dimensional compressible Navier-Stokes equations for ideal polytropic gas flow, with density dependent viscosity and temperature dependent heat conductivity under stress-free and thermally insulated boundary conditions. Here we assume viscosity coefficient μ (ρ) = 1 +ρα and heat conductivity coefficient κ (θ) =θβ for all α ∈ [ 0 , ∞) and β ∈ (0 , + ∞).

  5. Setting standards for DNA banks: toward a model code of conduct.

    PubMed

    McEwen, J E; Reilly, P R

    1996-01-01

    As genomic research proliferates, DNA banking will become more common. In research, samples will be banked largely in an effort to find and clone genes that predispose to disease. Commercially oriented banks, those that offer services to families, may also become more common. These entities will hold sensitive information. DNA banking is not yet regulated. We argue here that new laws are not needed at this time to regulate DNA banking. We suggest an approach that relies on a professional code of conduct and draws on principles of disclosure inherent to the process used in obtaining informed consent. In addition to suggesting 12 specific recommendations for the code of conduct, we suggest that items should be included in depositor's agreements. We offer a rationale for our suggestions.

  6. DNA base pair stacks with high electric conductance: a systematic structural search.

    PubMed

    Berlin, Yuri A; Voityuk, Alexander A; Ratner, Mark A

    2012-09-25

    We report a computational search for DNA π-stack structures exhibiting high electric conductance in the hopping regime, based on the INDO/S calculations of electronic coupling and the method of data analysis called k-means clustering. Using homogeneous poly(G)-poly(C) and poly(A)-poly(T) stacks as the simplest structural models, we identify the configurations of neighboring G:C and A:T pairs that allow strong electronic coupling and, therefore, molecular electric conductance much larger than the values reported for the corresponding reference systems in the literature. A computational approach for modeling the impact of thermal fluctuations on the averaged dimer structure was also proposed and applied to the [(G:C),(G:C)] and [(A:T),(A:T)] duplexes. The results of this work may provide guidance for the construction of DNA devices and DNA-based elements of nanoscale molecular circuits. Several factors that cause changes of step parameters favorable to the formation of the predicted stack conformation with high electric conductance of DNA molecules are also discussed; favorable geometries may enhance the conductivity by factors as large as 15.

  7. Ku antigen-DNA conformation determines the activation of DNA-dependent protein kinase and DNA sequence-directed repression of mouse mammary tumor virus transcription.

    PubMed

    Giffin, W; Gong, W; Schild-Poulter, C; Haché, R J

    1999-06-01

    Mouse mammary tumor virus (MMTV) transcription is repressed by DNA-dependent protein kinase (DNA-PK) through a DNA sequence element, NRE1, in the viral long terminal repeat that is a sequence-specific DNA binding site for the Ku antigen subunit of the kinase. While Ku is an essential component of the active kinase, how the catalytic subunit of DNA-PK (DNA-PKcs) is regulated through its association with Ku is only beginning to be understood. We report that activation of DNA-PKcs and the repression of MMTV transcription from NRE1 are dependent upon Ku conformation, the manipulation of DNA structure by Ku, and the contact of Ku80 with DNA. Truncation of one copy of the overlapping direct repeat that comprises NRE1 abrogated the repression of MMTV transcription by Ku-DNA-PKcs. Remarkably, the truncated element was recognized by Ku-DNA-PKcs with affinity similar to that of the full-length element but was unable to promote the activation of DNA-PKcs. Analysis of Ku-DNA-PKcs interactions with DNA ends, double- and single-stranded forms of NRE1, and the truncated NRE1 element revealed striking differences in Ku conformation that differentially affected the recruitment of DNA-PKcs and the activation of kinase activity.

  8. Simultaneous retrieval of temperature-dependent absorption coefficient and conductivity of participating media

    PubMed Central

    Ren, Yatao; Qi, Hong; Zhao, Fangzhou; Ruan, Liming; Tan, Heping

    2016-01-01

    A secondary optimization technique was proposed to estimate the temperature-dependent thermal conductivity and absorption coefficient. In the proposed method, the stochastic particle swarm optimization was applied to solve the inverse problem. The coupled radiation and conduction problem was solved in a 1D absorbing, emitting, but non-scattering slab exposed to a pulse laser. It is found that in the coupled radiation and conduction problem, the temperature response is highly sensitive to conductivity but slightly sensitive to the optical properties. On the contrary, the radiative intensity is highly sensitive to optical properties but slightly sensitive to thermal conductivity. Therefore, the optical and thermal signals should both be considered in the inverse problem to estimate the temperature-dependent properties of the transparent media. On this basis, the temperature-dependent thermal conductivity and absorption coefficient were both estimated accurately by measuring the time-dependent temperature, and radiative response at the boundary of the slab. PMID:26912418

  9. A robust assay to measure DNA topology-dependent protein binding affinity.

    PubMed

    Litwin, Tamara R; Solà, Maria; Holt, Ian J; Neuman, Keir C

    2015-04-20

    DNA structure and topology pervasively influence aspects of DNA metabolism including replication, transcription and segregation. However, the effects of DNA topology on DNA-protein interactions have not been systematically explored due to limitations of standard affinity assays. We developed a method to measure protein binding affinity dependence on the topology (topological linking number) of supercoiled DNA. A defined range of DNA topoisomers at equilibrium with a DNA binding protein is separated into free and protein-bound DNA populations using standard nitrocellulose filter binding techniques. Electrophoretic separation and quantification of bound and free topoisomers combined with a simple normalization procedure provide the relative affinity of the protein for the DNA as a function of linking number. Employing this assay we measured topology-dependent DNA binding of a helicase, a type IB topoisomerase, a type IIA topoisomerase, a non-specific mitochondrial DNA binding protein and a type II restriction endonuclease. Most of the proteins preferentially bind negatively supercoiled DNA but the details of the topology-dependent affinity differ among proteins in ways that expose differences in their interactions with DNA. The topology-dependent binding assay provides a robust and easily implemented method to probe topological influences on DNA-protein interactions for a wide range of DNA binding proteins.

  10. Volume-Dependent Atp-Conductive Large-Conductance Anion Channel as a Pathway for Swelling-Induced Atp Release

    PubMed Central

    Sabirov, Ravshan Z.; Dutta, Amal K.; Okada, Yasunobu

    2001-01-01

    In mouse mammary C127i cells, during whole-cell clamp, osmotic cell swelling activated an anion channel current, when the phloretin-sensitive, volume-activated outwardly rectifying Cl− channel was eliminated. This current exhibited time-dependent inactivation at positive and negative voltages greater than around ±25 mV. The whole-cell current was selective for anions and sensitive to Gd3+. In on-cell patches, single-channel events appeared with a lag period of ∼15 min after a hypotonic challenge. Under isotonic conditions, cell-attached patches were silent, but patch excision led to activation of currents that consisted of multiple large-conductance unitary steps. The current displayed voltage- and time-dependent inactivation similar to that of whole-cell current. Voltage-dependent activation profile was bell-shaped with the maximum open probability at −20 to 0 mV. The channel in inside-out patches had the unitary conductance of ∼400 pS, a linear current-voltage relationship, and anion selectivity. The outward (but not inward) single-channel conductance was suppressed by extracellular ATP with an IC50 of 12.3 mM and an electric distance (δ) of 0.47, whereas the inward (but not outward) conductance was inhibited by intracellular ATP with an IC50 of 12.9 mM and δ of 0.40. Despite the open channel block by ATP, the channel was ATP-conductive with PATP/PCl of 0.09. The single-channel activity was sensitive to Gd3+, SITS, and NPPB, but insensitive to phloretin, niflumic acid, and glibenclamide. The same pharmacological pattern was found in swelling-induced ATP release. Thus, it is concluded that the volume- and voltage-dependent ATP-conductive large-conductance anion channel serves as a conductive pathway for the swelling-induced ATP release in C127i cells. PMID:11524456

  11. The DNA-dependent protein kinase: A multifunctional protein kinase with roles in DNA double strand break repair and mitosis.

    PubMed

    Jette, Nicholas; Lees-Miller, Susan P

    2015-03-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes.

  12. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    PubMed Central

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  13. Study of the dependence the thermal conductivity of nanofluids on different parameters

    NASA Astrophysics Data System (ADS)

    Pryazhnikov, M. I.; Minakov, A. V.; Guzei, D. V.; Rudyak, V. Ya

    2016-10-01

    The paper presents the results of systematic measurements of the thermal conductivity coefficient of nanofluids at room temperature. It is shown that the thermal conductivity of all considered nanofluids depend on concentration, nanopartical size, as well as the base fluid properties. It was revealed that thermal conductivity coefficient of nanofluids increases with increasing concentration and size of nanoparticles.

  14. On-chip DNA preconcentration in different media conductivities by electrodeless dielectrophoresis.

    PubMed

    Li, Shunbo; Ye, Ziran; Hui, Yu Sanna; Gao, Yibo; Jiang, Yusheng; Wen, Weijia

    2015-09-01

    Electrodeless dielectrophoresis is the best choice to achieve preconcentration of nanoparticles and biomolecules due to its simple, robust, and easy implementation. We designed a simple chip with microchannels and nano-slits in between and then studied the trapping of DNA in high conductive medium and low conductive medium, corresponding to positive and negative dielectrophoresis (DEP), respectively. It is very important to investigate the trapping in media with different conductivities since one always has to deal with the sample solutions with different conductivities. The trapping process was analyzed by the fluorescent intensity changes. The results showed that DNA could be trapped at the nano-slit in both high and low conductive media in a lower electric field strength (10 V/cm) compared to the existing methods. This is a significant improvement to suppress the Joule heating effect in DEP related experiments. Our work may give insight to researchers for DNA trapping by a simple and low cost device in the Lab-on-a-Chip system.

  15. Cell cycle regulation of DNA double-strand break end resection by Cdk1-dependent Dna2 phosphorylation.

    PubMed

    Chen, Xuefeng; Niu, Hengyao; Chung, Woo-Hyun; Zhu, Zhu; Papusha, Alma; Shim, Eun Yong; Lee, Sang Eun; Sung, Patrick; Ira, Grzegorz

    2011-08-14

    DNA recombination pathways are regulated by the cell cycle to coordinate with replication. Cyclin-dependent kinase (Cdk1) promotes efficient 5' strand resection at DNA double-strand breaks (DSBs), the initial step of homologous recombination and damage checkpoint activation. The Mre11-Rad50-Xrs2 complex with Sae2 initiates resection, whereas two nucleases, Exo1 and Dna2, and the DNA helicase-topoisomerase complex Sgs1-Top3-Rmi1 generate longer ssDNA at DSBs. Using Saccharomyces cerevisiae, we provide evidence for Cdk1-dependent phosphorylation of the resection nuclease Dna2 at Thr4, Ser17 and Ser237 that stimulates its recruitment to DSBs, resection and subsequent Mec1-dependent phosphorylation. Poorly recruited dna2T4A S17A S237A and dna2ΔN248 mutant proteins promote resection only in the presence of Exo1, suggesting cross-talk between Dna2- and Exo1-dependent resection pathways.

  16. Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

    PubMed

    Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

    2017-10-06

    Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

  17. Ionic mechanisms underlying history-dependence of conduction delay in an unmyelinated axon.

    PubMed

    Zhang, Yang; Bucher, Dirk; Nadim, Farzan

    2017-07-10

    Axonal conduction velocity can change substantially during ongoing activity, thus modifying spike interval structures and, potentially, temporal coding. We used a biophysical model to unmask mechanisms underlying the history-dependence of conduction. The model replicates activity in the unmyelinated axon of the crustacean stomatogastric pyloric dilator neuron. At the timescale of a single burst, conduction delay has a non-monotonic relationship with instantaneous frequency, which depends on the gating rates of the fast voltage-gated Na(+) current. At the slower timescale of minutes, the mean value and variability of conduction delay increase. These effects are because of hyperpolarization of the baseline membrane potential by the Na(+)/K(+) pump, balanced by an h-current, both of which affect the gating of the Na(+) current. We explore the mechanisms of history-dependence of conduction delay in axons and develop an empirical equation that accurately predicts this history-dependence, both in the model and in experimental measurements.

  18. pH- and voltage-dependent conductances in toad skin.

    PubMed

    Lacaz-Vieira, F

    1995-11-01

    The present study focuses on two closely related topics on ion conductance in toad skins: (i) the interaction of apical protons with the apical voltage-dependent Cl(-)-activated channels of the mitochondria-rich cells, and (ii) the description and characterization of a novel subject, a voltage-dependent H(+)-activated conductance. The Cl- conductance (GCl) is activated by tissue hyperpolarization (which leads to apical membrane depolarization) and the presence of Cl- ions in the apical solution. Increasing apical proton concentration (from pH 8 to pH 4) impairs the process of activation of the Cl- conductive pathway, slowing the kinetics of It activation and reducing the steady-stage values of Gt and It. This effect is markedly voltage-dependent since no effect is seen at Vt = -100 mv and is fully present at -50 mV. The voltage-dependence of the pH effect suggests that the critical protonation sites of the apical Cl- channels are not freely exposed to the apical solution but dwell within the membrane electric field. An also coherent interpretation is that titration of apical proton binding sites affects the gating of the voltage-dependent Cl- channels, shifting the conductance-vs.-voltage curve to more negative clamping potentials. Tissue conductance in the absence of apical Cl- ions can be importantly affected by the pH of the apical solution (pHa), the effect being markedly dependent on the clamping potential. Generally speaking, the effect of rising apical proton concentration can be conspicuous at negative clamping potentials, while at positive potentials changes in tissue conductance were never observed. For a clamping potential of -100 mV, a turning point somewhere between pHa = 4 and pHa = 3 was observed. Apical acidification to pH 4 has no effect upon tissue conductance while apical acidification to pH 3 leads to a marked, slow and reversible increase of tissue conductance. A striking similitude exists between the voltage-dependent Cl(-)-gated conductance

  19. Metallic Conductive Nanowires Elaborated by PVD Metal Deposition on Suspended DNA Bundles.

    PubMed

    Brun, Christophe; Elchinger, Pierre-Henri; Nonglaton, Guillaume; Tidiane-Diagne, Cheikh; Tiron, Raluca; Thuaire, Aurélie; Gasparutto, Didier; Baillin, Xavier

    2017-09-01

    Metallic conductive nanowires (NWs) with DNA bundle core are achieved, thanks to an original process relying on double-stranded DNA alignment and physical vapor deposition (PVD) metallization steps involving a silicon substrate. First, bundles of DNA are suspended with a repeatable process between 2 µm high parallel electrodes with separating gaps ranging from 800 nm to 2 µm. The process consists in the drop deposition of a DNA lambda-phage solution on the electrodes followed by a naturally evaporation step. The deposition process is controlled by the DNA concentration within the buffer solution, the drop volume, and the electrode hydrophobicity. The suspended bundles are finally metallized with various thicknesses of titanium and gold by a PVD e-beam evaporation process. The achieved NWs have a width ranging from a few nanometers up to 100 nm. The electrical behavior of the achieved 60 and 80 nm width metallic NWs is shown to be Ohmic and their intrinsic resistance is estimated according to different geometrical models of the NW section area. For the 80 nm width NWs, a resistance of about few ohms is established, opening exploration fields for applications in microelectronics. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Modeling the electrical conduction in DNA nanowires: Charge transfer and lattice fluctuation theories

    NASA Astrophysics Data System (ADS)

    Behnia, S.; Fathizadeh, S.

    2015-02-01

    An analytical approach is proposed for the investigation of the conductivity properties of DNA. The charge mobility of DNA is studied based on an extended Peyrard-Bishop-Holstein model when the charge carrier is also subjected to an external electrical field. We have obtained the values of some of the system parameters, such as the electron-lattice coupling constant, by using the mean Lyapunov exponent method. On the other hand, the electrical current operator is calculated directly from the lattice operators. Also, we have studied Landauer resistance behavior with respect to the external field, which could serve as the interface between chaos theory tools and electronic concepts. We have examined the effect of two types of electrical fields (dc and ac) and variation of the field frequency on the current flowing through DNA. A study of the current-voltage (I -V ) characteristic diagram reveals regions with a (quasi-)Ohmic property and other regions with negative differential resistance (NDR). NDR is a phenomenon that has been observed experimentally in DNA at room temperature. We have tried to study the affected agents in charge transfer phenomena in DNA to better design nanostructures.

  1. DNA nanotubes self-assembled from triple-crossover tiles as templates for conductive nanowires

    PubMed Central

    Liu, Dage; Park, Sung Ha; Reif, John H.; LaBean, Thomas H.

    2004-01-01

    DNA-based nanotechnology is currently being developed as a general assembly method for nanopatterned materials that may find use in electronics, sensors, medicine, and many other fields. Here we present results on the construction and characterization of DNA nanotubes, a self-assembling superstructure composed of DNA tiles. Triple-crossover tiles modified with thiol-containing double-stranded DNA stems projected out of the tile plane were used as the basic building blocks. Triple-crossover nanotubes display a constant diameter of ≈25 nm and have been observed with lengths up to 20 μm. We present high-resolution images of the constructs, experimental evidence of their tube-like nature as well as data on metallization of the nanotubes to form nanowires, and electrical conductivity measurements through the nanowires. DNA nanotubes represent a potential breakthrough in the self-assembly of nanometer-scale circuits for electronics layout because they can be targeted to connect at specific locations on larger-scale structures and can subsequently be metallized to form nanometer-scale wires. The dimensions of these nanotubes are also perfectly suited for applications involving interconnection of molecular-scale devices with macroscale components fabricated by conventional photolithographic methods. PMID:14709674

  2. Modeling the electrical conduction in DNA nanowires: charge transfer and lattice fluctuation theories.

    PubMed

    Behnia, S; Fathizadeh, S

    2015-02-01

    An analytical approach is proposed for the investigation of the conductivity properties of DNA. The charge mobility of DNA is studied based on an extended Peyrard-Bishop-Holstein model when the charge carrier is also subjected to an external electrical field. We have obtained the values of some of the system parameters, such as the electron-lattice coupling constant, by using the mean Lyapunov exponent method. On the other hand, the electrical current operator is calculated directly from the lattice operators. Also, we have studied Landauer resistance behavior with respect to the external field, which could serve as the interface between chaos theory tools and electronic concepts. We have examined the effect of two types of electrical fields (dc and ac) and variation of the field frequency on the current flowing through DNA. A study of the current-voltage (I-V) characteristic diagram reveals regions with a (quasi-)Ohmic property and other regions with negative differential resistance (NDR). NDR is a phenomenon that has been observed experimentally in DNA at room temperature. We have tried to study the affected agents in charge transfer phenomena in DNA to better design nanostructures.

  3. Quinolone-DNA interaction: sequence-dependent binding to single-stranded DNA reflects the interaction within the gyrase-DNA complex.

    PubMed

    Noble, Christian G; Barnard, Faye M; Maxwell, Anthony

    2003-03-01

    We have investigated the interaction of quinolones with DNA by a number of methods to establish whether a particular binding mode correlates with quinolone potency. The specificities of the quinolone-mediated DNA cleavage reaction of DNA gyrase were compared for a number of quinolones. Two patterns that depended on the potency of the quinolone were identified. Binding to plasmid DNA was examined by measuring the unwinding of pBR322 by quinolones; no correlation with quinolone potency was observed. Quinolone binding to short DNA oligonucleotides was measured by surface plasmon resonance. The quinolones bound to both single- and double-stranded oligonucleotides in an Mg(2+)-dependent manner. Quinolones bound to single-stranded DNA with a higher affinity, and the binding exhibited sequence dependence; binding to double-stranded DNA was sequence independent. The variations in binding in the presence of metal ions showed that Mg(2+) promoted tighter, more specific binding to single-stranded DNA than softer metal ions (Mn(2+) and Cd(2+)). Single-stranded DNA binding by quinolones correlated with the in vitro quinolone potency, indicating that this mode of interaction may reflect the interaction of the quinolone with DNA in the context of the gyrase-DNA complex.

  4. Diameter Dependence of Lattice Thermal Conductivity of Single-Walled Carbon Nanotubes: Study from Ab Initio.

    PubMed

    Yue, Sheng-Ying; Ouyang, Tao; Hu, Ming

    2015-10-22

    The effects of temperature, tube length, defects, and surface functionalization on the thermal conductivity (κ) of single-walled carbon nanotubes (SWCNTs) were well documented in literature. However, diameter dependence of thermal conductivity of SWCNTs received less attentions. So far, diverse trends of the diameter dependence have been discussed by different methods and all the previous results were based on empirical interatomic potentials. In this paper, we emphasize to clarify accurate κ values of SWCNTs with different diameters and in-plane κ of graphene. All the studies were under the framework of anharmonic lattice dynamics and Boltzmann transport equation (BTE) based on first principle calculations. We try to infer the right trend of diameter dependent thermal conductivity of SWCNTs. We infer that graphene is the limitation as SWCNT with an infinite diameter. We analyzed the thermal conductivity contributions from each phonon mode in SWCNTs to explain the trend. Meanwhile, we also identify the extremely low thermal conductivity of ultra-thin SWCNTs.

  5. Bias-dependent conductive characteristics of individual GeSi quantum dots studied by conductive atomic force microscopy.

    PubMed

    Wu, R; Zhang, S L; Lin, J H; Jiang, Z M; Yang, X J

    2011-03-04

    The bias-dependent electrical characteristics of individual self-assembled GeSi quantum dots (QDs) are investigated by conductive atomic force microscopy. The results reveal that the conductive characteristics of QDs are strongly influenced by the applied bias. At low (-0.5 to - 2.0 V) and high (-2.5 to - 4.0 V) biases, the current distributions of individual GeSi QDs exhibit ring-like and disc-like characteristics respectively. The current of the QD's central part increases more quickly than that of the other parts as the bias magnitude increases. Histograms of the magnitude of the current on a number of QDs exhibit the same single-peak feature at low biases, and double- or three-peak features at high biases, where additional peaks appear at large-current locations. On the other hand, histograms of the magnitude of the current on the wetting layers exhibit the same single-peak feature for all biases. This indicates the conductive mechanism is significantly different for QDs and wetting layers. While the small-current peak of QDs can be attributed to the Fowler-Nordheim tunneling model at low biases and the Schottky emission model at high biases respectively, the large-current peak(s) may be attributed to the discrete energy levels of QDs. The results suggest the conductive mechanisms of GeSi QDs can be regulated by the applied bias.

  6. SIRT6 stabilizes DNA-dependent Protein Kinase at chromatin for DNA double-strand break repair

    PubMed Central

    McCord, Ronald A.; Michishita, Eriko; Hong, Tao; Berber, Elisabeth; Boxer, Lisa D.; Kusumoto, Rika; Guan, Shenheng; Shi, Xiaobing; Gozani, Or; Burlingame, Alma L.; Bohr, Vilhelm A.; Chua, Katrin F.

    2009-01-01

    The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor with chromatin impacts on the efficiency of repair, and establish a link between chromatin regulation, DNA repair, and a mammalian Sir2 factor. PMID:20157594

  7. Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

    PubMed Central

    Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

    2012-01-01

    Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100–300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK. PMID:23227178

  8. Structured DNA promotes phosphorylation of p53 by DNA-dependent protein kinase at serine 9 and threonine 18.

    PubMed

    Soubeyrand, Sébastien; Schild-Poulter, Caroline; Haché, Robert J G

    2004-09-01

    Phosphorylation at multiple sites within the N-terminus of p53 promotes its dissociation from hdm2/mdm2 and stimulates its transcriptional regulatory potential. The large phosphoinositide 3-kinase-like kinases ataxia telangiectasia mutated gene product and the ataxia telangectasia and RAD-3-related kinase promote phosphorylation of human p53 at Ser15 and Ser20, and are required for the activation of p53 following DNA damage. DNA-dependent protein kinase (DNA-PK) is another large phosphoinositide 3-kinase-like kinase with the potential to phosphorylate p53 at Ser15, and has been proposed to enhance phosphorylation of these sites in vivo. Moreover, recent studies support a role for DNA-PK in the regulation of p53-mediated apoptosis. We have shown previously that colocalization of p53 and DNA-PK to structured single-stranded DNA dramatically enhances the potential for p53 phosphorylation by DNA-PK. We report here the identification of p53 phosphorylation at two novel sites for DNA-PK, Thr18 and Ser9. Colocalization of p53 and DNA-PK on structured DNA was required for efficient phosphorylation of p53 at multiple sites, while specific recognition of Ser9 and Thr18 appeared to be dependent upon additional determinants of p53 beyond the N-terminal 65 amino acids. Our results suggest a role for DNA-PK in the modulation of p53 activity resultant from the convergence of p53 and DNA-PK on structured DNA.

  9. Probing DNA by 2-OG-dependent dioxygenase

    PubMed Central

    Tsai, Chi-Lin; Tainer, John A.

    2014-01-01

    TET-mediated 5-methyl cytosine (5mC) oxidation acts in epigenetic regulation, stem cell development, and cancer. Hu et al. now determine the crystal structure of the TET2 catalytic domain bound to DNA, shedding light on 5mC-DNA substrate recognition and the catalytic mechanism of 5mC oxidation. PMID:24360270

  10. ATP-dependent chromatin remodeling in the DNA-damage response

    PubMed Central

    2012-01-01

    The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways. PMID:22289628

  11. DNA replication-dependent induction of gene proximity by androgen.

    PubMed

    Coll-Bastus, Nuria; Mao, Xueying; Young, Bryan D; Sheer, Denise; Lu, Yong-Jie

    2015-02-15

    The male hormone androgen, working through the androgen receptor (AR), plays a major role in physiological process and disease development. Previous studies of AR mainly focus on its transcriptional activity. Here, we found that androgen-induced TMPRSS2 and ERG gene proximity is mediated by AR control of DNA replication rather than gene transcription. We demonstrate that, in both AR transactivation-positive and -negative prostate cells, androgen regulates DNA replication and androgen-induced gene proximity relies on both DNA replication-licensing and actual DNA replication activity. Androgen stimulation advances DNA replication timing of certain genomic regions, which may potentially increase gene proximity through sharing the same replication factory at a similar time. Therefore, we have revealed novel mechanisms of AR biological function, which will stimulate new research directions. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  12. Artemis phosphorylated by DNA-dependent protein kinase associates preferentially with discrete regions of chromatin.

    PubMed

    Soubeyrand, Sébastien; Pope, Louise; De Chasseval, Régina; Gosselin, Dominique; Dong, Fumin; de Villartay, Jean-Pierre; Haché, Robert J G

    2006-05-19

    Artemis is a nuclear phosphoprotein required for genomic integrity whose phosphorylation is increased subsequent to DNA damage. Artemis phosphorylation by the DNA-dependent protein kinase (DNA-PK) and the association of Artemis with DNA-PK catalytic subunit (DNA-PKcs) have been proposed to be crucial for the variable, diversity, joining (V(D)J) reaction, genomic stability and cell survival in response to double-stranded DNA breaks. The exact nature of the effectors of Artemis phosphorylation is presently being debated. Here, we have delimited the interface on Artemis required for its association with DNA-PKcs and present the characterization of six DNA-PK phosphorylation sites on Artemis whose phosphorylation shows dependence on its association with DNA-PKcs and is induced by double-stranded DNA damage. Surprisingly, DNA-PKcs Artemis association appeared to be dispensable in a V(D)J recombination assay with stably integrated DNA substrates. Phosphorylation at two of the sites on Artemis, S516 and S645, was verified in vivo using phosphospecific antibodies. Basal Artemis S516 and S645 phosphorylation in vivo showed a significant dependence on DNA-PKcs association. However, regardless of its association with DNA-PKcs, phosphorylation of Artemis at both S516 and S645 was stimulated in response to the double-stranded DNA-damaging agent bleomycin, albeit to a lesser extent. This suggests that additional factors contribute to promote DNA damage-induced Artemis phosphorylation. Intriguingly, pS516/pS645 Artemis was concentrated in chromatin-associated nuclear foci in naïve cells. These foci were maintained upon DNA damage but failed to overlap with the damage-induced gammaH2AX. These results provide the expectation of a specific role for DNA-PK-phosphorylated Artemis in both naïve and damaged cells.

  13. Frequency dependent optical conductivity of strained graphene at T=0 from an effective quantum field theory

    NASA Astrophysics Data System (ADS)

    Zhang, Shi-Jiang; Pan, Hui; Wang, Hai-Long

    2017-04-01

    An effective quantum field theory (EQFT) graphene sheet with arbitrary one dimensional strain field is derived from a microscopic effective low energy Hamiltonian. The geometric meaning of the strain-induced complex gauge field is clarified. The optical conductivity is also investigated, and a frequency dependent optical conductivity is obtained. The actual value of interband optical conductivity along the deformed direction is C0 + C1/ω2 in spite of the particular strain fields at T=0.

  14. Unifying the DNA end-processing roles of the artemis nuclease: Ku-dependent artemis resection at blunt DNA ends.

    PubMed

    Chang, Howard H Y; Watanabe, Go; Lieber, Michael R

    2015-10-02

    Artemis is a member of the metallo-β-lactamase protein family of nucleases. It is essential in vertebrates because, during V(D)J recombination, the RAG complex generates hairpins when it creates the double strand breaks at V, D, and J segments, and Artemis is required to open the hairpins so that they can be joined. Artemis is a diverse endo- and exonuclease, and creating a unified model for its wide range of nuclease properties has been challenging. Here we show that Artemis resects iteratively into blunt DNA ends with an efficiency that reflects the AT-richness of the DNA end. GC-rich ends are not cut by Artemis alone because of a requirement for DNA end breathing (and confirmed using fixed pseudo-Y structures). All DNA ends are cut when both the DNA-dependent protein kinase catalytic subunit and Ku accompany Artemis but not when Ku is omitted. These are the first biochemical data demonstrating a Ku dependence of Artemis action on DNA ends of any configuration. The action of Artemis at blunt DNA ends is slower than at overhangs, consistent with a requirement for a slow DNA end breathing step preceding the cut. The AT sequence dependence, the order of strand cutting, the length of the cuts, and the Ku-dependence of Artemis action at blunt ends can be reconciled with the other nucleolytic properties of both Artemis and Artemis·DNA-PKcs in a model incorporating DNA end breathing of blunt ends to form transient single to double strand boundaries that have structural similarities to hairpins and fixed 5' and 3' overhangs. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  16. Light sensitive memristor with bi-directional and wavelength-dependent conductance control

    SciTech Connect

    Maier, P.; Hartmann, F. Emmerling, M.; Schneider, C.; Kamp, M.; Worschech, L.; Rebello Sousa Dias, M.; Castelano, L. K.; Marques, G. E.; Lopez-Richard, V.; Höfling, S.

    2016-07-11

    We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.

  17. Light sensitive memristor with bi-directional and wavelength-dependent conductance control

    NASA Astrophysics Data System (ADS)

    Maier, P.; Hartmann, F.; Rebello Sousa Dias, M.; Emmerling, M.; Schneider, C.; Castelano, L. K.; Kamp, M.; Marques, G. E.; Lopez-Richard, V.; Worschech, L.; Höfling, S.

    2016-07-01

    We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.

  18. Detecting ATM-dependent chromatin modification in DNA damage response.

    PubMed

    Udayakumar, Durga; Horikoshi, Nobuo; Mishra, Lopa; Hunt, Clayton; Pandita, Tej K

    2015-01-01

    Loss of function or mutation of the ataxia-telangiectasia mutated gene product (ATM) results in inherited genetic disorders characterized by neurodegeneration, immunodeficiency, and cancer. Ataxia-telangiectasia mutated (ATM) gene product belongs to the PI3K-like protein kinase (PIKKs) family and is functionally implicated in mitogenic signal transduction, chromosome condensation, meiotic recombination, cell-cycle control, and telomere maintenance. The ATM protein kinase is primarily activated in response to DNA double strand breaks (DSBs), the most deleterious form of DNA damage produced by ionizing radiation (IR) or radiomimetic drugs. It is detected at DNA damage sites, where ATM autophosphorylation causes dissociation of the inactive homodimeric form to the activated monomeric form. Interestingly, heat shock can activate ATM independent of the presence of DNA strand breaks. ATM is an integral part of the sensory machinery that detects DSBs during meiosis, mitosis, or DNA breaks mediated by free radicals. These DNA lesions can trigger higher order chromatin reorganization fuelled by posttranslational modifications of histones and histone binding proteins. Our group, and others, have shown that ATM activation is tightly regulated by chromatin modifications. This review summarizes the multiple approaches used to discern the role of ATM and other associated proteins in chromatin modification in response to DNA damage.

  19. Detecting ATM-Dependent Chromatin Modification in DNA Damage Response

    PubMed Central

    Udayakumar, Durga; Horikoshi, Nobuo; Mishra, Lope; Hunt, Clayton; Pandita, Tej K.

    2015-01-01

    Loss of function or mutation of the ataxia–telangiectasia mutated gene product (ATM) results in inherited genetic disorders characterized by neurodegeneration, immunodeficiency, and cancer. Ataxia-telangiectasia mutated (ATM) gene product belongs to the PI3K-like protein kinase (PIKKs) family and is functionally implicated in mitogenic signal transduction, chromosome condensation, meiotic recombination, cell-cycle control, and telomere maintenance. The ATM protein kinase is primarily activated in response to DNA double strand breaks (DSBs), the most deleterious form of DNA damage produced by ionizing radiation (IR) or radiomimetic drugs. It is detected at DNA damage sites, where ATM autophosphorylation causes dissociation of the inactive homodimeric form to the activated monomeric form. Interestingly, heat shock can activate ATM independent of the presence of DNA strand breaks. ATM is an integral part of the sensory machinery that detects DSBs during meiosis, mitosis, or DNA breaks mediated by free radicals. These DNA lesions can trigger higher order chromatin reorganization fuelled by posttranslational modifications of histones and histone binding proteins. Our group, and others, have shown that ATM activation is tightly regulated by chromatin modifications. This review summarizes the multiple approaches used to discern the role of ATM and other associated proteins in chromatin modification in response to DNA damage. PMID:25827888

  20. Finite element analysis of hepatic radiofrequency ablation probes using temperature-dependent electrical conductivity.

    PubMed

    Chang, Isaac

    2003-05-08

    Few finite element models (FEM) have been developed to describe the electric field, specific absorption rate (SAR), and the temperature distribution surrounding hepatic radiofrequency ablation probes. To date, a coupled finite element model that accounts for the temperature-dependent electrical conductivity changes has not been developed for ablation type devices. While it is widely acknowledged that accounting for temperature dependent phenomena may affect the outcome of these models, the effect has not been assessed. The results of four finite element models are compared: constant electrical conductivity without tissue perfusion, temperature-dependent conductivity without tissue perfusion, constant electrical conductivity with tissue perfusion, and temperature-dependent conductivity with tissue perfusion. The data demonstrate that significant errors are generated when constant electrical conductivity is assumed in coupled electrical-heat transfer problems that operate at high temperatures. These errors appear to be closely related to the temperature at which the ablation device operates and not to the amount of power applied by the device or the state of tissue perfusion. Accounting for temperature-dependent phenomena may be critically important in the safe operation of radiofrequency ablation device that operate near 100 degrees C.

  1. Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

    PubMed

    Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

    2014-11-01

    DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

  2. The dependence of the electronic conductivity of carbon molecular sieve electrodes on their charging states.

    PubMed

    Pollak, Elad; Genish, Isaschar; Salitra, Gregory; Soffer, Abraham; Klein, Lior; Aurbach, Doron

    2006-04-13

    The dependence of the electronic conductivity of activated carbon electrodes on their potential in electrolyte solutions was examined. Kapton polymer films underwent carbonization (1000 degrees C), followed by a mild oxidation process (CO(2) at 900 degrees C) for various periods of time, to obtain carbons of different pore structures. A specially designed cell was assembled in order to measure the conductivity of carbon electrodes at different potentials in solutions. When the carbon electrodes possessed molecular sieving properties, a remarkable dependence of their conductivity on their charging state was observed. Aqueous electrolyte solutions containing ions of different sizes were used in order to demonstrate this phenomenon. As the average pore size of the activated carbons was larger, their molecular sieving ability was lower, and the dependence of their conductivity on their charging state regained its classical form. This behavior is discussed herein.

  3. The catalytic subunit DNA-dependent protein kinase (DNA-PKcs) facilitates recovery from radiation-induced inhibition of DNA replication

    PubMed Central

    Guan, Jun; DiBiase, Steven; Iliakis, George

    2000-01-01

    Exposure of cells to ionizing radiation inhibits DNA replication in a dose-dependent manner. The dose response is biphasic and the initial steep component reflects inhibition of replicon initiation thought to be mediated by activation of the S-phase checkpoint. In mammalian cells, inhibition of replicon initiation requires the ataxia telagiectasia mutated (ATM) gene, a member of the phosphatidyl inositol kinase-like (PIKL) family of protein kinases. We studied the effect on replicon initiation of another member of the PI-3 family of protein kinases, the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) by measuring either total DNA synthesis, or size distribution of nascent DNA using alkaline sucrose gradient centrifugation. Exposure of human cells proficient in DNA-PKcs (HeLa or M059-K) to 10 Gy inhibited replicon initiation in a time-dependent manner. Inhibition was at a maximum 1 h after irradiation and recovered at later times. Similar treatment of human cells deficient in DNA-PKcs (M059-J) inhibited replicon initiation to a similar level and with similar kinetics; however, no evidence for recovery, or only limited recovery, was observed for up to 8 h after irradiation. In addition a defect was observed in the maturation of nascent DNA. Similarly, a Chinese hamster cell line deficient in DNA-PKcs (irs-20) showed little evidence for recovery of DNA replication inhibition up to 6 h after irradiation, whereas the parental CHO cells showed significant recovery and an irs-20 derivative expressing the human DNA-PKcs complete recovery within 4 h. Normal kinetics of recovery were observed in xrs-5 cells, deficient in Ku80; in 180BR cells, deficient in DNA ligase IV; as well as XR-1 cells, deficient in XRCC4, an accessory factor of DNA ligase IV. Since all these cell lines share the DNA double strand break rejoining defect of M059-J and irs20 cells, the lack of recovery of DNA replication in the latter cells may not be attributed entirely to the prolonged

  4. The catalytic subunit DNA-dependent protein kinase (DNA-PKcs) facilitates recovery from radiation-induced inhibition of DNA replication.

    PubMed

    Guan, J; DiBiase, S; Iliakis, G

    2000-03-01

    Exposure of cells to ionizing radiation inhibits DNA replication in a dose-dependent manner. The dose response is biphasic and the initial steep component reflects inhibition of replicon initiation thought to be mediated by activation of the S-phase checkpoint. In mammalian cells, inhibition of replicon initiation requires the ataxia telagiectasia mutated ( ATM ) gene, a member of the phosphatidyl inositol kinase-like (PIKL) family of protein kinases. We studied the effect on replicon initiation of another member of the PI-3 family of protein kinases, the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) by measuring either total DNA synthesis, or size distribution of nascent DNA using alkaline sucrose gradient centrifugation. Exposure of human cells proficient in DNA-PKcs (HeLa or M059-K) to 10 Gy inhibited replicon initiation in a time-dependent manner. Inhibition was at a maximum 1 h after irradiation and recovered at later times. Similar treatment of human cells deficient in DNA-PKcs (M059-J) inhibited replicon initiation to a similar level and with similar kinetics; however, no evidence for recovery, or only limited recovery, was observed for up to 8 h after irradiation. In addition a defect was observed in the maturation of nascent DNA. Similarly, a Chinese hamster cell line deficient in DNA-PKcs (irs-20) showed little evidence for recovery of DNA replication inhibition up to 6 h after irradiation, whereas the parental CHO cells showed significant recovery and an irs-20 derivative expressing the human DNA-PKcs complete recovery within 4 h. Normal kinetics of recovery were observed in xrs-5 cells, deficient in Ku80; in 180BR cells, deficient in DNA ligase IV; as well as XR-1 cells, deficient in XRCC4, an accessory factor of DNA ligase IV. Since all these cell lines share the DNA double strand break rejoining defect of M059-J and irs20 cells, the lack of recovery of DNA replication in the latter cells may not be attributed entirely to the prolonged

  5. Usp7-dependent histone H3 deubiquitylation regulates maintenance of DNA methylation.

    PubMed

    Yamaguchi, Luna; Nishiyama, Atsuya; Misaki, Toshinori; Johmura, Yoshikazu; Ueda, Jun; Arita, Kyohei; Nagao, Koji; Obuse, Chikashi; Nakanishi, Makoto

    2017-03-03

    Uhrf1-dependent histone H3 ubiquitylation plays a crucial role in the maintenance of DNA methylation via the recruitment of the DNA methyltransferase Dnmt1 to DNA methylation sites. However, the involvement of deubiquitylating enzymes (DUBs) targeting ubiquitylated histone H3 in the maintenance of DNA methylation is largely unknown. With the use of Xenopus egg extracts, we demonstrate here that Usp7, a ubiquitin carboxyl-terminal hydrolase, forms a stable complex with Dnmt1 and is recruited to DNA methylation sites during DNA replication. Usp7 deubiquitylates ubiquitylated histone H3 in vitro. Inhibition of Usp7 activity or its depletion in egg extracts results in enhanced and extended binding of Dnmt1 to chromatin, suppressing DNA methylation. Depletion of Usp7 in HeLa cells causes enhanced histone H3 ubiquitylation and enlargement of Dnmt1 nuclear foci during DNA replication. Our results thus suggest that Usp7 is a key factor that regulates maintenance of DNA methylation.

  6. Prooxidant action of chebulinic acid and tellimagrandin I: causing copper-dependent DNA strand breaks.

    PubMed

    Yi, Zong-Chun; Liu, Yan-Ze; Li, Hai-Xia; Wang, Zhao

    2009-04-01

    The prooxidant activity of two hydrolysable tannins, chebulinic acid and tellimagrandin I, on plasmid DNA and genomic DNA of cultured MRC-5 human embryo lung fibroblasts was assessed. The results revealed that both hydrolysable tannins in combination with Cu(II) induced DNA strand breaks in pBR322 plasmid DNA in a concentration-dependent manner. Chebulinic acid and tellimagrandin I also induced genomic DNA strand breaks of MRC-5 human embryo lung fibroblasts in the presence of Cu(II). After treatment with chebulinic acid or tellimagrandin I alone, the pBR322 plasmid DNA and genomic DNA in MRC-5 cells kept intact. In addition, addition of Cu(I) reagent bathocuproinedisulfonic acid or catalase markedly inhibited the copper-dependent DNA strand breaks by both tannins. However, three typical hydroxyl radical scavengers, DMSO, ethanol and mannitol, did not inhibit the DNA strand breaks. Both tannins were able to reduce Cu(II) to Cu(I). These results indicated that chebulinic acid and tellimagrandin I induced the copper-dependent strand breaks of pBR322 plasmid DNA and MRC-5 genomic DNA with prooxidant action, in which Cu(II)/Cu(I) redox cycle and H(2)O(2) were involved and hydroxyl radical formation is important in the hypothetical mechanism by which DNA strand breaks are formed.

  7. Orientation dependent thermal conductance in single-layer MoS2.

    PubMed

    Jiang, Jin-Wu; Zhuang, Xiaoying; Rabczuk, Timon

    2013-01-01

    We investigate the thermal conductivity in the armchair and zigzag MoS2 nanoribbons, by combining the non-equilibrium Green's function approach and the first-principles method. A strong orientation dependence is observed in the thermal conductivity. Particularly, the thermal conductivity for the armchair MoS2 nanoribbon is about 673.6 Wm(-1) K(-1) in the armchair nanoribbon, and 841.1 Wm(-1) K(-1) in the zigzag nanoribbon at room temperature. By calculating the Caroli transmission, we disclose the underlying mechanism for this strong orientation dependence to be the fewer phonon transport channels in the armchair MoS2 nanoribbon in the frequency range of [150, 200] cm(-1). Through the scaling of the phonon dispersion, we further illustrate that the thermal conductivity calculated for the MoS2 nanoribbon is esentially in consistent with the superior thermal conductivity found for graphene.

