DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase

PubMed Central

Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F

2014-01-01

Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026

BioWires: Conductive DNA Nanowires in a Computationally-Optimized, Synthetic Biological Platform for Nanoelectronic Fabrication

NASA Technical Reports Server (NTRS)

Vecchioni, Simon; Toomey, Emily; Capece, Mark C.; Rothschild, Lynn; Wind, Shalom

2017-01-01

DNA is an ideal template for a biological nanowire-it has a linear structure several atoms thick; it possesses addressable nucleobase geometry that can be precisely defined; and it is massively scalable into branched networks. Until now, the drawback of DNA as a conducting nanowire been, simply put, its low conductance. To address this deficiency, we extensively characterize a chemical variant of canonical DNA that exploits the affinity of natural cytosine bases for silver ions. We successfully construct chains of single silver ions inside double-stranded DNA, confirm the basic dC-Ag+-dC bond geometry and kinetics, and show length-tunability dependent on mismatch distribution, ion availability and enzyme activity. An analysis of the absorbance spectra of natural DNA and silver-binding, poly-cytosine DNA demonstrates the heightened thermostability of the ion chain and its resistance to aqueous stresses such as precipitation, dialysis and forced reduction. These chemically critical traits lend themselves to an increase in electrical conductivity of over an order of magnitude for 11-base silver-paired duplexes over natural strands when assayed by STM break junction. We further construct and implement a genetic pathway in the E. coli bacterium for the biosynthesis of highly ionizable DNA sequences. Toward future circuits, we construct a model of transcription network architectures to determine the most efficient and robust connectivity for cell-based fabrication, and we perform sequence optimization with a genetic algorithm to identify oligonucleotides robust to changes in the base-pairing energy landscape. We propose that this system will serve as a synthetic biological fabrication platform for more complex DNA nanotechnology and nanoelectronics with applications to deep space and low resource environments.

Hormonal induction of transfected genes depends on DNA topology.

PubMed Central

Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M

1990-01-01

Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920

Effects of Ionic Dependence of DNA Persistence Length on the DNA Condensation at Room Temperature

NASA Astrophysics Data System (ADS)

Mao, Wei; Liu, Yan-Hui; Hu, Lin; Xu, Hou-Qiang

2016-05-01

DNA persistence length is a key parameter for quantitative interpretation of the conformational properties of DNA and related to the bending rigidity of DNA. A series of experiments pointed out that, in the DNA condensation process by multivalent cations, the condensed DNA takes elongated coil or compact globule states and the population of the compact globule states increases with an increase in ionic concentration. At the same time, single molecule experiments carried out in solution with multivalent cations (such as spermidine, spermine) indicated that DNA persistence length strongly depends on the ionic concentration. In order to revolve the effects of ionic concentration dependence of persistence length on DNA condensation, a model including the ionic concentration dependence of persistence length and strong correlation of multivalent cation on DNA is provided. The autocorrelation function of the tangent vectors is found as an effective way to detect the ionic concentration dependence of toroidal conformations. With an increase in ion concentration, the first periodic oscillation contained in the autocorrelation function shifts, the number of segment contained in the first periodic oscillation decreases gradually. According to the experiments, the average long-axis length is defined to estimate the ionic concentration dependence of condensation process further. The relation between long-axis length and ionic concentration matches the experimental results qualitatively. Supported by National Natural Science Foundation of China under Grant Nos. 11047022, 11204045, 11464004 and 31360215; The Research Foundation from Ministry of Education of China (212152), Guizhou Provincial Tracking Key Program of Social Development (SY20123089, SZ20113069); The General Financial Grant from the China Postdoctoral Science Foundation (2014M562341); The Research Foundation for Young University Teachers from Guizhou University (201311); The West Light Foundation (2015) and College

DNA origami metallized site specifically to form electrically conductive nanowires.

PubMed

Pearson, Anthony C; Liu, Jianfei; Pound, Elisabeth; Uprety, Bibek; Woolley, Adam T; Davis, Robert C; Harb, John N

2012-09-06

DNA origami is a promising tool for use as a template in the design and fabrication of nanoscale structures. The ability to engineer selected staple strands on a DNA origami structure provides a high density of addressable locations across the structure. Here we report a method using site-specific attachment of gold nanoparticles to modified staple strands and subsequent metallization to fabricate conductive wires from DNA origami templates. We have modified DNA origami structures by lengthening each staple strand in select regions with a 10-base nucleotide sequence and have attached DNA-modified gold nanoparticles to the lengthened staple strands via complementary base-pairing. The high density of extended staple strands allowed the gold nanoparticles to pack tightly in the modified regions of the DNA origami, where the measured median gap size between neighboring particles was 4.1 nm. Gold metallization processes were optimized so that the attached gold nanoparticles grew until gaps between particles were filled and uniform continuous nanowires were formed. Finally, electron beam lithography was used to pattern electrodes in order to measure the electrical conductivity of metallized DNA origami, which showed an average resistance of 2.4 kΩ per metallized structure.

DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

PubMed

Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

2017-09-01

Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

PubMed Central

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt V.; Besenbacher, Flemming; Bald, Ilko

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sections for electron induced single strand breaks in specific 13 mer oligonucleotides we used atomic force microscopy analysis of DNA origami based DNA nanoarrays. We investigated the DNA sequences 5′-TT(XYX)3TT with X = A, G, C and Y = T, BrU 5-bromouracil and found absolute strand break cross sections between 2.66 · 10−14 cm2 and 7.06 · 10−14 cm2. The highest cross section was found for 5′-TT(ATA)3TT and 5′-TT(ABrUA)3TT, respectively. BrU is a radiosensitizer, which was discussed to be used in cancer radiation therapy. The replacement of T by BrU into the investigated DNA sequences leads to a slight increase of the absolute strand break cross sections resulting in sequence-dependent enhancement factors between 1.14 and 1.66. Nevertheless, the variation of strand break cross sections due to the specific nucleotide sequence is considerably higher. Thus, the present results suggest the development of targeted radiosensitizers for cancer radiation therapy. PMID:25487346

Electrochemical DNA Hybridization Sensors Based on Conducting Polymers

PubMed Central

Rahman, Md. Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

2015-01-01

Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective. PMID:25664436

Electrochemical DNA hybridization sensors based on conducting polymers.

PubMed

Rahman, Md Mahbubur; Li, Xiao-Bo; Lopa, Nasrin Siraj; Ahn, Sang Jung; Lee, Jae-Joon

2015-02-05

Conducting polymers (CPs) are a group of polymeric materials that have attracted considerable attention because of their unique electronic, chemical, and biochemical properties. This is reflected in their use in a wide range of potential applications, including light-emitting diodes, anti-static coating, electrochromic materials, solar cells, chemical sensors, biosensors, and drug-release systems. Electrochemical DNA sensors based on CPs can be used in numerous areas related to human health. This review summarizes the recent progress made in the development and use of CP-based electrochemical DNA hybridization sensors. We discuss the distinct properties of CPs with respect to their use in the immobilization of probe DNA on electrode surfaces, and we describe the immobilization techniques used for developing DNA hybridization sensors together with the various transduction methods employed. In the concluding part of this review, we present some of the challenges faced in the use of CP-based DNA hybridization sensors, as well as a future perspective.

Sequence-Dependent Persistence Length of Long DNA

NASA Astrophysics Data System (ADS)

Chuang, Hui-Min; Reifenberger, Jeffrey G.; Cao, Han; Dorfman, Kevin D.

2017-12-01

Using a high-throughput genome-mapping approach, we obtained circa 50 million measurements of the extension of internal human DNA segments in a 41 nm ×41 nm nanochannel. The underlying DNA sequences, obtained by mapping to the reference human genome, are 2.5-393 kilobase pairs long and contain percent GC contents between 32.5% and 60%. Using Odijk's theory for a channel-confined wormlike chain, these data reveal that the DNA persistence length increases by almost 20% as the percent GC content increases. The increased persistence length is rationalized by a model, containing no adjustable parameters, that treats the DNA as a statistical terpolymer with a sequence-dependent intrinsic persistence length and a sequence-independent electrostatic persistence length.

Sequence-dependent DNA flexibility mediates DNase I cleavage.

PubMed

Heddi, Brahim; Abi-Ghanem, Josephine; Lavigne, Marc; Hartmann, Brigitte

2010-01-08

Understanding the preference of nonspecific proteins for certain DNA structural features requires an accurate description of the properties of free DNA, especially regarding their possible predisposition to adopt a conformation that favors the formation of a complex. Exploiting previous exhaustive NMR studies performed on free DNA oligomers, we investigated the molecular basis of DNase I sensitivity under conditions where DNase I binding limits the probability of cleavage. We showed that cleavage intensity was correlated with adjacent 3' phosphate linkage flexibility, monitored by (31)P chemical shifts. Examining NMR-refined DNA structures highlighted that sequence-dependent flexible phosphates were associated with large minor groove variations that may promote the affinity of DNase I, according to relevant DNA-protein complexes. In sum, this work demonstrates that specificity in DNA-DNase I interaction is mediated by DNA flexibility, which influences the induced-fit transitions required to form productive complexes.

DNA Stimulates ATP-Dependent Proteolysis and Protein-Dependent ATPase Activity of Protease La from Escherichia coli

NASA Astrophysics Data System (ADS)

Chung, Chin Ha; Goldberg, Alfred L.

1982-02-01

The product of the lon gene in Escherichia coli is an ATP-dependent protease, protease La, that also binds strongly to DNA. Addition of double-stranded or single-stranded DNA to the protease in the presence of ATP was found to stimulate the hydrolysis of casein or globin 2- to 7-fold, depending on the DNA concentration. Native DNA from several sources (plasmid pBR322, phage T7, or calf thymus) had similar effects, but after denaturation the DNA was 20-100% more effective than the native form. Although poly(rA), globin mRNA, and various tRNAs did not stimulate proteolysis, poly(rC) and poly(rU) were effective. Poly(dT) was stimulatory but (dT)10 was not. In the presence of DNA as in its absence, proteolysis required concomitant ATP hydrolysis, and the addition of DNA also enhanced ATP hydrolysis by protease La 2-fold, but only in the presence of casein. At much higher concentrations, DNA inhibited proteolysis as well as ATP cleavage. Thus, association of this enzyme with DNA may regulate the degradation of cell proteins in vivo.

Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors

NASA Astrophysics Data System (ADS)

Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.

2011-09-01

DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.

DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation

PubMed Central

Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob

2014-01-01

As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252

A sequence-dependent rigid-base model of DNA

NASA Astrophysics Data System (ADS)

Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.

2013-02-01

A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

A sequence-dependent rigid-base model of DNA.

PubMed

Gonzalez, O; Petkevičiūtė, D; Maddocks, J H

2013-02-07

A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

Conformation-dependent DNA attraction

NASA Astrophysics Data System (ADS)

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-05-01

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by

Sequence and Structure Dependent DNA-DNA Interactions

NASA Astrophysics Data System (ADS)

Kopchick, Benjamin; Qiu, Xiangyun

Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

PubMed

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Conformation-dependent DNA attraction.

PubMed

Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang

2014-06-21

Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.

A DNA enzyme with Mg(2+)-Dependent RNA Phosphoesterase Activity

NASA Technical Reports Server (NTRS)

Breaker, Ronald R.; Joyce, Gerald F.

1995-01-01

Previously we demonstrated that DNA can act as an enzyme in the Pb(2+)-dependent cleavage of an RNA phosphoester. This is a facile reaction, with an uncatalyzed rate for a typical RNA phosphoester of approx. 10(exp -4)/ min in the presence of 1 mM Pb(OAc)2 at pH 7.0 and 23 C. The Mg(2+) - dependent reaction is more difficult, with an uncatalyzed rate of approx. 10(exp -7)/ min under comparable conditions. Mg(2+) - dependent cleavage has special relevance to biology because it is compatible with intracellular conditions. Using in vitro selection, we sought to develop a family of phosphoester-cleaving DNA enzymes that operate in the presence of various divalent metals, focusing particularly on the Mg(2+) - dependent reaction. Results: We generated a population of greater than 10(exp 13) DNAs containing 40 random nucleotides and carried out repeated rounds of selective amplification, enriching for molecules that cleave a target RNA phosphoester in the presence of 1 mM Mg(2+), Mn(2+), Zn(2+) or Pb(2+). Examination of individual clones from the Mg(2+) lineage after the sixth round revealed a catalytic motif comprised of a three-stem junction.This motif was partially randomized and subjected to seven additional rounds of selective amplification, yielding catalysts with a rate of 0.01/ min. The optimized DNA catalyst was divided into separate substrate and enzyme domains and shown to have a similar level of activity under multiple turnover conditions. Conclusions: We have generated a Mg(2+) - dependent DNA enzyme that cleaves a target RNA phosphoester with a catalytic rate approx. 10(exp 5) - fold greater than that of the uncatalyzed reaction. This activity is compatible with intracellular conditions, raising the possibility that DNA enzymes might be made to operate in vivo.

Identification of DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel target of bisphenol A.

PubMed

Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

2012-01-01

Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.

Stimulation of NADH-dependent microsomal DNA strand cleavage by rifamycin SV.

PubMed

Kukiełka, E; Cederbaum, A I

1995-04-15

Rifamycin SV is an antibiotic anti-bacterial agent used in the treatment of tuberculosis. This drug can autoxidize, especially in the presence of metals, and generate reactive oxygen species. A previous study indicated that rifamycin SV can increase NADH-dependent microsomal production of reactive oxygen species. The current study evaluated the ability of rifamycin SV to interact with iron and increase microsomal production of hydroxyl radical, as detected by conversion of supercoiled plasmid DNA into the relaxed open circular state. The plasmid used was pBluescript II KS(-), and the forms of DNA were separated by agarose-gel electrophoresis. Incubation of rat liver microsomes with plasmid plus NADH plus ferric-ATP caused DNA strand cleavage. The addition of rifamycin SV produced a time- and concentration-dependent increase in DNA-strand cleavage. No stimulation by rifamycin SV occurred in the absence of microsomes, NADH or ferric-ATP. Stimulation occurred with other ferric complexes besides ferric-ATP, e.g. ferric-histidine, ferric-citrate, ferric-EDTA, and ferric-(NH4)2SO4. Rifamycin SV did not significantly increase the high rates of DNA strand cleavage found with NADPH as the microsomal reductant. The stimulation of NADH-dependent microsomal DNA strand cleavage was completely blocked by catalase, superoxide dismutase, GSH and a variety of hydroxyl-radical-scavenging agents, but not by anti-oxidants that prevent microsomal lipid peroxidation. Redox cycling agents, such as menadione and paraquat, in contrast with rifamycin SV, stimulated the NADPH-dependent reaction; menadione and rifamycin SV were superior to paraquat in stimulating the NADH-dependent reaction. These results indicate that rifamycin SV can, in the presence of an iron catalyst, increase microsomal production of reactive oxygen species which can cause DNA-strand cleavage. In contrast with other redox cycling agents, the stimulation by rifamycin SV is more pronounced with NADH than with NADPH as the

cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

PubMed

De Bruin, Lennart; Maddocks, John H

2018-06-14

The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

Inhibition of DNA-Dependent Protein Kinase Activity for Breast Cancer Therapy

DTIC Science & Technology

2002-06-01

Dependent Protein Kinase Activity for Breast Cancer Therapy PRINCIPAL INVESTIGATOR: Chin-Rang Yang, Ph.D. CONTRACTING ORGANIZATION: University of Rochester...Activity for Breast Cancer Therapy 6. AUTHOR(S) Chin-Rang Yang, Ph.D. 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT...The formation of DNA double strand breaks (DSBs) correlates well with lethality of cancer cells following ionizing radiation (IR). The DNA-dependent

Effects of pH, conductivity, host cell protein, and DNA size distribution on DNA clearance in anion exchange chromatography media

PubMed Central

Stone, Melani C.; Borman, Jon; Ferreira, Gisela

2017-01-01

Flowthrough anion exchange chromatography is commonly used as a polishing step in downstream processing of monoclonal antibodies and other therapeutic proteins to remove process‐related impurities and contaminants such as host cell DNA, host cell proteins, endotoxin, and viruses. DNA with a wide range of molecular weight distributions derived from Chinese Hamster Ovary cells was used to advance the understanding of DNA binding behavior in selected anion exchange media using the resin (Toyopearl SuperQ‐650M) and membranes (Mustang® Q and Sartobind® Q) through DNA spiking studies. The impacts of the process parameters pH (6–8), conductivity (2–15 mS/cm), and the potential binding competition between host cell proteins and host cell DNA were studied. Studies were conducted at the least and most favorable experimental conditions for DNA binding based on the anticipated electrostatic interactions between the host cell DNA and the resin ligand. The resin showed 50% higher DNA binding capacity compared to the membrane media. Spiking host cell proteins in the load material showed no impact on the DNA clearance capability of the anion exchange media. DNA size distributions were characterized based on a “size exclusion qPCR assay.” Results showed preferential binding of larger DNA fragments (>409 base pairs). © 2017 The Authors Biotechnology Progress published by Wiley Periodicals, Inc. on behalf of American Institute of Chemical Engineers Biotechnol. Prog., 34:141–149, 2018 PMID:28884511

ssDNA damage dependence from singlet oxygen concentration at photodynamic interaction

NASA Astrophysics Data System (ADS)

Klimenko, V. V.; Kaydanov, N. E.; Emelyanov, A. K.; Bogdanov, A. A.

2017-11-01

Single stranded DNA damage at photodynamic treatment with Radachlorin photosensitizer was investigated. Chemical trap method was used to evaluate generation of singlet oxygen in water solution. Interaction of singlet oxygen with ssDNA resulted into decrease of the replication activity of ssDNA. DNA stopped replicating during PCR at irradiation doses greater than 15 J/cm2 and concentration of photosensitizer [PS] = 3.8 μM. The dependence of replication activity of ssDNA on generated singlet oxygen concentration was identified.

Identification of DNA-Dependent Protein Kinase Catalytic Subunit (DNA-PKcs) as a Novel Target of Bisphenol A

PubMed Central

Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi

2012-01-01

Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100–300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK. PMID:23227178

A Sequence-Dependent DNA Condensation Induced by Prion Protein

PubMed Central

2018-01-01

Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis. PMID:29657864

A Sequence-Dependent DNA Condensation Induced by Prion Protein.

PubMed

Bera, Alakesh; Biring, Sajal

2018-01-01

Different studies indicated that the prion protein induces hybridization of complementary DNA strands. Cell culture studies showed that the scrapie isoform of prion protein remained bound with the chromosome. In present work, we used an oxazole dye, YOYO, as a reporter to quantitative characterization of the DNA condensation by prion protein. We observe that the prion protein induces greater fluorescence quenching of YOYO intercalated in DNA containing only GC bases compared to the DNA containing four bases whereas the effect of dye bound to DNA containing only AT bases is marginal. DNA-condensing biological polyamines are less effective than prion protein in quenching of DNA-bound YOYO fluorescence. The prion protein induces marginal quenching of fluorescence of the dye bound to oligonucleotides, which are resistant to condensation. The ultrastructural studies with electron microscope also validate the biophysical data. The GC bases of the target DNA are probably responsible for increased condensation in the presence of prion protein. To our knowledge, this is the first report of a human cellular protein inducing a sequence-dependent DNA condensation. The increased condensation of GC-rich DNA by prion protein may suggest a biological function of the prion protein and a role in its pathogenesis.

Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance

PubMed Central

Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

2014-01-01

Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. PMID:25389272

Enzyme-adenylate structure of a bacterial ATP-dependent DNA ligase with a minimized DNA-binding surface.

PubMed

Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder

2014-11-01

DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.

Force-dependent melting of supercoiled DNA at thermophilic temperatures.

PubMed

Galburt, E A; Tomko, E J; Stump, W T; Ruiz Manzano, A

2014-01-01

Local DNA opening plays an important role in DNA metabolism as the double-helix must be melted before the information contained within may be accessed. Cells finely tune the torsional state of their genomes to strike a balance between stability and accessibility. For example, while mesophilic life forms maintain negatively superhelical genomes, thermophilic life forms use unique mechanisms to maintain relaxed or even positively supercoiled genomes. Here, we use a single-molecule magnetic tweezers approach to quantify the force-dependent equilibrium between DNA melting and supercoiling at high temperatures populated by Thermophiles. We show that negatively supercoiled DNA denatures at 0.5 pN lower tension at thermophilic vs. mesophilic temperatures. This work demonstrates the ability to monitor DNA supercoiling at high temperature and opens the possibility to perform magnetic tweezers assays on thermophilic systems. The data allow for an estimation of the relative energies of base-pairing and DNA bending as a function of temperature and support speculation as to different general mechanisms of DNA opening in different environments. Lastly, our results imply that average in vivo DNA tensions range between 0.3 and 1.1 pN. Copyright © 2014 Elsevier B.V. All rights reserved.

Temperature gating and competing temperature-dependent effects in DNA molecular wires

NASA Astrophysics Data System (ADS)

Wibowo, Denni; Narenji, Alaleh; Kassegne, Sam

2017-02-01

While recent research in electron-transport mechanism on a double strands DNA seems to converge into a consensus, experiments in direct electrical measurements on a long DNA molecules still lead to a conflicting result This study is the continuation of our previous research in electrical characterization of DNA molecular wires, where we furtherly investigate the effects of temperature on the electrical conductivity of DNA molecular wires by measuring its impedance response. We found that at higher temperatures, the expected increase in charge hopping mechanism may account for the decrease in impedance (and hence increase in conductivity) supporting the 'charge hopping mechanism' theory. UV light exposure, on the other hand, causes damage to GC base pairs reducing the path available for hopping mechanism and hence resulting in increased impedance - this again supporting the 'charge hopping mechanism' theory. We also report that λ-DNA molecular wires have differing impedance responses at two temperature regimes: impedance increases between 4 °C - 40 °C and then decreases between 40 °C - melting point (˜110 °C), after which λ-DNA denatures resulting in no current transduction. We submit that the low impedance of λ-DNA molecular wires observed at moderate to high frequencies may have significant implications to the field of DNA-based bionanoelectronics.

SIRT6 stabilizes DNA-dependent Protein Kinase at chromatin for DNA double-strand break repair

PubMed Central

McCord, Ronald A.; Michishita, Eriko; Hong, Tao; Berber, Elisabeth; Boxer, Lisa D.; Kusumoto, Rika; Guan, Shenheng; Shi, Xiaobing; Gozani, Or; Burlingame, Alma L.; Bohr, Vilhelm A.; Chua, Katrin F.

2009-01-01

The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor with chromatin impacts on the efficiency of repair, and establish a link between chromatin regulation, DNA repair, and a mammalian Sir2 factor. PMID:20157594

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

Defined-size DNA triple crossover construct for molecular electronics: modification, positioning and conductance properties.

PubMed

Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi

2011-07-08

We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.

DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?

PubMed

Weterings, Eric; Chen, David J

2007-10-22

The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.

Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

PubMed

Charbonnel, Cyril; Gallego, Maria E; White, Charles I

2010-10-01

Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

Fluorescence quenching studies of potential-dependent DNA reorientation dynamics at glassy carbon electrode surfaces.

PubMed

Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun

2012-09-05

The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.

The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

PubMed Central

Jette, Nicholas; Lees-Miller, Susan P.

2015-01-01

The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

Structure of the adenylation domain of NAD[superscript +]-dependent DNA ligase from Staphylococcus aureus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Seungil; Chang, Jeanne S.; Griffor, Matt

DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3''-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD{sup +}-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD{sup +}-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD{sup +}-binding pocket and the 'C2more » tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.« less

Activation of cGAS-dependent antiviral responses by DNA intercalating agents

PubMed Central

Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J.; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G.; Williams, Bryan R.G.; Gantier, Michael P.

2017-01-01

Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. PMID:27694309

cgDNA: a software package for the prediction of sequence-dependent coarse-grain free energies of B-form DNA.

PubMed

Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H

2014-11-10

cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA-dependent protein kinase (DNA-PK)-deficient human glioblastoma cells are preferentially sensitized by Zebularine

PubMed Central

Meador, Jarah A.; Su, Yanrong; Ravanat, Jean-Luc; Balajee, Adayabalam S.

2010-01-01

Brain tumor cells respond poorly to radiotherapy and chemotherapy due to inherently efficient anti-apoptotic and DNA repair mechanisms. This necessitates the development of new strategies for brain cancer therapy. Here, we report that the DNA-demethylating agent Zebularine preferentially sensitizes the killing of human glioblastomas deficient in DNA-dependent protein kinase (DNA-PK). In contrast to DNA-PK-proficient human glioblastoma cells (MO59K), cytotoxicity assay with increasing Zebularine concentrations up to 300 μM resulted in a specific elevation of cell killing in DNA-PK-deficient MO59J cells. Further, an elevated frequency of polyploid cells observed in MO59J cells after Zebularine treatment pointed out a deficiency in mitotic checkpoint control. Existence of mitotic checkpoint deficiency in MO59J cells was confirmed by the abnormal centrosome number observed in Zebularine-treated MO59J cells. Although depletion of DNA methyltransferase 1 by Zebularine occurred at similar levels in both cell lines, MO59J cells displayed increased extent of DNA demethylation detected both at the gene promoter-specific level and at the genome overall level. Consistent with increased sensitivity, deoxy-Zebularine adduct level in the genomic DNA was 3- to 6-fold higher in MO59J than in MO59K cells. Elevated micronuclei frequency observed after Zebularine treatment in MO59J cells indicates the impairment of DNA repair response in MO59J cells. Collectively, our study suggests that DNA-PK is the major determining factor for cellular response to Zebularine. PMID:19933707

Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia

PubMed Central

Calloway, Cassandra

2016-01-01

BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P < 0.001, respectively). ΔmtDNA4977 was increased in the presence of either liver iron concentration > 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* < 20 ms) was present in 0%, 22%, and 46% of subjects with ΔmtDNA4977 frequency < 20, 20–40, and > 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305

[Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].

PubMed

Shematorova, E K; Shpakovskiĭ, G V

2002-01-01

In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.

Sequence-dependent modelling of local DNA bending phenomena: curvature prediction and vibrational analysis.

PubMed

Vlahovicek, K; Munteanu, M G; Pongor, S

1999-01-01

Bending is a local conformational micropolymorphism of DNA in which the original B-DNA structure is only distorted but not extensively modified. Bending can be predicted by simple static geometry models as well as by a recently developed elastic model that incorporate sequence dependent anisotropic bendability (SDAB). The SDAB model qualitatively explains phenomena including affinity of protein binding, kinking, as well as sequence-dependent vibrational properties of DNA. The vibrational properties of DNA segments can be studied by finite element analysis of a model subjected to an initial bending moment. The frequency spectrum is obtained by applying Fourier analysis to the displacement values in the time domain. This analysis shows that the spectrum of the bending vibrations quite sensitively depends on the sequence, for example the spectrum of a curved sequence is characteristically different from the spectrum of straight sequence motifs of identical basepair composition. Curvature distributions are genome-specific, and pronounced differences are found between protein-coding and regulatory regions, respectively, that is, sites of extreme curvature and/or bendability are less frequent in protein-coding regions. A WWW server is set up for the prediction of curvature and generation of 3D models from DNA sequences (http:@www.icgeb.trieste.it/dna).

Recombination-dependent mtDNA partitioning: in vivo role of Mhr1p to promote pairing of homologous DNA.

PubMed

Ling, Feng; Shibata, Takehiko

2002-09-02

Yeast mhr1-1 was isolated as a defective mutation in mitochondrial DNA (mtDNA) recombination. About half of mhr1-1 cells lose mtDNA during growth at a higher temperature. Here, we show that mhr1-1 exhibits a defect in the partitioning of nascent mtDNA into buds and is a base-substitution mutation in MHR1 encoding a mitochondrial matrix protein. We found that the Mhr1 protein (Mhr1p) has activity to pair single-stranded DNA and homologous double-stranded DNA to form heteroduplex joints in vitro, and that mhr1-1 causes the loss of this activity, indicating its role in homologous mtDNA recombination. While the majority of the mtDNA in the mother cells consists of head-to-tail concatemers, more than half of the mtDNA in the buds exists as genome-sized monomers. The mhr1-1 deltacce1 double mutant cells do not maintain any mtDNA, indicating the strict dependence of mtDNA maintenance on recombination functions. These results suggest a mechanism for mtDNA inheritance similar to that operating in the replication and packaging of phage DNA.

Probing the salt dependence of the torsional stiffness of DNA by multiplexed magnetic torque tweezers

PubMed Central

Kriegel, Franziska; Ermann, Niklas; Forbes, Ruaridh; Dulin, David; Dekker, Nynke H.

2017-01-01

Abstract The mechanical properties of DNA fundamentally constrain and enable the storage and transmission of genetic information and its use in DNA nanotechnology. Many properties of DNA depend on the ionic environment due to its highly charged backbone. In particular, both theoretical analyses and direct single-molecule experiments have shown its bending stiffness to depend on salt concentration. In contrast, the salt-dependence of the twist stiffness of DNA is much less explored. Here, we employ optimized multiplexed magnetic torque tweezers to study the torsional stiffness of DNA under varying salt conditions as a function of stretching force. At low forces (<3 pN), the effective torsional stiffness is ∼10% smaller for high salt conditions (500 mM NaCl or 10 mM MgCl2) compared to lower salt concentrations (20 mM NaCl and 100 mM NaCl). These differences, however, can be accounted for by taking into account the known salt dependence of the bending stiffness. In addition, the measured high-force (6.5 pN) torsional stiffness values of C = 103 ± 4 nm are identical, within experimental errors, for all tested salt concentration, suggesting that the intrinsic torsional stiffness of DNA does not depend on salt. PMID:28460037

Activation of cGAS-dependent antiviral responses by DNA intercalating agents.

PubMed

Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P

2017-01-09

Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

PubMed

Olson, Wilma K; Swigon, David; Coleman, Bernard D

2004-07-15

Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to

Proteasome-dependent degradation of replisome components regulates faithful DNA replication.

PubMed

Roseaulin, Laura C; Noguchi, Chiaki; Noguchi, Eishi

2013-08-15

The replication machinery, or the replisome, collides with a variety of obstacles during the normal process of DNA replication. In addition to damaged template DNA, numerous chromosome regions are considered to be difficult to replicate owing to the presence of DNA secondary structures and DNA-binding proteins. Under these conditions, the replication fork stalls, generating replication stress. Stalled forks are prone to collapse, posing serious threats to genomic integrity. It is generally thought that the replication checkpoint functions to stabilize the replisome and replication fork structure upon replication stress. This is important in order to allow DNA replication to resume once the problem is solved. However, our recent studies demonstrated that some replisome components undergo proteasome-dependent degradation during DNA replication in the fission yeast Schizosaccharomyces pombe. Our investigation has revealed the involvement of the SCF(Pof3) (Skp1-Cullin/Cdc53-F-box) ubiquitin ligase in replisome regulation. We also demonstrated that forced accumulation of the replisome components leads to abnormal DNA replication upon replication stress. Here we review these findings and present additional data indicating the importance of replisome degradation for DNA replication. Our studies suggest that cells activate an alternative pathway to degrade replisome components in order to preserve genomic integrity.

Probing the salt dependence of the torsional stiffness of DNA by multiplexed magnetic torque tweezers.

PubMed

Kriegel, Franziska; Ermann, Niklas; Forbes, Ruaridh; Dulin, David; Dekker, Nynke H; Lipfert, Jan

2017-06-02

The mechanical properties of DNA fundamentally constrain and enable the storage and transmission of genetic information and its use in DNA nanotechnology. Many properties of DNA depend on the ionic environment due to its highly charged backbone. In particular, both theoretical analyses and direct single-molecule experiments have shown its bending stiffness to depend on salt concentration. In contrast, the salt-dependence of the twist stiffness of DNA is much less explored. Here, we employ optimized multiplexed magnetic torque tweezers to study the torsional stiffness of DNA under varying salt conditions as a function of stretching force. At low forces (<3 pN), the effective torsional stiffness is ∼10% smaller for high salt conditions (500 mM NaCl or 10 mM MgCl2) compared to lower salt concentrations (20 mM NaCl and 100 mM NaCl). These differences, however, can be accounted for by taking into account the known salt dependence of the bending stiffness. In addition, the measured high-force (6.5 pN) torsional stiffness values of C = 103 ± 4 nm are identical, within experimental errors, for all tested salt concentration, suggesting that the intrinsic torsional stiffness of DNA does not depend on salt. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.

PubMed

Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A

2017-10-05

Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

Dynamics and Context-Dependent Roles of DNA Methylation.

PubMed

Ambrosi, Christina; Manzo, Massimiliano; Baubec, Tuncay

2017-05-19

DNA methylation is one of the most extensively studied epigenetic marks. It is involved in transcriptional gene silencing and plays important roles during mammalian development. Its perturbation is often associated with human diseases. In mammalian genomes, DNA methylation is a prevalent modification that decorates the majority of cytosines. It is found at the promoters and enhancers of inactive genes, at repetitive elements, and within transcribed gene bodies. Its presence at promoters is dynamically linked to gene activity, suggesting that it could directly influence gene expression patterns and cellular identity. The genome-wide distribution and dynamic behaviour of this mark have been studied in great detail in a variety of tissues and cell lines, including early embryonic development and in embryonic stem cells. In combination with functional studies, these genome-wide maps of DNA methylation revealed interesting features of this mark and provided important insights into its dynamic nature and potential functional role in genome regulation. In this review, we discuss how these recent observations, in combination with insights obtained from biochemical and functional genetics studies, have expanded our current knowledge about the regulation and context-dependent roles of DNA methylation in mammalian genomes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

PubMed Central

Yonetani, Yoshiteru; Kono, Hidetoshi

2009-01-01

Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Mapping protein-DNA and protein-protein interactions of ATP-dependent chromatin remodelers.

PubMed

Hota, Swetansu K; Dechassa, Mekonnen Lemma; Prasad, Punit; Bartholomew, Blaine

2012-01-01

Chromatin plays a key regulatory role in several DNA-dependent processes as it regulates DNA access to different protein factors. Several multisubunit protein complexes interact, modify, or mobilize nucleosomes: the basic unit of chromatin, from its original location in an ATP-dependent manner to facilitate processes, such as transcription, replication, repair, and recombination. Knowledge of the interactions of chromatin remodelers with nucleosomes is a crucial requirement to understand the mechanism of chromatin remodeling. Here, we describe several methods to analyze the interactions of multisubunit chromatin-remodeling enzymes with nucleosomes.

Bioenergetic metabolites regulate base excision repair dependent cell death in response to DNA damage

PubMed Central

Tang, Jiang-bo; Goellner, Eva M.; Wang, Xiao-hong; Trivedi, Ram N.; Croix, Claudette M. St; Jelezcova, Elena; Svilar, David; Brown, Ashley R.; Sobol, Robert W.

2009-01-01

Base excision repair (BER) protein expression is important for resistance to DNA damage-induced cytotoxicity. Conversely, BER imbalance (Polß deficiency or repair inhibition) enhances cytotoxicity of radiation and chemotherapeutic DNA-damaging agents. Whereas inhibition of critical steps in the BER pathway result in the accumulation of cytotoxic DNA double-strand breaks, we report that DNA damage-induced cytotoxicity due to deficiency in the BER protein Polß triggers cell death dependent on PARP activation yet independent of poly(ADP-ribose) (PAR)-mediated AIF nuclear translocation or PARG, suggesting that cytotoxicity is not from PAR or PAR-catabolite signaling. Cell death is rescued by the NAD+ metabolite NMN and is synergistic with inhibition of NAD+ biosynthesis, demonstrating that DNA damage-induced cytotoxicity mediated via BER inhibition is primarily dependent on cellular metabolite bioavailability. We offer a mechanistic justification for the elevated alkylation-induced cytotoxicity of Polß deficient cells, suggesting a linkage between DNA repair, cell survival and cellular bioenergetics. PMID:20068071

Resistance of Adenoviral DNA Replication to Aphidicolin Is Dependent on the 72-Kilodalton DNA-Binding Protein

PubMed Central

Foster, David A.; Hantzopoulos, Petros; Zubay, Geoffrey

1982-01-01

Aphidicolin is a highly specific inhibitor of DNA polymerase α and has been most useful for assessing the role of this enzyme in various replication processes (J. A. Huberman, Cell 23:647-648, 1981). Both nuclear DNA replication and simian virus 40 DNA replication are highly sensitive to this drug (Krokan et al., Biochemistry 18:4431-4443, 1979), whereas mitochondrial DNA synthesis is completely insensitive (Zimmerman et al., J. Biol. Chem. 255:11847-11852, 1980). Adenovirus DNA replication is sensitive to aphidicolin, but only at much higher concentrations. These patterns of sensitivity are seen both in vivo and in vitro (Krokan et al., Biochemistry 18:4431-4443, 1979). A temperature-sensitive mutant of adenovirus type 5 known as H5ts125 is able to complete but not initiate new rounds of replication at nonpermissive temperatures (P. C. van der Vliet and J. S. Sussenbach, Virology 67:415-426, 1975). When cells infected with H5ts125 were shifted from permissive (33°C) to nonpermissive (41°C) conditions, the residual DNA synthesis (elongation) showed a striking increase in sensitivity to aphidicolin. The temperature-sensitive mutation of H5ts125 is in the gene for the 72-kilodalton single-stranded DNA-binding protein. This demonstrated that the increased resistance to aphidicolin shown by adenovirus DNA replication was dependent on that protein. It also supports an elongation role for both DNA polymerase α and the 72-kilodalton single-stranded DNA-binding protein in adenovirus DNA replication. Further support for an elongation role of DNA polymerase α came from experiments with permissive temperature conditions and inhibiting levels of aphidicolin in which it was shown that newly initiated strands failed to elongate to completion. Images PMID:6809958

Donor-bridge-acceptor energetics determine the distance dependence of electron tunneling in DNA

NASA Astrophysics Data System (ADS)

Lewis, Frederick D.; Liu, Jianqin; Weigel, Wilfried; Rettig, Wolfgang; Kurnikov, Igor V.; Beratan, David N.

2002-10-01

Electron transfer (ET) processes in DNA are of current interest because of their involvement in oxidative strand cleavage reactions and their relevance to the development of molecular electronics. Two mechanisms have been identified for ET in DNA, a single-step tunneling process and a multistep charge-hopping process. The dynamics of tunneling reactions depend on both the distance between the electron donor and acceptor and the nature of the molecular bridge separating the donor and acceptor. In the case of protein and alkane bridges, the distance dependence is not strongly dependent on the properties of the donor and acceptor. In contrast, we show here that the distance decay of DNA ET rates varies markedly with the energetics of the donor and acceptor relative to the bridge. Specifically, we find that an increase in the energy of the bridge states by 0.25 eV (1 eV = 1.602 × 1019 J) relative to the donor and acceptor energies for photochemical oxidation of nucleotides, without changing the reaction free energy, results in an increase in the characteristic exponential distance decay constant for the ET rates from 0.71 to 1.1 Å1. These results show that, in the small tunneling energy gap regime of DNA ET, the distance dependence is not universal; it varies strongly with the tunneling energy gap. These DNA ET reactions fill a "missing link" or transition regime between the large barrier (rapidly decaying) tunneling regime and the (slowly decaying) hopping regime in the general theory of bridge-mediated ET processes.

Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fukumoto, Yasunori, E-mail: fukumoto@faculty.chiba-u.jp; Kuki, Kazumasa; Morii, Mariko

2014-09-26

Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the processmore » by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint.« less

HTLV-1 Tax Oncoprotein Subverts the Cellular DNA Damage Response via Binding to DNA-dependent Protein Kinase*S⃞

PubMed Central

Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John

2008-01-01

Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425

Spectrum of complex DNA damages depends on the incident radiation

NASA Astrophysics Data System (ADS)

Hada, M.; Sutherland, B.

Ionizing radiation induces clustered DNA damages in DNA-two or more abasic sites oxidized bases and strand breaks on opposite DNA strands within a few helical turns Clustered damages are considered to be difficult to repair and therefore potentially lethal and mutagenic damages Although induction of single strand breaks and isolated lesions has been studied extensively little is known of factors affecting induction of clusters other than double strand breaks DSB The aim of the present study was to determine whether the type of incident radiation could affect yield or spectra of specific clusters Genomic T7 DNA a simple 40 kbp linear blunt-ended molecule was irradiated in non-scavenging buffer conditions with Fe 970 MeV n Ti 980 MeV n C 293 MeV n Si 586 MeV n ions or protons 1 GeV n at the NASA Space Radiation Laboratory or with 100 kVp X-rays Irradiated DNA was treated with homogeneous Fpg or Nfo proteins or without enzyme treatment for DSB quantitation then electrophoresed in neutral agarose gels DSB Fpg-OxyPurine clusters and Nfo-Abasic clusters were quantified by number average length analysis The results show that the yields of all these complex damages depend on the incident radiation Although LETs are similar protons induced twice as many DSBs than did X-rays Further the spectrum of damage also depends on the radiation The yield damage Mbp Gy of all damages decreased with increasing linear energy transfer LET of the radiation The relative frequencies of DSBs to Abasic- and OxyBase clusters were higher

Chk2 and REGγ-dependent DBC1 regulation in DNA damage induced apoptosis

PubMed Central

Magni, Martina; Ruscica, Vincenzo; Buscemi, Giacomo; Kim, Ja-Eun; Nachimuthu, Benjamin Tamilselvan; Fontanella, Enrico; Delia, Domenico; Zannini, Laura

2014-01-01

Human DBC1 (Deleted in Breast Cancer 1; KIAA1967; CCAR2) is a protein implicated in the regulation of apoptosis, transcription and histone modifications. Upon DNA damage, DBC1 is phosphorylated by ATM/ATR on Thr454 and this modification increases its inhibitory interaction with SIRT1, leading to p53 acetylation and p53-dependent apoptosis. Here, we report that the inhibition of SIRT1 by DBC1 in the DNA damage response (DDR) also depends on Chk2, the transducer kinase that is activated by ATM upon DNA lesions and contributes to the spreading of DNA damage signal. Indeed we found that inactivation of Chk2 reduces DBC1-SIRT1 binding, thus preventing p53 acetylation and DBC1-induced apoptosis. These events are mediated by Chk2 phosphorylation of the 11S proteasome activator REGγ on Ser247, which increases REGγ-DBC1 interaction and SIRT1 inhibition. Overall our results clarify the mechanisms underlying the DBC1-dependent SIRT1 inhibition and link, for the first time, Chk2 and REGγ to the ATM-DBC1-SIRT1 axis. PMID:25361978

The force-dependent mechanism of DnaK-mediated mechanical folding

PubMed Central

Perales-Calvo, Judit; Giganti, David; Stirnemann, Guillaume; Garcia-Manyes, Sergi

2018-01-01

It is well established that chaperones modulate the protein folding free-energy landscape. However, the molecular determinants underlying chaperone-mediated mechanical folding remain largely elusive, primarily because the force-extended unfolded conformation fundamentally differs from that characterized in biochemistry experiments. We use single-molecule force-clamp spectroscopy, combined with molecular dynamics simulations, to study the effect that the Hsp70 system has on the mechanical folding of three mechanically stiff model proteins. Our results demonstrate that, when working independently, DnaJ (Hsp40) and DnaK (Hsp70) work as holdases, blocking refolding by binding to distinct substrate conformations. Whereas DnaK binds to molten globule–like forms, DnaJ recognizes a cryptic sequence in the extended state in an unanticipated force-dependent manner. By contrast, the synergetic coupling of the Hsp70 system exhibits a marked foldase behavior. Our results offer unprecedented molecular and kinetic insights into the mechanisms by which mechanical force finely regulates chaperone binding, directly affecting protein elasticity. PMID:29487911

Long conducting polymer nanonecklaces with a `beads-on-a-string' morphology: DNA nanotube-template synthesis and electrical properties

NASA Astrophysics Data System (ADS)

Chen, Guofang; Mao, Chengde

2016-05-01

Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k

Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis.

PubMed

Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P

2014-06-25

The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.

Polo-like kinase 1 (PLK1) and protein phosphatase 6 (PP6) regulate DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation in mitosis

PubMed Central

Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A.; De Wever, Veerle; Morrice, Nick A.; Meek, Katheryn; Lees-Miller, Susan P.

2014-01-01

The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs’ role in mitosis may be mechanistically distinct from its well-established role in NHEJ. PMID:24844881

Self-catalytic growth of unmodified gold nanoparticles as conductive bridges mediated gap-electrical signal transduction for DNA hybridization detection.

PubMed

Zhang, Jing; Nie, Huagui; Wu, Zhan; Yang, Zhi; Zhang, Lijie; Xu, Xiangju; Huang, Shaoming

2014-01-21

A simple and sensitive gap-electrical biosensor based on self-catalytic growth of unmodified gold nanoparticles (AuNPs) as conductive bridges has been developed for amplifying DNA hybridization events. In this strategy, the signal amplification degree of such conductive bridges is closely related to the variation of the glucose oxidase (GOx)-like catalytic activity of AuNPs upon interaction with single- and double-stranded DNA (ssDNA and dsDNA), respectively. In the presence of target DNA, the obtained dsDNA product cannot adsorb onto the surface of AuNPs due to electrostatic interaction, which makes the unmodified AuNPs exhibit excellent GOx-like catalytic activity. Such catalytic activity can enlarge the diameters of AuNPs in the glucose and HAuCl4 solution and result in a connection between most of the AuNPs and a conductive gold film formation with a dramatically increased conductance. For the control sample, the catalytic activity sites of AuNPs are fully blocked by ssDNA due to the noncovalent interaction between nucleotide bases and AuNPs. Thus, the growth of the assembled AuNPs will not happen and the conductance between microelectrodes will be not changed. Under the optimal experimental conditions, the developed strategy exhibited a sensitive response to target DNA with a high signal-to-noise ratio. Moreover, this strategy was also demonstrated to provide excellent differentiation ability for single-nucleotide polymorphism. Such performances indicated the great potential of this label-free electrical strategy for clinical diagnostics and genetic analysis under real biological sample separation.

Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

NASA Astrophysics Data System (ADS)

Roxbury, Daniel

solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.

Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication

PubMed Central

On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X

2014-01-01

Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989

Volume-dependent ATP-conductive large-conductance anion channel as a pathway for swelling-induced ATP release.

PubMed

Sabirov, R Z; Dutta, A K; Okada, Y

2001-09-01

In mouse mammary C127i cells, during whole-cell clamp, osmotic cell swelling activated an anion channel current, when the phloretin-sensitive, volume-activated outwardly rectifying Cl(-) channel was eliminated. This current exhibited time-dependent inactivation at positive and negative voltages greater than around +/-25 mV. The whole-cell current was selective for anions and sensitive to Gd(3)+. In on-cell patches, single-channel events appeared with a lag period of approximately 15 min after a hypotonic challenge. Under isotonic conditions, cell-attached patches were silent, but patch excision led to activation of currents that consisted of multiple large-conductance unitary steps. The current displayed voltage- and time-dependent inactivation similar to that of whole-cell current. Voltage-dependent activation profile was bell-shaped with the maximum open probability at -20 to 0 mV. The channel in inside-out patches had the unitary conductance of approximately 400 pS, a linear current-voltage relationship, and anion selectivity. The outward (but not inward) single-channel conductance was suppressed by extracellular ATP with an IC(50) of 12.3 mM and an electric distance (delta) of 0.47, whereas the inward (but not outward) conductance was inhibited by intracellular ATP with an IC(50) of 12.9 mM and delta of 0.40. Despite the open channel block by ATP, the channel was ATP-conductive with P(ATP)/P(Cl) of 0.09. The single-channel activity was sensitive to Gd(3)+, SITS, and NPPB, but insensitive to phloretin, niflumic acid, and glibenclamide. The same pharmacological pattern was found in swelling-induced ATP release. Thus, it is concluded that the volume- and voltage-dependent ATP-conductive large-conductance anion channel serves as a conductive pathway for the swelling-induced ATP release in C127i cells.

Rapid thermal responsive conductive hybrid cryogels with shape memory properties, photothermal properties and pressure dependent conductivity.

PubMed

Deng, Zexing; Guo, Yi; Ma, Peter X; Guo, Baolin

2018-09-15

Stimuli responsive cryogels with multi-functionality have potential application for electrical devices, actuators, sensors and biomedical devices. However, conventional thermal sensitive poly(N-isopropylacrylamide) cryogels show slow temperature response speed and lack of multi-functionality, which greatly limit their practical application. Herein we present conductive fast (2 min for both deswelling and reswelling behavior) thermally responsive poly(N-isopropylacrylamide) cryogels with rapid shape memory properties (3 s for shape recovery), near-infrared (NIR) light sensitivity and pressure dependent conductivity, and further demonstrated their applications as temperature sensitive on-off switch, NIR light sensitive on-off switch, water triggered shape memory on-off switch and pressure dependent device. These cryogels were first prepared in dimethyl sulfoxide below its melting temperature in ice bath and subsequently put into aniline or pyrrole solution to in situ deposition of conducting polyaniline or polypyrrole nanoparticles. The continuous macroporous sponge-like structure provides cryogels with rapid responsivity both in deswelling, reswelling kinetics and good elasticity. After incorporating electrically conductive polyaniline or polypyrrole nanoaggregates, the hybrid cryogels exhibit desirable conductivity, photothermal property, pressure dependent conductivity and good cytocompatibility. These multifunctional hybrid cryogels make them great potential as stimuli responsive electrical device, tissue engineering scaffolds, drug delivery vehicle and electronic skin. Copyright © 2018 Elsevier Inc. All rights reserved.

Reducing DNA context dependence in bacterial promoters

PubMed Central

Carr, Swati B.; Densmore, Douglas M.

2017-01-01

Variation in the DNA sequence upstream of bacterial promoters is known to affect the expression levels of the products they regulate, sometimes dramatically. While neutral synthetic insulator sequences have been found to buffer promoters from upstream DNA context, there are no established methods for designing effective insulator sequences with predictable effects on expression levels. We address this problem with Degenerate Insulation Screening (DIS), a novel method based on a randomized 36-nucleotide insulator library and a simple, high-throughput, flow-cytometry-based screen that randomly samples from a library of 436 potential insulated promoters. The results of this screen can then be compared against a reference uninsulated device to select a set of insulated promoters providing a precise level of expression. We verify this method by insulating the constitutive, inducible, and repressible promotors of a four transcriptional-unit inverter (NOT-gate) circuit, finding both that order dependence is largely eliminated by insulation and that circuit performance is also significantly improved, with a 5.8-fold mean improvement in on/off ratio. PMID:28422998

CgII cleaves DNA using a mechanism distinct from other ATP-dependent restriction endonucleases

PubMed Central

Toliusis, Paulius; Silanskas, Arunas; Szczelkun, Mark D.

2017-01-01

Abstract The restriction endonuclease CglI from Corynebacterium glutamicum recognizes an asymmetric 5′-GCCGC-3′ site and cleaves the DNA 7 and 6/7 nucleotides downstream on the top and bottom DNA strands, respectively, in an NTP-hydrolysis dependent reaction. CglI is composed of two different proteins: an endonuclease (R.CglI) and a DEAD-family helicase-like ATPase (H.CglI). These subunits form a heterotetrameric complex with R2H2 stoichiometry. However, the R2H2·CglI complex has only one nuclease active site sufficient to cut one DNA strand suggesting that two complexes are required to introduce a double strand break. Here, we report studies to evaluate the DNA cleavage mechanism of CglI. Using one- and two-site circular DNA substrates we show that CglI does not require two sites on the same DNA for optimal catalytic activity. However, one-site linear DNA is a poor substrate, supporting a mechanism where CglI complexes must communicate along the one-dimensional DNA contour before cleavage is activated. Based on experimental data, we propose that adenosine triphosphate (ATP) hydrolysis by CglI produces translocation on DNA preferentially in a downstream direction from the target, although upstream translocation is also possible. Our results are consistent with a mechanism of CglI action that is distinct from that of other ATP-dependent restriction-modification enzymes. PMID:28854738

Dimorphic DNA methylation during temperature-dependent sex determination in the sea turtle Lepidochelys olivacea.

PubMed

Venegas, Daniela; Marmolejo-Valencia, Alejandro; Valdes-Quezada, Christian; Govenzensky, Tzipe; Recillas-Targa, Félix; Merchant-Larios, Horacio

2016-09-15

Sex determination in vertebrates depends on the expression of a conserved network of genes. Sea turtles such as Lepidochelys olivacea have temperature-dependent sex determination. The present work analyses some of the epigenetic processes involved in this. We describe sexual dimorphism in global DNA methylation patterns between ovaries and testes of L. olivacea and show that the differences may arise from a combination of DNA methylation and demethylation events that occur during sex determination. Irrespective of incubation temperature, 5-hydroxymethylcytosine was abundant in the bipotential gonad; however, following sex determination, this modification was no longer found in pre-Sertoli cells in the testes. These changes correlate with the establishment of the sexually dimorphic DNA methylation patterns, down regulation of Sox9 gene expression in ovaries and irreversible gonadal commitment towards a male or female differentiation pathway. Thus, DNA methylation changes may be necessary for the stabilization of the gene expression networks that drive the differentiation of the bipotential gonad to form either an ovary or a testis in L. olivacea and probably among other species that manifest temperature-dependent sex determination. Copyright © 2016 Elsevier Inc. All rights reserved.

Homology-dependent repair is involved in 45S rDNA loss in plant CAF-1 mutants

PubMed Central

Muchová, Veronika; Amiard, Simon; Mozgová, Iva; Dvořáčková, Martina; Gallego, Maria E; White, Charles; Fajkus, Jiří

2015-01-01

Arabidopsis thaliana mutants in FAS1 and FAS2 subunits of chromatin assembly factor 1 (CAF1) show progressive loss of 45S rDNA copies and telomeres. We hypothesized that homology-dependent DNA damage repair (HDR) may contribute to the loss of these repeats in fas mutants. To test this, we generated double mutants by crossing fas mutants with knock-out mutants in RAD51B, one of the Rad51 paralogs of A. thaliana. Our results show that the absence of RAD51B decreases the rate of rDNA loss, confirming the implication of RAD51B-dependent recombination in rDNA loss in the CAF1 mutants. Interestingly, this effect is not observed for telomeric repeat loss, which thus differs from that acting in rDNA loss. Involvement of DNA damage repair in rDNA dynamics in fas mutants is further supported by accumulation of double-stranded breaks (measured as γ-H2AX foci) in 45S rDNA. Occurrence of the foci is not specific for S-phase, and is ATM-independent. While the foci in fas mutants occur both in the transcribed (intranucleolar) and non-transcribed (nucleoplasmic) fraction of rDNA, double fas rad51b mutants show a specific increase in the number of the intranucleolar foci. These results suggest that the repair of double-stranded breaks present in the transcribed rDNA region is RAD51B dependent and that this contributes to rDNA repeat loss in fas mutants, presumably via the single-stranded annealing recombination pathway. Our results also highlight the importance of proper chromatin assembly in the maintenance of genome stability. PMID:25359579

DNA-dependent protein kinase catalytic subunit functions in metastasis and influences survival in advanced-stage laryngeal squamous cell carcinoma.

PubMed

He, Sha-Sha; Chen, Yong; Shen, Xiao-Ming; Wang, Hong-Zhi; Sun, Peng; Dong, Jun; Guo, Gui-Fang; Chen, Ju-Gao; Xia, Liang-Ping; Hu, Pei-Li; Qiu, Hui-Juan; Liu, Shou-Sheng; Zhou, Yi-Xin; Wang, Wei; Hu, Wei-Han; Cai, Xiu-Yu

2017-01-01

Background: DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is known to function in several types of cancer. In this study, we investigated the expression and clinicopathologic significance of DNA-PKcs in laryngeal squamous cell carcinoma (LSCC). Methods: We conducted a retrospective study of 208 patients with advanced-stage LSCC treated at Sun Yat-sen University Cancer Center, Guangzhou, China. We assessed DNA-PKcs and p16INK4a (p16) status using immunohistochemistry. We examined the association between DNA-PKcs expression and clinicopathologic features and survival outcomes. To evaluate the independent prognostic relevance of DNA-PKcs, we used univariate and multivariate Cox regression models. We estimated overall survival (OS) and distant metastasis-free survival (DMFS) using the Kaplan-Meier method. Results: Immunohistochemical analyses revealed that 163/208 (78.4%) of the LSCC tissue samples exhibited high DNA-PKcs expression. High DNA-PKcs expression was significantly associated with survival outcomes ( P = 0.016) and distant metastasis ( P = 0.02; chi-squared test). High DNA-PKcs expression was associated with a significantly shorter OS and DMFS than low DNA-PKcs expression ( P = 0.029 and 0.033, respectively; log-rank test), and was associated with poor OS in the p16-positive subgroup ( P = 0.047). Multivariate analysis identified DNA-PKcs as an independent prognostic indicator of OS and DMFS in all patients ( P = 0.039 and 0.037, respectively). Conclusions : Our results suggest that patients with LSCC in whom DNA-PKcs expression is elevated have a higher incidence of distant metastasis and a poorer prognosis. DNA-PKcs may represent a marker of tumor progression in patients with p16-positive LSCC.

Temperature Dependence of Radiation Induced Conductivity in Insulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dennison, J. R.; Gillespie, Jodie; Hodges, Joshua

2009-03-10

This study measures Radiation Induced Conductivity (RIC) of Low Density Polyethylene (LDPE) over temperatures ranging from {approx}110 K to {approx}350 K. RIC occurs when incident ionizing radiation deposits energy and excites electrons into the conduction band of insulators. Conductivity was measured when a voltage was applied across vacuum-baked, thin film LDPE polymer samples in a parallel plate geometry. RIC was calculated as the difference in sample conductivity under no incident radiation and under an incident {approx}4 MeV electron beam at low incident fluxes of 10{sup -4}-10{sup -1} Gr/sec. The steady-state RIC was found to agree well with the standard powermore » law relation, {sigma}{sub RIC} = k{sub RIC}{center_dot}D ring {sup {delta}} between conductivity, {sigma} and adsorbed dose rate, D ring . Both the proportionality constant, k{sub RIC}, and the power, {delta}, were found to be temperature dependant above {approx}250 K, with behavior consistent with photoconductivity models developed for localized trap states in disordered semiconductors. Below {approx}250 K, kRIC and {delta} exhibited little change. The observed difference in temperature dependence might be related to a structural phase transition seen at T{sub {beta}}{approx}256 K in prior studies of mechanical and thermodynamic properties of LDPE.« less

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

Effects of cytotoxic cis- and trans-diammine monochlorido platinum(II) complexes on selenium-dependent redox enzymes and DNA.

PubMed

Lemmerhirt, Heidi; Behnisch, Steven; Bodtke, Anja; Lillig, Christopher H; Pazderova, Lucia; Kasparkova, Jana; Brabec, Viktor; Bednarski, Patrick J

2018-01-01

Here we present the preparation of 14 pairs of cis- and trans-diammine monochlorido platinum(II) complexes, coordinated to heterocycles (i.e., imidazole, 2-methylimidazole and pyrazole) and linked to various acylhydrazones, which were designed as potential inhibitors of the selenium-dependent enzymes glutathione peroxidase 1 (GPx-1) and thioredoxin reductase 1 (TrxR-1). However, no inhibition of bovine GPx-1 and only weak inhibition of murine TrxR-1 was observed in in vitro assays. Nonetheless, the cis configured diammine monochlorido Pt(II) complexes exhibited cytotoxic and apoptotic properties on various human cancer cell lines, whereas the trans configured complexes generally showed weaker potency with a few exceptions. On the other hand, the trans complexes were generally more likely to lack cross-resistance to cisplatin than the cis analogues. Platinum was found bound to the nuclear DNA of cancer cells treated with representative Pt complexes, suggesting that DNA might be a possible target. Thus, detailed in vitro binding experiments with DNA were conducted. Interactions of the compounds with calf thymus DNA were investigated, including Pt binding kinetics, circular dichroism (CD) spectral changes, changes in DNA melting temperatures, unwinding of supercoiled plasmids and ethidium bromide displacement in DNA. The CD results indicate that the most active cis configured pyrazole-derived complex causes unique structural changes in the DNA compared to the other complexes as well as to those caused by cisplatin, suggesting a denaturation of the DNA structure. This may be important for the antiproliferative activity of this compound in the cancer cells. Copyright © 2017. Published by Elsevier Inc.

Ab initio electron propagator calculations of transverse conduction through DNA nucleotide bases in 1-nm nanopore corroborate third generation sequencing.

PubMed

Kletsov, Aleksey A; Glukhovskoy, Evgeny G; Chumakov, Aleksey S; Ortiz, Joseph V

2016-01-01

The conduction properties of DNA molecule, particularly its transverse conductance (electron transfer through nucleotide bridges), represent a point of interest for DNA chemistry community, especially for DNA sequencing. However, there is no fully developed first-principles theory for molecular conductance and current that allows one to analyze the transverse flow of electrical charge through a nucleotide base. We theoretically investigate the transverse electron transport through all four DNA nucleotide bases by implementing an unbiased ab initio theoretical approach, namely, the electron propagator theory. The electrical conductance and current through DNA nucleobases (guanine [G], cytosine [C], adenine [A] and thymine [T]) inserted into a model 1-nm Ag-Ag nanogap are calculated. The magnitudes of the calculated conductance and current are ordered in the following hierarchies: gA>gG>gC>gT and IG>IA>IT>IC correspondingly. The new distinguishing parameter for the nucleobase identification is proposed, namely, the onset bias magnitude. Nucleobases exhibit the following hierarchy with respect to this parameter: Vonset(A)DNA translocation through an electrode-equipped nanopore. The results represent interest for the theorists and practitioners in the field of third generation sequencing techniques as well as in the field of DNA chemistry. Copyright © 2015 Elsevier B.V. All rights reserved.

Charge transport through DNA based electronic barriers

NASA Astrophysics Data System (ADS)

Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

2018-05-01

We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

Mhr1p-dependent concatemeric mitochondrial DNA formation for generating yeast mitochondrial homoplasmic cells.

PubMed

Ling, Feng; Shibata, Takehiko

2004-01-01

Mitochondria carry many copies of mitochondrial DNA (mtDNA), but mt-alleles quickly segregate during mitotic growth through unknown mechanisms. Consequently, all mtDNA copies are often genetically homogeneous within each individual ("homoplasmic"). Our previous study suggested that tandem multimers ("concatemers") formed mainly by the Mhr1p (a yeast nuclear gene-encoded mtDNA-recombination protein)-dependent pathway are required for mtDNA partitioning into buds with concomitant monomerization. The transmission of a few randomly selected clones (as concatemers) of mtDNA into buds is a possible mechanism to establish homoplasmy. The current study provides evidence for this hypothesis as follows: the overexpression of MHR1 accelerates mt-allele-segregation in growing heteroplasmic zygotes, and mhr1-1 (recombination-deficient) causes its delay. The mt-allele-segregation rate correlates with the abundance of concatemers, which depends on Mhr1p. In G1-arrested cells, concatemeric mtDNA was labeled by [14C]thymidine at a much higher density than monomers, indicating concatemers as the immediate products of mtDNA replication, most likely in a rolling circle mode. After releasing the G1 arrest in the absence of [14C]thymidine, the monomers as the major species in growing buds of dividing cells bear a similar density of 14C as the concatemers in the mother cells, indicating that the concatemers in mother cells are the precursors of the monomers in buds.

Deregulation of DNA-dependent protein kinase catalytic subunit contributes to human hepatocarcinogenesis development and has a putative prognostic value.

PubMed

Evert, M; Frau, M; Tomasi, M L; Latte, G; Simile, M M; Seddaiu, M A; Zimmermann, A; Ladu, S; Staniscia, T; Brozzetti, S; Solinas, G; Dombrowski, F; Feo, F; Pascale, R M; Calvisi, D F

2013-11-12

The DNA-repair gene DNA-dependent kinase catalytic subunit (DNA-PKcs) favours or inhibits carcinogenesis, depending on the cancer type. Its role in human hepatocellular carcinoma (HCC) is unknown. DNA-dependent protein kinase catalytic subunit, H2A histone family member X (H2AFX) and heat shock transcription factor-1 (HSF1) levels were assessed by immunohistochemistry and/or immunoblotting and qRT-PCR in a collection of human HCC. Rates of proliferation, apoptosis, microvessel density and genomic instability were also determined. Heat shock factor-1 cDNA or DNA-PKcs-specific siRNA were used to explore the role of both genes in HCC. Activator protein 1 (AP-1) binding to DNA-PKcs promoter was evaluated by chromatin immunoprecipitation. Kaplan-Meier curves and multivariate Cox model were used to study the impact on clinical outcome. Total and phosphorylated DNA-PKcs and H2AFX were upregulated in HCC. Activated DNA-PKcs positively correlated with HCC proliferation, genomic instability and microvessel density, and negatively with apoptosis and patient's survival. Proliferation decline and massive apoptosis followed DNA-PKcs silencing in HCC cell lines. Total and phosphorylated HSF1 protein, mRNA and activity were upregulated in HCC. Mechanistically, we demonstrated that HSF1 induces DNA-PKcs upregulation through the activation of the MAPK/JNK/AP-1 axis. DNA-dependent protein kinase catalytic subunit transduces HSF1 effects in HCC cells, and might represent a novel target and prognostic factor in human HCC.

Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription

PubMed Central

Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.

2016-01-01

Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002

Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach

NASA Astrophysics Data System (ADS)

Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.

2018-06-01

DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.

Bacterial DNA-induced NK cell IFN-gamma production is dependent on macrophage secretion of IL-12.

PubMed

Chace, J H; Hooker, N A; Mildenstein, K L; Krieg, A M; Cowdery, J S

1997-08-01

Bacterial DNA (bDNA) activates B cells and macrophages and can augment inflammatory responses by inducing release of proinflammatory cytokines. We found that bDNA stimulation of mouse spleen cells induced NK cell IFN-gamma production that was dependent upon the presence of unmethylated CpG motifs, and oligonucleotides with internal CpG motifs could also induce splenocytes to secrete IFN-gamma. The bDNA-induced IFN-gamma response was strictly macrophages dependent. While splenocytes from SCID mice secreted IFN-gamma in response to bDNA, depletion of macrophages eliminated this response. Additionally, purified NK cells did not respond to bDNA; however, addition of macrophages restored the NK cell IFN-gamma response. Coculture of NK cells with preactivated macrophages further increased bDNA-induced NK cell IFN-gamma production. Anti-IL-12 or IL-10 inhibited bDNA-induced IFN-gamma response. Treatment of purified macrophages with bDNA resulted in IL-12 secretion accompanied by an increase in IL-12 p40 mRNA level. Although isolated NK cells did not make IFN-gamma in response to bDNA, NK cells costimulated with IL-12 gained the ability to respond to bDNA. These experiments show that bDNA induces macrophage IL-12 production which, in turn, stimulates NK cell IFN-gamma production. Macrophage-derived IL-12 renders NK cells responsive to bDNA permitting an even greater IFN-gamma response to bDNA.

DNA bipedal motor walking dynamics: an experimental and theoretical study of the dependency on step size

PubMed Central

Khara, Dinesh C; Berger, Yaron; Ouldridge, Thomas E

2018-01-01

Abstract We present a detailed coarse-grained computer simulation and single molecule fluorescence study of the walking dynamics and mechanism of a DNA bipedal motor striding on a DNA origami. In particular, we study the dependency of the walking efficiency and stepping kinetics on step size. The simulations accurately capture and explain three different experimental observations. These include a description of the maximum possible step size, a decrease in the walking efficiency over short distances and a dependency of the efficiency on the walking direction with respect to the origami track. The former two observations were not expected and are non-trivial. Based on this study, we suggest three design modifications to improve future DNA walkers. Our study demonstrates the ability of the oxDNA model to resolve the dynamics of complex DNA machines, and its usefulness as an engineering tool for the design of DNA machines that operate in the three spatial dimensions. PMID:29294083

DNA Sequence-Dependent Ionic Currents in Ultra-Small Solid-State Nanopores†

PubMed Central

Comer, Jeffrey

2016-01-01

Measurements of ionic currents through nanopores partially blocked by DNA have emerged as a powerful method for characterization of the DNA nucleotide sequence. Although the effect of the nucleotide sequence on the nanopore blockade current has been experimentally demonstrated, prediction and interpretation of such measurements remain a formidable challenge. Using atomic resolution computational approaches, here we show how the sequence, molecular conformation, and pore geometry affect the blockade ionic current in model solid-state nanopores. We demonstrate that the blockade current from a DNA molecule is determined by the chemical identities and conformations of at least three consecutive nucleotides. We find the blockade currents produced by the nucleotide triplets to vary considerably with their nucleotide sequence despite having nearly identical molecular conformations. Encouragingly, we find blockade current differences as large as 25% for single-base substitutions in ultra small (1.6 nm × 1.1 nm cross section; 2 nm length) solid-state nanopores. Despite the complex dependence of the blockade current on the sequence and conformation of the DNA triplets, we find that, under many conditions, the number of thymine bases is positively correlated with the current, whereas the number of purine bases and the presence of both purine and pyrimidines in the triplet are negatively correlated with the current. Based on these observations, we construct a simple theoretical model that relates the ion current to the base content of a solid-state nanopore. Furthermore, we show that compact conformations of DNA in narrow pores provide the greatest signal-to-noise ratio for single base detection, whereas reduction of the nanopore length increases the ionic current noise. Thus, the sequence dependence of nanopore blockade current can be theoretically rationalized, although the predictions will likely need to be customized for each nanopore type. PMID:27103233

PEGylated Polyaniline Nanofibers: Antifouling and Conducting Biomaterial for Electrochemical DNA Sensing.

PubMed

Hui, Ni; Sun, Xiaotian; Niu, Shuyan; Luo, Xiliang

2017-01-25

Biofouling arising from nonspecific adsorption is a substantial outstanding challenge in diagnostics and disease monitoring, and antifouling sensing interfaces capable of reducing the nonspecific adsorption of proteins from biological complex samples are highly desirable. We present herein the preparation of novel composite nanofibers through the grafting of polyethylene glycol (PEG) polymer onto polyaniline (PANI) nanofibers and their application in the development of antifouling electrochemical biosensors. The PEGylated PANI (PANI/PEG) nanofibers possessed large surface area and remained conductive and at the same time demonstrated excellent antifouling performances in single protein solutions as well as complex human serum samples. Sensitive and low fouling electrochemical biosensors for the breast cancer susceptibility gene (BRCA1) can be easily fabricated through the attachment of DNA probes to the PANI/PEG nanofibers. The biosensor showed a very high sensitivity to target BRCA1 with a linear range from 0.01 pM to 1 nM and was also efficient enough to detect DNA mismatches with satisfactory selectivity. Moreover, the DNA biosensor based on the PEGylated PANI nanofibers supported the quantification of BRCA1 in complex human serum, indicating great potential of this novel biomaterial for application in biosensors and bioelectronics.

Set2 Methyltransferase Facilitates DNA Replication and Promotes Genotoxic Stress Responses through MBF-Dependent Transcription.

PubMed

Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C

2017-09-12

Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Modeling hole transport in wet and dry DNA.

PubMed

Pavanello, Michele; Adamowicz, Ludwik; Volobuyev, Maksym; Mennucci, Benedetta

2010-04-08

We present a DFT/classical molecular dynamics model of DNA charge conductivity. The model involves a temperature-driven, hole-hopping charge transfer and includes the time-dependent nonequilibrium interaction of DNA with its molecular environment. We validate our method against a variety of hole transport experiments. The method predicts a significant hole-transfer slowdown of approximately 35% from dry to wet DNA with and without electric field bias. In addition, in agreement with experiments, it also predicts an insulating behavior of (GC)(N) oligomers for 40 < N < 1000, depending on the experimental setup.

Inhibition of polyomavirus ori-dependent DNA replication by mSin3B.

PubMed

Xie, An-Yong; Folk, William R

2002-12-01

When tethered in cis to DNA, the transcriptional corepressor mSin3B inhibits polyomavirus (Py) ori-dependent DNA replication in vivo. Histone deacetylases (HDACs) appear not to be involved, since tethering class I and class II HDACs in cis does not inhibit replication and treating the cells with trichostatin A does not specifically relieve inhibition by mSin3B. However, the mSin3B L59P mutation that impairs mSin3B interaction with N-CoR/SMRT abrogates inhibition of replication, suggesting the involvement of N-CoR/SMRT. Py large T antigen interacts with mSin3B, suggesting an HDAC-independent mechanism by which mSin3B inhibits DNA replication.

Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

PubMed Central

Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

2002-01-01

KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

A "turn-on" fluorescent copper biosensor based on DNA cleavage-dependent graphene-quenched DNAzyme.

PubMed

Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie

2011-06-15

A novel and promising "turn-on" fluorescent Cu(2+) biosensor is designed based on graphene-DNAzyme catalytic beacon. Due to the essential surface and quenching properties of two-dimensional graphene, it can function as both "scaffold" and "quencher" of the Cu(2+)-dependent DNAzyme, facilitating the formation of self-assembled graphene-quenched DNAzyme complex. However, Cu(2+)-induced catalytic reaction disturbs the graphene-DNAzyme conformation, which will produce internal DNA cleavage-dependent effect. In this case, the quenched fluorescence in graphene-DNAzyme is quickly recovered to a large extent in 15 min. Compared with common DNAzyme-based sensors, the presented graphene-based catalytic beacon greatly improves the signal-to-background ratio, hence increasing the sensitivity (LOD=0.365 nM). Furthermore, the controllable DNA cleavage reaction provides an original and alternative internal method to regulate the interaction between graphene and DNA relative to the previous external sequence-specific hybridization-dependent regulation, which will open new opportunities for nucleic studies and sensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of the tunneling conductance across DNA bases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zikic, Radomir; Krstic, Predrag S; Zhang, Xiaoguang

2006-01-01

Characterization of the electrical properties of the DNA bases, Adenine, Cytosine, Guanine and Thymine, besides building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotide-like molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the DFT exchangecorrelation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristicsmore » of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.« less

Characterization of the tunneling conductance across DNA bases.

PubMed

Zikic, Radomir; Krstić, Predrag S; Zhang, X-G; Fuentes-Cabrera, Miguel; Wells, Jack; Zhao, Xiongce

2006-07-01

Characterization of the electrical properties of the DNA bases (adenine, cytosine, guanine, and thymine), in addition to building the basic knowledge on these fundamental constituents of a DNA, is a crucial step in developing a DNA sequencing technology. We present a first-principles study of the current-voltage characteristics of nucleotidelike molecules of the DNA bases, placed in a 1.5 nm gap formed between gold nanoelectrodes. The quantum transport calculations in the tunneling regime are shown to vary strongly with the electrode-molecule geometry and the choice of the density-functional theory exchange-correlation functionals. Analysis of the results in the zero-bias limit indicates that distinguishable current-voltage characteristics of different DNA bases are dominated by the geometrical conformations of the bases and nanoelectrodes.

Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers.

PubMed

Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

2010-12-09

The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs.

Chromatin Collapse during Caspase-dependent Apoptotic Cell Death Requires DNA Fragmentation Factor, 40-kDa Subunit-/Caspase-activated Deoxyribonuclease-mediated 3′-OH Single-strand DNA Breaks*

PubMed Central

Iglesias-Guimarais, Victoria; Gil-Guiñon, Estel; Sánchez-Osuna, María; Casanelles, Elisenda; García-Belinchón, Mercè; Comella, Joan X.; Yuste, Victor J.

2013-01-01

Apoptotic nuclear morphology and oligonucleosomal double-strand DNA fragments (also known as DNA ladder) are considered the hallmarks of apoptotic cell death. From a classic point of view, these two processes occur concomitantly. Once activated, DNA fragmentation factor, 40-kDa subunit (DFF40)/caspase-activated DNase (CAD) endonuclease hydrolyzes the DNA into oligonucleosomal-size pieces, facilitating the chromatin package. However, the dogma that the apoptotic nuclear morphology depends on DNA fragmentation has been questioned. Here, we use different cellular models, including MEF CAD−/− cells, to unravel the mechanism by which DFF40/CAD influences chromatin condensation and nuclear collapse during apoptosis. Upon apoptotic insult, SK-N-AS cells display caspase-dependent apoptotic nuclear alterations in the absence of internucleosomal DNA degradation. The overexpression of a wild-type form of DFF40/CAD endonuclease, but not of different catalytic-null mutants, restores the cellular ability to degrade the chromatin into oligonucleosomal-length fragments. We show that apoptotic nuclear collapse requires a 3′-OH endonucleolytic activity even though the internucleosomal DNA degradation is impaired. Moreover, alkaline unwinding electrophoresis and In Situ End-Labeling (ISEL)/In Situ Nick Translation (ISNT) assays reveal that the apoptotic DNA damage observed in the DNA ladder-deficient SK-N-AS cells is characterized by the presence of single-strand nicks/breaks. Apoptotic single-strand breaks can be impaired by DFF40/CAD knockdown, abrogating nuclear collapse and disassembly. In conclusion, the highest order of chromatin compaction observed in the later steps of caspase-dependent apoptosis relies on DFF40/CAD-mediated DNA damage by generating 3′-OH ends in single-strand rather than double-strand DNA nicks/breaks. PMID:23430749

The Molecular Origin of the MMR-dependent Apoptosis Pathway from Dynamics Analysis of MutSα-DNA Complexes

PubMed Central

Negureanu, Lacramioara; Salsbury, Freddie R.

2012-01-01

The cellular response to DNA damage signaling by MMR proteins is incompletely understood. It is generally accepted that MMR-dependent apoptosis pathway in response to DNA damage detection is independent of MMR's DNA repair function. In this study we investigate correlated motions in response to the binding of mismatched and PCL DNA fragments by MutSα, as derived from 50 ns molecular dynamics simulations. The protein dynamics in response to the mismatched and damaged DNA recognition suggests that MutSα signals their recognition through independent pathways providing evidence for the molecular origin of the MMR-dependent apoptosis. MSH2 subunit is indicated to play a key role in signaling both mismatched and damaged DNA recognition; localized and collective motions within the protein allow identifying sites on the MSH2 surface possible involved in recruiting proteins responsible for downstream events. Unlike in the mismatch complex, predicted key communication sites specific for the damage recognition are on the list of known cancer causing mutations or deletions. This confirms MSH2's role in signaling DNA-damage induced apoptosis and suggests that defects in MMR alone is sufficient to trigger tumorigenesis, supporting the experimental evidence that MMR-damage response function could protect from the early occurrence of tumors. Identifying these particular communication sites may have implications for the treatment of cancers that are not defective for MMR, but are unable to function optimally for MMR-dependent responses following DNA damage such as the case of resistance to cisplatin. PMID:22712459

BCR/ABL downregulates DNA-PK(CS)-dependent and upregulates backup non-homologous end joining in leukemic cells.

PubMed

Poplawski, Tomasz; Blasiak, Janusz

2010-06-01

Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.

Significance of phosphatase and tensin homologue (PTEN), O(6)-methylguanine-DNA methyltransferase (MGMT), and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) protein expression in gynaecomastia.

PubMed

Zhu, L; Liu, Z; Yang, J; Cai, J

2009-01-01

This study was designed to investigate the pathogenesis of gynaecomastia by measuring phosphatase and tensin homologue (PTEN), O(6)-methylguanine-DNA methyltransferase (MGMT) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) protein in breast tissue specimens from 68 patients with gynaecomastia and 24 normal male controls using immunohistochemical staining. The gynaecomastia cases were divided into three different histological types: florid, intermediate and fibrous. The PTEN, MGMT and DNA-PKcs proteins were detected in both gynaecomastia and normal breast tissue, but the levels of immunohistochemical staining of each protein were significantly lower in gynaecomastia breast tissue than in normal breast tissue. There were also significant differences in the levels of immunohistochemical staining for the three proteins according to gynaecomastia histological type. These results suggest that abnormally low levels of PTEN, MGMT and DNA-PKcs protein in gynaecomastia breast tissue may play a role in the development of gynaecomastia. Further research is required to elucidate fully their individual roles in the pathophysiology of gynaecomastia.

Recognition tunneling measurement of the conductance of DNA bases embedded in self-assembled monolayers

PubMed Central

Huang, Shuo; Chang, Shuai; He, Jin; Zhang, Peiming; Liang, Feng; Tuchband, Michael; Li, Shengqing; Lindsay, Stuart

2010-01-01

The DNA bases interact strongly with gold electrodes, complicating efforts to measure the tunneling conductance through hydrogen-bonded Watson Crick base pairs. When bases are embedded in a self-assembled alkane-thiol monolayer to minimize these interactions, new features appear in the tunneling data. These new features track the predictions of density-functional calculations quite well, suggesting that they reflect tunnel conductance through hydrogen-bonded base pairs. PMID:21197382

The N-terminal Region of the DNA-dependent Protein Kinase Catalytic Subunit Is Required for Its DNA Double-stranded Break-mediated Activation*

PubMed Central

Davis, Anthony J.; Lee, Kyung-Jong; Chen, David J.

2013-01-01

DNA-dependent protein kinase (DNA-PK) plays an essential role in the repair of DNA double-stranded breaks (DSBs) mediated by the nonhomologous end-joining pathway. DNA-PK is a holoenzyme consisting of a DNA-binding (Ku70/Ku80) and catalytic (DNA-PKcs) subunit. DNA-PKcs is a serine/threonine protein kinase that is recruited to DSBs via Ku70/80 and is activated once the kinase is bound to the DSB ends. In this study, two large, distinct fragments of DNA-PKcs, consisting of the N terminus (amino acids 1–2713), termed N-PKcs, and the C terminus (amino acids 2714–4128), termed C-PKcs, were produced to determine the role of each terminal region in regulating the activity of DNA-PKcs. N-PKcs but not C-PKcs interacts with the Ku-DNA complex and is required for the ability of DNA-PKcs to localize to DSBs. C-PKcs has increased basal kinase activity compared with DNA-PKcs, suggesting that the N-terminal region of DNA-PKcs keeps basal activity low. The kinase activity of C-PKcs is not stimulated by Ku70/80 and DNA, further supporting that the N-terminal region is required for binding to the Ku-DNA complex and full activation of kinase activity. Collectively, the results show the N-terminal region mediates the interaction between DNA-PKcs and the Ku-DNA complex and is required for its DSB-induced enzymatic activity. PMID:23322783

Nucleotide excision repair-dependent DNA double-strand break formation and ATM signaling activation in mammalian quiescent cells.

PubMed

Wakasugi, Mitsuo; Sasaki, Takuma; Matsumoto, Megumi; Nagaoka, Miyuki; Inoue, Keiko; Inobe, Manabu; Horibata, Katsuyoshi; Tanaka, Kiyoji; Matsunaga, Tsukasa

2014-10-10

Histone H2A variant H2AX is phosphorylated at Ser(139) in response to DNA double-strand break (DSB) and single-stranded DNA (ssDNA) formation. UV light dominantly induces pyrimidine photodimers, which are removed from the mammalian genome by nucleotide excision repair (NER). We previously reported that in quiescent G0 phase cells, UV induces ATR-mediated H2AX phosphorylation plausibly caused by persistent ssDNA gap intermediates during NER. In this study, we have found that DSB is also generated following UV irradiation in an NER-dependent manner and contributes to an earlier fraction of UV-induced H2AX phosphorylation. The NER-dependent DSB formation activates ATM kinase and triggers the accumulation of its downstream factors, MRE11, NBS1, and MDC1, at UV-damaged sites. Importantly, ATM-deficient cells exhibited enhanced UV sensitivity under quiescent conditions compared with asynchronously growing conditions. Finally, we show that the NER-dependent H2AX phosphorylation is also observed in murine peripheral T lymphocytes, typical nonproliferating quiescent cells in vivo. These results suggest that in vivo quiescent cells may suffer from NER-mediated secondary DNA damage including ssDNA and DSB. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.

PubMed

Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude

2011-01-01

Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.

Mutation of a Conserved Active Site Residue Converts Tyrosyl-DNA Phosphodiesterase l Into a DNA Topoisomerase l-Dependent Poison

DOE Office of Scientific and Technical Information (OSTI.GOV)

He,X.; van Waardenburg, R.; Babaoglu, K.

2007-01-01

Tyrosyl-DNA phosphodiesterase 1 (Tdp1) catalyzes the resolution of 3' and 5' phospho-DNA adducts. A defective mutant, associated with the recessive neurodegenerative disease SCAN1, accumulates Tdp1-DNA complexes in vitro. To assess the conservation of enzyme architecture, a 2.0 {angstrom} crystal structure of yeast Tdp1 was determined that is very similar to human Tdp1. Poorly conserved regions of primary structure are peripheral to an essentially identical catalytic core. Enzyme mechanism was also conserved, because the yeast SCAN1 mutant (H{sub 432}R) enhanced cell sensitivity to the DNA topoisomerase I (Top1) poison camptothecin. A more severe Top1-dependent lethality of Tdp1H{sub 432}N was drug-independent, coincidingmore » with increased covalent Top1-DNA and Tdp1-DNA complex formation in vivo. However, both H432 mutants were recessive to wild-type Tdp1. Thus, yeast H{sub 432} acts in the general acid/base catalytic mechanism of Tdp1 to resolve 3' phosphotyrosyl and 3' phosphoamide linkages. However, the distinct pattern of mutant Tdp1 activity evident in yeast cells, suggests a more severe defect in Tdp1H{sub 432}N-catalyzed resolution of 3' phospho-adducts.« less

DNA hybridization kinetics: zippering, internal displacement and sequence dependence.

PubMed

Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A

2013-10-01

Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.

DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells.

PubMed

Dolman, M Emmy M; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N; Molenaar, Jan J

2015-01-01

Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization.

STING-Dependent Cytosolic DNA Sensing Promotes Radiation-Induced Type I Interferon-Dependent Antitumor Immunity in Immunogenic Tumors.

PubMed

Deng, Liufu; Liang, Hua; Xu, Meng; Yang, Xuanming; Burnette, Byron; Arina, Ainhoa; Li, Xiao-Dong; Mauceri, Helena; Beckett, Michael; Darga, Thomas; Huang, Xiaona; Gajewski, Thomas F; Chen, Zhijian J; Fu, Yang-Xin; Weichselbaum, Ralph R

2014-11-20

Ionizing radiation-mediated tumor regression depends on type I interferon (IFN) and the adaptive immune response, but several pathways control I IFN induction. Here, we demonstrate that adaptor protein STING, but not MyD88, is required for type I IFN-dependent antitumor effects of radiation. In dendritic cells (DCs), STING was required for IFN-? induction in response to irradiated-tumor cells. The cytosolic DNA sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) mediated sensing of irradiated-tumor cells in DCs. Moreover, STING was essential for radiation-induced adaptive immune responses, which relied on type I IFN signaling on DCs. Exogenous IFN-? treatment rescued the cross-priming by cGAS or STING-deficient DCs. Accordingly, activation of STING by a second messenger cGAMP administration enhanced antitumor immunity induced by radiation. Thus radiation-mediated antitumor immunity in immunogenic tumors requires a functional cytosolic DNA-sensing pathway and suggests that cGAMP treatment might provide a new strategy to improve radiotherapy. Copyright © 2014 Elsevier Inc. All rights reserved.

Dependence of Thermal Conductivity on Water Saturation of Sandstones

NASA Astrophysics Data System (ADS)

Fehr, A.; Jorand, R.; Koch, A.; Clauser, C.

2008-12-01

Information on thermal conductivity of rocks and soils is essential in applied geothermal and hydrocarbon maturation research. In this study, we investigate the dependence of thermal conductivity on the degree of water saturation. Measurements were made on five sandstones from different outcrops in Germany. In a first step, we characterized the samples with respect to mineralogical composition, porosity, and microstructure by nuclear magnetic resonance (NMR) and mercury injection. We measured thermal conductivity with an optical scanner at different levels of water saturation. Finally we present a simple and easy model for the correlation of thermal conductivity and water saturation. Thermal conductivity decreases in the course of the drying of the rock. This behaviour is not linear and depends on the microstructure of the studied rock. We studied different mixing models for three phases: mineral skeleton, water and air. For argillaceous sandstones a modified arithmetic model works best which considers the irreducible water volume and different pore sizes. For pure quartz sandstones without clay minerals, we use the same model for low water saturations, but for high water saturations a modified geometric model. A clayey sandstone rich in feldspath shows a different behaviour which cannot be explained by simple models. A better understanding will require measurements on additional samples which will help to improve the derived correlations and substantiate our findings.

Alcohol Dependence and Domestic Violence as Sequelae of Abuse and Conduct Disorder in Childhood.

ERIC Educational Resources Information Center

Kunitz, Stephen J.; Levy, Jerrold E.; McCloskey, Joanne; Gabriel, K. Ruben

1998-01-01

This study compared 204 Navajo men and women for alcohol dependence and domestic violence as sequelae of abuse and conduct disorders in childhood. Both physical and sexual abuse were risk factors for conduct disorder. Physical abuse and conduct disorder were risk factors for alcohol dependence. Alcohol dependence and physical abuse were…

Exposure-dependent incorporation of trifluridine into DNA of tumors and white blood cells in tumor-bearing mouse.

PubMed

Yamashita, Fumiaki; Komoto, Ikumi; Oka, Hiroaki; Kuwata, Keizo; Takeuchi, Mayuko; Nakagawa, Fumio; Yoshisue, Kunihiro; Chiba, Masato

2015-08-01

Trifluridine (TFT) is an antitumor component of a novel nucleoside antitumor agent, TAS-102, which consists of TFT and tipiracil hydrochloride (thymidine phosphorylase inhibitor). Incorporation of TFT into DNA is a probable mechanism of antitumor activity and hematological toxicity. The objective of this study was to examine the TFT incorporation into tumor- and white blood cell-DNA, and to elucidate the mechanism of TFT-related effect and toxicity. TFT effect on the colony formation of mouse bone marrow cells was also investigated. Pharmacokinetics of TFT was determined in nude mice after single oral administration of TAS-102, while the antitumor activity and body weight change were evaluated in the tumor-bearing nude mice after multiple oral administrations for 2 weeks. TFT concentrations in the blood- and tumor-DNA were determined by LC/MS/MS. The colony formation was evaluated by CFU-GM assay. TFT systemic exposure in plasma increased dose-dependently. The tumor growth rate and body weight gain decreased dose-dependently, but TFT concentrations in the DNA of tumor tissues and white blood cells increased dose-dependently. TFT inhibited colony formation of bone marrow cells in a concentration-dependent manner. A significant relationship between systemic exposure of TFT and pharmacological effects including the antitumor activity and body weight change was well explained by the TFT incorporation into DNA. TFT inhibited proliferations of mouse bone marrow cells and human colorectal carcinoma cells implanted to nude mice dose-dependently. The highest tolerable TFT exposure provides the highest antitumor activity, and the hematological toxicity may serve as a potential surrogate indicator of TAS-102 efficacy.

Temperature-dependent regulation of rDNA condensation in Saccharomyces cerevisiae.

PubMed

Shen, Donglai; Skibbens, Robert V

2017-06-03

Chromatin condensation during mitosis produces detangled and discrete DNA entities required for high fidelity sister chromatid segregation during mitosis and positions DNA away from the cleavage furrow during cytokinesis. Regional condensation during G1 also establishes a nuclear architecture through which gene transcription is regulated but remains plastic so that cells can respond to changes in nutrient levels, temperature and signaling molecules. To date, however, the potential impact of this plasticity on mitotic chromosome condensation remains unknown. Here, we report results obtained from a new condensation assay that wildtype budding yeast cells exhibit dramatic changes in rDNA conformation in response to temperature. rDNA hypercondenses in wildtype cells maintained at 37°C, compared with cells maintained at 23°C. This hypercondensation machinery can be activated during preanaphase but readily inactivated upon exposure to lower temperatures. Extended mitotic arrest at 23°C does not result in hypercondensation, negating a kinetic-based argument in which condensation that typically proceeds slowly is accelerated when cells are placed at 37°C. Neither elevated recombination nor reduced transcription appear to promote this hypercondensation. This heretofore undetected temperature-dependent hypercondensation pathway impacts current views of chromatin structure based on conditional mutant gene analyses and significantly extends our understanding of physiologic changes in chromatin architecture in response to hypothermia.

