Sample records for dependent electron scattering

  1. Profiling of back-scattered electrons in opposed magnetic field of a Twin Electron Beam Gun

    NASA Astrophysics Data System (ADS)

    Sethi, S.; Gupta, Anchal; Dileep Kumar, V.; Mukherjee, Jaya; Gantayet, L. M.

    2012-11-01

    Electron gun is extensively used in material processing, physical vapour deposition and atomic vapour based laser processes. In these processes where the electron beam is incident on the substrate, a significant fraction of electron beam gets back-scattered from the target surface. The trajectory of this back scattered electron beam depends on the magnetic field in the vicinity. The fraction of back-scattered depends on the atomic number of the target metal and can be as high as ~40% of the incident beam current. These back-scattered electrons can cause undesired hot spots and also affect the overall process. Hence, the study of the trajectory of these back-scattered electrons is important. This paper provides the details of experimentally mapped back-scattered electrons of a 2×20kW Twin Electron Beam Gun (TEBG) in opposed magnetic field i.e. with these guns placed at 180° to each other.

  2. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dixit, Gopal; Santra, Robin; Department of Physics, University of Hamburg, D-20355 Hamburg

    2013-04-07

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)]. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixturemore » of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.« less

  3. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets

    NASA Astrophysics Data System (ADS)

    Dixit, Gopal; Santra, Robin

    2013-04-01

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)], 10.1073/pnas.1202226109. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixture of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.

  4. Role of electron-electron interference in ultrafast time-resolved imaging of electronic wavepackets.

    PubMed

    Dixit, Gopal; Santra, Robin

    2013-04-07

    Ultrafast time-resolved x-ray scattering is an emerging approach to image the dynamical evolution of the electronic charge distribution during complex chemical and biological processes in real-space and real-time. Recently, the differences between semiclassical and quantum-electrodynamical (QED) theory of light-matter interaction for scattering of ultrashort x-ray pulses from the electronic wavepacket were formally demonstrated and visually illustrated by scattering patterns calculated for an electronic wavepacket in atomic hydrogen [G. Dixit, O. Vendrell, and R. Santra, Proc. Natl. Acad. Sci. U.S.A. 109, 11636 (2012)]. In this work, we present a detailed analysis of time-resolved x-ray scattering from a sample containing a mixture of non-stationary and stationary electrons within both the theories. In a many-electron system, the role of scattering interference between a non-stationary and several stationary electrons to the total scattering signal is investigated. In general, QED and semiclassical theory provide different results for the contribution from the scattering interference, which depends on the energy resolution of the detector and the x-ray pulse duration. The present findings are demonstrated by means of a numerical example of x-ray time-resolved imaging for an electronic wavepacket in helium. It is shown that the time-dependent scattering interference vanishes within semiclassical theory and the corresponding patterns are dominated by the scattering contribution from the time-independent interference, whereas the time-dependent scattering interference contribution do not vanish in the QED theory and the patterns are dominated by the scattering contribution from the non-stationary electron scattering.

  5. Disorder dependence electron phonon scattering rate of V82Pd18 - xFex alloys at low temperature

    NASA Astrophysics Data System (ADS)

    Jana, R. N.; Meikap, A. K.

    2018-04-01

    We have systematically investigated the disorder dependence electron phonon scattering rate in three dimensional disordered V82Pd18 - xFex alloys. A minimum in temperature dependence resistivity curve has been observed at low temperature T =Tm. In the temperature range 5 K ≤ T ≤Tm the resistivity correction follows ρo 5 / 2T 1 / 2 law. The dephasing scattering time has been calculated from analysis of magnetoresistivity by weak localization theory. The electron dephasing time is dominated by electron-phonon scattering and follows anomalous temperature (T) and disorder (ρ0) dependence behaviour like τe-ph-1 ∝T2 /ρ0, where ρ0 is the impurity resistivity. The magnitude of the saturated dephasing scattering time (τ0) at zero temperature decreases with increasing disorder of the samples. Such anomalous behaviour of dephasing scattering rate is still unresolved.

  6. Spin-dependent electron scattering at graphene edges on Ni(111).

    PubMed

    Garcia-Lekue, A; Balashov, T; Olle, M; Ceballos, G; Arnau, A; Gambardella, P; Sanchez-Portal, D; Mugarza, A

    2014-02-14

    We investigate the scattering of surface electrons by the edges of graphene islands grown on Ni(111). By combining local tunneling spectroscopy and ab initio electronic structure calculations we find that the hybridization between graphene and Ni states results in strongly reflecting graphene edges. Quantum interference patterns formed around the islands reveal a spin-dependent scattering of the Shockley bands of Ni, which we attribute to their distinct coupling to bulk states. Moreover, we find a strong dependence of the scattering amplitude on the atomic structure of the edges, depending on the orbital character and energy of the surface states.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jana, R. N.; Meikap, A. K.

    The results of a comprehensive study of weak electron localization (WEL) and electron-electron interaction (EEI) effects in disordered V{sub 75}X{sub 25} (X = Pd, Al) alloys has been reported. The resistivity in absence of magnetic field shows a minimum at temperature T = T{sub m} and follows T{sup 1/2} law within the temperature range 5 K ≤ T ≤ T{sub m}, which suggests predominant EEI effect. Magnetoresistivity is positive due to strong spin-orbit interaction. The dephasing scattering time is dominated by the electron-phonon scattering. The electron-phonon scattering rate shows quadratic temperature dependence behavior, which is explained by the theory ofmore » incomplete dragging at the random scattering potential by phonons. The zero temperature scattering time strongly depends on the disorder and its magnitude decreases with increasing disorder.« less

  8. Dependence of mobility on the electron concentration upon scattering at polar optical phonons in A{sup III}–N nitrides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Borisenko, S. I., E-mail: sib@tpu.ru

    2016-04-15

    The dependence of the effective relaxation time on the electron concentration in A{sup III}–N nitrides in the case of electron scattering at polar longitudinal optical phonons is calculated by the marching method. The method takes into account the inelasticity of electron scattering at polar optical phonons for nitrides in the zinc-blende approximation. The calculations show a substantial increase in mobility in samples with a degenerate electron gas, if screening of the long-range potential of polar longitudinal optical phonons is taken into account.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikheev, Evgeny; Himmetoglu, Burak; Kajdos, Adam P.

    We analyze and compare the temperature dependence of the electron mobility of two- and three-dimensional electron liquids in SrTiO{sub 3}. The contributions of electron-electron scattering must be taken into account to accurately describe the mobility in both cases. For uniformly doped, three-dimensional electron liquids, the room temperature mobility crosses over from longitudinal optical (LO) phonon-scattering-limited to electron-electron-scattering-limited as a function of carrier density. In high-density, two-dimensional electron liquids, LO phonon scattering is completely screened and the mobility is dominated by electron-electron scattering up to room temperature. The possible origins of the observed behavior and the consequences for approaches to improvemore » the mobility are discussed.« less

  10. Direct observation and theory of trajectory-dependent electronic energy losses in medium-energy ion scattering.

    PubMed

    Hentz, A; Parkinson, G S; Quinn, P D; Muñoz-Márquez, M A; Woodruff, D P; Grande, P L; Schiwietz, G; Bailey, P; Noakes, T C Q

    2009-03-06

    The energy spectrum associated with scattering of 100 keV H+ ions from the outermost few atomic layers of Cu(111) in different scattering geometries provides direct evidence of trajectory-dependent electronic energy loss. Theoretical simulations, combining standard Monte Carlo calculations of the elastic scattering trajectories with coupled-channel calculations to describe inner-shell ionization and excitation as a function of impact parameter, reproduce the effects well and provide a means for far more complete analysis of medium-energy ion scattering data.