  8. Orientation Dependent Thermal Conductance in Single-Layer MoS2

    NASA Astrophysics Data System (ADS)

    Jiang, Jin-Wu; Zhuang, Xiaoying; Rabczuk, Timon

    2013-07-01

    We investigate the thermal conductivity in the armchair and zigzag MoS2 nanoribbons, by combining the non-equilibrium Green's function approach and the first-principles method. A strong orientation dependence is observed in the thermal conductivity. Particularly, the thermal conductivity for the armchair MoS2 nanoribbon is about 673.6 Wm-1 K-1 in the armchair nanoribbon, and 841.1 Wm-1 K-1 in the zigzag nanoribbon at room temperature. By calculating the Caroli transmission, we disclose the underlying mechanism for this strong orientation dependence to be the fewer phonon transport channels in the armchair MoS2 nanoribbon in the frequency range of [150, 200] cm-1. Through the scaling of the phonon dispersion, we further illustrate that the thermal conductivity calculated for the MoS2 nanoribbon is esentially in consistent with the superior thermal conductivity found for graphene.

  9. Atomistic Simulation of the Size and Orientation Dependences of Thermal Conductivity in GaN Nanowires

    SciTech Connect

    Wang, Zhiguo; Zu, Xiaotao; Gao, Fei; Weber, William J.; Crocombette, J.-P.

    2007-04-16

    The thermal conductivity of GaN nanowires has been determined computationally, by applying nonequilibrium atomistic simulation methods using the Stillinger-Weber [Phys. Rev. B 31, 5262 (1985)] potentials. The simulation results show that the thermal conductivity of the GaN nanowires is smaller than that of a bulk crystal and increases with increasing diameter. Surface scattering of phonons and the high surface to volume ratios of the nanowires are primarily responsible for the reduced thermal conductivity and its size dependence behavior. The thermal conductivity is also found to decrease with increasing temperature, which is due to phonon-phonon interactions at high temperatures. The thermal conductivity also exhibits a dependence on axial orientation of the nanowires.

  10. On the channel width-dependence of the thermal conductivity in ultra-narrow graphene nanoribbons

    SciTech Connect

    Karamitaheri, Hossein; Neophytou, Neophytos

    2016-08-08

    The thermal conductivity of low-dimensional materials and graphene nanoribbons, in particular, is limited by the strength of line-edge-roughness scattering. One way to characterize the roughness strength is the dependency of the thermal conductivity on the channel's width in the form W{sup β}. Although in the case of electronic transport, this dependency is very well studied, resulting in W{sup 6} for nanowires and quantum wells and W{sup 4} for nanoribbons, in the case of phonon transport it is not yet clear what this dependence is. In this work, using lattice dynamics and Non-Equilibrium Green's Function simulations, we examine the width dependence of the thermal conductivity of ultra-narrow graphene nanoribbons under the influence of line edge-roughness. We show that the exponent β is in fact not a single well-defined number, but it is different for different parts of the phonon spectrum depending on whether phonon transport is ballistic, diffusive, or localized. The exponent β takes values β < 1 for semi-ballistic phonon transport, values β ≫ 1 for sub-diffusive or localized phonons, and β = 1 only in the case where the transport is diffusive. The overall W{sup β} dependence of the thermal conductivity is determined by the width-dependence of the dominant phonon modes (usually the acoustic ones). We show that due to the long phonon mean-free-paths, the width-dependence of thermal conductivity becomes a channel length dependent property, because the channel length determines whether transport is ballistic, diffusive, or localized.

  11. Sequence-dependent folding of DNA three-way junctions

    PubMed Central

    Assenberg, René; Weston, Anthony; Cardy, Don L. N.; Fox, Keith R.

    2002-01-01

    Three-way DNA junctions can adopt several different conformers, which differ in the coaxial stacking of the arms. These structural variants are often dominated by one conformer, which is determined by the DNA sequence. In this study we have compared several three-way DNA junctions in order to assess how the arrangement of bases around the branch point affects the conformer distribution. The results show that rearranging the different arms, while retaining their base sequences, can affect the conformer distribution. In some instances this generates a structure that appears to contain parallel coaxially stacked helices rather than the usual anti-parallel arrangement. Although the conformer equilibrium can be affected by the order of purines and pyrimidines around the branch point, this is not sufficient to predict the conformer distribution. We find that the folding of three-way junctions can be separated into two groups of dinucleotide steps. These two groups show distinctive stacking properties in B-DNA, suggesting there is a correlation between B-DNA stacking and coaxial stacking in DNA junctions. PMID:12466538

  12. Coincident In Vitro Analysis of DNA-PK-Dependent and -Independent Nonhomologous End Joining

    PubMed Central

    Hendrickson, Cynthia L.; Purkayastha, Shubhadeep; Pastwa, Elzbieta; Neumann, Ronald D.; Winters, Thomas A.

    2010-01-01

    In mammalian cells, DNA double-strand breaks (DSBs) are primarily repaired by nonhomologous end joining (NHEJ). The current model suggests that the Ku 70/80 heterodimer binds to DSB ends and recruits DNA-PKcs to form the active DNA-dependent protein kinase, DNA-PK. Subsequently, XRCC4, DNA ligase IV, XLF and most likely, other unidentified components participate in the final DSB ligation step. Therefore, DNA-PK plays a key role in NHEJ due to its structural and regulatory functions that mediate DSB end joining. However, recent studies show that additional DNA-PK-independent NHEJ pathways also exist. Unfortunately, the presence of DNA-PKcs appears to inhibit DNA-PK-independent NHEJ, and in vitro analysis of DNA-PK-independent NHEJ in the presence of the DNA-PKcs protein remains problematic. We have developed an in vitro assay that is preferentially active for DNA-PK-independent DSB repair based solely on its reaction conditions, facilitating coincident differential biochemical analysis of the two pathways. The results indicate the biochemically distinct nature of the end-joining mechanisms represented by the DNA-PK-dependent and -independent NHEJ assays as well as functional differences between the two pathways. PMID:20706599

  13. Evidence that recBC-dependent degradation of duplex DNA in Escherichia coli recD mutants involves DNA unwinding.

    PubMed Central

    Rinken, R; Thomas, B; Wackernagel, W

    1992-01-01

    Infection of Escherichia coli with phage T4 gene 2am was used to transport 3H-labeled linear duplex DNA into cells to follow its degradation in relation to the cellular genotype. In wild-type cells, 49% of the DNA was made acid soluble within 60 min; in recB or recC cells, only about 5% of the DNA was made acid soluble. Remarkably, in recD cells about 25% of the DNA was rendered acid soluble. The DNA degradation in recD cells depended on intact recB and recC genes. The degradation in recD cells was largely decreased by mutations in recJ (which eliminates the 5' single-strand-specific exonuclease coded by this gene) or xonA (which abolishes the 3' single-strand-specific exonuclease I). In a recD recJ xonA triple mutant, the degradation of linear duplex DNA was roughly at the level of a recB mutant. Results similar to those with the set of recD strains were also obtained with a recC++ mutant (in which the RecD protein is intact but does not function) and its recJ, xonA, and recJ xonA derivatives. The observations provide evidence for a recBC-dependent DNA-unwinding activity that renders unwound DNA susceptible to exonucleolytic degradation. It is proposed that the DNA-unwinding activity causes the efficient recombination, DNA repair, and SOS induction (after application of nalidixic acid) in recD mutants. The RecBC helicase indirectly detected here may have a central function in Chi-dependent recombination and in the recombinational repair of double-strand breaks by the RecBCD pathway. PMID:1322885

  14. Measurement of DNA-Dependent Protein Kinase Phosphorylation Using Flow Cytometry Provides a Reliable Estimate of DNA Repair Capacity.

    PubMed

    Abramenkovs, Andris; Stenerlöw, Bo

    2017-09-27

    Uncontrolled generation of DNA double-strand breaks (DSBs) in cells is regarded as a highly toxic event that threatens cell survival. Radiation-induced DNA DSBs are commonly measured by pulsed-field gel electrophoresis, microscopic evaluation of accumulating DNA damage response proteins (e.g., 53BP1 or γ-H2AX) or flow cytometric analysis of γ-H2AX. The advantage of flow cytometric analysis is that DSB formation and repair can be studied in relationship to cell cycle phase or expression of other proteins. However, γ-H2AX is not able to monitor repair kinetics within the first 60 min postirradiation, a period when most DSBs undergo repair. A key protein in non-homologous end joining repair is the catalytic subunit of DNA-dependent protein kinase. Among several phosphorylation sites of DNA-dependent protein kinase, the threonine at position 2609 (T2609), which is phosphorylated by ataxia telangiectasia mutated (ATM) or DNA-dependent protein kinase catalytic subunit itself, activates the end processing of DSB. Using flow cytometry, we show here that phosphorylation at T2609 is faster in response to DSBs than γ-H2AX. Furthermore, flow cytometric analysis of T2609 resulted in a better representation of fast repair kinetics than analysis of γ-H2AX. In cells with reduced ligase IV activity, and wild-type cells where DNA-dependent protein kinase activity was inhibited, the reduced DSB repair capacity was observed by T2609 evaluation using flow cytometry. In conclusion, flow cytometric evaluation of DNA-dependent protein kinase T2609 can be used as a marker for early DSB repair and gives a better representation of early repair events than analysis of γ-H2AX.

  15. First-principles study of high-conductance DNA sequencing with carbon nanotube electrodes

    NASA Astrophysics Data System (ADS)

    Chen, X.; Rungger, I.; Pemmaraju, C. D.; Schwingenschlögl, U.; Sanvito, S.

    2012-03-01

    Rapid and cost-effective DNA sequencing at the single nucleotide level might be achieved by measuring a transverse electronic current as single-stranded DNA is pulled through a nanometer-sized pore. In order to enhance the electronic coupling between the nucleotides and the electrodes and hence the current signals, we employ a pair of single-walled close-ended (6,6) carbon nanotubes (CNTs) as electrodes. We then investigate the electron transport properties of nucleotides sandwiched between such electrodes by using first-principles quantum transport theory. In particular, we consider the extreme case where the separation between the electrodes is the smallest possible that still allows the DNA translocation. The benzene-like ring at the end cap of the CNT can strongly couple with the nucleobases and therefore it can both reduce conformational fluctuations and significantly improve the conductance. As such, when the electrodes are closely spaced, the nucleobases can pass through only with their base plane parallel to the plane of CNT end caps. The optimal molecular configurations, at which the nucleotides strongly couple to the CNTs, and which yield the largest transmission, are first identified. These correspond approximately to the lowest energy configurations. Then the electronic structures and the electron transport of these optimal configurations are analyzed. The typical tunneling currents are of the order of 50 nA for voltages up to 1 V. At higher bias, where resonant transport through the molecular states is possible, the current is of the order of several μA. Below 1 V, the currents associated to the different nucleotides are consistently distinguishable, with adenine having the largest current, guanine the second largest, cytosine the third and, finally, thymine the smallest. We further calculate the transmission coefficient profiles as the nucleotides are dragged along the DNA translocation path and investigate the effects of configurational variations

  16. Reversibility, dopant desorption, and tunneling in the temperature-dependent conductivity of type-separated, conductive carbon nanotube networks.

    PubMed

    Barnes, Teresa M; Blackburn, Jeffrey L; van de Lagemaat, Jao; Coutts, Timothy J; Heben, Michael J

    2008-09-23

    We present a comprehensive study of the effects of doping and temperature on the conductivity of single-walled carbon nanotube (SWNT) networks. We investigated nearly type-pure networks as well as networks comprising precisely tuned mixtures of metallic and semiconducting tubes. Networks were studied in their as-produced state and after treatments with nitric acid, thionyl chloride, and hydrazine to explore the effects of both intentional and adventitious doping. For intentionally and adventitiously doped networks, the sheet resistance (R(s)) exhibits an irreversible increase with temperature above approximately 350 K. Dopant desorption is shown to be the main cause of this increase and the observed hysteresis in the temperature-dependent resistivity. Both thermal and chemical dedoping produced networks free of hysteresis. Temperature-programmed desorption data showed that dopants are most strongly bound to the metallic tubes and that networks consisting of metallic tubes exhibit the best thermal stability. At temperatures below the dopant desorption threshold, conductivity in the networks is primarily controlled by thermally assisted tunneling through barriers at the intertube or interbundle junctions.

  17. Reversibility, Dopant Desorption, and Tunneling in the Temperature-Dependent Conductivity of Type-Separated, Conductive Carbon Nanotube Networks

    SciTech Connect

    Barnes, T. M.; Blackburn, J. L.; van de Lagemaat, J.; Coutts, T. J.; Heben, M. J.

    2008-09-01

    We present a comprehensive study of the effects of doping and temperature on the conductivity of single-walled carbon nanotube (SWNT) networks. We investigated nearly type-pure networks as well as networks comprising precisely tuned mixtures of metallic and semiconducting tubes. Networks were studied in their as-produced state and after treatments with nitric acid, thionyl chloride, and hydrazine to explore the effects of both intentional and adventitious doping. For intentionally and adventitiously doped networks, the sheet resistance (R{sub s}) exhibits an irreversible increase with temperature above {approx}350 K. Dopant desorption is shown to be the main cause of this increase and the observed hysteresis in the temperature-dependent resistivity. Both thermal and chemical dedoping produced networks free of hysteresis. Temperature-programmed desorption data showed that dopants are most strongly bound to the metallic tubes and that networks consisting of metallic tubes exhibit the best thermal stability. At temperatures below the dopant desorption threshold, conductivity in the networks is primarily controlled by thermally assisted tunneling through barriers at the intertube or interbundle junctions.

  18. Resistance of Adenoviral DNA Replication to Aphidicolin Is Dependent on the 72-Kilodalton DNA-Binding Protein

    PubMed Central

    Foster, David A.; Hantzopoulos, Petros; Zubay, Geoffrey

    1982-01-01

    Aphidicolin is a highly specific inhibitor of DNA polymerase α and has been most useful for assessing the role of this enzyme in various replication processes (J. A. Huberman, Cell 23:647-648, 1981). Both nuclear DNA replication and simian virus 40 DNA replication are highly sensitive to this drug (Krokan et al., Biochemistry 18:4431-4443, 1979), whereas mitochondrial DNA synthesis is completely insensitive (Zimmerman et al., J. Biol. Chem. 255:11847-11852, 1980). Adenovirus DNA replication is sensitive to aphidicolin, but only at much higher concentrations. These patterns of sensitivity are seen both in vivo and in vitro (Krokan et al., Biochemistry 18:4431-4443, 1979). A temperature-sensitive mutant of adenovirus type 5 known as H5ts125 is able to complete but not initiate new rounds of replication at nonpermissive temperatures (P. C. van der Vliet and J. S. Sussenbach, Virology 67:415-426, 1975). When cells infected with H5ts125 were shifted from permissive (33°C) to nonpermissive (41°C) conditions, the residual DNA synthesis (elongation) showed a striking increase in sensitivity to aphidicolin. The temperature-sensitive mutation of H5ts125 is in the gene for the 72-kilodalton single-stranded DNA-binding protein. This demonstrated that the increased resistance to aphidicolin shown by adenovirus DNA replication was dependent on that protein. It also supports an elongation role for both DNA polymerase α and the 72-kilodalton single-stranded DNA-binding protein in adenovirus DNA replication. Further support for an elongation role of DNA polymerase α came from experiments with permissive temperature conditions and inhibiting levels of aphidicolin in which it was shown that newly initiated strands failed to elongate to completion. Images PMID:6809958

  19. Manipulating the temperature dependence of the thermal conductivity of graphene phononic crystal

    NASA Astrophysics Data System (ADS)

    Hu, Shiqian; An, Meng; Yang, Nuo; Li, Baowen

    2016-07-01

    By using non-equilibrium molecular dynamics simulations, modulating the temperature dependence of thermal conductivity of graphene phononic crystals (GPnCs) is investigated. It is found that the temperature dependence of thermal conductivity of GPnCs follows ˜T -α behavior. The power exponents (α) can be efficiently tuned by changing the characteristic size of GPnCs. The phonon participation ratio spectra and dispersion relation reveal that the long-range phonon modes are more affected in GPnCs with larger holes (L 0). Our results suggest that constructing GPnCs is an effective method to manipulate the temperature dependence of thermal conductivity of graphene, which would be beneficial for developing GPnC-based thermal management and signal processing devices.

  20. Age dependency of base modification in rabbit liver DNA

    NASA Technical Reports Server (NTRS)

    Yamamoto, O.; Fuji, I.; Yoshida, T.; Cox, A. B.; Lett, J. T.

    1988-01-01

    Age-related modifications of DNA bases have been observed in the liver of the New Zealand white (NZW) rabbit (Oryctolagus cuniculus), a lagomorph with a median life span in captivity of 5-7 yr. The ages of the animals studied ranged from 6 wk to 9 yr. After the DNA had been extracted from the liver cell nuclei and hydrolyzed with acid, the bases were analyzed by column chromatography with Cellulofine gels (GC-15-m). Two peaks in the chromatogram, which eluted before the four DNA bases, contained modified bases. Those materials, which were obtained in relatively large amounts from old animals, were highly fluorescent, and were shown to be crosslinked base products by mass spectrometry. The yield of crosslinked products versus rabbit age (greater than 0.5 yr) can be fitted by an exponential function (correlation coefficient: 0.76 +/- 0.09).

  1. Age dependency of base modification in rabbit liver DNA

    NASA Technical Reports Server (NTRS)

    Yamamoto, O.; Fuji, I.; Yoshida, T.; Cox, A. B.; Lett, J. T.

    1988-01-01

    Age-related modifications of DNA bases have been observed in the liver of the New Zealand white (NZW) rabbit (Oryctolagus cuniculus), a lagomorph with a median life span in captivity of 5-7 yr. The ages of the animals studied ranged from 6 wk to 9 yr. After the DNA had been extracted from the liver cell nuclei and hydrolyzed with acid, the bases were analyzed by column chromatography with Cellulofine gels (GC-15-m). Two peaks in the chromatogram, which eluted before the four DNA bases, contained modified bases. Those materials, which were obtained in relatively large amounts from old animals, were highly fluorescent, and were shown to be crosslinked base products by mass spectrometry. The yield of crosslinked products versus rabbit age (greater than 0.5 yr) can be fitted by an exponential function (correlation coefficient: 0.76 +/- 0.09).

  2. Electronic density of states in sequence dependent DNA molecules

    NASA Astrophysics Data System (ADS)

    de Oliveira, B. P. W.; Albuquerque, E. L.; Vasconcelos, M. S.

    2006-09-01

    We report in this work a numerical study of the electronic density of states (DOS) in π-stacked arrays of DNA single-strand segments made up from the nucleotides guanine G, adenine A, cytosine C and thymine T, forming a Rudin-Shapiro (RS) as well as a Fibonacci (FB) polyGC quasiperiodic sequences. Both structures are constructed starting from a G nucleotide as seed and following their respective inflation rules. Our theoretical method uses Dyson's equation together with a transfer-matrix treatment, within an electronic tight-binding Hamiltonian model, suitable to describe the DNA segments modelled by the quasiperiodic chains. We compared the DOS spectra found for the quasiperiodic structure to those using a sequence of natural DNA, as part of the human chromosome Ch22, with a remarkable concordance, as far as the RS structure is concerned. The electronic spectrum shows several peaks, corresponding to localized states, as well as a striking self-similar aspect.

  3. Structural basis for sequence-dependent DNA cleavage by nonspecific endonucleases

    PubMed Central

    Wang, Yi-Ting; Yang, Wei-Jen; Li, Chia-Lung; Doudeva, Lyudmila G.; Yuan, Hanna S.

    2007-01-01

    Nonspecific endonucleases hydrolyze DNA without sequence specificity but with sequence preference, however the structural basis for cleavage preference remains elusive. We show here that the nonspecific endonuclease ColE7 cleaves DNA with a preference for making nicks after (at 3′O-side) thymine bases but the periplasmic nuclease Vvn cleaves DNA more evenly with little sequence preference. The crystal structure of the ‘preferred complex’ of the nuclease domain of ColE7 bound to an 18 bp DNA with a thymine before the scissile phosphate had a more distorted DNA phosphate backbone than the backbones in the non-preferred complexes, so that the scissile phosphate was compositionally closer to the endonuclease active site resulting in more efficient DNA cleavage. On the other hand, in the crystal structure of Vvn in complex with a 16 bp DNA, the DNA phosphate backbone was similar and not distorted in comparison with that of a previously reported complex of Vvn with a different DNA sequence. Taken together these results suggest a general structural basis for the sequence-dependent DNA cleavage catalyzed by nonspecific endonucleases, indicating that nonspecific nucleases could induce DNA to deform to distinctive levels depending on the local sequence leading to different cleavage rates along the DNA chain. PMID:17175542

  4. Hydrogen Peroxide-Dependent DNA Release and Transfer of Antibiotic Resistance Genes in Streptococcus gordonii ▿

    PubMed Central

    Itzek, Andreas; Zheng, Lanyan; Chen, Zhiyun; Merritt, Justin; Kreth, Jens

    2011-01-01

    Certain oral streptococci produce H2O2 under aerobic growth conditions to inhibit competing species like Streptococcus mutans. Additionally, H2O2 production causes the release of extracellular DNA (eDNA). eDNA can participate in several important functions: biofilm formation and cell-cell aggregation are supported by eDNA, while eDNA can serve as a nutrient and as an antimicrobial agent by chelating essential cations. eDNA contains DNA fragments of a size that has the potential to transfer genomic information. By using Streptococcus gordonii as a model organism for streptococcal H2O2 production, H2O2-dependent eDNA release was further investigated. Under defined growth conditions, the eDNA release process was shown to be entirely dependent on H2O2. Chromosomal DNA damage seems to be the intrinsic signal for the release, although only actively growing cells were proficient eDNA donors. Interestingly, the process of eDNA production was found to be coupled with the induction of the S. gordonii natural competence system. Consequently, the production of H2O2 triggered the transfer of antibiotic resistance genes. These results suggest that H2O2 is potentially much more than a simple toxic metabolic by-product; rather, its production could serve as an important environmental signal that facilitates species evolution by transfer of genetic information and an increase in the mutation rate. PMID:21984796

  5. DNA kinks and bubbles: Temperature dependence of the elastic energy of sharply bent 10-nm-size DNA molecules

    NASA Astrophysics Data System (ADS)

    Sanchez, Daniel S.; Qu, Hao; Bulla, Delenda; Zocchi, Giovanni

    2013-02-01

    A 10-nm-long DNA molecule can bend through large angles reversibly. Past the linear regime, its equilibrium nonlinear bending elasticity is governed by a critical bending torque τc≈30pN×nm at which the molecule develops a kink. This nonlinearity has long been attributed to the nucleation of a bubble or melted region in the molecule. Here we measure the temperature dependence of the critical bending torque for nicked DNA, and determine that the entropy associated with the kink in the nonlinear regime is negligible. Thus in the case of nicked DNA the kink is not a bubble, but a compact region deformed beyond a yield strain. We further argue that, with our boundary conditions, the same is likely true for intact DNA. The present measurements confirm that the critical bending torque τc is a materials parameter of DNA mechanics analogous to the bending modulus B≈200pN×nm.

  6. E2F-7 couples DNA damage-dependent transcription with the DNA repair process.

    PubMed

    Zalmas, Lykourgos-Panagiotis; Coutts, Amanda S; Helleday, Thomas; La Thangue, Nicholas B

    2013-09-15

    The cellular response to DNA damage, mediated by the DNA repair process, is essential in maintaining the integrity and stability of the genome. E2F-7 is an atypical member of the E2F family with a role in negatively regulating transcription and cell cycle progression under DNA damage. Surprisingly, we found that E2F-7 makes a transcription-independent contribution to the DNA repair process, which involves E2F-7 locating to and binding damaged DNA. Further, E2F-7 recruits CtBP and HDAC to the damaged DNA, altering the local chromatin environment of the DNA lesion. Importantly, the E2F-7 gene is a target for somatic mutation in human cancer and tumor-derived mutant alleles encode proteins with compromised transcription and DNA repair properties. Our results establish that E2F-7 participates in 2 closely linked processes, allowing it to directly couple the expression of genes involved in the DNA damage response with the DNA repair machinery, which has relevance in human malignancy.

  7. Theoretical and Experimental Analysis of Moisture-Dependent Thermal Conductivity of Lightweight Ceramic Bricks

    NASA Astrophysics Data System (ADS)

    Pavlík, Zbyšek; Fiala, Lukáš; Jerman, Miloš; Vejmelková, Eva; Pavlíková, Milena; Keppert, Martin; Černý, Robert

    2014-10-01

    The moisture-dependent thermal conductivity of two types of lightweight ceramic brick body is analyzed using both theoretical and experimental approaches. The basic physical properties are determined at first. Then, an impulse method is applied for the thermal-conductivity measurement. Initially, the material samples are dried, after that, they are exposed to liquid water for specific time intervals, and finally the moisture content is allowed to homogenize within the whole volume. The thermal-conductivity measurement is performed for different moisture contents achieved in this way. In the theoretical part, the homogenization principles are used for the calculation of the moisture-dependent thermal conductivity, utilizing the distribution functions based on the pore-size distribution measurement. Finally, a comparison of the measured and calculated data is done, and the validity of the applied effective media treatment is assessed.

  8. Structural basis for DNA-dependent poly(ADP-ribosyl)ation by human PARP-1

    PubMed Central

    Langelier, Marie-France; Planck, Jamie L.; Roy, Swati; Pascal, John M.

    2012-01-01

    Poly(ADP-ribose) polymerase-1 (PARP-1) has a modular domain architecture that couples DNA damage detection to poly(ADP-ribosyl)ation activity through a poorly understood mechanism. Here we report the crystal structure of a DNA double-strand break in complex with human PARP-1 domains essential for activation (Zn1, Zn3, WGR-CAT). PARP-1 engages DNA as a monomer, and the interaction with DNA damage organizes PARP-1 domains into a collapsed conformation that can explain the strong preference for automodification. The Zn1, Zn3, and WGR domains collectively bind to DNA, forming a network of interdomain contacts that links the DNA damage interface to the catalytic domain (CAT). The DNA damage-induced conformation of PARP-1 results in structural distortions that destabilize the CAT. Our results suggest that an increase in CAT protein dynamics underlies the DNA-dependent activation mechanism of PARP-1. PMID:22582261

  9. Ionic mechanisms underlying history-dependence of conduction delay in an unmyelinated axon

    PubMed Central

    Zhang, Yang; Bucher, Dirk; Nadim, Farzan

    2017-01-01

    Axonal conduction velocity can change substantially during ongoing activity, thus modifying spike interval structures and, potentially, temporal coding. We used a biophysical model to unmask mechanisms underlying the history-dependence of conduction. The model replicates activity in the unmyelinated axon of the crustacean stomatogastric pyloric dilator neuron. At the timescale of a single burst, conduction delay has a non-monotonic relationship with instantaneous frequency, which depends on the gating rates of the fast voltage-gated Na+ current. At the slower timescale of minutes, the mean value and variability of conduction delay increase. These effects are because of hyperpolarization of the baseline membrane potential by the Na+/K+ pump, balanced by an h-current, both of which affect the gating of the Na+ current. We explore the mechanisms of history-dependence of conduction delay in axons and develop an empirical equation that accurately predicts this history-dependence, both in the model and in experimental measurements. DOI: http://dx.doi.org/10.7554/eLife.25382.001 PMID:28691900

  10. Spin-dependent electrical conduction in a pentacene Schottky diode explored by electrically detected magnetic resonance

    NASA Astrophysics Data System (ADS)

    Fukuda, Kunito; Asakawa, Naoki

    2017-02-01

    Reported is the observation of dark spin-dependent electrical conduction in a Schottky barrier diode with pentacene (PSBD) using electrically detected magnetic resonance at room temperature. It is suggested that spin-dependent conduction exists in pentacene thin films, which is explored by examining the anisotropic linewidth of the EDMR signal and current density-voltage (J-V) measurements. The EDMR spectrum can be decomposed to Gaussian and Lorentzian components. The dependency of the two signals on the applied voltage was consistent with the current density-voltage (J-V) of the PSBD rather than that of the electron-only device of Al/pentacene/Al, indicating that the spin-dependent conduction is due to bipolaron formation associated with hole polaronic hopping processes. The applied-voltage dependence of the ratio of intensity of the Gaussian line to the Lorentzian may infer that increasing current density should make conducting paths more dispersive, thereby resulting in an increased fraction of the Gaussian line due to the higher dispersive g-factor.

  11. Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA-dependent protein kinase activity

    SciTech Connect

    Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo . E-mail: sueokae@post.saga-med.ac.jp

    2005-08-05

    Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression.

  12. Anisotropic Electroless Deposition on DNA Origami Templates To Form Small Diameter Conductive Nanowires.

    PubMed

    Uprety, Bibek; Westover, Tyler; Stoddard, Michael; Brinkerhoff, Kamron; Jensen, John; Davis, Robert C; Woolley, Adam T; Harb, John N

    2017-01-24

    An improved method for the metallization of DNA origami is examined in this work. DNA origami, a simple and robust method for creating a wide variety of nanostructured shapes and patterns, provides an enabling template for bottom-up fabrication of next-generation nanodevices. Selective metallization of these DNA templates is needed to make nanoelectronic devices. Here, we demonstrate a metallization process that uses gold nanorod seeds followed by anisotropic plating to provide improved morphology and greater control of the final metallized width of the structure. In our approach, gold nanorods are attached to an origami template to create a seed layer. Electroless gold deposition is then used to fill the gaps between seeds in order to create continuous, conductive nanowires. Importantly, growth during electroless deposition occurs preferentially in the length direction at a rate that is approximately 4 times the growth rate in the width direction, which enables fabrication of narrow, continuous wires. The electrical properties of 49 nanowires with widths ranging from 13 to 29 nm were characterized, and resistivity values as low as 8.9 × 10(-7) Ω·m were measured. The anisotropic metallization process presented here represents important progress toward the creation of nanoelectronic devices by molecularly directed placement of functional components onto self-assembled biological templates.

  13. Enhanced field-dependent conductivity of magnetorheological gels with low-doped carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Qu, Hang; Yu, Miao; Fu, Jie; Yang, Pingan; Liu, Yuxuan

    2017-10-01

    Magnetorheological gels (MRG) exhibit field-dependent conductivity and controllable mechanical properties. In order to extend their application field, filling a large number of traditional conductive materials is the most common means to enhance the poor conductivity of MRG. In this study, the conductivity of MRG is improved by low-doped carbon nanotubes (CNTs). The influence of CNTs on the magnetoresistance of MRG is discussed from two aspects—the improvement in electrical conductivity and the magnetic sensitivity of conductivity variation. The percolation threshold of CNTs in MRG should be between 1 wt% and 2 wt%. The conductivity of a 4 wt% CNT-doped sample increases more than 28 000 times compared with pure MRG. However, there is a cliff-like drop for the range and rate of conductivity variation when the doping amount of CNTs is between 3 wt% and 4 wt%. Therefore, it is concluded that the optimal mass fraction of CNTs is 3%, which can maintain a suitable variation range and a strong conductivity. Compared with pure MRG, its conductivity increases by at least two orders of magnitude. Finally, a sketch of particle motion simulation is developed to understand the improving mechanism and the effect of CNTs.

  14. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair.

    PubMed

    Gustafsson, Ann-Sofie; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-01

    Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80-95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure which is uncoupled from its essential function in DSB repair. This could have implications for the development of therapeutic strategies aiming to radiosensitize tumors by affecting the DNA-PKcs function.

  15. Lead-position dependent regular oscillations and random fluctuations of conductance in graphene quantum dots.

    PubMed

    Huang, Liang; Yang, Rui; Lai, Ying-Cheng; Ferry, David K

    2013-02-27

    Quantum interference causes a wavefunction to have sensitive spatial dependence, and this has a significant effect on quantum transport. For example, in a quantum-dot system, the conductance can depend on the lead positions. We investigate, for graphene quantum dots, the conductance variations with the lead positions. Since for graphene the types of boundaries, e.g., zigzag and armchair, can fundamentally affect the quantum transport characteristics, we focus on rectangular graphene quantum dots, for which the effects of boundaries can be systematically studied. For both zigzag and armchair horizontal boundaries, we find that changing the positions of the leads can induce significant conductance variations. Depending on the Fermi energy, the variations can be either regular oscillations or random conductance fluctuations. We develop a physical theory to elucidate the origin of the conductance oscillation/fluctuation patterns. In particular, quantum interference leads to standing-wave-like-patterns in the quantum dot which, in the absence of leads, are regulated by the energy-band structure of the corresponding vertical graphene ribbon. The observed 'coexistence' of regular oscillations and random fluctuations in the conductance can be exploited for the development of graphene-based nanodevices.

  16. Temperature dependence of unbinding forces between complementary DNA strands.

    PubMed

    Schumakovitch, Irina; Grange, Wilfried; Strunz, Torsten; Bertoncini, Patricia; Güntherodt, Hans-Joachim; Hegner, Martin

    2002-01-01

    Force probe techniques such as atomic force microscopy can directly measure the force required to rupture single biological ligand receptor bonds. Such forces are related to the energy landscape of these weak, noncovalent biological interactions. We report unbinding force measurements between complementary strands of DNA as a function of temperature. Our measurements emphasize the entropic contributions to the energy landscape of the bond.

  17. Conditions for Using DNA Polymerase I as an RNA-Dependent DNA Polymerase

    PubMed Central

    Gulati, S. C.; Kacian, D. L.; Spiegelman, S.

    1974-01-01

    Conditions are described for using Escherichia coli DNA polymerase I for synthesizing complementary DNA copies of natural RNA molecules, which are suitable for use in hybridization experiments. The molar ratio of enzyme to template is critical; below a certain level, synthesis is not observed. Hybrids formed with the complementary DNA are of comparable specificity and stability to those formed with complementary DNAs synthesized by viral RNA-directed DNA polymerase. Synthesis of dA-dT polymers, a common occurrence with this enzyme, can be eliminated by including distamycin in the reaction mixture. PMID:4133845

  18. pH- and salt-dependent molecular combing of DNA: experiments and phenomenological model.

    PubMed

    Benke, Annegret; Mertig, Michael; Pompe, Wolfgang

    2011-01-21

    λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng µl(-1)) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.

  19. Structure of the adenylation domain of NAD(+)-dependent DNA ligase from Staphylococcus aureus.

    PubMed

    Han, Seungil; Chang, Jeanne S; Griffor, Matt

    2009-11-01

    DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3'-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD(+)-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD(+)-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD(+)-binding pocket and the 'C2 tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.

  20. Structure of the adenylation domain of NAD[superscript +]-dependent DNA ligase from Staphylococcus aureus

    SciTech Connect

    Han, Seungil; Chang, Jeanne S.; Griffor, Matt; Pfizer

    2010-09-17

    DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3''-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD{sup +}-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD{sup +}-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD{sup +}-binding pocket and the 'C2 tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.

  1. Genomic assay reveals tolerance of DNA damage by both translesion DNA synthesis and homology-dependent repair in mammalian cells.

    PubMed

    Izhar, Lior; Ziv, Omer; Cohen, Isadora S; Geacintov, Nicholas E; Livneh, Zvi

    2013-04-16

    DNA lesions can block replication forks and lead to the formation of single-stranded gaps. These replication complications are mitigated by DNA damage tolerance mechanisms, which prevent deleterious outcomes such as cell death, genomic instability, and carcinogenesis. The two main tolerance strategies are translesion DNA synthesis (TLS), in which low-fidelity DNA polymerases bypass the blocking lesion, and homology-dependent repair (HDR; postreplication repair), which is based on the homologous sister chromatid. Here we describe a unique high-resolution method for the simultaneous analysis of TLS and HDR across defined DNA lesions in mammalian genomes. The method is based on insertion of plasmids carrying defined site-specific DNA lesions into mammalian chromosomes, using phage integrase-mediated integration. Using this method we show that mammalian cells use HDR to tolerate DNA damage in their genome. Moreover, analysis of the tolerance of the UV light-induced 6-4 photoproduct, the tobacco smoke-induced benzo[a]pyrene-guanine adduct, and an artificial trimethylene insert shows that each of these three lesions is tolerated by both TLS and HDR. We also determined the specificity of nucleotide insertion opposite these lesions during TLS in human genomes. This unique method will be useful in elucidating the mechanism of DNA damage tolerance in mammalian chromosomes and their connection to pathological processes such as carcinogenesis.

  2. Temperature-dependent statistical behavior of single molecular conductance in aqueous solution.

    PubMed

    Cao, Hui; Jiang, Jun; Ma, Jing; Luo, Yi

    2008-05-28

    We have combined molecular dynamics simulations with first principles calculations to study electron transport in a single molecule of perylene tetracarboxylic diimide (PTCDI) sandwiched between two gold electrodes with an aqueous electrolyte. This combination has for the first time allowed one to reveal statistical behavior of molecular conductance in solution at different temperatures and to produce conductance histograms that can be directly compared with experiments. Our calculations show that experimentally observed temperature-dependent conductance can be attributed to the thermal effect on the hydrogen bonding network around the molecule and can be described by the radial distribution of water molecules surrounding the oxygen atom in the PTCDI molecule.

  3. Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

    NASA Astrophysics Data System (ADS)

    Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

    2009-05-01

    Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1μg) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288μA. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35μA) and for the noncomplementary oligonucleotide (5.77μA). The drop in current after each event was clearly noticeable and it proved to be effective.

  4. Mitochondrial DNA integrity is not dependent on DNA polymerase-beta activity.

    PubMed

    Hansen, Alexis B; Griner, Nicholas B; Anderson, Jon P; Kujoth, Greg C; Prolla, Tomas A; Loeb, Lawrence A; Glick, Eitan

    2006-01-05

    Mutations in mitochondrial DNA (mtDNA) are involved in a variety of pathologies, including cancer and neurodegenerative diseases, as well as in aging. mtDNA mutations result predominantly from damage by reactive oxygen species (ROS) that is not repaired prior to replication. Repair of ROS-damaged bases occurs mainly via base excision repair (BER) in mitochondria and nuclei. In nuclear BER, the two penultimate steps are carried out by DNA polymerase-beta (Polbeta), which exhibits both 5'-deoxyribose-5-phosphate (5'-dRP) lyase and DNA polymerase activities. In mitochondria, DNA polymerase-gamma (Polgamma) is believed to be the sole polymerase and is therefore assumed to function in mitochondrial BER. However, a recent report suggested the presence of Polbeta or a "Polbeta-like" enzyme in bovine mitochondria. Consequently, in the present work, we tested the hypothesis that Polbeta is present and functions in mammalian mitochondria. Initially we identified two DNA polymerase activities, one corresponding to Polgamma and the other to Polbeta, in mitochondrial preparations obtained by differential centrifugation and discontinuous sucrose density gradient centrifugation. However, upon further fractionation in linear Percoll gradients, we were able to separate Polbeta from mitochondria and to show that intact mitochondria, identified by electron microscopy, lacked Polbeta activity. In a functional test for the presence of Polbeta function in mitochondria, we used a new assay for detection of random (i.e., non-clonal) mutations in single mtDNA molecules. We did not detect enhanced mutation frequency in mtDNA from Polbeta null cells. In contrast, mtDNA from cells harboring mutations in the Polgamma exonuclease domain that abolish proofreading displayed a >or=17-fold increase in mutation frequency. We conclude that Polbeta is not an essential component of the machinery that maintains mtDNA integrity.

  5. Reduced temperature-dependent thermal conductivity of magnetite thin films by controlling film thickness

    NASA Astrophysics Data System (ADS)

    Park, No-Won; Lee, Won-Yong; Kim, Jin-A.; Song, Kyungjun; Lim, Hyuneui; Kim, Wan-Doo; Yoon, Soon-Gil; Lee, Sang-Kwon

    2014-02-01

    We report on the out-of-plane thermal conductivities of epitaxial Fe3O4 thin films with thicknesses of 100, 300, and 400 nm, prepared using pulsed laser deposition (PLD) on SiO2/Si substrates. The four-point probe three-omega (3- ω) method was used for thermal conductivity measurements of the Fe3O4 thin films in the temperature range of 20 to 300 K. By measuring the temperature-dependent thermal characteristics of the Fe3O4 thin films, we realized that their thermal conductivities significantly decreased with decreasing grain size and thickness of the films. The out-of-plane thermal conductivities of the Fe3O4 films were found to be in the range of 0.52 to 3.51 W/m · K at 300 K. For 100-nm film, we found that the thermal conductivity was as low as approximately 0.52 W/m · K, which was 1.7 to 11.5 order of magnitude lower than the thermal conductivity of bulk material at 300 K. Furthermore, we calculated the temperature dependence of the thermal conductivity of these Fe3O4 films using a simple theoretical Callaway model for comparison with the experimental data. We found that the Callaway model predictions agree reasonably with the experimental data. We then noticed that the thin film-based oxide materials could be efficient thermoelectric materials to achieve high performance in thermoelectric devices.

  6. Irradiance dependence of the conduction block of an in vitro cardiomyocyte wire.

    PubMed

    Ogawa, Emiyu; Kurotsu, Mariko; Arai, Tsunenori

    2017-09-01

    To obtain therapeutic condition precisely by in vitro experiment, we studied the irradiance dependence of the electrical conduction blockage caused by a photodynamic reaction using a high extracellular concentration of talaporfin sodium on a novel in vitro cardiomyocyte electrical conduction wire. The cardiomyocyte wires were constructed on patterned cultivation cover glass, which had cultivation areas 60μm in width, and a maximum length of 10mm. The talaporfin sodium concentration was set to 20μg/mL. The photodynamic reaction with a high extracellular photosensitizer concentration was performed with a short time interval (approximately 15min) between photosensitizer exposure and irradiation. A 663-nm laser was applied to the cardiomyocyte wire, and the irradiance was varied between 3 and 120mW/cm(2). The cardiomyocyte electrical conduction was evaluated using the cross-correlation function of intracellular Ca(2+) probe fluorescence brightness from an upper and lower section outside the laser irradiation area of a wire every 10s, which lasted up to 600s. The onset of electrical conduction blockage was defined by an 85% decrease in the cross-correlation function, compared with its initial value. The time for the electrical conduction blockage decreased from 600 to 300s as the irradiance was increased. Also, the probability of electrical conduction blockage was found to increase with increasing irradiance. We found a strong dependence on the irradiance for the time and probability of electrical conduction blockage. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Crystal structure dependent thermal conductivity in two-dimensional phononic crystal nanostructures

    NASA Astrophysics Data System (ADS)

    Nakagawa, Junki; Kage, Yuta; Hori, Takuma; Shiomi, Junichiro; Nomura, Masahiro

    2015-07-01

    Thermal phonon transport in square- and triangular-lattice Si phononic crystal (PnC) nanostructures with a period of 300 nm was investigated by measuring the thermal conductivity using micrometer-scale time-domain thermoreflectance. The placement of circular nanoholes has a strong influence on thermal conductivity when the periodicity is within the range of the thermal phonon mean free path. A staggered hole structure, i.e., a triangular lattice, has lower thermal conductivity, where the difference in thermal conductivity depends on the porosity of the structure. The largest difference in conductivity of approximately 20% was observed at a porosity of around 30%. This crystal structure dependent thermal conductivity can be understood by considering the local heat flux disorder created by a staggered hole structure. Numerical simulation using the Monte Carlo technique was also employed and also showed the lower thermal conductivity for a triangular lattice structure. Besides gaining a deeper understanding of nanoscale thermal phonon transport, this information would be useful in the design of highly efficient thermoelectric materials created by nanopatterning.