Temperature-dependent regulation of rDNA condensation in Saccharomyces cerevisiae

PubMed Central

Shen, Donglai; Skibbens, Robert V.

2017-01-01

ABSTRACT Chromatin condensation during mitosis produces detangled and discrete DNA entities required for high fidelity sister chromatid segregation during mitosis and positions DNA away from the cleavage furrow during cytokinesis. Regional condensation during G1 also establishes a nuclear architecture through which gene transcription is regulated but remains plastic so that cells can respond to changes in nutrient levels, temperature and signaling molecules. To date, however, the potential impact of this plasticity on mitotic chromosome condensation remains unknown. Here, we report results obtained from a new condensation assay that wildtype budding yeast cells exhibit dramatic changes in rDNA conformation in response to temperature. rDNA hypercondenses in wildtype cells maintained at 37°C, compared with cells maintained at 23°C. This hypercondensation machinery can be activated during preanaphase but readily inactivated upon exposure to lower temperatures. Extended mitotic arrest at 23°C does not result in hypercondensation, negating a kinetic-based argument in which condensation that typically proceeds slowly is accelerated when cells are placed at 37°C. Neither elevated recombination nor reduced transcription appear to promote this hypercondensation. This heretofore undetected temperature-dependent hypercondensation pathway impacts current views of chromatin structure based on conditional mutant gene analyses and significantly extends our understanding of physiologic changes in chromatin architecture in response to hypothermia. PMID:28426272

Conformational Smear Characterization and Binning of Single-Molecule Conductance Measurements for Enhanced Molecular Recognition.

PubMed

Korshoj, Lee E; Afsari, Sepideh; Chatterjee, Anushree; Nagpal, Prashant

2017-11-01

Electronic conduction or charge transport through single molecules depends primarily on molecular structure and anchoring groups and forms the basis for a wide range of studies from molecular electronics to DNA sequencing. Several high-throughput nanoelectronic methods such as mechanical break junctions, nanopores, conductive atomic force microscopy, scanning tunneling break junctions, and static nanoscale electrodes are often used for measuring single-molecule conductance. In these measurements, "smearing" due to conformational changes and other entropic factors leads to large variances in the observed molecular conductance, especially in individual measurements. Here, we show a method for characterizing smear in single-molecule conductance measurements and demonstrate how binning measurements according to smear can significantly enhance the use of individual conductance measurements for molecular recognition. Using quantum point contact measurements on single nucleotides within DNA macromolecules, we demonstrate that the distance over which molecular junctions are maintained is a measure of smear, and the resulting variance in unbiased single measurements depends on this smear parameter. Our ability to identify individual DNA nucleotides at 20× coverage increases from 81.3% accuracy without smear analysis to 93.9% with smear characterization and binning (SCRIB). Furthermore, merely 7 conductance measurements (7× coverage) are needed to achieve 97.8% accuracy for DNA nucleotide recognition when only low molecular smear measurements are used, which represents a significant improvement over contemporary sequencing methods. These results have important implications in a broad range of molecular electronics applications from designing robust molecular switches to nanoelectronic DNA sequencing.

The C terminus of Ku80 activates the DNA-dependent protein kinase catalytic subunit.

PubMed

Singleton, B K; Torres-Arzayus, M I; Rottinghaus, S T; Taccioli, G E; Jeggo, P A

1999-05-01

Ku is a heterodimeric protein with double-stranded DNA end-binding activity that operates in the process of nonhomologous end joining. Ku is thought to target the DNA-dependent protein kinase (DNA-PK) complex to the DNA and, when DNA bound, can interact and activate the DNA-PK catalytic subunit (DNA-PKcs). We have carried out a 3' deletion analysis of Ku80, the larger subunit of Ku, and shown that the C-terminal 178 amino acid residues are dispensable for DNA end-binding activity but are required for efficient interaction of Ku with DNA-PKcs. Cells expressing Ku80 proteins that lack the terminal 178 residues have low DNA-PK activity, are radiation sensitive, and can recombine the signal junctions but not the coding junctions during V(D)J recombination. These cells have therefore acquired the phenotype of mouse SCID cells despite expressing DNA-PKcs protein, suggesting that an interaction between DNA-PKcs and Ku, involving the C-terminal region of Ku80, is required for DNA double-strand break rejoining and coding but not signal joint formation. To gain further insight into important domains in Ku80, we report a point mutational change in Ku80 in the defective xrs-2 cell line. This residue is conserved among species and lies outside of the previously reported Ku70-Ku80 interaction domain. The mutational change nonetheless abrogates the Ku70-Ku80 interaction and DNA end-binding activity.

DNA-Dependent Protein Kinase As Molecular Target for Radiosensitization of Neuroblastoma Cells

PubMed Central

Dolman, M. Emmy M.; van der Ploeg, Ida; Koster, Jan; Bate-Eya, Laurel Tabe; Versteeg, Rogier; Caron, Huib N.; Molenaar, Jan J.

2015-01-01

Tumor cells might resist therapy with ionizing radiation (IR) by non-homologous end-joining (NHEJ) of IR-induced double-strand breaks. One of the key players in NHEJ is DNA-dependent protein kinase (DNA-PK). The catalytic subunit of DNA-PK, i.e. DNA-PKcs, can be inhibited with the small-molecule inhibitor NU7026. In the current study, the in vitro potential of NU7026 to radiosensitize neuroblastoma cells was investigated. DNA-PKcs is encoded by the PRKDC (protein kinase, DNA-activated, catalytic polypeptide) gene. We showed that PRKDC levels were enhanced in neuroblastoma patients and correlated with a more advanced tumor stage and poor prognosis, making DNA-PKcs an interesting target for radiosensitization of neuroblastoma tumors. Optimal dose finding for combination treatment with NU7026 and IR was performed using NGP cells. One hour pre-treatment with 10 μM NU7026 synergistically sensitized NGP cells to 0.63 Gy IR. Radiosensitizing effects of NU7026 increased in time, with maximum effects observed from 96 h after IR-exposure on. Combined treatment of NGP cells with 10 μM NU7026 and 0.63 Gy IR resulted in apoptosis, while no apoptotic response was observed for either of the therapies alone. Inhibition of IR-induced DNA-PK activation by NU7026 confirmed the capability of NGP cells to, at least partially, resist IR by NHEJ. NU7026 also synergistically radiosensitized other neuroblastoma cell lines, while no synergistic effect was observed for low DNA-PKcs-expressing non-cancerous fibroblasts. Results obtained for NU7026 were confirmed by PRKDC knockdown in NGP cells. Taken together, the current study shows that DNA-PKcs is a promising target for neuroblastoma radiosensitization. PMID:26716839

Light sensitive memristor with bi-directional and wavelength-dependent conductance control

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maier, P.; Hartmann, F., E-mail: fabian.hartmann@physik.uni-wuerzburg.de; Emmerling, M.

2016-07-11

We report the optical control of localized charge on positioned quantum dots in an electro-photo-sensitive memristor. Interband absorption processes in the quantum dot barrier matrix lead to photo-generated electron-hole-pairs that, depending on the applied bias voltage, charge or discharge the quantum dots and hence decrease or increase the conductance. Wavelength-dependent conductance control is observed by illumination with red and infrared light, which leads to charging via interband and discharging via intraband absorption. The presented memristor enables optical conductance control and may thus be considered for sensory applications in artificial neural networks as light-sensitive synapses or optically tunable memories.

RNF8- and Ube2S-Dependent Ubiquitin Lysine 11-Linkage Modification in Response to DNA Damage.

PubMed

Paul, Atanu; Wang, Bin

2017-05-18

Ubiquitin modification of proteins plays pivotal roles in the cellular response to DNA damage. Given the complexity of ubiquitin conjugation due to the formation of poly-conjugates of different linkages, functional roles of linkage-specific ubiquitin modification at DNA damage sites are largely unclear. We identify that Lys11-linkage ubiquitin modification occurs at DNA damage sites in an ATM-dependent manner, and ubiquitin-modifying enzymes, including Ube2S E2-conjugating enzyme and RNF8 E3 ligase, are responsible for the assembly of Lys11-linkage conjugates on damaged chromatin, including histone H2A/H2AX. We show that RNF8- and Ube2S-dependent Lys11-linkage ubiquitin conjugation plays an important role in regulating DNA damage-induced transcriptional silencing, distinct from the role of Lys63-linkage ubiquitin in the recruitment of DNA damage repair proteins 53BP1 and BRCA1. Thus, our study highlights the importance of linkage-specific ubiquitination at DNA damage sites, and it reveals that Lys11-linkage ubiquitin modification plays a crucial role in the DNA damage response. Copyright © 2017 Elsevier Inc. All rights reserved.

Bilayer-Spanning DNA Nanopores with Voltage-Switching between Open and Closed State

PubMed Central

2014-01-01

Membrane-spanning nanopores from folded DNA are a recent example of biomimetic man-made nanostructures that can open up applications in biosensing, drug delivery, and nanofluidics. In this report, we generate a DNA nanopore based on the archetypal six-helix-bundle architecture and systematically characterize it via single-channel current recordings to address several fundamental scientific questions in this emerging field. We establish that the DNA pores exhibit two voltage-dependent conductance states. Low transmembrane voltages favor a stable high-conductance level, which corresponds to an unobstructed DNA pore. The expected inner width of the open channel is confirmed by measuring the conductance change as a function of poly(ethylene glycol) (PEG) size, whereby smaller PEGs are assumed to enter the pore. PEG sizing also clarifies that the main ion-conducting path runs through the membrane-spanning channel lumen as opposed to any proposed gap between the outer pore wall and the lipid bilayer. At higher voltages, the channel shows a main low-conductance state probably caused by electric-field-induced changes of the DNA pore in its conformation or orientation. This voltage-dependent switching between the open and closed states is observed with planar lipid bilayers as well as bilayers mounted on glass nanopipettes. These findings settle a discrepancy between two previously published conductances. By systematically exploring a large space of parameters and answering key questions, our report supports the development of DNA nanopores for nanobiotechnology. PMID:25338165

Bilayer-spanning DNA nanopores with voltage-switching between open and closed state.

PubMed

Seifert, Astrid; Göpfrich, Kerstin; Burns, Jonathan R; Fertig, Niels; Keyser, Ulrich F; Howorka, Stefan

2015-02-24

Membrane-spanning nanopores from folded DNA are a recent example of biomimetic man-made nanostructures that can open up applications in biosensing, drug delivery, and nanofluidics. In this report, we generate a DNA nanopore based on the archetypal six-helix-bundle architecture and systematically characterize it via single-channel current recordings to address several fundamental scientific questions in this emerging field. We establish that the DNA pores exhibit two voltage-dependent conductance states. Low transmembrane voltages favor a stable high-conductance level, which corresponds to an unobstructed DNA pore. The expected inner width of the open channel is confirmed by measuring the conductance change as a function of poly(ethylene glycol) (PEG) size, whereby smaller PEGs are assumed to enter the pore. PEG sizing also clarifies that the main ion-conducting path runs through the membrane-spanning channel lumen as opposed to any proposed gap between the outer pore wall and the lipid bilayer. At higher voltages, the channel shows a main low-conductance state probably caused by electric-field-induced changes of the DNA pore in its conformation or orientation. This voltage-dependent switching between the open and closed states is observed with planar lipid bilayers as well as bilayers mounted on glass nanopipettes. These findings settle a discrepancy between two previously published conductances. By systematically exploring a large space of parameters and answering key questions, our report supports the development of DNA nanopores for nanobiotechnology.

Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

NASA Astrophysics Data System (ADS)

Snodin, Benedict E. K.; Randisi, Ferdinando; Mosayebi, Majid; Šulc, Petr; Schreck, John S.; Romano, Flavio; Ouldridge, Thomas E.; Tsukanov, Roman; Nir, Eyal; Louis, Ard A.; Doye, Jonathan P. K.

2015-06-01

We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na+] = 0.5M), so that it can be used for a range of salt concentrations including those corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.

Introducing improved structural properties and salt dependence into a coarse-grained model of DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Snodin, Benedict E. K., E-mail: benedict.snodin@chem.ox.ac.uk; Mosayebi, Majid; Schreck, John S.

2015-06-21

We introduce an extended version of oxDNA, a coarse-grained model of deoxyribonucleic acid (DNA) designed to capture the thermodynamic, structural, and mechanical properties of single- and double-stranded DNA. By including explicit major and minor grooves and by slightly modifying the coaxial stacking and backbone-backbone interactions, we improve the ability of the model to treat large (kilobase-pair) structures, such as DNA origami, which are sensitive to these geometric features. Further, we extend the model, which was previously parameterised to just one salt concentration ([Na{sup +}] = 0.5M), so that it can be used for a range of salt concentrations including thosemore » corresponding to physiological conditions. Finally, we use new experimental data to parameterise the oxDNA potential so that consecutive adenine bases stack with a different strength to consecutive thymine bases, a feature which allows a more accurate treatment of systems where the flexibility of single-stranded regions is important. We illustrate the new possibilities opened up by the updated model, oxDNA2, by presenting results from simulations of the structure of large DNA objects and by using the model to investigate some salt-dependent properties of DNA.« less

DNA in the material world: electrical properties and nano-applications.

PubMed

Triberis, Georgios P; Dimakogianni, Margarita

2009-01-01

Contradictory experimental findings and theoretical interpretations have spurred intense debate over the electrical properties of the DNA double helix. In the present review article the various factors responsible for these divergences are discussed. The enlightenment of this issue could improve long range chemistry of oxidative DNA damage and repair processes, monitoring protein-DNA interactions and possible applications in nano-electronic circuit technology. The update experimental situation concerning measurements of the electrical conductivity is given. The character of the carriers responsible for the electrical conductivity measured in DNA is investigated. A theoretical model for the temperature dependence of the electrical conductivity of DNA is presented, based on microscopic models and percolation theoretical arguments. The theoretical results, excluding or including correlation effects, are applied to recent experimental findings for DNA, considering it as a one dimensional molecular wire. The results indicate that correlation effects are probably responsible for large hopping distances in DNA samples. Other theoretical conductivity models proposed for the interpretation of the responsible transport mechanism are also reviewed. Some of the most known and pioneering works on DNA's nano-applications, future developments and perspectives along with current technological limitations and patents are presented and discussed.

Zwitterionic peptide anchored to conducting polymer PEDOT for the development of antifouling and ultrasensitive electrochemical DNA sensor.

PubMed

Wang, Guixiang; Han, Rui; Su, Xiaoli; Li, Yinan; Xu, Guiyun; Luo, Xiliang

2017-06-15

Zwitterionic peptides were anchored to a conducting polymer of citrate doped poly(3,4-ethylenedioxythiophene) (PEDOT) via the nickel cation coordination, and the obtained peptide modified PEDOT, with excellent antifouling ability and good conductivity, was further used for the immobilization of a DNA probe to construct an electrochemical biosensor for the breast cancer marker BRCA1. The DNA biosensor was highly sensitive (with detection limit of 0.03fM) and selective, and it was able to detect BRCA1 in 5% (v/v) human plasma with satisfying accuracy and low fouling. The marriage of antifouling and biocompatible peptides with conducting polymers opened a new avenue to construct electrochemical biosensors capable of assaying targets in complex biological media with high sensitivity and without biofouling. Copyright © 2016 Elsevier B.V. All rights reserved.

The Midblastula Transition Defines the Onset of Y RNA-Dependent DNA Replication in Xenopus laevis ▿

PubMed Central

Collart, Clara; Christov, Christo P.; Smith, James C.; Krude, Torsten

2011-01-01

Noncoding Y RNAs are essential for the initiation of chromosomal DNA replication in mammalian cell extracts, but their role in this process during early vertebrate development is unknown. Here, we use antisense morpholino nucleotides (MOs) to investigate Y RNA function in Xenopus laevis and zebrafish embryos. We show that embryos in which Y RNA function is inhibited by MOs develop normally until the midblastula transition (MBT) but then fail to replicate their DNA and die before gastrulation. Consistent with this observation, Y RNA function is not required for DNA replication in Xenopus egg extracts but is required for replication in a post-MBT cell line. Y RNAs do not bind chromatin in karyomeres before MBT, but they associate with interphase nuclei after MBT in an origin recognition complex (ORC)-dependent manner. Y RNA-specific MOs inhibit the association of Y RNAs with ORC, Cdt1, and HMGA1a proteins, suggesting that these molecular associations are essential for Y RNA function in DNA replication. The MBT is thus a transition point between Y RNA-independent and Y RNA-dependent control of vertebrate DNA replication. Our data suggest that in vertebrates Y RNAs function as a developmentally regulated layer of control over the evolutionarily conserved eukaryotic DNA replication machinery. PMID:21791613

Analysis of mutagenic DNA repair in a thermoconditional mutant of Saccharomyces cerevisiae. IV. Influence of DNA replication and excision repair on REV2 dependent UV-mutagenesis and repair.

PubMed

Siede, W; Eckardt, F

1986-01-01

A double mutant being thermoconditionally defective in mutation induction as well as in repair of pre-lethal UV-induced DNA damage (rev2ts) and deficient in excision repair (rad3-2) was studied in temperature-shift experiments. The influence of inhibitors of DNA replication (hydroxyurea, aphidicolin) was determined. Additionally, an analysis of the dose-response pattern of mutation induction ("mutation kinetics") at several ochre alleles was carried out. It was concluded that the UV-inducible REV2 dependent mutagenic repair process is not induced in excision-deficient cells. In excision-deficient cells, REV2 dependent mutation fixation is slow and mostly post-replicative though not dependent on DNA replication. The REV2 mediated mutagenic process could be separated from the repair function.

DNA adducts and liver DNA replication in rats during chronic exposure to N-nitrosodimethylamine (NDMA) and their relationships to the dose-dependence of NDMA hepatocarcinogenesis.

PubMed

Souliotis, Vassilis L; Henneman, John R; Reed, Carl D; Chhabra, Saranjit K; Diwan, Bhalchandra A; Anderson, Lucy M; Kyrtopoulos, Soterios A

2002-03-20

Exposure of rats to the hepatocarcinogen N-nitrosodimethylamine (NDMA) (0.2-2.64 ppm in the drinking water) for up to 180 days resulted in rapid accumulation of N7- and O6-methylguanine in liver and white blood cell DNA, maximum adduct levels being reached within 1-7 days, depending on the dose. The levels of both adducts remained constant up to treatment day 28, subsequently declining slowly to about 40% of maximal levels for the liver and 60% for white blood cells by day 180. In order to elucidate the role of DNA replication in NDMA hepatocarcinogenesis, changes in liver cell labeling index (LI) were also measured on treatment days 21, 120 and 180. Although the time- and dose-dependence of the observed effects were complex, a clear trend towards increased rates of hepatocyte LI, as indicated by BrdU incorporation, with increasing NDMA doses was evident, particularly above 1 ppm, a concentration above which NDMA hepatocarcinogenicity is known to increase sharply. In contrast, no increase in Kupffer cell DNA replication was found at any of the doses employed, in accordance with the low susceptibility of these cells to NDMA-induced carcinogenesis. No significant increase in the occurrence of necrotic or apoptotic cells was noted under the treatment conditions employed. These results suggest that, in addition to the accumulation of DNA damage, alterations in hepatocyte DNA replication during the chronic NDMA exposure may influence the dose-dependence of its carcinogenic efficacy.

Anomalous frequency-dependent ionic conductivity of lesion-laden human-brain tissue

NASA Astrophysics Data System (ADS)

Emin, David; Akhtari, Massoud; Fallah, Aria; Vinters, Harry V.; Mathern, Gary W.

2017-10-01

We study the effect of lesions on our four-electrode measurements of the ionic conductivity of (˜1 cm3) samples of human brain excised from patients undergoing pediatric epilepsy surgery. For most (˜94%) samples, the low-frequency ionic conductivity rises upon increasing the applied frequency. We attributed this behavior to the long-range (˜0.4 mm) diffusion of solvated sodium cations before encountering intrinsic impenetrable blockages such as cell membranes, blood vessels, and cell walls. By contrast, the low-frequency ionic conductivity of some (˜6%) brain-tissue samples falls with increasing applied frequency. We attribute this unusual frequency-dependence to the electric-field induced liberation of sodium cations from traps introduced by the unusually severe pathology observed in samples from these patients. Thus, the anomalous frequency-dependence of the ionic conductivity indicates trap-producing brain lesions.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

NASA Astrophysics Data System (ADS)

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.

Hole Transport in A-form DNA/RNA Hybrid Duplexes

PubMed Central

Wong, Jiun Ru; Shao, Fangwei

2017-01-01

DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308

Interleukin-22 drives nitric oxide-dependent DNA damage and dysplasia in a murine model of colitis-associated cancer

PubMed Central

Sheh, A; Muthupalani, S; Bryant, EM; Puglisi, DA; Holcombe, H; Conaway, EA; Parry, NAP; Bakthavatchalu, V; Short, SP; Williams, CS; Wogan, GN; Tannenbaum, SR; Fox, JG; Horwitz, BH

2017-01-01

The risk of colon cancer is increased in patients with Crohn's disease and ulcerative colitis. Inflammation-induced DNA damage could be an important link between inflammation and cancer, although the pathways that link inflammation and DNA damage are incompletely defined. RAG2-deficient mice infected with Helicobacter hepaticus (Hh) develop colitis that progresses to lower bowel cancer. This process depends on nitric oxide (NO), a molecule with known mutagenic potential. We have previously hypothesized that production of NO by macrophages could be essential for Hh-driven carcinogenesis, however, whether Hh-infection induces DNA damage in this model and whether this depends on NO has not been determined. Here, we demonstrate that Hh infection of RAG2-deficient mice rapidly induces expression of iNOS and the development of DNA double-stranded breaks (DSBs) specifically in proliferating crypt epithelial cells. Generation of DSBs depended on iNOS activity, and further, induction of iNOS, the generation of DSBs, and the subsequent development of dysplasia were inhibited by depletion of the Hh-induced cytokine IL-22. These results demonstrate a strong association between Hh-induced DNA damage and the development of dysplasia, and further suggest that IL-22 dependent induction of iNOS within crypt epithelial cells rather than macrophages is a driving force in this process. PMID:28198364

Human β-defensin 3 increases the TLR9-dependent response to bacterial DNA.

PubMed

McGlasson, Sarah L; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J; Dorin, Julia R

2017-04-01

Human β-defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self-DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt-3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self-DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9-dependent response. In contrast to hBD3, lipofection of self-DNA enhances inflammatory signaling, but the response is predominantly TLR9-independent. Together, these data show that hBD3 has a role in the innate immune-mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy-number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA-based vaccines. © 2017 The Authors. European Journal of Immunology published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibiting Mitochondrial DNA Ligase IIIα Activates Caspase 1-Dependent Apoptosis in Cancer Cells.

PubMed

Sallmyr, Annahita; Matsumoto, Yoshihiro; Roginskaya, Vera; Van Houten, Bennett; Tomkinson, Alan E

2016-09-15

Elevated levels of DNA ligase IIIα (LigIIIα) have been identified as a biomarker of an alteration in DNA repair in cancer cells that confers hypersensitivity to a LigIIIα inhibitor, L67, in combination with a poly (ADP-ribose) polymerase inhibitor. Because LigIIIα functions in the nucleus and mitochondria, we examined the effect of L67 on these organelles. Here, we show that, although the DNA ligase inhibitor selectively targets mitochondria, cancer and nonmalignant cells respond differently to disruption of mitochondrial DNA metabolism. Inhibition of mitochondrial LigIIIα in cancer cells resulted in abnormal mitochondrial morphology, reduced levels of mitochondrial DNA, and increased levels of mitochondrially generated reactive oxygen species that caused nuclear DNA damage. In contrast, these effects did not occur in nonmalignant cells. Furthermore, inhibition of mitochondrial LigIIIα activated a caspase 1-dependent apoptotic pathway, which is known to be part of inflammatory responses induced by pathogenic microorganisms in cancer, but not nonmalignant cells. These results demonstrate that the disruption of mitochondrial DNA metabolism elicits different responses in nonmalignant and cancer cells and suggests that the abnormal response in cancer cells may be exploited in the development of novel therapeutic strategies that selectively target cancer cells. Cancer Res; 76(18); 5431-41. ©2016 AACR. ©2016 American Association for Cancer Research.

Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

PubMed

Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

2002-12-24

KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

Widespread Dependence of Backup NHEJ on Growth State: Ramifications for the Use of DNA-PK Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Satyendra K.; Wu Wenqi; Zhang Lihua

2011-02-01

Purpose: The backup pathway of nonhomologous end joining (B-NHEJ) enables cells to process DNA double-strand breaks (DSBs) when the DNA-PK-dependent pathway of NHEJ (D-NHEJ) is compromised. Our previous results show marked reduction in the activity of B-NHEJ when LIG4{sup -/-} mouse embryo fibroblasts (MEFs) cease to grow and enter a plateau phase. The dependence of B-NHEJ on growth state is substantially stronger than that of D-NHEJ and points to regulatory mechanisms or processing determinants that require elucidation. Because the different D-NHEJ mutants show phenotypes distinct in their details, it is necessary to characterize the dependence of their DSB repair capacitymore » on growth state and to explore species-specific responses. Methods and Materials: DSB repair was measured in cells of different genetic background from various species using pulsed-field gel electrophoresis, or the formation of {gamma}-H2AX foci, at different stages of growth. Results: Using pulsed-field gel electrophoresis, we report a marked reduction of B-NHEJ during the plateau phase of growth in KU and XRCC4, mouse or Chinese hamster, mutants. Notably, this reduction is only marginal in DNA-PKcs-deficient cells. However, reduced B-NHEJ is also observed in repair proficient, plateau-phase cells after treatment with DNA-PK inhibitors. The reduction of B-NHEJ activity in the plateau phase of growth does not derive from the reduced expression of participating proteins, is detectable by {gamma}-H2AX foci analysis, and leads to enhanced cell killing. Conclusions: These results further document the marked dependence on growth state of an essential DSB repair pathway and show the general nature of the effect. Molecular characterization of the mechanism underlying this response will help to optimize the administration of DNA repair inhibitors as adjuvants in radiation therapy.« less

Temperature-Dependent Charge Transport through Individually Contacted DNA Origami-Based Au Nanowires.

PubMed

Teschome, Bezu; Facsko, Stefan; Schönherr, Tommy; Kerbusch, Jochen; Keller, Adrian; Erbe, Artur

2016-10-11

DNA origami nanostructures have been used extensively as scaffolds for numerous applications such as for organizing both organic and inorganic nanomaterials, studying single molecule reactions, and fabricating photonic devices. Yet, little has been done toward the integration of DNA origami nanostructures into nanoelectronic devices. Among other challenges, the technical difficulties in producing well-defined electrical contacts between macroscopic electrodes and individual DNA origami-based nanodevices represent a serious bottleneck that hinders the thorough characterization of such devices. Therefore, in this work, we have developed a method to electrically contact individual DNA origami-based metallic nanowires using electron beam lithography. We then characterize the charge transport of such nanowires in the temperature range from room temperature down to 4.2 K. The room temperature charge transport measurements exhibit ohmic behavior, whereas at lower temperatures, multiple charge transport mechanisms such as tunneling and thermally assisted transport start to dominate. Our results confirm that charge transport along metallized DNA origami nanostructures may deviate from pure metallic behavior due to several factors including partial metallization, seed inhomogeneities, impurities, and weak electronic coupling among AuNPs. Besides, this study further elucidates the importance of variable temperature measurements for determining the dominant charge transport mechanisms for conductive nanostructures made by self-assembly approaches.

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

PubMed

Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

2013-12-01

Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Polyfluorophore Labels on DNA: Dramatic Sequence Dependence of Quenching

PubMed Central

Teo, Yin Nah; Wilson, James N.

2010-01-01

We describe studies carried out in the DNA context to test how a common fluorescence quencher, dabcyl, interacts with oligodeoxynu-cleoside fluorophores (ODFs)—a system of stacked, electronically interacting fluorophores built on a DNA scaffold. We tested twenty different tetrameric ODF sequences containing varied combinations and orderings of pyrene (Y), benzopyrene (B), perylene (E), dimethylaminostilbene (D), and spacer (S) monomers conjugated to the 3′ end of a DNA oligomer. Hybridization of this probe sequence to a dabcyl-labeled complementary strand resulted in strong quenching of fluorescence in 85% of the twenty ODF sequences. The high efficiency of quenching was also established by their large Stern–Volmer constants (KSV) of between 2.1 × 104 and 4.3 × 105M−1, measured with a free dabcyl quencher. Interestingly, quenching of ODFs displayed strong sequence dependence. This was particularly evident in anagrams of ODF sequences; for example, the sequence BYDS had a KSV that was approximately two orders of magnitude greater than that of BSDY, which has the same dye composition. Other anagrams, for example EDSY and ESYD, also displayed different responses upon quenching by dabcyl. Analysis of spectra showed that apparent excimer and exciplex emission bands were quenched with much greater efficiency compared to monomer emission bands by at least an order of magnitude. This suggests an important role played by delocalized excited states of the π stack of fluorophores in the amplified quenching of fluorescence. PMID:19780115

Allele-Specific, Age-Dependent and BMI-Associated DNA Methylation of Human MCHR1

PubMed Central

Stepanow, Stefanie; Reichwald, Kathrin; Huse, Klaus; Gausmann, Ulrike; Nebel, Almut; Rosenstiel, Philip; Wabitsch, Martin; Fischer-Posovszky, Pamela; Platzer, Matthias

2011-01-01

Background Melanin-concentrating hormone receptor 1 (MCHR1) plays a significant role in regulation of energy balance, food intake, physical activity and body weight in humans and rodents. Several association studies for human obesity showed contrary results concerning the SNPs rs133072 (G/A) and rs133073 (T/C), which localize to the first exon of MCHR1. The variations constitute two main haplotypes (GT, AC). Both SNPs affect CpG dinucleotides, whereby each haplotype contains a potential methylation site at one of the two SNP positions. In addition, 15 CpGs in close vicinity of these SNPs constitute a weak CpG island. Here, we studied whether DNA methylation in this sequence context may contribute to population- and age-specific effects of MCHR1 alleles in obesity. Principal Findings We analyzed DNA methylation of a 315 bp region of MCHR1 encompassing rs133072 and rs133073 and the CpG island in blood samples of 49 individuals by bisulfite sequencing. The AC haplotype shows a significantly higher methylation level than the GT haplotype. This allele-specific methylation is age-dependent. In young individuals (20–30 years) the difference in DNA methylation between haplotypes is significant; whereas in individuals older than 60 years it is not detectable. Interestingly, the GT allele shows a decrease in methylation status with increasing BMI, whereas the methylation of the AC allele is not associated with this phenotype. Heterozygous lymphoblastoid cell lines show the same pattern of allele-specific DNA methylation. The cell line, which exhibits the highest difference in methylation levels between both haplotypes, also shows allele-specific transcription of MCHR1, which can be abolished by treatment with the DNA methylase inhibitor 5-aza-2′-deoxycytidine. Conclusions We show that DNA methylation at MCHR1 is allele-specific, age-dependent, BMI-associated and affects transcription. Conceivably, this epigenetic regulation contributes to the age- and/or population

Phonon focusing and temperature dependences of thermal conductivity of silicon nanofilms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuleyev, I. I., E-mail: kuleev@imp.uran.ru; Bakharev, S. M.; Kuleyev, I. G.

2015-04-15

The effect of phonon focusing on the anisotropy and temperature dependences of the thermal conductivities of silicon nanofilms is analyzed using the three-mode Callaway model. The orientations of the film planes and the directions of the heat flux for maximal or minimal heat removal from silicon chip elements at low temperatures, as well as at room temperature, are determined. It is shown that in the case of diffuse reflection of phonons from the boundaries, the plane with the (100) orientation exhibits the lowest scattering ability (and the highest thermal conductivity), while the plane with the (111) orientation is characterized bymore » the highest scattering ability (and the lowest thermal conductivity). The thermal conductivity of wide films is determined to a considerable extent by the orientation of the film plane, while for nanowires with a square cross section, the thermal conductivity is mainly determined by the direction of the heat flux. The effect of elastic energy anisotropy on the dependences of the thermal conductivity on the geometrical parameters of films is analyzed. The temperatures of transition from boundary scattering to bulk relaxation mechanisms are determined.« less

Defect of Fe-S cluster binding by DNA polymerase δ in yeast suppresses UV-induced mutagenesis, but enhances DNA polymerase ζ - dependent spontaneous mutagenesis.

PubMed

Stepchenkova, E I; Tarakhovskaya, E R; Siebler, H M; Pavlov, Y I

2017-01-01

Eukaryotic genomes are duplicated by a complex machinery, utilizing high fidelity replicative B-family DNA polymerases (pols) α, δ and ε. Specialized error-prone pol ζ, the fourth B-family member, is recruited when DNA synthesis by the accurate trio is impeded by replication stress or DNA damage. The damage tolerance mechanism dependent on pol ζ prevents DNA/genome instability and cell death at the expense of increased mutation rates. The pol switches occurring during this specialized replication are not fully understood. The loss of pol ζ results in the absence of induced mutagenesis and suppression of spontaneous mutagenesis. Disruption of the Fe-S cluster motif that abolish the interaction of the C-terminal domain (CTD) of the catalytic subunit of pol ζ with its accessory subunits, which are shared with pol δ, leads to a similar defect in induced mutagenesis. Intriguingly, the pol3-13 mutation that affects the Fe-S cluster in the CTD of the catalytic subunit of pol δ also leads to defective induced mutagenesis, suggesting the possibility that Fe-S clusters are essential for the pol switches during replication of damaged DNA. We confirmed that yeast strains with the pol3-13 mutation are UV-sensitive and defective in UV-induced mutagenesis. However, they have increased spontaneous mutation rates. We found that this increase is dependent on functional pol ζ. In the pol3-13 mutant strain with defective pol δ, there is a sharp increase in transversions and complex mutations, which require functional pol ζ, and an increase in the occurrence of large deletions, whose size is controlled by pol ζ. Therefore, the pol3-13 mutation abrogates pol ζ-dependent induced mutagenesis, but allows for pol ζ recruitment for the generation of spontaneous mutations and prevention of larger deletions. These results reveal differential control of the two major types of pol ζ-dependent mutagenesis by the Fe-S cluster present in replicative pol δ. Copyright © 2016

DNA activates human immune cells through a CpG sequence-dependent manner

PubMed Central

Bauer, M; Heeg, K; Wagner, H; Lipford, G B

1999-01-01

While bacterial DNA and cytosine–guanosine-dinucleotide-containing oligonucleotides (CpG ODN) are well described activators of murine immune cells, their effect on human cells is inconclusive. We investigated their properties on human peripheral blood mononuclear cells (PBMC) and subsets thereof, such as purified monocytes, T and B cells. Here we demonstrate that bacterial DNA and CpG ODN induce proliferation of B cells, while other subpopulations, such as monocytes and T cells, did not proliferate. PBMC mixed cell cultures, as well as purified monocytes, produced interleukin-6 (IL-6), IL-12 and tumour necrosis factor-α upon stimulation with bacterial DNA; however, only IL-6 and IL-12 secretion became induced upon CpG ODN stimulation. We conclude that monocytes, but not B or T cells, represent the prime source of cytokines. Monocytes up-regulated expression of antigen-presenting, major histocompatibility complex class I and class II molecules in response to CpG DNA. In addition, both monocytes and B cells up-regulate costimulatory CD86 and CD40 molecules. The activation by CpG ODN depended on sequence motifs containing the core dinucleotide CG since destruction of the motif strongly reduced immunostimulatory potential. PMID:10457226

Conducting polymer based DNA biosensor for the detection of the Bacillus cereus group species

NASA Astrophysics Data System (ADS)

Velusamy, Vijayalakshmi; Arshak, Khalil; Korostynska, Olga; Oliwa, Kamila; Adley, Catherine

2009-05-01

Biosensor designs are emerging at a significant rate and play an increasingly important role in foodborne pathogen detection. Conducting polymers are excellent tools for the fabrication of biosensors and polypyrrole has been used in the detection of biomolecules due to its unique properties. The prime intention of this paper was to pioneer the design and fabrication of a single-strand (ss) DNA biosensor for the detection of the Bacillus cereus (B.cereus) group species. Growth of B. cereus, results in production of several highly active toxins. Therefore, consumption of food containing >106 bacteria/gm may results in emetic and diarrhoeal syndromes. The most common source of this bacterium is found in liquid food products, milk powder, mixed food products and is of particular concern in the baby formula industry. The electrochemical deposition technique, such as cyclic voltammetry, was used to develop and test a model DNA-based biosensor on a gold electrode electropolymerized with polypyrrole. The electrically conducting polymer, polypyrrole is used as a platform for immobilizing DNA (1μg) on the gold electrode surface, since it can be more easily deposited from neutral pH aqueous solutions of pyrrolemonomers. The average current peak during the electrodeposition event is 288μA. There is a clear change in the current after hybridization of the complementary oligonucleotide (6.35μA) and for the noncomplementary oligonucleotide (5.77μA). The drop in current after each event was clearly noticeable and it proved to be effective.

Glioblastoma cells deficient in DNA-dependent protein kinase are resistant to cell death.

PubMed

Chen, George G; Sin, Fanny L F; Leung, Billy C S; Ng, Ho K; Poon, Wai S

2005-04-01

DNA-dependent protein kinase (DNA-PK), a nuclear serine/threonine kinase, is responsible for the DNA double-strand break repair. Cells lacking or with dysfunctional DNA-PK are often associated with mis-repair, chromosome aberrations, and complex exchanges, all of which are known to contribute to the development of human cancers including glioblastoma. Two human glioblastoma cell lines were used in the experiment, M059J cells lacking the catalytic subunit of DNA-PK, and their isogenic but DNA-PK proficient counterpart, M059K. We found that M059K cells were much more sensitive to staurosporine (STS) treatment than M059J cells, as demonstrated by MTT assay, TUNEL detection, and annexin-V and propidium iodide (PI) staining. A possible mechanism responsible for the different sensitivity in these two cell lines was explored by the examination of Bcl-2, Bax, Bak, and Fas. The cell death stimulus increased anti-apoptotic Bcl-2 and decreased pro-apoptotic Bcl-2 members (Bak and Bax) and Fas in glioblastoma cells deficient in DNA-PK. Activation of DNA-PK is known to promote cell death of human tumor cells via modulation of p53, which can down-regulate the anti-apoptotic Bcl-2 member proteins, induce pro-apoptotic Bcl-2 family members and promote a Bax-Bak interaction. Our experiment also demonstrated that the mode of glioblastoma cell death induced by STS consisted of both apoptosis and necrosis and the percentage of cell death in both modes was similar in glioblastoma cell lines either lacking DNA-PK or containing intact DNA-PK. Taken together, our findings suggest that DNA-PK has a positive role in the regulation of apoptosis in human glioblastomas. The aberrant expression of Bcl-2 family members and Fas was, at least in part, responsible for decreased sensitivity of DNA-PK deficient glioblastoma cells to cell death stimuli. 2004 Wiley-Liss, Inc.

AC electrical characterisation and insight to charge transfer mechanisms in DNA molecular wires through temperature and UV effects.

PubMed

Kassegne, Sam; Wibowo, Denni; Chi, James; Ramesh, Varsha; Narenji, Alaleh; Khosla, Ajit; Mokili, John

2015-06-01

In this study, AC characterisation of DNA molecular wires, effects of frequency, temperature and UV irradiation on their conductivity is presented. λ-DNA molecular wires suspended between high aspect-ratio electrodes exhibit highly frequency-dependent conductivity that approaches metal-like behaviour at high frequencies (∼MHz). Detailed temperature dependence experiments were performed that traced the impedance response of λ-DNA until its denaturation. UV irradiation experiments where conductivity was lost at higher and longer UV exposures helped to establish that it is indeed λ-DNA molecular wires that generate conductivity. The subsequent renaturation of λ-DNA resulted in the recovery of current conduction, providing yet another proof of the conducting DNA molecular wire bridge. The temperature results also revealed hysteretic and bi-modal impedance responses that could make DNA a candidate for nanoelectronics components like thermal transistors and switches. Further, these experiments shed light on the charge transfer mechanism in DNA. At higher temperatures, the expected increase in thermal-induced charge hopping may account for the decrease in impedance supporting the 'charge hopping mechanism' theory. UV light, on the other hand, causes damage to GC base-pairs and phosphate groups reducing the path available both for hopping and short-range tunneling mechanisms, and hence increasing impedance--this again supporting both the 'charge hopping' and 'tunneling' mechanism theories.

Temperature dependence of direct current conductivity in Ag-ED20 nanocomposite films

NASA Astrophysics Data System (ADS)

Novikov, G. F.; Rabenok, E. V.; Bogdanova, L. M.; Irzhak, V. I.

2017-10-01

The effect of silver nanoparticles (NPs) in the concentration range of ≤0.8 wt % have on direct current conductivity σdc of Ag-ED20 nanocomposite is studied by method of broadband dielectric spectroscopy (10-2-105 Hz) method of broadband dielectric spectroscopy. It is found that temperature dependence σdc consists of two sections: above the glass transition temperature ( T g), the dependence corresponds to the empirical Vogel-Fulcher-Tammann law (Vogel temperature T 0 does not depend on the NP concentration); below T g, the dependence is Arrhenius with activation energy E a ≈ 1.2 eV. In the region where T > T g, the σdc value grows along with NP concentration. It is concluded that the observed broken form of the temperature dependence is apparently due to a change in the conduction mechanism after the freezing of ion mobility at temperatures below T g.

Mapping DNA damage-dependent genetic interactions in yeast via party mating and barcode fusion genetics.

PubMed

Díaz-Mejía, J Javier; Celaj, Albi; Mellor, Joseph C; Coté, Atina; Balint, Attila; Ho, Brandon; Bansal, Pritpal; Shaeri, Fatemeh; Gebbia, Marinella; Weile, Jochen; Verby, Marta; Karkhanina, Anna; Zhang, YiFan; Wong, Cassandra; Rich, Justin; Prendergast, D'Arcy; Gupta, Gaurav; Öztürk, Sedide; Durocher, Daniel; Brown, Grant W; Roth, Frederick P

2018-05-28

Condition-dependent genetic interactions can reveal functional relationships between genes that are not evident under standard culture conditions. State-of-the-art yeast genetic interaction mapping, which relies on robotic manipulation of arrays of double-mutant strains, does not scale readily to multi-condition studies. Here, we describe barcode fusion genetics to map genetic interactions (BFG-GI), by which double-mutant strains generated via en masse "party" mating can also be monitored en masse for growth to detect genetic interactions. By using site-specific recombination to fuse two DNA barcodes, each representing a specific gene deletion, BFG-GI enables multiplexed quantitative tracking of double mutants via next-generation sequencing. We applied BFG-GI to a matrix of DNA repair genes under nine different conditions, including methyl methanesulfonate (MMS), 4-nitroquinoline 1-oxide (4NQO), bleomycin, zeocin, and three other DNA-damaging environments. BFG-GI recapitulated known genetic interactions and yielded new condition-dependent genetic interactions. We validated and further explored a subnetwork of condition-dependent genetic interactions involving MAG1 , SLX4, and genes encoding the Shu complex, and inferred that loss of the Shu complex leads to an increase in the activation of the checkpoint protein kinase Rad53. © 2018 The Authors. Published under the terms of the CC BY 4.0 license.

Biomaterial-based Memory Device Development by Conducting Metallic DNA

DTIC Science & Technology

2013-05-28

time. Therefore, we have created a multiple-states memory system . This is the first multi-states resistance memory device by using bio-nanowire of the...world. Based on this achievement, logic device and application will be developed in the near future, too. Moreover, by using Ni-DNA detection system ...ions in DNA can change the resistance of Ni-DNA by applying different polar bias and time. Therefore, we have created a multiple-states memory system

[DNA-dependent DNA polymerase induced by herpes virus papio (HVP) in producing cells].

PubMed

D'iachenko, A G; Beriia, L Ia; Matsenko, L D; Kakubava, V V; Kokosh, L V

1980-11-01

A new DNA polymerase was found in the cells of suspension lymphoblastoid cultures, which produce lymphotropic baboon herpes virus (HVP). The enzyme was isolated in a partially purified form. In some properties the enzyme differs from other cellular DNA polymerases. The HVP-induced DNA polymerase has the molecular weight of 1,6 x 10(5) and sedimentation coefficient of about 8S. The enzyme is resistant to high salt concentrations and N-ethylmaleimide, but shows a pronounced sensitivity to phosphonoacetate. The enzyme effectively copies "activated" DNA and synthetic deoxyribohomopolymers. The attempts to detect the DNA polymerase activity in HVP virions were unsuccessful.