  11. Optical Asymmetry and Nonlinear Light Scattering from Colloidal Gold Nanorods.

    PubMed

    Lien, Miao-Bin; Kim, Ji-Young; Han, Myung-Geun; Chang, You-Chia; Chang, Yu-Chung; Ferguson, Heather J; Zhu, Yimei; Herzing, Andrew A; Schotland, John C; Kotov, Nicholas A; Norris, Theodore B

    2017-06-27

    A systematic study is presented of the intensity-dependent nonlinear light scattering spectra of gold nanorods under resonant excitation of the longitudinal surface plasmon resonance (SPR). The spectra exhibit features due to coherent second and third harmonic generation as well as a broadband feature that has been previously attributed to multiphoton photoluminescence arising primarily from interband optical transitions in the gold. A detailed study of the spectral dependence of the scaling of the scattered light with excitation intensity shows unexpected scaling behavior of the coherent signals, which is quantitatively accounted for by optically induced damping of the SPR mode through a Fermi liquid model of the electronic scattering. The broadband feature is shown to arise not from luminescence, but from scattering of the second-order longitudinal SPR mode with the electron gas, where efficient excitation of the second order mode arises from an optical asymmetry of the nanorod. The electronic-temperature-dependent plasmon damping and the Fermi-Dirac distribution together determine the intensity dependence of the broadband emission, and the structure-dependent absorption spectrum determines the spectral shape through the fluctuation-dissipation theorem. Hence a complete self-consistent picture of both coherent and incoherent light scattering is obtained with a single set of physical parameters.

  12. Many-body Effects in a Laterally Inhomogeneous Semiconductor Quantum Well

    NASA Technical Reports Server (NTRS)

    Ning, Cun-Zheng; Li, Jian-Zhong; Biegel, Bryan A. (Technical Monitor)

    2002-01-01

    Many body effects on conduction and diffusion of electrons and holes in a semiconductor quantum well are studied using a microscopic theory. The roles played by the screened Hartree-Fock (SHE) terms and the scattering terms are examined. It is found that the electron and hole conductivities depend only on the scattering terms, while the two-component electron-hole diffusion coefficients depend on both the SHE part and the scattering part. We show that, in the limit of the ambipolax diffusion approximation, however, the diffusion coefficients for carrier density and temperature are independent of electron-hole scattering. In particular, we found that the SHE terms lead to a reduction of density-diffusion coefficients and an increase in temperature-diffusion coefficients. Such a reduction or increase is explained in terms of a density-and temperature dependent energy landscape created by the bandgap renormalization.

  13. Exact Time-Dependent Exchange-Correlation Potential in Electron Scattering Processes

    NASA Astrophysics Data System (ADS)

    Suzuki, Yasumitsu; Lacombe, Lionel; Watanabe, Kazuyuki; Maitra, Neepa T.

    2017-12-01

    We identify peak and valley structures in the exact exchange-correlation potential of time-dependent density functional theory that are crucial for time-resolved electron scattering in a model one-dimensional system. These structures are completely missed by adiabatic approximations that, consequently, significantly underestimate the scattering probability. A recently proposed nonadiabatic approximation is shown to correctly capture the approach of the electron to the target when the initial Kohn-Sham state is chosen judiciously, and it is more accurate than standard adiabatic functionals but ultimately fails to accurately capture reflection. These results may explain the underestimation of scattering probabilities in some recent studies on molecules and surfaces.

  14. Room scatter effects in Total Skin Electron Irradiation: Monte Carlo simulation study.

    PubMed

    Nevelsky, Alexander; Borzov, Egor; Daniel, Shahar; Bar-Deroma, Raquel

    2017-01-01

    Total Skin Electron Irradiation (TSEI) is a complex technique which usually involves the use of large electron fields and the dual-field approach. In this situation, many electrons scattered from the treatment room floor are produced. However, no investigations of the effect of scattered electrons in TSEI treatments have been reported. The purpose of this work was to study the contribution of floor scattered electrons to skin dose during TSEI treatment using Monte Carlo (MC) simulations. All MC simulations were performed with the EGSnrc code. Influence of beam energy, dual-field angle, and floor material on the contribution of floor scatter was investigated. Spectrum of the scattered electrons was calculated. Measurements of dose profile were performed in order to verify MC calculations. Floor scatter dependency on the floor material was observed (at 20 cm from the floor, scatter contribution was about 21%, 18%, 15%, and 12% for iron, concrete, PVC, and water, respectively). Although total dose profiles exhibited slight variation as functions of beam energy and dual-field angle, no dependence of the floor scatter contribution on the beam energy or dual-field angle was found. The spectrum of the scattered electrons was almost uniform between a few hundred KeV to 4 MeV, and then decreased linearly to 6 MeV. For the TSEI technique, dose contribution due to the electrons scattered from the room floor may be clinically significant and should be taken into account during design and commissioning phases. MC calculations can be used for this task. © 2017 The Authors. Journal of Applied Clinical Medical Physics published by Wiley Periodicals, Inc. on behalf of American Association of Physicists in Medicine.

  15. Spin-dependence of the electron scattering cross section by a magnetic layer system and the magneto-resistance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, J.T.; Tang, F.; Brown, W.D.

    1998-12-20

    The authors present a theoretical model for calculating the spin-dependent cross section of the scattering of electrons by a magnetic layer system. The model demonstrates that the cross sections of the scattering are different for spin up and spin down electrons. The model assumes that the electrical resistivity in a conductor is proportional to the scattering cross section of the electron in it. It is believed to support the two channel mechanism in interpreting magneto-resistance (MR). Based on the model without considering the scattering due to the interfacial roughness and the spin flipping scattering, the authors have established a relationshipmore » between MR and the square of the magnetic moment in the bulk sample without considering the scattering due to the interfacial roughness and the spin flipping scattering. It can also qualitatively explain the MR difference between the current in plane (CIP) and current perpendicular to the plane (CPP) configurations. The predictions by the model agree well with the experimental findings.« less

  16. Optical Asymmetry and Nonlinear Light Scattering from Colloidal Gold Nanorods

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lien, Miao-Bin; Kim, Ji-Young; Han, Myung-Geun

    A systematic study is presented of the intensity-dependent nonlinear light scattering spectra of gold nanorods under resonant excitation of the longitudinal surface plasmon resonance (SPR). The spectra exhibit features due to coherent second and third harmonic generation as well as a broadband feature that has been previously attributed to multiphoton photoluminescence arising primarily from interband optical transitions in the gold. A detailed study of the spectral dependence of the scaling of the scattered light with excitation intensity shows unexpected scaling behavior of the coherent signals, which is quantitatively accounted for by optically induced damping of the SPR mode through amore » Fermi liquid model of the electronic scattering. The broadband feature is shown to arise not from luminescence, but from scattering of the secondorder longitudinal SPR mode with the electron gas, where efficient excitation of the 2nd order mode arises from an optical asymmetry of the nanorod. The electronic-temperature-dependent plasmon damping and the Fermi-Dirac distribution together determine the intensity dependence of the broadband emission, and the structure-dependent absorption spectrum determines the spectral shape through the fluctuation-dissipation theorem. Hence a complete self-consistent picture of both coherent and incoherent light scattering is obtained with a single set of physical parameters.« less

  17. Optical Asymmetry and Nonlinear Light Scattering from Colloidal Gold Nanorods

    DOE PAGES

    Lien, Miao-Bin; Kim, Ji-Young; Han, Myung-Geun; ...