  8. The basal proton conductance of mitochondria depends on adenine nucleotide translocase content

    PubMed Central

    2005-01-01

    The basal proton conductance of mitochondria causes mild uncoupling and may be an important contributor to metabolic rate. The molecular nature of the proton-conductance pathway is unknown. We show that the proton conductance of muscle mitochondria from mice in which isoform 1 of the adenine nucleotide translocase has been ablated is half that of wild-type controls. Overexpression of the adenine nucleotide translocase encoded by the stress-sensitive B gene in Drosophila mitochondria increases proton conductance, and underexpression decreases it, even when the carrier is fully inhibited using carboxyatractylate. We conclude that half to two-thirds of the basal proton conductance of mitochondria is catalysed by the adenine nucleotide carrier, independently of its ATP/ADP exchange or fatty-acid-dependent proton-leak functions. PMID:16076285

  9. Structural-dependent thermal conductivity of aluminium nitride produced by reactive direct current magnetron sputtering

    SciTech Connect

    Belkerk, B. E.; Soussou, A.; Carette, M.; Djouadi, M. A.; Scudeller, Y.

    2012-10-08

    This Letter reports the thermal conductivity of aluminium nitride (AlN) thin-films deposited by reactive DC magnetron sputtering on single-crystal silicon substrates (100) with varying plasma and magnetic conditions achieving different crystalline qualities. The thermal conductivity of the films was measured at room temperature with the transient hot-strip technique for film thicknesses ranging from 100 nm to 4000 nm. The thermal conductivity was found to increase with the thickness depending on the synthesis conditions and film microstructure. The conductivity in the bulk region of the films, so-called intrinsic conductivity, and the boundary resistance were in the range [120-210] W m{sup -1} K{sup -1} and [2-30 Multiplication-Sign 10{sup -9}] K m{sup 2} W{sup -1}, respectively, in good agreement with microstructures analysed by x-ray diffraction, high-resolution-scanning-electron-microscopy, and transmission-electron-microscopy.

  10. GADD45α inhibition of DNMT1 dependent DNA methylation during homology directed DNA repair

    PubMed Central

    Lee, Bongyong; Morano, Annalisa; Porcellini, Antonio; Muller, Mark T.

    2012-01-01

    In this work, we examine regulation of DNA methyltransferase 1 (DNMT1) by the DNA damage inducible protein, GADD45α. We used a system to induce homologous recombination (HR) at a unique double-strand DNA break in a GFP reporter in mammalian cells. After HR, the repaired DNA is hypermethylated in recombinant clones showing low GFP expression (HR-L expressor class), while in high expressor recombinants (HR-H clones) previous methylation patterns are erased. GADD45α, which is transiently induced by double-strand breaks, binds to chromatin undergoing HR repair. Ectopic overexpression of GADD45α during repair increases the HR-H fraction of cells (hypomethylated repaired DNA), without altering the recombination frequency. Conversely, silencing of GADD45α increases methylation of the recombined segment and amplifies the HR-L expressor (hypermethylated) population. GADD45α specifically interacts with the catalytic site of DNMT1 and inhibits methylation activity in vitro. We propose that double-strand DNA damage and the resulting HR process involves precise, strand selected DNA methylation by DNMT1 that is regulated by GADD45α. Since GADD45α binds with high avidity to hemimethylated DNA intermediates, it may also provide a barrier to spreading of methylation during or after HR repair. PMID:22135303

  11. Dendritic star polymers for efficient DNA binding and stimulus-dependent DNA release.

    PubMed

    Yin, Meizhen; Ding, Ke; Gropeanu, Radu A; Shen, Jie; Berger, Rüdiger; Weil, Tanja; Müllen, Klaus

    2008-11-01

    Water-soluble core-shell star polymers consisting of a dendritic polyphenylene core and an outer shell containing a defined number of amino groups have been synthesized via atom transfer radical polymerization (ATRP). All macromolecules efficiently interacted with a diverse set of DNA fragments, and stable complexes were formed and visualized by atomic force microscopy. The observed tight binding of DNA, which was found in the sub-nanomolar range, was mainly attributed to strong electrostatic interactions. Complex stoichiometries between the polyelectrolytes were controlled via the number of amino groups of the star polymers, and well-defined nanoscopic architectures were formed. DNA was released from the complexes after treatment with high concentrations of sodium chloride in aqueous solution. Such star polymers, which allow the binding and release of DNA, represent attractive candidates for the development of novel anion-exchange resins for DNA purification or as nonviral vector systems for gene delivery.

  12. Temperature dependence of unbinding forces between complementary DNA strands.

    PubMed Central

    Schumakovitch, Irina; Grange, Wilfried; Strunz, Torsten; Bertoncini, Patricia; Güntherodt, Hans-Joachim; Hegner, Martin

    2002-01-01

    Force probe techniques such as atomic force microscopy can directly measure the force required to rupture single biological ligand receptor bonds. Such forces are related to the energy landscape of these weak, noncovalent biological interactions. We report unbinding force measurements between complementary strands of DNA as a function of temperature. Our measurements emphasize the entropic contributions to the energy landscape of the bond. PMID:11751338

  13. Diffusion of isolated DNA molecules: dependence on length and topology.

    PubMed

    Robertson, Rae M; Laib, Stephan; Smith, Douglas E

    2006-05-09

    The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

  14. Time dependent variation of human blood conductivity as a method for an estimation of RBC aggregation.

    PubMed

    Antonova, Nadia; Riha, Pavel; Ivanov, Ivan

    2008-01-01

    Time variation of whole human blood conductivity and shear stresses were investigated at rectangular and trapezium-shaped Couette viscometric flow under electric field of 2 kHz. The kinetics of conductivity signals were recorded both under transient flow and after the complete stoppage of shearing at shear rates from 0.94 to 94.5 s(-1) and temperatures T=25 degrees C and 37 degrees C. Contraves Low Shear 30 rotational viscometer as a base unit and a concurrent measuring system, including a device, developed by the conductometric method with a software for measurement of conductivity of biological fluids (data acquisition system), previously described (IFMBE Proceedings Series, Vol. 11, 2005, pp. 4247-4252; Clin. Hemorheol. Microcirc. 35(1/2) (2006), 19-29), were used for the experiments. The obtained experimental relationships show that the human blood conductivity is time, shear rate, hematocrit and temperature dependent under transient flow. It is also dependent on the regime of the applied shear rates. Non-linear curve approximation of the growth and relaxation curves is done. The results show that valuable information could be received about the kinetics of "rouleaux formation" and the time dependences of the blood conductivity follow the structural transformations of RBC aggregates during the aggregation-disaggregation processes. The results suggest that this technique may be used to clarify the mechanism of dynamics of RBC aggregates.

  15. Film-thickness-dependent conduction in ordered Si quantum dot arrays.

    PubMed

    Surana, K; Lepage, H; Lebrun, J M; Doisneau, B; Bellet, D; Vandroux, L; Le Carval, G; Baudrit, M; Thony, P; Mur, P

    2012-03-16

    In recent years, silicon nanostructures have been investigated extensively for their potential use in photonic and photovoltaic applications. So far, for silicon quantum dots embedded in SiO(2), control over inter-dot distance and size has only been observed in multiple bilayer stacks of silicon-rich oxides and silicon dioxide. In this work, for the first time the fabrication of spatially well-ordered Si quantum dots (QDs) in SiO(2) is demonstrated, without using the multilayer approach. This ordered formation, confirmed with TEM micrographs, depends on the thickness of the initially deposited sub-stoichiometric silicon oxide film. Grazing incidence x-ray diffraction confirms the crystallinity of the 5 nm QDs while photoluminescence shows augmented bandgap values. Low-temperature current-voltage measurements demonstrate film thickness and order-dependent conduction mechanisms, showing the transition from temperature-dependent conduction in randomly placed dots to temperature-independent tunnelling for geometrically ordered nanocrystals. Contrary to expectations from dielectric materials, significant conduction and photocarrier generation have been observed in our Si QDs embedded in SiO(2) demonstrating the possibility of forming initial film-thickness-controlled conductive films. This conduction via the silicon quantum dots in thick single layers is a promising result for integration into photovoltaic devices.

  16. Film-thickness-dependent conduction in ordered Si quantum dot arrays

    NASA Astrophysics Data System (ADS)

    Surana, K.; Lepage, H.; Lebrun, J. M.; Doisneau, B.; Bellet, D.; Vandroux, L.; Le Carval, G.; Baudrit, M.; Thony, P.; Mur, P.

    2012-03-01

    In recent years, silicon nanostructures have been investigated extensively for their potential use in photonic and photovoltaic applications. So far, for silicon quantum dots embedded in SiO2, control over inter-dot distance and size has only been observed in multiple bilayer stacks of silicon-rich oxides and silicon dioxide. In this work, for the first time the fabrication of spatially well-ordered Si quantum dots (QDs) in SiO2 is demonstrated, without using the multilayer approach. This ordered formation, confirmed with TEM micrographs, depends on the thickness of the initially deposited sub-stoichiometric silicon oxide film. Grazing incidence x-ray diffraction confirms the crystallinity of the 5 nm QDs while photoluminescence shows augmented bandgap values. Low-temperature current-voltage measurements demonstrate film thickness and order-dependent conduction mechanisms, showing the transition from temperature-dependent conduction in randomly placed dots to temperature-independent tunnelling for geometrically ordered nanocrystals. Contrary to expectations from dielectric materials, significant conduction and photocarrier generation have been observed in our Si QDs embedded in SiO2 demonstrating the possibility of forming initial film-thickness-controlled conductive films. This conduction via the silicon quantum dots in thick single layers is a promising result for integration into photovoltaic devices.

  17. [KCl] Dependence of B-DNA Groove Bending Anisotropy.

    PubMed

    Ma, Ning; van der Vaart, Arjan

    2017-06-01

    The energetics of B-DNA bending toward the major and minor grooves were quantified by free energy simulations at four different KCl concentrations. Increased [KCl] led to more flexible DNA, with persistence lengths that agreed well with experimental values. At all salt concentrations, major groove bending was preferred, although preferences for major and minor groove bending were similar for the A-tract containing sequence. Since the phosphate repulsions and DNA internal energy favored minor groove bending, the preference for major groove bending was thought to originate from differences in solvation. Water in the minor groove was tighter bound than water in the major groove, and harder to displace than major groove water, which favored the compression of the major groove upon bending. Higher [KCl] decreased the persistence length for both major and minor groove bending but did not greatly affect the free energy spacing between the minor and major groove bending curves. For sequences without A-tracts, salt affected major and minor bending to nearly the same degree, and did not change the preference for major groove bending. For the A-tract containing sequence, an increase in salt concentration decreased the already small energetic difference between major and minor groove bending. Since salts did not significantly affect the relative differences in bending energetics and hydration, it is likely that the increased bending flexibilities upon salt increase are simply due to screening.

  18. ATM Dependent Silencing Links Nucleolar Chromatin Reorganization to DNA Damage Recognition.

    PubMed

    Harding, Shane M; Boiarsky, Jonathan A; Greenberg, Roger A

    2015-10-13

    Resolution of DNA double-strand breaks (DSBs) is essential for the suppression of genome instability. DSB repair in transcriptionally active genomic regions represents a unique challenge that is associated with ataxia telangiectasia mutated (ATM) kinase-mediated transcriptional silencing. Despite emerging insights into the underlying mechanisms, how DSB silencing connects to DNA repair remains undefined. We observe that silencing within the rDNA depends on persistent DSBs. Non-homologous end-joining was the predominant mode of DSB repair allowing transcription to resume. ATM-dependent rDNA silencing in the presence of persistent DSBs led to the large-scale reorganization of nucleolar architecture, with movement of damaged chromatin to nucleolar cap regions. These findings identify ATM-dependent temporal and spatial control of DNA repair and provide insights into how communication between DSB signaling and ongoing transcription promotes genome integrity.

  19. RCC1-dependent activation of Ran accelerates cell cycle and DNA repair, inhibiting DNA damage–induced cell senescence

    PubMed Central

    Cekan, Pavol; Hasegawa, Keisuke; Pan, Yu; Tubman, Emily; Odde, David; Chen, Jin-Qiu; Herrmann, Michelle A.; Kumar, Sheetal; Kalab, Petr

    2016-01-01

    The coordination of cell cycle progression with the repair of DNA damage supports the genomic integrity of dividing cells. The function of many factors involved in DNA damage response (DDR) and the cell cycle depends on their Ran GTPase–regulated nuclear–cytoplasmic transport (NCT). The loading of Ran with GTP, which is mediated by RCC1, the guanine nucleotide exchange factor for Ran, is critical for NCT activity. However, the role of RCC1 or Ran⋅GTP in promoting cell proliferation or DDR is not clear. We show that RCC1 overexpression in normal cells increased cellular Ran⋅GTP levels and accelerated the cell cycle and DNA damage repair. As a result, normal cells overexpressing RCC1 evaded DNA damage–induced cell cycle arrest and senescence, mimicking colorectal carcinoma cells with high endogenous RCC1 levels. The RCC1-induced inhibition of senescence required Ran and exportin 1 and involved the activation of importin β–dependent nuclear import of 53BP1, a large NCT cargo. Our results indicate that changes in the activity of the Ran⋅GTP–regulated NCT modulate the rate of the cell cycle and the efficiency of DNA repair. Through the essential role of RCC1 in regulation of cellular Ran⋅GTP levels and NCT, RCC1 expression enables the proliferation of cells that sustain DNA damage. PMID:26864624

  20. Effect of temperature-dependent electrical conductivity on transport processes in magnetosolidmechanics

    NASA Technical Reports Server (NTRS)

    Craig, G. T.; Arnas, O. A.

    1975-01-01

    The effect of temperature-dependent electrical conductivity on transport processes for a solid block is analyzed on the basis of a one-dimensional steady-state model under specified thermal boundary conditions. Assumptions are that the solid has an infinitely segmented electrode configuration, the magnetic field (By) may be resolved into a constant applied field and an induced field, the gradient of the electrochemical potential is equal to the electrostatic potential, a constant potential difference is applied externally across each pair of opposite electrodes, and all material properties except electrical conductivity are constant. Conductivity is expressed in normalized form in terms of a baseline conductivity and a constant for the material. The application of the assumptions of the model to the general phenomenological relations yields the governing equations. Solution of these equations gives the distribution of temperature, electric current density, and magnetic field strength along the length of the solid. It is shown that significant differences exist between the case for constant electrical conductivity and the case where electrical conductivity is temperature dependent.

  1. Concentration-dependent thermophoretic accumulation for the detection of DNA using DNA-functionalized nanoparticles.

    PubMed

    Yu, Li-Hsien; Chen, Yih-Fan

    2015-03-03

    Thermophoresis is a phenomenon about the migration of particles along a temperature gradient and is sensitive to the properties of particles and the surrounding medium. While a few studies have investigated its mechanisms and effects on particle motion in recent years, the applications of thermophoresis in biosensing has not been well explored. In this study, we demonstrate a thermophoresis-based method for detecting DNA. We use DNA-functionalized gold nanoparticles and fluorescent DNA probes to capture target DNA in free solution, and we demonstrate that the hybridization between the specially designed capture probes and the target DNA significantly changes the thermophoretic properties of the fluorescent probes. As a result, the target DNA can be specifically detected in serum-containing buffers based on the spatial distribution of the fluorescent probes in a laser-induced temperature gradient. The optical setup consists of only a laser and an epifluorescence microscope, and the detection does not rely on any micro- or nanofabricated devices. In addition, because the detection is based on the thermophoretic motion of molecules in free solution, no capture probes need to be immobilized on a fixed surface before detection, and no channels or pumps are needed for washing away unbound molecules. The thermophoresis-based biosensing method is found to be simple and effective for detecting DNA.

  2. Mitochondrial chaperone DnaJA3 induces Drp1-dependent mitochondrial fragmentation.

    PubMed

    Elwi, Adam N; Lee, Byoungchun; Meijndert, H Christopher; Braun, Janice E A; Kim, Sung-Woo

    2012-08-01

    Mitochondrial morphology is dynamic and controlled by coordinated fusion and fission pathways. The role of mitochondrial chaperones in mitochondrial morphological changes and pathology is currently unclear. Here we report that altered levels of DnaJA3 (Tid1/mtHsp40) a mitochondrial member of the DnaJ protein family, and heat shock protein (Hsp) co-chaperone of matrix 70 kDa Hsp70 (mtHsp70/mortalin/HSPA9), induces mitochondrial fragmentation. Suppression of DnaJA3 induced mitochondrial fragmentation in HeLa cells. Elevated levels of DnaJA3 in normal Hs68 fibroblast cells and HeLa, SKN-SH, U87 and U251 cancer cell lines induces mitochondrial fragmentation. Mitochondrial fragmentation induction was not observed in HeLa cells when other DnaJA family members, or mitochondrial DnaJ protein HSC20, were ectopically expressed, indicating that the effects on mitochondrial morphology were specific to DnaJA3. We show that the DnaJ domain (amino acids 88-168) of DnaJA3 is sufficient for the induction of mitochondrial fragmentation. Furthermore, an H121Q point mutation of the DnaJ domain, which abrogates interaction and activation of mtHsp70 ATPase, eliminates fragmentation induced by DnaJA3. This suggests that DnaJA3 interaction with mtHsp70 may be critical in mitochondrial morphological changes. DnaJA3-induced mitochondrial fragmentation was dependent on fission factor dynamin-related protein 1 (Drp1). Ectopic expression of the mitofusins (Mfn1 and Mfn2), however, does not rescue DnaJA3-induced mitochondrial fragmentation. Lastly, elevated levels of DnaJA3 inducing mitochondrial fragmentation were associated with reduction in cell viability. Taken together, elevated DnaJA3 induces Drp1-depedendent mitochondrial fragmentation and decreased cell viability.

  3. Structural Basis for p53 Lys120-Acetylation-Dependent DNA-Binding Mode.

    PubMed

    Vainer, Radion; Cohen, Sarit; Shahar, Anat; Zarivach, Raz; Arbely, Eyal

    2016-07-31

    Normal cellular homeostasis depends on tight regulation of gene expression, which requires the modulation of transcription factors' DNA-binding specificity. That said, the mechanisms that allow transcription factors to distinguish between closely related response elements following different cellular signals are not fully understood. In the tumor suppressor protein p53, acetylation of loop L1 residue Lys120 within the DNA-binding domain has been shown to promote the transcription of proapoptotic genes such as bax. Here, we report the crystal structures of Lys120-acetylated p53 DNA-binding domain in complex with a consensus response element and with the natural BAX response element. Our structural analyses reveal that Lys120 acetylation expands the conformational space of loop L1 in the DNA-bound state. Loop L1 flexibility is known to increase p53's DNA-binding specificity, and Lys120-acetylation-dependent conformational changes in loop L1 enable the formation of sequence-dependent DNA-binding modes for p53. Furthermore, binding to the natural BAX response element is accompanied by global conformational changes, deformation of the DNA helical structure, and formation of an asymmetric tetrameric complex. Based on these findings, we suggest a model for p53's Lys120 acetylation-dependent DNA-binding mode. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation.

    PubMed

    Boedicker, James Q; Garcia, Hernan G; Johnson, Stephanie; Phillips, Rob

    2013-12-01

    As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution.

  5. DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

    NASA Astrophysics Data System (ADS)

    Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

    2013-12-01

    As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution.

  6. Length Dependent Thermal Conductivity Measurements Yield Phonon Mean Free Path Spectra in Nanostructures

    PubMed Central

    Zhang, Hang; Hua, Chengyun; Ding, Ding; Minnich, Austin J.

    2015-01-01

    Thermal conductivity measurements over variable lengths on nanostructures such as nanowires provide important information about the mean free paths (MFPs) of the phonons responsible for heat conduction. However, nearly all of these measurements have been interpreted using an average MFP even though phonons in many crystals possess a broad MFP spectrum. Here, we present a reconstruction method to obtain MFP spectra of nanostructures from variable-length thermal conductivity measurements. Using this method, we investigate recently reported length-dependent thermal conductivity measurements on SiGe alloy nanowires and suspended graphene ribbons. We find that the recent measurements on graphene imply that 70% of the heat in graphene is carried by phonons with MFPs longer than 1 micron. PMID:25764977

  7. Magnetic field dependent electric conductivity of the magnetorheological fluids: the influence of oscillatory shear

    NASA Astrophysics Data System (ADS)

    Ruan, Xiaohui; Wang, Yu; Xuan, Shouhu; Gong, Xinglong

    2017-03-01

    In this work, the influence of oscillatory shear on the magnetic field dependent electric conductivity of the magnetorheological fluid (MRF) was reported. Upon applying a 0.96 T magnetic field, the electric conductivity could increase about 1500 times larger than the one without magnetic field. By increasing the volume fraction of carbonyl iron particles in the MRF from 5% to 30%, the electric conductivity increased about 565 times. Under applying an oscillatory shear, the resistance of the MRF decreased and it oscillated synchronously with the oscillatory shear. Interestingly, the larger shear strain led to larger oscillatory amplitude of the resistance. A particle-particle resistance model and a semi-empirical formula were proposed to investigate the influence of the oscillatory shear on the electric conductivity. The fitting results matched the experimental results very well. At last, a possible mechanism was proposed to explain the changes of resistance.

  8. Unique ligation properties of eukaryotic NAD+-dependent DNA ligase from Melanoplus sanguinipes entomopoxvirus.

    PubMed

    Lu, Jing; Tong, Jie; Feng, Hong; Huang, Jianmin; Afonso, Claudio L; Rock, Dan L; Barany, Francis; Cao, Weiguo

    2004-09-01

    The eukaryotic Melanoplus sanguinipes entomopoxvirus (MsEPV) genome reveals a homologous sequence to eubacterial nicotinamide adenine dinucleotide (NAD(+))-dependent DNA ligases [J. Virol. 73 (1999) 533]. This 522-amino acid open reading frame (ORF) contains all conserved nucleotidyl transferase motifs but lacks the zinc finger motif and BRCT domain found in conventional eubacterial NAD(+) ligases. Nevertheless, cloned MsEPV ligase seals DNA nicks in a NAD(+)-dependent fashion, while adenosine 5'-monophosphate (ATP) cannot serve as an adenylation cofactor. The ligation activity of MsEPV ligase requires Mg(2+) or Mn(2+). MsEPV ligase seals sticky ends efficiently, but has little activity on 1-nucleotide gap or blunt-ended DNA substrates even in the presence of polyethylene glycol. In comparison, bacterial NAD(+)-dependent ligases seal blunt-ended DNA substrates in the presence of polyethylene glycol. MsEPV DNA ligase readily joins DNA nicks with mismatches at either side of the nick junction, except for mismatches at the nick junction containing an A base in the template strand (A/A, G/A, and C/A). MsEPV NAD(+)-dependent DNA ligase can join DNA probes on RNA templates, a unique property that distinguishes this enzyme from other conventional bacterial NAD(+) DNA ligases. T4 ATP-dependent DNA ligase shows no detectable mismatch ligation at the 3' side of the nick but substantial 5' T/G mismatch ligation on an RNA template. In contrast, MsEPV ligase joins mismatches at the 3' side of the nick more frequently than at the 5' side of the nick on an RNA template. The complementary specificities of these two enzymes suggest alternative primer design for genomic profiling approaches that use allele-specific detection directly from RNA transcripts.

  9. Dependence on radiation quality of DNA fragmentation spectra

    NASA Astrophysics Data System (ADS)

    Campa, Alessandro; Ottolenghi, Andrea; Alloni, Daniele; Ballarini, Francesca; Belli, Mauro; Esposito, Giuseppe; Facoetti, Angelica; Friedland, Werner; Liotta, Marco; Paretzke, Herwig

    Energy deposition by radiation initially gives rise to cellular critical lesions such as DNA doublestrand breaks (DSB), that later lead to the formation of relevant biological endpoints. Studies on fragment size distributions induced by radiations of various qualities can be of great help in linking the characteristics of radiation to cellular endpoints, providing information for understanding the main mechanisms of cell damage. Here we are concerned with the damage induced by heavy charged particles; this issue is very important in the field of radioprotection of astronauts participating in long term space missions, besides being relevant also in other fields, like hadrontherapy. Galactic Cosmic Rays contain a large component of high-LET particles (HZE), e.g. helium and carbon ions, as well as highcharge particles such as iron ions. These particles are characterized by complex track structures with energy depositions not only along the path of the primary particle, but also at relatively large distance form the path, due to the presence of high energy secondary electrons. In this work we have simulated the irradiation of human fibroblasts with γ-rays, protons, helium, carbon and iron ions at a fixed dose with the biophysical Monte Carlo code PARTRAC,and calculated the induction of DSB. The PARTRAC code includes accurate representation of the chromatin geometry and of the physical and physico-chemical processes associated with the energy deposition by radiation. The results of a first validation of the code have been reported in A. Campa et al. (2005) and D. Alloni et al. (2007a, 2007b). DNA fragment spectra were calculated based on the DSB induction patterns and compared in particular for particles of the same specific energy and for particles of the same LET. Special emphasis has been directed to the calculation of very small fragments (< 1 kbp) that are not detectable by the most common experimental techniques and that can significantly influence the RBE

  10. Alternating current electrokinetic separation and detection of DNA nanoparticles in high-conductance solutions.

    PubMed

    Krishnan, Rajaram; Sullivan, Benjamin D; Mifflin, Robert L; Esener, Sadik C; Heller, Michael J

    2008-05-01

    In biomedical research and diagnostics, it is a significant challenge to directly isolate and identify rare cells and potential biomarkers in blood, plasma and other clinical samples. Additionally, the advent of bionanotechnology is leading to numerous drug delivery approaches that involve encapsulation of drugs and imaging agents within nanoparticles, which now will also have to be identified and separated from blood and plasma. Alternating current (AC) electrokinetic techniques such as dielectrophoresis (DEP) offer a particularly attractive mechanism for the separation of cells and nanoparticles. Unfortunately, present DEP techniques require the dilution of blood/plasma, thus making the technology less suitable for clinical sample preparation. Using array devices with microelectrodes over-coated with porous hydrogel layers, AC electric field conditions have been found which allow the separation of DNA nanoparticles to be achieved under high-conductance (ionic strength) conditions. At AC frequencies in the 3000 Hz to 10,000 Hz range and 10 volts peak-to-peak, the separation of 10-microm polystyrene particles into low field regions, and 60-nm DNA-derivatized nanoparticles and 200-nm nanoparticles into high-field regions was carried out in 149 mM 1xPBS buffer (1.68 S/m). These results may allow AC electrokinetic systems to be developed that can be used with clinically relevant samples under physiological conditions.

  11. Preparation, characterization and scanned conductance microscopy studies of DNA-templated one-dimensional copper nanostructures.

    PubMed

    Watson, Scott M D; Wright, Nicholas G; Horrocks, Benjamin R; Houlton, Andrew

    2010-02-02

    The synthesis of one-dimensional metal nanostructures can be achieved through the use of DNA molecules as templates to control and direct metal deposition. Copper nanostructures have been fabricated using this strategy, through association of Cu(2+) ions to DNA templates and reduced with ascorbic acid. Due to the possibility that the reduction of the Cu(2+) can result in the preferential formation of Cu(2)O over metallic Cu(0), X-ray photoelectron spectroscopy and X-ray diffraction have been carried out to establish the chemical identity of the nanostructures. Conclusive evidence is found that reduction of the Cu(2+) ions does result in the formation of the desired metallic Cu(0) structures. The morphology of the nanostructured Cu(0) material has also been observed by atomic force microscopy, showing the structures to have a "beads-on-a-string" appearance and being 3.0-5.5 nm in height. The electrical properties of the structures have been investigated by scanned conductance microscopy, showing the Cu(0) structures exhibit much larger electrical resistance than expected for a metallic nanowire. This is thought to be a consequence of their "beads-on-a-string" morphology and small lateral dimensions (sub-10 nm); both these factors would be expected to increase the electron scattering rate, and, further, there are likely to be significant tunneling barriers at the Cu(0) particle-particle junctions.

  12. Anion Conductance of Frog Muscle Membranes: One Channel, Two Kinds of pH Dependence

    PubMed Central

    Woodbury, J. W.; Miles, P. R.

    1973-01-01

    Anion conductance and permeability sequences were obtained for frog skeletal muscle membranes from the changes in characteristic resistance and transmembrane potential after the replacement of one anion by another in the bathing solution. Permeability and conductance sequences are the same. The conductance sequence at pH = 7.4 is Cl- Br- > NO3- > I- > trichloroacetate ≥ benzoate > valerate > butyrate > proprionate > formate > acetate ≥ lactate > benzenesulfonate ≥ isethionate > methylsulfonate > glutamate ≥ cysteate. The anions are divided into two classes: (a) Chloride-like anions (Cl- through trichloroacetate) have membrane conductances that decrease as pH decreases. The last six members of the complete sequence are also chloride like. (b) Benzoate-like anions (benzoate through acetate) have conductances that increase as pH decreases. At pH = 6.7 zinc ions block Cl- and benzoate conductances with inhibitory dissociation constants of 0.12 and 0.16 mM, respectively. Chloride-like and benzoate-like anions probably use the same channels. The minimum size of the channel aperture is estimated as 5.5 x 6.5 Å from the dimensions of the largest permeating anions. A simple model of the channel qualitatively explains chloride-like and benzoate-like conductance sequences and their dependence on pH. PMID:4542368

  13. Temperature and frequency dependent conductivity of lithium doped bismuth zinc vanadate semiconducting glassy system

    NASA Astrophysics Data System (ADS)

    Dahiya, S.; Punia, R.; Murugavel, S.; Maan, A. S.

    2014-11-01

    The ac conductivity of bismuth zinc vanadate glasses of compositions x Li2O (100 - x) (50V2O5·20 Bi2O3·30 ZnO); x = 0, 2, 4, 6, and 8 has been studied in the frequency range 10-1 Hzb-2 MHz and in temperature range 313-533 K. The temperature and frequency dependent conductivity is found to obey Almond-West universal power law for all the studied lithium doped bismuth zinc vanadate glassy systems. Various parameters such as dc conductivity ( σ dc ), crossover frequency ( ω H ) and frequency exponent ( s) have been estimated by fitting the experimental data of ac conductivity to Almond-West universal power law. It has been observed that the ac conductivity of bismuth zinc vanadate glass system decreases with the increase in Li2O content. The ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models. The ac conduction seems to take place via tunneling of overlapping large polarons in all the compositions.

  14. Self-consistent modeling of terahertz waveguide and cavity with frequency-dependent conductivity

    NASA Astrophysics Data System (ADS)

    Huang, Y. J.; Chu, K. R.; Thumm, M.

    2015-01-01

    The surface resistance of metals, and hence the Ohmic dissipation per unit area, scales with the square root of the frequency of an incident electromagnetic wave. As is well recognized, this can lead to excessive wall losses at terahertz (THz) frequencies. On the other hand, high-frequency oscillatory motion of conduction electrons tends to mitigate the collisional damping. As a result, the classical theory predicts that metals behave more like a transparent medium at frequencies above the ultraviolet. Such a behavior difference is inherent in the AC conductivity, a frequency-dependent complex quantity commonly used to treat electromagnetics of metals at optical frequencies. The THz region falls in the gap between microwave and optical frequencies. However, metals are still commonly modeled by the DC conductivity in currently active vacuum electronics research aimed at the development of high-power THz sources (notably the gyrotron), although a small reduction of the DC conductivity due to surface roughness is sometimes included. In this study, we present a self-consistent modeling of the gyrotron interaction structures (a metallic waveguide or cavity) with the AC conductivity. The resulting waveguide attenuation constants and cavity quality factors are compared with those of the DC-conductivity model. The reduction in Ohmic losses under the AC-conductivity model is shown to be increasingly significant as the frequency reaches deeper into the THz region. Such effects are of considerable importance to THz gyrotrons for which the minimization of Ohmic losses constitutes a major design consideration.

  15. Molecular study of time dependent changes in DNA stability in soil buried skeletal residues.

    PubMed

    Kaiser, Christina; Bachmeier, Beatrice; Conrad, Claudius; Nerlich, Andreas; Bratzke, Hansjürgen; Eisenmenger, Wolfgang; Peschel, Oliver

    2008-05-02

    In the past years, many publications about identification and sex-determination of dry human bones by means of DNA analysis have been published. However, few studies exist that investigate the potential use of DNA technique to determine the postmortem interval (PMI). In the present study we analyzed the rate of increasingly smaller fragments of chromosomal DNA and PMI. We examined DNA degradation in human bones with postmortem intervals ranging between 1 and more than 200 years that had been kept under comparable conditions concerning weather and soil. Following bone separation into the three different zones of interest of inner/middle/outer segments the quantity of total DNA was determined in each region. Subsequently, the degree of DNA fragmentation was estimated by searching for PCR products of defined size (150, 507 and 763 bp) with primers of the human-specific multicopy beta-actin-gene. Concerning DNA quantity we detected a significant correlation between the zone of interest and the amount of DNA. However, there was no correlation between the amount of DNA and PMI. In contrast to this, analyzing DNA using PCR showed a significant inverse correlation between fragment length and PMI. Thus, postmortem DNA degradation into increasingly smaller fragments reveals a time-dependent process. It has the potential to be used as a predictor of PMI in human bone findings, provided that environmental conditions are known.

  16. DNA-PKcs dependence of Artemis endonucleolytic activity, differences between hairpins and 5' or 3' overhangs.

    PubMed

    Niewolik, Doris; Pannicke, Ulrich; Lu, Haihui; Ma, Yunmei; Wang, Ling-Chi Vicky; Kulesza, Peter; Zandi, Ebrahim; Lieber, Michael R; Schwarz, Klaus

    2006-11-10

    During V(D)J recombination, the RAG proteins create DNA hairpins at the V, D, or J coding ends, and the structure-specific nuclease Artemis is essential to open these hairpins prior to joining. Artemis also is an endonuclease for 5' and 3' overhangs at many DNA double strand breaks caused by ionizing radiation, and Artemis functions as part of the nonhomologous DNA end joining pathway in repairing these. All of these activities require activation of the Artemis protein by interaction with and phosphorylation by the DNA-dependent protein kinase catalytic subunit (DNA-PKcs). In this study, we have identified a region of the Artemis protein involved in the interaction with DNA-PKcs. Furthermore, the biochemical and functional analyses of C-terminally truncated Artemis variants indicate that the hair-pin opening and DNA overhang endonucleolytic features of Artemis are triggered by DNA-PKcs in two modes. First, autoinhibition mediated by the C-terminal tail of Artemis is relieved by phosphorylation of this tail by DNA-PKcs. Thus, C-terminally truncated Artemis derivatives imitate DNA-PKcs-activated wild type Artemis protein and exhibit intrinsic hairpin opening activity. Second, DNA-PKcs may optimally configure 5' and 3' overhang substrates for the endonucleolytic function of Artemis.

  17. Orientation Dependent Thermal Conductance in Single-Layer MoS2

    PubMed Central

    Jiang, Jin-Wu; Zhuang, Xiaoying; Rabczuk, Timon

    2013-01-01

    We investigate the thermal conductivity in the armchair and zigzag MoS2 nanoribbons, by combining the non-equilibrium Green's function approach and the first-principles method. A strong orientation dependence is observed in the thermal conductivity. Particularly, the thermal conductivity for the armchair MoS2 nanoribbon is about 673.6 Wm−1 K−1 in the armchair nanoribbon, and 841.1 Wm−1 K−1 in the zigzag nanoribbon at room temperature. By calculating the Caroli transmission, we disclose the underlying mechanism for this strong orientation dependence to be the fewer phonon transport channels in the armchair MoS2 nanoribbon in the frequency range of [150, 200] cm−1. Through the scaling of the phonon dispersion, we further illustrate that the thermal conductivity calculated for the MoS2 nanoribbon is esentially in consistent with the superior thermal conductivity found for graphene. PMID:23860436

  18. Recombinant expression and purification of an ATP-dependent DNA ligase from Aliivibrio salmonicida.

    PubMed

    Williamson, Adele; Pedersen, Hege

    2014-05-01

    The genome of the psychrophilic fish-pathogen Aliivibrio salmonicida encodes a putative ATP-dependent DNA ligase in addition to a housekeeping NAD-dependent enzyme. In order to study the structure and activity of the ATP dependent ligase in vitro we have undertaken its recombinant production and purification from an Escherichia coli based expression system. Expression and purification of this protein presented two significant challenges. First, the gene product was moderately toxic to E. coli cells, second it was necessary to remove the large amounts of E. coli DNA present in bacterial lysates without contamination of the protein preparation by nucleases which might interfere with future assaying. The toxicity problem was overcome by fusion of the putative ligase to large solubility tags such as maltose-binding protein (MBP) or Glutathione-S-transferase (GST), and DNA was removed by treatment with a nuclease which could be inhibited by reducing agents. As the A. salmonicida ATP-dependent DNA ligase gene encodes a predicted leader peptide, both the full-length and mature forms of the protein were produced. Both possessed ATP-dependent DNA ligase activity, but the truncated form was significantly more active. Here we detail the first reported production, purification and preliminary characterization of active A. salmonicida ATP-dependent DNA ligase.

  19. Human ClCa1 modulates anionic conduction of calcium-dependent chloride currents

    PubMed Central

    Hamann, Martine; Gibson, Adele; Davies, Noel; Jowett, Amanda; Walhin, Jean Philippe; Partington, Leanne; Affleck, Karen; Trezise, Derek; Main, Martin

    2009-01-01

    Proteins of the CLCA gene family including the human ClCa1 (hClCa1) have been suggested to constitute a new family of chloride channels mediating Ca2+-dependent Cl− currents. The present study examines the relationship between the hClCa1 protein and Ca2+-dependent Cl− currents using heterologous expression of hClCa1 in HEK293 and NCIH522 cell lines and whole cell recordings. By contrast to previous reports claiming the absence of Cl− currents in HEK293 cells, we find that HEK293 and NCIH522 cell lines express constitutive Ca2+-dependent Cl− currents and show that hClCa1 increases the amplitude of Ca2+-dependent Cl− currents in those cells. We further show that hClCa1 does not modify the permeability sequence but increases the Cl− conductance while decreasing the GSCN−/GCl− conductance ratio from ∼2–3 to ∼1. We use an Eyring rate theory (two barriers, one site channel) model and show that the effect of hClCa1 on the anionic channel can be simulated by its action on lowering the first and the second energy barriers. We conclude that hClCa1 does not form Ca2+-dependent Cl− channels per se or enhance the trafficking/insertion of constitutive channels in the HEK293 and NCIH522 expression systems. Rather, hClCa1 elevates the single channel conductance of endogenous Ca2+-dependent Cl− channels by lowering the energy barriers for ion translocation through the pore. PMID:19307298

  20. Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

    NASA Astrophysics Data System (ADS)

    Chen, Guofang; Mao, Chengde

    2016-05-01

    Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

  1. DNA-PKcs-Dependent Modulation of Cellular Radiosensitivity by a Selective Cyclooxygenase-2 Inhibitor

    SciTech Connect

    Kodym, Elisabeth; Kodym, Reinhard; Chen, Benjamin P.; Chen, David J.; Morotomi-Yano, Keiko; Choy, Hak; Saha, Debabrata

    2007-09-01

    Purpose: Inhibition of cyclooxygenase-2 has been shown to increase radiosensitivity. Recently, the suppression of radiation-induced DNA-dependant protein kinase (DNA-PK) activity by the selective cyclooxygenase-2 inhibitor celecoxib was reported. Given the importance of DNA-PK for repair of radiation-induced DNA double-strand breaks by nonhomologous end-joining and the clinical use of the substance, we investigated the relevance of the DNA-PK catalytic subunit (DNA-PKcs) for the modulation of cellular radiosensitivity by celecoxib. Methods and Materials: We used a syngeneic model of Chinese hamster ovarian cell lines: AA8, possessing a wild-type DNK-PKcs; V3, lacking a functional DNA-PKcs; and V3/WT11, V3 stably transfected with the DNA-PKcs. The cells were treated with celecoxib (50 {mu}M) for 24 h before irradiation. The modulation of radiosensitivity was determined using the colony formation assay. Results: Treatment with celecoxib increased the cellular radiosensitivity in the DNA-PKcs-deficient cell line V3 with a dose-enhancement ratio of 1.3 for a surviving fraction of 0.5. In contrast, clonogenic survival was increased in DNA-PKcs wild-type-expressing AA8 cells and in V3 cells transfected with DNA-PKcs (V3/WT11). The decrease in radiosensitivity was comparable to the radiosensitization in V3 cells, with a dose-enhancement ratio of 0.76 (AA8) and 0.80 (V3/WT11) for a survival of 0.5. Conclusions: We have demonstrated a DNA-PKcs-dependent differential modulation of cellular radiosensitivity by celecoxib. These effects might be attributed to alterations in signaling cascades downstream of DNA-PK toward cell survival. These findings offer an explanation for the poor outcomes in some recently published clinical trials.

  2. Temperature Dependence of the Thermal Conductivity of Single Wall Carbon Nanotubes

    NASA Technical Reports Server (NTRS)

    Osman, Mohamed A.; Srivastava, Deepak

    2000-01-01

    The thermal conductivity of several single wall carbon nanotubes (CNT) has been calculated over a temperature range of 100-500 K using molecular dynamics simulations with Tersoff-Brenner potential for C-C interactions. In all cases, starting from similar values at 100K, thermal conductivities show a peaking behavior before falling off at higher temperatures. The peak position shifts to higher temperatures for nanotubes of larger diameter, and no significant dependence on the tube chirality is observed. It is shown that this phenomenon is due to onset of Umklapp scattering, which shifts to higher temperatures for nanotubes of larger diameter.

  3. Bias-dependent amino-acid-induced conductance changes in short semi-metallic carbon nanotubes.

    PubMed

    Abadir, G B; Walus, K; Pulfrey, D L

    2010-01-08

    We study the interaction between short semi-metallic carbon nanotubes and different amino acids using molecular dynamics and ab initio (density functional theory/non-equilibrium Green's function) simulations. We identify two different mechanisms of nanotube conductance change upon adsorption of amino acids: one due to the change of the coordinates of the nanotube arising from van der Waals forces of interaction with the adsorbed amino acid; and one due to electrostatic interactions, which appear only in the case of charged amino acids. We also find that the transport mechanism and the changes in the conductance of the tube upon amino acid adsorption are bias dependent.

  4. Permeability dependence of streaming potential in rocks for various fluid conductivities

    NASA Astrophysics Data System (ADS)

    Jouniaux, Laurence; Pozzi, Jean-Pierre

    1995-02-01

    Streaming potentials have been measured on sandstone and limestone samples in a large range of permeabilities. The electrokinetic coupling coefficient increases with permeability and we explain this effect by the related variation of surface conductivity. A model is proposed to study this effect for various fluid conductivities and it is shown that the dependence of the electrokinetic coupling coefficient on permeability is stronger for high fluid resistivity and is weaker for lower fluid resistivity. When fluid resistivity is below 1 Ohm-meter permeability and streaming potential are no more related.

  5. Frequency-dependent stability of parallel-plate electrostatic actuators in conductive fluids

    NASA Astrophysics Data System (ADS)

    Sounart, T. L.; Panchawagh, H. V.; Mahajan, R. L.

    2010-05-01

    We present an electromechanical stability analysis of passivated parallel-plate electrostatic actuators in conductive dielectric media and show that the pull-in instability can be eliminated by tuning the applied frequency below a design-dependent stability limit. A partial instability region is also obtained, where the actuator jumps from the pull-in displacement to another stable position within the gap. The results predict that the stability limit is always greater than the critical actuation frequency, and therefore any device that is feasible to actuate in a conductive fluid can be operated with stability over the full range of motion.

  6. Time Dependent Universal Conductance Fluctuations In AuPd, Ag, And Au Wires

    NASA Astrophysics Data System (ADS)

    Trionfi, A.; Lee, S.; Natelson, D.