On the channel width-dependence of the thermal conductivity in ultra-narrow graphene nanoribbons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karamitaheri, Hossein; Neophytou, Neophytos, E-mail: N.Neophytou@warwick.ac.uk

The thermal conductivity of low-dimensional materials and graphene nanoribbons, in particular, is limited by the strength of line-edge-roughness scattering. One way to characterize the roughness strength is the dependency of the thermal conductivity on the channel's width in the form W{sup β}. Although in the case of electronic transport, this dependency is very well studied, resulting in W{sup 6} for nanowires and quantum wells and W{sup 4} for nanoribbons, in the case of phonon transport it is not yet clear what this dependence is. In this work, using lattice dynamics and Non-Equilibrium Green's Function simulations, we examine the width dependencemore » of the thermal conductivity of ultra-narrow graphene nanoribbons under the influence of line edge-roughness. We show that the exponent β is in fact not a single well-defined number, but it is different for different parts of the phonon spectrum depending on whether phonon transport is ballistic, diffusive, or localized. The exponent β takes values β < 1 for semi-ballistic phonon transport, values β ≫ 1 for sub-diffusive or localized phonons, and β = 1 only in the case where the transport is diffusive. The overall W{sup β} dependence of the thermal conductivity is determined by the width-dependence of the dominant phonon modes (usually the acoustic ones). We show that due to the long phonon mean-free-paths, the width-dependence of thermal conductivity becomes a channel length dependent property, because the channel length determines whether transport is ballistic, diffusive, or localized.« less

Trisomy 21 Alters DNA Methylation in Parent-of-Origin-Dependent and -Independent Manners

PubMed Central

Alves da Silva, Antônio Francisco; Machado, Filipe Brum; Pavarino, Érika Cristina; Biselli-Périco, Joice Matos; Zampieri, Bruna Lancia; da Silva Francisco Junior, Ronaldo; Mozer Rodrigues, Pedro Thyago; Terra Machado, Douglas; Santos-Rebouças, Cíntia Barros; Gomes Fernandes, Maria; Chuva de Sousa Lopes, Susana Marina; Lopes Rios, Álvaro Fabricio

2016-01-01

The supernumerary chromosome 21 in Down syndrome differentially affects the methylation statuses at CpG dinucleotide sites and creates genome-wide transcriptional dysregulation of parental alleles, ultimately causing diverse pathologies. At present, it is unknown whether those effects are dependent or independent of the parental origin of the nondisjoined chromosome 21. Linkage analysis is a standard method for the determination of the parental origin of this aneuploidy, although it is inadequate in cases with deficiency of samples from the progenitors. Here, we assessed the reliability of the epigenetic 5mCpG imprints resulting in the maternally (oocyte)-derived allele methylation at a differentially methylated region (DMR) of the candidate imprinted WRB gene for asserting the parental origin of chromosome 21. We developed a methylation-sensitive restriction enzyme-specific PCR assay, based on the WRB DMR, across single nucleotide polymorphisms (SNPs) to examine the methylation statuses in the parental alleles. In genomic DNA from blood cells of either disomic or trisomic subjects, the maternal alleles were consistently methylated, while the paternal alleles were unmethylated. However, the supernumerary chromosome 21 did alter the methylation patterns at the RUNX1 (chromosome 21) and TMEM131 (chromosome 2) CpG sites in a parent-of-origin-independent manner. To evaluate the 5mCpG imprints, we conducted a computational comparative epigenomic analysis of transcriptome RNA sequencing (RNA-Seq) and histone modification expression patterns. We found allele fractions consistent with the transcriptional biallelic expression of WRB and ten neighboring genes, despite the similarities in the confluence of both a 17-histone modification activation backbone module and a 5-histone modification repressive module between the WRB DMR and the DMRs of six imprinted genes. We concluded that the maternally inherited 5mCpG imprints at the WRB DMR are uncoupled from the parental allele

Theory of electron transfer and molecular state in DNA

NASA Astrophysics Data System (ADS)

Endres, Robert Gunter

2002-09-01

In this thesis, a mechanism for long-range electron transfer in DNA and a systematic search for high conductance DNA are developed. DNA is well known for containing the genetic code of all living species. On the other hand, there are some experimental indications that DNA can mediate effectively long-range electron transfer leading to the concept of chemistry at a distance. This can be important for DNA damage and healing. In the first part of the thesis, a possible mechanism for long-range electron transfer is introduced. The weak distance dependent electron transfer was experimentally observed using transition metal intercalators for donor and acceptor. In our model calculations, the transfer is mediated by the molecular analogue of a Kondo bound state well known from solid state physics of mixed-valence rare-earth compounds. We believe this is quite realistic, since localized d orbitals of the transition metal ions could function as an Anderson impurity embedded in a reservoir of rather delocalized molecular orbitals of the intercalator ligands and DNA pi orbitals. The effective Anderson model is solved with a physically intuitive variational ansatz as well as with the essentially exact DMRG method. The electronic transition matrix element, which is important because it contains the donor-acceptor distance dependence, is obtained with the Mulliken-Hush algorithm as well as from Born-Oppenheimer potential energy surfaces. Our possible explanation of long-range electron transfer is put in context to other more conventional mechanisms which also could lead to similar behavior. Another important issue of DNA is its possible use for nano-technology. Although DNA's mechanical properties are excellent, the question whether it can be conducting and be used for nano-wires is highly controversial. Experimentally, DNA shows conducting, semi-conducting and insulating properties. Motivated by these wide ranging experimental results on the conductivity of DNA, we have

Ancestry Dependent DNA Methylation and Influence of Maternal Nutrition

PubMed Central

Mozhui, Khyobeni; Smith, Alicia K.; Tylavsky, Frances A.

2015-01-01

There is extensive variation in DNA methylation between individuals and ethnic groups. These differences arise from a combination of genetic and non-genetic influences and potential modifiers include nutritional cues, early life experience, and social and physical environments. Here we compare genome-wide DNA methylation in neonatal cord blood from African American (AA; N = 112) and European American (EA; N = 91) participants of the CANDLE Study (Conditions Affecting Neurocognitive Development and Learning in Early Childhood). Our goal is to determine if there are replicable ancestry-specific methylation patterns that may implicate risk factors for diseases that have differential prevalence between populations. To identify the most robust ancestry-specific CpG sites, we replicate our results in lymphoblastoid cell lines from Yoruba African and CEPH European panels of HapMap. We also evaluate the influence of maternal nutrition—specifically, plasma levels of vitamin D and folate during pregnancy—on methylation in newborns. We define stable ancestry-dependent methylation of genes that include tumor suppressors and cell cycle regulators (e.g., APC, BRCA1, MCC). Overall, there is lower global methylation in African ancestral groups. Plasma levels of 25-hydroxy vitamin D are also considerably lower among AA mothers and about 60% of AA and 40% of EA mothers have concentrations below 20 ng/ml. Using a weighted correlation analysis, we define a network of CpG sites that is jointly modulated by ancestry and maternal vitamin D. Our results show that differences in DNA methylation patterns are remarkably stable and maternal micronutrients can exert an influence on the child epigenome. PMID:25742137

The Fanconi anemia pathway promotes replication-dependent DNA interstrand crosslink repair

PubMed Central

Knipscheer, Puck; Räschle, Markus; Smogorzewska, Agata; Enoiu, Milica; Ho, The Vinh; Schärer, Orlando D.; Elledge, Stephen J.; Walter, Johannes C.

2010-01-01

Fanconi anemia is a human cancer predisposition syndrome caused by mutations in thirteen Fanc genes. The disorder is characterized by genomic instability and cellular hypersensitivity to chemicals that generate DNA interstrand crosslinks (ICLs). A central event in the activation of the Fanconi anemia pathway is the mono-ubiquitylation of the FANCI-FANCD2 complex, but how this complex confers ICL resistance remains enigmatic. We make use of a cell-free system to show that the FANCI-FANCD2 complex is required for replication-dependent ICL repair. Removal of FANCD2 from extracts inhibits nucleolytic incisions near the ICL as well as translesion DNA synthesis past the lesion. Reversal of these defects requires ubiquitylated FANCI-FANCD2. Our results show that multiple steps of the essential S phase ICL repair mechanism fail when the Fanconi anemia pathway is compromised. PMID:19965384

The association of DNA-dependent protein kinase activity of peripheral blood lymphocytes with prognosis of cancer

PubMed Central

Someya, M; Sakata, K-i; Matsumoto, Y; Kamdar, R P; Kai, M; Toyota, M; Hareyama, M

2011-01-01

Background: Repair of various types of DNA damages is critical for genomic stability. DNA-dependent protein kinase (DNA-PK) has an important role in DNA double-strand break repair. We examined whether there may be a correlation between DNA-PK activity in peripheral blood lymphocytes (PBLs) and survival percentages in various cancer patients. We also investigated the changes of DNA-PK activity in PBLs after radiotherapy. Methods: A total of 167 of untreated cancer patients participated in this study. Peripheral blood was collected, separated, and centrifuged. DNA-PK activity was measured by DNA-pull-down assay. Chromosomal aberrations were examined by cytogenetic methods. Results: DNA-PK activity of PBLs in advanced cancer patients was significantly lower than that in early stage. The patients with lower DNA-PK activity in PBLs tended to have the lower disease-specific survivals and distant metastasis-free survivals than those with higher DNA-PK activity in advanced stages. There was also a tendency of inverse correlation between DNA-PK activity and excess fragments. The DNA-PK activity of PBLs in most patients decreased in response to radiation as the equivalent whole-body dose increased. Conclusion: Cancer patients in advanced stage, with lower DNA-PK activity of PBLs might have higher distant metastasis and exhibit poorer prognosis. Therefore, DNA-PK activity in PBLs could be used as a marker to predict the chromosomal instability and poorer prognosis. PMID:21559021

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA

NASA Astrophysics Data System (ADS)

Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.

2005-09-01

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

Brownian dynamics simulations of sequence-dependent duplex denaturation in dynamically superhelical DNA.

PubMed

Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J

2005-09-22

The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.

DNA nanosensor surface grafting and salt dependence

NASA Astrophysics Data System (ADS)

Carvalho, B. G.; Fagundes, J.; Martin, A. A.; Raniero, L.; Favero, P. P.

2013-02-01

In this paper we investigated the Paracoccidoides brasiliensis fungus nanosensor by simulations of simple strand DNA grafting on gold nanoparticle. In order to improve the knowledge of nanoparticle environment, the addiction of salt solution was studied at the models proposed by us. Nanoparticle and DNA are represented by economic models validated by us in this paper. In addition, the DNA grafting and salt influences are evaluated by adsorption and bond energies calculations. This theoretical evaluation gives support to experimental diagnostics techniques of diseases.

Electronic Activation of a DNA Nanodevice Using a Multilayer Nanofilm.

PubMed

Jeong, Hyejoong; Ranallo, Simona; Rossetti, Marianna; Heo, Jiwoong; Shin, Jooseok; Park, Kwangyong; Ricci, Francesco; Hong, Jinkee

2016-10-01

A method to control activation of a DNA nanodevice by supplying a complementary DNA (cDNA) strand from an electro-responsive nanoplatform is reported. To develop functional nanoplatform, hexalayer nanofilm is precisely designed by layer-by-layer assembly technique based on electrostatic interaction with four kinds of materials: Hydrolyzed poly(β-amino ester) can help cDNA release from the film. A cDNA is used as a key building block to activate DNA nanodevice. Reduced graphene oxides (rGOs) and the conductive polymer provide conductivity. In particular, rGOs efficiently incorporate a cDNA in the film via several interactions and act as a barrier. Depending on the types of applied electronic stimuli (reductive and oxidative potentials), a cDNA released from the electrode can quantitatively control the activation of DNA nanodevice. From this report, a new system is successfully demonstrated to precisely control DNA release on demand. By applying more advanced form of DNA-based nanodevices into multilayer system, the electro-responsive nanoplatform will expand the availability of DNA nanotechnology allowing its improved application in areas such as diagnosis, biosensing, bioimaging, and drug delivery. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Inhibition of autophagy enhances DNA damage-induced apoptosis by disrupting CHK1-dependent S phase arrest

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liou, Jong-Shian; Wu, Yi-Chen; Yen, Wen-Yen

2014-08-01

DNA damage has been shown to induce autophagy, but the role of autophagy in the DNA damage response and cell fate is not fully understood. BO-1012, a bifunctional alkylating derivative of 3a-aza-cyclopenta[a]indene, is a potent DNA interstrand cross-linking agent with anticancer activity. In this study, BO-1012 was found to reduce DNA synthesis, inhibit S phase progression, and induce phosphorylation of histone H2AX on serine 139 (γH2AX) exclusively in S phase cells. Both CHK1 and CHK2 were phosphorylated in response to BO-1012 treatment, but only depletion of CHK1, but not CHK2, impaired BO-1012-induced S phase arrest and facilitated the entry ofmore » γH2AX-positive cells into G2 phase. CHK1 depletion also significantly enhanced BO-1012-induced cell death and apoptosis. These results indicate that BO-1012-induced S phase arrest is a CHK1-dependent pro-survival response. BO-1012 also resulted in marked induction of acidic vesicular organelle (AVO) formation and microtubule-associated protein 1 light chain 3 (LC3) processing and redistribution, features characteristic of autophagy. Depletion of ATG7 or co-treatment of cells with BO-1012 and either 3-methyladenine or bafilomycin A1, two inhibitors of autophagy, not only reduced CHK1 phosphorylation and disrupted S phase arrest, but also increased cleavage of caspase-9 and PARP, and cell death. These results suggest that cells initiate S phase arrest and autophagy as pro-survival responses to BO-1012-induced DNA damage, and that suppression of autophagy enhances BO-1012-induced apoptosis via disruption of CHK1-dependent S phase arrest. - Highlights: • Autophagy inhibitors enhanced the cytotoxicity of a DNA alkylating agent, BO-1012. • BO-1012-induced S phase arrest was a CHK1-dependent pro-survival response. • Autophagy inhibition enhanced BO-1012 cytotoxicity via disrupting the S phase arrest.« less

XPD-dependent activation of apoptosis in response to triplex-induced DNA damage

PubMed Central

Kaushik Tiwari, Meetu; Rogers, Faye A.

2013-01-01

DNA sequences capable of forming triplexes are prevalent in the human genome and have been found to be intrinsically mutagenic. Consequently, a balance between DNA repair and apoptosis is critical to counteract their effect on genomic integrity. Using triplex-forming oligonucleotides to synthetically create altered helical distortions, we have determined that pro-apoptotic pathways are activated by the formation of triplex structures. Moreover, the TFIIH factor, XPD, occupies a central role in triggering apoptosis in response to triplex-induced DNA strand breaks. Here, we show that triplexes are capable of inducing XPD-independent double strand breaks, which result in the formation of γH2AX foci. XPD was subsequently recruited to the triplex-induced double strand breaks and co-localized with γH2AX at the damage site. Furthermore, phosphorylation of H2AX tyrosine 142 was found to stimulate the signaling pathway of XPD-dependent apoptosis. We suggest that this mechanism may play an active role in minimizing genomic instability induced by naturally occurring noncanonical structures, perhaps protecting against cancer initiation. PMID:23913414

Temperature dependence of electrical conduction in PEMA-EMITFSI film

NASA Astrophysics Data System (ADS)

Zain, N. F.; Megat Hasnan, M. M. I.; Sabri, M. F. M.; Said, S. M.; Mohamed, N. S.; Salleh, F.

2018-04-01

Transparent and flexible film of poly (ethyl methacrylate) incorporated with 1-ethyl-3-methyl imidazolium bis(trifluorosulfonyl) imide ionic liquid (PEMA-EMITFSI) with thickness between 100 and 200 µm was fabricated by using solution casting technique. From the ionic transport measurement, it is confirmed that the electrical conduction in PEMA-EMITFSI film is mainly contributed by ionic transport. Moreover, the temperature-dependence of electrical conductivity measurement for 7 days reveals that the electrical properties of PEMA-EMITFSI film could be able to withstand a number of thermal cycles and be lasting for a period of time for potentially used as thermoelectric material through thermal heating.

Alcohol dependence and domestic violence as sequelae of abuse and conduct disorder in childhood.

PubMed

Kunitz, S J; Levy, J E; McCloskey, J; Gabriel, K R

1998-11-01

To examine in the Navajo population: (1) the importance of childhood abuse as a risk factor for conduct disorder; (2) the importance of each form of abuse and conduct disorder as risk factors for alcohol dependence; and (3) the relative importance of each form of abuse, conduct disorder, and alcohol dependence as risk factors for being a perpetrator and/or victim of domestic violence. The study is based on a case-control design. Cases (204 men and 148 women) between the ages of 21 and 65 were interviewed in alcohol treatment program and matched to community controls. There were two groups of controls: alcohol dependent (374 men, 60 women) and nonalcohol dependent (157 men, 143 women). When adjusted for stratification by age, community of residence, and sex, the combined control groups comprise a representative sample of the Navajo male and female population 21-65 years of age. The prevalence of physical and sexual abuse before age 15 is within limits observed in other populations. Each form of abuse is a risk factor for conduct disorder. Along with conduct disorder, physical abuse is a risk factor for alcohol dependence. Physical abuse and alcohol dependence are independent risk factors for being involved in domestic violence as both perpetrator and victim. There appears to have been no secular trend in the incidence of childhood abuse over the past several generations, but there is suggestive evidence that domestic violence has become more common. Physical abuse is a significant risk factor for alcohol dependence as well as for domestic violence independent of the effects of alcohol abuse. The effects of sexual abuse with regard to both domestic violence and alcohol dependence do not appear to be significant.

Quinolinone and pyridopyrimidinone inhibitors of DNA-dependent protein kinase.

PubMed

Barbeau, Olivier R; Cano-Soumillac, Celine; Griffin, Roger J; Hardcastle, Ian R; Smith, Graeme C M; Richardson, Caroline; Clegg, William; Harrington, Ross W; Golding, Bernard T

2007-08-21

8-Substituted 2-morpholin-4-yl-quinolin-4-ones and 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones with selected aryl and heteroaryl groups as the substituent have been synthesised as potential inhibitors of DNA-dependent protein kinase. A multiple-parallel approach, employing Suzuki cross-coupling methodology, was utilised in the preparation of 8-substituted 2-morpholin-4-yl-quinolin-4-ones. For this purpose 8-bromo-2-morpholin-4-yl-quinolin-4-one was required as an intermediate. This compound was obtained by adapting a literature route in which thermal cyclocondensation of (2-bromoanilino)-morpholin-4-yl-5-methylene-2,2-dimethyl[1,3]dioxane-4,6-dione afforded 8-bromo-2-morpholin-4-yl-quinolin-4-one. A multiple-parallel approach, employing Suzuki cross-coupling methodology, was also utilised to prepare 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones using 9-hydroxy-2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-one O-trifluoromethanesulfonate as an intermediate. 8-Substituted 2-morpholin-4-yl-quinolin-4-ones and 9-substituted 2-morpholin-4-yl-pyrido[1,2-a]pyrimidin-4-ones were both inhibitors of DNA-dependent protein kinase. When the substituent was dibenzothiophen-4-yl, dibenzofuran-4-yl or biphen-3-yl, IC50 values in the low nanomolar range were observed. Interestingly, the pyridopyrimidinones and quinolinones were essentially equipotent with the corresponding 8-substituted 2-morpholin-4-yl-chromen-4-ones previously reported (I. R. Hardcastle, X. Cockcroft, N. J. Curtin, M. Desage El-Murr, J. J. J. Leahy, M. Stockley, B. T. Golding, L. Rigoreau, C. Richardson, G. C. M. Smith and R. J. Griffin, J. Med. Chem., 2005, 48, 7829-7846).

Distinct kinetics of DNA repair protein accumulation at DNA lesions and cell cycle-dependent formation of γH2AX- and NBS1-positive repair foci.

PubMed

Suchánková, Jana; Kozubek, Stanislav; Legartová, Soňa; Sehnalová, Petra; Küntziger, Thomas; Bártová, Eva

2015-12-01

The DNA damage response is a fundamental, well-regulated process that occurs in the genome to recognise DNA lesions. Here, we studied kinetics of proteins involved in DNA repair pathways and their recruitment to DNA lesions during the cell cycle. In non-irradiated and irradiated cells, we analysed the distribution pattern and spatiotemporal dynamics of γH2AX, 53BP1, BMI1, MDC1, NBS1, PCNA, coilin and BRCA1 proteins. We observed that spontaneous and irradiation-induced foci (IRIF) demonstrated a high abundance of phosphorylated H2AX, which was consistent with 53BP1 and BMI1 protein accumulation. However, NBS1 and MDC1 proteins were recruited to nuclear bodies (NBs) to a lesser extent. Irradiation by γ-rays significantly increased the number of 53BP1- and γH2AX-positive IRIF, but cell cycle-dependent differences were only observed for γH2AX-positive foci in both non-irradiated and γ-irradiated cells. In non-irradiated cells, the G2 phase was characterised by an increased number of spontaneous γH2AX-foci; this increase was more pronounced after γ-irradiation. Cells in G2 phase had the highest number of γH2AX-positive foci. Similarly, γ-irradiation increased the number of NBS1-positive NBs only in G2 phase. Moreover, NBS1 accumulated in nucleoli after γ-irradiation showed the slowest recovery after photobleaching. Analysis of protein accumulation kinetics at locally induced DNA lesions showed that in HeLa cells, BMI1, PCNA and coilin were rapidly recruited to the lesions, 10-15 s after UVA-irradiation, whereas among the other proteins studied, BRCA1 demonstrated the slowest recruitment: BRCA1 appeared at the lesion 20 min after local micro-irradiation by UVA laser. We show that the kinetics of the accumulation of selected DNA repair-related proteins is protein specific at locally induced DNA lesions, and that the formation of γH2AX- and NBS1-positive foci, but not 53BP1-positive NBs, is cell cycle dependent in HeLa cells. Moreover, γH2AX is the most

Dependence of the optical conductivity on the uniaxial and biaxial strains in black phosphorene

NASA Astrophysics Data System (ADS)

Yang, C. H.; Zhang, J. Y.; Wang, G. X.; Zhang, C.

2018-06-01

By using the Kubo formula, the optical conductivity of strained black phosphorene was studied. The anisotropic band dispersion gives rise to an orientation dependent optical conductivity. The energy gap can be tuned by the uniaxial and biaxial strains which can be observed from the interband optical conductivity polarized along the armchair (x ) direction. The preferential conducting direction is along the x direction. The dependence of the intraband optical conductivity along the zigzag (y ) direction on the Fermi energy and strain exhibits increasing or decreasing monotonously. However, along the x direction this dependence is complicated which originates from the carriers' inverse-direction movements obtained by two types of the nearest phosphorus atom interactions. The modification of the biaxial strain on the energy structure and optical-absorption property is more effective. The imaginary part of the total optical conductivity (Im σ ) can be negative around the threshold of the interband optical transition by modifying the chemical potential. Away from this frequency region, Im σ exhibits positive value. It can be used in the application of the surface plasmon propagations in multilayer dielectric structures.

Spin-dependent electrical conduction in a pentacene Schottky diode explored by electrically detected magnetic resonance

NASA Astrophysics Data System (ADS)

Fukuda, Kunito; Asakawa, Naoki

2017-02-01

Reported is the observation of dark spin-dependent electrical conduction in a Schottky barrier diode with pentacene (PSBD) using electrically detected magnetic resonance at room temperature. It is suggested that spin-dependent conduction exists in pentacene thin films, which is explored by examining the anisotropic linewidth of the EDMR signal and current density-voltage (J-V) measurements. The EDMR spectrum can be decomposed to Gaussian and Lorentzian components. The dependency of the two signals on the applied voltage was consistent with the current density-voltage (J-V) of the PSBD rather than that of the electron-only device of Al/pentacene/Al, indicating that the spin-dependent conduction is due to bipolaron formation associated with hole polaronic hopping processes. The applied-voltage dependence of the ratio of intensity of the Gaussian line to the Lorentzian may infer that increasing current density should make conducting paths more dispersive, thereby resulting in an increased fraction of the Gaussian line due to the higher dispersive g-factor.

A Conserved, Mg2+-Dependent Exonuclease Degrades Organelle DNA during Arabidopsis Pollen Development[C][W

PubMed Central

Matsushima, Ryo; Tang, Lay Yin; Zhang, Lingang; Yamada, Hiroshi; Twell, David; Sakamoto, Wataru

2011-01-01

In plant cells, mitochondria and plastids contain their own genomes derived from the ancestral bacteria endosymbiont. Despite their limited genetic capacity, these multicopy organelle genomes account for a substantial fraction of total cellular DNA, raising the question of whether organelle DNA quantity is controlled spatially or temporally. In this study, we genetically dissected the organelle DNA decrease in pollen, a phenomenon that appears to be common in most angiosperm species. By staining mature pollen grains with fluorescent DNA dye, we screened Arabidopsis thaliana for mutants in which extrachromosomal DNAs had accumulated. Such a recessive mutant, termed defective in pollen organelle DNA degradation1 (dpd1), showing elevated levels of DNAs in both plastids and mitochondria, was isolated and characterized. DPD1 encodes a protein belonging to the exonuclease family, whose homologs appear to be found in angiosperms. Indeed, DPD1 has Mg2+-dependent exonuclease activity when expressed as a fusion protein and when assayed in vitro and is highly active in developing pollen. Consistent with the dpd phenotype, DPD1 is dual-targeted to plastids and mitochondria. Therefore, we provide evidence of active organelle DNA degradation in the angiosperm male gametophyte, primarily independent of maternal inheritance; the biological function of organellar DNA degradation in pollen is currently unclear. PMID:21521697

Separase is recruited to mitotic chromosomes to dissolve sister chromatid cohesion in a DNA-dependent manner.

PubMed

Sun, Yuxiao; Kucej, Martin; Fan, Heng-Yu; Yu, Hong; Sun, Qing-Yuan; Zou, Hui

2009-04-03

Sister chromatid separation is triggered by the separase-catalyzed cleavage of cohesin. This process is temporally controlled by cell-cycle-dependent factors, but its biochemical mechanism and spatial regulation remain poorly understood. We report that cohesin cleavage by human separase requires DNA in a sequence-nonspecific manner. Separase binds to DNA in vitro, but its proteolytic activity, measured by its autocleavage, is not stimulated by DNA. Instead, biochemical characterizations suggest that DNA mediates cohesin cleavage by bridging the interaction between separase and cohesin. In human cells, a fraction of separase localizes to the mitotic chromosome. The importance of the chromosomal DNA in cohesin cleavage is further demonstrated by the observation that the cleavage of the chromosome-associated cohesins is sensitive to nuclease treatment. Our observations explain why chromosome-associated cohesins are specifically cleaved by separase and the soluble cohesins are left intact in anaphase.

Ligand-activated PPARα-dependent DNA demethylation regulates the fatty acid β-oxidation genes in the postnatal liver.

PubMed

Ehara, Tatsuya; Kamei, Yasutomi; Yuan, Xunmei; Takahashi, Mayumi; Kanai, Sayaka; Tamura, Erina; Tsujimoto, Kazutaka; Tamiya, Takashi; Nakagawa, Yoshimi; Shimano, Hitoshi; Takai-Igarashi, Takako; Hatada, Izuho; Suganami, Takayoshi; Hashimoto, Koshi; Ogawa, Yoshihiro

2015-03-01

The metabolic function of the liver changes sequentially during early life in mammals to adapt to the marked changes in nutritional environment. Accordingly, hepatic fatty acid β-oxidation is activated after birth to produce energy from breast milk lipids. However, how it is induced during the neonatal period is poorly understood. Here we show DNA demethylation and increased mRNA expression of the fatty acid β-oxidation genes in the postnatal mouse liver. The DNA demethylation does not occur in the fetal mouse liver under the physiologic condition, suggesting that it is specific to the neonatal period. Analysis of mice deficient in the nuclear receptor peroxisome proliferator-activated receptor α (PPARα) and maternal administration of a PPARα ligand during the gestation and lactation periods reveal that the DNA demethylation is PPARα dependent. We also find that DNA methylation of the fatty acid β-oxidation genes are reduced in the adult human liver relative to the fetal liver. This study represents the first demonstration that the ligand-activated PPARα-dependent DNA demethylation regulates the hepatic fatty acid β-oxidation genes during the neonatal period, thereby highlighting the role of a lipid-sensing nuclear receptor in the gene- and life-stage-specific DNA demethylation of a particular metabolic pathway. © 2015 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

NASA Astrophysics Data System (ADS)

Lee, Sunhee; Hedin, Eric; Joe, Yong

2010-03-01

The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

Quercetin-Iron Complex: Synthesis, Characterization, Antioxidant, DNA Binding, DNA Cleavage, and Antibacterial Activity Studies.

PubMed

Raza, Aun; Xu, Xiuquan; Xia, Li; Xia, Changkun; Tang, Jian; Ouyang, Zhen

2016-11-01

Quercetin-iron (II) complex was synthesized and characterized by elemental analysis, ultraviolet-visible spectrophotometry, fourier transform infrared spectroscopy, mass spectrometry, proton nuclear magnetic resonance spectroscopy, thermogravimetry and differential scanning calorimetry, scanning electron micrography and molar conductivity. The low molar conductivity value investigates the non-electrolyte nature of the complex. The elemental analysis and other physical and spectroscopic methods reveal the 1:2 stoichiometric ratio (metal:ligand) of the complex. Antioxidant study of the quercetin and its metal complex against 2, 2-di-phenyl-1-picryl hydrazyl radical showed that the complex has much more radical scavenging activity than free quercetin. The interaction of quercetin-iron (II) complex with DNA was determined using ultraviolet visible spectra, fluorescence spectra and agarose gel electrophoresis. The results showed that quercetin-iron (II) complex can intercalate moderately with DNA, quench a strong intercalator ethidium bromide and compete for the intercalative binding sites. The complex showed significant cleavage of pBR 322 DNA from supercoiled form to nicked circular form and these cleavage effects were dose-dependent. Moreover, the mechanism of DNA cleavage indicated that it was an oxidative cleavage pathway. These results revealed the potential nuclease activity of complex to cleave DNA. In addition, antibacterial activity of complex on E.coli and S. aureus was also investigated. The results showed that complex has higher antibacterial activity than ligand.

Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

DOE Office of Scientific and Technical Information (OSTI.GOV)

X Qiu; D Rau; V Parsegian

2011-12-31

Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In themore » commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.« less

CHD3 and CHD4 recruitment and chromatin remodeling activity at DNA breaks is promoted by early poly(ADP-ribose)-dependent chromatin relaxation.

PubMed

Smith, Rebecca; Sellou, Hafida; Chapuis, Catherine; Huet, Sébastien; Timinszky, Gyula

2018-05-04

One of the first events to occur upon DNA damage is the local opening of the compact chromatin architecture, facilitating access of repair proteins to DNA lesions. This early relaxation is triggered by poly(ADP-ribosyl)ation by PARP1 in addition to ATP-dependent chromatin remodeling. CHD4 recruits to DNA breaks in a PAR-dependent manner, although it lacks any recognizable PAR-binding domain, and has the ability to relax chromatin structure. However, its role in chromatin relaxation at the site of DNA damage has not been explored. Using a live cell fluorescence three-hybrid assay, we demonstrate that the recruitment of CHD4 to DNA damage, while being poly(ADP-ribosyl)ation-dependent, is not through binding poly(ADP-ribose). Additionally, we show that CHD3 is recruited to DNA breaks in the same manner as CHD4 and that both CHD3 and CHD4 play active roles in chromatin remodeling at DNA breaks. Together, our findings reveal a two-step mechanism for DNA damage induced chromatin relaxation in which PARP1 and the PAR-binding remodeler activities of Alc1/CHD1L induce an initial chromatin relaxation phase that promotes the subsequent recruitment of CHD3 and CHD4 via binding to DNA for further chromatin remodeling at DNA breaks.

Angular-dependent EDMR linewidth for spin-dependent space charge limited conduction in a polycrystalline pentacene

NASA Astrophysics Data System (ADS)

Fukuda, Kunito; Asakawa, Naoki

2017-08-01

Spin-dependent space charge limited carrier conduction in a Schottky barrier diode using polycrystalline p-type π-conjugated molecular pentacene is explored using multiple-frequency electrically detected magnetic resonance (EDMR) spectroscopy with a variable-angle configuration. The measured EDMR spectra are decomposed into two components derived respectively from mobile and trapped positive polarons. The linewidth of the EDMR signal for the trapped polarons increases with increasing resonance magnetic field for an in-plane configuration where the normal vector of the device substrate is perpendicular to the resonance magnetic field, while it is independent of the field for an out-of-plane configuration. This difference is consistent with the pentacene arrangement on the device substrate, where pentacene molecules exhibit a uniaxial orientation on the out-of-substrate plane. By contrast, the mobile polarons do not show anisotropic behavior with respect to the resonance magnetic field, indicating that the anisotropic effect is averaged out owing to carrier motion. These results suggest that the orientational arrangements of polycrystalline pentacene molecules in a nano thin film play a crucial role in spin-dependent electrical conduction.

Site-Dependent Differences in DNA Methylation and Their Impact on Plant Establishment and Phosphorus Nutrition in Populus trichocarpa

PubMed Central

Schönberger, Brigitte; Chen, Xiaochao; Mager, Svenja

2016-01-01

The propagation via clonal stem cuttings is a frequent practice in tree plantations. Despite their clonal origin, the trees establish differently according to weather, temperature and nutrient availability, as well as the presence of various stresses. Here, clonal Populus trichocarpa (cv. Muhle Larson) cuttings from different sites were transferred into a common, fully nutrient supplied environment. Despite identical underlying genetics, stem cuttings derived from sites with lower phosphorus availability established worse, independent of phosphorus (P) level after transplantation. Differential growth of material from the sites was reflected in differences in the whole genome DNA methylome. Methylation differences were sequence context-dependent, but differentially methylated regions (DMRs) were apparently unrelated to P nutrition genes. Despite the undisputed negative general correlation of DNA promoter methylation with gene repression, only few of the top-ranked DMRs resulted in differential gene expression in roots or shoots. However, differential methylation was associated with site-dependent, different total amounts of microRNAs (miRNAs), with few miRNAs sequences directly targeted by differential methylation. Interestingly, in roots and shoots, the miRNA amount was dependent on the previous habitat and changed in roots in a habitat-dependent way under phosphate starvation conditions. Differentially methylated miRNAs, together with their target genes, showed P-dependent expression profiles, indicating miRNA expression differences as a P-related epigenetic modification in poplar. Together with differences in DNA methylation, such epigenetic mechanisms may explain habitat or seasonal memory in perennials and site-dependent growth performances. PMID:27992519

Site-Dependent Differences in DNA Methylation and Their Impact on Plant Establishment and Phosphorus Nutrition in Populus trichocarpa.

PubMed

Schönberger, Brigitte; Chen, Xiaochao; Mager, Svenja; Ludewig, Uwe

2016-01-01

The propagation via clonal stem cuttings is a frequent practice in tree plantations. Despite their clonal origin, the trees establish differently according to weather, temperature and nutrient availability, as well as the presence of various stresses. Here, clonal Populus trichocarpa (cv. Muhle Larson) cuttings from different sites were transferred into a common, fully nutrient supplied environment. Despite identical underlying genetics, stem cuttings derived from sites with lower phosphorus availability established worse, independent of phosphorus (P) level after transplantation. Differential growth of material from the sites was reflected in differences in the whole genome DNA methylome. Methylation differences were sequence context-dependent, but differentially methylated regions (DMRs) were apparently unrelated to P nutrition genes. Despite the undisputed negative general correlation of DNA promoter methylation with gene repression, only few of the top-ranked DMRs resulted in differential gene expression in roots or shoots. However, differential methylation was associated with site-dependent, different total amounts of microRNAs (miRNAs), with few miRNAs sequences directly targeted by differential methylation. Interestingly, in roots and shoots, the miRNA amount was dependent on the previous habitat and changed in roots in a habitat-dependent way under phosphate starvation conditions. Differentially methylated miRNAs, together with their target genes, showed P-dependent expression profiles, indicating miRNA expression differences as a P-related epigenetic modification in poplar. Together with differences in DNA methylation, such epigenetic mechanisms may explain habitat or seasonal memory in perennials and site-dependent growth performances.

FAST TRACK COMMUNICATION: Conformation dependence of molecular conductance: chemistry versus geometry

NASA Astrophysics Data System (ADS)

Finch, Christopher M.; Sirichantaropass, Skon; Bailey, Steven W.; Grace, Iain M.; García-Suárez, Víctor M.; Lambert, Colin J.

2008-01-01

Recent experiments by Venkataraman et al (2006 Nature 442 904) on a series of molecular wires with varying chemical compositions revealed a linear dependence of the conductance on cos2 θ, where θ is the angle of twist between neighbouring aromatic rings. To investigate whether or not this dependence has a more general applicability, we present a first-principles theoretical study of the transport properties of this family of molecules as a function of the chemical composition, conformation and the contact atom and geometry. If the Fermi energy EF lies within the HOMO-LUMO (highest occupied molecular orbital-lowest unoccupied molecular orbital) gap, then we reproduce the above experimental results. More generally, however, if EF is located within either the LUMO or the HOMO states, the presence of resonances destroys the linear dependence of the conductance on cos2 θ and gives rise to non-monotonic behaviour associated with the level structure of the different molecules. Our results suggest that the above experiments provide a novel method for extracting spectroscopic information about molecules contacted to electrodes.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy.

PubMed

Nayak, Alpana; Suresh, K A

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Conductivity of Langmuir-Blodgett films of a disk-shaped liquid-crystalline molecule-DNA complex studied by current-sensing atomic force microscopy

NASA Astrophysics Data System (ADS)

Nayak, Alpana; Suresh, K. A.

2008-08-01

We have studied the electrical conductivity in monolayer films of an ionic disk-shaped liquid-crystal molecule, pyridinium tethered with hexaalkoxytriphenylene (PyTp), and its complex with DNA by current-sensing atomic force microscopy (CS-AFM). The pure PyTp and PyTp-DNA complex monolayer films were first formed at the air-water interface and then transferred onto conducting substrates by the Langmuir-Blodgett (LB) technique to study the nanoscale electron transport through these films. The conductive tip of CS-AFM, the LB film, and the metal substrate form a nanoscopic metal-LB film-metal (M-LB-M) junction. We have measured the current-voltage (I-V) characteristics for the M-LB-M junction using CS-AFM and have analyzed the data quantitatively. We find that the I-V curves fit well to the Fowler-Nordheim (FN) model, suggesting electron tunneling to be a possible mechanism for electron transport in our system. Further, analysis of the I-V curves based on the FN model yields the barrier heights of PyTp-DNA complex and pure PyTp films. Electron transport studies of films of ionic disk-shaped liquid-crystal molecules and their complex with DNA are important from the point of view of their applications in organic electronics.

Human β‐defensin 3 increases the TLR9‐dependent response to bacterial DNA

PubMed Central

McGlasson, Sarah L.; Semple, Fiona; MacPherson, Heather; Gray, Mohini; Davidson, Donald J.

2017-01-01

Human β‐defensin 3 (hBD3) is a cationic antimicrobial peptide with potent bactericidal activity in vitro. HBD3 is produced in response to pathogen challenge and can modulate immune responses. The amplified recognition of self‐DNA by human plasmacytoid dendritic cells has been previously reported, but we show here that hBD3 preferentially enhances the response to bacterial DNA in mouse Flt‐3 induced dendritic cells (FLDCs) and in human peripheral blood mononuclear cells. We show the effect is mediated through TLR9 and although hBD3 significantly increases the cellular uptake of both E. coli and self‐DNA in mouse FLDCs, only the response to bacterial DNA is enhanced. Liposome transfection also increases uptake of bacterial DNA and amplifies the TLR9‐dependent response. In contrast to hBD3, lipofection of self‐DNA enhances inflammatory signaling, but the response is predominantly TLR9‐independent. Together, these data show that hBD3 has a role in the innate immune‐mediated response to pathogen DNA, increasing inflammatory signaling and promoting activation of the adaptive immune system via antigen presenting cells including dendritic cells. Therefore, our data identify an additional immunomodulatory role for this copy‐number variable defensin, of relevance to host defence against infection and indicate a potential for the inclusion of HBD3 in pathogen DNA‐based vaccines. PMID:28102569

Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression.

PubMed

Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

2016-06-01

Half of the human genome is made up of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using bacterial artificial chromosomes in Xenopus laevis egg extract. Using this approach we characterized the chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication-dependent enrichment of a network of DNA repair factors including the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR-dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to the inability of the single-stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of topoisomerase I-dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications for our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions.

Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression

PubMed Central

Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

2016-01-01

Half of human genome is made of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using Bacterial Artificial Chromosomes (BACs) in Xenopus laevis egg extract. Using this approach we characterized chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication dependent enrichment of a network of DNA repair factors among which the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to inability of single stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of Topoisomerase I dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications on our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions. PMID:27111843

A time dependent anatomically detailed model of cardiac conduction

NASA Technical Reports Server (NTRS)

Saxberg, B. E.; Grumbach, M. P.; Cohen, R. J.

1985-01-01

In order to understand the determinants of transitions in cardiac electrical activity from normal patterns to dysrhythmias such as ventricular fibrillation, we are constructing an anatomically and physiologically detailed finite element simulation of myocardial electrical propagation. A healthy human heart embedded in paraffin was sectioned to provide a detailed anatomical substrate for model calculations. The simulation of propagation includes anisotropy in conduction velocity due to fiber orientation as well as gradients in conduction velocities, absolute and relative refractory periods, action potential duration and electrotonic influence of nearest neighbors. The model also includes changes in the behaviour of myocardial tissue as a function of the past local activity. With this model, we can examine the significance of fiber orientation and time dependence of local propagation parameters on dysrhythmogenesis.

Resolving DNA-ligand intercalation in the entropic stretching regime

NASA Astrophysics Data System (ADS)

Almaqwashi, Ali A.

Single molecule studies of DNA intercalation are typically conducted by applying stretching forces to obtain force-dependent DNA elongation measurements. The zero-force properties of DNA intercalation are determined by equilibrium and kinetic force-analysis. However, the applied stretching forces that are above the entropic regime (>5 pN) prevent DNA-DNA contact which may eliminate competitive DNA-ligand interactions. In particular, it is noted that cationic mono-intercalators investigated by single molecule force spectroscopy are mostly found to intercalate DNA with single rate, while bulk studies reported additional slower rates. Here, a proposed framework quantifies DNA intercalation by cationic ligands in competition with relatively rapid kinetic DNA-ligand aggregation. At a constant applied force in the entropic stretching regime, the analysis illustrates that DNA intercalation would be measurably optimized only within a narrow range of low ligand concentrations. As DNA intercalators are considered for potential DNA-targeted therapeutics, this analysis provides insights in tuning ligand concertation to maximize therapeutics efficiency.

Regulation of ATM-Dependent DNA Damage Responses in Breast Cancer by the RhoGEF Net1

DTIC Science & Technology

2013-04-01

Science 279: 509-514. 5. Jaffe AB. et al., (2010) RhoGTPases: Biochemistry and Biology. Annu. Rev. Cell Dev. Biol. 21:247-269. 6. Rossman KL, et al...exchange factor Net1 is regulated by nuclear sequestration. J. Biol. Chem. 277:17, 14581-14588. 17. Harper JW, et al., (2007) The DNA Damage Response: Ten...Research (AACR) Annual Meeting and 2013 Annual Cancer Research Biochemistry Retreat Regulation of ATM-dependent DNA damage signaling in human breast

Measurement of changes in impedance of DNA nanowires due to radiation induced structural damage. A novel approach for a DNA-based radiosensitive device

NASA Astrophysics Data System (ADS)

Heimbach, Florian; Arndt, Alexander; Nettelbeck, Heidi; Langner, Frank; Giesen, Ulrich; Rabus, Hans; Sellner, Stefan; Toppari, Jussi; Shen, Boxuan; Baek, Woon Yong

2017-08-01

The ability of DNA to conduct electric current has been the topic of numerous investigations over the past few decades. Those investigations indicate that this ability is dependent on the molecular structure of the DNA. Radiation-induced damages, which lead to an alteration of the molecular structure, should therefore change the electrical impedance of a DNA molecule. In this paper, the damage due to ionising radiation is shown to have a direct effect on the electrical transport properties of DNA. Impedance measurements of DNA samples were carried out by an AC impedance spectrometer before, during and after irradiation. The samples comprised of DNA segments, which were immobilized between gold electrodes with a gap of 12 μm. The impedance of all DNA samples exhibited rising capacitive behaviour with increasing absorbed dose.

In the Absence of Writhe, DNA Relieves Torsional Stress with Localized, Sequence-Dependent Structural Failure to Preserve B-form

DOE Office of Scientific and Technical Information (OSTI.GOV)

Randall, Graham L.; Zechiedrich, E. L.; Pettitt, Bernard M.

2009-09-01

To understand how underwinding and overwinding the DNA helix affects its structure, we simulated 19 independent DNA systems with fixed degrees of twist using molecular dynamics in a system that does not allow writhe. Underwinding DNA induced spontaneous, sequence-dependent base flipping and local denaturation, while overwinding DNA induced the formation of Pauling-like DNA (P-DNA). The winding resulted in a bimodal state simultaneously including local structural failure and B-form DNA for both underwinding and extreme overwinding. Our simulations suggest that base flipping and local denaturation may provide a landscape influencing protein recognition of DNA sequence to affect, for examples, replication, transcriptionmore » and recombination. Additionally, our findings help explain results from singlemolecule experiments and demonstrate that elastic rod models are strictly valid on average only for unstressed or overwound DNA up to P-DNA formation. Finally, our data support a model in which base flipping can result from torsional stress.« less

DNA-PKcs, a novel functional target of acriflavine, mediates acriflavine's p53-dependent synergistic anti-tumor efficiency with melphalan.

PubMed

Cao, Ji; Lin, Guanyu; Gong, Yanling; Pan, Peichen; Ma, Yaxi; Huang, Ping; Ying, Meidan; Hou, Tingjun; He, Qiaojun; Yang, Bo

2016-12-01

Acriflavine (ACF), a known antibacterial drug, has recently been recognized as a suitable candidate for cancer chemotherapy. However, the molecular target of ACF is not fully understood, which limits its application in cancer therapy. In this study, we established a structure-specific probe-based pull-down approach to comprehensively profile the potential target of ACF, and we identified DNA dependent protein kinase catalytic subunit (DNA-PKcs) as the direct target of ACF. Since DNA-PKcs facilitates the repair process following DNA double-strand breaks, we further developed a drug combination strategy that combined ACF with the bifunctional alkylating agent melphalan, which exerted a p53-dependent synergistic efficacy against human cancer cells both in vitro and in vivo. With these findings, our study demonstrated that structure-specific probe-based pull-down approaches can be used to identify new functional target of drug, and provided novel opportunities for the development of ACF-based antitumor chemotherapies. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Application of a time-dependent coalescence process for inferring the history of population size changes from DNA sequence data.