    2017-05-16

    A systematic study is presented of the intensity-dependent nonlinear light scattering spectra of gold nanorods under resonant excitation of the longitudinal surface plasmon resonance (SPR). The spectra exhibit features due to coherent second and third harmonic generation as well as a broadband feature that has been previously attributed to multiphoton photoluminescence arising primarily from interband optical transitions in the gold. A detailed study of the spectral dependence of the scaling of the scattered light with excitation intensity shows unexpected scaling behavior of the coherent signals, which is quantitatively accounted for by optically induced damping of the SPR mode through amore » Fermi liquid model of the electronic scattering. The broadband feature is shown to arise not from luminescence, but from scattering of the secondorder longitudinal SPR mode with the electron gas, where efficient excitation of the 2nd order mode arises from an optical asymmetry of the nanorod. The electronic-temperature-dependent plasmon damping and the Fermi-Dirac distribution together determine the intensity dependence of the broadband emission, and the structure-dependent absorption spectrum determines the spectral shape through the fluctuation-dissipation theorem. Hence a complete self-consistent picture of both coherent and incoherent light scattering is obtained with a single set of physical parameters.« less

  18. Effect of electron-electron scattering on the conductance of a quantum wire studied with the Boltzman transport equation

    NASA Astrophysics Data System (ADS)

    Lyo, S. K.; Huang, Danhong

    2006-05-01

    Electron-electron scattering conserves total momentum and does not dissipate momentum directly in a low-density system where the umklapp process is forbidden. However, it can still affect the conductance through the energy relaxation of the electrons. We show here that this effect can be studied with arbitrary accuracy in a multisublevel one-dimensional (1D) single quantum wire system in the presence of roughness and phonon scattering using a formally exact solution of the Boltzmann transport equation. The intrasubband electron-electron scattering is found to yield no net effect on the transport of electrons in 1D with only one sublevel occupied. For a system with a multilevel occupation, however, we find a significant effect of intersublevel electron-electron scattering on the temperature and density dependence of the resistance at low temperatures.

  19. Fourier-transform-based model for carrier transport in semiconductor heterostructures: Longitudinal optical phonon scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lü, X.; Schrottke, L.; Grahn, H. T.

    We present scattering rates for electrons at longitudinal optical phonons within a model completely formulated in the Fourier domain. The total intersubband scattering rates are obtained by averaging over the intrasubband electron distributions. The rates consist of the Fourier components of the electron wave functions and a contribution depending only on the intersubband energies and the intrasubband carrier distributions. The energy-dependent part can be reproduced by a rational function, which allows for the separation of the scattering rates into a dipole-like contribution, an overlap-like contribution, and a contribution which can be neglected for low and intermediate carrier densities of themore » initial subband. For a balance between accuracy and computation time, the number of Fourier components can be adjusted. This approach facilitates an efficient design of complex heterostructures with realistic, temperature- and carrier density-dependent rates.« less

  20. Inelastic scattering of electrons at real metal surfaces

    NASA Astrophysics Data System (ADS)

    Ding, Z.-J.

    1997-04-01

    A theory is presented to calculate the electron inelastic scattering cross section for a moving electron near the surface region at an arbitrary takeoff angle. The theory is based on using a bulk plasmon-pole approximation to derive the numerically computable expression of the electron self-energy in the random-phase approximation for a surface system, through the use of experimental optical constants. It is shown that the wave-vector-dependent surface dielectric function satisfies the surface sum rules in this scheme. The theory provides a detailed knowledge of electron self-energy depending on the kinetic energy, distance from surface, and velocity vector of an electron moving in any metal of a known dielectric constant, accommodating the formulation to practical situation in surface electron spectroscopies. Numerical computations of the energy-loss cross section have been made for Si and Au. The contribution to the total differential scattering cross section from each component is analyzed. The depth dependence informs us in detail how the bulk excitation mode changes to a surface excitation mode with an electron approaching the surface from the interior of a medium.

  1. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized 2H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    M. Ferro-Luzzi; M. Bouwhuis; E. Passchier

    1996-09-23

    We report an absolute measurement of the tensor analyzing powers T20 and T22 in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup -1}. The novel approach of this measurement is the use of a tensor polarized 2H target internal to an electron storage ring, with in situ measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering.

  2. Comparative analysis of characteristic electron energy loss spectra and inelastic scattering cross-section spectra of Fe

    NASA Astrophysics Data System (ADS)

    Parshin, A. S.; Igumenov, A. Yu.; Mikhlin, Yu. L.; Pchelyakov, O. P.; Zhigalov, V. S.

    2016-05-01

    The inelastic electron scattering cross section spectra of Fe have been calculated based on experimental spectra of characteristic reflection electron energy loss as dependences of the product of the inelastic mean free path by the differential inelastic electron scattering cross section on the electron energy loss. It has been shown that the inelastic electron scattering cross-section spectra have certain advantages over the electron energy loss spectra in the analysis of the interaction of electrons with substance. The peaks of energy loss in the spectra of characteristic electron energy loss and inelastic electron scattering cross sections have been determined from the integral and differential spectra. It has been shown that the energy of the bulk plasmon is practically independent of the energy of primary electrons in the characteristic electron energy loss spectra and monotonically increases with increasing energy of primary electrons in the inelastic electron scattering cross-section spectra. The variation in the maximum energy of the inelastic electron scattering cross-section spectra is caused by the redistribution of intensities over the peaks of losses due to various excitations. The inelastic electron scattering cross-section spectra have been analyzed using the decomposition of the spectra into peaks of the energy loss. This method has been used for the quantitative estimation of the contributions from different energy loss processes to the inelastic electron scattering cross-section spectra of Fe and for the determination of the nature of the energy loss peaks.

  3. Directly Characterizing the Relative Strength and Momentum Dependence of Electron-Phonon Coupling Using Resonant Inelastic X-Ray Scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Devereaux, T. P.; Shvaika, A. M.; Wu, K.

    The coupling between lattice and charge degrees of freedom in condensed matter materials is ubiquitous and can often result in interesting properties and ordered phases, including conventional superconductivity, charge-density wave order, and metal-insulator transitions. Angle-resolved photoemission spectroscopy and both neutron and nonresonant x-ray scattering serve as effective probes for determining the behavior of appropriate, individual degrees of freedom—the electronic structure and lattice excitation, or phonon dispersion, respectively. However, each provides less direct information about the mutual coupling between the degrees of freedom, usually through self-energy effects, which tend to renormalize and broaden spectral features precisely where the coupling is strong,more » impacting one’s ability to quantitatively characterize the coupling. Here, we demonstrate that resonant inelastic x-ray scattering, or RIXS, can be an effective tool to directly determine the relative strength and momentum dependence of the electron-phonon coupling in condensed matter systems. Using a diagrammatic approach for an eight-band model of copper oxides, we study the contributions from the lowest-order diagrams to the full RIXS intensity for a realistic scattering geometry, accounting for matrix element effects in the scattering cross section, as well as the momentum dependence of the electron-phonon coupling vertex. A detailed examination of these maps offers a unique perspective into the characteristics of electron-phonon coupling, which complements both neutron and nonresonant x-ray scattering, as well as Raman and infrared conductivity.« less

  4. Directly Characterizing the Relative Strength and Momentum Dependence of Electron-Phonon Coupling Using Resonant Inelastic X-Ray Scattering

    DOE PAGES

    Devereaux, T. P.; Shvaika, A. M.; Wu, K.; ...