    2006-09-01

    Quantum transport phenomena allow experimental determinations of the phase coherence information in metals. We report quantitative comparisons of inferred coherence lengths from independent measurements of the weak localization magnetoresistance and time-dependent universal conductance fluctuations' magnetic field dependence. Strong agreement is observed in both quasi-2D and quasi-1D AuPd samples. However, quantitative agreement is not seen in quasi-1D Ag wires below 10 K and quasi-1D Au wires below 14 K. A possible explanation for this disagreement will be discussed. Attempts to produce changes in the coherence length in Au by annealing have also been made and results will be reported.

  7. Thermoelectric Property Dependence and Geometry Optimization of Peltier Current Leads Using Highly Electrically Conductive Thermoelectric Materials

    NASA Astrophysics Data System (ADS)

    Fujii, Tomohiro; Fukuda, Shinji; Emoto, Masahiko; Osada, Koudai; Kawahara, Toshio; Hamabe, Makoto; Watanabe, Hirofumi; Ivanov, Yury; Sun, Jian; Yamaguchi, Satarou

    2011-05-01

    Thermoelectric materials are promising candidates for use in energy-saving devices in many fields. They are also useful in superconducting applications such as those using Peltier current leads (PCLs) to reduce system heat loss. In the case of PCLs, consideration must be given to Joule heating. Furthermore, the performance of PCLs is intricately dependent on their thermoelectric properties. In addition to the figure of merit Z, consideration of the electrical conductivity is also important for the design of high-performance PCLs. In this paper, we discuss the resistivity dependence of the performance of PCLs using model parameters obtained from real devices.

  8. Reduced temperature-dependent thermal conductivity of magnetite thin films by controlling film thickness.

    PubMed

    Park, No-Won; Lee, Won-Yong; Kim, Jin-A; Song, Kyungjun; Lim, Hyuneui; Kim, Wan-Doo; Yoon, Soon-Gil; Lee, Sang-Kwon

    2014-02-26

    We report on the out-of-plane thermal conductivities of epitaxial Fe3O4 thin films with thicknesses of 100, 300, and 400 nm, prepared using pulsed laser deposition (PLD) on SiO2/Si substrates. The four-point probe three-omega (3-ω) method was used for thermal conductivity measurements of the Fe3O4 thin films in the temperature range of 20 to 300 K. By measuring the temperature-dependent thermal characteristics of the Fe3O4 thin films, we realized that their thermal conductivities significantly decreased with decreasing grain size and thickness of the films. The out-of-plane thermal conductivities of the Fe3O4 films were found to be in the range of 0.52 to 3.51 W/m · K at 300 K. For 100-nm film, we found that the thermal conductivity was as low as approximately 0.52 W/m · K, which was 1.7 to 11.5 order of magnitude lower than the thermal conductivity of bulk material at 300 K. Furthermore, we calculated the temperature dependence of the thermal conductivity of these Fe3O4 films using a simple theoretical Callaway model for comparison with the experimental data. We found that the Callaway model predictions agree reasonably with the experimental data. We then noticed that the thin film-based oxide materials could be efficient thermoelectric materials to achieve high performance in thermoelectric devices.

  9. Situation-dependent repair of DNA damage in yeast

    SciTech Connect

    von Borstel, R.C.; Hastings, P.J.

    1985-01-01

    The concept of channelling of lesions in DNA into defined repair systems has been used to explain many aspects of induced and spontaneous mutation. The channelling hypothesis states that lesions excluded from one repair process will be taken up by another repair process. This is a simplification. The three known modes of repair of damage induced by radiation are not equivalent modes of repair; they are, instead, different solutions to the problem of replacement of damaged molecules with new molecules which have the same informational content as those that were damaged. The mode of repair that is used is the result of the response to the situation in which the damage takes place. Thus, when the most likely mode of repair does not take place, then the situation changes with respect to the repair of the lesion; the lesion may enter the replication fork and be reparable by another route.

  10. Efficiency of coaxial stacking depends on the DNA duplex structure.

    PubMed

    Pyshnyi, Dmitrii V; Goldberg, Eugenii L; Ivanova, Eugenia M

    2003-12-01

    Thermodynamic parameters of coaxial stacking at complementary helix-helix interfaces GX*pYG/CZVC (X,Y=A,C,T,G;*-nick) created by contiguous oligonucleotide hybridization were determined. The data obtained were compared to the thermodynamic parameters of coaxial stacking at the interfaces CX*pYC/GZVG. Multiple linear regression analysis has revealed that the free-energy increments of interaction for the contacts GX*pYG/CZVC and CX*pYC/GZVG can be described by a set of uniform Delta G degrees(X*pY/ZV) values. The difference in the observed free-energy of the coaxial stacking between the two sets is defined by the contribution from the factors reflecting structural differences between compared DNA duplexes.

  11. A Review of the Role of the Sequence-Dependent Electrostatic Landscape in DNA Alkylation Patterns

    PubMed Central

    Gold, Barry; Marky, Luis M.; Stone, Michael P.; Williams, Loren D.

    2008-01-01

    Alkylating agents, including environmental and endogenous carcinogens, and DNA targeting antineoplastic agents, that adduct DNA via intermediates with significant cationic charge show a sequence selectively in their covalent bonding to nucleobases. The resulting patterns of alkylation eventually contribute to the agent-dependent distributions and types of mutations. The origin of the regioselective modification of DNA by electrophiles has been attributed to steric and/or electronic factors, but attempts to mechanistically model and predict alkylation patterns have had limited success. In this review, we present data consistent with the role of the intrinsic sequence-dependent electrostatic landscape (SDEL) in DNA that modulates the equilibrium binding of cations and the bonding of reactive charged alkylating agents to atoms that line the floor of the major groove of DNA. PMID:17112226

  12. Down-regulation of histone H2B by DNA-dependent protein kinase in response to DNA damage through modulation of octamer transcription factor 1.

    PubMed

    Schild-Poulter, Caroline; Shih, Amy; Yarymowich, Nicholas C; Haché, Robert J G

    2003-11-01

    Cells respond to double-stranded DNA breaks (DSBs) by pausing cell cycle progression to allow the repair machinery to restore genomic integrity. DNA-dependent protein kinase (DNA-PK), comprising a large catalytic subunit (DNA-PK(cs)) and the Ku antigen regulatory subunit (Ku70/Ku80), is activated in response to DSBs and is required for DNA repair through the nonhomologous end-joining pathway. Here we provide evidence that DNA-PK participates in altering specific gene expression in response to DNA damage by modulating the stability and transcriptional regulatory potential of the essential transcription factor octamer transcription factor 1 (Oct-1). Histone H2B and U2 RNA, whose expression are highly dependent on Oct-1, were strongly decreased in response to ionizing radiation in a DNA-PK-dependent manner, and Oct-1-dependent reporter gene transcription was repressed. Furthermore, Oct-1 phosphorylation in response to ionizing radiation increased in a DNA-PK-dependent manner. Paradoxically, down-regulation of transactivation correlated with the rapid DNA-PK-dependent stabilization of Oct-1. Stabilization of Oct-1 was dependent on the NH(2)-terminal region of Oct-1, which contains a transcriptional activation domain and which was phosphorylated by DNA-PK in vitro. These results suggest a mechanism for the regulation of Oct-1 in response to DNA damage through specific phosphorylation within the NH(2)-terminal transcriptional regulatory domain.

  13. Mitochondrial quality control: Cell-type-dependent responses to pathological mutant mitochondrial DNA

    PubMed Central

    Malena, Adriana; Pantic, Boris; Borgia, Doriana; Sgarbi, Gianluca; Solaini, Giancarlo; Holt, Ian J.; Spinazzola, Antonella; Perissinotto, Egle; Sandri, Marco; Baracca, Alessandra; Vergani, Lodovica

    2016-01-01

    ABSTRACT Pathological mutations in the mitochondrial DNA (mtDNA) produce a diverse range of tissue-specific diseases and the proportion of mutant mitochondrial DNA can increase or decrease with time via segregation, dependent on the cell or tissue type. Previously we found that adenocarcinoma (A549.B2) cells favored wild-type (WT) mtDNA, whereas rhabdomyosarcoma (RD.Myo) cells favored mutant (m3243G) mtDNA. Mitochondrial quality control (mtQC) can purge the cells of dysfunctional mitochondria via mitochondrial dynamics and mitophagy and appears to offer the perfect solution to the human diseases caused by mutant mtDNA. In A549.B2 and RD.Myo cybrids, with various mutant mtDNA levels, mtQC was explored together with macroautophagy/autophagy and bioenergetic profile. The 2 types of tumor-derived cell lines differed in bioenergetic profile and mitophagy, but not in autophagy. A549.B2 cybrids displayed upregulation of mitophagy, increased mtDNA removal, mitochondrial fragmentation and mitochondrial depolarization on incubation with oligomycin, parameters that correlated with mutant load. Conversely, heteroplasmic RD.Myo lines had lower mitophagic markers that negatively correlated with mutant load, combined with a fully polarized and highly fused mitochondrial network. These findings indicate that pathological mutant mitochondrial DNA can modulate mitochondrial dynamics and mitophagy in a cell-type dependent manner and thereby offer an explanation for the persistence and accumulation of deleterious variants. PMID:27627835

  14. The kinetics of force-dependent hybridization and strand-peeling of short DNA fragments

    NASA Astrophysics Data System (ADS)

    Yang, ZhouJie; Yuan, GuoHua; Zhai, WeiLi; Yan, Jie; Chen, Hu

    2016-08-01

    Deoxyribonucleic acid (DNA) carries the genetic information in all living organisms. It consists of two interwound single-stranded (ss) strands, forming a double-stranded (ds) DNA with a right-handed double-helical conformation. The two strands are held together by highly specific basepairing interactions and are further stabilized by stacking between adjacent basepairs. A transition from a dsDNA to two separated ssDNA is called melting and the reverse transition is called hybridization. Applying a tensile force to a dsDNA can result in a particular type of DNA melting, during which one ssDNA strand is peeled away from the other. In this work, we studied the kinetics of strand-peeling and hybridization of short DNA under tensile forces. Our results show that the force-dependent strand-peeling and hybridization can be described with a simple two-state model. Importantly, detailed analysis of the force-dependent transition rates revealed that the transition state consists of several basepairs dsDNA.

  15. Sequence-Dependent Fluorescence of Cy3- and Cy5-Labeled Double-Stranded DNA

    PubMed Central

    2016-01-01

    The fluorescent intensity of Cy3 and Cy5 dyes is strongly dependent on the nucleobase sequence of the labeled oligonucleotides. Sequence-dependent fluorescence may significantly influence the data obtained from many common experimental methods based on fluorescence detection of nucleic acids, such as sequencing, PCR, FRET, and FISH. To quantify sequence dependent fluorescence, we have measured the fluorescence intensity of Cy3 and Cy5 bound to the 5′ end of all 1024 possible double-stranded DNA 5mers. The fluorescence intensity was also determined for these dyes bound to the 5′ end of fixed-sequence double-stranded DNA with a variable sequence 3′ overhang adjacent to the dye. The labeled DNA oligonucleotides were made using light-directed, in situ microarray synthesis. The results indicate that the fluorescence intensity of both dyes is sensitive to all five bases or base pairs, that the sequence dependence is stronger for double- (vs single-) stranded DNA, and that the dyes are sensitive to both the adjacent dsDNA sequence and the 3′-ssDNA overhang. Purine-rich sequences result in higher fluorescence. The results can be used to estimate measurement error in experiments with fluorescent-labeled DNA, as well as to optimize the fluorescent signal by considering the nucleobase environment of the labeling cyanine dye. PMID:26895222

  16. Temperature and frequency dependent conductivity of bismuth zinc vanadate semiconducting glassy system

    NASA Astrophysics Data System (ADS)

    Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.

    2012-10-01

    The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.

  17. Measurement of the position-dependent electrophoretic force on DNA in a glass nanocapillary.

    PubMed

    Bulushev, Roman D; Steinbock, Lorenz J; Khlybov, Sergey; Steinbock, Julian F; Keyser, Ulrich F; Radenovic, Aleksandra

    2014-11-12

    The electrophoretic force on a single DNA molecule inside a glass nanocapillary depends on the opening size and varies with the distance along the symmetrical axis of the nanocapillary. Using optical tweezers and DNA-coated beads, we measured the stalling forces and mapped the position-dependent force profiles acting on DNA inside nanocapillaries of different sizes. We showed that the stalling force is higher in nanocapillaries of smaller diameters. The position-dependent force profiles strongly depend on the size of the nanocapillary opening, and for openings smaller than 20 nm, the profiles resemble the behavior observed in solid-state nanopores. To characterize the position-dependent force profiles in nanocapillaries of different sizes, we used a model that combines information from both analytical approximations and numerical calculations.

  18. Temperature Dependence of Electrical and Thermal Conduction in Single Silver Nanowire

    DTIC Science & Technology

    2015-06-02

    SECURITY CLASSIFICATION OF: In this work, the thermal and electrical transport in an individual silver nanowire is characterized down to 35 K for in...resistivity increases by around 4 folds from that of bulk silver. The Debye temperature (151 K) of the silver nanowire is found 36% lower than that (235 K) of...public release; distribution is unlimited. Temperature Dependence of Electrical and Thermal Conduction in Single Silver Nanowire The views, opinions

  19. Modeling activity-dependent changes of axonal spike conduction in primary afferent C-nociceptors

    PubMed Central

    Tigerholm, Jenny; Petersson, Marcus E.; Obreja, Otilia; Lampert, Angelika; Carr, Richard; Schmelz, Martin

    2013-01-01

    Action potential initiation and conduction along peripheral axons is a dynamic process that displays pronounced activity dependence. In patients with neuropathic pain, differences in the modulation of axonal conduction velocity by activity suggest that this property may provide insight into some of the pathomechanisms. To date, direct recordings of axonal membrane potential have been hampered by the small diameter of the fibers. We have therefore adopted an alternative approach to examine the basis of activity-dependent changes in axonal conduction by constructing a comprehensive mathematical model of human cutaneous C-fibers. Our model reproduced axonal spike propagation at a velocity of 0.69 m/s commensurate with recordings from human C-nociceptors. Activity-dependent slowing (ADS) of axonal propagation velocity was adequately simulated by the model. Interestingly, the property most readily associated with ADS was an increase in the concentration of intra-axonal sodium. This affected the driving potential of sodium currents, thereby producing latency changes comparable to those observed for experimental ADS. The model also adequately reproduced post-action potential excitability changes (i.e., recovery cycles) observed in vivo. We performed a series of control experiments replicating blockade of particular ion channels as well as changing temperature and extracellular ion concentrations. In the absence of direct experimental approaches, the model allows specific hypotheses to be formulated regarding the mechanisms underlying activity-dependent changes in C-fiber conduction. Because ADS might functionally act as a negative feedback to limit trains of nociceptor activity, we envisage that identifying its mechanisms may also direct efforts aimed at alleviating neuronal hyperexcitability in pain patients. PMID:24371290

  20. Temperature and Thickness Dependences of the Anisotropic In-Plane Thermal Conductivity of Black Phosphorus.

    PubMed

    Smith, Brandon; Vermeersch, Bjorn; Carrete, Jesús; Ou, Eric; Kim, Jaehyun; Mingo, Natalio; Akinwande, Deji; Shi, Li

    2017-02-01

    The anisotropic basal-plane thermal conductivities of thin black phosphorus obtained from a new four-probe measurement exhibit much higher peak values at low temperatures than previous reports. First principles calculations reveal the important role of crystal defects and weak thickness dependence that is opposite to the case of graphene and graphite due to the absence of reflection symmetry in puckered phosphorene. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Temperature Dependence and Thermodynamics of Klenow Polymerase Binding to Primed-Template DNA

    PubMed Central

    Datta, Kausiki; Wowor, Andy J.; Richard, Allison J.; LiCata, Vince J.

    2006-01-01

    DNA binding of Klenow polymerase has been characterized with respect to temperature to delineate the thermodynamic driving forces involved in the interaction of this polymerase with primed-template DNA. The temperature dependence of the binding affinity exhibits distinct curvature, with tightest binding at 25–30°C. Nonlinear temperature dependence indicates Klenow binds different primed-template constructs with large heat capacity (ΔCp) values (−870 to −1220 cal/mole K) and thus exhibits large temperature dependent changes in enthalpy and entropy. Binding is entropy driven at lower temperatures and enthalpy driven at physiological temperatures. Large negative ΔCp values have been proposed to be a ‘signature’ of site-specific DNA binding, but type I DNA polymerases do not exhibit significant DNA sequence specificity. We suggest that the binding of Klenow to a specific DNA structure, the primed-template junction, results in a correlated thermodynamic profile that mirrors what is commonly seen for DNA sequence-specific binding proteins. Klenow joins a small number of other DNA-sequence independent DNA binding proteins which exhibit unexpectedly large negative ΔCp values. Spectroscopic measurements show small conformational rearrangements of both the DNA and Klenow upon binding, and small angle x-ray scattering shows a global induced fit conformational compaction of the protein upon binding. Calculations from both crystal structure and solution structural data indicate that Klenow DNA binding is an exception to the often observed correlation between ΔCp and changes in accessible surface area. In the case of Klenow, surface area burial can account for only about half of the ΔCp of binding. PMID:16339886

  2. Temperature dependence and thermodynamics of Klenow polymerase binding to primed-template DNA.

    PubMed

    Datta, Kausiki; Wowor, Andy J; Richard, Allison J; LiCata, Vince J

    2006-03-01

    DNA binding of Klenow polymerase has been characterized with respect to temperature to delineate the thermodynamic driving forces involved in the interaction of this polymerase with primed-template DNA. The temperature dependence of the binding affinity exhibits distinct curvature, with tightest binding at 25-30 degrees C. Nonlinear temperature dependence indicates Klenow binds different primed-template constructs with large heat capacity (DeltaCp) values (-870 to -1220 cal/mole K) and thus exhibits large temperature dependent changes in enthalpy and entropy. Binding is entropy driven at lower temperatures and enthalpy driven at physiological temperatures. Large negative DeltaCp values have been proposed to be a 'signature' of site-specific DNA binding, but type I DNA polymerases do not exhibit significant DNA sequence specificity. We suggest that the binding of Klenow to a specific DNA structure, the primed-template junction, results in a correlated thermodynamic profile that mirrors what is commonly seen for DNA sequence-specific binding proteins. Klenow joins a small number of other DNA-sequence independent DNA binding proteins which exhibit unexpectedly large negative DeltaCp values. Spectroscopic measurements show small conformational rearrangements of both the DNA and Klenow upon binding, and small angle x-ray scattering shows a global induced fit conformational compaction of the protein upon binding. Calculations from both crystal structure and solution structural data indicate that Klenow DNA binding is an exception to the often observed correlation between DeltaCp and changes in accessible surface area. In the case of Klenow, surface area burial can account for only about half of the DeltaCp of binding.

  3. In Situ Study of Strain-Dependent Ion Conductivity of Stretchable Polyethylene Oxide Electrolyte

    NASA Astrophysics Data System (ADS)

    Kelly, Taylor; Ghadi, Bahar Moradi; Berg, Sean; Ardebili, Haleh

    2016-02-01

    There is a strong need in developing stretchable batteries that can accommodate stretchable or irregularly shaped applications including medical implants, wearable devices and stretchable electronics. Stretchable solid polymer electrolytes are ideal candidates for creating fully stretchable lithium ion batteries mainly due to their mechanical and electrochemical stability, thin-film manufacturability and enhanced safety. However, the characteristics of ion conductivity of polymer electrolytes during tensile deformation are not well understood. Here, we investigate the effects of tensile strain on the ion conductivity of thin-film polyethylene oxide (PEO) through an in situ study. The results of this investigation demonstrate that both in-plane and through-plane ion conductivities of PEO undergo steady and linear growths with respect to the tensile strain. The coefficients of strain-dependent ion conductivity enhancement (CSDICE) for in-plane and through-plane conduction were found to be 28.5 and 27.2, respectively. Tensile stress-strain curves and polarization light microscopy (PLM) of the polymer electrolyte film reveal critical insights on the microstructural transformation of stretched PEO and the potential consequences on ionic conductivity.

  4. In Situ Study of Strain-Dependent Ion Conductivity of Stretchable Polyethylene Oxide Electrolyte

    PubMed Central

    Kelly, Taylor; Ghadi, Bahar Moradi; Berg, Sean; Ardebili, Haleh

    2016-01-01

    There is a strong need in developing stretchable batteries that can accommodate stretchable or irregularly shaped applications including medical implants, wearable devices and stretchable electronics. Stretchable solid polymer electrolytes are ideal candidates for creating fully stretchable lithium ion batteries mainly due to their mechanical and electrochemical stability, thin-film manufacturability and enhanced safety. However, the characteristics of ion conductivity of polymer electrolytes during tensile deformation are not well understood. Here, we investigate the effects of tensile strain on the ion conductivity of thin-film polyethylene oxide (PEO) through an in situ study. The results of this investigation demonstrate that both in-plane and through-plane ion conductivities of PEO undergo steady and linear growths with respect to the tensile strain. The coefficients of strain-dependent ion conductivity enhancement (CSDICE) for in-plane and through-plane conduction were found to be 28.5 and 27.2, respectively. Tensile stress-strain curves and polarization light microscopy (PLM) of the polymer electrolyte film reveal critical insights on the microstructural transformation of stretched PEO and the potential consequences on ionic conductivity. PMID:26831948

  5. Characterization and dynamic charge dependent modeling of conducting polymer trilayer bending

    NASA Astrophysics Data System (ADS)

    Farajollahi, Meisam; Sassani, Farrokh; Naserifar, Naser; Fannir, Adelyne; Plesse, Cédric; Nguyen, Giao T. M.; Vidal, Frédéric; Madden, John D. W.

    2016-11-01

    Trilayer bending actuators are charge driven devices that have the ability to function in air and provide large mechanical amplification. The electronic and mechanical properties of these actuators are known to be functions of their charge state making prediction of their responses more difficult when they operate over their full range of deformation. In this work, a combination of state space representation and a two-dimensional RC transmission line model are used to implement a nonlinear time variant model for conducting polymer-based trilayer actuators. Electrical conductivity and Young’s modulus of electromechanically active PEDOT conducting polymer containing films as a function of applied voltage were measured and incorporated into the model. A 16% drop in Young’s modulus and 24 times increase in conductivity are observed by oxidizing the PEDOT. A closed form formulation for radius of curvature of trilayer actuators considering asymmetric and location dependent Young’s modulus and conductivity in the conducting polymer layers is derived and implemented in the model. The nonlinear model shows the capability to predict the radius of curvature as a function of time and position with reasonable consistency (within 4%). The formulation is useful for general trilayer configurations to calculate the radius of curvature as a function of time. The proposed electrochemical modeling approach may also be useful for modeling energy storage devices.

  6. Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

    PubMed

    Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

    2012-09-05

    The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

  7. DNA electrophoresis in agarose gels: A new mobility vs. DNA length dependence

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin

    2002-04-01

    Separations were performed on double stranded DNA (dsDNA) using electrophoresis. Electrophoresis is the steady transport of particles under the influence of an external electric field. Double stranded DNA fragments ranging in length from 200 base pairs (bp) to 194,000 bp (0.34 nm = 1 bp) were electrophoresed at agarose gel concentrations T = 0.4%--1.5%. The electric field was varied from 0.62 V/cm to 6.21 V/cm. A wide range of electric fields and gel concentrations were used to study the usefulness of a new interpolation equation, 1mL =1mL-( 1mL-1 ms)e-L/g , where mL,ms , and g are independent free fitting parameters. The long length mobility limit is interpreted as mL , the short length mobility limit is ms , and g is the crossover between the long length limit and the short length limit. This exponential relation fit very well (chi2 ≥ 0.999) when there are two smooth transitions observed in the "reptation plots" (plotting 3mL/m∘ vs. L) (J. Rousseau, G. Drouin, and G. W. Slater, Phys Rev Lett. 1997, 79, 1945--1948). Fits deviate from the data when three different slopes were observed in the reptation plots. Reptation plots were used to determine a phase diagram for dsDNA migration regimes. The phase diagrams define different regions where mechanisms for molecular transport affect the migration of dsDNA in agarose gels during electrophoresis. The parameters from the equation have also been interpreted to provide a physical description of the structure of the agarose gel by calculating the pore sizes. The relations between the values for the pore sizes and the phase diagrams are interpreted to better understand the migration of the DNA through agarose gels.

  8. Sieving DNA molecules by length dependence in artificial nano-channel matrices

    NASA Astrophysics Data System (ADS)

    Wang, Chung-Hsuan; Hua Ho, Chia; Chou, Y. C.

    2013-01-01

    Nano-channel matrices are designed and fabricated for sieving DNA molecules by length. The length dependence is found to change with the size of the channels. Three regimes can be distinguished: (a) for the matrices with the size of the channels comparable to the persistence length (lp) of DNA molecules (45 nm), the mobility of DNA is found to decrease with the length of the molecules, similar to that found for the gel electrophoresis; (b) as the size of the nano-channel increases, the successful attacking frequency increases for the long molecules. The length-dependence of the mobility reverses; and (c) the Ogston mechanism holds for even larger channels. The short DNA molecules drift faster for the channels with diameter larger than 10 lp. Such a variety of the length dependence is observed for the first time in the electrophoresis in the artificial structures.

  9. Probing the salt dependence of the torsional stiffness of DNA by multiplexed magnetic torque tweezers

    PubMed Central

    Kriegel, Franziska; Ermann, Niklas; Forbes, Ruaridh; Dulin, David; Dekker, Nynke H.

    2017-01-01

    Abstract The mechanical properties of DNA fundamentally constrain and enable the storage and transmission of genetic information and its use in DNA nanotechnology. Many properties of DNA depend on the ionic environment due to its highly charged backbone. In particular, both theoretical analyses and direct single-molecule experiments have shown its bending stiffness to depend on salt concentration. In contrast, the salt-dependence of the twist stiffness of DNA is much less explored. Here, we employ optimized multiplexed magnetic torque tweezers to study the torsional stiffness of DNA under varying salt conditions as a function of stretching force. At low forces (<3 pN), the effective torsional stiffness is ∼10% smaller for high salt conditions (500 mM NaCl or 10 mM MgCl2) compared to lower salt concentrations (20 mM NaCl and 100 mM NaCl). These differences, however, can be accounted for by taking into account the known salt dependence of the bending stiffness. In addition, the measured high-force (6.5 pN) torsional stiffness values of C = 103 ± 4 nm are identical, within experimental errors, for all tested salt concentration, suggesting that the intrinsic torsional stiffness of DNA does not depend on salt. PMID:28460037

  10. Defect association mediated ionic conductivity of rare earth doped nanoceria: Dependency on ionic radius

    NASA Astrophysics Data System (ADS)

    Anirban, Sk.; Sinha, A.; Bandyopadhyay, S.; Dutta, A.

    2016-05-01

    Rare earth doped nanoceria Ce0.9RE0.1O1.95 (RE = Pr, Nd, Eu and Gd) were prepared through citrate auto-ignition method. The single phase cubic fluorite structure with space group Fm3 ¯m of the compositions were confirmed from Rietveld analysis of XRD data. The particle size of the compositions were in the range 49.77 nm to 66.20 nm. An ionic radius dependent lattice parameter variation was found. The DC conductivity of each composition was evaluated using Random Barrier Model. The conductivity decreased and activation energy increased with increasing ionic radius from Gd to Pr doping due to the size mismatch with host ions and formation of stable defect associate. The formation of different defect associates and their correlation with ionic conductivity has been discussed.

  11. Effect of cyclic AMP on the calcium-dependent potassium conductances of rat Leydig cells.

    PubMed

    Desaphy, J F; Joffre, M

    1998-06-01

    Two potassium conductances have been isolated in rat Leydig cells by their sensitivity to cytosolic calcium and to K+ channel blockers. We used the whole-cell configuration of the patch-clamp technique to investigate their sensitivity to cyclic AMP, the main messenger of luteinizing hormone, which stimulates Leydig cell steroidogenesis. The voltage-dependent potassium conductance is not modified by exposing the cell to 1 mM chlorophenylthio-cyclic AMP (CPT-cAMP), a membrane-permeant analogue of cAMP. By contrast, the large, calcium-activated potassium conductance is upregulated by CPT-cAMP. Furthermore, the latter is potentiated by the chloride channel blocker 4-acetamido-4'-isothiocyanato-stilbene-2,2'-disulfonic acid, sodium salt (SITS).

  12. Transcription-Dependent DNA Transactions in the Mitochondrial Genome of a Yeast Hypersuppressive Petite Mutant

    PubMed Central

    Van Dyck, Eric; Clayton, David A.

    1998-01-01

    Mitochondrial DNA (mtDNA) of Saccharomyces cerevisiae contains highly conserved sequences, called rep/ori, that are associated with several aspects of its metabolism. These rep/ori sequences confer the transmission advantage exhibited by a class of deletion mutants called hypersuppressive petite mutants. In addition, because they share features with the mitochondrial leading-strand DNA replication origin of mammals, rep/ori sequences have also been proposed to participate in mtDNA replication initiation. Like the mammalian origins, where transcription is used as a priming mechanism for DNA synthesis, yeast rep/ori sequences contain an active promoter. Although transcription is required for maintenance of wild-type mtDNA in yeast, the role of the rep/ori promoter as a cis-acting element involved in the replication of wild-type mtDNA is unclear, since mitochondrial deletion mutants need neither transcription nor a rep/ori sequence to maintain their genome. Similarly, transcription from the rep/ori promoter does not seem to be necessary for biased inheritance of mtDNA. As a step to elucidate the function of the rep/ori promoter, we have attempted to detect transcription-dependent DNA transactions in the mtDNA of a hypersuppressive petite mutant. We have examined the mtDNA of the well-characterized petite mutant a-1/1R/Z1, whose repeat unit shelters the rep/ori sequence ori1, in strains carrying either wild-type or null alleles of the nuclear genes encoding the mitochondrial transcription apparatus. Complex DNA transactions were detected that take place around GC-cluster C, an evolutionarily conserved GC-rich sequence block immediately downstream from the rep/ori promoter. These transactions are strictly dependent upon mitochondrial transcription. PMID:9566917

  13. Transcription-dependent DNA transactions in the mitochondrial genome of a yeast hypersuppressive petite mutant.

    PubMed

    Van Dyck, E; Clayton, D A

    1998-05-01

    Mitochondrial DNA (mtDNA) of Saccharomyces cerevisiae contains highly conserved sequences, called rep/ori, that are associated with several aspects of its metabolism. These rep/ori sequences confer the transmission advantage exhibited by a class of deletion mutants called hypersuppressive petite mutants. In addition, because they share features with the mitochondrial leading-strand DNA replication origin of mammals, rep/ori sequences have also been proposed to participate in mtDNA replication initiation. Like the mammalian origins, where transcription is used as a priming mechanism for DNA synthesis, yeast rep/ori sequences contain an active promoter. Although transcription is required for maintenance of wild-type mtDNA in yeast, the role of the rep/ori promoter as a cis-acting element involved in the replication of wild-type mtDNA is unclear, since mitochondrial deletion mutants need neither transcription nor a rep/ori sequence to maintain their genome. Similarly, transcription from the rep/ori promoter does not seem to be necessary for biased inheritance of mtDNA. As a step to elucidate the function of the rep/ori promoter, we have attempted to detect transcription-dependent DNA transactions in the mtDNA of a hypersuppressive petite mutant. We have examined the mtDNA of the well-characterized petite mutant a-1/1R/Z1, whose repeat unit shelters the rep/ori sequence ori1, in strains carrying either wild-type or null alleles of the nuclear genes encoding the mitochondrial transcription apparatus. Complex DNA transactions were detected that take place around GC-cluster C, an evolutionarily conserved GC-rich sequence block immediately downstream from the rep/ori promoter. These transactions are strictly dependent upon mitochondrial transcription.

  14. Caveolae in Ventricular Myocytes are Required for Stretch-Dependent Conduction Slowing

    PubMed Central

    Pfeiffer, E.R.; Wright, A.T.; Edwards, A.G.; Stowe, J.C.; McNall, K.; Tan, J.; Niesman, I.; Patel, H.H.; Roth, D.M.; Omens, J.H.; McCulloch, A.D.

    2014-01-01

    Mechanical stretch of cardiac muscle modulates action potential propagation velocity, causing potentially arrhythmogenic conduction slowing. The mechanisms by which stretch alters cardiac conduction remain unknown, but previous studies suggest that stretch can affect the conformation of caveolae in myocytes and other cell types. We tested the hypothesis that slowing of action potential conduction due to cardiac myocyte stretch is dependent on caveolae. Cardiac action potential propagation velocities, measured by optical mapping in isolated mouse hearts and in micropatterned mouse cardiomyocyte cultures, decreased reversibly with volume loading or stretch, respectively (by 19±5% and 26±4%). Stretch-dependent conduction slowing was not altered by stretch-activated channel blockade with gadolinium or by GsMTx-4 peptide, but was inhibited when caveolae were disrupted via genetic deletion of caveolin-3 (Cav3 KO) or membrane cholesterol depletion by methyl-β-cyclodextrin. In wild-type mouse hearts, stretch coincided with recruitment of caveolae to the sarcolemma, as observed by electron microscopy. In myocytes from wild-type but not Cav3 KO mice, stretch significantly increased cell membrane capacitance (by 98±64%), electrical time constant (by 285±149%), and lipid recruitment to the bilayer (by 84±39%). Recruitment of caveolae to the sarcolemma during physiologic cardiomyocyte stretch slows ventricular action potential propagation by increasing cell membrane capacitance. PMID:25257915

  15. Reduced conductivity dependence method for increase of dipole localization accuracy in the EEG inverse problem.

    PubMed

    Yitembe, Bertrand Russel; Crevecoeur, Guillaume; Van Keer, Roger; Dupre, Luc

    2011-05-01

    The EEG is a neurological diagnostic tool with high temporal resolution. However, when solving the EEG inverse problem, its localization accuracy is limited because of noise in measurements and available uncertainties of the conductivity value in the forward model evaluations. This paper proposes the reduced conductivity dependence (RCD) method for decreasing the localization error in EEG source analysis by limiting the propagation of the uncertain conductivity values to the solutions of the inverse problem. We redefine the traditional EEG cost function, and in contrast to previous approaches, we introduce a selection procedure of the EEG potentials. The selected potentials are, as low as possible, affected by the uncertainties of the conductivity when solving the inverse problem. We validate the methodology on the widely used three-shell spherical head model with a single electrical dipole and multiple dipoles as source model. The proposed RCD method enhances the source localization accuracy with a factor ranging between 2 and 4, dependent on the dipole location and the noise in measurements. © 2011 IEEE

  16. Large Conductance Switching in a Single-Molecule Device through Room Temperature Spin-Dependent Transport.

    PubMed

    Aragonès, Albert C; Aravena, Daniel; Cerdá, Jorge I; Acís-Castillo, Zulema; Li, Haipeng; Real, José Antonio; Sanz, Fausto; Hihath, Josh; Ruiz, Eliseo; Díez-Pérez, Ismael

    2016-01-13

    Controlling the spin of electrons in nanoscale electronic devices is one of the most promising topics aiming at developing devices with rapid and high density information storage capabilities. The interface magnetism or spinterface resulting from the interaction between a magnetic molecule and a metal surface, or vice versa, has become a key ingredient in creating nanoscale molecular devices with novel functionalities. Here, we present a single-molecule wire that displays large (>10000%) conductance switching by controlling the spin-dependent transport under ambient conditions (room temperature in a liquid cell). The molecular wire is built by trapping individual spin crossover Fe(II) complexes between one Au electrode and one ferromagnetic Ni electrode in an organic liquid medium. Large changes in the single-molecule conductance (>100-fold) are measured when the electrons flow from the Au electrode to either an α-up or a β-down spin-polarized Ni electrode. Our calculations show that the current flowing through such an interface appears to be strongly spin-polarized, thus resulting in the observed switching of the single-molecule wire conductance. The observation of such a high spin-dependent conductance switching in a single-molecule wire opens up a new door for the design and control of spin-polarized transport in nanoscale molecular devices at room temperature.

  17. Temperature-dependent thermal conductivity in silicon nanostructured materials studied by the Boltzmann transport equation

    NASA Astrophysics Data System (ADS)

    Romano, Giuseppe; Esfarjani, Keivan; Strubbe, David A.; Broido, David; Kolpak, Alexie M.

    2016-01-01

    Nanostructured materials exhibit low thermal conductivity because of the additional scattering due to phonon-boundary interactions. As these interactions are highly sensitive to the mean free path (MFP) of phonons, MFP distributions in nanostructures can be dramatically distorted relative to bulk. Here we calculate the MFP distribution in periodic nanoporous Si for different temperatures, using the recently developed MFP-dependent Boltzmann transport equation. After analyzing the relative contribution of each phonon branch to thermal transport in nanoporous Si, we find that at room temperature optical phonons contribute 17 % to heat transport, compared to 5 % in bulk Si. Interestingly, we observe a constant thermal conductivity over the range 200 K dependence of the heat capacity. Our findings, which are in qualitative agreement with the temperature trend of thermal conductivities measured in nanoporous Si-based systems, shed light on the origin of the reduction of thermal conductivity in nanostructured materials and demonstrate the necessity of multiscale heat transport engineering, in which the bulk material and geometry are optimized concurrently.

  18. Methods to detect replication-dependent and replication-independent DNA structure-induced genetic instability

    PubMed Central

    Wang, Guliang; Gaddis, Sally; Vasquez, Karen M.

    2013-01-01

    DNA can adopt a variety of alternative secondary (i.e., non-B DNA) conformations that play important roles in cellular metabolism, including genetic instability, disease etiology, and evolution. While we still have much to learn, research in this field has expanded dramatically in the past decade. We have summarized in our previous Methods review (Wang et al., Methods, 2009) some commonly used techniques to determine non-B DNA structural conformations and non-B DNA-induced genetic instability in prokaryotes and eukaryotes. Since that time, we and others have further characterized mechanisms involved in DNA structure-induced mutagenesis and have proposed both replication-dependent and replication-independent models. Thus, in this review, we highlight some current methodologies to identify DNA replication-related and replication-independent mutations occurring at non-B DNA regions to allow for a better understanding of the mechanisms underlying DNA structure-induced genetic instability. We also describe a new web-based search engine to identify potential intramolecular triplex (H-DNA) and left-handed Z-DNA-forming motifs in entire genomes or at selected sequences of interest. PMID:23954565

  19. RNA dependent DNA replication fidelity of HIV-1 reverse transcriptase: evidence of discrimination between DNA and RNA substrates.

    PubMed

    Kerr, S G; Anderson, K S

    1997-11-18

    The RNA dependent DNA replication fidelity of HIV-1 reverse transcriptase has been investigated using pre-steady-state kinetics under single turnover conditions. In contrast to previous estimates of low replication fidelity of HIV-1 reverse transcriptase, the present study finds the enzyme to be more highly discriminating when an RNA/DNA template-primer is employed as compared with the corresponding DNA/DNA template-primer. The basis of this selectivity is due to extremely slow polymerization kinetics for incorporation of an incorrect deoxynucleotide. The maximum rates for misincorporation (kpol) of dGTP, dCTP, and dTTP opposite a template uridine were 0.2, 0.03, and 0.003 s-1, respectively. The equilibrium dissociation constants (Kd) for the incorrect nucleotide opposite a template uridine were 1.0, 1.1, and 0.7 mM for dGTP, dCTP, and dTTP, respectively. These kinetic values provide fidelity estimates of 26 000 for discrimination against dGTP, 176 000 for dCTP, and 1 x 10(6) for dTTP misincorporation at this position. Similar observations were obtained when incorrect nucleotide misincorporation was examined opposite a template adenine. Thus in a direct comparison of RNA/DNA and DNA/DNA template-primer substrates, HIV-1 RT exhibits approximately a 10-60-fold increase in fidelity. This study augments our current understanding of the similarities and differences of catalytic activity of HIV-1 reverse transcriptase using RNA and DNA substrates. Moreover, these studies lend further support for a model for nucleotide incorporation by HIV-1 reverse transcriptase involving a two-step binding mechanism governed by a rate-limiting conformational change for correct incorporation.

  20. Response-coefficient method for heat-conduction transients with time-dependent inputs

    NASA Technical Reports Server (NTRS)

    Ceylan, Tamer

    1993-01-01

    A theoretical overview of the response coefficient method for heat conduction transients with time-dependent input forcing functions is presented with a number of illustrative applications. The method may be the most convenient and economical if the same problem is to be solved many times with different input-time histories or if the solution time is relatively long. The method is applicable to a wide variety of problems, including irregular geometries, position-dependent boundary conditions, position-dependent physical properties, and nonperiodic irregular input histories. Nonuniform internal energy generation rates within the structure can also be handled by the method. The area of interest is long-time solutions, in which initial condition is unimportant, and not the early transient period. The method can be applied to one dimensional problems in cartesian, cylindrical, and spherical coordinates as well as to two dimensional problems in cartesian and cylindrical coordinates.

  1. DNA-dependent protein kinase is a context dependent regulator of Lmx1a and midbrain specification.

    PubMed

    Hunt, Cameron P; Fabb, Stewart A; Pouton, Colin W; Haynes, John M

    2013-01-01

    The identification of small molecules capable of directing pluripotent cell differentiation towards specific lineages is highly desirable to both reduce cost, and increase efficiency. Within neural progenitors, LIM homeobox transcription factor 1 alpha (Lmx1a) is required for proper development of roof plate and cortical hem structures of the forebrain, as well as the development of floor plate and midbrain dopaminergic neurons. In this study we generated homologous recombinant cell lines expressing either luciferase or β-lactamase under the control of the Lmx1a promoter, and used these cell lines to investigate kinase-mediated regulation of Lmx1a activity during neuronal differentiation. A screen of 143 small molecule tyrosine kinase inhibitors yielded 16 compounds that positively or negatively modulated Lmx1a activity. Inhibition of EGF, VEGF and DNA-dependent protein kinase (DNA-PK) signaling significantly upregulated Lmx1a activity whereas MEK inhibition strongly downregulated its activity. Quantitative FACS analysis revealed that the DNA-PK inhibitor significantly increased the number of Lmx1a+ progenitors while subsequent qPCR showed an upregulation of Notch effectors, the basic helix-loop-helix genes, Hes5 and Hey1. FACS further revealed that DNA-PK-mediated regulation of Lmx1a+ cells is dependent on the rapamycin-sensitive complex, mTORC1. Interestingly, this DNA-PK inhibitor effect was preserved in a co-culture differentiation protocol. Terminal differentiation assays showed that DNA-PK inhibition shifted development of neurons from forebrain toward midbrain character as assessed by Pitx3/TH immunolabeling and corresponding upregulation of midbrain (En1), but not forebrain (FoxG1) transcripts. These studies show that Lmx1a signaling in mouse embryonic stem cells contributes to a molecular cascade establishing neuronal specification. The data presented here identifies a novel regulatory pathway where signaling from DNA-PK appears to suppress midbrain

  2. Conjugation length dependent transport in conducting polymers from a resistor network model

    NASA Astrophysics Data System (ADS)

    Baughman, R. H.; Shacklette, L. W.