PubMed

Polanski, A; Kimmel, M; Chakraborty, R

1998-05-12

Distribution of pairwise differences of nucleotides from data on a sample of DNA sequences from a given segment of the genome has been used in the past to draw inferences about the past history of population size changes. However, all earlier methods assume a given model of population size changes (such as sudden expansion), parameters of which (e.g., time and amplitude of expansion) are fitted to the observed distributions of nucleotide differences among pairwise comparisons of all DNA sequences in the sample. Our theory indicates that for any time-dependent population size, N(tau) (in which time tau is counted backward from present), a time-dependent coalescence process yields the distribution, p(tau), of the time of coalescence between two DNA sequences randomly drawn from the population. Prediction of p(tau) and N(tau) requires the use of a reverse Laplace transform known to be unstable. Nevertheless, simulated data obtained from three models of monotone population change (stepwise, exponential, and logistic) indicate that the pattern of a past population size change leaves its signature on the pattern of DNA polymorphism. Application of the theory to the published mtDNA sequences indicates that the current mtDNA sequence variation is not inconsistent with a logistic growth of the human population.

Delineating Species with DNA Barcodes: A Case of Taxon Dependent Method Performance in Moths

PubMed Central

Kekkonen, Mari; Mutanen, Marko; Kaila, Lauri; Nieminen, Marko; Hebert, Paul D. N.

2015-01-01

The accelerating loss of biodiversity has created a need for more effective ways to discover species. Novel algorithmic approaches for analyzing sequence data combined with rapidly expanding DNA barcode libraries provide a potential solution. While several analytical methods are available for the delineation of operational taxonomic units (OTUs), few studies have compared their performance. This study compares the performance of one morphology-based and four DNA-based (BIN, parsimony networks, ABGD, GMYC) methods on two groups of gelechioid moths. It examines 92 species of Finnish Gelechiinae and 103 species of Australian Elachistinae which were delineated by traditional taxonomy. The results reveal a striking difference in performance between the two taxa with all four DNA-based methods. OTU counts in the Elachistinae showed a wider range and a relatively low (ca. 65%) OTU match with reference species while OTU counts were more congruent and performance was higher (ca. 90%) in the Gelechiinae. Performance rose when only monophyletic species were compared, but the taxon-dependence remained. None of the DNA-based methods produced a correct match with non-monophyletic species, but singletons were handled well. A simulated test of morphospecies-grouping performed very poorly in revealing taxon diversity in these small, dull-colored moths. Despite the strong performance of analyses based on DNA barcodes, species delineated using single-locus mtDNA data are best viewed as OTUs that require validation by subsequent integrative taxonomic work. PMID:25849083

Conductance of Single Molecule Junctions: Dependence on Structure and Conformation

NASA Astrophysics Data System (ADS)

Venkataraman, Latha

2007-03-01

We recently demonstrated that the conductance of single molecule junctions formed by breaking Au point contacts in an environment of molecules with amine linkages can be measured reliably and reproducibly^1. We have now studied junctions formed by approximately 30 different amine terminated molecules, allowing systematic study of the correlation between molecular properties and single molecule junction conductance. This talk will focus on the relation between molecular conductance and molecule conformation for the simple case of a biphenyl, two benzene rings linked together by a single C-C bond. Our results from a series of seven biphenyl derivatives show that the molecular junction conductance depends on the twist angle. Specifically, we find that the planar molecule has the highest conductance, and the conductance for the series decreases with increasing twist angle, consistent with a cosine squared relation predicted theoretically^2. 1. L. Venkataraman, J.E. Klare, I.W. Tam, C. Nuckolls, M.S Hybertsen and M. Steigerwald, Nano Letters, vol. 5, pp. 458-462, 2006. 2. L. Venkataraman, J.E. Klare, C. Nuckolls, M.S Hybertsen and M. Steigerwald, Nature, vol. 442, pp. 904-907, 2006.

Methylation-dependent DNA discrimination in natural transformation of Campylobacter jejuni

PubMed Central

Leveque, Rhiannon M.; Dawid, Suzanne; DiRita, Victor J.

2017-01-01

Campylobacter jejuni, a leading cause of bacterial gastroenteritis, is naturally competent. Like many competent organisms, C. jejuni restricts the DNA that can be used for transformation to minimize undesirable changes in the chromosome. Although C. jejuni can be transformed by C. jejuni-derived DNA, it is poorly transformed by the same DNA propagated in Escherichia coli or produced with PCR. Our work indicates that methylation plays an important role in marking DNA for transformation. We have identified a highly conserved DNA methyltransferase, which we term Campylobacter transformation system methyltransferase (ctsM), which methylates an overrepresented 6-bp sequence in the chromosome. DNA derived from a ctsM mutant transforms C. jejuni significantly less well than DNA derived from ctsM+ (parental) cells. The ctsM mutation itself does not affect transformation efficiency when parental DNA is used, suggesting that CtsM is important for marking transforming DNA, but not for transformation itself. The mutant has no growth defect, arguing against ongoing restriction of its own DNA. We further show that E. coli plasmid and PCR-derived DNA can efficiently transform C. jejuni when only a subset of the CtsM sites are methylated in vitro. A single methylation event 1 kb upstream of the DNA involved in homologous recombination is sufficient to transform C. jejuni, whereas otherwise identical unmethylated DNA is not. Methylation influences DNA uptake, with a slight effect also seen on DNA binding. This mechanism of DNA discrimination in C. jejuni is distinct from the DNA discrimination described in other competent bacteria. PMID:28855338

Conductivity dependence of seismoelectric wave phenomena in fluid-saturated sediments

NASA Astrophysics Data System (ADS)

Block, Gareth I.; Harris, John G.

2006-01-01

Seismoelectric phenomena in sediments arise from acoustic wave-induced fluid motion in the pore space, which perturbs the electrostatic equilibrium of the electric double layer on the grain surfaces. Experimental techniques and the apparatus built to study the conductivity dependence of the electrokinetic (EK) effect are described, and outcomes for studies in loose glass microspheres and medium-grain sand are presented. By varying the NaCl concentration in the pore fluid, we measured the conductivity dependence of two kinds of EK behavior: (1) the electric fields generated within the samples by the passage of transmitted acoustic waves and (2) the electromagnetic waves produced at the fluid-sediment interface by the incident acoustic wave. Both phenomena are caused by relative fluid motion in the sediment pores; this feature is characteristic of poroelastic (Biot) media but is not predicted by either viscoelastic fluid or solid models. A model of plane wave reflection from a fluid-sediment interface using EK-Biot theory leads to theoretical predictions that compare well to the experimental data for both loose glass microspheres and medium-grain sand.

RAE1 ligands for the NKG2D receptor are regulated by STING-dependent DNA sensor pathways in lymphoma.

PubMed

Lam, Adeline R; Bert, Nina Le; Ho, Samantha Sw; Shen, Yu J; Tang, Li Fm; Xiong, Gordon M; Croxford, John L; Koo, Christine X; Ishii, Ken J; Akira, Shizuo; Raulet, David H; Gasser, Stephan

2014-04-15

The immunoreceptor NKG2D originally identified in natural killer (NK) cells recognizes ligands that are upregulated on tumor cells. Expression of NKG2D ligands (NKG2DL) is induced by the DNA damage response (DDR), which is often activated constitutively in cancer cells, revealing them to NK cells as a mechanism of immunosurveillance. Here, we report that the induction of retinoic acid early transcript 1 (RAE1) ligands for NKG2D by the DDR relies on a STING-dependent DNA sensor pathway involving the effector molecules TBK1 and IRF3. Cytosolic DNA was detected in lymphoma cell lines that express RAE1 and its occurrence required activation of the DDR. Transfection of DNA into ligand-negative cells was sufficient to induce RAE1 expression. Irf3(+/-);Eμ-Myc mice expressed lower levels of RAE1 on tumor cells and showed a reduced survival rate compared with Irf3(+/+);Eμ-Myc mice. Taken together, our results suggest that genomic damage in tumor cells leads to activation of STING-dependent DNA sensor pathways, thereby activating RAE1 and enabling tumor immunosurveillance. ©2014 AACR.

Inverse Temperature Dependence of Nuclear Quantum Effects in DNA Base Pairs

PubMed Central

2016-01-01

Despite the inherently quantum mechanical nature of hydrogen bonding, it is unclear how nuclear quantum effects (NQEs) alter the strengths of hydrogen bonds. With this in mind, we use ab initio path integral molecular dynamics to determine the absolute contribution of NQEs to the binding in DNA base pair complexes, arguably the most important hydrogen-bonded systems of all. We find that depending on the temperature, NQEs can either strengthen or weaken the binding within the hydrogen-bonded complexes. As a somewhat counterintuitive consequence, NQEs can have a smaller impact on hydrogen bond strengths at cryogenic temperatures than at room temperature. We rationalize this in terms of a competition of NQEs between low-frequency and high-frequency vibrational modes. Extending this idea, we also propose a simple model to predict the temperature dependence of NQEs on hydrogen bond strengths in general. PMID:27195654

Dependence of the Thermal Conductivity of BiFeO3 Thin Films on Polarization and Structure

NASA Astrophysics Data System (ADS)

Ning, Shuai; Huberman, Samuel C.; Zhang, Chen; Zhang, Zhengjun; Chen, Gang; Ross, Caroline A.

2017-11-01

The role of the ferroelectric polarization state and crystal structure in determining the room-temperature thermal conductivity of epitaxial BiFeO3 thin films is investigated. The ferroelectric domain configuration is varied by changing the oxygen partial pressure during growth, as well as by polarizing the samples by the application of an in situ electric field during the thermal conductivity measurement. However, little or no dependence of thermal conductivity on the ferroelectric domain structure is observed. In contrast, the thermal conductivity significantly depends on the morphotropic phase structure, being about 2 /3 as large in tetragonal-like compared to rhombohedral-like BiFeO3 film. The substantial structural dependence of thermal conductivity found here may provide a route to reversible manipulation of thermal properties.

UDP-glucuronosyltransferase-dependent bioactivation of clofibric acid to a DNA-damaging intermediate in mouse hepatocytes.

PubMed

Ghaoui, Roula; Sallustio, Benedetta C; Burcham, Philip C; Fontaine, Frank R

2003-05-06

Glucuronidation of a number of carboxyl-containing drugs generates reactive acyl glucuronide metabolites. These electrophilic species alkylate cell proteins and may be implicated in the pathogenesis of a number of toxic syndromes seen in patients receiving the parent aglycones. Whether acyl glucuronides also attack nuclear DNA is unknown, although the acyl glucuronide formed from clofibric acid was recently found to decrease the transfection efficiency of phage DNA and generate strand breaks in plasmid DNA in vitro. To determine if such a DNA damage occurs within a cellular environment, the comet assay (i.e. single-cell gel electrophoresis) was used to detect DNA lesions in the nuclear genome of isolated mouse hepatocytes cultured with clofibric acid. Overnight exposure to 50 microM and higher concentrations of clofibric acid produced concentration-dependent increases in the comet areas of hepatocyte nuclei, with 1 mM clofibrate producing a 3.6-fold elevation over controls. These effects closely coincided with culture medium concentrations of the glucuronide metabolite formed from clofibric acid, 1-O-beta-clofibryl glucuronide. Consistent with a role for glucuronidation in the DNA damage observed, the glucuronidation inhibitor borneol diminished glucuronide formation from 100 microM clofibrate by 98% and returned comet areas to baseline levels. Collectively, these results suggest that the acyl glucuronide formed from clofibric acid is capable of migrating from its site of formation within the endoplasmic reticulum to generate strand nicks in nuclear DNA.

Chromosome Synapsis Alleviates Mek1-Dependent Suppression of Meiotic DNA Repair

PubMed Central

Subramanian, Vijayalakshmi V.; MacQueen, Amy J.; Vader, Gerben; Shinohara, Miki; Sanchez, Aurore; Borde, Valérie; Shinohara, Akira; Hochwagen, Andreas

2016-01-01

Faithful meiotic chromosome segregation and fertility require meiotic recombination between homologous chromosomes rather than the equally available sister chromatid, a bias that in Saccharomyces cerevisiae depends on the meiotic kinase, Mek1. Mek1 is thought to mediate repair template bias by specifically suppressing sister-directed repair. Instead, we found that when Mek1 persists on closely paired (synapsed) homologues, DNA repair is severely delayed, suggesting that Mek1 suppresses any proximal repair template. Accordingly, Mek1 is excluded from synapsed homologues in wild-type cells. Exclusion requires the AAA+-ATPase Pch2 and is directly coupled to synaptonemal complex assembly. Stage-specific depletion experiments further demonstrate that DNA repair in the context of synapsed homologues requires Rad54, a repair factor inhibited by Mek1. These data indicate that the sister template is distinguished from the homologue primarily by its closer proximity to inhibitory Mek1 activity. We propose that once pairing or synapsis juxtaposes homologues, exclusion of Mek1 is necessary to avoid suppression of all templates and accelerate repair progression. PMID:26870961

Powerful bacterial killing by buckwheat honeys is concentration-dependent, involves complete DNA degradation and requires hydrogen peroxide.

PubMed

Brudzynski, Katrina; Abubaker, Kamal; Wang, Tony

2012-01-01

Exposure of bacterial cells to honey inhibits their growth and may cause cell death. Our previous studies showed a cause-effect relationship between hydroxyl radical generated from honey hydrogen peroxide and growth arrest. Here we explored the role of hydroxyl radicals as inducers of bacterial cells death. The bactericidal effect of ·OH on antibiotic-resistant clinical isolates of MRSA and VRE and standard bacterial strains of E. coli and B. subtiles was examined using a broth microdilution assay supplemented with 3'-(p-aminophenyl) fluorescein (APF) as the ·OH trap, followed by colony enumeration. Bactericidal activities of eight honeys (six varieties of buckwheat, blueberry and manuka honeys) were analyzed. The MBC/MIC ratio ≤4 and the killing curves indicated that honeys exhibited powerful, concentration-dependent bactericidal effect. The extent of killing depended on the ratio of honey concentration to bacterial load, indicating that honey dose was critical for its bactericidal efficacy. The killing rate and potency varied between honeys and ranged from over a 6-log(10) to 4-log(10) CFU/ml reduction of viable cells, equivalent to complete bacterial eradication. The maximal killing was associated with the extensive degradation of bacterial DNA. Honey concentration at which DNA degradation occurred correlated with cell death observed in the concentration-dependent cell-kill on agar plates. There was no quantitative relationship between the ·OH generation by honey and bactericidal effect. At the MBC, where there was no surviving cells and no DNA was visible on agarose gels, the ·OH levels were on average 2-3x lower than at Minimum Inhibitory Concentration (MICs) (p < 0.0001). Pre-treatment of honey with catalase, abolished the bactericidal effect. This raised possibilities that either the abrupt killing prevented accumulation of ·OH (dead cells did not generate ·OH) or that DNA degradation and killing is the actual footprint of ·OH action. In conclusion

Exploring mechanisms of transport and persistence of environmental DNA (eDNA)

NASA Astrophysics Data System (ADS)

Shogren, A.; Tank, J. L.; Riis, T.; Rosi, E. J.; Bolster, D.

2017-12-01

Sampling for eDNA is a non-intrusive method to detect species presence without direct observation, which allows for earlier detection and more rapid response than conventional sampling methods. However, our current understanding of how eDNA is transported and persists in flowing waters (e.g., streams and rivers) remains imprecise; in flowing waters, the target organism may be some distance away from where the eDNA in water is collected. It is uncertain how the unique transport properties of suspended eDNA or the inherent heterogeneity of natural flowing systems may impact the probability of downstream eDNA detection. To improve understanding of eDNA fate, we first conducted experimental releases and modeled the impact of benthic substrate heterogeneity and size on eDNA transport and retention in streams. We also used recirculating artificial streams to constrain estimates of eDNA degradation in systems with varying flow and microbial biofilm coverage. We found that eDNA retention in streams is substrate-specific, and that streambed hydraulics have significant influence on how far eDNA is transported downstream. Through the degradation experiments, we found that eDNA degradation is strongly context dependent, but even in systems with low velocity, eDNA can remain detectable in the water column >24hrs after introduction. This differential persistence of eDNA particles confirms that eDNA dynamics in flowing waters are not constant along a spatial continuum, which complicates interpretation of a positive detection in flowing waters, which presents a scaling problem for future modeling efforts to support transport predictions. To test our experimental results in a natural system, we compared our previous estimates for eDNA transport, retention, and degradation to field data collected during a longitudinal field survey for zebra mussel eDNA on the Gudena River in Silkeborg, Denmark. We found that though heterogeneity indeed complicates scaling efforts to extrapolate

Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.

PubMed

Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua

2016-05-19

Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.

Kinetic mechanism of human DNA ligase I reveals magnesium-dependent changes in the rate-limiting step that compromise ligation efficiency.

PubMed

Taylor, Mark R; Conrad, John A; Wahl, Daniel; O'Brien, Patrick J

2011-07-01

DNA ligase I (LIG1) catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing. We used steady state and pre-steady state kinetics to characterize the minimal mechanism for DNA ligation catalyzed by human LIG1. The ATP dependence of the reaction indicates that LIG1 requires multiple Mg(2+) ions for catalysis and that an essential Mg(2+) ion binds more tightly to ATP than to the enzyme. Further dissection of the magnesium ion dependence of individual reaction steps revealed that the affinity for Mg(2+) changes along the reaction coordinate. At saturating concentrations of ATP and Mg(2+) ions, the three chemical steps occur at similar rates, and the efficiency of ligation is high. However, under conditions of limiting Mg(2+), the nick-sealing step becomes rate-limiting, and the adenylylated DNA intermediate is prematurely released into solution. Subsequent adenylylation of enzyme prevents rebinding to the adenylylated DNA intermediate comprising an Achilles' heel of LIG1. These ligase-generated 5'-adenylylated nicks constitute persistent breaks that are a threat to genomic stability if they are not repaired. The kinetic and thermodynamic framework that we have determined for LIG1 provides a starting point for understanding the mechanism and specificity of mammalian DNA ligases.

Chicken Fetal Liver DNA Damage and Adduct Formation by Activation-Dependent DNA-Reactive Carcinogens and Related Compounds of Several Structural Classes

PubMed Central

Williams, Gary M.; Duan, Jian-Dong; Brunnemann, Klaus D.; Iatropoulos, Michael J.; Vock, Esther; Deschl, Ulrich

2014-01-01

The chicken egg genotoxicity assay (CEGA), which utilizes the liver of an intact and aseptic embryo-fetal test organism, was evaluated using four activation-dependent DNA-reactive carcinogens and four structurally related less potent carcinogens or non-carcinogens. In the assay, three daily doses of test substances were administered to eggs containing 9–11-day-old fetuses and the fetal livers were assessed for two endpoints, DNA breaks using the alkaline single cell gel electrophoresis (comet) assay and DNA adducts using the 32P-nucleotide postlabeling (NPL) assay. The effects of four carcinogens of different structures requiring distinct pathways of bioactivation, i.e., 2-acetylaminofluorene (AAF), aflatoxin B1 (AFB1), benzo[a]pyrene (B[a]P), and diethylnitrosamine (DEN), were compared with structurally related non-carcinogens fluorene (FLU) and benzo[e]pyrene (B[e]P) or weak carcinogens, aflatoxin B2 (AFB2) and N-nitrosodiethanolamine (NDELA). The four carcinogens all produced DNA breaks at microgram or low milligram total doses, whereas less potent carcinogens and non-carcinogens yielded borderline or negative results, respectively, at higher doses. AAF and B[a]P produced DNA adducts, whereas none was found with the related comparators FLU or B[e]P, consistent with comet results. DEN and NDELA were also negative for adducts, as expected in the case of DEN for an alkylating agent in the standard NPL assay. Also, AFB1 and AFB2 were negative in NPL, as expected, due to the nature of ring opened aflatoxin adducts, which are resistant to enzymatic digestion. Thus, the CEGA, using comet and NPL, is capable of detection of the genotoxicity of diverse DNA-reactive carcinogens, while not yielding false positives for non-carcinogens. PMID:24973097

Chicken fetal liver DNA damage and adduct formation by activation-dependent DNA-reactive carcinogens and related compounds of several structural classes.

PubMed

Williams, Gary M; Duan, Jian-Dong; Brunnemann, Klaus D; Iatropoulos, Michael J; Vock, Esther; Deschl, Ulrich

2014-09-01

The chicken egg genotoxicity assay (CEGA), which utilizes the liver of an intact and aseptic embryo-fetal test organism, was evaluated using four activation-dependent DNA-reactive carcinogens and four structurally related less potent carcinogens or non-carcinogens. In the assay, three daily doses of test substances were administered to eggs containing 9-11-day-old fetuses and the fetal livers were assessed for two endpoints, DNA breaks using the alkaline single cell gel electrophoresis (comet) assay and DNA adducts using the (32)P-nucleotide postlabeling (NPL) assay. The effects of four carcinogens of different structures requiring distinct pathways of bioactivation, i.e., 2-acetylaminofluorene (AAF), aflatoxin B1 (AFB1), benzo[a]pyrene (B[a]P), and diethylnitrosamine (DEN), were compared with structurally related non-carcinogens fluorene (FLU) and benzo[e]pyrene (B[e]P) or weak carcinogens, aflatoxin B2 (AFB2) and N-nitrosodiethanolamine (NDELA). The four carcinogens all produced DNA breaks at microgram or low milligram total doses, whereas less potent carcinogens and non-carcinogens yielded borderline or negative results, respectively, at higher doses. AAF and B[a]P produced DNA adducts, whereas none was found with the related comparators FLU or B[e]P, consistent with comet results. DEN and NDELA were also negative for adducts, as expected in the case of DEN for an alkylating agent in the standard NPL assay. Also, AFB1 and AFB2 were negative in NPL, as expected, due to the nature of ring opened aflatoxin adducts, which are resistant to enzymatic digestion. Thus, the CEGA, using comet and NPL, is capable of detection of the genotoxicity of diverse DNA-reactive carcinogens, while not yielding false positives for non-carcinogens. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please email: journals.permissions@oup.com.

pH-Dependent DNA Distortion and Repression of Gene Expression by Pectobacterium atrosepticum PecS.

PubMed

Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2016-07-15

Transcriptional activity is exquisitely sensitive to changes in promoter DNA topology. Transcription factors may therefore control gene activity by modulating the relative positioning of -10 and -35 promoter elements. The plant pathogen Pectobacterium atrosepticum, which causes soft rot in potatoes, must alter gene expression patterns to ensure growth in planta. In the related soft-rot enterobacterium Dickeya dadantii, PecS functions as a master regulator of virulence gene expression. Here, we report that P. atrosepticum PecS controls gene activity by altering promoter DNA topology in response to pH. While PecS binds the pecS promoter with high affinity regardless of pH, it induces significant DNA distortion only at neutral pH, the pH at which the pecS promoter is repressed in vivo. At pH ∼8, DNA distortions are attenuated, and PecS no longer represses the pecS promoter. A specific histidine (H142) located in a crevice between the dimerization- and DNA-binding regions is required for pH-dependent changes in DNA distortion and repression of gene activity, and mutation of this histidine renders the mutant protein incapable of repressing the pecS promoter. We propose that protonated PecS induces a DNA conformation at neutral pH in which -10 and -35 promoter elements are suboptimally positioned for RNA polymerase binding; on deprotonation of PecS, binding is no longer associated with significant changes in DNA conformation, allowing gene expression. We suggest that this mode of gene regulation leads to differential expression of the PecS regulon in response to alkalinization of the plant apoplast.

Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

PubMed

Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba

2018-05-14

In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.

ATM-dependent phosphorylation of Mdm2 on serine 395: role in p53 activation by DNA damage

PubMed Central

Maya, Ruth; Balass, Moshe; Kim, Seong-Tae; Shkedy, Dganit; Leal, Juan-Fernando Martinez; Shifman, Ohad; Moas, Miri; Buschmann, Thomas; Ronai, Ze'ev; Shiloh, Yosef; Kastan, Michael B.; Katzir, Ephraim; Oren, Moshe

2001-01-01

The p53 tumor suppressor protein, a key regulator of cellular responses to genotoxic stress, is stabilized and activated after DNA damage. The rapid activation of p53 by ionizing radiation and radiomimetic agents is largely dependent on the ATM kinase. p53 is phosphorylated by ATM shortly after DNA damage, resulting in enhanced stability and activity of p53. The Mdm2 oncoprotein is a pivotal negative regulator of p53. In response to ionizing radiation and radiomimetic drugs, Mdm2 undergoes rapid ATM-dependent phosphorylation prior to p53 accumulation. This results in a decrease in its reactivity with the 2A10 monoclonal antibody. Phage display analysis identified a consensus 2A10 recognition sequence, possessing the core motif DYS. Unexpectedly, this motif appears twice within the human Mdm2 molecule, at positions corresponding to residues 258–260 and 393–395. Both putative 2A10 epitopes are highly conserved and encompass potential phosphorylation sites. Serine 395, residing within the carboxy-terminal 2A10 epitope, is the major target on Mdm2 for phosphorylation by ATM in vitro. Mutational analysis supports the conclusion that Mdm2 undergoes ATM-dependent phosphorylation on serine 395 in vivo in response to DNA damage. The data further suggests that phosphorylated Mdm2 may be less capable of promoting the nucleo-cytoplasmic shuttling of p53 and its subsequent degradation, thereby enabling p53 accumulation. Our findings imply that activation of p53 by DNA damage is achieved, in part, through attenuation of the p53-inhibitory potential of Mdm2. PMID:11331603

Regulating DNA Self-assembly by DNA-Surface Interactions.

PubMed

Liu, Longfei; Li, Yulin; Wang, Yong; Zheng, Jianwei; Mao, Chengde

2017-12-14

DNA self-assembly provides a powerful approach for preparation of nanostructures. It is often studied in bulk solution and involves only DNA-DNA interactions. When confined to surfaces, DNA-surface interactions become an additional, important factor to DNA self-assembly. However, the way in which DNA-surface interactions influence DNA self-assembly is not well studied. In this study, we showed that weak DNA-DNA interactions could be stabilized by DNA-surface interactions to allow large DNA nanostructures to form. In addition, the assembly can be conducted isothermally at room temperature in as little as 5 seconds. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

PubMed Central

Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

2010-01-01

Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

Flow of chemically reactive magneto Cross nanoliquid with temperature-dependent conductivity

NASA Astrophysics Data System (ADS)

Hayat, Tasawar; Ullah, Ikram; Waqas, Muhammad; Alsaedi, Ahmed

2018-05-01

Influence of temperature-dependent thermal conductivity on MHD flow of Cross nanoliquid bounded by a stretched sheet is explored. The combined feature of Brownian motion and thermophoresis in nanoliquid modeling is retained. In addition, the attributes of zero mass flux at sheet are imposed. First-order chemical reaction is retained. The resulting problems are numerically computed. Plots and tabulated values are presented and examined. It is figured out that larger thermophoretic diffusion and thermal conductivity significantly rise the thermal field, whereas opposite situation is seen for heat transfer rate.

Defibrillation depends on conductivity fluctuations and the degree of disorganization in reentry patterns.

PubMed

Plank, Gernot; Leon, L Joshua; Kimber, Shane; Vigmond, Edward J

2005-02-01

Defibrillation depends on conductivity and disorganization. Cardiac fibrillation is the deterioration of the heart's normally well-organized activity into one or more meandering spiral waves, which subsequently break up into many meandering wave fronts. Delivery of an electric shock (defibrillation) is the only effective way of restoring the normal rhythm. This study focuses on examining whether higher degrees of disorganization requires higher shock strengths to defibrillate and whether microscopic conductivity fluctuations favor shock success. We developed a three-dimensional computer bidomain model of a block of cardiac tissue with straight fibers immersed in a conductive bath. The membrane behavior was described by the Courtemanche human atrial action potential model incorporating electroporation and an acetylcholine- (ACh) dependent potassium current. Intracellular conductivities were varied stochastically around nominal values with variations of up to 50%. A single rotor reentry was initiated and, by adjusting the spatial ACh variation, the level of organization could be controlled. The single rotor could be stabilized or spiral wave breakup could be provoked leading to fibrillatory-like activity. For each level of organization, multiple shock timings and strengths were applied to compute the probability of shock success as a function of shock strength. Our results suggest that the level of the small-scale conductivity fluctuations is a very important factor in defibrillation. A higher variation significantly lowers the required shock strength. Further, we demonstrated that success also heavily depends on the level of organization of the fibrillatory episode. In general, higher levels of disorganization require higher shock strengths to defibrillate.

The pathways and outcomes of mycobacterial NHEJ depend on the structure of the broken DNA ends

PubMed Central

Aniukwu, Jideofor; Glickman, Michael S.; Shuman, Stewart

2008-01-01

Mycobacteria can repair DNA double-strand breaks (DSBs) via a nonhomologous end-joining (NHEJ) system that includes a dedicated DNA ligase (LigD) and the DNA end-binding protein Ku. Here we exploit an improved plasmid-based NHEJ assay and a collection of Mycobacterium smegmatis strains bearing deletions or mutations in Ku or the DNA ligases to interrogate the contributions of LigD’s three catalytic activities (polymerase, ligase, and 3′ phosphoesterase) and structural domains (POL, LIG, and PE) to the efficiency and molecular outcomes of NHEJ in vivo. By analyzing in parallel the repair of blunt, 5′ overhang, and 3′ overhang DSBs, we discovered a novel end-joining pathway specific to breaks with 3′ overhangs that is Ku- and LigD-independent and perfectly faithful. This 3′ overhang NHEJ pathway is independent of ligases B and C; we surmise that it relies on NAD+-dependent LigA, the essential replicative ligase. We find that efficient repair of blunt and 5′ overhang DSBs depends stringently on Ku and the LigD POL domain, but not on the LigD polymerase activity, which mainly serves to promote NHEJ infidelity. The lack of an effect of PE-inactivating LigD mutations on NHEJ outcomes, especially the balance between deletions and insertions at blunt or 5′ overhang breaks, argues against LigD being the catalyst of deletion formation. Ligase-inactivating LigD mutations (or deletion of the LIG domain) have a modest impact on the efficiency of blunt and 5′ overhang DSB repair, because the strand sealing activity can be provided in trans by one of the other resident ATP-dependent ligases (likely LigC). Reliance on the backup ligase is accompanied by a drastic loss of fidelity during blunt end and 5′ overhang DSB repair. We conclude that the mechanisms of mycobacterial NHEJ are many and the outcomes depend on the initial structures of the DSBs and the available ensemble of end-processing and end-sealing components, which are not limited to Ku and LigD. PMID

DNA replication initiator Cdc6 also regulates ribosomal DNA transcription initiation.

PubMed

Huang, Shijiao; Xu, Xiaowei; Wang, Guopeng; Lu, Guoliang; Xie, Wenbing; Tao, Wei; Zhang, Hongyin; Jiang, Qing; Zhang, Chuanmao

2016-04-01

RNA-polymerase-I-dependent ribosomal DNA (rDNA) transcription is fundamental to rRNA processing, ribosome assembly and protein synthesis. However, how this process is initiated during the cell cycle is not fully understood. By performing a proteomic analysis of transcription factors that bind RNA polymerase I during rDNA transcription initiation, we identified that the DNA replication initiator Cdc6 interacts with RNA polymerase I and its co-factors, and promotes rDNA transcription in G1 phase in an ATPase-activity-dependent manner. We further showed that Cdc6 is targeted to the nucleolus during late mitosis and G1 phase in a manner that is dependent on B23 (also known as nucleophosmin, NPM1), and preferentially binds to the rDNA promoter through its ATP-binding domain. Overexpression of Cdc6 increases rDNA transcription, whereas knockdown of Cdc6 results in a decreased association of both RNA polymerase I and the RNA polymerase I transcription factor RRN3 with rDNA, and a reduction of rDNA transcription. Furthermore, depletion of Cdc6 impairs the interaction between RRN3 and RNA polymerase I. Taken together, our data demonstrate that Cdc6 also serves as a regulator of rDNA transcription initiation, and indicate a mechanism by which initiation of rDNA transcription and DNA replication can be coordinated in cells. © 2016. Published by The Company of Biologists Ltd.

Mechanochemical regulations of RPA's binding to ssDNA

NASA Astrophysics Data System (ADS)

Chen, Jin; Le, Shimin; Basu, Anindita; Chazin, Walter J.; Yan, Jie

2015-03-01

Replication protein A (RPA) is a ubiquitous eukaryotic single-stranded DNA (ssDNA) binding protein that serves to protect ssDNA from degradation and annealing, and as a template for recruitment of many downstream factors in virtually all DNA transactions in cell. During many of these transactions, DNA is tethered and is likely subject to force. Previous studies of RPA's binding behavior on ssDNA were conducted in the absence of force; therefore the RPA-ssDNA conformations regulated by force remain unclear. Here, using a combination of atomic force microscopy imaging and mechanical manipulation of single ssDNA tethers, we show that force mediates a switch of the RPA bound ssDNA from amorphous aggregation to a much more regular extended conformation. Further, we found an interesting non-monotonic dependence of the binding affinity on monovalent salt concentration in the presence of force. In addition, we discovered that zinc in micromolar concentrations drives ssDNA to a unique, highly stiff and more compact state. These results provide new mechanochemical insights into the influences and the mechanisms of action of RPA on large single ssDNA.

Smarcal1-Mediated Fork Reversal Triggers Mre11-Dependent Degradation of Nascent DNA in the Absence of Brca2 and Stable Rad51 Nucleofilaments.

PubMed

Kolinjivadi, Arun Mouli; Sannino, Vincenzo; De Antoni, Anna; Zadorozhny, Karina; Kilkenny, Mairi; Técher, Hervé; Baldi, Giorgio; Shen, Rong; Ciccia, Alberto; Pellegrini, Luca; Krejci, Lumir; Costanzo, Vincenzo

2017-09-07

Brca2 deficiency causes Mre11-dependent degradation of nascent DNA at stalled forks, leading to cell lethality. To understand the molecular mechanisms underlying this process, we isolated Xenopus laevis Brca2. We demonstrated that Brca2 protein prevents single-stranded DNA gap accumulation at replication fork junctions and behind them by promoting Rad51 binding to replicating DNA. Without Brca2, forks with persistent gaps are converted by Smarcal1 into reversed forks, triggering extensive Mre11-dependent nascent DNA degradation. Stable Rad51 nucleofilaments, but not RPA or Rad51 T131P mutant proteins, directly prevent Mre11-dependent DNA degradation. Mre11 inhibition instead promotes reversed fork accumulation in the absence of Brca2. Rad51 directly interacts with the Pol α N-terminal domain, promoting Pol α and δ binding to stalled replication forks. This interaction likely promotes replication fork restart and gap avoidance. These results indicate that Brca2 and Rad51 prevent formation of abnormal DNA replication intermediates, whose processing by Smarcal1 and Mre11 predisposes to genome instability. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Acute inactivation of the replicative helicase in human cells triggers MCM8–9-dependent DNA synthesis

PubMed Central

Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy; Bhowmick, Rahul; Hickson, Ian D.; Kanemaki, Masato T.

2017-01-01

DNA replication fork progression can be disrupted at difficult to replicate loci in the human genome, which has the potential to challenge chromosome integrity. This replication fork disruption can lead to the dissociation of the replisome and the formation of DNA damage. To model the events stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks (DSBs). Remarkably, these cells maintain some DNA synthesis in the absence of MCM2, and this requires the MCM8–9 complex, a paralog of the MCM2–7 replicative helicase. We show that MCM8–9 functions in a homologous recombination-based pathway downstream from RAD51, which is promoted by DSB induction. This RAD51/MCM8–9 axis is distinct from the recently described RAD52-dependent DNA synthesis pathway that operates in early mitosis at common fragile sites. We propose that stalled replication forks can be restarted in S phase via homologous recombination using MCM8–9 as an alternative replicative helicase. PMID:28487407

A chimeric protein composed of NuMA fused to the DNA binding domain of LANA is sufficient for the ori-P-dependent DNA replication

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohsaki, Eriko; Ueda, Keiji, E-mail: kueda@virus.me

The Kaposi's sarcoma-associated herpesvirus (KSHV) genome is stably maintained in KSHV-infected PEL cell lines during cell division. We previously showed that accumulation of LANA in the nuclear matrix fraction could be important for the latent DNA replication, and that the functional significance of LANA should be its recruitment of ori-P to the nuclear matrix. Here, we investigated whether the forced localization of the LANA-DNA binding domain (DBD) to the nuclear matrix facilitated ori-P-containing plasmid replication. We demonstrated that chimeric proteins constructed by fusion of LANA DBD with the nuclear mitotic apparatus protein (NuMA), which is one of the components ofmore » the nuclear matrix, could bind with ori-P and enhance replication of an ori-P-containing plasmid, compared with that in the presence of DBD alone. These results further suggested that the ori-P recruitment to the nuclear matrix through the binding with DBD is important for latent viral DNA replication. - Highlights: •KSHV replication in latency depends on LANA localization to the nuclear matrix. •LANA DBD was fused with NuMA, a nuclear matrix protein, at the N- and C-terminus. •NuMA-DBD was in the nuclear matrix and supported the ori-P dependent replication. •LANA in the nuclear matrix should be important for the KSHV replication in latency.« less

Mechanism of UVA-dependent DNA damage induced by an antitumor drug dacarbazine in relation to its photogenotoxicity.

PubMed

Iwamoto, Takuya; Hiraku, Yusuke; Okuda, Masahiro; Kawanishi, Shosuke

2008-03-01

It has been reported that dacarbazine (DTIC) is photogenotoxic. The purpose of this study is to clarify the mechanism of photogenotoxicity induced by DTIC. We examined DNA damage induced by UVA-irradiated DTIC using 32P-5'-end-labeled DNA fragments obtained from human genes. Formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) in calf thymus DNA was measured by high performance liquid chromatograph with an electrochemical detector. Electron spin resonance (ESR) spin-trapping experiments were performed to detect radical species generated from UVA-irradiated DTIC. UVA-irradiated DTIC caused DNA damage at guanine residues, especially at the 5'-GGT-3' sequence in the presence of Cu(II) and also induced 8-oxodG generation in calf thymus DNA. DTIC-induced photodamage to DNA fragments was partially inhibited by catalase, whereas 8-oxodG formation was significantly increased by catalase. NaN3, a carbene scavenger, inhibited DNA damage and 8-oxodG formation in a dose-dependent manner, suggesting that carbene intermediates are involved. The ESR spin-trapping experiments demonstrated the generation of aryl radicals in the process of photodegradation of DTIC. Photoactivated DTIC generates the carbene and aryl radicals, which may induce both DNA adduct and 8-oxodG formation, resulting in photogenotoxicity. This study could provide an insight into the safe usage of DTIC.

ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage

PubMed Central

Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

2014-01-01

The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein–protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage. PMID:24675884

ATM-dependent E2F1 accumulation in the nucleolus is an indicator of ribosomal stress in early response to DNA damage.

PubMed

Jin, Ya-Qiong; An, Guo-Shun; Ni, Ju-Hua; Li, Shu-Yan; Jia, Hong-Ti

2014-01-01

The nucleolus plays a major role in ribosome biogenesis. Most genotoxic agents disrupt nucleolar structure and function, which results in the stabilization/activation of p53, inducing cell cycle arrest or apoptosis. Likewise, transcription factor E2F1 as a DNA damage responsive protein also plays roles in cell cycle arrest, DNA repair, or apoptosis in response to DNA damage through transcriptional response and protein-protein interaction. Furthermore, E2F1 is known to be involved in regulating rRNA transcription. However, how E2F1 displays in coordinating DNA damage and nucleolar stress is unclear. In this study, we demonstrate that ATM-dependent E2F1 accumulation in the nucleolus is a characteristic feature of nucleolar stress in early response to DNA damage. We found that at the early stage of DNA damage, E2F1 accumulation in the nucleolus was an ATM-dependent and a common event in p53-suficient and -deficient cells. Increased nucleolar E2F1 was sequestered by the nucleolar protein p14ARF, which repressed E2F1-dependent rRNA transcription initiation, and was coupled with S phase. Our data indicate that early accumulation of E2F1 in the nucleolus is an indicator for nucleolar stress and a component of ATM pathway, which presumably buffers elevation of E2F1 in the nucleoplasm and coordinates the diversifying mechanisms of E2F1 acts in cell cycle progression and apoptosis in early response to DNA damage.

Strategic role of the ubiquitin-dependent segregase p97 (VCP or Cdc48) in DNA replication.

PubMed

Ramadan, Kristijan; Halder, Swagata; Wiseman, Katherine; Vaz, Bruno

2017-02-01

Genome amplification (DNA synthesis) is one of the most demanding cellular processes in all proliferative cells. The DNA replication machinery (also known as the replisome) orchestrates genome amplification during S-phase of the cell cycle. Genetic material is particularly vulnerable to various events that can challenge the replisome during its assembly, activation (firing), progression (elongation) and disassembly from chromatin (termination). Any disturbance of the replisome leads to stalling of the DNA replication fork and firing of dormant replication origins, a process known as DNA replication stress. DNA replication stress is considered to be one of the main causes of sporadic cancers and other pathologies related to tissue degeneration and ageing. The mechanisms of replisome assembly and elongation during DNA synthesis are well understood. However, once DNA synthesis is complete, the process of replisome disassembly, and its removal from chromatin, remains unclear. In recent years, a growing body of evidence has alluded to a central role in replisome regulation for the ubiquitin-dependent protein segregase p97, also known as valosin-containing protein (VCP) in metazoans and Cdc48 in lower eukaryotes. By orchestrating the spatiotemporal turnover of the replisome, p97 plays an essential role in DNA replication. In this review, we will summarise our current knowledge about how p97 controls the replisome from replication initiation, to elongation and finally termination. We will also further examine the more recent findings concerning the role of p97 and how mutations in p97 cofactors, also known as adaptors, cause DNA replication stress induced genomic instability that leads to cancer and accelerated ageing. To our knowledge, this is the first comprehensive review concerning the mechanisms involved in the regulation of DNA replication by p97.

Squalene Inhibits ATM-Dependent Signaling in γIR-Induced DNA Damage Response through Induction of Wip1 Phosphatase.

PubMed

Tatewaki, Naoto; Konishi, Tetsuya; Nakajima, Yuki; Nishida, Miyako; Saito, Masafumi; Eitsuka, Takahiro; Sakamaki, Toshiyuki; Ikekawa, Nobuo; Nishida, Hiroshi

2016-01-01

Ataxia telangiectasia mutated (ATM) kinase plays a crucial role as a master controller in the cellular DNA damage response. Inhibition of ATM leads to inhibition of the checkpoint signaling pathway. Hence, addition of checkpoint inhibitors to anticancer therapies may be an effective targeting strategy. A recent study reported that Wip1, a protein phosphatase, de-phosphorylates serine 1981 of ATM during the DNA damage response. Squalene has been proposed to complement anticancer therapies such as chemotherapy and radiotherapy; however, there is little mechanistic information supporting this idea. Here, we report the inhibitory effect of squalene on ATM-dependent DNA damage signals. Squalene itself did not affect cell viability and the cell cycle of A549 cells, but it enhanced the cytotoxicity of gamma-irradiation (γIR). The in vitro kinase activity of ATM was not altered by squalene. However, squalene increased Wip1 expression in cells and suppressed ATM activation in γIR-treated cells. Consistent with the potential inhibition of ATM by squalene, IR-induced phosphorylation of ATM effectors such as p53 (Ser15) and Chk1 (Ser317) was inhibited by cell treatment with squalene. Thus, squalene inhibits the ATM-dependent signaling pathway following DNA damage through intracellular induction of Wip1 expression.

Temperature-dependent thermal conductivities of one-dimensional nonlinear Klein-Gordon lattices with a soft on-site potential

NASA Astrophysics Data System (ADS)

Yang, Linlin; Li, Nianbei; Li, Baowen

2014-12-01

The temperature-dependent thermal conductivities of one-dimensional nonlinear Klein-Gordon lattices with soft on-site potential (soft-KG) are investigated systematically. Similarly to the previously studied hard-KG lattices, the existence of renormalized phonons is also confirmed in soft-KG lattices. In particular, the temperature dependence of the renormalized phonon frequency predicted by a classical field theory is verified by detailed numerical simulations. However, the thermal conductivities of soft-KG lattices exhibit the opposite trend in temperature dependence in comparison with those of hard-KG lattices. The interesting thing is that the temperature-dependent thermal conductivities of both soft- and hard-KG lattices can be interpreted in the same framework of effective phonon theory. According to the effective phonon theory, the exponents of the power-law dependence of the thermal conductivities as a function of temperature are only determined by the exponents of the soft or hard on-site potentials. These theoretical predictions are consistently verified very well by extensive numerical simulations.

Attomolar quantitation of Mycobacterium tuberculosis by asymmetric helicase-dependent isothermal DNA-amplification and electrochemical detection.

PubMed

Barreda-García, Susana; González-Álvarez, María José; de-Los-Santos-Álvarez, Noemí; Palacios-Gutiérrez, Juan José; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

2015-06-15

A highly sensitive and robust method for the quantification of specific DNA sequences based on coupling asymmetric helicase-dependent DNA amplification to electrochemical detection is described. This method relies on the entrapment of the amplified ssDNA sequences on magnetic beads followed by a post-amplification hybridization assay to provide an added degree of specificity. As a proof-of-concept a 84-bases long sequence specific of Mycobacterium tuberculosis is amplified at 65°C, providing 3×10(6) amplification after 90 min. Using this system 0.5 aM, corresponding to 15 copies of the target gene in 50 µL of sample, can be successfully detected and reliably quantified under isothermal conditions in less than 4h. The assay has been applied to the detection of M. tuberculosis in sputum, pleural fluid and urine samples. Besides this application, the proposed assays is a powerful and general tool for molecular diagnostic that can be applied to the detection of other specific DNA sequences, taking full advantage of the plethora of genomic information now available. Copyright © 2014 Elsevier B.V. All rights reserved.