    2016-10-25

    The coupling between lattice and charge degrees of freedom in condensed matter materials is ubiquitous and can often result in interesting properties and ordered phases, including conventional superconductivity, charge-density wave order, and metal-insulator transitions. Angle-resolved photoemission spectroscopy and both neutron and nonresonant x-ray scattering serve as effective probes for determining the behavior of appropriate, individual degrees of freedom—the electronic structure and lattice excitation, or phonon dispersion, respectively. However, each provides less direct information about the mutual coupling between the degrees of freedom, usually through self-energy effects, which tend to renormalize and broaden spectral features precisely where the coupling is strong,more » impacting one’s ability to quantitatively characterize the coupling. Here, we demonstrate that resonant inelastic x-ray scattering, or RIXS, can be an effective tool to directly determine the relative strength and momentum dependence of the electron-phonon coupling in condensed matter systems. Using a diagrammatic approach for an eight-band model of copper oxides, we study the contributions from the lowest-order diagrams to the full RIXS intensity for a realistic scattering geometry, accounting for matrix element effects in the scattering cross section, as well as the momentum dependence of the electron-phonon coupling vertex. A detailed examination of these maps offers a unique perspective into the characteristics of electron-phonon coupling, which complements both neutron and nonresonant x-ray scattering, as well as Raman and infrared conductivity.« less

  5. Monte Carlo study of the effective Sherman function for electron polarimetry

    NASA Astrophysics Data System (ADS)

    Drągowski, M.; Włodarczyk, M.; Weber, G.; Ciborowski, J.; Enders, J.; Fritzsche, Y.; Poliszczuk, A.

    2016-12-01

    The PEBSI Monte Carlo simulation was upgraded towards usefulness for electron Mott polarimetry. The description of Mott scattering was improved and polarisation transfer in Møller scattering was included in the code. An improved agreement was achieved between the simulation and available experimental data for a 100 keV polarised electron beam scattering off gold foils of various thicknesses. The dependence of the effective Sherman function on scattering angle and target thickness, as well as the method of finding optimal conditions for Mott polarimetry measurements were analysed.

  6. Thomson scattering diagnostics of thermal plasmas: Laser heating of electrons and the existence of local thermodynamic equilibrium.

    PubMed

    Murphy, A B

    2004-01-01

    A number of assessments of electron temperatures in atmospheric-pressure arc plasmas using Thomson scattering of laser light have recently been published. However, in this method, the electron temperature is perturbed due to strong heating of the electrons by the incident laser beam. This heating was taken into account by measuring the electron temperature as a function of the laser pulse energy, and linearly extrapolating the results to zero pulse energy to obtain an unperturbed electron temperature. In the present paper, calculations show that the laser heating process has a highly nonlinear dependence on laser power, and that the usual linear extrapolation leads to an overestimate of the electron temperature, typically by 5000 K. The nonlinearity occurs due to the strong dependence on electron temperature of the absorption of laser energy and of the collisional and radiative cooling of the heated electrons. There are further problems in deriving accurate electron temperatures from laser scattering due to necessary averages that have to be made over the duration of the laser pulse and over the finite volume from which laser light is scattered. These problems are particularly acute in measurements in which the laser beam is defocused in order to minimize laser heating; this can lead to the derivation of electron temperatures that are significantly greater than those existing anywhere in the scattering volume. It was concluded from the earlier Thomson scattering measurements that there were significant deviations from equilibrium between the electron and heavy-particle temperatures at the center of arc plasmas of industrial interest. The present calculations indicate that such deviations are only of the order of 1000 K in 20 000 K, so that the usual approximation that arc plasmas are approximately in local thermodynamic equilibrium still applies.

  7. A comparative study of transport properties of monolayer graphene and AlGaN-GaN heterostructure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ozdemir, M. D.; Atasever, O.; Ozdemir, B.

    2015-07-15

    The electronic transport properties of monolayer graphene are presented with an Ensemble Monte Carlo method where a rejection technique is used to account for the occupancy of the final states after scattering. Acoustic and optic phonon scatterings are considered for intrinsic graphene and in addition, ionized impurity and surface roughness scatterings are considered for the case of dirty graphene. The effect of screening is considered in the ionized impurity scattering of electrons. The time dependence of drift velocity of carriers is obtained where overshoot and undershoot effects are observed for certain values of applied field and material parameters for intrinsicmore » graphene. The field dependence of drift velocity of carriers showed negative differential resistance and disappeared as acoustic scattering becomes dominant for intrinsic graphene. The variation of electron mobility with temperature is calculated for intrinsic (suspended) and dirty monolayer graphene sheets separately and they are compared. These are also compared with the mobility of two dimensional electrons at an AlGaN/GaN heterostructure. It is observed that interface roughness may become very effective in limiting the mobility of electrons in graphene.« less

  8. Electron transport in furfural: dependence of the electron ranges on the cross sections and the energy loss distribution functions

    NASA Astrophysics Data System (ADS)

    Ellis-Gibbings, L.; Krupa, K.; Colmenares, R.; Blanco, F.; Muńoz, A.; Mendes, M.; Ferreira da Silva, F.; Limá Vieira, P.; Jones, D. B.; Brunger, M. J.; García, G.

    2016-09-01

    Recent theoretical and experimental studies have provided a complete set of differential and integral electron scattering cross section data from furfural over a broad energy range. The energy loss distribution functions have been determined in this study by averaging electron energy loss spectra for different incident energies and scattering angles. All these data have been used as input parameters for an event by event Monte Carlo simulation procedure to obtain the electron energy deposition patterns and electron ranges in liquid furfural. The dependence of these results on the input cross sections is then analysed to determine the uncertainty of the simulated values.

  9. Comptonization of thermal photons by relativistic electron beams

    NASA Technical Reports Server (NTRS)

    Daugherty, Joseph K.; Harding, Alice K.

    1989-01-01

    This paper presents a numerical calculation of gamma-ray emission produced by Compton scattering of relativistic electron beams on background thermal radiation, which includes spatial dependence of electron energy losses and cyclotron resonance scattering in a strong magnetic field. In the first version, the scattering is described by the fully relativistic Klein-Nishina cross section, but the magnetic field is neglected. In the second version, the scattering is described by the magnetic resonant cross section in the Thomson limit. It is found that when the magnetic field is not included, electron energy losses are important only at higher neutron star surface temperatures (T about 3,000,000 K). In the presence of a strong magnetic field, (10 to the 12th G), resonant scattering greatly increases electron energy losses, making scattering very efficient even at lower surface temperatures. Resulting photon and electron spectra for both cases ae discussed in relation to models for pulsar X-ray and gamma-ray emission.