    1989-06-01

    The effect of conjugation length (L) upon electronic conductivity components of conducting polymers is derived using a generalized resistor network model. Results are obtained for polymers which contain a statistical distribution of defects which limit conjugation, as well as for regular copolymers which have a fixed phase relationship between interruptions in conjugation on neighboring chains. The short-conjugation-length limits of the derived equations are identical with those previously obtained by evaluating molecular aspects of charge transfer. More specifically, when interchain transport fully limits both chain-direction conductivity (σ1) and an orthogonal conductivity (σ2), the calculated electrical anisotropy is σ1/σ2=L2/6d2F, where d is the interchain separation in a hopping direction, and the product d2F is the mean square average projection of the interchain vector on the electric field direction. The present analysis extends predictive capabilities over the entire range from short conjugation lengths to infinite conjugation lengths. For long conjugation lengths terminated by effectively infinite barrier defects, σ1/σ1(∞) and σ2/σ2(∞) are calculated from the parameters which define polymer structure and, for the former ratio, the ratio of infinite chain conductivities parallel [σ1(∞)] and orthogonal [σ2(∞)] to the chains. A general relationship, appropriate for a still wider range of conjugation lengths, is derived between σ1/σ1(∞) and [σ2/σ1(∞)]1/2(L/d)/F1/2, where the geometrical parameter F is of order unity in directions of high σ2. Using this relationship for a polymer of known structure, the chain-direction electrical conductivity in the infinite-chain limit can be derived from measurements of σ1, σ2, and average conjugation length. Good agreement is obtained between the calculated and observed dependence of conductivity upon conjugation length for available polymers, in which bulk conductivity is limited by interchain

  3. WEE1 inhibition in pancreatic cancer cells is dependent on DNA repair status in a context dependent manner

    PubMed Central

    Lal, Shruti; Zarei, Mahsa; Chand, Saswati N.; Dylgjeri, Emanuela; Mambelli-Lisboa, Nicole C.; Pishvaian, Michael J.; Yeo, Charles J.; Winter, Jordan M.; Brody, Jonathan R.

    2016-01-01

    Pancreatic ductal adenocarcinoma (PDA) is a lethal disease, in part, because of the lack of effective targeted therapeutic options. MK-1775 (also known as AZD1775), a mitotic inhibitor, has been demonstrated to enhance the anti-tumor effects of DNA damaging agents such as gemcitabine. We evaluated the efficacy of MK-1775 alone or in combination with DNA damaging agents (MMC or oxaliplatin) in PDA cell lines that are either DNA repair proficient (DDR-P) or deficient (DDR-D). PDA cell lines PL11, Hs 766T and Capan-1 harboring naturally selected mutations in DNA repair genes FANCC, FANCG and BRCA2 respectively, were less sensitive to MK-1775 as compared to two out of four representative DDR-P (MIA PaCa2 and PANC-1) cell lines. Accordingly, DDR-P cells exhibit reduced sensitivity to MK-1775 upon siRNA silencing of DNA repair genes, BRCA2 or FANCD2, compared to control cells. Only DDR-P cells showed increased apoptosis as a result of early mitotic entry and catastrophe compared to DDR-D cells. Taken together with other recently published reports, our results add another level of evidence that the efficacy of WEE1 inhibition is influenced by the DNA repair status of a cell and may also be dependent on the tumor type and model evaluated. PMID:27616351

  4. Sequence dependence of isothermal DNA amplification via EXPAR

    PubMed Central

    Qian, Jifeng; Ferguson, Tanya M.; Shinde, Deepali N.; Ramírez-Borrero, Alissa J.; Hintze, Arend; Adami, Christoph; Niemz, Angelika

    2012-01-01

    Isothermal nucleic acid amplification is becoming increasingly important for molecular diagnostics. Therefore, new computational tools are needed to facilitate assay design. In the isothermal EXPonential Amplification Reaction (EXPAR), template sequences with similar thermodynamic characteristics perform very differently. To understand what causes this variability, we characterized the performance of 384 template sequences, and used this data to develop two computational methods to predict EXPAR template performance based on sequence: a position weight matrix approach with support vector machine classifier, and RELIEF attribute evaluation with Naïve Bayes classification. The methods identified well and poorly performing EXPAR templates with 67–70% sensitivity and 77–80% specificity. We combined these methods into a computational tool that can accelerate new assay design by ruling out likely poor performers. Furthermore, our data suggest that variability in template performance is linked to specific sequence motifs. Cytidine, a pyrimidine base, is over-represented in certain positions of well-performing templates. Guanosine and adenosine, both purine bases, are over-represented in similar regions of poorly performing templates, frequently as GA or AG dimers. Since polymerases have a higher affinity for purine oligonucleotides, polymerase binding to GA-rich regions of a single-stranded DNA template may promote non-specific amplification in EXPAR and other nucleic acid amplification reactions. PMID:22416064

  5. Pilus-dependent, double-stranded DNA bacteriophage for Caulobacter.

    PubMed Central

    Scholl, D R; Jollick, J D

    1980-01-01

    Caulobacter phage phi 6, previously reported to adsorb specifically to bacterial flagella, was shown here to attach to pili more frequently than to flagella. Phage phi 6 was shown to contain double-stranded DNA by circular dichroism spectroscopy and thermal denaturation accompanied by a hyperchromic shift at 260 nm. Morphologically, phage phi 6 fits group B2 (H.-W. Ackermann, in A. I. Laskin and H. A. Lechevalier, ed., Handbook of Microbiology, vol. 1, p. 638-643, 1973) with a long, noncontractile tail and an elongate head. Pilus-less mutants of the host Caulobacter vibrioides CV6 are phage phi 6 resistant, whereas flagellum-less mutants, which produce pili, are phage susceptible. Treatments of susceptible cells which remove or immobilize pili and flagella, e.g., blending or cyanide, inhibited phage phi 6 infection. Our evidence suggests that phage of phi 6 initiates infection in a manner similar to the pilus-specific phages for Pseudomonas described previously (D. E. Bradley, Virology 51:489-492, 1973; D. E. Bradley and T. L. Pitt, J. Gen. Virol. 24:1-15, 1974). Images PMID:6106721

  6. Burning off DNA methylation: new evidence for oxygen-dependent DNA demethylation.

    PubMed

    Jurkowski, Tomasz P; Jeltsch, Albert

    2011-11-25

    Where do you stop? Three recent publications have described how the oxidation of 5-methylcytosine by Tet dioxygenases does not stop at the 5-hydroxymethylcytosine (5hmC) state, rather further oxidation of 5hmC is involved in DNA demethylation. The nature of the enzymes involved in this process shed light on the dynamics of epigenetic signaling and its evolutionary origin.

  7. Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN

    DOE PAGES

    Stingele, Julian; Bellelli, Roberto; Alte, Ferdinand; ...

    2016-10-27

    Covalent DNA-protein crosslinks (DPCs) are toxic DNA lesions that interfere with essential chromatin transactions, such as replication and transcription. Little was known about DPC-specific repair mechanisms until the recent identification of a DPC-processing protease in yeast. The existence of a DPC protease in higher eukaryotes is inferred from data in Xenopus laevis egg extracts, but its identity remains elusive. Here we identify the metalloprotease SPRTN as the DPC protease acting in metazoans. Loss of SPRTN results in failure to repair DPCs and hypersensitivity to DPC-inducing agents. SPRTN accomplishes DPC processing through a unique DNA-induced protease activity, which is controlled bymore » several sophisticated regulatory mechanisms. Cellular, biochemical, and structural studies define a DNA switch triggering its protease activity, a ubiquitin switch controlling SPRTN chromatin accessibility, and regulatory autocatalytic cleavage. Our data also provide a molecular explanation on how SPRTN deficiency causes the premature aging and cancer predisposition disorder Ruijs-Aalfs syndrome.« less

  8. Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN

    SciTech Connect

    Stingele, Julian; Bellelli, Roberto; Alte, Ferdinand; Hewitt, Graeme; Sarek, Grzegorz; Maslen, Sarah L.; Tsutakawa, Susan E.; Borg, Annabel; Kjær, Svend; Tainer, John A.; Skehel, J. Mark; Groll, Michael; Boulton, Simon J.

    2016-10-27

    Covalent DNA-protein crosslinks (DPCs) are toxic DNA lesions that interfere with essential chromatin transactions, such as replication and transcription. Little was known about DPC-specific repair mechanisms until the recent identification of a DPC-processing protease in yeast. The existence of a DPC protease in higher eukaryotes is inferred from data in Xenopus laevis egg extracts, but its identity remains elusive. Here we identify the metalloprotease SPRTN as the DPC protease acting in metazoans. Loss of SPRTN results in failure to repair DPCs and hypersensitivity to DPC-inducing agents. SPRTN accomplishes DPC processing through a unique DNA-induced protease activity, which is controlled by several sophisticated regulatory mechanisms. Cellular, biochemical, and structural studies define a DNA switch triggering its protease activity, a ubiquitin switch controlling SPRTN chromatin accessibility, and regulatory autocatalytic cleavage. Our data also provide a molecular explanation on how SPRTN deficiency causes the premature aging and cancer predisposition disorder Ruijs-Aalfs syndrome.

  9. Temperature gating and competing temperature-dependent effects in DNA molecular wires

    NASA Astrophysics Data System (ADS)

    Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

    2017-02-01

    While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

  10. Temperature-dependent electrical conduction in porous silicon: Non-Arrhenius behavior

    NASA Astrophysics Data System (ADS)

    Mikrajuddin; Shi, F. G.; Okuyama, K.

    2001-04-01

    A model for the temperature dependence of electrical conduction in a porous silicon (PS) layer is introduced based on the consideration that the onset of electrical conduction is dependent on the formation of a continuous network of conducting sites extending the entire thickness of a PS layer. At an arbitrary temperature, a PS layer consists of both unblocked and blocked sites (blocking energies are larger than thermal fluctuation energy). The fraction of unblocked sites increases with temperature. At low temperatures (T < T1) a PS layer is mainly dominated by a continuous network of blocked sites, while discrete unblocked sites do not form any continuous network extending the entire thickness of a PS layer. At medium temperatures (T1 < T < T2) both continuous networks of unblocked and blocked sites appear in a PS layer. And at higher temperatures (T > T2), a PS layer is mainly dominated by a continuous network of unblocked sites, while discrete blocked sites do not form any continuous network extending the entire thickness of a PS layer. Contrary to the prevalent views, the overall temperature dependence of the electrical conductivity of a PS is not always Arrhenius: it obeys a Vogel-Tammann-Fulcher (VTF) law at T > T2, becomes insulating at T < T1, and exhibits the Arrhenius behavior only for T2 > T > T1. Both T1 and T2 are found to increase with the decrease silicon nanocrytallites sizes. The VTF behavior was derived using the mean-field approximation for Ising model and found to agree with experimental evidences.

  11. Force and twist dependence of RepC nicking activity on torsionally-constrained DNA molecules

    PubMed Central

    Pastrana, Cesar L.; Carrasco, Carolina; Akhtar, Parvez; Leuba, Sanford H.; Khan, Saleem A.; Moreno-Herrero, Fernando

    2016-01-01

    Many bacterial plasmids replicate by an asymmetric rolling-circle mechanism that requires sequence-specific recognition for initiation, nicking of one of the template DNA strands and unwinding of the duplex prior to subsequent leading strand DNA synthesis. Nicking is performed by a replication-initiation protein (Rep) that directly binds to the plasmid double-stranded origin and remains covalently bound to its substrate 5′-end via a phosphotyrosine linkage. It has been proposed that the inverted DNA sequences at the nick site form a cruciform structure that facilitates DNA cleavage. However, the role of Rep proteins in the formation of this cruciform and the implication for its nicking and religation functions is unclear. Here, we have used magnetic tweezers to directly measure the DNA nicking and religation activities of RepC, the replication initiator protein of plasmid pT181, in plasmid sized and torsionally-constrained linear DNA molecules. Nicking by RepC occurred only in negatively supercoiled DNA and was force- and twist-dependent. Comparison with a type IB topoisomerase in similar experiments highlighted a relatively inefficient religation activity of RepC. Based on the structural modeling of RepC and on our experimental evidence, we propose a model where RepC nicking activity is passive and dependent upon the supercoiling degree of the DNA substrate. PMID:27488190

  12. Layer thickness-dependent phonon properties and thermal conductivity of MoS2

    NASA Astrophysics Data System (ADS)

    Gu, Xiaokun; Li, Baowen; Yang, Ronggui

    2016-02-01

    For conventional materials, the thermal conductivity of thin films is usually suppressed when the thickness decreases due to phonon-boundary scattering. However, this is not necessarily true for the van der Waals solids if the thickness is reduced to only a few layers. In this letter, the layer thickness-dependent phonon properties and thermal conductivity in the few-layer MoS2 are studied using the first-principles-based Peierls-Boltzmann transport equation approach. The basal-plane thermal conductivity of 10-μm-long samples is found to monotonically reduce from 138 W/mK to 98 W/mK for naturally occurring MoS2, and from 155 W/mK to 115 W/mK for isotopically pure MoS2, when its thickness increases from one layer to three layers. The thermal conductivity of tri-layer MoS2 approaches to that of bulk MoS2. Both the change of phonon dispersion and the thickness-induced anharmonicity are important for explaining such a thermal conductivity reduction. The increased anharmonicity in bi-layer MoS2 results in stronger phonon scattering for ZAi modes, which is linked to the breakdown of the symmetry in single-layer MoS2.

  13. Use dependence of peripheral nociceptive conduction in the absence of tetrodotoxin-resistant sodium channel subtypes.

    PubMed

    Hoffmann, Tal; Kistner, Katrin; Nassar, Mohammed; Reeh, Peter W; Weidner, Christian

    2016-10-01

    This study examines conduction in peripheral nerves and its use dependence in tetrodotoxin-resistant (TTXr) sodium channel (Nav 1.8, Nav 1.9) knockout and wildtype animals. We observed use-dependent decreases of single fibre and compound action potential amplitude in peripheral mouse C-fibres (wildtype). This matches the previously published hypothesis that increased Na/K-pump activity is not the underlying mechanism for use-dependent changes of neural conduction. Knocking out TTXr sodium channels influences use-dependent changes of conductive properties (action potential amplitude, latency, conduction safety) in the order Nav 1.8 KO > Nav 1.9KO > wildtype. This is most likely explained by different subsets of presumably (relatively) Nav 1.7-rich conducting fibres in knockout animals as compared to wildtypes, in combination with reduced per-pulse sodium influx. Use dependency of peripheral nerves, especially of nociceptors, correlates with receptive properties. Slow inactivation of voltage-gated sodium channels has been discussed to be the underlying mechanism - pointing to a receptive class-related difference of sodium channel equipment. Using electrophysiological recordings of single unmyelinated cutaneous fibres and their compound action potential (AP), we evaluated use-dependent changes in mouse peripheral nerves, and the contribution of the tetrodotoxin-resistant (TTXr) sodium channels Nav 1.8 and Nav 1.9 to these changes. Nerve fibres were electrically stimulated using single or double pulses at 2 Hz. Use-dependent changes of latency, AP amplitude, and duration as well as the fibres' ability to follow the stimulus were evaluated. AP amplitudes substantially diminished in used fibres from C57BL/6 but increased in Nav 1.8 knockout (KO) mice, with Nav 1.9 KO in between. Activity-induced latency slowing was in contrast the most pronounced in Nav 1.8 KOs and the least in wildtype mice. The genotype was also predictive of how long fibres could follow the

  14. Spatial dependence of polycrystalline FTO’s conductance analyzed by conductive atomic force microscope (C-AFM)

    SciTech Connect

    Peixoto, Alexandre Pessoa; Costa, J. C. da

    2014-05-15

    Fluorine-doped Tin oxide (FTO) is a highly transparent, electrically conductive polycrystalline material frequently used as an electrode in organic solar cells and optical-electronic devices [1–2]. In this work a spatial analysis of the conductive behavior of FTO was carried out by Conductive-mode Atomic Force Microscopy (C-AFM). Rare highly oriented grains sample give us an opportunity to analyze the top portion of polycrystalline FTO and compare with the border one. It is shown that the current flow essentially takes place through the polycrystalline edge at grain boundaries.

  15. Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

    PubMed Central

    Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

    2008-01-01

    Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

  16. Examination of the causes of covariation between conduct disorder symptoms and vulnerability to drug dependence.

    PubMed

    Button, Tanya M M; Hewitt, John K; Rhee, Soo Hyun; Young, Susan E; Corley, Robin P; Stallings, Michael C

    2006-02-01

    Conduct disorder (CD) symptoms and substance dependence commonly co-occur. Both phenotypes are highly heritable and a common genetic influence on the covariation has been suggested. The aim of this study was to determine the extent to which genes and environment contribute to the covariance between CD and drug dependence using twins from the Colorado Longitudinal Twin Sample and the Colorado Twin Registry. A total of 880 twin pairs (237 monozygotic [MZ] female, 195 MZ male, 116 dizygotic [DZ] female, 118 DZ male and 214 DZ opposite-sex) aged 13 to 18 (mean = 15.65) were included in the analysis. CD was assessed by lifetime Diagnostic and Statistical Manual of Mental Disorders (4th ed.; DSM-IV; American Psychiatric Association, 1994) symptom count and a polysubstance dependence vulnerability index was developed from responses to the Composite International Diagnostic Interview--Substance Abuse Module. A bivariate Cholesky Decomposition model was used to partition the cause of variation and covariation of the two phenotypes. No sex-limitation was observed in our data, and male and female parameter estimates were constrained to be equal. Both CD symptoms and dependence vulnerability were significantly heritable, and genes, shared environment and nonshared environment all contributed to the covariation between them. Genes contributed 35% of the phenotypic covariance, shared environment contributed 46%, and nonshared environmental influences contributed the remaining 19% to the phenotypic covariance. Therefore, there appears to be pleiotropic genetic influence on CD symptoms and dependence vulnerability.

  17. Thrombopoietin-increased DNA-PK-dependent DNA repair limits hematopoietic stem and progenitor cell mutagenesis in response to DNA damage.

    PubMed

    de Laval, Bérengère; Pawlikowska, Patrycja; Petit-Cocault, Laurence; Bilhou-Nabera, Chrystèle; Aubin-Houzelstein, Geneviève; Souyri, Michèle; Pouzoulet, Frédéric; Gaudry, Murielle; Porteu, Françoise

    2013-01-03

    DNA double-strand breaks (DSBs) represent a serious threat for hematopoietic stem cells (HSCs). How cytokines and environmental signals integrate the DNA damage response and contribute to HSC-intrinsic DNA repair processes remains unknown. Thrombopoietin (TPO) and its receptor, Mpl, are critical factors supporting HSC self-renewal and expansion. Here, we uncover an unknown function for TPO-Mpl in the regulation of DNA damage response. We show that DNA repair following γ-irradiation (γ-IR) or the action of topoisomerase-II inhibitors is defective in Mpl(-/-) and in wild-type mouse or human hematopoietic stem and progenitor cells treated in the absence of TPO. TPO stimulates DNA repair in vitro and in vivo by increasing DNA-PK-dependent nonhomologous end-joining efficiency. This ensures HSC chromosomal integrity and limits their long-term injury in response to IR. This shows that niche factors can modulate the HSC DSB repair machinery and opens new avenues for administration of TPO agonists for minimizing radiotherapy-induced HSC injury and mutagenesis. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Mycobacterium tuberculosis NAD+-dependent DNA ligase is selectively inhibited by glycosylamines compared with human DNA ligase I

    PubMed Central

    Srivastava, Sandeep Kumar; Dube, Divya; Tewari, Neetu; Dwivedi, Namrata; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2005-01-01

    DNA ligases are important enzymes which catalyze the joining of nicks between adjacent bases of double-stranded DNA. NAD+-dependent DNA ligases (LigA) are essential in bacteria and are absent in humans. They have therefore been identified as novel, validated and attractive drug targets. Using virtual screening against an in-house database of compounds and our recently determined crystal structure of the NAD+ binding domain of the Mycobacterium tuberculosis LigA, we have identified N1, Nn-bis-(5-deoxy-α-d-xylofuranosylated) diamines as a novel class of inhibitors for this enzyme. Assays involving M.tuberculosis LigA, T4 ligase and human DNA ligase I show that these compounds specifically inhibit LigA from M.tuberculosis. In vitro kinetic and inhibition assays demonstrate that the compounds compete with NAD+ for binding and inhibit enzyme activity with IC50 values in the µM range. Docking studies rationalize the observed specificities and show that among several glycofuranosylated diamines, bis xylofuranosylated diamines with aminoalkyl and 1, 3-phenylene carbamoyl spacers mimic the binding modes of NAD+ with the enzyme. Assays involving LigA-deficient bacterial strains show that in vivo inhibition of ligase by the compounds causes the observed antibacterial activities. They also demonstrate that the compounds exhibit in vivo specificity for LigA over ATP-dependent ligase. This class of inhibitors holds out the promise of rational development of new anti-tubercular agents. PMID:16361267

  19. Mycobacterium tuberculosis NAD+-dependent DNA ligase is selectively inhibited by glycosylamines compared with human DNA ligase I.

    PubMed

    Srivastava, Sandeep Kumar; Dube, Divya; Tewari, Neetu; Dwivedi, Namrata; Tripathi, Rama Pati; Ramachandran, Ravishankar

    2005-01-01

    DNA ligases are important enzymes which catalyze the joining of nicks between adjacent bases of double-stranded DNA. NAD+-dependent DNA ligases (LigA) are essential in bacteria and are absent in humans. They have therefore been identified as novel, validated and attractive drug targets. Using virtual screening against an in-house database of compounds and our recently determined crystal structure of the NAD+ binding domain of the Mycobacterium tuberculosis LigA, we have identified N1, N(n)-bis-(5-deoxy-alpha-D-xylofuranosylated) diamines as a novel class of inhibitors for this enzyme. Assays involving M.tuberculosis LigA, T4 ligase and human DNA ligase I show that these compounds specifically inhibit LigA from M.tuberculosis. In vitro kinetic and inhibition assays demonstrate that the compounds compete with NAD+ for binding and inhibit enzyme activity with IC50 values in the microM range. Docking studies rationalize the observed specificities and show that among several glycofuranosylated diamines, bis xylofuranosylated diamines with aminoalkyl and 1, 3-phenylene carbamoyl spacers mimic the binding modes of NAD+ with the enzyme. Assays involving LigA-deficient bacterial strains show that in vivo inhibition of ligase by the compounds causes the observed antibacterial activities. They also demonstrate that the compounds exhibit in vivo specificity for LigA over ATP-dependent ligase. This class of inhibitors holds out the promise of rational development of new anti-tubercular agents.

  20. Facet-dependent electrical conductivity properties of Cu2O crystals.

    PubMed

    Tan, Chih-Shan; Hsu, Shih-Chen; Ke, Wei-Hong; Chen, Lih-Juann; Huang, Michael H

    2015-03-11

    It is interesting to examine facet-dependent electrical properties of single Cu2O crystals, because such study greatly advances our understanding of various facet effects exhibited by semiconductors. We show a Cu2O octahedron is highly conductive, a cube is moderately conductive, and a rhombic dodecahedron is nonconductive. The conductivity differences are ascribed to the presence of a thin surface layer having different degrees of band bending. When electrical connection was made on two different facets of a rhombicuboctahedron, a diode-like response was obtained, demonstrating the potential of using single polyhedral nanocrystals as functional electronic components. Density of state (DOS) plots for three layers of Cu2O (111), (100), and (110) planes show respective metallic, semimetal, and semiconducting band structures. By examining DOS plots for varying number of planes, the surface layer thicknesses responsible for the facet-dependent electrical properties of Cu2O crystals have been determined to be below 1.5 nm for these facets.

  1. Dependence of interface conductivity on relevant physical parameters in polarized Fermi mixtures

    NASA Astrophysics Data System (ADS)

    Ebrahimian, N.; Mehrafarin, M.; Afzali, R.

    2012-10-01

    We consider a mass-asymmetric polarized Fermi system in the presence of Hartree-Fock (HF) potentials. We concentrate on the BCS regime with various interaction strengths and numerically obtain the allowed values of the chemical and HF potentials, as well as the mass ratio. The functional dependence of the heat conductivity of the N-SF interface on relevant physical parameters, namely the temperature, the mass ratio, and the interaction strength, is obtained. In particular, we show that the interface conductivity starts to drop with decreasing temperature at the temperature, Tm, where the mean kinetic energy of the particles is just sufficient to overcome the SF gap. We obtain Tm as a function of the mass ratio and the interaction strength. The variation of the heat conductivity, at fixed temperature, with the HF potentials and the imbalance chemical potential is also obtained. Finally, because the range of relevant temperatures increases for larger values of the mass ratio, we consider the 6Li-40K mixture separately by taking the temperature dependence of the pair potential into account.

  2. Mutation dependance of the mitochondrial DNA copy number in the first stages of human embryogenesis.

    PubMed

    Monnot, Sophie; Samuels, David C; Hesters, Laetitia; Frydman, Nelly; Gigarel, Nadine; Burlet, Philippe; Kerbrat, Violaine; Lamazou, Frédéric; Frydman, René; Benachi, Alexandra; Feingold, Josué; Rotig, Agnes; Munnich, Arnold; Bonnefont, Jean-Paul; Steffann, Julie

    2013-05-01

    Mitochondrial DNA (mtDNA) content is thought to remain stable over the preimplantation period of human embryogenesis that is, therefore, suggested to be entirely dependent on ooplasm mtDNA capital. We have explored the impact of two disease-causing mutations [m.3243A>G myopathy, encephalopathy, lactic acidosis and stroke-like syndrome (MELAS) and m.8344A>G myoclonic epilepsy associated with ragged-red fibers (MERRF)] on mtDNA amounts in human oocytes and day 4-5 preimplantation embryos. The mtDNA amount was stable in MERRF and control materials, whereas gradually increasing from the germinal vesicle of oogenesis to the blastocyst stage of embryogenesis in MELAS cells, MELAS embryos carrying ∼3-fold higher mtDNA amount than control embryos (P = 0.0003). A correlation between mtDNA copy numbers and mutant loads was observed in MELAS embryos (R(2) = 0.42, P < 0.0013), suggestive of a compensation for the respiratory chain defect resulting from high mutation levels. These results suggest that mtDNA can replicate in early embryos and emphasize the need for sufficient amount of wild-type mtDNA to sustain embryonic development in humans.

  3. Concentration-dependent organization of DNA by the dinoflagellate histone-like protein HCc3

    PubMed Central

    Chan, Yuk-Hang; Wong, Joseph T. Y.

    2007-01-01

    The liquid crystalline chromosomes of dinoflagellates are the alternative to the nucleosome-based organization of chromosomes in the eukaryotes. These nucleosome-less chromosomes have to devise novel ways to maintain active parts of the genome. The dinoflagellate histone-like protein HCc3 has significant sequence identity with the bacterial DNA-binding protein HU. HCc3 also has a secondary structure resembling HU in silico. We have examined HCc3 in its recombinant form. Experiments on DNA-cellulose revealed its DNA-binding activity is on the C-terminal domain. The N-terminal domain is responsible for intermolecular oligomerization as demonstrated by cross-linking studies. However, HCc3 could not complement Escherichia coli HU-deficient mutants, suggesting functional differences. In ligation assays, HCc3-induced DNA concatenation but not ring closure as the DNA-bending HU does. The basic HCc3 was an efficient DNA condensing agent, but it did not behave like an ordinary polycationic compound. HCc3 also induced specific structures with DNA in a concentration-dependent manner, as demonstrated by atomic force microscopy (AFM). At moderate concentration of HCc3, DNA bridging and bundling were observed; at high concentrations, the complexes were even more condensed. These results are consistent with a biophysical role for HCc3 in maintaining extended DNA loops at the periphery of liquid crystalline chromosomes. PMID:17412706

  4. Sodium chlorate induces DNA damage and DNA-protein cross-linking in rat intestine: A dose dependent study.

    PubMed

    Ali, Shaikh Nisar; Ansari, Fariheen Aisha; Arif, Hussain; Mahmood, Riaz

    2017-06-01

    Sodium chlorate (NaClO3) is widely used in paper and pulp industries and as a non-selective herbicide. It is also a major by-product generated upon disinfection of drinking water by chlorine dioxide. In this study, we have investigated the genotoxicity of NaClO3 on the small intestine of rats. Adult male rats were divided into 5 groups: one control and four NaClO3 treated groups. The NaClO3 treated groups were given a single acute oral dose of NaClO3 (100, 250, 500 and 750 mg/kg body weight) and sacrificed 24 h later. Administration of NaClO3 caused significant DNA damage in a dose dependent manner in the rat intestine. This was evident from the comet assay which showed DNA strand breaks and was further confirmed by agarose gel electrophoresis and release of free nucleotides. Increased DNA protein cross-linking in NaClO3 administered groups showed formation of a critical lesion which hampers activities of proteins/enzymes involved in DNA repair, transcription and replication. Thus, oral administration of NaClO3 induces DNA damage in the rat intestine, probably through chlorate induced production of reactive oxygen species. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. FAST TRACK COMMUNICATION: Conformation dependence of molecular conductance: chemistry versus geometry

    NASA Astrophysics Data System (ADS)

    Finch, Christopher M.; Sirichantaropass, Skon; Bailey, Steven W.; Grace, Iain M.; García-Suárez, Víctor M.; Lambert, Colin J.

    2008-01-01

    Recent experiments by Venkataraman et al (2006 Nature 442 904) on a series of molecular wires with varying chemical compositions revealed a linear dependence of the conductance on cos2 θ, where θ is the angle of twist between neighbouring aromatic rings. To investigate whether or not this dependence has a more general applicability, we present a first-principles theoretical study of the transport properties of this family of molecules as a function of the chemical composition, conformation and the contact atom and geometry. If the Fermi energy EF lies within the HOMO-LUMO (highest occupied molecular orbital-lowest unoccupied molecular orbital) gap, then we reproduce the above experimental results. More generally, however, if EF is located within either the LUMO or the HOMO states, the presence of resonances destroys the linear dependence of the conductance on cos2 θ and gives rise to non-monotonic behaviour associated with the level structure of the different molecules. Our results suggest that the above experiments provide a novel method for extracting spectroscopic information about molecules contacted to electrodes.

  6. Growth factor-dependent initiation of DNA replication in nuclei isolated from an interleukin 3-dependent murine myeloid cell line.

    PubMed

    Munshi, N C; Gabig, T G

    1990-01-01

    To study the proliferative response of hematopoietic cells to growth factors at the molecular level, we developed a cell-free system for growth factor-dependent initiation of genomic DNA replication. Nuclei were isolated from the IL-3-dependent cell line NFS/N1-H7 after a 10-h period of IL-3 deprivation. Cytosolic and membrane-containing subcellular fractions were prepared from proliferating NFS/N1-H7 cells. Nuclei from the nonproliferating cells (+/- IL-3) showed essentially no incorporation of [3H]thymidine during a 16-h incubation with a mixture of unlabeled GTP, ATP, UTP, CTP, dGTP, dATP, dCTP, and [3H]dTTP. When the combination of IL-3, a cytosolic fraction, and a membrane-containing fraction from proliferating cells was added to nuclei from nonproliferating cells, a burst of [3H]thymidine incorporation into DNA began after a 12-h lag period, attained a maximal rate at 16 h, and reached a level of 860 pmol thymidine/10(6) nuclei at 24 h (corresponding to replication of approximately 56% total mouse genomic DNA). This DNA synthesis was inhibited approximately 90% by the specific DNA polymerase alpha inhibitor aphidicolin. Deletion of a single cellular component or IL-3 from the system resulted in a marked reduction of DNA replication (-membrane, 80 +/- 4%; -cytosol, 90% +/- 4%; -IL-3, 74 +/- 7% inhibition). This model requires a growth factor (IL-3), a sedimentable cell fraction containing its receptor and possibly additional membrane-associated components, and a cytosolic fraction. It appears to recapitulate the molecular events required for progression from early G1 to S phase of the cell cycle induced by IL-3 binding to its receptor.

  7. Growth factor-dependent initiation of DNA replication in nuclei isolated from an interleukin 3-dependent murine myeloid cell line.

    PubMed Central

    Munshi, N C; Gabig, T G

    1990-01-01

    To study the proliferative response of hematopoietic cells to growth factors at the molecular level, we developed a cell-free system for growth factor-dependent initiation of genomic DNA replication. Nuclei were isolated from the IL-3-dependent cell line NFS/N1-H7 after a 10-h period of IL-3 deprivation. Cytosolic and membrane-containing subcellular fractions were prepared from proliferating NFS/N1-H7 cells. Nuclei from the nonproliferating cells (+/- IL-3) showed essentially no incorporation of [3H]thymidine during a 16-h incubation with a mixture of unlabeled GTP, ATP, UTP, CTP, dGTP, dATP, dCTP, and [3H]dTTP. When the combination of IL-3, a cytosolic fraction, and a membrane-containing fraction from proliferating cells was added to nuclei from nonproliferating cells, a burst of [3H]thymidine incorporation into DNA began after a 12-h lag period, attained a maximal rate at 16 h, and reached a level of 860 pmol thymidine/10(6) nuclei at 24 h (corresponding to replication of approximately 56% total mouse genomic DNA). This DNA synthesis was inhibited approximately 90% by the specific DNA polymerase alpha inhibitor aphidicolin. Deletion of a single cellular component or IL-3 from the system resulted in a marked reduction of DNA replication (-membrane, 80 +/- 4%; -cytosol, 90% +/- 4%; -IL-3, 74 +/- 7% inhibition). This model requires a growth factor (IL-3), a sedimentable cell fraction containing its receptor and possibly additional membrane-associated components, and a cytosolic fraction. It appears to recapitulate the molecular events required for progression from early G1 to S phase of the cell cycle induced by IL-3 binding to its receptor. Images PMID:2104881

  8. Viral DNA Replication-Dependent DNA Damage Response Activation during BK Polyomavirus Infection

    PubMed Central

    Verhalen, Brandy; Justice, Joshua L.; Imperiale, Michael J.

    2015-01-01

    ABSTRACT BK polyomavirus (BKPyV) reactivation is associated with severe human disease in kidney and bone marrow transplant patients. The interplay between viral and host factors that regulates the productive infection process remains poorly understood. We have previously reported that the cellular DNA damage response (DDR) is activated upon lytic BKPyV infection and that its activation is required for optimal viral replication in primary kidney epithelial cells. In this report, we set out to determine what viral components are responsible for activating the two major phosphatidylinositol 3-kinase-like kinases (PI3KKs) involved in the DDR: ataxia telangiectasia mutated (ATM) kinase and ATM and Rad3-related (ATR) kinase. Using a combination of UV treatment, lentivirus transduction, and mutant virus infection experiments, our results demonstrate that neither the input virus nor the expression of large T antigen (TAg) alone is sufficient to trigger the activation of ATM or ATR in our primary culture model. Instead, our data suggest that the activation of both the ATM- and ATR-mediated DDR pathways is linked to viral DNA replication. Intriguingly, a TAg mutant virus that is unable to activate the DDR causes substantial host DNA damage. Our study provides insight into how DDRs are activated by polyomaviruses in primary cells with intact cell cycle checkpoints and how the activation might be linked to the maintenance of host genome stability. IMPORTANCE Polyomaviruses are opportunistic pathogens that are associated with several human diseases under immunosuppressed conditions. BK polyomavirus (BKPyV) affects mostly kidney and bone marrow transplant patients. The detailed replication mechanism of these viruses remains to be determined. We have previously reported that BKPyV activates the host DNA damage response (DDR), a response normally used by the host cell to combat genotoxic stress, to aid its own replication. In this study, we identified that the trigger for DDR

  9. A DNA break– and phosphorylation-dependent positive feedback loop promotes immunoglobulin class-switch recombination

    PubMed Central

    Vuong, Bao Q; Ucher, Anna J; Donghia, Nina M; Gu, Xiwen; Nicolas, Laura; Nowak, Urszula; Rahman, Numa; Strout, Matthew P; Mills, Kevin D; Stavnezer, Janet; Chaudhuri, Jayanta

    2014-01-01

    The ability of activation-induced cytidine deaminase (AID) to efficiently mediate class-switch recombination (CSR) is dependent on its phosphorylation at Ser38; however, the trigger that induces AID phosphorylation and the mechanism by which phosphorylated AID drives CSR have not been elucidated. Here we found that phosphorylation of AID at Ser38 was induced by DNA breaks. Conversely, in the absence of AID phosphorylation, DNA breaks were not efficiently generated at switch (S) regions in the immunoglobulin heavy-chain locus (Igh), consistent with a failure of AID to interact with the endonuclease APE1. Additionally, deficiency in the DNA-damage sensor ATM impaired the phosphorylation of AID at Ser38 and the interaction of AID with APE1. Our results identify a positive feedback loop for the amplification of DNA breaks at S regions through the phosphorylation- and ATM-dependent interaction of AID with APE1. PMID:24097111

  10. ATP-dependent chromatin remodeling and DNA double-strand break repair.

    PubMed

    van Attikum, Haico; Gasser, Susan M

    2005-08-01

    The repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genomic stability. Two pathways for the repair of DBSs, nonhomologous end-joining (NHEJ) and homologous recombination (HR), have evolved in eukaryotes. These pathways, like processes such as transcription and replication, act on DNA that is embedded in nucleosomes. Recent studies have shown that DNA repair, like transcription, is facilitated both by histone tail modification and by ATP-dependent chromatin remodeling. This review emphasizes recent reports that demonstrate a function for the ATP-dependent chromatin remodeling complexes INO80 and RSC in NHEJ and HR. We also discuss the possible role of SWR1- and TIP60-mediated nucleosomal histone exchange in DNA repair.

  11. Ionic conduction in non-uniform nanopores and DNA translocation: a Nernst-Planck-Jacobs one-dimensional description

    NASA Astrophysics Data System (ADS)

    Marini Bettolo Marconi, Umberto; Melchionna, Simone

    2013-12-01

    The conduction of an electrolyte solution in the presence of a DNA intruder in a synthetic charged pore is studied by theoretical means. The pore conductivity is controlled by two competing mechanisms: the steric effect of the DNA decreases the current and the extra-surface charges determine an increase in the number of charge carriers that increase the current. By using a Nernst-Planck description of the electrolyte and a one-dimensional advection-diffusion equation similar to the Jacobs-Zwanzig method, we obtain the characteristic curve within the local electroneutrality approximation. Such an information allows predicting the variation of the conductance caused by the DNA intruder and determining the current blockage/enhancement phase diagram.

  12. Purification of DNA Damage-Dependent PARPs from E. coli for Structural and Biochemical Analysis.

    PubMed

    Langelier, Marie-France; Steffen, Jamin D; Riccio, Amanda A; McCauley, Michael; Pascal, John M

    2017-01-01

    Human PARP-1, PARP-2, and PARP-3 are key players in the cellular response to DNA damage, during which their catalytic activities are acutely stimulated through interaction with DNA strand breaks. There are also roles for these PARPs outside of the DNA damage response, most notably for PARP-1 and PARP-2 in the regulation of gene expression. Here, we describe a general method to express and purify these DNA damage-dependent PARPs from E. coli cells for use in biochemical assays and for structural and functional analysis. The procedure allows for robust production of PARP enzymes that are free of contaminant DNA that can interfere with downstream analysis. The described protocols have been updated from our earlier reported methods, most importantly to introduce PARP inhibitors in the production scheme to cope with enzyme toxicity that can compromise the yield of purified protein.

  13. DNAPKcs-dependent arrest of RNA polymerase II transcription in the presence of DNA breaks.

    PubMed

    Pankotai, Tibor; Bonhomme, Céline; Chen, David; Soutoglou, Evi

    2012-02-12

    DNA double-strand break (DSB) repair interferes with ongoing cellular processes, including replication and transcription. Although the process of replication stalling upon collision of replication forks with damaged DNA has been extensively studied, the fate of elongating RNA polymerase II (RNAPII) that encounters a DSB is not well understood. We show that the occurrence of a single DSB at a human RNAPII-transcribed gene leads to inhibition of transcription elongation and reinitiation. Upon inhibition of DNA protein kinase (DNAPK), RNAPII bypasses the break and continues transcription elongation, suggesting that it is not the break per se that inhibits the processivity of RNAPII, but the activity of DNAPK. We also show that the mechanism of DNAPK-mediated transcription inhibition involves the proteasome-dependent pathway. The results point to the pivotal role of DNAPK activity in the eviction of RNAPII from DNA upon encountering a DNA lesion.

  14. In situ studies of strain dependent transport properties of conducting polymers on elastomeric substrates

    NASA Astrophysics Data System (ADS)

    Vijay, Venugopalan; Rao, Arun D.; Narayan, K. S.

    2011-04-01

    We report the changes in the surface electrical resistance, R, of conducting polymer, Poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) (PEDOT:PSS) films coated on appropriate flexible substrates in stretched conditions. These studies are important in the context of flexible organic electronic applications. In situ conductivity measurements on pristine PEDOT:PSS thin films on elastomeric substrates upon stretching reveal a minima in R as a function of strain, x, prior to the expected increase at higher strain levels. The studies emphasize (i) role of substrates, (ii) stress-induced anisotropic features, and temperature dependence of R (iii) in comparison of R(x) in polymer films to that of conventional metal films. The stress induced changes is modeled in terms of effective medium approximation.

  15. Stability of DNA repeats in Escherichia coli dam mutant strains indicates a Dam methylation-dependent DNA deletion process.

    PubMed

    Troester, H; Bub, S; Hunziker, A; Trendelenburg, M F

    2000-11-27

    In this study we report on the stabilization of short direct repetitive DNA elements. We arranged a 20 bp SK-primer element in a direct repeat manner within the cloning vector pBluescript KS (+). This resulted in an array of 27 direct repeats consisting of 24 bp units. We show that this plasmid could only be propagated without deletion of repeats in dam mutant Escherichia coli hosts, whereas all efforts to use strains that were defective in the methylation-dependent restriction system and the recA- or the mismatch repair-dependent deletion system failed. The deletions always affected whole repeat units and not parts of them, leading to an unpredictable reduction of the unit number down to a range of between 12 and two during propagation. We conclude that a Dam methylation-dependent, but recA- and mismatch repair-independent, deletion mechanism caused the DNA rearrangements without an obvious involvement of the known methylated-DNA restriction systems.

  16. Pressure dependence of ionic conductivity of hydrated and dehydrated zeolites A

    NASA Astrophysics Data System (ADS)

    Goryainov, S. V.; Secco, R. A.; Huang, Y.; Liu, H.

    2007-03-01

    Hydrated and dehydrated zeolites MA (where M=Li, Na and K) with LTA structure have been studied by impedance spectroscopy with scanning frequency from 1 Hz to 1 MHz at high pressure up to 4.5 GPa and high temperature up to 250 °C. Anomalous increase in electrical AC conductivity at about 1.5-2 GPa observed in hydrated zeolites is associated with changes in crystalline structure leading to the formation of high-diffusion state of cation and water stuffing of the channels. In dehydrated zeolites, electrical conductivity is controlled by diffusion of cations (Li +, Na + and K +), which is determined by cation sites and aluminosilicate ring windows. LiA and NaA zeolites show normal decrease of conductivity with pressure, whereas KA zeolite exhibits the anomalous dependence with considerable increase and then fast decrease of conductivity. The behaviour of KA zeolite is associated with nearly central location of cation site in 8-membered ring, different from that in LiA and NaA zeolites.

  17. Saturation-Dependent Hydraulic Conductivity Anisotropy for Multifluid Systems in Porous Media

    SciTech Connect

    Zhang, Z. F.; Oostrom, Mart; Ward, Andy L.

    2007-11-01

    The hydraulic conductivity of unsaturated anisotropic soils has recently been described with a tensorial connectivity-tortuosity (TCT) concept. We extend this concept to unsaturated porous media with two or three immiscible fluids. Mathematical expressions to describe the conductivity of each fluid in anisotropic porous media under unsaturated condition are derived in the form of symmetric second order tensors. The theory is applicable to the combination of any type of saturation-pressure formulation and a generalized hydraulic conductivity model. The extended model shows that the anisotropic coefficient of a fluid is independent of the saturation of other fluids. Synthetic Miller-similar soils having hypothetical anisotropy were defined by allowing the saturated hydraulic conductivity to have different correlation ranges for different directions of flow. The extended TCT concept was tested using synthetic soils with four levels of heterogeneity and four levels of anisotropy. Numerical experiments of infiltration of two liquid phases, i.e., water and the nonaqueous phase liquid (NAPL) carbon tetrachloride, were carried out to test the extended model. The results show that, similar to water in a two-fluid (air-water) system, NAPL retention curves in a three-fluid (air-NAPL-water) system were independent of flow direction but dependent on soil heterogeneity, while the connectivity-tortuosity coefficients are functions of both soil heterogeneity and anisotropy. The extended TCT model accurately describes unsaturated hydraulic functions of anisotropic soils and can be combined into commonly used relative permeability functions for use in multifluid flow and transport numerical simulations.