Deoxyinosine triphosphate induces MLH1/PMS2- and p53-dependent cell growth arrest and DNA instability in mammalian cells

PubMed Central

Yoneshima, Yasuto; Abolhassani, Nona; Iyama, Teruaki; Sakumi, Kunihiko; Shiomi, Naoko; Mori, Masahiko; Shiomi, Tadahiro; Noda, Tetsuo; Tsuchimoto, Daisuke; Nakabeppu, Yusaku

2016-01-01

Deoxyinosine (dI) occurs in DNA either by oxidative deamination of a previously incorporated deoxyadenosine residue or by misincorporation of deoxyinosine triphosphate (dITP) from the nucleotide pool during replication. To exclude dITP from the pool, mammals possess specific hydrolysing enzymes, such as inosine triphosphatase (ITPA). Previous studies have shown that deficiency in ITPA results in cell growth suppression and DNA instability. To explore the mechanisms of these phenotypes, we analysed ITPA-deficient human and mouse cells. We found that both growth suppression and accumulation of single-strand breaks in nuclear DNA of ITPA-deficient cells depended on MLH1/PMS2. The cell growth suppression of ITPA-deficient cells also depended on p53, but not on MPG, ENDOV or MSH2. ITPA deficiency significantly increased the levels of p53 protein and p21 mRNA/protein, a well-known target of p53, in an MLH1-dependent manner. Furthermore, MLH1 may also contribute to cell growth arrest by increasing the basal level of p53 activity. PMID:27618981

Temperature Dependence of the Thermal Conductivity of Single Wall Carbon Nanotubes

NASA Technical Reports Server (NTRS)

Osman, Mohamed A.; Srivastava, Deepak

2000-01-01

The thermal conductivity of several single wall carbon nanotubes (CNT) has been calculated over a temperature range of 100-500 K using molecular dynamics simulations with Tersoff-Brenner potential for C-C interactions. In all cases, starting from similar values at 100K, thermal conductivities show a peaking behavior before falling off at higher temperatures. The peak position shifts to higher temperatures for nanotubes of larger diameter, and no significant dependence on the tube chirality is observed. It is shown that this phenomenon is due to onset of Umklapp scattering, which shifts to higher temperatures for nanotubes of larger diameter.

Reconstitution of Saccharomyces cerevisiae DNA polymerase ε-dependent mismatch repair with purified proteins.

PubMed

Bowen, Nikki; Kolodner, Richard D

2017-04-04

Mammalian and Saccharomyces cerevisiae mismatch repair (MMR) proteins catalyze two MMR reactions in vitro. In one, mispair binding by either the MutS homolog 2 (Msh2)-MutS homolog 6 (Msh6) or the Msh2-MutS homolog 3 (Msh3) stimulates 5' to 3' excision by exonuclease 1 (Exo1) from a single-strand break 5' to the mispair, excising the mispair. In the other, Msh2-Msh6 or Msh2-Msh3 activate the MutL homolog 1 (Mlh1)-postmeiotic segregation 1 (Pms1) endonuclease in the presence of a mispair and a nick 3' to the mispair, to make nicks 5' to the mispair, allowing Exo1 to excise the mispair. DNA polymerase δ (Pol δ) is thought to catalyze DNA synthesis to fill in the gaps resulting from mispair excision. However, colocalization of the S. cerevisiae mispair recognition proteins with the replicative DNA polymerases during DNA replication has suggested that DNA polymerase ε (Pol ε) may also play a role in MMR. Here we describe the reconstitution of Pol ε-dependent MMR using S. cerevisiae proteins. A mixture of Msh2-Msh6 (or Msh2-Msh3), Exo1, RPA, RFC-Δ1N, PCNA, and Pol ε was found to catalyze both short-patch and long-patch 5' nick-directed MMR of a substrate containing a +1 (+T) mispair. When the substrate contained a nick 3' to the mispair, a mixture of Msh2-Msh6 (or Msh2-Msh3), Exo1, RPA, RFC-Δ1N, PCNA, and Pol ε was found to catalyze an MMR reaction that required Mlh1-Pms1. These results demonstrate that Pol ε can act in eukaryotic MMR in vitro.

Comparison of three DNA extraction kits to establish maximum yield and quality of coral-associated microbial DNA

USGS Publications Warehouse

Baker, Erin J.; Kellogg, Christina A.

2014-01-01

Coral microbiology is an expanding field, yet there is no standard DNA extraction protocol. Although many researchers depend on commercial extraction kits, no specific kit has been optimized for use with coral samples. Both soil and plant DNA extraction kits from MO BIO Laboratories, Inc., have been used by many research groups for this purpose. MO BIO recently replaced their PowerPlant® kit with an improved PowerPlantPro kit, but it was unclear how these changes would affect the kit’s use with coral samples. In order to determine which kit produced the best results, we conducted a comparison between the original PowerPlant kit, the new PowerPlantPro kit, and an alternative kit, PowerSoil, using samples from several different coral genera. The PowerPlantPro kit had the highest DNA yields, but the lack of 16S rRNA gene amplification in many samples suggests that much of the yield may be coral DNA rather than microbial DNA. The most consistent positive amplifications came from the PowerSoil kit.

DNA compaction in the early part of the SOS response is dependent on RecN and RecA.

PubMed

Odsbu, Ingvild; Skarstad, Kirsten

2014-05-01

The nucleoids of undamaged Escherichia coli cells have a characteristic shape and number, which is dependent on the growth medium. Upon induction of the SOS response by a low dose of UV irradiation an extensive reorganization of the nucleoids occurred. Two distinct phases were observed by fluorescence microscopy. First, the nucleoids were found to change shape and fuse into compact structures at midcell. The compaction of the nucleoids lasted for 10-20 min and was followed by a phase where the DNA was dispersed throughout the cells. This second phase lasted for ~1 h. The compaction was found to be dependent on the recombination proteins RecA, RecO and RecR as well as the SOS-inducible, SMC (structural maintenance of chromosomes)-like protein RecN. RecN protein is produced in high amounts during the first part of the SOS response. It is possible that the RecN-mediated 'compact DNA' stage at the beginning of the SOS response serves to stabilize damaged DNA prior to recombination and repair.

Enhanced field-dependent conductivity of magnetorheological gels with low-doped carbon nanotubes

NASA Astrophysics Data System (ADS)

Qu, Hang; Yu, Miao; Fu, Jie; Yang, Pingan; Liu, Yuxuan

2017-10-01

Magnetorheological gels (MRG) exhibit field-dependent conductivity and controllable mechanical properties. In order to extend their application field, filling a large number of traditional conductive materials is the most common means to enhance the poor conductivity of MRG. In this study, the conductivity of MRG is improved by low-doped carbon nanotubes (CNTs). The influence of CNTs on the magnetoresistance of MRG is discussed from two aspects—the improvement in electrical conductivity and the magnetic sensitivity of conductivity variation. The percolation threshold of CNTs in MRG should be between 1 wt% and 2 wt%. The conductivity of a 4 wt% CNT-doped sample increases more than 28 000 times compared with pure MRG. However, there is a cliff-like drop for the range and rate of conductivity variation when the doping amount of CNTs is between 3 wt% and 4 wt%. Therefore, it is concluded that the optimal mass fraction of CNTs is 3%, which can maintain a suitable variation range and a strong conductivity. Compared with pure MRG, its conductivity increases by at least two orders of magnitude. Finally, a sketch of particle motion simulation is developed to understand the improving mechanism and the effect of CNTs.

Toehold-mediated strand displacement reaction-dependent fluorescent strategy for sensitive detection of uracil-DNA glycosylase activity.

PubMed

Wu, Yushu; Wang, Lei; Jiang, Wei

2017-03-15

Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.

DNA-dependent protein kinase is a molecular target for the development of noncytotoxic radiation-sensitizing drugs.

PubMed

Shinohara, Eric T; Geng, Ling; Tan, Jiahui; Chen, Heidi; Shir, Yu; Edwards, Eric; Halbrook, James; Kesicki, Edward A; Kashishian, Adam; Hallahan, Dennis E

2005-06-15

DNA-dependent protein kinase (DNA-PK)-defective severe combined immunodeficient (SCID) mice have a greater sensitivity to ionizing radiation compared with wild-type mice due to deficient repair of DNA double-strand break. SCID cells were therefore studied to determine whether radiosensitization by the specific inhibitor of DNA-PK, IC87361, is eliminated in the absence of functional DNA-PK. IC87361 enhanced radiation sensitivity in wild-type C57BL6 endothelial cells but not in SCID cells. The tumor vascular window model was used to assess IC87361-induced radiosensitization of SCID and wild-type tumor microvasculature. Vascular density was 5% in irradiated SCID host compared with 50% in C57BL6 mice (P < 0.05). IC87361 induced radiosensitization of tumor microvasculature in wild-type mice that resembled the radiosensitive phenotype of tumor vessels in SCID mice. Radiosensitization by IC87361 was eliminated in SCID tumor vasculature, which lack functional DNA-PK. Irradiated LLC and B16F0 tumors implanted into SCID mice showed greater tumor growth delay compared with tumors implanted into either wild-type C57BL6 or nude mice. Furthermore, LLC tumors treated with radiation and IC87361 showed tumor growth delay that was significantly greater than tumors treated with radiation alone (P < 0.01 for 3 Gy alone versus 3 Gy + IC87361). DNA-PK inhibitors induced no cytotoxicity and no toxicity in mouse normal tissues. Mouse models deficient in enzyme activity are useful to assess the specificity of novel kinase inhibitors. DNA-PK is an important target for the development of novel radiation-sensitizing drugs that have little intrinsic cytotoxicity.

Checkpoint Kinase-Dependent Regulation of DNA Repair and Genome Instability in Breast Cancer

DTIC Science & Technology

2009-06-01

4A-mediated ubiquitination and deg- radation. J. Biol. Chem. 276:48175–48182. 14. Chu, G., and E. Chang. 1988. Xeroderma pigmentosum group E cells lack...a nuclear factor that binds to damaged DNA. Science 242:564–567. 15. Cleaver, J. E. 2005. Cancer in xeroderma pigmentosum and related disorders of...28. Hwang, B. J., J. M. Ford, P. C. Hanawalt, and G. Chu. 1999. Expression of the p48 xeroderma pigmentosum gene is p53-dependent and is involved in

Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stingele, Julian; Bellelli, Roberto; Alte, Ferdinand

Covalent DNA-protein crosslinks (DPCs) are toxic DNA lesions that interfere with essential chromatin transactions, such as replication and transcription. Little was known about DPC-specific repair mechanisms until the recent identification of a DPC-processing protease in yeast. The existence of a DPC protease in higher eukaryotes is inferred from data in Xenopus laevis egg extracts, but its identity remains elusive. Here we identify the metalloprotease SPRTN as the DPC protease acting in metazoans. Loss of SPRTN results in failure to repair DPCs and hypersensitivity to DPC-inducing agents. SPRTN accomplishes DPC processing through a unique DNA-induced protease activity, which is controlled bymore » several sophisticated regulatory mechanisms. Cellular, biochemical, and structural studies define a DNA switch triggering its protease activity, a ubiquitin switch controlling SPRTN chromatin accessibility, and regulatory autocatalytic cleavage. Our data also provide a molecular explanation on how SPRTN deficiency causes the premature aging and cancer predisposition disorder Ruijs-Aalfs syndrome.« less

Mechanism and Regulation of DNA-Protein Crosslink Repair by the DNA-Dependent Metalloprotease SPRTN

DOE PAGES

Stingele, Julian; Bellelli, Roberto; Alte, Ferdinand; ...

2016-10-27

Covalent DNA-protein crosslinks (DPCs) are toxic DNA lesions that interfere with essential chromatin transactions, such as replication and transcription. Little was known about DPC-specific repair mechanisms until the recent identification of a DPC-processing protease in yeast. The existence of a DPC protease in higher eukaryotes is inferred from data in Xenopus laevis egg extracts, but its identity remains elusive. Here we identify the metalloprotease SPRTN as the DPC protease acting in metazoans. Loss of SPRTN results in failure to repair DPCs and hypersensitivity to DPC-inducing agents. SPRTN accomplishes DPC processing through a unique DNA-induced protease activity, which is controlled bymore » several sophisticated regulatory mechanisms. Cellular, biochemical, and structural studies define a DNA switch triggering its protease activity, a ubiquitin switch controlling SPRTN chromatin accessibility, and regulatory autocatalytic cleavage. Our data also provide a molecular explanation on how SPRTN deficiency causes the premature aging and cancer predisposition disorder Ruijs-Aalfs syndrome.« less

Efficient removal of cyclobutane pyrimidine dimers in barley: differential contribution of light-dependent and dark DNA repair pathways.

PubMed

Manova, Vasilissa; Georgieva, Ralitsa; Borisov, Borislav; Stoilov, Lubomir

2016-10-01

Barley stress response to ultraviolet radiation (UV) has been intensively studied at both the physiological and morphological level. However, the ability of barley genome to repair UV-induced lesions at the DNA level is far less characterized. In this study, we have investigated the relative contribution of light-dependent and dark DNA repair pathways for the efficient elimination of cyclobutane pyrimidine dimers (CPDs) from the genomic DNA of barley leaf seedlings. The transcriptional activity of barley CPD photolyase gene in respect to the light-growth conditions and UV-C irradiation of the plants has also been analyzed. Our results show that CPDs induced in the primary barley leaf at frequencies potentially damaging DNA at the single-gene level are removed efficiently and exclusively by photorepair pathway, whereas dark repair is hardly detectable, even at higher CPD frequency. A decrease of initially induced CPDs under dark is observed but only after prolonged incubation, suggesting the activation of light-independent DNA damage repair and/or tolerance mechanisms. The green barley seedlings possess greater capacity for CPD photorepair than the etiolated ones, with efficiency of CPD removal dependent on the intensity and quality of recovering light. The higher repair rate of CPDs measured in the green leaves correlates with the higher transcriptional activity of barley CPD photolyase gene. Visible light and UV-C radiation affect differentially the expression of CPD photolyase gene particularly in the etiolated leaves. We propose that the CPD repair potential of barley young seedlings may influence their response to UV-stress. © 2016 Scandinavian Plant Physiology Society.

A novel single-stranded DNA detection method based on organic semiconductor heterojunction

NASA Astrophysics Data System (ADS)

Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun

2016-12-01

We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.

Reduced temperature-dependent thermal conductivity of magnetite thin films by controlling film thickness

PubMed Central

2014-01-01

We report on the out-of-plane thermal conductivities of epitaxial Fe3O4 thin films with thicknesses of 100, 300, and 400 nm, prepared using pulsed laser deposition (PLD) on SiO2/Si substrates. The four-point probe three-omega (3-ω) method was used for thermal conductivity measurements of the Fe3O4 thin films in the temperature range of 20 to 300 K. By measuring the temperature-dependent thermal characteristics of the Fe3O4 thin films, we realized that their thermal conductivities significantly decreased with decreasing grain size and thickness of the films. The out-of-plane thermal conductivities of the Fe3O4 films were found to be in the range of 0.52 to 3.51 W/m · K at 300 K. For 100-nm film, we found that the thermal conductivity was as low as approximately 0.52 W/m · K, which was 1.7 to 11.5 order of magnitude lower than the thermal conductivity of bulk material at 300 K. Furthermore, we calculated the temperature dependence of the thermal conductivity of these Fe3O4 films using a simple theoretical Callaway model for comparison with the experimental data. We found that the Callaway model predictions agree reasonably with the experimental data. We then noticed that the thin film-based oxide materials could be efficient thermoelectric materials to achieve high performance in thermoelectric devices. PMID:24571956

Empowering Malaysian dentists to tobacco dependence treatment conduct.

PubMed

Nordin, Amer Siddiq Amer; Kadir, Rahimah Abdul; Yahya, Nurul Asyikin; Zakaria, Hazli; Rashid, Rusdi Abdul; Habil, Mohamed Hussain

2014-08-01

As a signatory to the World Health Organisation 2003 Framework Convention on Tobacco Control, Malaysia has policies in place and funded 300 public Quit clinics. Unfortunately, government dentists are not included to run tobacco dependence treatment. A cross-sectional exploratory survey was carried out to seek Malaysian dentists' opinion on their knowledge, perception and willingness to conduct tobacco dependence treatment. Participation was voluntary from those who attended a specially designed one-day, four-module workshop on tobacco cessation intervention. Data were collected using the Audience-Response-System equipment which tracked immediate responses covering four domains namely: smoking as a public health problem, smoking as an addiction, the role of dentists in the programme and confidence in conducting smoking cessation in the clinic. Sample comprised more female dentists (73.5%), mean age 33.6 (SD 8.99) years and with more than 3 years working experience. Findings indicated that the majority agreed Malaysia has a rising problem in the prevalence of smoking (71.6%) and predicted that it will affect mostly the young (81.9%). Only half of the dentists surveyed (58.9%) routinely recorded their patients' smoking habits. The majority (71.6%) believed that dentists are effective in helping their patient to stop smoking and 76.3% agreed that dentists should discuss the smoking habit with their patients; however, 60% agreed that doing so is too time consuming. In addition, only 24.7% knew of more ways to treat a smoking habit. The majority felt comfortable giving advice to patients about changing their habits (76.5%) or discussing treatment options (60.5%): 75% would opt for a combined programme of counselling and use of medication if they have to do, 15% would choose to go on counselling only, while 8% did not want to treat. In conclusion, the findings suggest that dentists have a strong potential to contribute significantly to providing smoking cessation

RPA coordinates DNA end resection and prevents formation of DNA hairpins.

PubMed

Chen, Huan; Lisby, Michael; Symington, Lorraine S

2013-05-23

Replication protein A (RPA) is an essential eukaryotic single-stranded DNA binding protein with a central role in DNA metabolism. RPA directly participates in DNA double-strand break repair by stimulating 5'-3' end resection by the Sgs1/BLM helicase and Dna2 endonuclease in vitro. Here we investigated the role of RPA in end resection in vivo, using a heat-inducible degron system that allows rapid conditional depletion of RPA in Saccharomyces cerevisiae. We found that RPA depletion eliminated both the Sgs1-Dna2- and Exo1-dependent extensive resection pathways and synergized with mre11Δ to prevent end resection. The short single-stranded DNA tails formed in the absence of RPA were unstable due to 3' strand loss and the formation of fold-back hairpin structures that required resection initiation and Pol32-dependent DNA synthesis. Thus, RPA is required to generate ssDNA, and also to protect ssDNA from degradation and inappropriate annealing that could lead to genome rearrangements. Copyright © 2013 Elsevier Inc. All rights reserved.

Interaction of BRCA1 With the DNA-Dependent Protein Kinase

DTIC Science & Technology

2004-09-01

involved in mounting an innate immune response to bacterial DNA and to viral infection. For a detailed review see (1). The most important role of DNA-PK...arise within the cell, DNA double-strand breaks (DSBs) are particularly dangerous as they can lead to cell death or cancer if improperly repaired...DNA-PK is known to associate with and phosphorylate (Shao et al., 1999). Methods Cell culture and drug treatments HeLa and normal human skin

Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins

NASA Astrophysics Data System (ADS)

Dahlke, K.; Sing, C. E.

2018-02-01

Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.

Dose-Dependent AMPK-Dependent and Independent Mechanisms of Berberine and Metformin Inhibition of mTORC1, ERK, DNA Synthesis and Proliferation in Pancreatic Cancer Cells

PubMed Central

Ming, Ming; Sinnett-Smith, James; Wang, Jia; Soares, Heloisa P.; Young, Steven H.; Eibl, Guido; Rozengurt, Enrique

2014-01-01

Natural products represent a rich reservoir of potential small chemical molecules exhibiting anti-proliferative and chemopreventive properties. Here, we show that treatment of pancreatic ductal adenocarcinoma (PDAC) cells (PANC-1, MiaPaCa-2) with the isoquinoline alkaloid berberine (0.3–6 µM) inhibited DNA synthesis and proliferation of these cells and delay the progression of their cell cycle in G1. Berberine treatment also reduced (by 70%) the growth of MiaPaCa-2 cell growth when implanted into the flanks of nu/nu mice. Mechanistic studies revealed that berberine decreased mitochondrial membrane potential and intracellular ATP levels and induced potent AMPK activation, as shown by phosphorylation of AMPK α subunit at Thr-172 and acetyl-CoA carboxylase (ACC) at Ser79. Furthermore, berberine dose-dependently inhibited mTORC1 (phosphorylation of S6K at Thr389 and S6 at Ser240/244) and ERK activation in PDAC cells stimulated by insulin and neurotensin or fetal bovine serum. Knockdown of α1 and α2 catalytic subunit expression of AMPK reversed the inhibitory effect produced by treatment with low concentrations of berberine on mTORC1, ERK and DNA synthesis in PDAC cells. However, at higher concentrations, berberine inhibited mitogenic signaling (mTORC1 and ERK) and DNA synthesis through an AMPK-independent mechanism. Similar results were obtained with metformin used at doses that induced either modest or pronounced reductions in intracellular ATP levels, which were virtually identical to the decreases in ATP levels obtained in response to berberine. We propose that berberine and metformin inhibit mitogenic signaling in PDAC cells through dose-dependent AMPK-dependent and independent pathways. PMID:25493642

A time-dependent model to determine the thermal conductivity of a nanofluid

NASA Astrophysics Data System (ADS)

Myers, T. G.; MacDevette, M. M.; Ribera, H.

2013-07-01

In this paper, we analyse the time-dependent heat equations over a finite domain to determine expressions for the thermal diffusivity and conductivity of a nanofluid (where a nanofluid is a fluid containing nanoparticles with average size below 100 nm). Due to the complexity of the standard mathematical analysis of this problem, we employ a well-known approximate solution technique known as the heat balance integral method. This allows us to derive simple analytical expressions for the thermal properties, which appear to depend primarily on the volume fraction and liquid properties. The model is shown to compare well with experimental data taken from the literature even up to relatively high concentrations and predicts significantly higher values than the Maxwell model for volume fractions approximately >1 %. The results suggest that the difficulty in reproducing the high values of conductivity observed experimentally may stem from the use of a static heat flow model applied over an infinite domain rather than applying a dynamic model over a finite domain.

Conducting antireflection coatings with low polarization dependent loss for telecommunication applications.

PubMed

Dobrowolski, J; Ford, Joseph; Sullivan, Brian; Lu, Liping; Osborne, Norman

2004-12-13

Conducting optical coatings for the visible light range are commonly made of Indium Tin Oxide (ITO), but ITO is unsuitable for near-infrared telecommunications wavelengths because it can become absorptive after extended illumination. In this paper we show an alternative approach which uses conventional coating materials to create either non-conducting or conducting antireflection (AR) coatings that are effective over a fairly broad spectral region ( lambdalong/lambdashort approximately 1.40) and also usable for a wide range of angles of incidence (0-38 masculine, or 0-55 masculine) in the telecom wavelength range. Not only is the transmittance of windows treated with such coatings quite high, but they can be made to have extreme polarization independence (low polarization dependent loss values). A number of such coating designs are presented in the paper. A prototype of one of the conducting AR coating designs was fabricated and the measurements were found to be in reasonable agreement with the calculated performance. Such AR coatings should be of interest for telecommunication applications and especially for anti-static hermetic packaging of MEMS devices such as optical switches.

RecA-Dependent DNA Repair Results in Increased Heteroplasmy of the Arabidopsis Mitochondrial Genome1[C][W

PubMed Central

Miller-Messmer, Marie; Kühn, Kristina; Bichara, Marc; Le Ret, Monique; Imbault, Patrice; Gualberto, José M.

2012-01-01

Plant mitochondria have very active DNA recombination activities that are responsible for its plastic structures and that should be involved in the repair of double-strand breaks in the mitochondrial genome. Little is still known on plant mitochondrial DNA repair, but repair by recombination is believed to be a major determinant in the rapid evolution of plant mitochondrial genomes. In flowering plants, mitochondria possess at least two eubacteria-type RecA proteins that should be core components of the mitochondrial repair mechanisms. We have performed functional analyses of the two Arabidopsis (Arabidopsis thaliana) mitochondrial RecAs (RECA2 and RECA3) to assess their potential roles in recombination-dependent repair. Heterologous expression in Escherichia coli revealed that RECA2 and RECA3 have overlapping as well as specific activities that allow them to partially complement bacterial repair pathways. RECA2 and RECA3 have similar patterns of expression, and mutants of either display the same molecular phenotypes of increased recombination between intermediate-size repeats, thus suggesting that they act in the same recombination pathways. However, RECA2 is essential past the seedling stage and should have additional important functions. Treatment of plants with several DNA-damaging drugs further showed that RECA3 is required for different recombination-dependent repair pathways that significantly contribute to plant fitness under stress. Replication repair of double-strand breaks results in the accumulation of crossovers that increase the heteroplasmic state of the mitochondrial DNA. It was shown that these are transmitted to the plant progeny, enhancing the potential for mitochondrial genome evolution. PMID:22415515

Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery

PubMed Central

Coelho-Castelo, AAM; Trombone, AP; Rosada, RS; Santos, RR; Bonato, VLD; Sartori, A; Silva, CL

2006-01-01

In order to assess a new strategy of DNA vaccine for a more complete understanding of its action in immune response, it is important to determine the in vivo biodistribution fate and antigen expression. In previous studies, our group focused on the prophylactic and therapeutic use of a plasmid DNA encoding the Mycobacterium leprae 65-kDa heat shock protein (Hsp65) and achieved an efficient immune response induction as well as protection against virulent M. tuberculosis challenge. In the present study, we examined in vivo tissue distribution of naked DNA-Hsp65 vaccine, the Hsp65 message, genome integration and methylation status of plasmid DNA. The DNA-Hsp65 was detectable in several tissue types, indicating that DNA-Hsp65 disseminates widely throughout the body. The biodistribution was dose-dependent. In contrast, RT-PCR detected the Hsp65 message for at least 15 days in muscle or liver tissue from immunized mice. We also analyzed the methylation status and integration of the injected plasmid DNA into the host cellular genome. The bacterial methylation pattern persisted for at least 6 months, indicating that the plasmid DNA-Hsp65 does not replicate in mammalian tissue, and Southern blot analysis showed that plasmid DNA was not integrated. These results have important implications for the use of DNA-Hsp65 vaccine in a clinical setting and open new perspectives for DNA vaccines and new considerations about the inoculation site and delivery system. PMID:16445866

Instabilities of thin layers of conducting fluids produced by time dependent magnetic fields

NASA Astrophysics Data System (ADS)

Burguete, Javier

2011-11-01

We present the recent results of an experiment where thin layers of conducting fluids are forced by time-dependent magnetic fields perpendicular to their surface. We use as conducting fluid an In-Ga-Sn alloy, immersed in a 5% hydrocloric acid solution to prevent oxidation. The conducting layers have a circular shape, and are placed inside a set-up that produces the vertical magnetic field. Due to MHD effects, the competition between the Lorentz force and gravity triggers an instability of the free surface. The shape of this surface can adopt many different configurations, with a very rich dynamics, presenting azimuthal wave numbers between 3 and 8 for the explored parameters. The magnetic field evolves harmonically with a frequency up to 10Hz, small enough to not to observe skin depth effects and with a magnitude up to 0.1 T. Different resonant regions have been observed, for narrow windows of the forcing frequency. We have analysed the existence of thresholds for these instabilities, depending on the wave number and experimental parameters. These results are compared with others present in the literature.

N-terminal-mediated oligomerization of DnaA drives the occupancy-dependent rejuvenation of the protein on the membrane.

PubMed

Aranovich, Alexander; Braier-Marcovitz, Shani; Ansbacher, Esti; Granek, Rony; Parola, Abraham H; Fishov, Itzhak

2015-08-13

DnaA, the initiator of chromosome replication in most known eubacteria species, is activated once per cell division cycle. Its overall activity cycle is driven by ATP hydrolysis and ADP-ATP exchange. The latter can be promoted by binding to specific sequences on the chromosome and/or to acidic phospholipids in the membrane. We have previously shown that the transition into an active form (rejuvenation) is strongly co-operative with respect to DnaA membrane occupancy. Only at low membrane occupancy is DnaA reactivation efficiently catalysed by the acidic phospholipids. The present study was aimed at unravelling the molecular mechanism underlying the occupancy-dependent DnaA rejuvenation. We found that truncation of the DnaA N-terminal completely abolishes the co-operative transformation between the high and low occupancy states (I and II respectively) without affecting the membrane binding. The environmentally sensitive fluorophore specifically attached to the N-terminal cysteines of DnaA reported on occupancy-correlated changes in its vicinity. Cross-linking of DnaA with a short homobifunctional reagent revealed that state II of the protein on the membrane corresponds to a distinct oligomeric form of DnaA. The kinetic transition of DnaA on the membrane surface is described in the present study by a generalized 2D condensation phase transition model, confirming the existence of two states of DnaA on the membrane and pointing to the possibility that membrane protein density serves as an on-off switch in vivo. We conclude that the DnaA conformation attained at low surface density drives its N-terminal-mediated oligomerization, which is presumably a pre-requisite for facilitated nt exchange. © 2015 Authors.

Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

PubMed Central

Seco, Elena M.

2017-01-01

Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

Changes in DnaA-dependent gene expression contribute to the transcriptional and developmental response of Bacillus subtilis to manganese limitation in Luria-Bertani medium.

PubMed

Hoover, Sharon E; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F

2010-08-01

The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress.

The Vaccine Adjuvant Chitosan Promotes Cellular Immunity via DNA Sensor cGAS-STING-Dependent Induction of Type I Interferons.

PubMed

Carroll, Elizabeth C; Jin, Lei; Mori, Andres; Muñoz-Wolf, Natalia; Oleszycka, Ewa; Moran, Hannah B T; Mansouri, Samira; McEntee, Craig P; Lambe, Eimear; Agger, Else Marie; Andersen, Peter; Cunningham, Colm; Hertzog, Paul; Fitzgerald, Katherine A; Bowie, Andrew G; Lavelle, Ed C

2016-03-15

The cationic polysaccharide chitosan is an attractive candidate adjuvant capable of driving potent cell-mediated immunity, but the mechanism by which it acts is not clear. We show that chitosan promotes dendritic cell maturation by inducing type I interferons (IFNs) and enhances antigen-specific T helper 1 (Th1) responses in a type I IFN receptor-dependent manner. The induction of type I IFNs, IFN-stimulated genes and dendritic cell maturation by chitosan required the cytoplasmic DNA sensor cGAS and STING, implicating this pathway in dendritic cell activation. Additionally, this process was dependent on mitochondrial reactive oxygen species and the presence of cytoplasmic DNA. Chitosan-mediated enhancement of antigen specific Th1 and immunoglobulin G2c responses following vaccination was dependent on both cGAS and STING. These findings demonstrate that a cationic polymer can engage the STING-cGAS pathway to trigger innate and adaptive immune responses. Copyright © 2016 Elsevier Inc. All rights reserved.

Characterization and dynamic charge dependent modeling of conducting polymer trilayer bending

NASA Astrophysics Data System (ADS)

Farajollahi, Meisam; Sassani, Farrokh; Naserifar, Naser; Fannir, Adelyne; Plesse, Cédric; Nguyen, Giao T. M.; Vidal, Frédéric; Madden, John D. W.

2016-11-01

Trilayer bending actuators are charge driven devices that have the ability to function in air and provide large mechanical amplification. The electronic and mechanical properties of these actuators are known to be functions of their charge state making prediction of their responses more difficult when they operate over their full range of deformation. In this work, a combination of state space representation and a two-dimensional RC transmission line model are used to implement a nonlinear time variant model for conducting polymer-based trilayer actuators. Electrical conductivity and Young’s modulus of electromechanically active PEDOT conducting polymer containing films as a function of applied voltage were measured and incorporated into the model. A 16% drop in Young’s modulus and 24 times increase in conductivity are observed by oxidizing the PEDOT. A closed form formulation for radius of curvature of trilayer actuators considering asymmetric and location dependent Young’s modulus and conductivity in the conducting polymer layers is derived and implemented in the model. The nonlinear model shows the capability to predict the radius of curvature as a function of time and position with reasonable consistency (within 4%). The formulation is useful for general trilayer configurations to calculate the radius of curvature as a function of time. The proposed electrochemical modeling approach may also be useful for modeling energy storage devices.

Sequence dependency of canonical base pair opening in the DNA double helix

PubMed Central

Villa, Alessandra

2017-01-01

The flipping-out of a DNA base from the double helical structure is a key step of many cellular processes, such as DNA replication, modification and repair. Base pair opening is the first step of base flipping and the exact mechanism is still not well understood. We investigate sequence effects on base pair opening using extensive classical molecular dynamics simulations targeting the opening of 11 different canonical base pairs in two DNA sequences. Two popular biomolecular force fields are applied. To enhance sampling and calculate free energies, we bias the simulation along a simple distance coordinate using a newly developed adaptive sampling algorithm. The simulation is guided back and forth along the coordinate, allowing for multiple opening pathways. We compare the calculated free energies with those from an NMR study and check assumptions of the model used for interpreting the NMR data. Our results further show that the neighboring sequence is an important factor for the opening free energy, but also indicates that other sequence effects may play a role. All base pairs are observed to have a propensity for opening toward the major groove. The preferred opening base is cytosine for GC base pairs, while for AT there is sequence dependent competition between the two bases. For AT opening, we identify two non-canonical base pair interactions contributing to a local minimum in the free energy profile. For both AT and CG we observe long-lived interactions with water and with sodium ions at specific sites on the open base pair. PMID:28369121

ATR-dependent phosphorylation of FANCA on serine 1449 after DNA damage is important for FA pathway function

PubMed Central

Collins, Natalie B.; Wilson, James B.; Bush, Thomas; Thomashevski, Andrei; Roberts, Kate J.; Jones, Nigel J.

2009-01-01

Previous work has shown several proteins defective in Fanconi anemia (FA) are phosphorylated in a functionally critical manner. FANCA is phosphorylated after DNA damage and localized to chromatin, but the site and significance of this phosphorylation are unknown. Mass spectrometry of FANCA revealed one phosphopeptide, phosphorylated on serine 1449. Serine 1449 phosphorylation was induced after DNA damage but not during S phase, in contrast to other posttranslational modifications of FA proteins. Furthermore, the S1449A mutant failed to completely correct a variety of FA-associated phenotypes. The DNA damage response is coordinated by phosphorylation events initiated by apical kinases ATM (ataxia telangectasia mutated) and ATR (ATM and Rad3-related), and ATR is essential for proper FA pathway function. Serine 1449 is in a consensus ATM/ATR site, phosphorylation in vivo is dependent on ATR, and ATR phosphorylated FANCA on serine 1449 in vitro. Phosphorylation of FANCA on serine 1449 is a DNA damage–specific event that is downstream of ATR and is functionally important in the FA pathway. PMID:19109555

The pH-dependent elastic properties of nanoscale DNA films and the resultant bending signals for microcantilever biosensors.

PubMed

Zhou, Mei-Hong; Meng, Wei-Lie; Zhang, Cheng-Yin; Li, Xiao-Bin; Wu, Jun-Zheng; Zhang, Neng-Hui

2018-04-25

The diverse mechanical properties of nanoscale DNA films on solid substrates have a close correlation with complex detection signals of micro-/nano-devices. This paper is devoted to formulating several multiscale models to study the effect of pH-dependent ionic inhomogeneity on the graded elastic properties of nanoscale DNA films and the resultant bending deflections of microcantilever biosensors. First, a modified inverse Debye length is introduced to improve the classical Poisson-Boltzmann equation for the electrical potential of DNA films to consider the inhomogeneous effect of hydrogen ions. Second, the graded characteristics of the particle distribution are taken into consideration for an improvement in Parsegian's mesoscopic potential for both attraction-dominated and repulsion-dominated films. Third, by the improved interchain interaction potential and the thought experiment about the compression of a macroscopic continuum DNA bar, we investigate the diversity of the elastic properties of single-stranded DNA (ssDNA) films due to pH variations. The relevant theoretical predictions quantitatively or qualitatively agree well with the relevant DNA experiments on the electrical potential, film thickness, condensation force, elastic modulus, and microcantilever deflections. The competition between attraction and repulsion among the fixed charges and the free ions endows the DNA film with mechanical properties such as a remarkable size effect and a non-monotonic behavior, and a negative elastic modulus is first revealed in the attraction-dominated ssDNA film. There exists a transition between the pH-sensitive parameter interval and the pH-insensitive one for the bending signals of microcantilevers, which is predominated by the initial stress effect in the DNA film.

Nanoscale size dependence parameters on lattice thermal conductivity of Wurtzite GaN nanowires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mamand, S.M., E-mail: soran.mamand@univsul.net; Omar, M.S.; Muhammad, A.J.

2012-05-15

Graphical abstract: Temperature dependence of calculated lattice thermal conductivity of Wurtzite GaN nanowires. Highlights: Black-Right-Pointing-Pointer A modified Callaway model is used to calculate lattice thermal conductivity of Wurtzite GaN nanowires. Black-Right-Pointing-Pointer A direct method is used to calculate phonon group velocity for these nanowires. Black-Right-Pointing-Pointer 3-Gruneisen parameter, surface roughness, and dislocations are successfully investigated. Black-Right-Pointing-Pointer Dislocation densities are decreases with the decrease of wires diameter. -- Abstract: A detailed calculation of lattice thermal conductivity of freestanding Wurtzite GaN nanowires with diameter ranging from 97 to 160 nm in the temperature range 2-300 K, was performed using a modified Callaway model.more » Both longitudinal and transverse modes are taken into account explicitly in the model. A method is used to calculate the Debye and phonon group velocities for different nanowire diameters from their related melting points. Effect of Gruneisen parameter, surface roughness, and dislocations as structure dependent parameters are successfully used to correlate the calculated values of lattice thermal conductivity to that of the experimentally measured curves. It was observed that Gruneisen parameter will decrease with decreasing nanowire diameters. Scattering of phonons is assumed to be by nanowire boundaries, imperfections, dislocations, electrons, and other phonons via both normal and Umklapp processes. Phonon confinement and size effects as well as the role of dislocation in limiting thermal conductivity are investigated. At high temperatures and for dislocation densities greater than 10{sup 14} m{sup -2} the lattice thermal conductivity would be limited by dislocation density, but for dislocation densities less than 10{sup 14} m{sup -2}, lattice thermal conductivity would be independent of that.« less

DNA methyltransferase mediates dose-dependent stimulation of neural stem cell proliferation by folate.

PubMed

Li, Wen; Yu, Min; Luo, Suhui; Liu, Huan; Gao, Yuxia; Wilson, John X; Huang, Guowei

2013-07-01

The proliferative response of neural stem cells (NSCs) to folate may play a critical role in the development, function and repair of the central nervous system. It is important to determine the dose-dependent effects of folate in NSC cultures that are potential sources of transplantable cells for therapies for neurodegenerative diseases. To determine the optimal concentration and mechanism of action of folate for stimulation of NSC proliferation in vitro, NSCs were exposed to folic acid or 5-methyltetrahydrofolate (5-MTHF) (0-200 μmol/L) for 24, 48 or 72 h. Immunocytochemistry and methyl thiazolyl tetrazolium assay showed that the optimal concentration of folic acid for NSC proliferation was 20-40 μmol/L. Stimulation of NSC proliferation by folic acid was associated with DNA methyltransferase (DNMT) activation and was attenuated by the DNMT inhibitor zebularine, which implies that folate dose-dependently stimulates NSC proliferation through a DNMT-dependent mechanism. Based on these new findings and previously published evidence, we have identified a mechanism by which folate stimulates NSC growth. Copyright © 2013 Elsevier Inc. All rights reserved.

Development of Reverse Transcription Thermostable Helicase-Dependent DNA Amplification for the Detection of Tomato Spotted Wilt Virus.

PubMed

Wu, Xinghai; Chen, Chanfa; Xiao, Xizhi; Deng, Ming Jun

2016-11-01

A protocol for the reverse transcription-helicase-dependent amplification (RT-HDA) of isothermal DNA was developed for the detection of tomato spotted wilt virus (TSWV). Specific primers, which were based on the highly conserved region of the N gene sequence in TSWV, were used for the amplification of virus's RNA. The LOD of RT-HDA, reverse transcriptase-loop-mediated isothermal amplification (RT-LAMP), and reverse transcriptase-polymerase chain reaction (RT-PCR) assays were conducted using 10-fold serial dilution of RNA eluates. TSWV sensitivity in RT-HDA and RT-LAMP was 4 pg RNA compared with 40 pg RNA in RT-PCR. The specificity of RT-HDA for TSWV was high, showing no cross-reactivity with other tomato and Tospovirus viruses including cucumber mosaic virus (CMV), tomato black ring virus (TBRV), tomato mosaic virus (ToMV), or impatiens necrotic spot virus (INSV). The RT-HDA method is effective for the detection of TSWV in plant samples and is a potential tool for early and rapid detection of TSWV.

Conducting antireflection coatings with low polarization dependent loss for telecommunication applications

NASA Astrophysics Data System (ADS)

Dobrowolski, J. A.; Ford, Joseph E.; Sullivan, Brian T.; Lu, Liping; Osborne, Norman R.

2004-12-01

Conducting optical coatings for the visible light range are commonly made of Indium Tin Oxide (ITO), but ITO is unsuitable for near-infrared telecommunications wavelengths because it can become absorptive after extended illumination. In this paper we show an alternative approach which uses conventional coating materials to create either non-conducting or conducting antireflection (AR) coatings that are effective over a fairly broad spectral region ( λlong/λshort ≈ 1.40) and also usable for a wide range of angles of incidence (0-38°, or 0-55°) in the telecom wavelength range. Not only is the transmittance of windows treated with such coatings quite high, but they can be made to have extreme polarization independence (low polarization dependent loss values). A number of such coating designs are presented in the paper. A prototype of one of the conducting AR coating designs was fabricated and the measurements were found to be in reasonable agreement with the calculated performance. Such AR coatings should be of interest for telecommunication applications and especially for anti-static hermetic packaging of MEMS devices such as optical switches.

DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

PubMed

Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

2017-01-11

DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

PTSD, alcohol dependence, and conduct problems: Distinct pathways via lability and disinhibition.

PubMed

Simons, Jeffrey S; Simons, Raluca M; O'Brien, Carol; Stoltenberg, Scott F; Keith, Jessica A; Hudson, Jaime A

2017-01-01

This study tested the role of affect lability and disinhibition in mediating associations between PTSD symptoms and two forms of alcohol-related problems, dependence syndrome symptoms (e.g., impaired control over consumption) and conduct problems (e.g., assault, risk behaviors). Genotype at the serotonin transporter linked polymorphic region (5-HTTLPR) was hypothesized to moderate associations between traumatic stress and PTSD symptoms. In addition, the study tested whether childhood traumatic stress moderated associations between combat trauma and PTSD symptoms. Participants were 270 OIF/OEF/OND veterans. The hypothesized model was largely supported. Participants with the low expression alleles of 5-HTTLPR (S or L G ) exhibited stronger associations between childhood (but not combat) traumatic stress and PTSD symptoms. Affect lability mediated the associations between PTSD symptoms and alcohol dependence symptoms. Behavioral disinhibition mediated associations between PTSD symptoms and conduct related problems. Conditional indirect effects indicated stronger associations between childhood traumatic stress and lability, behavioral disinhibition, alcohol consumption, AUD symptoms, and associated conduct problems via PTSD symptoms among those with the low expression 5-HTTLPR alleles. However, interactions between combat trauma and either childhood trauma or genotype were not significant. The results support the hypothesis that affect lability and behavioral disinhibition are potential intermediate traits with distinct associations with AUD and associated externalizing problems. Copyright © 2016 Elsevier Ltd. All rights reserved.

The functional dependence of canopy conductance on water vapor pressure deficit revisited

NASA Astrophysics Data System (ADS)

Fuchs, Marcel; Stanghellini, Cecilia

2018-03-01

Current research seeking to relate between ambient water vapor deficit (D) and foliage conductance (g F ) derives a canopy conductance (g W ) from measured transpiration by inverting the coupled transpiration model to yield g W = m - n ln(D) where m and n are fitting parameters. In contrast, this paper demonstrates that the relation between coupled g W and D is g W = AP/D + B, where P is the barometric pressure, A is the radiative term, and B is the convective term coefficient of the Penman-Monteith equation. A and B are functions of g F and of meteorological parameters but are mathematically independent of D. Keeping A and B constant implies constancy of g F . With these premises, the derived g W is a hyperbolic function of D resembling the logarithmic expression, in contradiction with the pre-set constancy of g F . Calculations with random inputs that ensure independence between g F and D reproduce published experimental scatter plots that display a dependence between g W and D in contradiction with the premises. For this reason, the dependence of g W on D is a computational artifact unrelated to any real effect of ambient humidity on stomatal aperture and closure. Data collected in a maize field confirm the inadequacy of the logarithmic function to quantify the relation between canopy conductance and vapor pressure deficit.

A role for nuclear translocation of tripeptidyl-peptidase II in reactive oxygen species-dependent DNA damage responses.