  10. Frequency-dependent shot noise in long disordered superconductor-normal-metal-superconductor contacts.

    PubMed

    Nagaev, K E

    2001-04-02

    The shot noise in long diffusive superconductor-normal-metal-superconductor contacts is calculated using the semiclassical approach. At low frequencies and for purely elastic scattering, the voltage dependence of the noise is of the form S(I) = (4Delta+2eV)/3R. The electron-electron scattering suppresses the noise at small voltages resulting in vanishing noise yet infinite dS(I)/dV at V = 0. The distribution function of electrons consists of a series of steps, and the frequency dependence of noise exhibits peculiarities at omega = neV, omega = neV-2Delta, and omega = 2Delta-neV for integer n.

  11. A novel analytical model for scattering limited electron transport in nano-dimensional InAlAs/InGaAs heterostructure for cryogenic applications

    NASA Astrophysics Data System (ADS)

    Sharma, Neetika; Verma, Neha; Jogi, Jyotika

    2017-11-01

    This paper models the scattering limited electron transport in a nano-dimensional In0.52Al0.48As/In0.53Ga0.47As/InP heterostructure. An analytical model for temperature dependent sheet carrier concentration and carrier mobility in a two dimensional electron gas, confined in a triangular potential well has been developed. The model accounts for all the major scattering process including ionized impurity scattering and lattice scattering. Quantum mechanical variational technique is employed for studying the intrasubband scattering mechanism in the two dimensional electron gas. Results of various scattering limited structural parameters such as energy band-gap and functional parameters such as sheet carrier concentration, scattering rate and mobility are presented. The model corroborates the dominance of ionized impurity scattering mechanism at low temperatures and that of lattice scattering at high temperatures, both in turn limiting the carrier mobility. Net mobility obtained taking various scattering mechanisms into account has been found in agreement with earlier reported results, thus validating the model.

  12. Measurement of Tensor Analyzing Powers for Elastic Electron Scattering from a Polarized {sup 2}H Target Internal to a Storage Ring

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ferro-Luzzi, M.; Bouwhuis, M.; Passchier, E.

    1996-09-01

    We report an absolute measurement of the tensor analyzing powers {ital T}{sub 20} and {ital T}{sub 22} in elastic electron-deuteron scattering at a momentum transfer of 1.6 fm{sup {minus}1}. The novel approach of this measurement is the use of a tensor polarized {sup 2}H target internal to an electron storage ring, with {ital in} {ital situ} measurement of the polarization of the target gas. Scattered electrons and recoil deuterons were detected in coincidence with two large acceptance nonmagnetic detectors. The techniques demonstrated have broad applicability to further measurements of spin-dependent electron scattering. {copyright} {ital 1996 The American Physical Society.}

  13. Doping dependence of charge order in electron-doped cuprate superconductors

    NASA Astrophysics Data System (ADS)

    Mou, Yingping; Feng, Shiping

    2017-12-01

    In the recent studies of the unconventional physics in cuprate superconductors, one of the central issues is the interplay between charge order and superconductivity. Here the mechanism of the charge-order formation in the electron-doped cuprate superconductors is investigated based on the t-J model. The experimentally observed momentum dependence of the electron quasiparticle scattering rate is qualitatively reproduced, where the scattering rate is highly anisotropic in momentum space, and is intriguingly related to the charge-order gap. Although the scattering strength appears to be weakest at the hot spots, the scattering in the antinodal region is stronger than that in the nodal region, which leads to the original electron Fermi surface is broken up into the Fermi pockets and their coexistence with the Fermi arcs located around the nodal region. In particular, this electron Fermi surface instability drives the charge-order correlation, with the charge-order wave vector that matches well with the wave vector connecting the hot spots, as the charge-order correlation in the hole-doped counterparts. However, in a striking contrast to the hole-doped case, the charge-order wave vector in the electron-doped side increases in magnitude with the electron doping. The theory also shows the existence of a quantitative link between the single-electron fermiology and the collective response of the electron density.

  14. Low-Energy Elastic Electron Scattering by Atomic Oxygen

    NASA Technical Reports Server (NTRS)

    Zatsarinny O.; Bartschat, K.; Tayal, S. S.

    2006-01-01

    The B-spline R-matrix method is employed to investigate the low-energy elastic electron scattering by atomic oxygen. Flexible non-orthogonal sets of radial functions are used to construct the target description and to represent the scattering functions. A detailed investigation regarding the dependence of the predicted partial and total cross sections on the scattering model and the accuracy of the target description is presented. The predicted angle-integrated elastic cross sections are in good agreement with experiment, whereas significant discrepancies are found in the angle-differential elastic cross sections near the forward direction. .The near-threshold results are found to strongly depend on the treatment of inner-core short-range correlation effects in the target description, as well as on a proper account of the target polarizability. A sharp increase in the elastic cross sections below 1 eV found in some earlier calculations is judged to be an artifact of an unbalanced description of correlation in the N-electron target structure and the (N+l)-electron-collision problems.

  15. Microwave studies of weak localization and antilocalization in epitaxial graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drabińska, Aneta; Kamińska, Maria; Wołoś, Agnieszka

    2013-12-04

    A microwave detection method was applied to study weak localization and antilocalization in epitaxial graphene sheets grown on both polarities of SiC substrates. Both coherence and scattering length values were obtained. The scattering lengths were found to be smaller for graphene grown on C-face of SiC. The decoherence rate was found to depend linearly on temperature, showing the electron-electron scattering mechanism.

  16. Surface roughness scattering of electrons in bulk mosfets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zuverink, Amanda Renee

    2015-11-01

    Surface-roughness scattering of electrons at the Si-SiO 2 interface is a very important consideration when analyzing Si metal-oxide-semiconductor field-effect transistors (MOSFETs). Scattering reduces the mobility of the electrons and degrades the device performance. 250-nm and 50-nm bulk MOSFETs were simulated with varying device parameters and mesh sizes in order to compare the effects of surface-roughness scattering in multiple devices. The simulation framework includes the ensemble Monte Carlo method used to solve the Boltzmann transport equation coupled with a successive over-relaxation method used to solve the two-dimensional Poisson's equation. Four methods for simulating the surface-roughness scattering of electrons were implemented onmore » both devices and compared: the constant specularity parameter, the momentum-dependent specularity parameter, and the real-space-roughness method with both uniform and varying electric fields. The specularity parameter is the probability of an electron scattering speculariy from a rough surface. It can be chosen as a constant, characterizing partially diffuse scattering of all electrons from the surface the same way, or it can be momentum dependent, where the size of rms roughness and the normal component of the electron wave number determine the probability of electron-momentum randomization. The real-space rough surface method uses the rms roughness height and correlation length of an actual MOSFET to simulate a rough interface. Due to their charge, electrons scatter from the electric field and not directly from the surface. If the electric field is kept uniform, the electrons do not perceive the roughness and scatter as if from a at surface. However, if the field is allowed to vary, the electrons scatter from the varying electric field as they would in a MOSFET. These methods were implemented for both the 50-nm and 250-nm MOSFETs, and using the rms roughness heights and correlation lengths for real devices. The current-voltage and mobility-electric field curves were plotted for each method on the two devices and compared. The conclusion is that the specularity-parameter methods are valuable as simple models for relatively smooth interfaces. However, they have limitations, as they cannot accurately describe the drastic reduction in the current and the electron mobility that occur in MOSFETs with very rough Si-SiO 2 interfaces.« less

  17. Effects of the Electronic Spin-Orbit Interaction on the Anomalous Asymmetric Scattering of the Spin-Polarized He+ Beam with Paramagnetic Target Materials II. Partial Wave Representation

    NASA Astrophysics Data System (ADS)

    Sakai, Osamu; Suzuki, Taku T.