  18. [Sound reception of marine mammales depending on parameters and sound-conducting tracks].

    PubMed

    Babushina, E S

    2000-01-01

    Underwater audiograms of a northern fur seal, a Caspic seal and a dolphin aphalina were measured under conditions of full or partial (the head above the water) submergence of animals using the method of instrumental conditioned reflexes with food reinforcement. The possibility and peculiarities of sound conduction through the body of marine mammals were investigated by isolating the auricle from the medium of sound spreading (under conditions of partial submergence). By the same technique, the hearing thresholds of Caspic seal were measured in the presence of broad- and narrow-band noises with different central frequencies depending on the medium (underwater or in air) the signal and the noise masker were presented and on the sound-conducting ways (under conditions of full or partial submergence of animals). It was found that aerial and underwater sound-conducting canals of the Caspic seal were functionally connected with each other. The level of hearing masking in the Caspic seal is determined by the tracts of signal and noise conduction, by the differences in sensitivity to the signal and masker, and by their spectral structure. Apparently, the tissues of the seal body considerably change the amplitude-frequency characteristics of the sound.

  19. Single molecule tunneling conductance: The temperature and length dependences controlled by conformational fluctuations

    NASA Astrophysics Data System (ADS)

    Kornyshev, A. A.; Kuznetsov, A. M.

    2006-05-01

    We present a model for a tunnelling conductance of a chain molecule controlled by fluctuations of relative conformations between nearest neighbour units of the chain molecule. The model leads to a simple formula which in one regime reproduces recently reported Arrhenius dependences for alkanedithiols [W. Haiss, H. van Zalinge, D. Bethel, J. Ulstrup, D.J. Schiffrin, R.J. Nichols, Faraday Discuss. 131 (19) (2005)] with an activation energy proportional to the length of the molecule, whereas in other regimes it shows activationless behaviour corresponding to the tunnelling across more rigid molecules. The general formula covers the transition between the two limits, predicting some new dependences that could be interesting to verify experimentally.

  20. Electrical current dependence of the ionic conduction in Zn4Sb3

    NASA Astrophysics Data System (ADS)

    Kunioka, Haruno; Yamamoto, Atsushi; Iida, Tsutomu; Obara, Haruhiko

    2017-09-01

    The ion conduction in Zn4Sb3 was investigated to determine the potential of Zn4Sb3 as a thermoelectric element. Various temperature differences and electrical currents were applied and the resulting voltages were monitored for 1 h. The thermoelectric elements were analyzed after the tests by scanning electron microscopy with energy-dispersive X-ray spectroscopy (SEM/EDX), resistance scanning, and Seebeck coefficient mapping. Zn ions migrated in the current direction and formed a ZnSb layer; the thickness was proportional to the current density and strongly dependent on the temperature.

  1. Disparate Strain Dependent Thermal Conductivity of Two-dimensional Penta-Structures.

    PubMed

    Liu, Huake; Qin, Guangzhao; Lin, Yuan; Hu, Ming

    2016-06-08

    Two-dimensional (2D) carbon allotrope called penta-graphene was recently proposed from first-principles calculations and various similar penta-structures emerged. Despite significant effort having been dedicated to electronic structures and mechanical properties, little research has been focused on thermal transport in penta-structures. Motivated by this, we performed a comparative study of thermal transport properties of three representative pentagonal structures, namely penta-graphene, penta-SiC2, and penta-SiN2, by solving the phonon Boltzmann transport equation with interatomic force constants extracted from first-principles calculations. Unexpectedly, the thermal conductivity of the three penta-structures exhibits diverse strain dependence, despite their very similar geometry structures. While the thermal conductivity of penta-graphene exhibits standard monotonic reduction by stretching, penta-SiC2 possesses an unusual nonmonotonic up-and-down behavior. More interestingly, the thermal conductivity of penta-SiN2 has 1 order of magnitude enhancement due to the strain induced buckled to planar structure transition. The mechanism governing the diverse strain dependence is identified as the competition between the change of phonon group velocity and phonon lifetime of acoustic phonon modes with combined effect from the unique structure transition for penta-SiN2. The disparate thermal transport behavior is further correlated to the fundamentally different bonding nature in the atomic structures with solid evidence from the distribution of deformation charge density and more in-depth molecular orbital analysis. The reported giant and robust tunability of thermal conductivity may inspire intensive research on other derivatives of penta-structures as potential materials for emerging nanoelectronic devices. The fundamental physics understood from this study also solidifies the strategy to engineer thermal transport properties of broad 2D materials by simple mechanical

  2. Transitional Metal/Chalcogen Dependant Interactions of Hairpin DNA with Transition Metal Dichalcogenides, MX2.

    PubMed

    Loo, Adeline Huiling; Bonanni, Alessandra; Sofer, Zdenek; Pumera, Martin

    2015-08-03

    Owing to the attractive properties that transition metal dichalcogenides (TMDs) display, they have found recent application in the fabrication of biosensing devices. These devices involve the immobilization of a recognition element such as DNA onto the surface of TMDs. Therefore, it is imperative to examine the interactions between TMDs and DNA. Herein, we explore the effect of different transition metals (Mo and W) and chalcogens (S and Se) on the interactions between hairpin DNA and TMDs of both bulk and t-BuLi exfoliated forms. We discovered that the interactions are strongly dependent on the metal/chalcogen composition in TMDs.

  3. Electrochemical impedance sensing of DNA hybridization on conducting polymer film-modified diamond.

    PubMed

    Gu, Huiru; Su, Xiao di; Loh, Kian Ping

    2005-07-21

    The impedimetric sensing of DNA hybridization on polyaniline/polyacrylate (PANI/PAA)-modified boron-doped diamond (BDD) electrode has been investigated. An ultrathin film of PANI-PAA copolymer was electropolymerized onto the diamond surfaces to provide carboxylic groups for tethering to DNA sensing probes. The electrochemical impedance and the intrinsic electroactivity of the polymer-diamond interface were analyzed after the hybridization reaction with target and non-target DNA. The impedance measurement shows changes in the impedance modulus as well as electron-transfer resistance at the stage of probe DNA immobilization (single-strand), as well as after hybridization with target DNA (double-strand). DNA hybridization increases the capacitance of the polymer-DNA layer and reduces the overall impedance of the DNA-polymer-diamond stack significantly. The polymer-modified BDD electrode shows no detectable nonspecific adsorption, with good selectivity between the complementary DNA targets and the one-base mismatch targets. The detection limit was measured to be 2 x 10(-8) M at 1000 Hz. Denaturing test on the hybridized probe and subsequent reuse of the probe indicates chemical robustness of the sensor. Our results suggest that electropolymerization followed by the immobilization of biomolecules is a simple and effective way of creating a functional biomolecular scaffold on the diamond surface. In addition, label-free electrochemical impedance method can provide direct and noninvasive sensing of DNA hybridization on BDD.

  4. Dynamic DNA methylation in the brain: a new epigenetic mark for experience-dependent plasticity

    PubMed Central

    Tognini, Paola; Napoli, Debora; Pizzorusso, Tommaso

    2015-01-01

    Experience-dependent plasticity is the ability of brain circuits to undergo molecular, structural and functional changes as a function of neural activity. Neural activity continuously shapes our brain during all the stages of our life, from infancy through adulthood and beyond. Epigenetic modifications of histone proteins and DNA seem to be a leading molecular mechanism to modulate the transcriptional changes underlying the fine-tuning of synaptic connections and circuitry rewiring during activity-dependent plasticity. The recent discovery that cytosine methylation is an epigenetic mark particularly dynamic in brain cells has strongly increased the interest of neuroscientists in understanding the role of covalent modifications of DNA in activity-induced remodeling of neuronal circuits. Here, we provide an overview of the role of DNA methylation and hydroxylmethylation in brain plasticity both during adulthood, with emphasis on learning and memory related processes, and during postnatal development, focusing specifically on experience-dependent plasticity in the visual cortex. PMID:26379502

  5. Matching base-pair number dependence of the kinetics of DNA-DNA hybridization studied by surface plasmon fluorescence spectroscopy.

    PubMed

    Tawa, Keiko; Yao, Danfeng; Knoll, Wolfgang

    2005-08-15

    Two single-stranded DNA oligonucleotides consisting of complementary base-pairs can form double strands. This phenomenon is well studied in solutions, however, in order to clarify the physical mechanism of the hybridization occurring at a solid/solution interface, we studied the kinetics by surface plasmon fluorescence spectroscopy (SPFS): one single-stranded oligo-DNA (probe-DNA) was immobilized on the substrate, the other one (target-DNA) labelled with a fluorescent probe was added to the flow cell. After hybridization, the chromophores could be excited by the surface plasmon mode and their fluorescence detected with high sensitivity. The dependence of the k(on) and k(off) rate constants on the length of the hybridizing oligonucleotides was investigated by using a MM0 series (no mismatch) and the kinetics was found to be well described by a Langmuir adsorption model. From these measurements we found that also in the case of surface hybridization the affinity of the duplexes decreases as the number of matching base-pairs decreases from 15 to 10. In order to show that SPFS is the powerful technique with high sensitivity, the hybridization process for mixed target-oligos was measured by SPFS and analyzed by an expanded Langmuir model in which two components of target-oligo can bind to probe-DNA at the sensor surface competitively. Two sets of the k(on) and k(off) obtained from the experiment are successfully consistent with the k(on) and k(off) obtained from experiments for single (pure) target-DNA.

  6. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    SciTech Connect

    Snodin, Benedict E. K. Mosayebi, Majid; Schreck, John S.; Romano, Flavio; Doye, Jonathan P. K.; Randisi, Ferdinando; Šulc, Petr; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  7. Proteasome-dependent degradation of replisome components regulates faithful DNA replication.

    PubMed

    Roseaulin, Laura C; Noguchi, Chiaki; Noguchi, Eishi

    2013-08-15

    The replication machinery, or the replisome, collides with a variety of obstacles during the normal process of DNA replication. In addition to damaged template DNA, numerous chromosome regions are considered to be difficult to replicate owing to the presence of DNA secondary structures and DNA-binding proteins. Under these conditions, the replication fork stalls, generating replication stress. Stalled forks are prone to collapse, posing serious threats to genomic integrity. It is generally thought that the replication checkpoint functions to stabilize the replisome and replication fork structure upon replication stress. This is important in order to allow DNA replication to resume once the problem is solved. However, our recent studies demonstrated that some replisome components undergo proteasome-dependent degradation during DNA replication in the fission yeast Schizosaccharomyces pombe. Our investigation has revealed the involvement of the SCF(Pof3) (Skp1-Cullin/Cdc53-F-box) ubiquitin ligase in replisome regulation. We also demonstrated that forced accumulation of the replisome components leads to abnormal DNA replication upon replication stress. Here we review these findings and present additional data indicating the importance of replisome degradation for DNA replication. Our studies suggest that cells activate an alternative pathway to degrade replisome components in order to preserve genomic integrity.

  8. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

    NASA Astrophysics Data System (ADS)

    Snodin, Benedict E. K.; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S.; Romano, Flavio; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.; Doye, Jonathan P. K.

    2015-06-01

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na+] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  9. Introducing improved structural properties and salt dependence into a coarse-grained model of DNA.

    PubMed

    Snodin, Benedict E K; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S; Romano, Flavio; Ouldridge, Thomas E; Tsukanov, Roman; Nir, Eyal; Louis, Ard A; Doye, Jonathan P K

    2015-06-21

    We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na(+)] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

  10. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging.

    PubMed

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J; Smith, Douglas E

    2016-08-01

    In many viruses molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50-100 nm prohead shells(1, 2). Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions(3). Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems(4-8). Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles(5) we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.(9, 10).

  11. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging

    NASA Astrophysics Data System (ADS)

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J.; Smith, Douglas E.

    2016-08-01

    In many viruses, molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50-100 nm prohead shells. Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions. Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems. Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.

  12. Nuclear extracts lacking DNA-dependent protein kinase are deficient in multiple round transcription.

    PubMed

    Woodard, R L; Anderson, M G; Dynan, W S

    1999-01-01

    We have compared levels of in vitro transcription in nuclear extracts from DNA-dependent protein kinase (DNA-PK)-deficient and DNA-PK-containing Chinese hamster ovary cell lines. DNA-PK-deficient cell lines are radiosensitive mutants lacking either the catalytic subunit or the 80-kDa subunit of the Ku protein regulatory component. Extracts from DNA-PK-deficient cell lines had a 2-7-fold decrease in the level of in vitro transcription when compared with matched controls. This decrease was observed with several promoters. Transcription could be restored to either of the deficient extracts by addition of small amounts of extract from the DNA-PK-containing cell lines. Transcription was not restored by addition of purified DNA-PK catalytic subunit, Ku protein, or individually purified general transcription factors. We conclude that extracts from DNA-PK-deficient cells lack a positively acting regulatory factor or a complex of factors not readily reconstituted with individual proteins. We have also investigated the mechanistic defect in the deficient extracts and have found that the observed differences in transcription levels between Ku-positive and Ku-negative cell lines can be attributed solely to a greater ability of the Ku-positive nuclear extracts to carry out secondary initiation events subsequent to the first round of transcription.

  13. Single DNA molecule jamming and history-dependent dynamics during motor-driven viral packaging

    PubMed Central

    Keller, Nicholas; Grimes, Shelley; Jardine, Paul J.; Smith, Douglas E.

    2016-01-01

    In many viruses molecular motors forcibly pack single DNA molecules to near-crystalline density into ~50–100 nm prohead shells1, 2. Unexpectedly, we found that packaging frequently stalls in conditions that induce net attractive DNA-DNA interactions3. Here, we present findings suggesting that this stalling occurs because the DNA undergoes a nonequilibrium jamming transition analogous to that observed in many soft-matter systems, such as colloidal and granular systems4–8. Experiments in which conditions are changed during packaging to switch DNA-DNA interactions between purely repulsive and net attractive reveal strongly history-dependent dynamics. An abrupt deceleration is usually observed before stalling, indicating that a transition in DNA conformation causes an abrupt increase in resistance. Our findings suggest that the concept of jamming can be extended to a single polymer molecule. However, compared with macroscopic samples of colloidal particles5 we find that single DNA molecules jam over a much larger range of densities. We attribute this difference to the nanoscale system size, consistent with theoretical predictions for jamming of attractive athermal particles.9, 10 PMID:27540410

  14. The Borrelia burgdorferi telomere resolvase, ResT, possesses ATP-dependent DNA unwinding activity.

    PubMed

    Huang, Shu Hui; Cozart, McKayla R; Hart, Madison A; Kobryn, Kerri

    2016-12-09

    Spirochetes of the genus Borrelia possess unusual genomes harboring multiple linear and circular replicons. The linear replicons are terminated by covalently closed hairpin (hp) telomeres. Hairpin telomeres are formed from replicated intermediates by the telomere resolvase, ResT, in a phosphoryl transfer reaction with mechanistic similarities to those promoted by type 1B topoisomerases and tyrosine recombinases. There is growing evidence that ResT is multifunctional. Upon ResT depletion DNA replication unexpectedly ceases. Additionally, ResT possesses RecO-like biochemical activities being able to promote single-strand annealing on both free ssDNA and ssDNA complexed with cognate single-stranded DNA binding protein. We report here that ResT possesses DNA-dependent ATPase activity that promotes DNA unwinding with a 3'-5' polarity. ResT can unwind a variety of substrates including synthetic replication forks and D-loops. We demonstrate that ResT's twin activities of DNA unwinding and annealing can drive regression of a model replication fork. These properties are similar to those of the RecQ helicase of the RecF pathway involved in DNA gap repair. We propose that ResT's combination of activities implicates it in replication and recombination processes operating on the linear chromosome and plasmids of Borrelia burgdorferi.

  15. Characterization of a voltage-dependent conductance in the basolateral membrane of leech skin epithelium.

    PubMed

    Schnizler, M; Clauss, W

    1998-05-01

    Voltage clamp studies were performed on the dorsal integument of Hirudo medicinalis. Under apical calcium-free conditions an inward-directed component of transepithelial current was activated by changes of transepithelial voltage. Depolarization caused up to 50% increase of the transepithelial sodium current. Hyperpolarization had no comparable effects. With calcium (1.8 mM) or amiloride (100 microM) in the apical solution and in sodium-free solutions the inward-directed current failed to increase after depolarization. Activation also occurred under chloride-free conditions. Permeabilization of the apical membrane by nystatin (5 microM) increased the current activation significantly. After nystatin, calcium as well as amiloride lost their inhibitory effects. This indicates a basolateral localization of the voltage-dependent conductance. Vesicle insertion or cytoskeletal structures are probably not involved in regulation, as seen by the lack of effects of brefeldin A and the cytochalasins B and D. However, serosal hyposmolar solutions (170 mosmol.1(-1)) caused a reinforced activation of the current. Our results indicate a voltage-dependent conductance in a tight sodium-absorbing epithelium.

  16. Dependence of current switching dynamics on contact conductivity in semiconductor superlattices

    NASA Astrophysics Data System (ADS)

    Teitsworth, Stephen W.; Xu, Huidong

    2006-03-01

    Numerical simulation results are presented for a discrete drift-diffusion electronic transport model appropriate to weakly-coupled semiconductor superlattices [1]. Sequential resonant tunneling between adjacent quantum wells is the primary conduction mechanism for this model which also incorporates an effective contact conductivity σc. We study the dependence on σc of time-averaged current-voltage characteristics and transient current response to abrupt steps in applied voltage. For intermediate values of σc, three qualitatively distinct transient responses -- each associated with a different mechanism for the relocation of a static charge accumulation layer [1] - are observed for different values of voltage step Vstep; these involve, respectively, 1) the motion of a single charge accumulation layer, 2) the simultaneous motion of one depletion and two accumulation layers [2], and 3) the simultaneous motion of two accumulation layers. The range of Vstep values for each mechanism and the relocation times associated with each are studied as a function of σc; a critical value of σc is identified above which the second relocation mechanism is not observed for any value of Vstep. Relocation times are found to depend sensitively on specific values of σc and Vstep. [1] L. L. Bonilla and H. T. Grahn, Rep. Prog. Phys. 68, pp. 577-683 (2005), and refs. therein. [2] A. Amann, A. Wacker, L. L. Bonilla, and E. Schoell, Phys. Rev. E 63, 066207 (2001).

  17. Adenylation-Dependent Conformation and Unfolding Pathways of the NAD+-Dependent DNA Ligase from the Thermophile Thermus scotoductus

    PubMed Central

    Georlette, Daphné; Blaise, Vinciane; Bouillenne, Fabrice; Damien, Benjamin; Thorbjarnardóttir, Sigridur H.; Depiereux, Eric; Gerday, Charles; Uversky, Vladimir N.; Feller, Georges

    2004-01-01

    In the last few years, an increased attention has been focused on NAD+-dependent DNA ligases. This is mostly due to their potential use as antibiotic targets, because effective inhibition of these essential enzymes would result in the death of the bacterium. However, development of an efficient drug requires that the conformational modifications involved in the catalysis of NAD+-dependent DNA ligases are understood. From this perspective, we have investigated the conformational changes occurring in the thermophilic Thermus scotoductus NAD+-DNA ligase upon adenylation, as well as the effect of cofactor binding on protein resistance to thermal and chemical (guanidine hydrochloride) denaturation. Our results indicate that cofactor binding induces conformational rearrangement within the active site and promotes a compaction of the enzyme. These data support an induced “open-closure” process upon adenylation, leading to the formation of the catalytically active enzyme that is able to bind DNA. These conformational changes are likely to be associated with the protein function, preventing the formation of nonproductive complexes between deadenylated ligases and DNA. In addition, enzyme adenylation significantly increases resistance of the protein to thermal denaturation and GdmCl-induced unfolding, establishing a thermodynamic link between ligand binding and increased conformational stability. Finally, chemical unfolding of deadenylated and adenylated enzyme is accompanied by accumulation of at least two equilibrium intermediates, the molten globule and premolten globule states. Maximal populations of these intermediates are shifted toward higher GdmCl concentrations in the case of the adenylated ligase. These data provide further insights into the properties of partially folded intermediates. PMID:14747344

  18. CgII cleaves DNA using a mechanism distinct from other ATP-dependent restriction endonucleases.

    PubMed

    Toliusis, Paulius; Zaremba, Mindaugas; Silanskas, Arunas; Szczelkun, Mark D; Siksnys, Virginijus

    2017-08-21

    The restriction endonuclease CglI from Corynebacterium glutamicum recognizes an asymmetric 5'-GCCGC-3' site and cleaves the DNA 7 and 6/7 nucleotides downstream on the top and bottom DNA strands, respectively, in an NTP-hydrolysis dependent reaction. CglI is composed of two different proteins: an endonuclease (R.CglI) and a DEAD-family helicase-like ATPase (H.CglI). These subunits form a heterotetrameric complex with R2H2 stoichiometry. However, the R2H2·CglI complex has only one nuclease active site sufficient to cut one DNA strand suggesting that two complexes are required to introduce a double strand break. Here, we report studies to evaluate the DNA cleavage mechanism of CglI. Using one- and two-site circular DNA substrates we show that CglI does not require two sites on the same DNA for optimal catalytic activity. However, one-site linear DNA is a poor substrate, supporting a mechanism where CglI complexes must communicate along the one-dimensional DNA contour before cleavage is activated. Based on experimental data, we propose that adenosine triphosphate (ATP) hydrolysis by CglI produces translocation on DNA preferentially in a downstream direction from the target, although upstream translocation is also possible. Our results are consistent with a mechanism of CglI action that is distinct from that of other ATP-dependent restriction-modification enzymes. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Manipulating graphene's lattice to create pseudovector potentials, discover anomalous friction, and measure strain dependent thermal conductivity

    NASA Astrophysics Data System (ADS)

    Kitt, Alexander Luke

    Graphene is a single atomic sheet of graphite that exhibits a diverse range of unique properties. The electrons in intrinsic graphene behave like relativistic Dirac fermions; graphene has a record high Young's modulus but extremely low bending rigidity; and suspended graphene exhibits very high thermal conductivity. These properties are made more intriguing because with a thickness of only a single atomic layer, graphene is both especially affected by its environment and readily manipulated. In this dissertation the interaction between graphene and its environment as well as the exciting new physics realized by manipulating graphene's lattice are investigated. Lattice manipulations in the form of strain cause alterations in graphene's electrical dispersion mathematically analogous to the vector potential associated with a magnetic field. We complete the standard description of the strain-induced vector potential by explicitly including the lattice deformations and find new, leading order terms. Additionally, a strain engineered device with large, localized, plasmonically enhanced pseudomagnetic fields is proposed to couple light to pseudomagnetic fields. Accurate strain engineering requires a complete understanding of the interactions between a two dimensional material and its environment, particularly the adhesion and friction between graphene and its supporting substrate. We measure the load dependent sliding friction between mono-, bi-, and trilayer graphene and the commonly used silicon dioxide substrate by analyzing Raman spectra of circular, graphene sealed microchambers under variable external pressure. We find that the sliding friction for trilayer graphene behaves normally, scaling with the applied load, whereas the friction for monolayer and bilayer graphene is anomalous, scaling with the inverse of the strain in the graphene. Both strain and graphene's environment are expected to affect the quadratically dispersed out of plane acoustic phonon. Although

  20. Carrier interactions and porosity initiated reversal of temperature dependence of thermal conduction in nanoscale tin films

    SciTech Connect

    Kaul, Pankaj B.; Prakash, Vikas

    2014-01-14

    Recently, tin has been identified as an attractive electrode material for energy storage/conversion technologies. Tin thin films have also been utilized as an important constituent of thermal interface materials in thermal management applications. In this regards, in the present paper, we investigate thermal conductivity of two nanoscale tin films, (i) with thickness 500 ± 50 nm and 0.45% porosity and (ii) with thickness 100 ± 20 nm and 12.21% porosity. Thermal transport in these films is characterized over the temperature range from 40 K–310 K, using a three-omega method for multilayer configurations. The experimental results are compared with analytical predictions obtained by considering both phonon and electron contributions to heat conduction as described by existing frequency-dependent phenomenological models and BvK dispersion for phonons. The thermal conductivity of the thicker tin film (500 nm) is measured to be 46.2 W/m-K at 300 K and is observed to increase with reduced temperatures; the mechanisms for thermal transport are understood to be governed by strong phonon-electron interactions in addition to the normal phonon-phonon interactions within the temperature range 160 K–300 K. In the case of the tin thin film with 100 nm thickness, porosity and electron-boundary scattering supersede carrier interactions, and a reversal in the thermal conductivity trend with reduced temperatures is observed; the thermal conductivity falls to 1.83 W/m-K at 40 K from its room temperature value of 36.1 W/m-K. In order to interpret the experimental results, we utilize the existing analytical models that account for contributions of electron-boundary scattering using the Mayadas-Shatzkes and Fuchs-Sondheimer models for the thin and thick films, respectively. Moreover, the effects of porosity on carrier transport are included using a previous treatment based on phonon radiative transport involving frequency-dependent mean free paths

  1. Role of acoustic phonons in frequency dependent electronic thermal conductivity of graphene

    NASA Astrophysics Data System (ADS)

    Bhalla, Pankaj

    2017-03-01

    We study the effect of the electron-phonon interaction on the finite frequency dependent electronic thermal conductivity of two dimensional graphene. We calculate it for various acoustic phonons present in graphene and characterized by different dispersion relations using the memory function approach. It is found that the electronic thermal conductivity κe (T) in the zero frequency limit follows different power law for the longitudinal/transverse and the flexural acoustic phonons. For the longitudinal/transverse phonons, κe (T) ∼T-1 at the low temperature and saturates at the high temperature. These signatures qualitatively agree with the results calculated by solving the Boltzmann equation analytically and numerically. Similarly, for the flexural phonons, we find that κe (T) shows T 1 / 2 law at the low temperature and then saturates at the high temperature. In the finite frequency regime, we observe that the real part of the electronic thermal conductivity, Re [κe (ω , T) ] follows ω-2 behavior at the low frequency and becomes frequency independent at the high frequency.

  2. Temperature-dependent conduction mechanism of vertically aligned graphene nanoflakes incorporated with nitrogen in situ

    NASA Astrophysics Data System (ADS)

    Kumar, Pawan

    2017-07-01

    Carbon nanostructured materials have been widely investigated and explored all over the world. However, the frontiers of applications and basic examinations related to these materials have yet to be opened in terms of their stability and robustness in the required environment. I report the temperature-dependent transport properties of vertically aligned graphene nanoflakes (GNFs) at room temperature to 800 K. Investigation of GNFs incorporated with nitrogen (N2) of varying concentration in situ and their possible conduction mechanism has been carried out over the entire range of temperatures mentioned above. N-type conductivity, carrier concentration, mobility and modulation at various temperatures are observed by means of Hall-effect measurements. The film of GNFs incorporated with nitrogen in situ persists in a linear trend, satisfying conduction behaviour expectations for all measured transport parameters with only a small discrete-point anomaly. Supporting evidence of N2 incorporation and structural modifications is studied by scanning electron microscopy, Raman spectroscopy and x-ray photoemission spectroscopy. The observation findings also provide the thermal stability of N2 incorporated into two-dimensional vertically standing GNFs.

  3. Substrate-dependent thermal conductivity of aluminum nitride thin-films processed at low temperature

    SciTech Connect

    Belkerk, B. E.; Bensalem, S.; Soussou, A.; Carette, M.; Djouadi, M. A.; Scudeller, Y.; Al Brithen, H.

    2014-12-01

    In this paper, we report on investigation concerning the substrate-dependent thermal conductivity (k) of Aluminum Nitride (AlN) thin-films processed at low temperature by reactive magnetron sputtering. The thermal conductivity of AlN films grown at low temperature (<200 °C) on single-crystal silicon (Si) and amorphous silicon nitride (SiN) with thicknesses ranging from 100 nm to 4000 nm was measured with the transient hot-strip technique. The k values for AlN films on SiN were found significantly lower than those on Silicon consistently with their microstructures revealed by X-ray diffraction, high resolution scanning electron microscopy, and transmission electron microscopy. The change in k was due to the thermal boundary resistance found to be equal to 10 × 10{sup −9} Km{sup 2}W{sup −1} on SiN against 3.5 × 10{sup −9} Km{sup 2}W{sup −1} on Si. However, the intrinsic thermal conductivity was determined with a value as high as 200 Wm{sup −1}K{sup −1} whatever the substrate.

  4. The dependence of leaf hydraulic conductance on irradiance during HPFM measurements: any role for stomatal response?

    PubMed

    Tyree, Melvin T; Nardini, Andrea; Salleo, Sebastiano; Sack, Lawren; El Omari, Bouchra

    2005-02-01

    This paper examines the dependence of whole leaf hydraulic conductance to liquid water (K(L)) on irradiance when measured with a high pressure flowmeter (HPFM). During HPFM measurements, water is perfused into leaves faster than it evaporates hence water infiltrates leaf air spaces and must pass through stomates in the liquid state. Since stomates open and close under high versus low irradiance, respectively, the possibility exists that K(L) might change with irradiance if stomates close tightly enough to restrict water movement. However, the dependence of K(L) on irradiance could be due to a direct effect of irradiance on the hydraulic properties of other tissues in the leaf. In the present study, K(L) increased with irradiance for 6 of the 11 species tested. Whole leaf conductance to water vapour, g(L), was used as a proxy for stomatal aperture and the time-course of changes in K(L) and g(L) was studied during the transition from low to high irradiance and from high to low irradiance. Experiments showed that in some species K(L) changes were not paralleled by g(L) changes. Measurements were also done after perfusion of leaves with ABA which inhibited the g(L) response to irradiance. These leaves showed the same K(L) response to irradiance as control leaves. These experimental results and theoretical calculations suggest that the irradiance dependence of K(L) is more consistent with an effect on extravascular (and/or vascular) tissues rather than stomatal aperture. Irradiance-mediated stimulation of aquaporins or hydrogel effects in leaf tracheids may be involved.

  5. Optogenetic Control of Ca(2+) and Voltage-Dependent Large Conductance (BK) Potassium Channels.

    PubMed

    Mager, Thomas; Wood, Phillip G; Bamberg, Ernst

    2017-03-24

    Ca(2+) concentration jumps for the activation of Ca(2+)-dependent ion channels or transporters can be obtained either by fast solution exchange or by the use of caged Ca(2+). Here, we report on an alternate optogenetic method for the activation of Ca(2+) and voltage-dependent large conductance (BK) potassium channels. This was achieved through the use of the light-gated channelrhodopsin 2 variant, CatCh(Calcium translocating Channelrhodopsin) with enhanced Ca, which produces locally [Ca(2+)] in the μM range on the inner side of the membrane, without significant [Ca(2+)] increase in the cytosol. BK channel subunits α and β1 were expressed together with CatCh in HEK293 cells, and voltage and Ca(2+) dependence were analyzed. Light activation of endogenous BK channels under native conditions in astrocytes and glioma cells was also investigated. Additionally, BK channels were used as sensors for the calibration of the [Ca(2+)] on the inner surface of the cell membrane. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Time-Dependent Soil Hydraulic Conductivity in Salt-Affected Soils

    NASA Astrophysics Data System (ADS)

    Russo, D.

    2012-04-01

    Mixed salts such as sodium-calcium salts interact with the soil matrix. The physico chemical interactions between the soil solution and the soil matrix (SS-SM), particularly in the presence of smectite minerals (e.g., montmorillonite), may change the soil pore-size distribution; the latter could affect the soil hydraulic properties, i.e., the soil hydraulic conductivity and soil water retention. Since the magnitude of the SS-SM interactions depend on time-dependent flow-controlled attributes, i.e., soil solution concentration and composition and water content, the resultant hydraulic properties are also time-dependent. The present talk focuses on the effect of mixed-ion solutions on soil hydraulic properties relevant to water flow and solute transport. Experimental evidence on, and an approach for modeling of the effect of soil solution concentration and composition on the local- (Darcy) scale soil hydraulic properties are presented and discussed. Long-term effect of the soil solution concentration and composition on the soil hydraulic properties, and, concurrently, on water flow and solute transport are presented through simulations of field-scale flow and transport.

  7. Thickness-dependent Crack Propagation in Uniaxially Strained Conducting Graphene Oxide Films on Flexible Substrates.

    PubMed

    Sakorikar, Tushar; Kavitha, Maheswari Kavirajan; Vayalamkuzhi, Pramitha; Jaiswal, Manu

    2017-06-01

    We demonstrate that crack propagation in uniaxially strained reduced graphene oxide (rGO) films is substantially dependent on the film thickness, for films in the sub-micron regime. rGO film on flexible polydimethylsiloxane (PDMS) substrate develop quasi-periodic cracks upon application of strain. The crack density and crack width follow contrasting trends as film thickness is increased and the results are described in terms of a sequential cracking model. Further, these cracks also have a tendency to relax when the strain is released. These features are also reflected in the strain-dependent electrical dc and ac conductivity studies. For an optimal thickness (3-coat), the films behave as strain-resistant, while for all other values it becomes strain-responsive, attributed to a favorable combination of crack density and width. This study of the film thickness dependent response and the crack propagation mechanism under strain is a significant step for rationalizing the application of layered graphene-like systems for flexible optoelectronic and strain sensing applications. When the thickness is tuned for enhanced extent of crack propagation, strain-sensors with gauge factor up to ∼470 are realized with the same material. When thickness is chosen to suppress the crack propagation, strain-resistive flexible TiO2- rGO UV photoconductor is realized.

  8. Antecedents of opioid dependence and personality disorder: attention-deficit/hyperactivity disorder and conduct disorder.

    PubMed

    Modestin, J; Matutat, B; Würmle, O

    2001-01-01

    Both attention-deficit/hyperactivity disorder (ADHD) and conduct disorder (CD) were explored as possible antecedents of opioid dependence and personality disorder. One hundred adult opioid-dependent, treatment-seeking male inpatients were explored; an extended clinical semistructured interview to collect sociodemographic, drug use related, and clinical data and the Structured Clinical Interview for DSM-IV personality disorders SCID-II were carried out. Four groups of patients, namely ADHD alone (4 patients), ADHD + CD (7 patients), CD alone (47 patients) and no ADHD/no CD (42 patients) were identified and compared with each other. The results indicate that ADHD alone does not predispose to the development of opioid dependence in male inpatients. Childhood ADHD may nevertheless be found more frequently in male opioid addicts due to its comorbidity with CD, which was identified in more than half of our sample. Patients with ADHD history seemed to go through the drug abuse career earlier and to develop more frequently histrionic and obsessive-compulsive personality disorder. Over half of the CD patients developed borderline and/or antisocial personality disorder; both ADHD and CD predispose significantly to the PD development. Early substance use preventive measures are necessary in children and adolescents suffering from CD and from ADHD comorbid with CD.

  9. A mammalian microRNA cluster controls DNA methylation and telomere recombination via Rbl2-dependent regulation of DNA methyltransferases

    PubMed Central

    Benetti, Roberta; Gonzalo, Susana; Jaco, Isabel; Muñoz, Purificación; Gonzalez, Susana; Schoeftner, Stefan; Murchison, Elizabeth; Andl, Thomas; Chen, Taiping; Klatt, Peter; Li, En; Serrano, Manuel; Millar, Sarah; Hannon, Gregory; Blasco, Maria A

    2010-01-01

    Dicer initiates RNA interference by generating small RNAs involved in various silencing pathways. Dicer participates in centromeric silencing, but its role in the epigenetic regulation of other chromatin domains has not been explored. Here we show that Dicer1 deficiency in Mus musculus leads to decreased DNA methylation, concomitant with increased telomere recombination and telomere elongation. These DNA-methylation defects correlate with decreased expression of Dnmt1, Dnmt3a and Dnmt3b DNA methyltransferases (Dnmts), and methylation levels can be recovered by their overexpression. We identify the retinoblastoma-like 2 protein (Rbl2) as responsible for decreased Dnmt expression in Dicer1-null cells, suggesting the existence of Dicer-dependent small RNAs that target Rbl2. We identify the miR-290 cluster as being downregulated in Dicer1-deficient cells and show that it silences Rbl2, thereby controlling Dnmt expression. These results identify a pathway by which miR-290 directly regulates Rbl2-dependent Dnmt expression, indirectly affecting telomere-length homeostasis. PMID:18311151

  10. Modeling the Time-dependent Changes in Electrical Conductivity of Basaltic Melts With Redox State

    NASA Astrophysics Data System (ADS)

    Pommier, A.; Gaillard, F.; Pichavant, M.

    2008-12-01

    The electrical conductivity σ is an efficient probe of mass transfer processes within silicate melts and magmas. Little attention has been given to the influence of redox state (fO2) on the melts conductivity. We present an experimental setup allowing electrical conductivity measurements for basaltic melts under variable fO2. We demonstrate a significant dependence of σ with fO2, allowing to characterize in situ the mechanisms and kinetics of redox changes in the melt. Experiments were conducted on basalts from Pu'u 'O'o, Hawaii, and Mt.Vesuvius, Italy. Measurements were performed cylindrical glass samples (OD: 6mm, ID: 1mm, L: 8mm) using an impedance spectrometer. Experiments were conducted in a 1atm vertical furnace, from 1200°C to 1400°C. Variable gas atmosphere (air, CO2 or CO-CO2 gas mixtures) were used, imposing ΔNNO from -1 to +7. Electrical conductivities were determined for the two melts at constant fO2, different T (constant fO2) and constant T, different fO2 (variable fO2) obtained by changing the gas composition. Isothermal reduction and oxidation cycles were performed. Glasses quenched from different T and fO2 conditions were analyzed by electron microprobe, the FeO concentration was determined by wet chemistry. In constant fO2 experiments, a small but detectable effect of fO2 on σ is evidenced. At 1300°C, the difference in the Kilauea sample conductivity between reduced (ΔNNO=-1) and oxidized (ΔNNO=+7) fO2 is <1(ohm.m)-1, the sample being more conductive when reduced. The temperature dependence of σ was fitted using Arrhenian equations, the activation energy Ea being 100kJ/mol. Sodium was identified as the main charge carrier in the melts. The fO2-effect on σ can thus be attributed to the influence of the Fe2+/Fe3+ ratio on sodium mobility. The fO2-dependence of σ was included in the model of Pommier et al.(2008), allowing the conductivity of natural melts to be calculated as a function of T, P, H2O, and fO2. Variable fO2 experiments

  11. Temperature-dependent ultraviolet resonance Raman spectroscopy of the premelting state of dA.dT DNA.

    PubMed

    Chan, S S; Austin, R H; Mukerji, I; Spiro, T G

    1997-04-01

    Poly(dA).poly(dT) and DNA duplex with four or more adenine bases in a row exhibits a broad, solid-state structural premelting transition at about 35 degrees C. The low-temperature structure is correlated with the phenomena of "bent DNA." We have conducted temperature-dependent ultraviolet resonance Raman measurements of the structural transition using poly(dA).poly(dT) at physiological salt conditions, and are able to identify, between the high and low temperature limits, changes in the vibrational frequencies associated with the C4 carbonyl stretching mode in the thymine ring and the N6 scissors mode of the amine in the adenine ring of poly(dA).poly(dT). This work supports the model that the oligo-dA tracts' solid-state structural premelting transition is due to a set of cross-stand bifurcated hydrogen bonds between consecutive dA. dT pairs.

  12. Revisiting the Valence and Conduction Band Size Dependence of PbS Quantum Dot Thin Films

    SciTech Connect

    Miller, Elisa M.; Kroupa, Daniel M.; Zhang, Jianbing; Schulz, Philip; Marshall, Ashley R.; Kahn, Antoine; Lany, Stephan; Luther, Joseph M.; Beard, Matthew C.; Perkins, Craig L.; van de Lagemaat, Jao

    2016-03-22

    We use a high signal-to-noise X-ray photoelectron spectrum of bulk PbS, GW calculations, and a model assuming parabolic bands to unravel the various X-ray and ultraviolet photoelectron spectral features of bulk PbS as well as determine how to best analyze the valence band region of PbS quantum dot (QD) films. X-ray and ultraviolet photoelectron spectroscopy (XPS and UPS) are commonly used to probe the difference between the Fermi level and valence band maximum (VBM) for crystalline and thin-film semiconductors. However, we find that when the standard XPS/UPS analysis is used for PbS, the results are often unrealistic due to the low density of states at the VBM. Instead, a parabolic band model is used to determine the VBM for the PbS QD films, which is based on the bulk PbS experimental spectrum and bulk GW calculations. Our analysis highlights the breakdown of the Brillioun zone representation of the band diagram for large band gap, highly quantum confined PbS QDs. We have also determined that in 1,2-ethanedithiol-treated PbS QD films the Fermi level position is dependent on the QD size; specifically, the smallest band gap QD films have the Fermi level near the conduction band minimum and the Fermi level moves away from the conduction band for larger band gap PbS QD films. This change in the Fermi level within the QD band gap could be due to changes in the Pb:S ratio. In addition, we use inverse photoelectron spectroscopy to measure the conduction band region, which has similar challenges in the analysis of PbS QD films due to a low density of states near the conduction band minimum.

  13. Viral Single-Strand DNA Induces p53-Dependent Apoptosis in Human Embryonic Stem Cells

    PubMed Central

    Hirsch, Matthew L.; Fagan, B. Matthew; Dumitru, Raluca; Bower, Jacquelyn J.; Yadav, Swati; Porteus, Matthew H.; Pevny, Larysa H.; Samulski, R. Jude

    2011-01-01

    Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication. PMID:22114676

  14. Sequence-dependent B<-->A transition in DNA evaluated with dimeric and trimeric scales.

    PubMed Central

    Tolstorukov, M Y; Ivanov, V I; Malenkov, G G; Jernigan, R L; Zhurkin, V B

    2001-01-01

    Experimental data on the sequence-dependent B<-->A conformational transition in 24 oligo- and polymeric duplexes yield optimal dimeric and trimeric scales for this transition. The 10 sequence dimers and the 32 trimers of the DNA duplex were characterized by the free energy differences between the B and A forms in water solution. In general, the trimeric scale describes the sequence-dependent DNA conformational propensities more accurately than the dimeric scale, which is likely related to the trimeric model accounting for the two interfaces between adjacent base pairs on both sides (rather than only one interface in the dimeric model). The exceptional preference of the B form for the AA:TT dimers and AAN:N'TT trimers is consistent with the cooperative interactions in both grooves. In the minor groove, this is the hydration spine that stabilizes adenine runs in B form. In the major groove, these are hydrophobic interactions between the thymine methyls and the sugar methylene groups from the preceding nucleotides, occurring in B form. This interpretation is in accord with the key role played by hydration in the B<-->A transition in DNA. Importantly, our trimeric scale is consistent with the relative occurrences of the DNA trimers in A form in protein-DNA cocrystals. Thus, we suggest that the B/A scales developed here can be used for analyzing genome sequences in search for A-philic motifs, putatively operative in the protein-DNA recognition. PMID:11721003

  15. The DNA-dependent protein kinase catalytic subunit phosphorylation sites in human Artemis.

    PubMed

    Ma, Yunmei; Pannicke, Ulrich; Lu, Haihui; Niewolik, Doris; Schwarz, Klaus; Lieber, Michael R

    2005-10-07

    Artemis protein has irreplaceable functions in V(D)J recombination and nonhomologous end joining (NHEJ) as a hairpin and 5' and 3' overhang endonuclease. The kinase activity of the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is necessary in activating Artemis as an endonuclease. Here we report that three basal phosphorylation sites and 11 DNA-PKcs phosphorylation sites within the mammalian Artemis are all located in the C-terminal domain. All but one of these phosphorylation sites deviate from the SQ or TQ motif of DNA-PKcs that was predicted previously from in vitro phosphorylation studies. Phosphatase-treated mammalian Artemis and Artemis that is mutated at the three basal phosphorylation sites still retain DNA-PKcs-dependent endonucleolytic activities, indicating that basal phosphorylation is not required for the activation. In vivo studies of Artemis lacking the C-terminal domain have been reported to be sufficient to complement V(D)J recombination in Artemis null cells. Therefore, the C-terminal domain may have a negative regulatory effect on the Artemis endonucleolytic activities, and phosphorylation by DNA-PKcs in the C-terminal domain may relieve this inhibition.