PubMed

Preta, Giulio; de Klark, Rainier; Glas, Rickard

2009-11-27

Responses to DNA damage are influenced by cellular metabolism through the continuous production of reactive oxygen species (ROS), of which most are by-products of mitochondrial respiration. ROS have a strong influence on signaling pathways during responses to DNA damage, by relatively unclear mechanisms. Previous reports have shown conflicting data on a possible role for tripeptidyl-peptidase II (TPPII), a large cytosolic peptidase, within the DNA damage response. Here we show that TPPII translocated into the nucleus in a p160-ROCK-dependent fashion in response to gamma-irradiation, and that nuclear expression of TPPII was present in most gamma-irradiated transformed cell lines. We used a panel of nine cell lines of diverse tissue origin, including four lymphoma cell lines (T, B and Hodgkins lymphoma), a melanoma, a sarcoma, a colon and two breast carcinomas, where seven out of nine cell lines showed nuclear TPPII expression after gamma-irradiation. Further, this required cellular production of ROS; treatment with either N-acetyl-Cysteine (anti-oxidant) or Rotenone (inhibitor of mitochondrial respiration) inhibited nuclear accumulation of TPPII. The local density of cells was important for nuclear accumulation of TPPII at early time-points following gamma-irradiation (at 1-4h), indicating a bystander effect. Further, we showed that the peptide-based inhibitor Z-Gly-Leu-Ala-OH, but not its analogue Z-Gly-(D)-Leu-Ala-OH, excluded TPPII from the nucleus. This correlated with reduced nuclear expression of p53 as well as caspase-3 and -9 activation in gamma-irradiated lymphoma cells. Our data suggest a role for TPPII in ROS-dependent DNA damage responses, through alteration of its localization from the cytosol into the nucleus.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation.

PubMed

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H; Proukakis, Christos

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array "waves", and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance.

Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

PubMed

Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

2013-11-15

The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

NASA Astrophysics Data System (ADS)

Pandey, Harsh; Underhill, Patrick T.

2015-11-01

The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE PAGES

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

2017-01-16

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

The tilt-dependent potential of mean force of a pair of DNA oligomers from all-atom molecular dynamics simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cortini, Ruggero; Cheng, Xiaolin; Smith, Jeremy C.

Electrostatic interactions between DNA molecules have been extensively studied experimentally and theoretically, but several aspects (e.g. its role in determining the pitch of the cholesteric DNA phase) still remain unclear. Here, we performed large-scale all-atom molecular dynamics simulations in explicit water and 150 mM sodium chloride, to reconstruct the potential of mean force (PMF) of two DNA oligomers 24 base pairs long as a function of their interaxial angle and intermolecular distance. We find that the potential of mean force is dominated by total DNA charge, and not by the helical geometry of its charged groups. The theory of homogeneously charged cylinders fits well all our simulation data, and the fit yields the optimal value of the total compensated charge on DNA to ≈65% of its total fixed charge (arising from the phosphorous atoms), close to the value expected from Manning's theory of ion condensation. The PMF calculated from our simulations does not show a significant dependence on the handedness of the angle between the two DNA molecules, or its size is on the order ofmore » $$1{{k}_{\\text{B}}}T$$ . Thermal noise for molecules of the studied length seems to mask the effect of detailed helical charge patterns of DNA. The fact that in monovalent salt the effective interaction between two DNA molecules is independent on the handedness of the tilt may suggest that alternative mechanisms are required to understand the cholesteric phase of DNA.« less

Changes in DnaA-Dependent Gene Expression Contribute to the Transcriptional and Developmental Response of Bacillus subtilis to Manganese Limitation in Luria-Bertani Medium▿ †

PubMed Central

Hoover, Sharon E.; Xu, Weihong; Xiao, Wenzhong; Burkholder, William F.

2010-01-01

The SOS response to DNA damage in bacteria is a well-known component of the complex transcriptional responses to genotoxic environmental stresses such as exposure to reactive oxygen species, alkylating agents, and many of the antibiotics targeting DNA replication. However, bacteria such as Bacillus subtilis also respond to conditions that perturb DNA replication via a transcriptional response mediated by the replication initiation protein DnaA. In addition to regulating the initiation of DNA replication, DnaA directly regulates the transcription of specific genes. Conditions that perturb DNA replication can trigger the accumulation of active DnaA, activating or repressing the transcription of genes in the DnaA regulon. We report here that simply growing B. subtilis in LB medium altered DnaA-dependent gene expression in a manner consistent with the accumulation of active DnaA and that this was part of a general transcriptional response to manganese limitation. The SOS response to DNA damage was not induced under these conditions. One of the genes positively regulated by DnaA in Bacillus subtilis encodes a protein that inhibits the initiation of sporulation, Sda. Sda expression was induced as cells entered stationary phase in LB medium but not in LB medium supplemented with manganese, and the induction of Sda inhibited sporulation-specific gene expression and the onset of spore morphogenesis. In the absence of Sda, manganese-limited cells initiated spore development but failed to form mature spores. These data highlight that DnaA-dependent gene expression may influence the response of bacteria to a range of environmental conditions, including conditions that are not obviously associated with genotoxic stress. PMID:20511500

Variola Type IB DNA Topoisomerase: DNA Binding and Supercoil Unwinding Using Engineered DNA Minicircles

PubMed Central

2015-01-01

Type IB topoisomerases unwind positive and negative DNA supercoils and play a key role in removing supercoils that would otherwise accumulate at replication and transcription forks. An interesting question is whether topoisomerase activity is regulated by the topological state of the DNA, thereby providing a mechanism for targeting the enzyme to highly supercoiled DNA domains in genomes. The type IB enzyme from variola virus (vTopo) has proven to be useful in addressing mechanistic questions about topoisomerase function because it forms a reversible 3′-phosphotyrosyl adduct with the DNA backbone at a specific target sequence (5′-CCCTT-3′) from which DNA unwinding can proceed. We have synthesized supercoiled DNA minicircles (MCs) containing a single vTopo target site that provides highly defined substrates for exploring the effects of supercoil density on DNA binding, strand cleavage and ligation, and unwinding. We observed no topological dependence for binding of vTopo to these supercoiled MC DNAs, indicating that affinity-based targeting to supercoiled DNA regions by vTopo is unlikely. Similarly, the cleavage and religation rates of the MCs were not topologically dependent, but topoisomers with low superhelical densities were found to unwind more slowly than highly supercoiled topoisomers, suggesting that reduced torque at low superhelical densities leads to an increased number of cycles of cleavage and ligation before a successful unwinding event. The K271E charge reversal mutant has an impaired interaction with the rotating DNA segment that leads to an increase in the number of supercoils that were unwound per cleavage event. This result provides evidence that interactions of the enzyme with the rotating DNA segment can restrict the number of supercoils that are unwound. We infer that both superhelical density and transient contacts between vTopo and the rotating DNA determine the efficiency of supercoil unwinding. Such determinants are likely to be

Temperature Dependence of the Thermal Conductivity of a Trapped Dipolar Bose-Condensed Gas

NASA Astrophysics Data System (ADS)

Yavari, H.

2018-02-01

The thermal conductivity of a trapped dipolar Bose condensed gas is calculated as a function of temperature in the framework of linear response theory. The contributions of the interactions between condensed and noncondensed atoms and between noncondensed atoms in the presence of both contact and dipole-dipole interactions are taken into account to the thermal relaxation time, by evaluating the self-energies of the system in the Beliaev approximation. We will show that above the Bose-Einstein condensation temperature ( T > T BEC ) in the absence of dipole-dipole interaction, the temperature dependence of the thermal conductivity reduces to that of an ideal Bose gas. In a trapped Bose-condensed gas for temperature interval k B T << n 0 g B , E p << k B T ( n 0 is the condensed density and g B is the strength of the contact interaction), the relaxation rates due to dipolar and contact interactions between condensed and noncondensed atoms change as {τ}_{dd12}^{-1}∝ {e}^{-E/{k}_BT} and τ c12 ∝ T -5, respectively, and the contact interaction plays the dominant role in the temperature dependence of the thermal conductivity, which leads to the T -3 behavior of the thermal conductivity. In the low-temperature limit, k B T << n 0 g B , E p >> k B T, since the relaxation rate {τ}_{c12}^{-1} is independent of temperature and the relaxation rate due to dipolar interaction goes to zero exponentially, the T 2 temperature behavior for the thermal conductivity comes from the thermal mean velocity of the particles. We will also show that in the high-temperature limit ( k B T > n 0 g B ) and low momenta, the relaxation rates {τ}_{c12}^{-1} and {τ}_{dd12}^{-1} change linearly with temperature for both dipolar and contact interactions and the thermal conductivity scales linearly with temperature.

Ni-DNA-based nanowires and nanodevices

NASA Astrophysics Data System (ADS)

Chang, Chia-Ching; Yuan, Chiun-Jye; Jian, Wen-Bin; Chen, Yu-Chang; di Ventra, Massimiliano

DNA is a highly versatile biopolymer that has been a recent focus in the field of nanomachines and nanoelectronics. DNA exhibits high stability, adjustable conductance, self-organizing capability, programmability and vast information storage. It is an ideal material in the applications of nanodevices, nanoelectronics, and molecular computing. Low conductance of native DNA renders applications difficult. However, doping with nickel ions tunes the DNA into a conducting polymer. Further studies showed that nickel ions containing DNA (Ni-DNA) nanowires exhibit characteristics of memristor and memcapacitor making them a potential mass information storage system. In summary, Ni-DNA has promising applications in a variety of fields, including nanoelectronics, biosensors and memcomputing. This study was supported in part by the Ministry of Science and Technology (MOST), Taiwan (ROC) MOST 103-2112-M-009-011 -MY3, and MOST 105-2627-M-009-006.

Blood micronutrients and DNA damage in children.

PubMed

Milne, Elizabeth; Greenop, Kathryn R; Ramankutty, Padmaja; Miller, Margaret; de Klerk, Nicholas H; Armstrong, Bruce K; Almond, Theodora; O'Callaghan, Nathan J; Fenech, Michael

2015-10-01

Maintenance of normal cellular phenotype depends largely on accurate DNA replication and repair. DNA damage causes gene mutations and predisposes to cancer and other chronic diseases. Growing evidence indicates that nutritional factors are associated with DNA damage in adults; here, we investigate these associations in children. We conducted a cross-sectional study among 462 healthy children 3, 6, and 9 years of age. Blood was collected and micronutrient levels were measured. The cytokinesis-block micronucleus cytome assay was used to measure chromosomal DNA damage (micronuclei, nucleoplasmic bridges, and nuclear buds) in lymphocytes. Cell apoptosis, necrosis, and the nuclear division index were also measured. Nine loci in genes involved in folate metabolism and DNA repair were genotyped. Data were analyzed using linear regression with adjustment for potential confounders. Plasma calcium was positively associated with micronuclei and necrosis, and α-tocopherol negatively associated with apoptosis, nuclear division index, and nucleoplasmic bridges; lutein was positively associated with nucleoplasmic bridges. α-tocopherol was positively associated with necrosis. DNA damage in healthy children may be influenced by blood micronutrient levels and certain genotypes. Further investigation of associations between nutritional status and genomic integrity in children is needed to shed additional light on potential mechanisms. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA mutagenic activity and capacity for HIV-1 restriction of the cytidine deaminase APOBEC3G depend on whether DNA or RNA binds to tyrosine 315

PubMed Central

Polevoda, Bogdan; Joseph, Rebecca; Friedman, Alan E.; Bennett, Ryan P.; Greiner, Rebecca; De Zoysa, Thareendra; Stewart, Ryan A.; Smith, Harold C.

2017-01-01

APOBEC3G (A3G) belongs to the AID/APOBEC protein family of cytidine deaminases (CDA) that bind to nucleic acids. A3G mutates the HIV genome by deamination of dC to dU, leading to accumulation of virus-inactivating mutations. Binding to cellular RNAs inhibits A3G binding to substrate single-stranded (ss) DNA and CDA activity. Bulk RNA and substrate ssDNA bind to the same three A3G tryptic peptides (amino acids 181–194, 314–320, and 345–374) that form parts of a continuously exposed protein surface extending from the catalytic domain in the C terminus of A3G to its N terminus. We show here that the A3G tyrosines 181 and 315 directly cross-linked ssDNA. Binding experiments showed that a Y315A mutation alone significantly reduced A3G binding to both ssDNA and RNA, whereas Y181A and Y182A mutations only moderately affected A3G nucleic acid binding. Consistent with these findings, the Y315A mutant exhibited little to no deaminase activity in an Escherichia coli DNA mutator reporter, whereas Y181A and Y182A mutants retained ∼50% of wild-type A3G activity. The Y315A mutant also showed a markedly reduced ability to assemble into viral particles and had reduced antiviral activity. In uninfected cells, the impaired RNA-binding capacity of Y315A was evident by a shift of A3G from high-molecular-mass ribonucleoprotein complexes to low-molecular-mass complexes. We conclude that Tyr-315 is essential for coordinating ssDNA interaction with or entry to the deaminase domain and hypothesize that RNA bound to Tyr-315 may be sufficient to competitively inhibit ssDNA deaminase-dependent antiviral activity. PMID:28381554

A role for nuclear translocation of tripeptidyl-peptidase II in reactive oxygen species-dependent DNA damage responses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Preta, Giulio; Klark, Rainier de; Glas, Rickard, E-mail: rickard.glas@ki.se

2009-11-27

Responses to DNA damage are influenced by cellular metabolism through the continuous production of reactive oxygen species (ROS), of which most are by-products of mitochondrial respiration. ROS have a strong influence on signaling pathways during responses to DNA damage, by relatively unclear mechanisms. Previous reports have shown conflicting data on a possible role for tripeptidyl-peptidase II (TPPII), a large cytosolic peptidase, within the DNA damage response. Here we show that TPPII translocated into the nucleus in a p160-ROCK-dependent fashion in response to {gamma}-irradiation, and that nuclear expression of TPPII was present in most {gamma}-irradiated transformed cell lines. We used amore » panel of nine cell lines of diverse tissue origin, including four lymphoma cell lines (T, B and Hodgkins lymphoma), a melanoma, a sarcoma, a colon and two breast carcinomas, where seven out of nine cell lines showed nuclear TPPII expression after {gamma}-irradiation. Further, this required cellular production of ROS; treatment with either N-acetyl-Cysteine (anti-oxidant) or Rotenone (inhibitor of mitochondrial respiration) inhibited nuclear accumulation of TPPII. The local density of cells was important for nuclear accumulation of TPPII at early time-points following {gamma}-irradiation (at 1-4 h), indicating a bystander effect. Further, we showed that the peptide-based inhibitor Z-Gly-Leu-Ala-OH, but not its analogue Z-Gly-(D)-Leu-Ala-OH, excluded TPPII from the nucleus. This correlated with reduced nuclear expression of p53 as well as caspase-3 and -9 activation in {gamma}-irradiated lymphoma cells. Our data suggest a role for TPPII in ROS-dependent DNA damage responses, through alteration of its localization from the cytosol into the nucleus.« less

The Aurora-B-dependent NoCut checkpoint prevents damage of anaphase bridges after DNA replication stress.

PubMed

Amaral, Nuno; Vendrell, Alexandre; Funaya, Charlotta; Idrissi, Fatima-Zahra; Maier, Michael; Kumar, Arun; Neurohr, Gabriel; Colomina, Neus; Torres-Rosell, Jordi; Geli, María-Isabel; Mendoza, Manuel

2016-05-01

Anaphase chromatin bridges can lead to chromosome breakage if not properly resolved before completion of cytokinesis. The NoCut checkpoint, which depends on Aurora B at the spindle midzone, delays abscission in response to chromosome segregation defects in yeast and animal cells. How chromatin bridges are detected, and whether abscission inhibition prevents their damage, remain key unresolved questions. We find that bridges induced by DNA replication stress and by condensation or decatenation defects, but not dicentric chromosomes, delay abscission in a NoCut-dependent manner. Decatenation and condensation defects lead to spindle stabilization during cytokinesis, allowing bridge detection by Aurora B. NoCut does not prevent DNA damage following condensin or topoisomerase II inactivation; however, it protects anaphase bridges and promotes cellular viability after replication stress. Therefore, the molecular origin of chromatin bridges is critical for activation of NoCut, which plays a key role in the maintenance of genome stability after replicative stress.

Inhibition of DNA-dependent protein kinase catalytic subunit by small molecule inhibitor NU7026 sensitizes human leukemic K562 cells to benzene metabolite-induced apoptosis.

PubMed

You, Hao; Kong, Meng-meng; Wang, Li-ping; Xiao, Xiao; Liao, Han-lin; Bi, Zhuo-yue; Yan, Hong; Wang, Hong; Wang, Chun-hong; Ma, Qiang; Liu, Yan-qun; Bi, Yong-yi

2013-02-01

Benzene is an established leukotoxin and leukemogen in humans. We have previously reported that exposure of workers to benzene and to benzene metabolite hydroquinone in cultured cells induced DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to mediate the cellular response to DNA double strand break (DSB) caused by DNA-damaging metabolites. In this study, we used a new, small molecule, a selective inhibitor of DNA-PKcs, 2-(morpholin-4-yl)-benzo[h]chomen-4-one (NU7026), as a probe to analyze the molecular events and pathways in hydroquinone-induced DNA DSB repair and apoptosis. Inhibition of DNA-PKcs by NU7026 markedly potentiated the apoptotic and growth inhibitory effects of hydroquinone in proerythroid leukemic K562 cells in a dose-dependent manner. Treatment with NU7026 did not alter the production of reactive oxygen species and oxidative stress by hydroquinone but repressed the protein level of DNA-PKcs and blocked the induction of the kinase mRNA and protein expression by hydroquinone. Moreover, hydroquinone increased the phosphorylation of Akt to activate Akt, whereas co-treatment with NU7026 prevented the activation of Akt by hydroquinone. Lastly, hydroquinone and NU7026 exhibited synergistic effects on promoting apoptosis by increasing the protein levels of pro-apoptotic proteins Bax and caspase-3 but decreasing the protein expression of anti-apoptotic protein Bcl-2. Taken together, the findings reveal a central role of DNA-PKcs in hydroquinone-induced hematotoxicity in which it coordinates DNA DSB repair, cell cycle progression, and apoptosis to regulate the response to hydroquinone-induced DNA damage.

Sequence-Dependent Diastereospecific and Diastereodivergent Crosslinking of DNA by Decarbamoylmitomycin C.

PubMed

Aguilar, William; Paz, Manuel M; Vargas, Anayatzinc; Clement, Cristina C; Cheng, Shu-Yuan; Champeil, Elise

2018-04-20

Mitomycin C (MC), a potent antitumor drug, and decarbamoylmitomycin C (DMC), a derivative lacking the carbamoyl group, form highly cytotoxic DNA interstrand crosslinks. The major interstrand crosslink formed by DMC is the C1'' epimer of the major crosslink formed by MC. The molecular basis for the stereochemical configuration exhibited by DMC was investigated using biomimetic synthesis. The formation of DNA-DNA crosslinks by DMC is diastereospecific and diastereodivergent: Only the 1''S-diastereomer of the initially formed monoadduct can form crosslinks at GpC sequences, and only the 1''R-diastereomer of the monoadduct can form crosslinks at CpG sequences. We also show that CpG and GpC sequences react with divergent diastereoselectivity in the first alkylation step: 1"S stereochemistry is favored at GpC sequences and 1''R stereochemistry is favored at CpG sequences. Therefore, the first alkylation step results, at each sequence, in the selective formation of the diastereomer able to generate an interstrand DNA-DNA crosslink after the "second arm" alkylation. Examination of the known DNA adduct pattern obtained after treatment of cancer cell cultures with DMC indicates that the GpC sequence is the major target for the formation of DNA-DNA crosslinks in vivo by this drug. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA isolation protocol effects on nuclear DNA analysis by microarrays, droplet digital PCR, and whole genome sequencing, and on mitochondrial DNA copy number estimation

PubMed Central

Nacheva, Elizabeth; Mokretar, Katya; Soenmez, Aynur; Pittman, Alan M.; Grace, Colin; Valli, Roberto; Ejaz, Ayesha; Vattathil, Selina; Maserati, Emanuela; Houlden, Henry; Taanman, Jan-Willem; Schapira, Anthony H.

2017-01-01

Potential bias introduced during DNA isolation is inadequately explored, although it could have significant impact on downstream analysis. To investigate this in human brain, we isolated DNA from cerebellum and frontal cortex using spin columns under different conditions, and salting-out. We first analysed DNA using array CGH, which revealed a striking wave pattern suggesting primarily GC-rich cerebellar losses, even against matched frontal cortex DNA, with a similar pattern on a SNP array. The aCGH changes varied with the isolation protocol. Droplet digital PCR of two genes also showed protocol-dependent losses. Whole genome sequencing showed GC-dependent variation in coverage with spin column isolation from cerebellum. We also extracted and sequenced DNA from substantia nigra using salting-out and phenol / chloroform. The mtDNA copy number, assessed by reads mapping to the mitochondrial genome, was higher in substantia nigra when using phenol / chloroform. We thus provide evidence for significant method-dependent bias in DNA isolation from human brain, as reported in rat tissues. This may contribute to array “waves”, and could affect copy number determination, particularly if mosaicism is being sought, and sequencing coverage. Variations in isolation protocol may also affect apparent mtDNA abundance. PMID:28683077

In Situ Study of Strain-Dependent Ion Conductivity of Stretchable Polyethylene Oxide Electrolyte

PubMed Central

Kelly, Taylor; Ghadi, Bahar Moradi; Berg, Sean; Ardebili, Haleh

2016-01-01

There is a strong need in developing stretchable batteries that can accommodate stretchable or irregularly shaped applications including medical implants, wearable devices and stretchable electronics. Stretchable solid polymer electrolytes are ideal candidates for creating fully stretchable lithium ion batteries mainly due to their mechanical and electrochemical stability, thin-film manufacturability and enhanced safety. However, the characteristics of ion conductivity of polymer electrolytes during tensile deformation are not well understood. Here, we investigate the effects of tensile strain on the ion conductivity of thin-film polyethylene oxide (PEO) through an in situ study. The results of this investigation demonstrate that both in-plane and through-plane ion conductivities of PEO undergo steady and linear growths with respect to the tensile strain. The coefficients of strain-dependent ion conductivity enhancement (CSDICE) for in-plane and through-plane conduction were found to be 28.5 and 27.2, respectively. Tensile stress-strain curves and polarization light microscopy (PLM) of the polymer electrolyte film reveal critical insights on the microstructural transformation of stretched PEO and the potential consequences on ionic conductivity. PMID:26831948

Temperature Dependence of Electrical and Thermal Conduction in Single Silver Nanowire

DTIC Science & Technology

2015-06-02

Methods section. After knowing the geometrical sizes of the films, the electrical resistivity can be calculated . The temper- ature dependent electrical...plane spacing for peaks (111), (220) and (311) are 2.3616 Å, 1.4518 Å and 1.2287 Å respectively. The corresponding lattice constant can be calculated ...21 nm). So the upper limit of the thermal conductivity ( C vl 3ph vκ = /, ) is calculated as 12.3 W/K·m at 36 K. The phonon mean free path should

The Dynamic Interplay Between DNA Topoisomerases and DNA Topology.

PubMed

Seol, Yeonee; Neuman, Keir C

2016-09-01

Topological properties of DNA influence its structure and biochemical interactions. Within the cell DNA topology is constantly in flux. Transcription and other essential processes including DNA replication and repair, alter the topology of the genome, while introducing additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases, is a pervasive factor that influences DNA metabolism in vivo . Building on the extensive structural and biochemical characterization over the past four decades that established the fundamental mechanistic basis of topoisomerase activity, the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases have begun to be explored. In this review we survey established and emerging DNA topology dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

The dynamic interplay between DNA topoisomerases and DNA topology.

PubMed

Seol, Yeonee; Neuman, Keir C

2016-11-01

Topological properties of DNA influence its structure and biochemical interactions. Within the cell, DNA topology is constantly in flux. Transcription and other essential processes, including DNA replication and repair, not only alter the topology of the genome but also introduce additional complications associated with DNA knotting and catenation. These topological perturbations are counteracted by the action of topoisomerases, a specialized class of highly conserved and essential enzymes that actively regulate the topological state of the genome. This dynamic interplay among DNA topology, DNA processing enzymes, and DNA topoisomerases is a pervasive factor that influences DNA metabolism in vivo. Building on the extensive structural and biochemical characterization over the past four decades that has established the fundamental mechanistic basis of topoisomerase activity, scientists have begun to explore the unique roles played by DNA topology in modulating and influencing the activity of topoisomerases. In this review we survey established and emerging DNA topology-dependent protein-DNA interactions with a focus on in vitro measurements of the dynamic interplay between DNA topology and topoisomerase activity.

Targeting GLI by GANT61 involves mechanisms dependent on inhibition of both transcription and DNA licensing.

PubMed

Zhang, Ruowen; Wu, Jiahui; Ferrandon, Sylvain; Glowacki, Katie J; Houghton, Janet A

2016-12-06

The GLI genes are transcription factors and in cancers are oncogenes, aberrantly and constitutively activated. GANT61, a specific GLI inhibitor, has induced extensive cytotoxicity in human models of colon cancer. The FOXM1 promoter was determined to be a transcriptional target of GLI1. In HT29 cells, inhibition of GLI1 binding at the GLI consensus sequence by GANT61 led to inhibited binding of Pol II, the pause-release factors DSIF, NELF and p-TEFb. The formation of R-loops (RNA:DNA hybrids, ssDNA), were reduced by GANT61 at the FOXM1 promoter. Pretreatment of HT29 cells with α-amanitin reduced GANT61-induced γH2AX foci. Co-localization of GLI1 and BrdU foci, inhibited by GANT61, indicated GLI1 and DNA replication to be linked. By co-immunoprecipitation and confocal microscopy, GLI1 co-localized with the DNA licensing factors ORC4, CDT1, and MCM2. Significant co-localization of GLI1 and ORC4 was inhibited by GANT61, and enrichment of ORC4 occurred at the GLI binding site in the FOXM1 promoter. CDT1 was found to be a transcription target of GLI1. Overexpression of CDT1 in HT29 and SW480 cells reduced GANT61-induced cell death, gH2AX foci, and cleavage of caspase-3. Data demonstrate involvement of transcription and of DNA replication licensing factors by non-transcriptional and transcriptional mechanisms in the GLI-dependent mechanism of action of GANT61.

Single-stranded DNA-binding Protein in Vitro Eliminates the Orientation-dependent Impediment to Polymerase Passage on CAG/CTG Repeats*

PubMed Central

Delagoutte, Emmanuelle; Goellner, Geoffrey M.; Guo, Jie; Baldacci, Giuseppe; McMurray, Cynthia T.

2008-01-01

Small insertions and deletions of trinucleotide repeats (TNRs) can occur by polymerase slippage and hairpin formation on either template or newly synthesized strands during replication. Although not predicted by a slippage model, deletions occur preferentially when 5′-CTG is in the lagging strand template and are highly favored over insertion events in rapidly replicating cells. The mechanism for the deletion bias and the orientation dependence of TNR instability is poorly understood. We report here that there is an orientation-dependent impediment to polymerase progression on 5′-CAG and 5′-CTG repeats that can be relieved by the binding of single-stranded DNA-binding protein. The block depends on the primary sequence of the TNR but does not correlate with the thermodynamic stability of hairpins. The orientation-dependent block of polymerase passage is the strongest when 5′-CAG is the template. We propose a “template-push” model in which the slow speed of DNA polymerase across the 5′-CAG leading strand template creates a threat to helicase-polymerase coupling. To prevent uncoupling, the TNR template is pushed out and by-passed. Hairpins do not cause the block, but appear to occur as a consequence of polymerase pass-over. PMID:18263578

Modeling the Time-dependent Changes in Electrical Conductivity of Basaltic Melts With Redox State

NASA Astrophysics Data System (ADS)

Pommier, A.; Gaillard, F.; Pichavant, M.

2008-12-01

The electrical conductivity σ is an efficient probe of mass transfer processes within silicate melts and magmas. Little attention has been given to the influence of redox state (fO2) on the melts conductivity. We present an experimental setup allowing electrical conductivity measurements for basaltic melts under variable fO2. We demonstrate a significant dependence of σ with fO2, allowing to characterize in situ the mechanisms and kinetics of redox changes in the melt. Experiments were conducted on basalts from Pu'u 'O'o, Hawaii, and Mt.Vesuvius, Italy. Measurements were performed cylindrical glass samples (OD: 6mm, ID: 1mm, L: 8mm) using an impedance spectrometer. Experiments were conducted in a 1atm vertical furnace, from 1200°C to 1400°C. Variable gas atmosphere (air, CO2 or CO-CO2 gas mixtures) were used, imposing ΔNNO from -1 to +7. Electrical conductivities were determined for the two melts at constant fO2, different T (constant fO2) and constant T, different fO2 (variable fO2) obtained by changing the gas composition. Isothermal reduction and oxidation cycles were performed. Glasses quenched from different T and fO2 conditions were analyzed by electron microprobe, the FeO concentration was determined by wet chemistry. In constant fO2 experiments, a small but detectable effect of fO2 on σ is evidenced. At 1300°C, the difference in the Kilauea sample conductivity between reduced (ΔNNO=-1) and oxidized (ΔNNO=+7) fO2 is <1(ohm.m)-1, the sample being more conductive when reduced. The temperature dependence of σ was fitted using Arrhenian equations, the activation energy Ea being 100kJ/mol. Sodium was identified as the main charge carrier in the melts. The fO2-effect on σ can thus be attributed to the influence of the Fe2+/Fe3+ ratio on sodium mobility. The fO2-dependence of σ was included in the model of Pommier et al.(2008), allowing the conductivity of natural melts to be calculated as a function of T, P, H2O, and fO2. Variable fO2 experiments

The budding yeast Rad9 checkpoint protein is subjected to Mec1/Tel1-dependent hyperphosphorylation and interacts with Rad53 after DNA damage.

PubMed

Vialard, J E; Gilbert, C S; Green, C M; Lowndes, N F

1998-10-01

The Saccharomyces cerevisiae RAD9 checkpoint gene is required for transient cell-cycle arrests and transcriptional induction of DNA repair genes in response to DNA damage. Polyclonal antibodies raised against the Rad9 protein recognized several polypeptides in asynchronous cultures, and in cells arrested in S or G2/M phases while a single form was observed in G1-arrested cells. Treatment with various DNA damaging agents, i.e. UV, ionizing radiation or methyl methane sulfonate, resulted in the appearance of hypermodified forms of the protein. All modifications detected during a normal cell cycle and after DNA damage were sensitive to phosphatase treatment, indicating that they resulted from phosphorylation. Damage-induced hyperphosphorylation of Rad9 correlated with checkpoint functions (cell-cycle arrest and transcriptional induction) and was cell-cycle stage- and progression-independent. In asynchronous cultures, Rad9 hyperphosphorylation was dependent on MEC1 and TEL1, homologues of the ATR and ATM genes. In G1-arrested cells, damage-dependent hyperphosphorylation required functional MEC1 in addition to RAD17, RAD24, MEC3 and DDC1, demonstrating cell-cycle stage specificity of the checkpoint genes in this response to DNA damage. Analysis of checkpoint protein interactions after DNA damage revealed that Rad9 physically associates with Rad53.

MAP kinase dependent cyclinE/cdk2 activity promotes DNA replication in early sea urchin embryos

PubMed Central

Kisielewska, J.; Philipova, R.; Huang, J.-Y.; Whitaker, M.

2009-01-01

Sea urchins provide an excellent model for studying cell cycle control mechanisms governing DNA replication in vivo. Fertilization and cell cycle progression are tightly coordinated by Ca2+ signals, but the mechanisms underlying the onset of DNA replication after fertilization remain less clear. In this study we demonstrate that calcium-dependent activation of ERK1 promotes accumulation of cyclinE/cdk2 into the male and female pronucleus and entry into first S-phase. We show that cdk2 activity rises quickly after fertilization to a maximum at 4 min, corresponding in timing to the early ERK1 activity peak. Abolishing MAP kinase activity after fertilization with MEK inhibitor, U0126, substantially reduces the early peak of cdk2 activity and prevents cyclinE and cdk2 accumulation in both sperm pronucleus and zygote nucleus in vivo. Both p27kip1 and roscovitine, cdk2 inhibitors, prevented DNA replication suggesting cdk2 involvement in this process in sea urchin. Inhibition of cdk2 activity using p27kip1 had no effect on the phosphorylation of MBP by ERK, but completely abolished phosphorylation of retinoblastoma protein, a cdk2 substrate, indicating that cdk2 activity is downstream of ERK1 activation. This pattern of regulation of DNA synthesis conforms to the pattern observed in mammalian somatic cells. PMID:19665013

Detection of regional DNA methylation using DNA-graphene affinity interactions.

PubMed

Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A

2017-01-15

We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

Cystic Fibrosis Gene Encodes a cAMP-Dependent Chloride Channel in Heart

NASA Astrophysics Data System (ADS)

Hart, Padraig; Warth, John D.; Levesque, Paul C.; Collier, Mei Lin; Geary, Yvonne; Horowitz, Burton; Hume, Joseph R.

1996-06-01

cAMP-dependent chloride channels in heart contribute to autonomic regulation of action potential duration and membrane potential and have been inferred to be due to cardiac expression of the epithelial cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel. In this report, a cDNA from rabbit ventricle was isolated and sequenced, which encodes an exon 5 splice variant (exon 5-) of CFTR, with >90% identity to human CFTR cDNA present in epithelial cells. Expression of this cDNA in Xenopus oocytes gave rise to robust cAMP-activated chloride currents that were absent in control water-injected oocytes. Antisense oligodeoxynucleotides directed against CFTR significnatly reduced the density of cAMP-dependent chloride currents in acutely cultured myocytes, thereby establishing a direct functional link between cardiac expression of CFTR protein and an endogenous chloride channel in native cardiac myocytes.

Making the Bend: DNA Tertiary Structure and Protein-DNA Interactions

PubMed Central

Harteis, Sabrina; Schneider, Sabine

2014-01-01

DNA structure functions as an overlapping code to the DNA sequence. Rapid progress in understanding the role of DNA structure in gene regulation, DNA damage recognition and genome stability has been made. The three dimensional structure of both proteins and DNA plays a crucial role for their specific interaction, and proteins can recognise the chemical signature of DNA sequence (“base readout”) as well as the intrinsic DNA structure (“shape recognition”). These recognition mechanisms do not exist in isolation but, depending on the individual interaction partners, are combined to various extents. Driving force for the interaction between protein and DNA remain the unique thermodynamics of each individual DNA-protein pair. In this review we focus on the structures and conformations adopted by DNA, both influenced by and influencing the specific interaction with the corresponding protein binding partner, as well as their underlying thermodynamics. PMID:25026169

Age dependency of base modification in rabbit liver DNA

NASA Technical Reports Server (NTRS)

Yamamoto, O.; Fuji, I.; Yoshida, T.; Cox, A. B.; Lett, J. T.

1988-01-01

Age-related modifications of DNA bases have been observed in the liver of the New Zealand white (NZW) rabbit (Oryctolagus cuniculus), a lagomorph with a median life span in captivity of 5-7 yr. The ages of the animals studied ranged from 6 wk to 9 yr. After the DNA had been extracted from the liver cell nuclei and hydrolyzed with acid, the bases were analyzed by column chromatography with Cellulofine gels (GC-15-m). Two peaks in the chromatogram, which eluted before the four DNA bases, contained modified bases. Those materials, which were obtained in relatively large amounts from old animals, were highly fluorescent, and were shown to be crosslinked base products by mass spectrometry. The yield of crosslinked products versus rabbit age (greater than 0.5 yr) can be fitted by an exponential function (correlation coefficient: 0.76 +/- 0.09).

Deficiency of the Arabidopsis Helicase RTEL1 Triggers a SOG1-Dependent Replication Checkpoint in Response to DNA Cross-Links

PubMed Central

Hu, Zhubing; Cools, Toon; Kalhorzadeh, Pooneh; Heyman, Jefri; De Veylder, Lieven

2015-01-01

To maintain genome integrity, DNA replication is executed and regulated by a complex molecular network of numerous proteins, including helicases and cell cycle checkpoint regulators. Through a systematic screening for putative replication mutants, we identified an Arabidopsis thaliana homolog of human Regulator of Telomere Length 1 (RTEL1), which functions in DNA replication, DNA repair, and recombination. RTEL1 deficiency retards plant growth, a phenotype including a prolonged S-phase duration and decreased cell proliferation. Genetic analysis revealed that rtel1 mutant plants show activated cell cycle checkpoints, specific sensitivity to DNA cross-linking agents, and increased homologous recombination, but a lack of progressive shortening of telomeres, indicating that RTEL1 functions have only been partially conserved between mammals and plants. Surprisingly, RTEL1 deficiency induces tolerance to the deoxynucleotide-depleting drug hydroxyurea, which could be mimicked by DNA cross-linking agents. This resistance does not rely on the essential replication checkpoint regulator WEE1 but could be blocked by a mutation in the SOG1 transcription factor. Taken together, our data indicate that RTEL1 is required for DNA replication and that its deficiency activates a SOG1-dependent replication checkpoint. PMID:25595823

Pulsewidth-dependent nature of laser-induced DNA damage in RPE cells

NASA Astrophysics Data System (ADS)

Hall, Rebecca M.; Glickman, Randolph D.; Rockwell, Benjamin A.; Kumar, Neeru; Noojin, Gary D.

2001-07-01

Ultrashort pulse laser radiation may produce cellular damage through unique mechanisms. Primary cultures of bovine retinal pigment epithelial (RPE) cells were exposed to the out put of a Ti:Sapphire laser producing 30 fs (mode-locked) pulses, 44 amplified fs pulses, or continuous wave exposures at 800 nm. Laser exposures at and below the damage threshold were studied. DNA damage was detected using single cell gel electrophoresis (comet assay). Unexposed (control) cells produced short tails with low tail moments. In contrast, all laser-exposed cells showed some degree of DNA fragmentation, but the size and shape of the resulting comets differed among the various modalities. CW-exposed cells produced generally light and relatively compact tails, suggesting fewer and larger DNA fragments, while mode-locked laser exposures (30 fs pulses) resulted in large and diffuse comets, indicating the DNA was fragmented into many very small pieces. Work is continuing to define the relationship of laser pulsewidth and intensity with the degree of DNA fragmentation. These results suggest that DNA damage may result from multiple mechanisms of laser-cell interaction, including multiphoton absorption.

Analysis of a four generation family reveals the widespread sequence-dependent maintenance of allelic DNA methylation in somatic and germ cells

PubMed Central

Tang, Aifa; Huang, Yi; Li, Zesong; Wan, Shengqing; Mou, Lisha; Yin, Guangliang; Li, Ning; Xie, Jun; Xia, Yudong; Li, Xianxin; Luo, Liya; Zhang, Junwen; Chen, Shen; Wu, Song; Sun, Jihua; Sun, Xiaojuan; Jiang, Zhimao; Chen, Jing; Li, Yingrui; Wang, Jian; Wang, Jun; Cai, Zhiming; Gui, Yaoting

2016-01-01

Differential methylation of the homologous chromosomes, a well-known mechanism leading to genomic imprinting and X-chromosome inactivation, is widely reported at the non-imprinted regions on autosomes. To evaluate the transgenerational DNA methylation patterns in human, we analyzed the DNA methylomes of somatic and germ cells in a four-generation family. We found that allelic asymmetry of DNA methylation was pervasive at the non-imprinted loci and was likely regulated by cis-acting genetic variants. We also observed that the allelic methylation patterns for the vast majority of the cis-regulated loci were shared between the somatic and germ cells from the same individual. These results demonstrated the interaction between genetic and epigenetic variations and suggested the possibility of widespread sequence-dependent transmission of DNA methylation during spermatogenesis. PMID:26758766

Apigenin induces DNA damage through the PKCδ-dependent activation of ATM and H2AX causing down-regulation of genes involved in cell cycle control and DNA repair

PubMed Central

Arango, Daniel; Parihar, Arti; Villamena, Frederick A.; Wang, Liwen; Freitas, Michael A.; Grotewold, Erich; Doseff, Andrea I.

2014-01-01

Apigenin, an abundant plant flavonoid, exhibits anti-proliferative and anti-carcinogenic activities through mechanisms yet not fully defined. In the present study, we show that the treatment of leukemia cells with apigenin resulted in the induction of DNA damage preceding the activation of the apoptotic program. Apigenin-induced DNA damage was mediated by p38 and protein kinase C-delta (PKCδ), yet was independent of reactive oxygen species or caspase activity. Treatment of monocytic leukemia cells with apigenin induced the phosphorylation of the ataxia-telangiectasia mutated (ATM) kinase and histone H2AX, two key regulators of the DNA damage response, without affecting the ataxia-telangiectasia mutated and Rad-3-related (ATR) kinase. Silencing and pharmacological inhibition of PKCδ abrogated ATM and H2AX phosphorylation, whereas inhibition of p38 reduced H2AX phosphorylation independently of ATM. We established that apigenin delayed cell cycle progression at G1/S and increased the number of apoptotic cells. In addition, genome-wide mRNA analyses showed that apigenin-induced DNA damage led to down-regulation of genes involved in cell-cycle control and DNA repair. Taken together, the present results show that the PKCδ-dependent activation of ATM and H2AX define the signaling networks responsible for the regulation of DNA damage promoting genome-wide mRNA alterations that result in cell cycle arrest, hence contributing to the anti-carcinogenic activities of this flavonoid. PMID:22985621

Quinolone resistance-associated amino acid substitutions affect enzymatic activity of Mycobacterium leprae DNA gyrase.

PubMed

Yamaguchi, Tomoyuki; Yokoyama, Kazumasa; Nakajima, Chie; Suzuki, Yasuhiko

2017-07-01

Quinolones are important antimicrobials for treatment of leprosy, a chronic infectious disease caused by Mycobacterium leprae. Although it is well known that mutations in DNA gyrase are responsible for quinolone resistance, the effect of those mutations on the enzymatic activity is yet to be studied in depth. Hence, we conducted in vitro assays to observe supercoiling reactions of wild type and mutated M. leprae DNA gyrases. DNA gyrase with amino acid substitution Ala91Val possessed the highest activity among the mutants. DNA gyrase with Gly89Cys showed the lowest level of activity despite being found in clinical strains, but it supercoiled DNA like the wild type does if applied at a sufficient concentration. In addition, patterns of time-dependent conversion from relaxed circular DNA into supercoiled DNA by DNA gyrases with clinically unreported Asp95Gly and Asp95Asn were observed to be distinct from those by the other DNA gyrases.

Temperature Dependence of the Tunneling Conductance in Ba_1-xK_xBiO_3

NASA Astrophysics Data System (ADS)

Miyakawa, N.; Ozyuzer, L.; Zasadzinski, J. F.

1997-03-01

Tunneling measurements have been made on high-density polycrystalline pellets of Ba_1-xK_xBiO3 using a point contact method. The temperature dependence (up to 30 K) and magnetic field dependence (up to 6T) of the tunneling conductance has been measured. It is found that at temperatures less than 4.2 K the gap region conductance can be fit with a BCS density of states (dos) and thermal smearing only. However, as the temperature is increased a quasiparticle recombination rate, Γ, which increases as T^n (n ~ 3) must be included in the dos to fit the data. The behavior of Γ (T) does not follow the strong-coupling theory of Kaplan et al. (S.B. Kaplan et al. Phys. Rev. B 14), 4854 (1976) We investigate whether this anomalous power law dependence can come out of Eliashberg theory using the electron-phonon spectral function, a^2F(ω) for Ba_1-xK_xBiO_3.

Measurements of the temperature dependence of radiation induced conductivity in polymeric dielectrics

NASA Astrophysics Data System (ADS)

Gillespie, Jodie

This study measures Radiation Induced Conductivity (RIC) in five insulating polymeric materials over temperatures ranging from ~110 K to ~350 K: polyimide (PI or Kapton HN(TM) and Kapton E(TM)), polytetraflouroethylene (PTFE or Teflon(TM)), ethylene-tetraflouroethylene (ETFE or Tefzel(TM)), and Low Density Polyethylene (LDPE). RIC occurs when incident ionizing radiation deposits energy and excites electrons into the conduction band of insulators. Conductivity was measured when a voltage was applied across vacuum-baked, thin film polymer samples in a parallel plate geometry. RIC was calculated as the difference in sample conductivity under no incident radiation and under an incident ~4 MeV electron beam at low incident dose rates of 0.01 rad/sec to 10 rad/sec. The steady-state RIC was found to agree well with the standard power law relation, sigmaRIC(D˙) = kRIC(T) D˙Delta(T) between conductivity, sigmaRIC and adsorbed dose rate, D˙. Both the proportionality constant, kRIC, and the power, Delta, were found to be temperature-dependent above ~250 K, with behavior consistent with photoconductivity models developed for localized trap states in disordered semiconductors. Below ~250 K, kRIC and Delta exhibited little change in any of the materials.

Temperature and frequency dependent conductivity of bismuth zinc vanadate semiconducting glassy system

NASA Astrophysics Data System (ADS)

Punia, R.; Kundu, R. S.; Dult, Meenakshi; Murugavel, S.; Kishore, N.

2012-10-01

The ac conductivity of bismuth zinc vanadate glasses with compositions 50V2O5. xBi2O3. (50-x) ZnO has been studied in the frequency range 10-1 Hz to 2 MHz and in temperature range 333.16 K to 533.16 K. The temperature and frequency dependent conductivity is found to obey Jonscher's universal power law for all the compositions of bismuth zinc vanadate glass system. The dc conductivity (σdc), crossover frequency (ωH), and frequency exponent (s) have been estimated from the fitting of experimental data of ac conductivity with Jonscher's universal power law. Enthalpy to dissociate the cation from its original site next to a charge compensating center (Hf) and enthalpy of migration (Hm) have also been estimated. It has been observed that mobility of charge carriers and ac conductivity in case of zinc vanadate glass system increases with increase in Bi2O3 content. In order to determine the conduction mechanism, the ac conductivity and its frequency exponent have been analyzed in the frame work of various theoretical models based on classical hopping over barriers and quantum mechanical tunneling. The ac conduction takes place via tunneling of overlapping large polarons in all the compositions of presently studied vanadate glasses. The fitting of experimental data of ac conductivity with overlapping large polarons tunneling model has also been done. The parameters; density of states at Fermi level (N(EF)), activation energy associated with charge transfer between the overlapping sites (WHO), inverse localization length (α) and polaron radius (rp) obtained from fitting of this model with experimental data are reasonable.