    2018-05-01

    The scattering of an electron-spin-polarized 4He+ beam on paramagnetic materials has an anomalously large asymmetric scattering component (ASC) around 10%, which is 104 times that expected from the spin-orbit coupling for the potential of the target nucleus. The scattering angle (θ) dependence of the ASC has been measured. It changes sign near 90° for some materials (for example, Au and Pt), while it does not change sign for other materials (for example, Pb and Bi). It has been noted that the spin-orbit interaction of electrons on the target in the electron-transfer intermediate state causes the ASC of He nucleus motion, and it has also been predicted that the sign change in the θ dependence occurs when the d electron transfer is dominant. This seems to correspond to the cases of Au and Pt, but not to the cases of Pb and Bi. The previous approach is refined on the basis of the partial wave representation, which can give a more correct estimation of the ASC. It is shown that the sign change appears in the weak-resonance domain in the case of d electron excitation, whereas the sign change disappears in the strong-resonance domain. Our calculated results qualitatively agree with the material dependence of the ASC observed experimentally.

  18. Transport and breakdown analysis for improved figure-of-merit for AlGaN power devices

    NASA Astrophysics Data System (ADS)

    Coltrin, Michael E.; Kaplar, Robert J.

    2017-02-01

    Mobility and critical electric field for bulk AlxGa1-xN alloys across the full composition range (0 ≤ x ≤ 1) are analyzed to address the potential application of this material system for power electronics. Calculation of the temperature-dependent electron mobility includes the potential limitations due to different scattering mechanisms, including alloy, optical polar phonon, deformation potential, and piezoelectric scattering. The commonly used unipolar figure of merit (appropriate for vertical-device architectures), which increases strongly with increasing mobility and critical electric field, is examined across the alloy composition range to estimate the potential performance in power electronics applications. Alloy scattering is the dominant limitation to mobility and thus also for the unipolar figure of merit. However, at higher alloy compositions, the limitations due to alloy scattering are overcome by increased critical electric field. These trade-offs, and their temperature dependence, are quantified in the analysis.

  19. Coherence factors in a high-tc cuprate probed by quasi-particle scattering off vortices.

    PubMed

    Hanaguri, T; Kohsaka, Y; Ono, M; Maltseva, M; Coleman, P; Yamada, I; Azuma, M; Takano, M; Ohishi, K; Takagi, H

    2009-02-13

    When electrons pair in a superconductor, quasi-particles develop an acute sensitivity to different types of scattering potential that is described by the appearance of coherence factors in the scattering amplitudes. Although the effects of coherence factors are well established in isotropic superconductors, they are much harder to detect in their anisotropic counterparts, such as high-superconducting-transition-temperature cuprates. We demonstrate an approach that highlights the momentum-dependent coherence factors in Ca2-xNaxCuO2Cl2. We used Fourier-transform scanning tunneling spectroscopy to reveal a magnetic-field dependence in quasi-particle scattering interference patterns that is sensitive to the sign of the anisotropic gap. This result is associated with the d-wave coherence factors and quasi-particle scattering off vortices. Our technique thus provides insights into the nature of electron pairing as well as quasi-particle scattering processes in unconventional superconductors.

  20. Electron transport in erbium arsenide:indium gallium(aluminum)arsenide metal/semiconductor nanocomposites for thermoelectric power generation

    NASA Astrophysics Data System (ADS)

    Bahk, Je-Hyeong

    Electron transport in thin film ErAs:InGa(Al)As metal/semiconductor nanocomposite materials grown by molecular beam epitaxy is investigated experimentally and theoretically for efficient thermoelectric power generation. Thermoelectric properties such as the Seebeck coefficient, the electrical conductivity, and the thermal conductivity are measured for the various compositions of the material up to 840 K. A special sample preparation method is proposed to protect the thin films from damage and/or decomposition, and prevent the parasitic substrate conduction effect during the high temperature measurements. The sample preparation method includes surface passivation, high temperature metallization with a diffusion barrier, and the covalent oxide bonding technique for substrate removal. The experimental results for the nanocomposite materials are analyzed using the Boltzmann transport equation under the relaxation time approximation. The scattering characteristics of free electrons in the InGa(Al)As is defined by four major scattering mechanisms such as the polar optical phonon scattering, the ionized impurity scattering, the alloy scattering, and the acoustic phonon deformation potential scattering. Combining these scattering mechanisms, the electron transport model successfully fits the temperature-dependent thermoelectric properties of Si-doped InGaAlAs materials, and predicts the figure of merits at various doping levels in various Al compositions. The nanoparticle-electron interaction is modeled as a momentum scattering for free electrons caused by the electrostatic potential perturbation around nanoparticles and the band offset at the interface. The ErAs nanoparticles are assumed to be semi-metals that can donate electrons to the matrix, and positively charged after the charge transfer to build up the screened coulomb potential outside them. The nanoparticle scattering rate is calculated for this potential profile using the partial wave method, and used to analyze the enhancement of the Seebeck coefficient. Finally, the experimental results for the various compositions of the ErAs:InGa(Al)As nanocomposites are fit using the electron transport model and the nanoparticle scattering. It is shown that nanoparticle scattering can enhance the power factor via energy-dependent electron scattering in ErAs:InGaAs system. The figure of merit for the 0.6% ErAs:(InGaAs)0.8(InAlAs) 0.2 lattice matched to InP is measured to be 1.3 at 800 K, and the theory predicts that it can reach 1.9 at 1000 K.

  1. Energy-loss- and thickness-dependent contrast in atomic-scale electron energy-loss spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tan, Haiyan; Zhu, Ye; Dwyer, Christian

    2014-12-31

    Atomic-scale elemental maps of materials acquired by core-loss inelastic electron scattering often exhibit an undesirable sensitivity to the unavoidable elastic scattering, making the maps counter-intuitive to interpret. Here, we present a systematic study that scrutinizes the energy-loss and sample-thickness dependence of atomic-scale elemental maps acquired using 100 keV incident electrons in a scanning transmission electron microscope. For single-crystal silicon, the balance between elastic and inelastic scattering means that maps generated from the near-threshold Si-L signal (energy loss of 99 eV) show no discernible contrast for a thickness of 0.5λ (λ is the electron mean-free path, here approximately 110 nm). Atmore » greater thicknesses we observe a counter-intuitive “negative” contrast. Only at much higher energy losses is an intuitive “positive” contrast gradually restored. Our quantitative analysis shows that the energy-loss at which a positive contrast is restored depends linearly on the sample thickness. This behavior is in very good agreement with our double-channeling inelastic scattering calculations. We test a recently-proposed experimental method to correct the core-loss inelastic scattering and restore an intuitive “positive” chemical contrast. The method is demonstrated to be reliable over a large range of energy losses and sample thicknesses. The corrected contrast for near-threshold maps is demonstrated to be (desirably) inversely proportional to sample thickness. As a result, implications for the interpretation of atomic-scale elemental maps are discussed.« less

  2. Electron mobility of two-dimensional electron gas in InGaN heterostructures: Effects of alloy disorder and random dipole scatterings

    NASA Astrophysics Data System (ADS)

    Hoshino, Tomoki; Mori, Nobuya

    2018-04-01

    InGaN has a smaller electron effective mass and is expected to be used as a channel material for high-electron-mobility transistors. However, it is an alloy semiconductor with a random distribution of atoms, which introduces additional scattering mechanisms: alloy disorder and random dipole scatterings. In this work, we calculate the electron mobility in InGaN- and GaN-channel high-electron-mobility transistors (HEMTs) while taking into account acoustic deformation potential, polar optical phonon, alloy disorder, and random dipole scatterings. For InGaN-channel HEMTs, we find that not only alloy disorder but also random dipole scattering has a strong impact on the electron mobility and it significantly decreases as the In mole fraction of the channel increases. Our calculation also shows that the channel thickness w dependence of the mobility is rather weak when w > 1 nm for In0.1Ga0.9N-channel HEMTs.