  16. Metal electrode dependent field effect transistors made of lanthanide ion-doped DNA crystals

    NASA Astrophysics Data System (ADS)

    Reddy Dugasani, Sreekantha; Hwang, Taehyun; Kim, Jang Ah; Gnapareddy, Bramaramba; Kim, Taesung; Park, Sung Ha

    2016-03-01

    We fabricated lanthanide ion (Ln3+, e.g. Dy3+, Er3+, Eu3+, and Gd3+)-doped self-assembled double-crossover (DX) DNA crystals grown on the surface of field effect transistors (FETs) containing either a Cr, Au, or Ni electrode. Here we demonstrate the metal electrode dependent FET characteristics as a function of various Ln3+. The drain-source current (I ds), controlled by the drain-source voltage (V ds) of Ln3+-doped DX DNA crystals with a Cr electrode on an FET, changed significantly under various gate voltages (V g) due to the relative closeness of the work function of Cr to the energy band gap of Ln3+-DNA crystals compared to those of Au and Ni. For Ln3+-DNA crystals on an FET with either a Cr or Ni electrode at a fixed V ds, I ds decreased with increasing V g ranging from  -2 to 0 V and from 0 to  +3 V in the positive and negative regions, respectively. By contrast, I ds for Ln3+-DNA crystals on an FET with Au decreased with increasing V g in only the positive region due to the greater electronegativity of Au. Furthermore, Ln3+-DNA crystals on an FET exhibited behaviour sensitive to V g due to the appreciable charge carriers generated from Ln3+. Finally, we address the resistivity and the mobility of Ln3+-DNA crystals on an FET with different metal electrodes obtained from I ds-V ds and I ds-V g curves. The resistivities of Ln3+-DNA crystals on FETs with Cr and Au electrodes were smaller than those of pristine DNA crystals on an FET, and the mobility of Ln3+-DNA crystals on an FET with Cr was relatively higher than that associated with other electrodes.

  17. DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

    PubMed

    Dolman, M Emmy M; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N; Molenaar, Jan J

    2015-01-01

    Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

  18. Composition, Temperature, and Pressure Dependence of the Phonon (Thermal) Conductivity of Silicate Geoliquids

    NASA Astrophysics Data System (ADS)

    Tikunoff, Dane Michael

    The study of geoliquids and their transport properties is a burgeoning field that sheds light on many critical geological problems. One such property, the thermal conductivity, measures the heat conduction capacity of a material and plays an important role in mantle and crust dynamics. Previous research has suggested that an increased insulation factor in rocks of the crust, regulated by relatively small values of the thermal conductivity, promotes anatexis and alleviates radiogenic heating requirements for the inducement of dehydration-triggered partial melting (Whittington et al., 2009). At greater depths, the proposed existence of melt patches along and immediately above the Core-Mantle Boundary (CMB) at ~2900 km depth could explain the discrete rather than graduated thermal gradient seen across the CMB (Murakami and Bass, 2011). This thesis describes the use of Molecular Dynamics (MD) simulations to compute thermal conductivity for three liquid silicates: CaMgSi2O6, NaAlSi3 O8 and MgSi2O4. The motivation for this study was to examine the temperature, pressure and compositional dependencies of thermal conductivity approximating conditions in the upper mantle (0-30 GPa, 2000-4500 K) for a few end member geosilicate liquids of natural importance. Results at low pressure and temperature show good agreement with recent laboratory measurements on CaMgSi2O6 and NaAlSi3O8 suggesting that MD simulation can provide realistic values at elevated pressure and temperature, conditions not readily accessible without great expense and time in the laboratory. For example, simulation results for molten diopside at 1763+/-13 K and 0.36+/-0.017 GPa provide a thermal conductivity value of k=1.186+/-0.019 W/m K while laser-flash data from Hofmeister et al. (2009) provides a value of k=1.178 +/-0.06 W/m K, agreement to within a percent. Further, a positive correlation between atomic structure and thermal conductivity is confirmed. At low pressure, the polymeric liquid NaAlSi3O8, in

  19. Ku and DNA-dependent Protein Kinase Dynamic Conformations and Assembly Regulate DNA Binding and the Initial Non-homologous End Joining Complex*

    PubMed Central

    Hammel, Michal; Yu, Yaping; Mahaney, Brandi L.; Cai, Brandon; Ye, Ruiqiong; Phipps, Barry M.; Rambo, Robert P.; Hura, Greg L.; Pelikan, Martin; So, Sairei; Abolfath, Ramin M.; Chen, David J.; Lees-Miller, Susan P.; Tainer, John A.

    2010-01-01

    DNA double strand break (DSB) repair by non-homologous end joining (NHEJ) is initiated by DSB detection by Ku70/80 (Ku) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) recruitment, which promotes pathway progression through poorly defined mechanisms. Here, Ku and DNA-PKcs solution structures alone and in complex with DNA, defined by x-ray scattering, reveal major structural reorganizations that choreograph NHEJ initiation. The Ku80 C-terminal region forms a flexible arm that extends from the DNA-binding core to recruit and retain DNA-PKcs at DSBs. Furthermore, Ku- and DNA-promoted assembly of a DNA-PKcs dimer facilitates trans-autophosphorylation at the DSB. The resulting site-specific autophosphorylation induces a large conformational change that opens DNA-PKcs and promotes its release from DNA ends. These results show how protein and DNA interactions initiate large Ku and DNA-PKcs rearrangements to control DNA-PK biological functions as a macromolecular machine orchestrating assembly and disassembly of the initial NHEJ complex on DNA. PMID:19893054

  20. ATPase-dependent, cooperative binding of ORC and Cdc6p to origin DNA

    PubMed Central

    Speck, Christian; Chen, Zhiqiang; Li, Huilin; Stillman, Bruce

    2010-01-01

    Binding of Cdc6p to the Origin-Recognition-Complex (ORC) is a key step in the assembly of a pre-replication complex (pre-RC) at origins of DNA replication. ORC recognizes specific origin DNA sequences in an ATP-dependent manner. Here we demonstrate cooperative binding of Saccharomyces cerevisiae Cdc6p to ORC on DNA in an ATP-dependent manner, inducing a change in the pattern of origin binding that requires the Orc1p ATPase. The reaction is blocked by specific origin mutations that do not interfere with the interaction between ORC and DNA. Single particle reconstruction of electron microscopic images shows that the ORC-Cdc6p complex forms a ring-shaped structure with dimensions similar to the ring-shaped MCM helicase. The ORC-Cdc6p structure is predicted to contain six AAA+ subunits, analogous to other ATP-dependent protein machines. We suggest that Cdc6p and origin DNA activate a molecular switch in ORC that contributes to pre-RC assembly. PMID:16228006

  1. ATPase-dependent cooperative binding of ORC and Cdc6 to origin DNA.

    PubMed

    Speck, Christian; Chen, Zhiqiang; Li, Huilin; Stillman, Bruce

    2005-11-01

    Binding of Cdc6 to the origin recognition complex (ORC) is a key step in the assembly of a pre-replication complex (pre-RC) at origins of DNA replication. ORC recognizes specific origin DNA sequences in an ATP-dependent manner. Here we demonstrate cooperative binding of Saccharomyces cerevisiae Cdc6 to ORC on DNA in an ATP-dependent manner, which induces a change in the pattern of origin binding that requires the Orc1 ATPase. The reaction is blocked by specific origin mutations that do not interfere with the interaction between ORC and DNA. Single-particle reconstruction of electron microscopic images shows that the ORC-Cdc6 complex forms a ring-shaped structure with dimensions similar to those of the ring-shaped MCM helicase. The ORC-Cdc6 structure is predicted to contain six AAA+ subunits, analogous to other ATP-dependent protein machines. We suggest that Cdc6 and origin DNA activate a molecular switch in ORC that contributes to pre-RC assembly.

  2. ATM-dependent chromatin remodeler Rsf-1 facilitates DNA damage checkpoints and homologous recombination repair.

    PubMed

    Min, Sunwoo; Jo, Sujin; Lee, Ho-Soo; Chae, Sunyoung; Lee, Jong-Soo; Ji, Jae-Hoon; Cho, Hyeseong

    2014-01-01

    As a member of imitation switch (ISWI) family in ATP-dependent chromatin remodeling factors, RSF complex consists of SNF2h ATPase and Rsf-1. Although it has been reported that SNF2h ATPase is recruited to DNA damage sites (DSBs) in a poly(ADP-ribosyl) polymerase 1 (PARP1)-dependent manner in DNA damage response (DDR), the function of Rsf-1 is still elusive. Here we show that Rsf-1 is recruited to DSBs confirmed by various cellular analyses. Moreover, the initial recruitment of Rsf-1 and SNF2h to DSBs shows faster kinetics than that of γH2AX after micro-irradiation. Signals of Rsf-1 and SNF2h are retained over 30 min after micro-irradiation, whereas γH2AX signals are gradually reduced at 10 min. In addition, Rsf-1 is accumulated at DSBs in ATM-dependent manner, and the putative pSQ motifs of Rsf-1 by ATM are required for its accumulation at DSBs. Furtheremore, depletion of Rsf-1 attenuates the activation of DNA damage checkpoint signals and cell survival upon DNA damage. Finally, we demonstrate that Rsf-1 promotes homologous recombination repair (HRR) by recruiting resection factors RPA32 and Rad51. Thus, these findings reveal a new function of chromatin remodeler Rsf-1 as a guard in DNA damage checkpoints and homologous recombination repair.

  3. Force-dependent persistence length of DNA-intercalator complexes measured in single molecule stretching experiments.

    PubMed

    Bazoni, R F; Lima, C H M; Ramos, E B; Rocha, M S

    2015-06-07

    By using optical tweezers with an adjustable trap stiffness, we have performed systematic single molecule stretching experiments with two types of DNA-intercalator complexes, in order to investigate the effects of the maximum applied forces on the mechanical response of such complexes. We have explicitly shown that even in the low-force entropic regime the persistence length of the DNA-intercalator complexes is strongly force-dependent, although such behavior is not exhibited by bare DNA molecules. We discuss the possible physicochemical effects that can lead to such results. In particular, we propose that the stretching force can promote partial denaturation on the highly distorted double-helix of the DNA-intercalator complexes, which interfere strongly in the measured values of the persistence length.

  4. DNA-Dependent RNA Polymerase Detects Hidden Giant Viruses in Published Databanks

    PubMed Central

    Sharma, Vikas; Colson, Philippe; Giorgi, Roch; Pontarotti, Pierre; Raoult, Didier

    2014-01-01

    Environmental metagenomic studies show that there is a “dark matter,” composed of sequences not linked to any known organism, as determined mainly using ribosomal DNA (rDNA) sequences, which therefore ignore giant viruses. DNA-dependent RNA polymerase (RNAP) genes are universal in microbes and conserved in giant viruses and may replace rDNA for identifying microbes. We found while reconstructing RNAP subunit 2 (RNAP2) phylogeny that a giant virus sequenced together with the genome of a large eukaryote, Hydra magnipapillata, has been overlooked. To explore the dark matter, we used viral RNAP2 and reconstructed putative ancestral RNAP2, which were significantly superior in detecting distant clades than current sequences, and we revealed two additional unknown mimiviruses, misclassified as an euryarchaeote and an oomycete plant pathogen, and detected unknown putative viral clades. We suggest using RNAP systematically to decipher the black matter and identify giant viruses. PMID:24929085

  5. Plasma cell differentiation is coupled to division-dependent DNA hypomethylation and gene regulation

    PubMed Central

    Bally, Alexander P.R.; Boss, Jeremy M.

    2016-01-01

    The epigenetic processes that regulate antibody secreting plasma cells are not well understood. Here, analysis of plasma cell differentiation revealed DNA hypomethylation of 10% of CpG loci that were overrepresented at enhancers. Inhibition of DNA methylation enhanced plasma cell commitment in a cell division-dependent manner. Examination of in vivo differentiating B cells stratified by cell division revealed a 5-fold increase in mRNA transcription coupled to DNA hypomethylation. Demethylation occurred first at binding motifs of NF-κB and AP-1 and later at those for IRF and Oct-2, and were coincident with activation and differentiation gene expression programs. These data provide mechanistic insight into the cell-division coupled transcriptional and epigenetic reprogramming and suggest DNA hypomethylation reflects the cis-regulatory history of plasma cell differentiation. PMID:27500631

  6. DNA-dependent protein kinase mediates V(D)J recombination via RAG2 phosphorylation.

    PubMed

    Hah, Young-Sool; Lee, Jung Hwa; Kim, Deok Ryong

    2007-05-31

    V(D)J recombination, a site-specific gene rearrangement process occurring during the lymphocyte development, begins with DNA double strand breaks by two recombination activating gene products (RAG1/2) and finishes with the repair process by several proteins including DNA-dependent protein kinase (DNA-PK). In this report, we found that RAG2 was specifically phosphorylated by DNA-PK at the 365(th) serine residue, and this phosphorylated RAG2 affected the V(D)J recombination activity in cells in the GFP expression-based assay. While the V(D)J recombination activity between wild-type RAG2 and mutant S365A RAG2 in the assay using a signal joint substrate was undistinguishable in DNA-PK deficient cells (M059J), the activity with wild-type RAG2 was largely increased in DNA-PK proficient cells (M059K) in comparison with mutant RAG2, suggesting that RAG2 phosphorylation by DNA-PK plays a crucial role in the signal joint formation during V(D)J recombination.

  7. ATP-dependent chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-coupling factor.

    PubMed

    Citterio, E; Van Den Boom, V; Schnitzler, G; Kanaar, R; Bonte, E; Kingston, R E; Hoeijmakers, J H; Vermeulen, W

    2000-10-01

    The Cockayne syndrome B protein (CSB) is required for coupling DNA excision repair to transcription in a process known as transcription-coupled repair (TCR). Cockayne syndrome patients show UV sensitivity and severe neurodevelopmental abnormalities. CSB is a DNA-dependent ATPase of the SWI2/SNF2 family. SWI2/SNF2-like proteins are implicated in chromatin remodeling during transcription. Since chromatin structure also affects DNA repair efficiency, chromatin remodeling activities within repair are expected. Here we used purified recombinant CSB protein to investigate whether it can remodel chromatin in vitro. We show that binding of CSB to DNA results in an alteration of the DNA double-helix conformation. In addition, we find that CSB is able to remodel chromatin structure at the expense of ATP hydrolysis. Specifically, CSB can alter DNase I accessibility to reconstituted mononucleosome cores and disarrange an array of nucleosomes regularly spaced on plasmid DNA. In addition, we show that CSB interacts not only with double-stranded DNA but also directly with core histones. Finally, intact histone tails play an important role in CSB remodeling. CSB is the first repair protein found to play a direct role in modulating nucleosome structure. The relevance of this finding to the interplay between transcription and repair is discussed.

  8. ATP-Dependent Chromatin Remodeling by the Cockayne Syndrome B DNA Repair-Transcription-Coupling Factor

    PubMed Central

    Citterio, Elisabetta; Van Den Boom, Vincent; Schnitzler, Gavin; Kanaar, Roland; Bonte, Edgar; Kingston, Robert E.; Hoeijmakers, Jan H. J.; Vermeulen, Wim

    2000-01-01

    The Cockayne syndrome B protein (CSB) is required for coupling DNA excision repair to transcription in a process known as transcription-coupled repair (TCR). Cockayne syndrome patients show UV sensitivity and severe neurodevelopmental abnormalities. CSB is a DNA-dependent ATPase of the SWI2/SNF2 family. SWI2/SNF2-like proteins are implicated in chromatin remodeling during transcription. Since chromatin structure also affects DNA repair efficiency, chromatin remodeling activities within repair are expected. Here we used purified recombinant CSB protein to investigate whether it can remodel chromatin in vitro. We show that binding of CSB to DNA results in an alteration of the DNA double-helix conformation. In addition, we find that CSB is able to remodel chromatin structure at the expense of ATP hydrolysis. Specifically, CSB can alter DNase I accessibility to reconstituted mononucleosome cores and disarrange an array of nucleosomes regularly spaced on plasmid DNA. In addition, we show that CSB interacts not only with double-stranded DNA but also directly with core histones. Finally, intact histone tails play an important role in CSB remodeling. CSB is the first repair protein found to play a direct role in modulating nucleosome structure. The relevance of this finding to the interplay between transcription and repair is discussed. PMID:11003660

  9. Inhibiting Mitochondrial DNA Ligase IIIα Activates Caspase 1-Dependent Apoptosis in Cancer Cells.

    PubMed

    Sallmyr, Annahita; Matsumoto, Yoshihiro; Roginskaya, Vera; Van Houten, Bennett; Tomkinson, Alan E

    2016-09-15

    Elevated levels of DNA ligase IIIα (LigIIIα) have been identified as a biomarker of an alteration in DNA repair in cancer cells that confers hypersensitivity to a LigIIIα inhibitor, L67, in combination with a poly (ADP-ribose) polymerase inhibitor. Because LigIIIα functions in the nucleus and mitochondria, we examined the effect of L67 on these organelles. Here, we show that, although the DNA ligase inhibitor selectively targets mitochondria, cancer and nonmalignant cells respond differently to disruption of mitochondrial DNA metabolism. Inhibition of mitochondrial LigIIIα in cancer cells resulted in abnormal mitochondrial morphology, reduced levels of mitochondrial DNA, and increased levels of mitochondrially generated reactive oxygen species that caused nuclear DNA damage. In contrast, these effects did not occur in nonmalignant cells. Furthermore, inhibition of mitochondrial LigIIIα activated a caspase 1-dependent apoptotic pathway, which is known to be part of inflammatory responses induced by pathogenic microorganisms in cancer, but not nonmalignant cells. These results demonstrate that the disruption of mitochondrial DNA metabolism elicits different responses in nonmalignant and cancer cells and suggests that the abnormal response in cancer cells may be exploited in the development of novel therapeutic strategies that selectively target cancer cells. Cancer Res; 76(18); 5431-41. ©2016 AACR. ©2016 American Association for Cancer Research.

  10. Direction- and Salt-Dependent Ionic Current Signatures for DNA Sensing with Asymmetric Nanopores.

    PubMed

    Chen, Kaikai; Bell, Nicholas A W; Kong, Jinglin; Tian, Yu; Keyser, Ulrich F

    2017-02-28

    Solid-state nanopores are promising tools for single-molecule detection of both DNA and proteins. In this study, we investigated the patterns of ionic current blockades as DNA translocates into or out of the geometric confinement of conically shaped pores across a wide range of salt conditions. We studied how the geometry of a nanopore affects the detected ionic current signal of a translocating DNA molecule over a wide range of salt concentration. The blockade level in the ionic current depends on the translocation direction at a high salt concentration, and at lower salt concentrations we find a nonintuitive ionic current decrease and increase within each single event for the DNA translocations exiting from confinement. We use a recently developed method for synthesizing DNA molecules with multiple position markers, which provides further experimental characterization by matching the position of the DNA in the pore with the observed ionic current signal. Finally, we employ finite element calculations to explain the shapes of the signals observed at all salt concentrations and show that the unexpected current decrease and increase are due to the competing effects of ion concentration polarization and geometric exclusion of ions. Our analysis shows that over a wide range of geometries, voltages, and salt concentrations, we are able to understand the ionic current signals of DNA in asymmetric nanopores, enabling signal optimization in molecular sensing applications. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  11. DNA-length-dependent fluorescent sensing based on energy transfer in self-assembled multilayers.

    PubMed

    Sun, Xiang-Ying; Liu, Bin; Sun, Yan-Feng; Yu, Yaming

    2014-11-15

    In this paper, a novel DNA-length-dependent fluorescent sensor was constructed based on the fluorescence resonance energy transfer. In the self-assembled multilayers (Quartz/GO/PDDA/Tx-DNA/PDDA/ZnO@CdS), ZnO@CdS and graphene oxide(GO) were employed as an energy donor and an energy acceptor, respectively. Single-stranded Tx-DNA (x represents different chain length of DNA) and poly(diallydimethylammonium) chloride (PDDA) were used as a linker. In the presence of complementary Px-DNA, the formation of double-stranded DNA leads to a change in chain length and achieves the purpose of changing the distance between ZnO@CdS and GO. Thereby, it enhances the efficiency of energy transfer between ZnO@CdS and GO resulting in the quench of fluorescence of ZnO@CdS, and thus different length DNA sequence was detected. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners.

    PubMed

    Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio; Medina-Acosta, Enrique

    2016-01-01

    The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele

  13. Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

    PubMed Central

    Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

    2016-01-01

    The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele

  14. Processing of meiotic DNA double strand breaks requires cyclin-dependent kinase and multiple nucleases.

    PubMed

    Manfrini, Nicola; Guerini, Ilaria; Citterio, Andrea; Lucchini, Giovanna; Longhese, Maria Pia

    2010-04-09

    Meiotic recombination requires the formation of programmed Spo11-dependent DNA double strand breaks (DSBs). In Saccharomyces cerevisiae, the Sae2 protein and the Mre11-Rad50-Xrs2 complex are necessary to remove the covalently attached Spo11 protein from the DNA ends, which are then resected by so far unknown nucleases. Here, we demonstrate that phosphorylation of Sae2 Ser-267 by cyclin-dependent kinase 1 (Cdk1) is required to initiate meiotic DSB resection by allowing Spo11 removal from DSB ends. This finding suggests that Cdk1 activity is required for the processing of Spo11-induced DSBs, thus providing a mechanism for coordinating DSB resection with progression through meiotic prophase. Furthermore, the helicase Sgs1 and the nucleases Exo1 and Dna2 participate in lengthening the 5'-3' resection tracts during meiosis by controlling a step subsequent to Spo11 removal.

  15. Artemis-dependent DNA double-strand break formation at stalled replication forks.

    PubMed

    Unno, Junya; Takagi, Masatoshi; Piao, Jinhua; Sugimoto, Masataka; Honda, Fumiko; Maeda, Daisuke; Masutani, Mitsuko; Kiyono, Tohru; Watanabe, Fumiaki; Morio, Tomohiro; Teraoka, Hirobumi; Mizutani, Shuki

    2013-06-01

    Stalled replication forks undergo DNA double-strand breaks (DSBs) under certain conditions. However, the precise mechanism underlying DSB induction and the cellular response to persistent replication fork stalling are not fully understood. Here we show that, in response to hydroxyurea exposure, DSBs are generated in an Artemis nuclease-dependent manner following prolonged stalling with subsequent activation of the ataxia-telangiectasia mutated (ATM) signaling pathway. The kinase activity of the catalytic subunit of the DNA-dependent protein kinase, a prerequisite for stimulation of the endonuclease activity of Artemis, is also required for DSB generation and subsequent ATM activation. Our findings indicate a novel function of Artemis as a molecular switch that converts stalled replication forks harboring single-stranded gap DNA lesions into DSBs, thereby activating the ATM signaling pathway following prolonged replication fork stalling. © 2013 Japanese Cancer Association.

  16. The diagonal hopping dependent I-V characteristics of periodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Yudiarsah, E.

    2017-07-01

    The diagonal hopping dependent I-V characteristic of a periodic DNA molecule has been studied. Exponentially twisting angle dependent hopping constant is used in the calculation. The diagonal hopping constant is modeled using semi-empirical Slater-Koster theory. A 32 base pairs doubled-stranded Poly(dG)-poly(dC) DNA molecule model sandwiched in between two metallic electrodes is used in the calculation of I-V characteristic using Landauer-Buttiker formalism by assuming symmetric voltage drop at the contacts. The I-V characteristics is calculated from the transmission probability of charge on the molecule calculated using transfer and scattering matrix methods, simultaneously. The results show that generally, as the vibration and diagonal hopping coupling constant increases, the current magnitude increases. However, at low voltage the increment of current is minute. These trends are observed in the I-V characteristic of DNA molecule for all frequencies and temperatures used.

  17. Periodic MHD flow with temperature dependent viscosity and thermal conductivity past an isothermal oscillating cylinder

    NASA Astrophysics Data System (ADS)

    Ahmed, Rubel; Rana, B. M. Jewel; Ahmmed, S. F.

    2017-06-01

    Temperature dependent viscosity and thermal conducting heat and mass transfer flow with chemical reaction and periodic magnetic field past an isothermal oscillating cylinder have been considered. The partial dimensionless equations governing the flow have been solved numerically by applying explicit finite difference method with the help Compaq visual 6.6a. The obtained outcome of this inquisition has been discussed for different values of well-known flow parameters with different time steps and oscillation angle. The effect of chemical reaction and periodic MHD parameters on the velocity field, temperature field and concentration field, skin-friction, Nusselt number and Sherwood number have been studied and results are presented by graphically. The novelty of the present problem is to study the streamlines by taking into account periodic magnetic field.

  18. Anomalous pressure dependence of thermal conductivities of large mass ratio compounds

    NASA Astrophysics Data System (ADS)

    Lindsay, L.; Broido, D. A.; Carrete, Jesús; Mingo, Natalio; Reinecke, T. L.

    2015-03-01

    The lattice thermal conductivities (κ) of binary compound materials are examined as a function of hydrostatic pressure P using a first-principles approach. Compounds with relatively small mass ratios, such as MgO, show an increase in κ with P , consistent with measurements. Conversely, compounds with large mass ratios that create significant frequency gaps between acoustic and optic phonons (e.g., BSb, BAs, BeTe, BeSe) exhibit decreasing κ with increasing P , a behavior that cannot be understood using simple theories of κ. This anomalous P dependence of κ arises from the fundamentally different nature of the intrinsic scattering processes for heat-carrying acoustic phonons in large mass ratio compounds compared to those with small mass ratios. This work demonstrates the power of first-principles methods for thermal properties and advances a broad paradigm for understanding thermal transport in nonmetals.

  19. Anomalous temperature dependent magneto-conductance in organic light-emitting diodes with multiple emissive states

    SciTech Connect

    Zhao, Chen-xiao; Jia, Wei-yao; Huang, Ke-Xun; Zhang, Qiao-ming; Yang, Xiao-hui; Xiong, Zu-hong

    2015-07-13

    The temperature dependence of the magneto-conductance (MC) in organic electron donor-acceptor hybrid and layer heterojunction diodes was studied. The MC value increased with temperature in layer heterojunction and in 10 wt. % hybrid devices. An anomalous decrease of the MC with temperature was observed in 25 wt. %–50 wt. % hybrid devices. Further increasing donor concentration to 75 wt. %, the MC again increased with temperature. The endothermic exciplex-exciton energy transfer and the change in electroplex/exciton ratio caused by change in charge transport with temperature may account for these phenomena. Comparative studies of the temperature evolutions of the IV curves and the electroluminescence and photoluminescence spectra back our hypothesis.

  20. Estimation of temperature-dependent thermal conductivity of a packed bed of 13X molecular sieves

    SciTech Connect

    Vyas, R.K.; Kumar, S.

    1995-11-01

    Modeling and simulation of packed bed systems operating non-isothermally require sufficiently accurate knowledge of thermal transport properties.Effective thermal conductivity (k) of packed bed of molecular sieves is rarely reported. In this paper, dependence of k on temperature for a packed bed of 13X molecular sieves has been determined. An electrical heater embedded coaxially in the bed was used to heat it, and the radical temperature profiles thus obtained under transient conditions were utilized for estimation. The estimated relationship is k = 8.17635 {times} 10{sup {minus}5} + 10.915427 {times} 10{sup {minus}7}(T {minus} T{sub 0}). Statistical analysis of the estimated parameters has also been carried out. The deviations between experimental and predicted temperatures are less than 5%.

  1. Anomalous pressure dependence of thermal conductivities of large mass ratio compounds

    DOE PAGES

    Lindsay, Lucas R; Broido, David A.; Carrete, Jesus; ...

    2015-03-27

    The lattice thermal conductivities (k) of binary compound materials are examined as a function of hydrostatic pressure P using a first-principles approach. Compound materials with relatively small mass ratios, such as MgO, show an increase in k with P, consistent with measurements. Conversely, compounds with large mass ratios (e.g., BSb, BAs, BeTe, BeSe) exhibit decreasing with increasing P, a behavior that cannot be understood using simple theories of k. This anomalous P dependence of k arises from the fundamentally different nature of the intrinsic scattering processes for heat-carrying acoustic phonons in large mass ratio compounds compared to those with smallmore » mass ratios. We find this work demonstrates the power of first principles methods for thermal properties and advances the understanding of thermal transport in non-metals.« less

  2. Anomalous pressure dependence of thermal conductivities of large mass ratio compounds

    SciTech Connect

    Lindsay, Lucas R; Broido, David A.; Carrete, Jesus; Mingo, Natalio; Reinecke, Tom L.

    2015-03-27

    The lattice thermal conductivities (k) of binary compound materials are examined as a function of hydrostatic pressure P using a first-principles approach. Compound materials with relatively small mass ratios, such as MgO, show an increase in k with P, consistent with measurements. Conversely, compounds with large mass ratios (e.g., BSb, BAs, BeTe, BeSe) exhibit decreasing with increasing P, a behavior that cannot be understood using simple theories of k. This anomalous P dependence of k arises from the fundamentally different nature of the intrinsic scattering processes for heat-carrying acoustic phonons in large mass ratio compounds compared to those with small mass ratios. We find this work demonstrates the power of first principles methods for thermal properties and advances the understanding of thermal transport in non-metals.

  3. Genome-derived cytosolic DNA mediates type I interferon-dependent rejection of B cell lymphoma cells.

    PubMed

    Shen, Yu J; Le Bert, Nina; Chitre, Anuja A; Koo, Christine Xing'Er; Nga, Xing H; Ho, Samantha S W; Khatoo, Muznah; Tan, Nikki Y; Ishii, Ken J; Gasser, Stephan

    2015-04-21

    The DNA damage response (DDR) induces the expression of type I interferons (IFNs), but the underlying mechanisms are poorly understood. Here, we show the presence of cytosolic DNA in different mouse and human tumor cells. Treatment of cells with genotoxic agents increased the levels of cytosolic DNA in a DDR-dependent manner. Cloning of cytosolic DNA molecules from mouse lymphoma cells suggests that cytosolic DNA is derived from unique genomic loci and has the potential to form non-B DNA structures, including R-loops. Overexpression of Rnaseh1, which resolves R-loops, reduced the levels of cytosolic DNA, type I Ifn transcripts, and type I IFN-dependent rejection of lymphoma cells. Live-cell imaging showed a dynamic contact of cytosolic DNA with mitochondria, an important organelle for innate immune recognition of cytosolic nucleotides. In summary, we found that cytosolic DNA is present in many tumor cells and contributes to the immunogenicity of tumor cells.

  4. Use of Data Comm by Flight Crew to Conduct Interval Management Operations to Parallel Dependent Runways

    NASA Technical Reports Server (NTRS)

    Baxley, Brian T.; Hubbs, Clay; Shay, Rick; Karanian, James

    2011-01-01

    The Interval Management (IM) concept is being developed as a method to maintain or increase high traffic density airport arrival throughput while allowing aircraft to conduct near idle thrust descents. The Interval Management with Spacing to Parallel Dependent Runways (IMSPiDR1) experiment at NASA Langley Research Center used 24 commercial pilots to examine IM procedures to conduct parallel dependent runway arrival operations while maintaining safe but efficient intervals behind the preceding aircraft. The use of IM procedures during these operations requires a lengthy and complex clearance from Air Traffic Control (ATC) to the participating aircraft, thereby making the use of Controller Pilot Data Link Communications (CPDLC) highly desirable as the communication method. The use of CPDLC reduces the need for voice transmissions between controllers and flight crew, and enables automated transfer of IM clearance elements into flight management systems or other aircraft avionics. The result is reduced crew workload and an increase in the efficiency of crew procedures. This paper focuses on the subset of data collected related to the use of CPDLC for IM operations into a busy airport. Overall, the experiment and results were very successful, with the mean time under 43 seconds for the flight crew to load the clearance into the IM spacing tool, review the calculated speed, and respond to ATC. An overall mean rating of Moderately Agree was given when the crews were asked if the use of CPDLC was operationally acceptable as simulated in this experiment. Approximately half of the flight crew reported the use of CPDLC below 10,000 for IM operations was unacceptable, with 83% reporting below 5000 was unacceptable. Also described are proposed modifications to the IM operations that may reduce CPDLC Respond time to less than 30 seconds and should significantly reduce the complexity of crew procedures, as well as follow-on research issues for operational use of CPDLC during IM

  5. Discovery of bacterial NAD+-dependent DNA ligase inhibitors: optimization of antibacterial activity.

    PubMed

    Stokes, Suzanne S; Huynh, Hoan; Gowravaram, Madhusudhan; Albert, Robert; Cavero-Tomas, Marta; Chen, Brendan; Harang, Jenna; Loch, James T; Lu, Min; Mullen, George B; Zhao, Shannon; Liu, Ce-Feng; Mills, Scott D

    2011-08-01

    Optimization of adenosine analog inhibitors of bacterial NAD(+)-dependent DNA ligase is discussed. Antibacterial activity against Streptococcus pneumoniae and Staphylococcus aureus was improved by modification of the 2-position substituent on the adenine ring and 3'- and 5'-substituents on the ribose. Compounds with logD values 1.5-2.5 maximized potency and maintained drug-like physical properties.

  6. Thickness, humidity, and polarization dependent ferroelectric switching and conductivity in Mg doped lithium niobate

    DOE PAGES

    Neumayer, Sabine M.; Strelcov, Evgheni; Manzo, Michele; ...

    2015-12-28

    Mg doped lithium niobate (Mg:LN) exhibits several advantages over undoped LN such as resistance to photorefraction, lower coercive fields, and p-type conductivity that is particularly pronounced at domain walls and opens up a range of applications, e.g., in domain wall electronics. Engineering of precise domain patterns necessitates well founded knowledge of switching kinetics, which can differ significantly from that of undoped LN. In this work, the role of humidity and sample composition in polarization reversal has been investigated under application of the same voltage waveform. Control over domain sizes has been achieved by varying the sample thickness and initial polarizationmore » as well as atmospheric conditions. Additionally, local introduction of proton exchanged phases allows for inhibition of domain nucleation or destabilization, which can be utilized to modify domain patterns. In polarization dependent current flow, attributed to charged domain walls and band bending, it the rectifying ability of Mg: LN in combination with suitable metal electrodes that allow for further tailoring of conductivity is demonstrated.« less

  7. Temperature Dependent Thermal Conductivity and Thermal Interface Resistance of Pentacene Thin Films with Varying Morphology.

    PubMed

    Epstein, Jillian; Ong, Wee-Liat; Bettinger, Christopher J; Malen, Jonathan A

    2016-07-27

    Temperature dependent thermal conductivities and thermal interface resistances of pentacene (Pn) thin films deposited on silicon substrates and self-assembled monolayer-modified [octadecyltrichlorosilane (OTS) and (3-aminopropyl)triethoxysilane (APTES)] silicon substrates were measured using frequency domain thermoreflectance. Atomic force microscopy images were used to derive an effective film thickness for thermal transport that accounts for surface roughness. Data taken over a temperature range of 77-300 K for various morphologies and film thicknesses show that the thermal conductivity increases with increasing Pn grain size. The sum of the substrate-Pn and Pn-gold thermal interface resistances was isolated from the intrinsic thermal resistance of the Pn films and found to be independent of surface chemistry. Corresponding Kapitza lengths of approximately 150 nm are larger than the physical thicknesses of typical Pn thin films and indicate that the interfaces play a dominant role in the total thermal resistance. This study has implications for increasing the performance and effective thermal management of small molecule electronic and energy conversion devices.

  8. Thickness, humidity, and polarization dependent ferroelectric switching and conductivity in Mg doped lithium niobate

    SciTech Connect

    Neumayer, Sabine M.; Strelcov, Evgheni; Manzo, Michele; Gallo, Katia; Kravchenko, Ivan I.; Kholkin, Andrei L.; Kalinin, Sergei V.; Rodriguez, Brian J.

    2015-12-28

    Mg doped lithium niobate (Mg:LN) exhibits several advantages over undoped LN such as resistance to photorefraction, lower coercive fields, and p-type conductivity that is particularly pronounced at domain walls and opens up a range of applications, e.g., in domain wall electronics. Engineering of precise domain patterns necessitates well founded knowledge of switching kinetics, which can differ significantly from that of undoped LN. In this work, the role of humidity and sample composition in polarization reversal has been investigated under application of the same voltage waveform. Control over domain sizes has been achieved by varying the sample thickness and initial polarization as well as atmospheric conditions. Additionally, local introduction of proton exchanged phases allows for inhibition of domain nucleation or destabilization, which can be utilized to modify domain patterns. In polarization dependent current flow, attributed to charged domain walls and band bending, it the rectifying ability of Mg: LN in combination with suitable metal electrodes that allow for further tailoring of conductivity is demonstrated.

  9. Surface conductivity dependent dynamic behaviour of an ultrafine atmospheric pressure plasma jet for microscale surface processing

    NASA Astrophysics Data System (ADS)

    Abuzairi, Tomy; Okada, Mitsuru; Bhattacharjee, Sudeep; Nagatsu, Masaaki

    2016-12-01

    An experimental study on the dynamic behaviour of microcapillary atmospheric pressure plasma jets (APPJs) with 5 μm tip size for surfaces of different conductivity is reported. Electrical and spatio-temporal characteristics of the APPJs are monitored using high voltage probe, current monitor and high speed intensified charge couple device camera. From these experimental results, we presented a simple model to understand the electrical discharge characteristics of the capillary APPJs with double electrodes, and estimated the velocity of the ionization fronts in the jet and the electron density to be 3.5-4.2 km/s and 2-7 × 1017 m-3. By analyzing the dynamics of the microcapillary APPJs for different substrate materials, it was found that the surface irradiation area strongly depended on the substrate conductivity and permittivity, especially in the case of polymer-like substrate, surface irradiation area was significantly broadened probably due to the repelling behaviour of the plasma jets from the accumulated electrical charges on the polymer surface. The effect of applying a substrate bias in the range from -900 V to +900 V on the plasma irradiation onto the substrates was also investigated. From the knowledge of the present results, it is helpful for choosing the substrate materials for microscale surface modification.

  10. Thickness, humidity, and polarization dependent ferroelectric switching and conductivity in Mg doped lithium niobate

    SciTech Connect

    Neumayer, Sabine M.; Rodriguez, Brian J.; Strelcov, Evgheni; Kravchenko, Ivan I.; Kalinin, Sergei V.; Manzo, Michele; Gallo, Katia; Kholkin, Andrei L.

    2015-12-28

    Mg doped lithium niobate (Mg:LN) exhibits several advantages over undoped LN such as resistance to photorefraction, lower coercive fields, and p-type conductivity that is particularly pronounced at domain walls and opens up a range of applications, e.g., in domain wall electronics. Engineering of precise domain patterns necessitates well founded knowledge of switching kinetics, which can differ significantly from that of undoped LN. In this work, the role of humidity and sample composition in polarization reversal has been investigated under application of the same voltage waveform. Control over domain sizes has been achieved by varying the sample thickness and initial polarization as well as atmospheric conditions. In addition, local introduction of proton exchanged phases allows for inhibition of domain nucleation or destabilization, which can be utilized to modify domain patterns. Polarization dependent current flow, attributed to charged domain walls and band bending, demonstrates the rectifying ability of Mg:LN in combination with suitable metal electrodes that allow for further tailoring of conductivity.

  11. Observation of a magnetic field dependence of the lattice thermal conductivity

    NASA Astrophysics Data System (ADS)

    Jin, Hyungyu; Restrepo, Oscar; Antolin, Nikolas; Windl, Wolfgang; Barnes, Stewart; Heremans, Joseph

    2014-03-01

    Can phonons respond to magnetic fields? From the simple point of view of the classical lattice vibrations, there is no clue that phonons possess any magnetic characteristics. Here, we report for the first time that the lattice thermal conductivity can show a response to an external magnetic field in a non-magnetic semiconductor crystal. We observe a magnetic field dependence of the lattice thermal conductivity in a high quality 2x1015 Te doped single crystal of InSb. The electronic contribution is over 106 times smaller than the lattice. The effect is observed in the temperature regime where the Umklapp processes start appearing, and still mainly involve phonons with long mean free paths. A special thermal design is employed to obtain a high accuracy heat flux measurement. Detailed experimental procedures and results are presented along with a brief discussion about possible origins of the effect. HJ and JPH are supported by AFOSR MURI ``Cryogenic Peltier Cooling'' Contract #FA9550-10-1-0533; ODR and WW are supported by the Center for Emergent Materials, an NSF MRSEC at The Ohio State University (Grant DMR-0820414).

  12. Lead titanate/cyclic carbonate dependence on ionic conductivity of ferro/acrylate blend polymer composites

    NASA Astrophysics Data System (ADS)

    Jayaraman, R.; Vickraman, P.; Subramanian, N. M. V.; Justin, A. Simon

    2016-05-01

    Impedance, XRD, DSC and FTIR studies had been carried out for PVdF-co-HFP/LIBETI based system for three plasticizer (EC/DMC) - filler (PbTiO3) weight ratios. The enhanced conductivity 4.18 × 10-5 Scm-1 was noted for 57.5 wt% -7.5 wt% plasticizer - filler. while blending PEMA to PVdF-co-HFP respectively 7.5: 22.5 wt % (3/7), 15 wt%: 15 wt % (5/5) and 22.5wt %: 7.5 wt % (7/3), the improved conductivity was noted for 3/7 ratio 1.22 × 10-5 S cm-1 and its temperature dependence abide Arrhenius behavior. The intensity of peaks in XRD diffractogram registered dominance of lead titanate, from 2θ = 10° to 80° and absence of VdF crystallites (α+β phase) was noted. In DSC studies, the presence of the exotherm events, filler effect was distinctively seen exhibiting recrystallization of VdF crystallites. In blending PEMA, however, no trace of exotherms was found suggestive of PEMA better inhibiting recrystallization. FTIR study confirmed molecular interactions of various constituents in the vibrational band 500 - 1000 cm-1 both in pristine PVdF-co-HFP and PEMA blended composites with reference to C-F stretching, C-H stretching and C=O carbonyl bands.

  13. Lead titanate/cyclic carbonate dependence on ionic conductivity of ferro/acrylate blend polymer composites

    SciTech Connect

    Jayaraman, R.; Vickraman, P. Subramanian, N. M. V.; Justin, A. Simon

    2016-05-23

    Impedance, XRD, DSC and FTIR studies had been carried out for PVdF-co-HFP/LIBETI based system for three plasticizer (EC/DMC) – filler (PbTiO3) weight ratios. The enhanced conductivity 4.18 × 10{sup −5} Scm{sup −1} was noted for 57.5 wt% −7.5 wt% plasticizer – filler. while blending PEMA to PVdF-co-HFP respectively 7.5: 22.5 wt % (3/7), 15 wt%: 15 wt % (5/5) and 22.5wt %: 7.5 wt % (7/3), the improved conductivity was noted for 3/7 ratio 1.22 × 10{sup −5} S cm{sup −1} and its temperature dependence abide Arrhenius behavior. The intensity of peaks in XRD diffractogram registered dominance of lead titanate, from 2θ = 10° to 80° and absence of VdF crystallites (α+β phase) was noted. In DSC studies, the presence of the exotherm events, filler effect was distinctively seen exhibiting recrystallization of VdF crystallites. In blending PEMA, however, no trace of exotherms was found suggestive of PEMA better inhibiting recrystallization. FTIR study confirmed molecular interactions of various constituents in the vibrational band 500 – 1000 cm{sup −1} both in pristine PVdF-co-HFP and PEMA blended composites with reference to C-F stretching, C-H stretching and C=O carbonyl bands.