Quantum interference in DNA bases probed by graphene nanoribbons

NASA Astrophysics Data System (ADS)

Jeong, Heejeong; Seul Kim, Han; Lee, Sung-Hoon; Lee, Dongho; Hoon Kim, Yong; Huh, Nam

2013-07-01

Based on first-principles nonequilibrium Green's function calculations, we demonstrate quantum interference (QI) effects on the tunneling conductance of deoxyribonucleic acid bases placed between zigzag graphene nanoribbon electrodes. With the analogy of QI in hydrocarbon ring structures, we hypothesize that QI can be well preserved in the π-π coupling between the carbon-based electrode and a single DNA base. We demonstrate indications of QI, such as destructively interfered anti-resonance or Fano-resonance, that affect the variation of tunneling conductance depending on the orientation of a base. We find that guanine, with a 10-fold higher transverse conductance, can be singled out from the other bases.

Charge transport and ac response under light illumination in gate-modulated DNA molecular junctions.

PubMed

Zhang, Yan; Zhu, Wen-Huan; Ding, Guo-Hui; Dong, Bing; Wang, Xue-Feng

2015-05-22

Using a two-strand tight-binding model and within nonequilibrium Green's function approach, we study charge transport through DNA sequences (GC)NGC and (GC)1(TA)NTA (GC)3 sandwiched between two Pt electrodes. We show that at low temperature DNA sequence (GC)NGC exhibits coherent charge carrier transport at very small bias, since the highest occupied molecular orbital in the GC base pair can be aligned with the Fermi energy of the metallic electrodes by a gate voltage. A weak distance dependent conductance is found in DNA sequence (GC)1(TA)NTA (GC)3 with large NTA. Different from the mechanism of thermally induced hopping of charges proposed by the previous experiments, we find that this phenomenon is dominated by quantum tunnelling through discrete quantum well states in the TA base pairs. In addition, ac response of this DNA junction under light illumination is also investigated. The suppression of ac conductances of the left and right lead of DNA sequences at some particular frequencies is attributed to the excitation of electrons in the DNA to the lead Fermi surface by ac potential, or the excitation of electrons in deep DNA energy levels to partially occupied energy levels in the transport window. Therefore, measuring ac response of DNA junctions can reveal a wealth of information about the intrinsic dynamics of DNA molecules.

Poly(ADP-Ribose) Polymerase-1 and DNA-Dependent Protein Kinase Have Equivalent Roles in Double Strand Break Repair Following Ionizing Radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchell, Jody; Smith, Graeme; Curtin, Nicola J., E-mail: n.j.curtin@ncl.ac.u

2009-12-01

Purpose: Radiation-induced DNA double strand breaks (DSBs) are predominantly repaired by nonhomologous end joining (NHEJ), involving DNA-dependent protein kinase (DNA-PK). Poly(ADP-ribose) polymerase-1 (PARP-1), well characterized for its role in single strand break repair, may also facilitate DSB repair. We investigated the activation of these enzymes by differing DNA ends and their interaction in the cellular response to ionizing radiation (IR). Methods and Materials: The effect of PARP and DNA-PK inhibitors (KU-0058684 and NU7441) on repair of IR-induced DSBs was investigated in DNA-PK and PARP-1 proficient and deficient cells by measuring gammaH2AX foci and neutral comets. Complementary in vitro enzyme kineticsmore » assays demonstrated the affinities of DNA-PK and PARP-1 for DSBs with varying DNA termini. Results: DNA-PK and PARP-1 both promoted the fast phase of resolution of IR-induced DSBs in cells. Inactivation of both enzymes was not additive, suggesting that PARP-1 and DNA-PK cooperate within the same pathway to promote DSB repair. The affinities of the two enzymes for oligonucleotides with blunt, 3' GGG or 5' GGG overhanging termini were similar and overlapping (K{sub dapp} = 2.6-6.4nM for DNA-PK; 1.7-4.5nM for PARP-1). DNA-PK showed a slightly greater affinity for overhanging DNA and was significantly more efficient when activated by a 5' GGG overhang. PARP-1 had a preference for blunt-ended DNA and required a separate factor for efficient stimulation by a 5' GGG overhang. Conclusion: DNA-PK and PARP-1 are both required in a pathway facilitating the fast phase of DNA DSB repair.« less

SMAD3 augments FoxO3-induced MuRF-1 promoter activity in a DNA-binding-dependent manner

PubMed Central

Bollinger, Lance M.; Witczak, Carol A.; Houmard, Joseph A.

2014-01-01

Muscle-specific RING finger-1 (MuRF-1), a ubiquitin ligase and key regulator of proteasome-dependent protein degradation, is highly expressed during skeletal muscle atrophy. The transcription factor forkhead box O3 (FoxO3) induces MuRF-1 expression, but the direct role of other major atrophy-related transcription factors, such as SMAD3, is largely unknown. The goal of this study was to determine whether SMAD3 individually regulates, or with FoxO3 coordinately regulates, MuRF-1 expression. In cultured myotubes or human embryonic kidney cells, MuRF-1 mRNA content and promoter activity were increased by FoxO3 but not by SMAD3 overexpression. However, FoxO3 and SMAD3 coexpression synergistically increased MuRF-1 mRNA and promoter activity. Mutation of the SMAD-binding element (SBE) in the proximal MuRF-1 promoter or overexpression of a SMAD3 DNA-binding mutant attenuated FoxO3-dependent MuRF-1 promoter activation, showing that SMAD binding to DNA is required for optimal activation of FoxO3-induced transcription of MuRF-1. Using chromatin immunoprecipitation, SMAD3 DNA binding increased FoxO3 abundance and SBE mutation reduced FoxO3 abundance on the MuRF-1 promoter. Furthermore, SMAD3 overexpression dose-dependently increased FoxO3 protein content, and coexpression of FoxO3 and SMAD3 synergistically increased FoxO-dependent gene transcription [assessed with a FoxO response element (FRE)-driven reporter]. Collectively, these results show that SMAD3 regulates transcription of MuRF-1 by increasing FoxO3 binding at a conserved FRE-SBE motif within the proximal promoter region, and by increasing FoxO3 protein content and transcriptional activity. These data are the first to indicate that two major transcription factors regulating protein degradation, FoxO3 and SMAD3, converge to coordinately and directly regulate transcription of MuRF-1. PMID:24920680

Lack of a p21waf1/cip -dependent G1/S checkpoint in neural stem and progenitor cells after DNA damage in vivo.

PubMed

Roque, Telma; Haton, Céline; Etienne, Olivier; Chicheportiche, Alexandra; Rousseau, Laure; Martin, Ludovic; Mouthon, Marc-André; Boussin, François D

2012-03-01

The cyclin-dependent kinase inhibitor p21(waf1/cip) mediates the p53-dependent G1/S checkpoint, which is generally considered to be a critical requirement to maintain genomic stability after DNA damage. We used staggered 5-ethynyl-2'deoxyuridine/5-bromo-2'-deoxyuridine double-labeling in vivo to investigate the cell cycle progression and the role of p21(waf1/cip) in the DNA damage response of neural stem and progenitor cells (NSPCs) after exposure of the developing mouse cortex to ionizing radiation. We observed a radiation-induced p21-dependent apoptotic response in migrating postmitotic cortical cells. However, neural stem and progenitor cells (NSPCs) did not initiate a p21(waf1/cip1) -dependent G1/S block and continued to enter S-phase at a similar rate to the non-irradiated controls. The G1/S checkpoint is not involved in the mechanisms underlying the faithful transmission of the NSPC genome and/or the elimination of critically damaged cells. These processes typically involve intra-S and G2/M checkpoints that are rapidly activated after irradiation. p21 is normally repressed in neural cells during brain development except at the G1 to G0 transition. Lack of activation of a G1/S checkpoint and apoptosis of postmitotic migrating cells after DNA damage appear to depend on the expression of p21 in neural cells, since substantial cell-to-cell variations are found in the irradiated cortex. This suggests that repression of p21 during brain development prevents the induction of the G1/S checkpoint after DNA damage. Copyright © 2011 AlphaMed Press.

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

PubMed

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-22

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

NASA Astrophysics Data System (ADS)

Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

2016-03-01

Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

Improved electro-transformation of highly DNA-restrictive corynebacteria with DNA extracted from starved Escherichia coli.

PubMed

Ankri, S; Reyes, O; Leblon, G

1996-07-01

Differences of up to 33 000-fold in electro-transformability of highly DNA restrictive corynebacteria are observed in the DNA of a shuttle plasmid extracted from Escherichia coli hosts propagated in different nutritional conditions. Growth of the host in minimal medium increases plasmid transformability, whereas growth on rich media decreases it. In the E. coli DH5 alpha host, the starvation-dependent increase DNA transformability is reverted by supplementing with methionine, an obligate 5-adenosyl-methionine (SAM) precursor. This suggests that an E. coli nutritionally modulated SAM-dependent DNA-methyltransferase may be involved in this phenomenon.

Immortal DNA strand cosegregation requires p53/IMPDH-dependent asymmetric self-renewal associated with adult stem cells.

PubMed

Rambhatla, Lakshmi; Ram-Mohan, Sumati; Cheng, Jennifer J; Sherley, James L

2005-04-15

Because they are long-lived and cycle continuously, adult stem cells (ASCs) are predicted as the most common precursor for cancers in adult mammalian tissues. Two unique attributes have been proposed to restrict the carcinogenic potential of ASCs. These are asymmetric self-renewal that limits their number and immortal DNA strand cosegregation that limits their accumulation of mutations due to DNA replication errors. Until recently, the molecular basis and regulation of these important ASC-specific functions were unknown. We developed engineered cultured cells that exhibit asymmetric self-renewal and immortal DNA strand cosegregation. These model cells were used to show that both ASC-specific functions are regulated by the p53 cancer gene. Previously, we proposed that IMP dehydrogenase (IMPDH) was an essential factor for p53-dependent asymmetric self-renewal. We now confirm this proposal and provide quantitative evidence that asymmetric self-renewal is acutely sensitive to even modest changes in IMPDH expression. These analyses reveal that immortal DNA strand cosegregation is also regulated by IMPDH and confirm the original implicit precept that immortal DNA strand cosegregation is specific to cells undergoing asymmetric self-renewal (i.e., ASCs). With IMPDH being the rate-determining enzyme for guanine ribonucleotide (rGNP) biosynthesis, its requirement implicates rGNPs as important regulators of ASC asymmetric self-renewal and immortal DNA strand cosegregation. An in silico analysis of global gene expression data from human cancer cell lines underscored the importance of p53-IMPDH-rGNP regulation for normal tissue cell kinetics, providing further support for the concept that ASCs are key targets for adult tissue carcinogenesis.

Leading temperature dependence of the conductance in Kondo-correlated quantum dots.

PubMed

Aligia, A A

2018-04-18

Using renormalized perturbation theory in the Coulomb repulsion, we derive an analytical expression for the leading term in the temperature dependence of the conductance through a quantum dot described by the impurity Anderson model, in terms of the renormalized parameters of the model. Taking these parameters from the literature, we compare the results with published ones calculated using the numerical renormalization group obtaining a very good agreement. The approach is superior to alternative perturbative treatments. We compare in particular to the results of a simple interpolative perturbation approach.

The RON Receptor Tyrosine Kinase Promotes Metastasis by Triggering MBD4-Dependent DNA Methylation Reprogramming

PubMed Central

Cunha, Stéphanie; Lin, Yi-Chun; Goossen, Elizabeth A.; DeVette, Christa I.; Albertella, Mark R.; Thomson, Stuart; Mulvihill, Mark J.; Welm, Alana L.

2017-01-01

SUMMARY Metastasis is the major cause of death in cancer patients, yet the genetic and epigenetic programs that drive metastasis are poorly understood. Here, we report an epigenetic reprogramming pathway that is required for breast cancer metastasis. Concerted differential DNA methylation is initiated by the activation of the RON receptor tyrosine kinase by its ligand, macrophage stimulating protein (MSP). Through PI3K signaling, RON/MSP promotes expression of the G:T mismatch-specific thymine glycosylase MBD4. RON/MSP and MBD4-dependent aberrant DNA methylation results in the misregulation of a specific set of genes. Knockdown of MBD4 reverses methylation at these specific loci and blocks metastasis. We also show that the MBD4 glycosylase catalytic residue is required for RON/MSP-driven metastasis. Analysis of human breast cancers revealed that this epigenetic program is significantly associated with poor clinical outcome. Furthermore, inhibition of Ron kinase activity with a pharmacological agent blocks metastasis of patient-derived breast tumor grafts in vivo. PMID:24388747

DNA recombination protein-dependent mechanism of homoplasmy and its proposed functions.

PubMed

Shibata, Takehiko; Ling, Feng

2007-01-01

Homoplasmy is a basic genetic state of mitochondria, in which all of the hundreds to thousands of mitochondrial (mt)DNA copies within a cell or an individual have the same nucleotide-sequence. It was recently found that "vegetative segregation" to generate homoplasmic cells is an active process under genetic control. In the yeast Saccharomyces cerevisiae, the Mhr1 protein which catalyzes a key reaction in mtDNA homologous recombination, plays a pivotal role in vegetative segregation. Conversely, within the nuclear genome, homologous DNA recombination causes genetic diversity. Considering these contradictory roles of this key reaction in DNA recombination, possible functions of homoplasmy are discussed.

Self-consistent modeling of terahertz waveguide and cavity with frequency-dependent conductivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Y. J.; Chu, K. R., E-mail: krchu@yahoo.com.tw; Thumm, M.

The surface resistance of metals, and hence the Ohmic dissipation per unit area, scales with the square root of the frequency of an incident electromagnetic wave. As is well recognized, this can lead to excessive wall losses at terahertz (THz) frequencies. On the other hand, high-frequency oscillatory motion of conduction electrons tends to mitigate the collisional damping. As a result, the classical theory predicts that metals behave more like a transparent medium at frequencies above the ultraviolet. Such a behavior difference is inherent in the AC conductivity, a frequency-dependent complex quantity commonly used to treat electromagnetics of metals at opticalmore » frequencies. The THz region falls in the gap between microwave and optical frequencies. However, metals are still commonly modeled by the DC conductivity in currently active vacuum electronics research aimed at the development of high-power THz sources (notably the gyrotron), although a small reduction of the DC conductivity due to surface roughness is sometimes included. In this study, we present a self-consistent modeling of the gyrotron interaction structures (a metallic waveguide or cavity) with the AC conductivity. The resulting waveguide attenuation constants and cavity quality factors are compared with those of the DC-conductivity model. The reduction in Ohmic losses under the AC-conductivity model is shown to be increasingly significant as the frequency reaches deeper into the THz region. Such effects are of considerable importance to THz gyrotrons for which the minimization of Ohmic losses constitutes a major design consideration.« less

The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

PubMed Central

Austin, S; Dixon, R

1992-01-01

The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

Using DNA origami nanostructures to determine absolute cross sections for UV photon-induced DNA strand breakage.

PubMed

Vogel, Stefanie; Rackwitz, Jenny; Schürman, Robin; Prinz, Julia; Milosavljević, Aleksandar R; Réfrégiers, Matthieu; Giuliani, Alexandre; Bald, Ilko

2015-11-19

We have characterized ultraviolet (UV) photon-induced DNA strand break processes by determination of absolute cross sections for photoabsorption and for sequence-specific DNA single strand breakage induced by photons in an energy range from 6.50 to 8.94 eV. These represent the lowest-energy photons able to induce DNA strand breaks. Oligonucleotide targets are immobilized on a UV transparent substrate in controlled quantities through attachment to DNA origami templates. Photon-induced dissociation of single DNA strands is visualized and quantified using atomic force microscopy. The obtained quantum yields for strand breakage vary between 0.06 and 0.5, indicating highly efficient DNA strand breakage by UV photons, which is clearly dependent on the photon energy. Above the ionization threshold strand breakage becomes clearly the dominant form of DNA radiation damage, which is then also dependent on the nucleotide sequence.

Structural-dependent thermal conductivity of aluminium nitride produced by reactive direct current magnetron sputtering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belkerk, B. E.; Soussou, A.; Carette, M.

This Letter reports the thermal conductivity of aluminium nitride (AlN) thin-films deposited by reactive DC magnetron sputtering on single-crystal silicon substrates (100) with varying plasma and magnetic conditions achieving different crystalline qualities. The thermal conductivity of the films was measured at room temperature with the transient hot-strip technique for film thicknesses ranging from 100 nm to 4000 nm. The thermal conductivity was found to increase with the thickness depending on the synthesis conditions and film microstructure. The conductivity in the bulk region of the films, so-called intrinsic conductivity, and the boundary resistance were in the range [120-210] W m{sup -1}more » K{sup -1} and [2-30 Multiplication-Sign 10{sup -9}] K m{sup 2} W{sup -1}, respectively, in good agreement with microstructures analysed by x-ray diffraction, high-resolution-scanning-electron-microscopy, and transmission-electron-microscopy.« less

Drosha drives the formation of DNA:RNA hybrids around DNA break sites to facilitate DNA repair.

PubMed

Lu, Wei-Ting; Hawley, Ben R; Skalka, George L; Baldock, Robert A; Smith, Ewan M; Bader, Aldo S; Malewicz, Michal; Watts, Felicity Z; Wilczynska, Ania; Bushell, Martin

2018-02-07

The error-free and efficient repair of DNA double-stranded breaks (DSBs) is extremely important for cell survival. RNA has been implicated in the resolution of DNA damage but the mechanism remains poorly understood. Here, we show that miRNA biogenesis enzymes, Drosha and Dicer, control the recruitment of repair factors from multiple pathways to sites of damage. Depletion of Drosha significantly reduces DNA repair by both homologous recombination (HR) and non-homologous end joining (NHEJ). Drosha is required within minutes of break induction, suggesting a central and early role for RNA processing in DNA repair. Sequencing of DNA:RNA hybrids reveals RNA invasion around DNA break sites in a Drosha-dependent manner. Removal of the RNA component of these structures results in impaired repair. These results show how RNA can be a direct and critical mediator of DNA damage repair in human cells.

Predominant role of DNA polymerase eta and p53-dependent translesion synthesis in the survival of ultraviolet-irradiated human cells.

PubMed

Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M

2017-02-17

Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA Looping Facilitates Targeting of a Chromatin Remodeling Enzyme

PubMed Central

Yadon, Adam N; Singh, Badri Nath; Hampsey, Michael; Tsukiyama, Toshio

2013-01-01

Summary ATP-dependent chromatin remodeling enzymes are highly abundant and play pivotal roles regulating DNA-dependent processes. The mechanisms by which they are targeted to specific loci have not been well understood on a genome-wide scale. Here we present evidence that a major targeting mechanism for the Isw2 chromatin remodeling enzyme to specific genomic loci is through sequence-specific transcription factor (TF)-dependent recruitment. Unexpectedly, Isw2 is recruited in a TF-dependent fashion to a large number of loci without TF binding sites. Using the 3C assay, we show that Isw2 can be targeted by Ume6- and TFIIB-dependent DNA looping. These results identify DNA looping as a previously unknown mechanism for the recruitment of a chromatin remodeling enzyme and defines a novel function for DNA looping. We also present evidence suggesting that Ume6-dependent DNA looping is involved in chromatin remodeling and transcriptional repression, revealing a mechanism by which the three-dimensional folding of chromatin affects DNA-dependent processes. PMID:23478442

DNA-based cryptographic methods for data hiding in DNA media.

PubMed

Marwan, Samiha; Shawish, Ahmed; Nagaty, Khaled

2016-12-01

Information security can be achieved using cryptography, steganography or a combination of them, where data is firstly encrypted using any of the available cryptography techniques and then hid into any hiding medium. Recently, the famous genomic DNA has been introduced as a hiding medium, known as DNA steganography, due to its notable ability to hide huge data sets with a high level of randomness and hence security. Despite the numerous cryptography techniques, to our knowledge only the vigenere cipher and the DNA-based playfair cipher have been combined with the DNA steganography, which keeps space for investigation of other techniques and coming up with new improvements. This paper presents a comprehensive analysis between the DNA-based playfair, vigenere, RSA and the AES ciphers, each combined with a DNA hiding technique. The conducted analysis reports the performance diversity of each combined technique in terms of security, speed, hiding capacity in addition to both key size and data size. Moreover, this paper proposes a modification of the current combined DNA-based playfair cipher technique, which makes it not only simple and fast but also provides a significantly higher hiding capacity and security. The conducted extensive experimental studies confirm such outstanding performance in comparison with all the discussed combined techniques. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Deficiency of the Arabidopsis helicase RTEL1 triggers a SOG1-dependent replication checkpoint in response to DNA cross-links.

PubMed

Hu, Zhubing; Cools, Toon; Kalhorzadeh, Pooneh; Heyman, Jefri; De Veylder, Lieven

2015-01-01

To maintain genome integrity, DNA replication is executed and regulated by a complex molecular network of numerous proteins, including helicases and cell cycle checkpoint regulators. Through a systematic screening for putative replication mutants, we identified an Arabidopsis thaliana homolog of human Regulator of Telomere Length 1 (RTEL1), which functions in DNA replication, DNA repair, and recombination. RTEL1 deficiency retards plant growth, a phenotype including a prolonged S-phase duration and decreased cell proliferation. Genetic analysis revealed that rtel1 mutant plants show activated cell cycle checkpoints, specific sensitivity to DNA cross-linking agents, and increased homologous recombination, but a lack of progressive shortening of telomeres, indicating that RTEL1 functions have only been partially conserved between mammals and plants. Surprisingly, RTEL1 deficiency induces tolerance to the deoxynucleotide-depleting drug hydroxyurea, which could be mimicked by DNA cross-linking agents. This resistance does not rely on the essential replication checkpoint regulator WEE1 but could be blocked by a mutation in the SOG1 transcription factor. Taken together, our data indicate that RTEL1 is required for DNA replication and that its deficiency activates a SOG1-dependent replication checkpoint. © 2015 American Society of Plant Biologists. All rights reserved.

Identification of transcription coactivator OCA-B-dependent genes involved in antigen-dependent B cell differentiation by cDNA array analyses.

PubMed

Kim, Unkyu; Siegel, Rachael; Ren, Xiaodi; Gunther, Cary S; Gaasterland, Terry; Roeder, Robert G

2003-07-22

The tissue-specific transcriptional coactivator OCA-B is required for antigen-dependent B cell differentiation events, including germinal center formation. However, the identity of OCA-B target genes involved in this process is unknown. This study has used large-scale cDNA arrays to monitor changes in gene expression patterns that accompany mature B cell differentiation. B cell receptor ligation alone induces many genes involved in B cell expansion, whereas B cell receptor and helper T cell costimulation induce genes associated with B cell effector function. OCA-B expression is induced by both B cell receptor ligation alone and helper T cell costimulation, suggesting that OCA-B is involved in B cell expansion as well as B cell function. Accordingly, several genes involved in cell proliferation and signaling, such as Lck, Kcnn4, Cdc37, cyclin D3, B4galt1, and Ms4a11, have been identified as OCA-B-dependent genes. Further studies on the roles played by these genes in B cells will contribute to an understanding of B cell differentiation.

Signal-on fluorescence biosensor for microRNA-21 detection based on DNA strand displacement reaction and Mg2+-dependent DNAzyme cleavage.

PubMed

Yin, Huan-Shun; Li, Bing-Chen; Zhou, Yun-Lei; Wang, Hai-Yan; Wang, Ming-Hui; Ai, Shi-Yun

2017-10-15

MicroRNAs have been involved into many biological processes and are regarded as disease biomarkers. Simple, rapid, sensitive and selective method for microRNA detection is crucial for early diagnosis and therapy of diseases. In this work, sensitive fluorescence assay was developed for microRNA-21 detection based on DNA polymerase induced strand displacement amplification reaction, Mg 2+ -dependent DNAzyme catalysis reaction, and magnetic separation. In the presence of target microRNA-21, amounts of trigger DNA could be produced with DNA polymerase induced strand displacement amplification reaction, and the trigger DNA could be further hybridized with signal DNA, which was labeled with biotin and AMCA dye. After introduction of Mg 2+ , trigger DNA could form DNAzyme to cleave signal DNA. After magnetic separation, the DNA fragment with AMCA dye could give fluorescence signal, which was related to microRNA-21 concentration. Based on the two efficient signal amplifications, the developed method showed high detection sensitivity with low detection limit of 0.27fM (3σ). In addition, this fluorescence strategy also possessed excellent detection specificity, and could be applied to analyze microRNA-21 expression level in serum of cancer patient. According to the obtained results, the developed fluorescence method might be a promising detection platform for microRNA-21 quantitative analysis in biomedical research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA Physical Properties and Nucleosome Positions Are Major Determinants of HIV-1 Integrase Selectivity

PubMed Central

Naughtin, Monica; Haftek-Terreau, Zofia; Xavier, Johan; Meyer, Sam; Silvain, Maud; Jaszczyszyn, Yan; Levy, Nicolas; Miele, Vincent; Benleulmi, Mohamed Salah; Ruff, Marc; Parissi, Vincent; Vaillant, Cédric; Lavigne, Marc

2015-01-01

Retroviral integrases (INs) catalyse the integration of the reverse transcribed viral DNA into the host cell genome. This process is selective, and chromatin has been proposed to be a major factor regulating this step in the viral life cycle. However, the precise underlying mechanisms are still under investigation. We have developed a new in vitro integration assay using physiologically-relevant, reconstituted genomic acceptor chromatin and high-throughput determination of nucleosome positions and integration sites, in parallel. A quantitative analysis of the resulting data reveals a chromatin-dependent redistribution of the integration sites and establishes a link between integration sites and nucleosome positions. The co-activator LEDGF/p75 enhanced integration but did not modify the integration sites under these conditions. We also conducted an in cellulo genome-wide comparative study of nucleosome positions and human immunodeficiency virus type-1 (HIV-1) integration sites identified experimentally in vivo. These studies confirm a preferential integration in nucleosome-covered regions. Using a DNA mechanical energy model, we show that the physical properties of DNA probed by IN binding are important in determining IN selectivity. These novel in vitro and in vivo approaches confirm that IN has a preference for integration into a nucleosome, and suggest the existence of two levels of IN selectivity. The first depends on the physical properties of the target DNA and notably, the energy required to fit DNA into the IN catalytic pocket. The second depends on the DNA deformation associated with DNA wrapping around a nucleosome. Taken together, these results indicate that HIV-1 IN is a shape-readout DNA binding protein. PMID:26075397

Study on the temperature-dependent coupling among viscosity, conductivity and structural relaxation of ionic liquids.

PubMed

Yamaguchi, Tsuyoshi; Yonezawa, Takuya; Koda, Shinobu

2015-07-15

The frequency-dependent viscosity and conductivity of three imidazolium-based ionic liquids were measured at several temperatures in the MHz region, and the results are compared with the intermediate scattering functions determined by neutron spin echo spectroscopy. The relaxations of both the conductivity and the viscosity agree with that of the intermediate scattering function at the ionic correlation when the relaxation time is short. As the relaxation time increases, the relaxations of the two transport properties deviate to lower frequencies than that of the ionic structure. The deviation begins at a shorter relaxation time for viscosity than for conductivity, which explains the fractional Walden rule between the zero-frequency values of the shear viscosity and the molar conductivity.

Differential impact of ionic and coordinate covalent chromium (Cr)-DNA binding on DNA replication.

PubMed

Fornsaglio, Jamie L; O'Brien, Travis J; Patierno, Steven R

2005-11-01

The reactive species produced by the reduction of Cr(VI), particularly Cr(III), can form both ionic and coordinate covalent complexes with DNA. These Cr(III)-DNA interactions consist of Cr-DNA monoadducts, Cr-DNA ternary adducts, and Cr-DNA interstrand cross-links (Cr-ICLs), the latter of which are DNA polymerase arresting lesions (PALs). We sought to determine the impact of Cr-DNA interactions on the formation of replication blocking lesions in S. cerevisiae using a PCR-based method. We found that target sequence (TS) amplification using DNA isolated from Cr(VI)-treated yeast actually increased as a function of Cr(VI) concentration. Moreover, the enhanced TS amplification was reproduced in vitro using Cr(III)-treated DNA. In contrast, PCR amplification of TS from DNA isolated from yeast exposed to equitoxic doses of the inorganic DNA cross-linking agent cisplatin (CDDP), was decreased in a concentration-dependent manner. This paradox suggested that a specific Cr-DNA interaction, such as an ionic Cr-DNA complex, was responsible for the enhanced TS amplification, thereby masking the replication-blocking effect of certain ternary Cr-DNA adducts (i.e. interstrand cross-links). To test this possibility, we removed ionically associated Cr from the DNA using salt extraction prior to PCR analysis. This procedure obviated the increased amplification and revealed a dose-dependent decrease in TS amplification and an increase in Cr-PALs. These data from DNA analyzed ex vivo after treatment of intact cells indicate that ionic interactions of Cr with DNA result in increased DNA amplification whereas coordinate-covalent Cr-DNA complexes lead to formation of Cr-PALs. Thus, these results suggest that treatment of living cells with Cr(VI) leads to two modes of Cr-binding, which may have conflicting effects on DNA replication.

Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.

PubMed Central

Winnacker, E L

1975-01-01

Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487

DNA-Templated Molecular Silver Fluorophores

PubMed Central

Petty, Jeffrey T.; Story, Sandra P.; Hsiang, Jung-Cheng; Dickson, Robert M.

2013-01-01

Conductive and plasmon-supporting noble metals exhibit an especially wide range of size-dependent properties, with discrete electronic levels, strong optical absorption, and efficient radiative relaxation dominating optical behavior at the ~10-atom cluster scale. In this Perspective, we describe the formation and stabilization of silver clusters using DNA templates and highlight the distinct spectroscopic and photophysical properties of the resulting hybrid fluorophores. Strong visible to near-IR emission from DNA-encapsulated silver clusters ranging in size from 5–11 atoms has been produced and characterized. Importantly, this strong Ag cluster fluorescence can be directly modulated and selectively recovered by optically controlling the dark state residence, even when faced with an overwhelming background. The strength and sequence sensitivity of the oligonucleotide-Ag interaction suggests strategies for fine tuning and stabilizing cluster-based emitters in a host of sensing and biolabeling applications that would benefit from brighter, more photostable, and quantifiable emitters in high background environments. PMID:23745165

Sperm DNA oxidative damage and DNA adducts

PubMed Central

Jeng, Hueiwang Anna; Pan, Chih-Hong; Chao, Mu-Rong; Lin, Wen-Yi

2015-01-01

The objective of this study was to investigate DNA damage and adducts in sperm from coke oven workers who have been exposed to polycyclic aromatic hydrocarbons. A longitudinal study was conducted with repeated measurements during spermatogenesis. Coke-oven workers (n=112) from a coke-oven plant served the PAH-exposed group, while administrators and security personnel (n=67) served the control. Routine semen parameters (concentration, motility, vitality, and morphology) were analyzed simultaneously; the assessment of sperm DNA integrity endpoints included DNA fragmentation, bulky DNA adducts, and 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxo-dGuo). The degree of sperm DNA fragmentation was measured using the terminal deoxynucleotidyl transferase-mediated dUTP nick end-labeling (TUNEL) assay and sperm chromatin structure assay (SCSA). The PAH-exposed group had a significant increase in bulky DNA adducts and 8-oxo-dGuo compared to the control subjects (Ps = 0.002 and 0.045, respectively). Coke oven workers' percentages of DNA fragmentation and denaturation from the PAH-exposed group were not significantly different from those of the control subjects (Ps = 0.232 and 0.245, respectively). Routine semen parameters and DNA integrity endpoints were not correlated. Concentrations of 8-oxo-dGuo were positively correlated with percentages of DNA fragmentation measured by both TUNEL and SCSA (Ps = 0.045 and 0.034, respectively). However, the concentrations of 8-oxo-dGuo and percentages of DNA fragmentation did not correlate with concentrations of bulky DNA adducts. In summary, coke oven workers with chronic exposure to PAHs experienced decreased sperm DNA integrity. Oxidative stress could contribute to the degree of DNA fragmentation. Bulky DNA adducts may be independent of the formation of DNA fragmentation and oxidative adducts in sperm. Monitoring sperm DNA integrity is recommended as a part of the process of assessing the impact of occupational and environmental toxins on

A-DNA and B-DNA: Comparing Their Historical X-Ray Fiber Diffraction Images

ERIC Educational Resources Information Center

Lucas, Amand A.

2008-01-01

A-DNA and B-DNA are two secondary molecular conformations (among other allomorphs) that double-stranded DNA drawn into a fiber can assume, depending on the relative water content and other chemical parameters of the fiber. They were the first two forms to be observed by X-ray fiber diffraction in the early 1950s, respectively by Wilkins and…

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism.

PubMed

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-02-28

Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure.

Sequence-dependent response of DNA to torsional stress: a potential biological regulation mechanism

PubMed Central

Reymer, Anna; Zakrzewska, Krystyna; Lavery, Richard

2018-01-01

Abstract Torsional restraints on DNA change in time and space during the life of the cell and are an integral part of processes such as gene expression, DNA repair and packaging. The mechanical behavior of DNA under torsional stress has been studied on a mesoscopic scale, but little is known concerning its response at the level of individual base pairs and the effects of base pair composition. To answer this question, we have developed a geometrical restraint that can accurately control the total twist of a DNA segment during all-atom molecular dynamics simulations. By applying this restraint to four different DNA oligomers, we are able to show that DNA responds to both under- and overtwisting in a very heterogeneous manner. Certain base pair steps, in specific sequence environments, are able to absorb most of the torsional stress, leaving other steps close to their relaxed conformation. This heterogeneity also affects the local torsional modulus of DNA. These findings suggest that modifying torsional stress on DNA could act as a modulator for protein binding via the heterogeneous changes in local DNA structure. PMID:29267977

USP7S-dependent inactivation of Mule regulates DNA damage signalling and repair.

PubMed

Khoronenkova, Svetlana V; Dianov, Grigory L

2013-02-01

The E3 ubiquitin ligase Mule/ARF-BP1 plays an important role in the cellular DNA damage response by controlling base excision repair and p53 protein levels. However, how the activity of Mule is regulated in response to DNA damage is currently unknown. Here, we report that the Ser18-containing isoform of the USP7 deubiquitylation enzyme (USP7S) controls Mule stability by preventing its self-ubiquitylation and subsequent proteasomal degradation. We find that in response to DNA damage, downregulation of USP7S leads to self-ubiquitylation and proteasomal degradation of Mule, which eventually leads to p53 accumulation. Cells that are unable to downregulate Mule show reduced ability to upregulate p53 levels in response to DNA damage. We also find that, as Mule inactivation is required for stabilization of base excision repair enzymes, the failure of cells to downregulate Mule after DNA damage results in deficient DNA repair. Our data describe a novel mechanism by which Mule is regulated in response to DNA damage and coordinates cellular DNA damage responses and DNA repair.

[Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

PubMed

Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

2009-01-01

The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

Cystic fibrosis transmembrane conductance regulator: temperature-dependent cysteine reactivity suggests different stable conformers of the conduction pathway.

PubMed

Liu, Xuehong; Dawson, David C

2011-11-29

Cysteine scanning has been widely used to identify pore-lining residues in mammalian ion channels, including the cystic fibrosis transmembrane conductance regulator (CFTR). These studies, however, have been typically conducted at room temperature rather than human body temperature. Reports of substantial effects of temperature on gating and anion conduction in CFTR channels as well as an unexpected pattern of cysteine reactivity in the sixth transmembrane segment (TM6) prompted us to investigate the effect of temperature on the reactivity of cysteines engineered into TM6 of CFTR. We compared reaction rates at temperatures ranging from 22 to 37 °C for cysteines placed on either side of an apparent size-selective accessibility barrier previously defined by comparing reactivity toward channel-permeant and channel-impermeant, thiol-directed reagents. The results indicate that the reactivity of cysteines at three positions extracellular to the position of the accessibility barrier, 334, 336, and 337, is highly temperature-dependent. At 37 °C, cysteines at these positions were highly reactive toward MTSES(-), whereas at 22 °C, the reaction rates were 2-6-fold slower to undetectable. An activation energy of 157 kJ/mol for the reaction at position 337 is consistent with the hypothesis that, at physiological temperature, the extracellular portion of the CFTR pore can adopt conformations that differ significantly from those that can be accessed at room temperature. However, the position of the accessibility barrier defined empirically by applying channel-permeant and channel-impermeant reagents to the extracellular aspect of the pore is not altered. The results illuminate previous scanning results and indicate that the assay temperature is a critical variable in studies designed to use chemical modification to test structural models for the CFTR anion conduction pathway.

Factors influencing detection of eDNA from a stream-dwelling amphibian

USGS Publications Warehouse

Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

2013-01-01

Environmental DNA (eDNA) methods for detecting and estimating abundance of aquatic species are emerging rapidly, but little is known about how processes such as secretion rate, environmental degradation, and time since colonization or extirpation from a given site affect eDNA measurements. Using stream-dwelling salamanders and quantitative PCR (qPCR) analysis, we conducted three experiments to assess eDNA: (i) production rate; (ii) persistence time under different temperature and light conditions; and (iii) detectability and concentration through time following experimental introduction and removal of salamanders into previously unoccupied streams. We found that 44–50 g individuals held in aquaria produced 77 ng eDNA/h for 2 h, after which production either slowed considerably or began to equilibrate with degradation. eDNA in both full-sun and shaded treatments degraded exponentially to 2) and when samples were collected within 5 m of the animals. Concentrations of eDNA detected were very low and increased steadily from 6–24 h after introduction, reaching 0.0022 ng/L. Within 1 h of removing salamanders from the stream, eDNA was no longer detectable. These results suggest that eDNA detectability and concentration depend on production rates of individuals, environmental conditions, density of animals, and their residence time.

Metabolic response to MMS-mediated DNA damage in Saccharomyces cerevisiae is dependent on the glucose concentration in the medium.

PubMed

Kitanovic, Ana; Walther, Thomas; Loret, Marie Odile; Holzwarth, Jinda; Kitanovic, Igor; Bonowski, Felix; Van Bui, Ngoc; Francois, Jean Marie; Wölfl, Stefan

2009-06-01

Maintenance and adaptation of energy metabolism could play an important role in the cellular ability to respond to DNA damage. A large number of studies suggest that the sensitivity of cells to oxidants and oxidative stress depends on the activity of cellular metabolism and is dependent on the glucose concentration. In fact, yeast cells that utilize fermentative carbon sources and hence rely mainly on glycolysis for energy appear to be more sensitive to oxidative stress. Here we show that treatment of the yeast Saccharomyces cerevisiae growing on a glucose-rich medium with the DNA alkylating agent methyl methanesulphonate (MMS) triggers a rapid inhibition of respiration and enhances reactive oxygen species (ROS) production, which is accompanied by a strong suppression of glycolysis. Further, diminished activity of pyruvate kinase and glyceraldehyde-3-phosphate dehydrogenase upon MMS treatment leads to a diversion of glucose carbon to glycerol, trehalose and glycogen accumulation and an increased flux through the pentose-phosphate pathway. Such conditions finally result in a significant decline in the ATP level and energy charge. These effects are dependent on the glucose concentration in the medium. Our results clearly demonstrate that calorie restriction reduces MMS toxicity through increased respiration and reduced ROS accumulation, enhancing the survival and recovery of cells.

A new family of polymerases related to superfamily A DNA polymerases and T7-like DNA-dependent RNA polymerases.

PubMed

Iyer, Lakshminarayan M; Abhiman, Saraswathi; Aravind, L

2008-10-04

Using sequence profile methods and structural comparisons we characterize a previously unknown family of nucleic acid polymerases in a group of mobile elements from genomes of diverse bacteria, an algal plastid and certain DNA viruses, including the recently reported Sputnik virus. Using contextual information from domain architectures and gene-neighborhoods we present evidence that they are likely to possess both primase and DNA polymerase activity, comparable to the previously reported prim-pol proteins. These newly identified polymerases help in defining the minimal functional core of superfamily A DNA polymerases and related RNA polymerases. Thus, they provide a framework to understand the emergence of both DNA and RNA polymerization activity in this class of enzymes. They also provide evidence that enigmatic DNA viruses, such as Sputnik, might have emerged from mobile elements coding these polymerases.

DnaA protein DNA-binding domain binds to Hda protein to promote inter-AAA+ domain interaction involved in regulatory inactivation of DnaA.

PubMed

Keyamura, Kenji; Katayama, Tsutomu

2011-08-19

Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis.

DnaA Protein DNA-binding Domain Binds to Hda Protein to Promote Inter-AAA+ Domain Interaction Involved in Regulatory Inactivation of DnaA*

PubMed Central

Keyamura, Kenji; Katayama, Tsutomu

2011-01-01

Chromosomal replication is initiated from the replication origin oriC in Escherichia coli by the active ATP-bound form of DnaA protein. The regulatory inactivation of DnaA (RIDA) system, a complex of the ADP-bound Hda and the DNA-loaded replicase clamp, represses extra initiations by facilitating DnaA-bound ATP hydrolysis, yielding the inactive ADP-bound form of DnaA. However, the mechanisms involved in promoting the DnaA-Hda interaction have not been determined except for the involvement of an interaction between the AAA+ domains of the two. This study revealed that DnaA Leu-422 and Pro-423 residues within DnaA domain IV, including a typical DNA-binding HTH motif, are specifically required for RIDA-dependent ATP hydrolysis in vitro and that these residues support efficient interaction with the DNA-loaded clamp·Hda complex and with Hda in vitro. Consistently, substitutions of these residues caused accumulation of ATP-bound DnaA in vivo and oriC-dependent inhibition of cell growth. Leu-422 plays a more important role in these activities than Pro-423. By contrast, neither of these residues is crucial for DNA replication from oriC, although they are highly conserved in DnaA orthologues. Structural analysis of a DnaA·Hda complex model suggested that these residues make contact with residues in the vicinity of the Hda AAA+ sensor I that participates in formation of a nucleotide-interacting surface. Together, the results show that functional DnaA-Hda interactions require a second interaction site within DnaA domain IV in addition to the AAA+ domain and suggest that these interactions are crucial for the formation of RIDA complexes that are active for DnaA-ATP hydrolysis. PMID:21708944

Radical-induced purine lesion formation is dependent on DNA helical topology.

PubMed

Terzidis, Michael A; Prisecaru, Andreea; Molphy, Zara; Barron, Niall; Randazzo, Antonio; Dumont, Elise; Krokidis, Marios G; Kellett, Andrew; Chatgilialoglu, Chryssostomos

2016-11-01

Herein we report the quantification of purine lesions arising from gamma-radiation sourced hydroxyl radicals (HO • ) on tertiary dsDNA helical forms of supercoiled (SC), open circular (OC), and linear (L) conformation, along with single-stranded folded and non-folded sequences of guanine-rich DNA in selected G-quadruplex structures. We identify that DNA helical topology and folding plays major, and unexpected, roles in the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxo-dG) and 8-oxo-7,8-dihydro-2'-deoxyadenosine (8-oxo-dA), along with tandem-type purine lesions 5',8-cyclo-2'-deoxyguanosine (5',8-cdG) and 5',8-cyclo-2'-deoxyadenosine (5',8-cdA). SC, OC, and L dsDNA conformers together with folded and non-folded G-quadruplexes d[TGGGGT] 4 (TG4T), d[AGGG(TTAGGG) 3 ] (Tel22), and the mutated tel24 d[TTGGG(TTAGGG) 3 A] (mutTel24) were exposed to HO • radicals and purine lesions were then quantified via stable isotope dilution LC-MS/MS analysis. Purine oxidation in dsDNA follows L > OC ≫ SC indicating greater damage towards the extended B-DNA topology. Conversely, G-quadruplex sequences were significantly more resistant toward purine oxidation in their unfolded states as compared with G-tetrad folded topologies; this effect is confirmed upon comparative analysis of Tel22 (∼50% solution folded) and mutTel24 (∼90% solution folded). In an effort to identify the accessibly of hydroxyl radicals to quadruplex purine nucleobases, G-quadruplex solvent cavities were then modeled at 1.33 Å with evidence suggesting that folded G-tetrads may act as potential oxidant traps to protect against chromosomal DNA damage.

Cyclic AMP Regulates Bacterial Persistence through Repression of the Oxidative Stress Response and SOS-Dependent DNA Repair in Uropathogenic Escherichia coli.

PubMed

Molina-Quiroz, Roberto C; Silva-Valenzuela, Cecilia; Brewster, Jennifer; Castro-Nallar, Eduardo; Levy, Stuart B; Camilli, Andrew

2018-01-09

Bacterial persistence is a transient, nonheritable physiological state that provides tolerance to bactericidal antibiotics. The stringent response, toxin-antitoxin modules, and stochastic processes, among other mechanisms, play roles in this phenomenon. How persistence is regulated is relatively ill defined. Here we show that cyclic AMP, a global regulator of carbon catabolism and other core processes, is a negative regulator of bacterial persistence in uropathogenic Escherichia coli , as measured by survival after exposure to a β-lactam antibiotic. This phenotype is regulated by a set of genes leading to an oxidative stress response and SOS-dependent DNA repair. Thus, persister cells tolerant to cell wall-acting antibiotics must cope with oxidative stress and DNA damage and these processes are regulated by cyclic AMP in uropathogenic E. coli IMPORTANCE Bacterial persister cells are important in relapsing infections in patients treated with antibiotics and also in the emergence of antibiotic resistance. Our results show that in uropathogenic E. coli , the second messenger cyclic AMP negatively regulates persister cell formation, since in its absence much more persister cells form that are tolerant to β-lactams antibiotics. We reveal the mechanism to be decreased levels of reactive oxygen species, specifically hydroxyl radicals, and SOS-dependent DNA repair. Our findings suggest that the oxidative stress response and DNA repair are relevant pathways to target in the design of persister-specific antibiotic compounds. Copyright © 2018 Molina-Quiroz et al.