  3. Intrinsic Gilbert Damping in Metallic Ferromagnets in Ballistic Regime and the Effect of Inelastic Electron Scattering from Magnetic Moments: A Time Dependent Keldysh Green Function Approach

    NASA Astrophysics Data System (ADS)

    Mahfouzi, Farzad; Kioussis, Nicholas

    Gilbert damping in metallic ferromagnets is mainly governed by the exchange coupling between the electrons and the magnetic degree of freedom, where the time dependent evolution of the magnetization leads to the excitation of electrons and loss of energy as a result of flow of spin and charge currents. However, it turns out that when the magnetization evolves slowly in time, in the presence of spin-orbit interaction (SOI), the resonant electronic excitations has a major contribution to the damping which leads to infinite result in ballistic regime. In this work we consider the inelastic spin-flip scattering of electrons from the magnetic moments and show that in the presence of SOI it leads to the relaxation of the excited electrons. We show that in the case of clean crystal systems such scattering leads to a linear dependence of the Gilbert on the SOI strength and in the limit of diffusive systems we get the Gilbert damping expression obtained from Kambersky's Fermi breathing approach. This research was supported by NSF-PREM Grant No. DMR-1205734

  4. Development of an electron-ion coincidence apparatus for molecular-frame electron energy loss spectroscopy studies

    NASA Astrophysics Data System (ADS)

    Watanabe, Noboru; Hirayama, Tsukasa; Yamada, So; Takahashi, Masahiko

    2018-04-01

    We report details of an electron-ion coincidence apparatus, which has been developed for molecular-frame electron energy loss spectroscopy studies. The apparatus is mainly composed of a pulsed electron gun, an energy-dispersive electron spectrometer, and an ion momentum imaging spectrometer. Molecular-orientation dependence of the high-energy electron scattering cross section can be examined by conducting measurements of vector correlation between the momenta of the scattered electron and fragment ion. Background due to false coincidences is significantly reduced by introducing a pulsed electron beam and pulsing scheme of ion extraction. The experimental setup has been tested by measuring the inner-shell excitation of N2 at an incident electron energy of 1.5 keV and a scattering angle of 10.2°.

  5. Asymmetric Flow-Field Flow Fractionation (AF4) of Aqueous C60 Aggregates with Dynamic Light Scattering Size and LC-MS

    EPA Science Inventory

    Current methods for the size determination of nanomaterials in aqueous suspension include dynamic or static light scattering and electron or atomic force microscopy techniques. Light scattering techniques are limited by poor resolution and the scattering intensity dependence on p...

  6. Influence of scattering processes on electron quantum states in nanowires

    PubMed Central

    Galenchik, Vadim; Borzdov, Andrei; Borzdov, Vladimir; Komarov, Fadei

    2007-01-01

    In the framework of quantum perturbation theory the self-consistent method of calculation of electron scattering rates in nanowires with the one-dimensional electron gas in the quantum limit is worked out. The developed method allows both the collisional broadening and the quantum correlations between scattering events to be taken into account. It is an alternativeper seto the Fock approximation for the self-energy approach based on Green’s function formalism. However this approach is free of mathematical difficulties typical to the Fock approximation. Moreover, the developed method is simpler than the Fock approximation from the computational point of view. Using the approximation of stable one-particle quantum states it is proved that the electron scattering processes determine the dependence of electron energy versus its wave vector.

  7. Layer-dependent second-order Raman intensity of Mo S2 and WS e2 : Influence of intervalley scattering

    NASA Astrophysics Data System (ADS)

    Qian, Qingkai; Zhang, Zhaofu; Chen, Kevin J.

    2018-04-01

    Acoustic-phonon Raman scattering, as a defect-induced second-order Raman scattering process (with incident photon scattered by one acoustic phonon at the Brillouin-zone edge and the momentum conservation fulfilled by defect scattering), is used as a sensitive tool to study the defects of transition-metal dichalcogenides (TMDs). Moreover, second-order Raman scattering processes are closely related to the valley depolarization of single-layer TMDs in potential valleytronic applications. Here, the layer dependence of second-order Raman intensity of Mo S2 and WS e2 is studied. The electronic band structures of Mo S2 and WS e2 are modified by the layer thicknesses; hence, the resonance conditions for both first-order and second-order Raman scattering processes are tuned. In contrast to the first-order Raman scattering, second-order Raman scattering of Mo S2 and WS e2 involves additional intervalley scattering of electrons by phonons with large momenta. As a result, the electron states that contribute most to the second-order Raman intensity are different from that to first-order process. A weaker layer-tuned resonance enhancement of second-order Raman intensity is observed for both Mo S2 and WS e2 . Specifically, when the incident laser has photon energy close to the optical band gap and the Raman spectra are normalized by the first-order Raman peaks, single-layer Mo S2 or WS e2 has the strongest second-order Raman intensity. This layer-dependent second-order Raman intensity can be further utilized as an indicator to identify the layer number of Mo S2 and WS e2 .

  8. The Radiation Belt Electron Scattering by Magnetosonic Wave: Dependence on Key Parameters

    NASA Astrophysics Data System (ADS)

    Lei, Mingda; Xie, Lun; Li, Jinxing; Pu, Zuyin; Fu, Suiyan; Ni, Binbin; Hua, Man; Chen, Lunjin; Li, Wen

    2017-12-01

    Magnetosonic (MS) waves have been found capable of creating radiation belt electron butterfly distributions in the inner magnetosphere. To investigate the physical nature of the interactions between radiation belt electrons and MS waves, and to explore a preferential condition for MS waves to scatter electrons efficiently, we performed a comprehensive parametric study of MS wave-electron interactions using test particle simulations. The diffusion coefficients simulated by varying the MS wave frequency show that the scattering effect of MS waves is frequency insensitive at low harmonics (f < 20 fcp), which has great implications on modeling the electron scattering caused by MS waves with harmonic structures. The electron scattering caused by MS waves is very sensitive to wave normal angles, and MS waves with off 90° wave normal angles scatter electrons more efficiently. By simulating the diffusion coefficients and the electron phase space density evolution at different L shells under different plasma environment circumstances, we find that MS waves can readily produce electron butterfly distributions in the inner part of the plasmasphere where the ratio of electron plasma-to-gyrofrequency (fpe/fce) is large, while they may essentially form a two-peak distribution outside the plasmapause and in the inner radiation belt where fpe/fce is small.