  14. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

    PubMed

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

    2014-06-25

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

  15. Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis

    PubMed Central

    Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A.; De Wever, Veerle; Morrice, Nick A.; Meek, Katheryn; Lees-Miller, Susan P.

    2014-01-01

    The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs’ role in mitosis may be mechanistically distinct from its well-established role in NHEJ. PMID:24844881

  16. DNA-programmed modular assembly of cyclic and linear nanoarrays for the synthesis of two-dimensional conducting polymers.

    PubMed

    Chen, Wen; Schuster, Gary B

    2012-01-18

    Nanometer-scale arrays of conducting polymers were prepared on scaffolds of self-assembling DNA modules. A series of DNA oligomers was prepared, each containing six 2,5-bis(2-thienyl)pyrrole (SNS) monomer units linked covalently to N4 atoms of alternating cytosines placed between leading and trailing 12-nucleobase recognition sequences. These DNA modules were encoded so the recognition sequences would uniquely associate through Watson-Crick assembly to form closed-cycle or linear arrays of aligned SNS monomers. The melting behavior and electrophoretic migration of these assemblies showed cooperative formation of multicomponent arrays containing two to five DNA modules (i.e., 12-30 SNS monomers). The treatment of these arrays with horseradish peroxidase and H(2)O(2) resulted in oxidative polymerization of the SNS monomers with concomitant ligation of the DNA modules. The resulting cyclic and linear arrays exhibited chemical and optical properties typical of conducting thiophene-like polymers, with a red-end absorption beyond 1250 nm. AFM images of the cyclic array containing 18 SNS units revealed highly regular 10 nm diameter objects. © 2011 American Chemical Society

  17. Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

    PubMed

    Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

    2017-06-15

    Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Collapse of Conductance Is Prevented by a Glutamate Residue Conserved in Voltage-Dependent K+ Channels

    PubMed Central

    Ortega-Sáenz, Patricia; Pardal, Ricardo; Castellano, Antonio; López-Barneo, José

    2000-01-01

    Voltage-dependent K+ channel gating is influenced by the permeating ions. Extracellular K+ determines the occupation of sites in the channels where the cation interferes with the motion of the gates. When external [K+] decreases, some K+ channels open too briefly to allow the conduction of measurable current. Given that extracellular K+ is normally low, we have studied if negatively charged amino acids in the extracellular loops of Shaker K+ channels contribute to increase the local [K+]. Surprisingly, neutralization of the charge of most acidic residues has minor effects on gating. However, a glutamate residue (E418) located at the external end of the membrane spanning segment S5 is absolutely required for keeping channels active at the normal external [K+]. E418 is conserved in all families of voltage-dependent K+ channels. Although the channel mutant E418Q has kinetic properties resembling those produced by removal of K+ from the pore, it seems that E418 is not simply concentrating cations near the channel mouth, but has a direct and critical role in gating. Our data suggest that E418 contributes to stabilize the S4 voltage sensor in the depolarized position, thus permitting maintenance of the channel open conformation. PMID:10919865

  19. Inactivation of a high conductance calcium dependent potassium current in rat hippocampal neurons.

    PubMed

    McLarnon, J G

    1995-06-23

    Inactivating, high conductance BK-type currents have been recorded from inside-out patches (internal and external K+ of 140 mM and 5 mM, respectively), obtained from cultured rat hippocampal neurons. The presence of prominent inactivation, not normally associated with BK channel activity, was dependent on two factors: a depolarizing step to 0 mV from a holding level of -80 mV and internal calcium at a concentration of 0.7 microM. Without the prior conditioning step to a negative potential, unitary currents were not evident at 0 mV; in addition, such currents were not elicited with the stimulus protocol if the internal Ca2+ was reduced to a level of 0.3 microM. Concomitant with current inactivation was the finding of a delayed activation of BK currents following the depolarizing step. Higher internal calcium, at 100 microM, led to persistent and sustained channel activity at 0 mV which was not dependent on a prior step to -80 mV. These results may be relevant to the complex nature of the repolarizing neuronal current Ic which is the macroscopic analogue of the unitary BK current.

  20. Calcium activates the light-dependent conductance in melanopsin-expressing photoreceptors of amphioxus.

    PubMed

    Peinado, Gabriel; Osorno, Tomás; Gomez, María del Pilar; Nasi, Enrico

    2015-06-23

    Melanopsin, the photopigment of the "circadian" receptors that regulate the biological clock and the pupillary reflex in mammals, is homologous to invertebrate rhodopsins. Evidence supporting the involvement of phosphoinositides in light-signaling has been garnered, but the downstream effectors that control the light-dependent conductance remain unknown. Microvillar photoreceptors of the primitive chordate amphioxus also express melanopsin and transduce light via phospholipase-C, apparently not acting through diacylglycerol. We therefore examined the role of calcium in activating the photoconductance, using simultaneous, high time-resolution measurements of membrane current and Ca(2+) fluorescence. The light-induced calcium rise precedes the onset of the photocurrent, making it a candidate in the activation chain. Moreover, photolysis of caged Ca elicits an inward current of similar size, time course and pharmacology as the physiological photoresponse, but with a much shorter latency. Internally released calcium thus emerges as a key messenger to trigger the opening of light-dependent channels in melanopsin-expressing microvillar photoreceptors of early chordates.

  1. The calcium-dependent protein kinase CPK7 acts on root hydraulic conductivity.

    PubMed

    Li, Guowei; Boudsocq, Marie; Hem, Sonia; Vialaret, Jérôme; Rossignol, Michel; Maurel, Christophe; Santoni, Véronique

    2015-07-01

    The hydraulic conductivity of plant roots (Lp(r)) is determined in large part by the activity of aquaporins. Mechanisms occurring at the post-translational level, in particular phosphorylation of aquaporins of the plasma membrane intrinsic protein 2 (PIP2) subfamily, are thought to be of critical importance for regulating root water transport. However, knowledge of protein kinases and phosphatases acting on aquaporin function is still scarce. In the present work, we investigated the Lp(r) of knockout Arabidopsis plants for four Ca(2+)-dependent protein kinases. cpk7 plants showed a 30% increase in Lp(r) because of a higher aquaporin activity. A quantitative proteomic analysis of wild-type and cpk7 plants revealed that PIP gene expression and PIP protein quantity were not correlated and that CPK7 has no effect on PIP2 phosphorylation. In contrast, CPK7 exerts a negative control on the cellular abundance of PIP1s, which likely accounts for the higher Lp(r) of cpk7. In addition, this study revealed that the cellular amount of a few additional proteins including membrane transporters is controlled by CPK7. The overall work provides evidence for CPK7-dependent stability of specific membrane proteins.

  2. Calcium activates the light-dependent conductance in melanopsin-expressing photoreceptors of amphioxus

    PubMed Central

    Peinado, Gabriel; Osorno, Tomás; Gomez, María del Pilar; Nasi, Enrico

    2015-01-01

    Melanopsin, the photopigment of the “circadian” receptors that regulate the biological clock and the pupillary reflex in mammals, is homologous to invertebrate rhodopsins. Evidence supporting the involvement of phosphoinositides in light-signaling has been garnered, but the downstream effectors that control the light-dependent conductance remain unknown. Microvillar photoreceptors of the primitive chordate amphioxus also express melanopsin and transduce light via phospholipase-C, apparently not acting through diacylglycerol. We therefore examined the role of calcium in activating the photoconductance, using simultaneous, high time-resolution measurements of membrane current and Ca2+ fluorescence. The light-induced calcium rise precedes the onset of the photocurrent, making it a candidate in the activation chain. Moreover, photolysis of caged Ca elicits an inward current of similar size, time course and pharmacology as the physiological photoresponse, but with a much shorter latency. Internally released calcium thus emerges as a key messenger to trigger the opening of light-dependent channels in melanopsin-expressing microvillar photoreceptors of early chordates. PMID:26056310

  3. History dependence of human muscle-fiber conduction velocity during voluntary isometric contractions

    PubMed Central

    Lateva, Zoia C.

    2011-01-01

    The conduction velocity (CV) of a muscle fiber is affected by the fiber's discharge history going back ∼1 s. We investigated this dependence by measuring CV fluctuations during voluntary isometric contractions of the human brachioradialis muscle. We recorded electromyogram (EMG) signals simultaneously from multiple intramuscular electrodes, identified potentials belonging to the same motor unit using EMG decomposition, and estimated the CV of each discharge from the interpotential interval. In 12 of 14 subjects, CV increased by ∼10% during the first second after recruitment and then fluctuated by about ±2% in a way that mirrored the fluctuations in the instantaneous firing rate. The CV profile could be precisely described in terms of the discharge history by a simple mathematical model. In the other two subjects, and one subject retested after cooling the arm, the CV fluctuations were inversely correlated with instantaneous firing rate. In all subjects, CV was additionally affected by very short interdischarge intervals (<25 ms): it was increased in doublets at recruitment, but decreased in doublets during continuous firing and after short interdischarge intervals in doubly innervated fibers. CV also exhibited a slow trend of about −0.05%/s that did not depend on the immediate discharge history. We suggest that measurements of CV fluctuations during voluntary contractions, or during stimulation protocols that involve longer and more complex stimulation patterns than are currently being used, may provide a sensitive approach for estimating the dynamic characteristics of ion channels in the human muscle-fiber membrane. PMID:21565985

  4. Ion concentration-dependence of rat cardiac unitary L-type calcium channel conductance.

    PubMed Central

    Guia, A; Stern, M D; Lakatta, E G; Josephson, I R

    2001-01-01

    Little is known about the native properties of unitary cardiac L-type calcium currents (i(Ca)) measured with physiological calcium (Ca) ion concentration, and their role in excitation-contraction (E-C) coupling. Our goal was to chart the concentration-dependence of unitary conductance (gamma) to physiological Ca concentration and compare it to barium ion (Ba) conductance in the absence of agonists. In isolated, K-depolarized rat myocytes, i(Ca) amplitudes were measured using cell-attached patches with 2 to 70 mM Ca or 2 to 105 mM Ba in the pipette. At 0 mV, 2 mM of Ca produced 0.12 pA, and 2 mM of Ba produced 0.19 pA unitary currents. Unitary conductance was described by a Langmuir isotherm relationship with a maximum gammaCa of 5.3 +/- 0.2 pS (n = 15), and gammaBa of 15 +/- 1 pS (n = 27). The concentration producing half-maximal gamma, Kd(gamma), was not different between Ca (1.7 +/- 0.3 mM) and Ba (1.9 +/- 0.4 mM). We found that quasi-physiological concentrations of Ca produced currents that were as easily resolvable as those obtained with the traditionally used higher concentrations. This study leads to future work on the molecular basis of E-C coupling with a physiological concentration of Ca ions permeating the Ca channel. PMID:11371449

  5. DNA polymerase β-dependent cell survival independent of XRCC1 expression

    PubMed Central

    Horton, Julie K.; Gassman, Natalie R.; Dunigan, Brittany B.; Stefanick, Donna F.; Wilson, Samuel H.

    2014-01-01

    Base excision repair (BER) is a primary mechanism for repair of base lesions in DNA such as those formed by exposure to the DNA methylating agent methyl methanesulfonate (MMS). Both DNA polymerase β (pol β)- and XRCC1-deficient mouse fibroblasts are hypersensitive to MMS. This is linked to a repair deficiency as measured by accumulation of strand breaks and poly(ADP-ribose) (PAR). The interaction between pol β and XRCC1 is important for recruitment of pol β to sites of DNA damage. Endogenous DNA damage can substitute for MMS-induced damage such that BER deficiency as a result of either pol β- or XRCC1-deletion is associated with sensitivity to PARP inhibitors. Pol β shRNA was used to knock down pol β in Xrcc1+/+ and Xrcc1−/− mouse fibroblasts. We determined whether pol β-mediated cellular resistance to MMS and PARP inhibitors resulted entirely from coordination with XRCC1 within the same BER sub-pathway. We find evidence for pol β- dependent cell survival independent of XRCC1 expression for both types of agents. The results suggest a role for pol β-dependent, XRCC1-independent repair. PAR immunofluorescence data are consistent with the hypothesis of a decrease in repair in both pol β knock down cell variants. PMID:25541391

  6. Erythroblast transformation by FLI-1 depends upon its specific DNA binding and transcriptional activation properties.

    PubMed

    Ano, Sabine; Pereira, Rui; Pironin, Martine; Lesault, Isabelle; Milley, Caroline; Lebigot, Ingrid; Quang, Christine Tran; Ghysdael, Jacques

    2004-01-23

    FLI-1 is a transcriptional regulator of the ETS family of proteins. Insertional activation at the FLI-1 locus is an early event in F-murine leukemia virus-induced erythroleukemia. Consistent with its essential role in erythroid transformation, enforced expression of FLI-1 in primary erythroblasts strongly impairs the response of these cells to erythropoietin (Epo), a cytokine essential to erythropoiesis. We show here that point mutations in the ETS domain that abolished FLI-1 binding to specific DNA elements (ETS-binding sites) suppressed the ability of FLI-1 to transform erythroblasts. The exchange of the entire ETS domain (DNA binding domain) of FLI-1 for that of PU.1 changed the DNA binding specificity of FLI-1 for that of PU.1 and impaired FLI-1 transforming properties. In contrast, ETS domain swapping mutants that maintained the DNA binding specificity of FLI-1 did not affect the ability of FLI-1 to transform erythroblasts. Deletion and swapping mutants that failed to inhibit the DNA binding activity of FLI-1 but impaired its transcriptional activation properties were also transformation-defective. Taken together, these results show that both the ability of FLI-1 to inhibit Epo-induced differentiation of erythroblasts and to confer enhanced cell survival in the absence of Epo critically depend upon FLI-1 ETS-binding site-dependent transcriptional activation properties.

  7. Involvement of a Rac1-Dependent Macropinocytosis Pathway in Plasmid DNA Delivery by Electrotransfection.

    PubMed

    Mao, Mao; Wang, Liangli; Chang, Chun-Chi; Rothenberg, Katheryn E; Huang, Jianyong; Wang, Yingxiao; Hoffman, Brenton D; Liton, Paloma B; Yuan, Fan

    2017-03-01

    Electrotransfection is a widely used method for delivering genes into cells with electric pulses. Although different hypotheses have been proposed, the mechanism of electrotransfection remains controversial. Previous studies have indicated that uptake and intracellular trafficking of plasmid DNA (pDNA) are mediated by endocytic pathways, but it is still unclear which pathways are directly involved in the delivery. To this end, the present study investigated the dependence of electrotransfection on macropinocytosis. Data from the study demonstrated that electric pulses induced cell membrane ruffling and actin cytoskeleton remodeling. Using fluorescently labeled pDNA and a macropinocytosis marker (i.e., dextran), the study showed that electrotransfected pDNA co-localized with dextran in intracellular vesicles. Furthermore, electrotransfection efficiency could be decreased significantly by reducing temperature or treatment of cells with a pharmacological inhibitor of Rac1 and could be altered by changing Rac1 activity. Taken together, the findings suggested that electrotransfection of pDNA involved Rac1-dependent macropinocytosis.

  8. Highly thymine-dependent formation of fluorescent copper nanoparticles templated by ss-DNA

    NASA Astrophysics Data System (ADS)

    Liu, Guiying; Shao, Yong; Peng, Jian; Dai, Wei; Liu, Lingling; Xu, Shujuan; Wu, Fei; Wu, Xiaohua

    2013-08-01

    Double-stranded DNAs (ds-DNAs) have been identified as efficient templates favoring the formation of fluorescent copper nanoparticles (Cu NPs). Herein, we have tried to synthesize fluorescent Cu NPs using single-stranded DNAs (ss-DNAs) as templates and to identify the critical DNA sequences. By comparing the results using homopolymer DNAs, hairpin DNAs, and pristine ss-DNAs as templates, we found that DNA thymine base plays a dominant role in producing red-emissive fluorescent Cu NPs on ss-DNA templates. The thymine-dependent growth of the fluorescent Cu NPs is confirmed by Hg2+ mediated T-T base pair in comparison with the other non-specific metal ions, which could be developed into a practical sensor for turn-on fluorescence detection of Hg2+ with a high selectivity. The mechanism is briefly discussed according the DNA sequence-dependent formation of fluorescent Cu NPs. This work demonstrates the sequence role in producing fluorescent Cu NPs that could serve as promising fluorescent nanoprobes in biosensing and DNA-hosted Cu nanomaterials.

  9. Pulse Shape and Timing Dependence on the Spike-Timing Dependent Plasticity Response of Ion-Conducting Memristors as Synapses

    PubMed Central

    Campbell, Kristy A.; Drake, Kolton T.; Barney Smith, Elisa H.

    2016-01-01

    Ion-conducting memristors comprised of the layered materials Ge2Se3/SnSe/Ag are promising candidates for neuromorphic computing applications. Here, the spike-timing dependent plasticity (STDP) application is demonstrated for the first time with a single memristor type operating as a synapse over a timescale of 10 orders of magnitude, from nanoseconds through seconds. This large dynamic range allows the memristors to be useful in applications that require slow biological times, as well as fast times such as needed in neuromorphic computing, thus allowing multiple functions in one design for one memristor type—a “one size fits all” approach. This work also investigated the effects of varying the spike pulse shapes on the STDP response of the memristors. These results showed that small changes in the pre- and postsynaptic pulse shape can have a significant impact on the STDP. These results may provide circuit designers with insights into how pulse shape affects the actual memristor STDP response and aid them in the design of neuromorphic circuits and systems that can take advantage of certain features in the memristor STDP response that are programmable via the pre- and postsynaptic pulse shapes. In addition, the energy requirement per memristor is approximated based on the pulse shape and timing responses. The energy requirement estimated per memristor operating on slower biological timescales (milliseconds to seconds) is larger (nanojoules range), as expected, than the faster (nanoseconds) operating times (~0.1 pJ in some cases). Lastly, the memristors responded in a similar manner under normal STDP conditions (pre- and post-spikes applied to opposite memristor terminals) as they did to the case where a waveform corresponding to the difference between pre- and post-spikes was applied to only one electrode, with the other electrode held at ground potential. By applying the difference signal to only one terminal, testing of the memristor in various

  10. Preferential Hydration of DNA: The Magnitude and Distance Dependence of Alcohol and Polyol Interactions

    PubMed Central

    Stanley, Christopher; Rau, Donald C.

    2006-01-01

    The physical forces that underlie the exclusion of solutes from macromolecular surfaces can be probed in a similar way as the measurement of forces between macromolecules in condensed arrays using the osmotic stress technique and x-ray scattering. We report here the dependence of alcohol exclusion or, equivalently, the preferential hydration of DNA on the spacing between helices in condensed arrays. The actual forces describing exclusion are quite different from the commonly assumed steric crowding coupled with weak binding. For a set of 12 nonpolar alcohols, exclusion is due to repulsive hydration interactions with the charged DNA surface. Exclusion amplitudes do not depend simply on size, but rather on the balance between alkyl carbons and hydroxyl oxygens. Polyols are included at very close spacings. The distance dependence of polyol inclusion, however, is quite different from nonpolar alcohol exclusion, suggesting the underlying mechanism of interaction is different. PMID:16714350

  11. Strain dependent UV degradation of Escherichia coli DNA monitored by Fourier transform infrared spectroscopy.

    PubMed

    Muntean, Cristina M; Lapusan, Alexandra; Mihaiu, Liora; Stefan, Razvan

    2014-01-05

    In this work we present a method for detection of DNA isolated from nonpathogenic Escherichia coli strains, respectively. Untreated and UV irradiated bacterial DNAs were analyzed by FT-IR spectroscopy, to investigate their screening characteristic features and their structural radiotolerance at 253.7nm. FT-IR spectra, providing a high molecular structural information, have been analyzed in the wavenumber range 800-1800cm(-1). FT-IR signatures, spectroscopic band assignments and structural interpretations of these DNAs are reported. Also, UV damage at the DNA molecular level is of interest. Strain dependent UV degradation of DNA from E. coli has been observed. Particularly, alterations in nucleic acid bases, base pairing and base stacking have been found. Also changes in the DNA conformation and deoxyribose were detected. Based on this work, specific E. coli DNA-ligand interactions, drug development and vaccine design for a better understanding of the infection mechanism caused by an interference between pathogenic and nonpathogenic bacteria and for a better control of disease, respectively, might be further investigated using Fourier transform infrared spectroscopy. Besides, understanding the pathways for UV damaged DNA response, like nucleic acids repair mechanisms is appreciated.

  12. Delineating Species with DNA Barcodes: A Case of Taxon Dependent Method Performance in Moths

    PubMed Central

    Kekkonen, Mari; Mutanen, Marko; Kaila, Lauri; Nieminen, Marko; Hebert, Paul D. N.

    2015-01-01

    The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs), few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC) methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65%) OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90%) in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work. PMID:25849083

  13. Direction- and Salt-Dependent Ionic Current Signatures for DNA Sensing with Asymmetric Nanopores

    NASA Astrophysics Data System (ADS)

    Chen, Kaikai; Bell, Nicholas A. W.; Kong, Jinglin; Tian, Yu; Keyser, Ulrich F.

    2017-02-01

    Solid-state nanopores are promising tools for single molecule detection of both DNA and proteins. In this study, we investigate the patterns of ionic current blockades as DNA translocates into or out of the geometric confinement of such conically shaped pores. We studied how the geometry of a nanopore affects the detected ionic current signal of a translocating DNA molecule over a wide range of salt concentration. The blockade level in the ionic current depends on the translocation direction at a high salt concentration, and at lower salt concentrations we find a non-intuitive ionic current decrease and increase within each single event for the DNA translocations exiting from confinement. We use recently developed DNA rulers with markers and finite element calculations to explain our observations. Our calculations explain the shapes of the signals observed at all salt concentrations and show that the unexpected current decrease and increase are due to the competing effects of ion concentration polarization and geometric exclusion of ions. Our analysis shows that over a wide range of geometry, voltage and salt concentrations we are able to understand the ionic current signals of DNA in asymmetric nanopores enabling signal optimization in molecular sensing applications.

  14. Electrochemical DNA biosensor based on the proximity-dependent surface hybridization assay.

    PubMed

    Zhang, Yanli; Wang, Ying; Wang, Haibo; Jiang, Jian-Hui; Shen, Guo-Li; Yu, Ru-Qin; Li, Jinghong

    2009-03-01

    This paper describes a novel electrochemical DNA (E-DNA) biosensor for simple, rapid, and specific detection of nucleic acids based on the proximity-dependent surface hybridization assay. This E-DNA biosensor was constructed by self-assembly of a 3' short thiolated capture probe on the gold electrode. DNA detection was realized by outputting a remarkable redox current of the 5' ferrocene (Fc) tail labeled probe. When the target DNA was introduced into the system, it was complementary to the 5' Fc labeled probe at the one-half-segment and complementary to the 3' short thiolated capture probe at the other half-segment, resulting in forming a stable duplex complex. As a result, the Fc probe was proximate to the electrode surface, and the Faradaic current was observed. This E-DNA biosensor was proved to have a low detection limit (1 fM) and a wide dynamic range (from 1 fM to 1 nM) due to the stable hybridization mode. In addition, the sensing system could discriminate the complementary sequence from mismatch sequences, with high sensitivity, stability, and reusability.

  15. Sequence-dependent dynamics of duplex DNA: the applicability of a dinucleotide model.

    PubMed Central

    Okonogi, T M; Alley, S C; Reese, A W; Hopkins, P B; Robinson, B H

    2002-01-01

    The short-time (submicrosecond) bending dynamics of duplex DNA were measured to determine the effect of sequence on dynamics. All measurements were obtained from a single site on duplex DNA, using a single, site-specific modified base containing a rigidly tethered, electron paramagnetic resonance active spin probe. The observed dynamics are interpreted in terms of single-step sequence-dependent bending force constants, determined from the mean squared amplitude of bending relative to the end-to-end vector using the modified weakly bending rod model. The bending dynamics at a single site are a function of the sequence of the nucleotides constituting the duplex DNA. We developed and examined several dinucleotide-based models for flexibility. The models indicate that the dominant feature of the dynamics is best explained in terms of purine- and pyrimidine-type steps, although distinction is made among all 10 unique steps: It was found that purine-purine steps (which are the same as pyrimidine-pyrimidine steps) were near average in flexibility, but the pyrimidine-purine steps (5' to 3') were nearly twice as flexible, whereas purine-pyrimidine steps were more than half as flexible as average DNA. Therefore, the range of stepwise flexibility is approximately fourfold and is characterized by both the type of base pair step (pyrimidine/purine combination) and the identity of the bases within the pair (G, A, T, or C). All of the four models considered here underscore the complexity of the dependence of dynamics on DNA sequence with certain sequences not satisfactorily explainable in terms of any dinucleotide model. These findings provide a quantitative basis for interpreting the dynamics and kinetics of DNA-sequence-dependent biological processes, including protein recognition and chromatin packaging. PMID:12496111

  16. Sodium selenide toxicity is mediated by O2-dependent DNA breaks.

    PubMed

    Peyroche, Gérald; Saveanu, Cosmin; Dauplais, Marc; Lazard, Myriam; Beuneu, François; Decourty, Laurence; Malabat, Christophe; Jacquier, Alain; Blanquet, Sylvain; Plateau, Pierre

    2012-01-01

    Hydrogen selenide is a recurrent metabolite of selenium compounds. However, few experiments studied the direct link between this toxic agent and cell death. To address this question, we first screened a systematic collection of Saccharomyces cerevisiae haploid knockout strains for sensitivity to sodium selenide, a donor for hydrogen selenide (H(2)Se/HSe(-/)Se(2-)). Among the genes whose deletion caused hypersensitivity, homologous recombination and DNA damage checkpoint genes were over-represented, suggesting that DNA double-strand breaks are a dominant cause of hydrogen selenide toxicity. Consistent with this hypothesis, treatment of S. cerevisiae cells with sodium selenide triggered G2/M checkpoint activation and induced in vivo chromosome fragmentation. In vitro, sodium selenide directly induced DNA phosphodiester-bond breaks via an O(2)-dependent reaction. The reaction was inhibited by mannitol, a hydroxyl radical quencher, but not by superoxide dismutase or catalase, strongly suggesting the involvement of hydroxyl radicals and ruling out participations of superoxide anions or hydrogen peroxide. The (•)OH signature could indeed be detected by electron spin resonance upon exposure of a solution of sodium selenide to O(2). Finally we showed that, in vivo, toxicity strictly depended on the presence of O(2). Therefore, by combining genome-wide and biochemical approaches, we demonstrated that, in yeast cells, hydrogen selenide induces toxic DNA breaks through an O(2)-dependent radical-based mechanism.

  17. Requirement of Rad5 for DNA Polymerase ζ-Dependent Translesion Synthesis in Saccharomyces cerevisiae

    PubMed Central

    Pagès, Vincent; Bresson, Anne; Acharya, Narottam; Prakash, Satya; Fuchs, Robert P.; Prakash, Louise

    2008-01-01

    In yeast, Rad6–Rad18-dependent lesion bypass involves translesion synthesis (TLS) by DNA polymerases η or ζ or Rad5-dependent postreplication repair (PRR) in which error-free replication through the DNA lesion occurs by template switching. Rad5 functions in PRR via its two distinct activities—a ubiquitin ligase that promotes Mms2–Ubc13-mediated K63-linked polyubiquitination of PCNA at its lysine 164 residue and a DNA helicase that is specialized for replication fork regression. Both these activities are important for Rad5's ability to function in PRR. Here we provide evidence for the requirement of Rad5 in TLS mediated by Polζ. Using duplex plasmids carrying different site-specific DNA lesions—an abasic site, a cis–syn TT dimer, a (6-4) TT photoproduct, or a G-AAF adduct—we show that Rad5 is needed for Polζ-dependent TLS. Rad5 action in this role is likely to be structural, since neither the inactivation of its ubiquitin ligase activity nor the inactivation of its helicase activity impairs its role in TLS. PMID:18757916

  18. Single-Molecule Studies of the Temperature Dependence of Viral DNA Packaging Motors

    NASA Astrophysics Data System (ADS)

    White, Michael; Raymer, Dorian; Rickgauer, Peter; Fuller, Derek; Grimes, Shelley; Jardine, Paul; Anderson, Dwight; Smith, Doug

    2007-03-01

    A key step in the assembly of many viruses is the packaging of dsDNA into a preformed capsid by the action of a portal molecular motor complex. We have developed methods for directly measuring viral DNA translocation at the single molecule level using optical tweezers and applied these methods to study bacteriophages φ29, lambda, and T4. Our previous measurements with φ29 were performed at room temperature. Here we report that the rate of DNA translocation is strongly temperature dependent. Preliminary measurements indicate that the motor velocity increases ˜2-fold, to ˜250-300 bp/s when the temperature is increased from ˜20 to 30 degrees C. As the viral packaging motors are enzymes that catalyze ATP hydrolysis, such a trend with increasing temperature is to be expected, at least up to the point where the motor complex is thermally dissociated or denatured. However, the detailed form of the temperature dependence is difficult to quantify using standard bulk assay methods. We have installed a heating/cooling system in our optical tweezers instrument that allows us to precisely control the temperature in our sample chamber. This system allows us to systematically study the temperature dependence of the DNA translocation rate.

  19. Inhibition of RNA-dependent DNA polymerase of Rous sarcoma virus by thiosemicarbazones and several cations.

    PubMed

    Levinson, W; Faras, A; Woodson, B; Jackson, J; Bishop, J M

    1973-01-01

    The RNA-dependent DNA polymerase of Rous sarcoma virus is inhibited by N-methyl isatin beta-thiosemicarbazone and by thiosemicarbazide, but not by semicarbazide. These inhibitors also inactivate, upon contact with the virion, the transforming ability of Rous sarcoma virus. Sulfhydryl donors, such as 2-mercapto-ethanol, can prevent these effects. The RNA-directed activity of the purified polymerase is inhibited to a greater degree than is the DNA-directed activity. Two cations, Cu(++) and Hg(++), can inhibit RNA-dependent DNA polymerase and inactivate the transforming ability of the virus. Synergism between N-methyl isatin beta-thiosemicarbazone and Cu(++) occurs, since treatment of the virus with a low dose of either N-methyl isatin beta-thiosemicarbazone or Cu(++) has little effect; however, when the two compounds are mixed together, significant inactivation occurs. This observation supports the hypothesis that the antiviral action of thiosemicarbazones is a function of their ability to act as a ligand for metallic ions. Several cations (Ag(+), Co(++), Zn(++), Cd(++), and Ni(++)) significantly inactivate the RNA-dependent DNA polymerase, but have little effect on the transforming ability. In view of this result, the conclusion that the enzyme activity is required for transformation remains open to question.

  20. Dimorphic DNA methylation during temperature-dependent sex determination in the sea turtle Lepidochelys olivacea.

    PubMed

    Venegas, Daniela; Marmolejo-Valencia, Alejandro; Valdes-Quezada, Christian; Govenzensky, Tzipe; Recillas-Targa, Félix; Merchant-Larios, Horacio

    2016-09-15

    Sex determination in vertebrates depends on the expression of a conserved network of genes. Sea turtles such as Lepidochelys olivacea have temperature-dependent sex determination. The present work analyses some of the epigenetic processes involved in this. We describe sexual dimorphism in global DNA methylation patterns between ovaries and testes of L. olivacea and show that the differences may arise from a combination of DNA methylation and demethylation events that occur during sex determination. Irrespective of incubation temperature, 5-hydroxymethylcytosine was abundant in the bipotential gonad; however, following sex determination, this modification was no longer found in pre-Sertoli cells in the testes. These changes correlate with the establishment of the sexually dimorphic DNA methylation patterns, down regulation of Sox9 gene expression in ovaries and irreversible gonadal commitment towards a male or female differentiation pathway. Thus, DNA methylation changes may be necessary for the stabilization of the gene expression networks that drive the differentiation of the bipotential gonad to form either an ovary or a testis in L. olivacea and probably among other species that manifest temperature-dependent sex determination.

  1. Early days of DNA repair: discovery of nucleotide excision repair and homology-dependent recombinational repair.

    PubMed

    Rupp, W Dean

    2013-12-13

    The discovery of nucleotide excision repair in 1964 showed that DNA could be repaired by a mechanism that removed the damaged section of a strand and replaced it accurately by using the remaining intact strand as the template. This result showed that DNA could be actively metabolized in a process that had no precedent. In 1968, experiments describing postreplication repair, a process dependent on homologous recombination, were reported. The authors of these papers were either at Yale University or had prior Yale connections. Here we recount some of the events leading to these discoveries and consider the impact on further research at Yale and elsewhere.

  2. Computational Study of the Force Dependence of Phosphoryl Transfer during DNA Synthesis by a High Fidelity Polymerase

    NASA Astrophysics Data System (ADS)

    Venkatramani, Ravindra; Radhakrishnan, Ravi

    2008-02-01

    High fidelity polymerases are efficient catalysts of phosphodiester bond formation during DNA replication or repair. We interpret molecular dynamics simulations of a polymerase bound to its substrate DNA and incoming nucleotide using a quasiharmonic model to study the effect of external forces applied to the bound DNA on the kinetics of phosphoryl transfer. The origin of the force dependence is shown to be an intriguing coupling between slow, delocalized polymerase-DNA modes and fast catalytic site motions. Using noncognate DNA substrates we show that the force dependence is context specific.

  3. Unusual sequence length-dependent gold nanoparticles aggregation of the ssDNA sticky end and its application for enzyme-free and signal amplified colorimetric DNA detection

    NASA Astrophysics Data System (ADS)

    He, Hongfei; Dai, Jianyuan; Duan, Zhijuan; Zheng, Baozhan; Meng, Yan; Guo, Yong; Dan Xiao, A1"/>

    2016-08-01

    It is known that the adsorption of short single-stranded DNA (ssDNA) on unmodified gold nanoparticles (AuNPs) is much faster than that for long ssDNA, and thus leads to length-dependent AuNPs aggregation after addition of salt, the color of the solutions sequentially changed from red to blue in accordance with the increase of ssDNA length. However, we found herein that the ssDNA sticky end of hairpin DNA exhibited a completely different adsorption behavior compared to ssDNA, an inverse blue-to-red color variation was observed in the colloid solution with the increase of sticky end length when the length is within a certain range. This unusual sequence length-dependent AuNPs aggregation might be ascribed to the effect of the stem of hairpin DNA. On the basis of this unique phenomenon and catalytic hairpin assembly (CHA) based signal amplification, a novel AuNPs-based colorimetric DNA assay with picomolar sensitivity and specificity was developed. This unusual sequence length-dependent AuNPs aggregation of the ssDNA sticky end introduces a new direction for the AuNPs-based colorimetric assays.

  4. Hydroxyl-radical-dependent DNA damage by ambient particulate matter from contrasting sampling locations

    SciTech Connect

    Shi Tingming; Duffin, Rodger; Borm, Paul J.A.; Li Hui; Weishaupt, Christel; Schins, Roel P.F. . E-mail: roel.schins@uni-duesseldorf.de

    2006-05-15

    Exposure to ambient particulate matter (PM) has been reported to be associated with increased respiratory, cardiovascular, and malignant lung disease. Previously we have shown that PM can induce oxidative DNA damage in A549 human lung epithelial cells. The aims of the present study were to investigate the variability of the DNA-damaging properties of PM sampled at different locations and times and to relate the observed effects to the hydroxyl-radical ({center_dot}OH)-generating activities of these samples. Weekly samples of coarse (10-2.5 {mu}m) and fine (<2.5 {mu}m) PM from four sites (Nordrheim Westfalen, Germany) were analyzed for hydrogen-peroxide-dependent {center_dot}OH formation using electron paramagnetic resonance and formation of 8-hydroxydeoxyguanosine (8-OHdG) in calf thymus DNA using an immuno-dot-blot assay. DNA strand breakage by fine PM in A549 human lung epithelial cells was quantified using the alkaline comet assay. Both PM size distribution fractions elicited {center_dot}OH generation and 8-OHdG formations in calf thymus DNA. Significantly higher {center_dot}OH generation was observed for PM sampled at urban/industrial locations and for coarse PM. Samples of fine PM also caused DNA strand breakage in A549 cells and this damage could be prevented using the hydroxyl-radical scavengers 5,5-dimethyl-1-pyrroline-N-oxide and dimethyl sulfoxide. The observed DNA strand breakage appeared to correlate with the hydroxyl-radical-generating capacities of the PM samples but with different profiles for rural versus urban/industrial samples. In conclusion, when considered at equal mass, {center_dot}OH formation of PM shows considerable variability with regard to the sampling location and time and is correlated with its ability to cause DNA damage.

  5. Context-dependent DNA recognition code for C2H2 zinc-finger transcription factors

    PubMed Central

    Liu, Jiajian; Stormo, Gary D.

    2008-01-01

    Motivation: Modeling and identifying the DNA-protein recognition code is one of the most challenging problems in computational biology. Several quantitative methods have been developed to model DNA-protein interactions with specific focus on the C2H2 zinc-finger proteins, the largest transcription factor family in eukaryotic genomes. In many cases, they performed well. But the overall the predictive accuracy of these methods is still limited. One of the major reasons is all these methods used weight matrix models to represent DNA-protein interactions, assuming all base-amino acid contacts contribute independently to the total free energy of binding. Results: We present a context-dependent model for DNA–zinc-finger protein interactions that allows us to identify inter-positional dependencies in the DNA recognition code for C2H2 zinc-finger proteins. The degree of non-independence was detected by comparing the linear perceptron model with the non-linear neural net (NN) model for their predictions of DNA–zinc-finger protein interactions. This dependency is supported by the complex base-amino acid contacts observed in DNA–zinc-finger interactions from structural analyses. Using extensive published qualitative and quantitative experimental data, we demonstrated that the context-dependent model developed in this study can significantly improves predictions of DNA binding profiles and free energies of binding for both individual zinc fingers and proteins with multiple zinc fingers when comparing to previous positional-independent models. This approach can be extended to other protein families with complex base-amino acid residue interactions that would help to further understand the transcriptional regulation in eukaryotic genomes. Availability:The software implemented as c programs and are available by request. http://ural.wustl.edu/softwares.html Contact: stormo@ural.wustl.edu PMID:18586699

  6. Electronic promotion effect of double proton transfer on conduction of DNA through improvement of transverse electronic communication of base pairs

    NASA Astrophysics Data System (ADS)

    Liu, Haiying; Li, Genqin; Zhang, Laibin; Li, Jilai; Wang, Meishan; Bu, Yuxiang

    2011-10-01

    The effect of double proton transfer (DPT) on charge migration of DNA was investigated by the nonequilibrium Green's function method combined with density functional theory. The results revealed that DPT not only lowers ionization potentials, but also improves the delocalization of the localized π-orbitals at each base moiety through adjusting energy levels and spatial distributions of their molecular orbitals. Furthermore, DPT leads to both the strengthening of the second-order interactions of the Watson-Crick H-bond zones, and the promotion of the charge transfer transitions between two pairing bases in the UV absorption spectra. Electronic transport calculations indicated that DPT can improve the charge migration along the DNA duplex for specific sequences through enhancing transverse base-to-base electronic communication. This work will provide a new insight into the understanding of DNA charge conduction which can be electronically promoted or regulated by DPT.

  7. Plasmodium falciparum Regulatory Subunit of cAMP-Dependent PKA and Anion Channel Conductance

    PubMed Central

    Merckx, Anaïs; Nivez, Marie-Paule; Bouyer, Guillaume; Alano, Pietro; Langsley, Gordon; Deitsch, Kirk; Thomas, Serge; Doerig, Christian; Egée, Stéphane

    2008-01-01

    Malaria symptoms occur during Plasmodium falciparum development into red blood cells. During this process, the parasites make substantial modifications to the host cell in order to facilitate nutrient uptake and aid in parasite metabolism. One significant alteration that is required for parasite development is the establishment of an anion channel, as part of the establishment of New Permeation Pathways (NPPs) in the red blood cell plasma membrane, and we have shown previously that one channel can be activated in uninfected cells by exogenous protein kinase A. Here, we present evidence that in P. falciparum-infected red blood cells, a cAMP pathway modulates anion conductance of the erythrocyte membrane. In patch-clamp experiments on infected erythrocytes, addition of recombinant PfPKA-R to the pipette in vitro, or overexpression of PfPKA-R in transgenic parasites lead to down-regulation of anion conductance. Moreover, this overexpressing PfPKA-R strain has a growth defect that can be restored by increasing the levels of intracellular cAMP. Our data demonstrate that the anion channel is indeed regulated by a cAMP-dependent pathway in P. falciparum-infected red blood cells. The discovery of a parasite regulatory pathway responsible for modulating anion channel activity in the membranes of P. falciparum-infected red blood cells represents an important insight into how parasites modify host cell permeation pathways. These findings may also provide an avenue for the development of new intervention strategies targeting this important anion channel and its regulation. PMID:18248092

  8. Coordinate 5' and 3' endonucleolytic trimming of terminally blocked blunt DNA double-strand break ends by Artemis nuclease and DNA-dependent protein kinase.

    PubMed

    Yannone, Steven M; Khan, Imran S; Zhou, Rui-Zhe; Zhou, Tong; Valerie, Kristoffer; Povirk, Lawrence F

    2008-06-01

    Previous work showed that, in the presence of DNA-dependent protein kinase (DNA-PK), Artemis slowly trims 3'-phosphoglycolate-terminated blunt ends. To examine the trimming reaction in more detail, long internally labeled DNA substrates were treated with Artemis. In the absence of DNA-PK, Artemis catalyzed extensive 5'-->3' exonucleolytic resection of double-stranded DNA. This resection required a 5'-phosphate, but did not require ATP, and was accompanied by endonucleolytic cleavage of the resulting 3' overhang. In the presence of DNA-PK, Artemis-mediated trimming was more limited, was ATP-dependent and did not require a 5'-phosphate. For a blunt end with either a 3'-phosphoglycolate or 3'-hydroxyl terminus, endonucleolytic trimming of 2-4 nucleotides from the 3'-terminal strand was accompanied by trimming of 6 nt from the 5'-terminal strand. The results suggest that autophosphorylated DNA-PK suppresses the exonuclease activity of Artemis toward blunt-ended DNA, and promotes slow and limited endonucleolytic trimming of the 5'-terminal strand, resulting in short 3' overhangs that are trimmed endonucleolytically. Thus, Artemis and DNA-PK can convert terminally blocked DNA ends of diverse geometry and chemical structure to a form suitable for polymerase-mediated patching and ligation, with minimal loss of terminal sequence. Such processing could account for the very small deletions often found at DNA double-strand break repair sites.

  9. Electrical conductivity and magnetic field dependent current-voltage characteristics of nanocrystalline nickel ferrite

    NASA Astrophysics Data System (ADS)

    Ghosh, P.; Bhowmik, R. N.; Das, M. R.; Mitra, P.

    2017-04-01

    We have studied the grain size dependent electrical conductivity, dielectric relaxation and magnetic field dependent current voltage (I - V) characteristics of nickel ferrite (NiFe2O4) . The material has been synthesized by sol-gel self-combustion technique, followed by ball milling at room temperature in air environment to control the grain size. The material has been characterized using X-ray diffraction (refined with MAUD software analysis) and Transmission electron microscopy. Impedance spectroscopy and I - V characteristics in the presence of variable magnetic fields have confirmed the increase of resistivity for the fine powdered samples (grain size 5.17±0.6 nm), resulted from ball milling of the chemical routed sample. Activation energy of the material for electrical charge hopping process has increased with the decrease of grain size by mechanical milling of chemical routed sample. The I - V curves showed many highly non-linear and irreversible electrical features, e.g., I - V loop and bi-stable electronic states (low resistance state-LRS and high resistance state-HRS) on cycling the electrical bias voltage direction during I-V curve measurement. The electrical dc resistance for the chemically routed (without milled) sample in HRS (∼3.4876×104