  9. Phonon exchange by two-dimensional electrons in intermediate magnetic fields

    NASA Astrophysics Data System (ADS)

    Gopalakrishnan, Gokul

    The discovery of the integer and fractional quantum Hall effects have broadened the exploration of the two-dimensional electron gas to regimes where complex and exciting physics lay previously hidden. While many experimental investigations have focused on the regime of large magnetic fields where transport properties are determined by contributions from a single Landau level, the regime of intermediate fields, where multiple Landau levels are involved, has been much less explored. This dissertation is a report on a previously unobserved interaction probed by a novel type of magneto-transport measurement performed in this intermediate regime, in bilayer two-dimensional electron systems. This measurement technique, known as electron drag, directly measures interlayer electron-electron scattering rates, by measuring the voltage induced in one of the layers when a current is driven through the other. The scattering mechanism, which may be Coulomb or phonon mediated, depends critically on both the separation between the layers and the electron density. When electron drag is measured in the presence of a perpendicular magnetic field in suitable samples, the resulting magnetodrag signal reveals new information about the electronic states as well as properties of a phonon mediated scattering mechanism. This phonon scattering mechanism is reflected in previously unobserved oscillations. These oscillations, which are periodic in the inverse field, are argued to arise from a resonant interlayer exchange of 2 kF phonons. Measurements of the temperature, density and layer-spacing dependences of magnetodrag resistivity are reported and are shown to confirm this particular mechanism. Additionally, analysis of the temperature dependence reveals a strong sensitivity to Landau level widths. Based on this analysis, a means of characterizing the broadening of Landau levels and hence, electronic lifetimes in this regime, which are otherwise difficult to characterize, is proposed.

  10. Approximating the nonlinear density dependence of electron transport coefficients and scattering rates across the gas-liquid interface

    NASA Astrophysics Data System (ADS)

    Garland, N. A.; Boyle, G. J.; Cocks, D. G.; White, R. D.

    2018-02-01

    This study reviews the neutral density dependence of electron transport in gases and liquids and develops a method to determine the nonlinear medium density dependence of electron transport coefficients and scattering rates required for modeling transport in the vicinity of gas-liquid interfaces. The method has its foundations in Blanc’s law for gas-mixtures and adapts the theory of Garland et al (2017 Plasma Sources Sci. Technol. 26) to extract electron transport data across the gas-liquid transition region using known data from the gas and liquid phases only. The method is systematically benchmarked against multi-term Boltzmann equation solutions for Percus-Yevick model liquids. Application to atomic liquids highlights the utility and accuracy of the derived method.

  11. Spin in Compton scattering with pronounced polarization dynamics

    NASA Astrophysics Data System (ADS)

    Ahrens, Sven; Sun, Chang-Pu

    2017-12-01

    We theoretically investigate a scattering configuration in Compton scattering, in which the orientation of the electron spin is reversed and, simultaneously, the photon polarization changes from linear polarization into circular polarization. The intrinsic angular momentum of electron and photon are computed along the coincident propagation direction of the incoming and outgoing photon. We find that this intrinsic angular momentum is not conserved in the considered scattering process. We also discuss the generation of entanglement for the considered scattering setup and present an angle-dependent investigation of the corresponding differential cross section, Stokes parameters, and spin expectation.

  12. Analysis of multiple scattering contributions in electron-impact ionization of molecular hydrogen

    NASA Astrophysics Data System (ADS)

    Ren, Xueguang; Hossen, Khokon; Wang, Enliang; Pindzola, M. S.; Dorn, Alexander; Colgan, James

    2017-10-01

    We report a combined experimental and theoretical study on the low-energy (E 0 = 31.5 eV) electron-impact ionization of molecular hydrogen (H2). Triple differential cross sections are measured for a range of fixed emission angles of one outgoing electron between {θ }1=-70^\\circ and -130° covering the full 4π solid angle of the second electron. The energy sharing of the outgoing electrons varies from symmetric ({E}1={E}2=8 eV) to highly asymmetric (E 1 = 1 eV and E 2 = 15 eV). In addition to the binary and recoil lobes, a structure is observed perpendicular to the incoming beam direction which is due to multiple scattering of the projectile inside the molecular potential. The absolutely normalized experimental cross sections are compared with results from the time-dependent close-coupling (TDCC) calculations. Molecular alignment dependent TDCC results demonstrate that these structures are only present if the molecule axis is lying in the scattering plane.

  13. Thickness dependence of scattering cross-sections in quantitative scanning transmission electron microscopy.

    PubMed

    Martinez, G T; van den Bos, K H W; Alania, M; Nellist, P D; Van Aert, S

    2018-04-01

    In quantitative scanning transmission electron microscopy (STEM), scattering cross-sections have been shown to be very sensitive to the number of atoms in a column and its composition. They correspond to the integrated intensity over the atomic column and they outperform other measures. As compared to atomic column peak intensities, which saturate at a given thickness, scattering cross-sections increase monotonically. A study of the electron wave propagation is presented to explain the sensitivity of the scattering cross-sections. Based on the multislice algorithm, we analyse the wave propagation inside the crystal and its link to the scattered signal for the different probe positions contained in the scattering cross-section for detector collection in the low-, middle- and high-angle regimes. The influence to the signal from scattering of neighbouring columns is also discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schaefer, Tim; Institut für Physikalische Chemie, Universität zu Köln, 50939 Köln; Schwab, Tobias

    A random scattering approach to enhance light extraction in white top-emitting organic light-emitting diodes (OLEDs) is reported. Through solution processing from fluorinated solvents, a nano-particle scattering layer (NPSL) can be deposited directly on top of small molecule OLEDs without affecting their electrical performance. The scattering length for light inside the NPSL is determined from transmission measurements and found to be in agreement with Mie scattering theory. Furthermore, the dependence of the light outcoupling enhancement on electron transport layer thickness is studied. Depending on the electron transport layer thickness, the NPSL enhances the external quantum efficiency of the investigated white OLEDsmore » by between 1.5 and 2.3-fold. For a device structure that has been optimized prior to application of the NPSL, the maximum external quantum efficiency is improved from 4.7% to 7.4% (1.6-fold improvement). In addition, the scattering layer strongly reduces the undesired shift in emission color with viewing angle.« less

  15. Low-energy Auger electron diffraction: influence of multiple scattering and angular momentum

    NASA Astrophysics Data System (ADS)

    Chassé, A.; Niebergall, L.; Kucherenko, Yu.

    2002-04-01

    The angular dependence of Auger electrons excited from single-crystal surfaces is treated theoretically within a multiple-scattering cluster model taking into account the full Auger transition matrix elements. In particular the model has been used to discuss the influence of multiple scattering and angular momentum of the Auger electron wave on Auger electron diffraction (AED) patterns in the region of low kinetic energies. Theoretical results of AED patterns are shown and discussed in detail for Cu(0 0 1) and Ni(0 0 1) surfaces, respectively. Even though Cu and Ni are very similar in their electronic and scattering properties recently strong differences have been found in AED patterns measured in the low-energy region. It is shown that the differences may be caused to superposition of different electron diffraction effects in an energy-integrated experiment. A good agreement between available experimental and theoretical results has been achieved.

  16. Angle-resolved molecular beam scattering of NO at the gas-liquid interface.

    PubMed

    Zutz, Amelia; Nesbitt, David J

    2017-08-07

    This study presents first results on angle-resolved, inelastic collision dynamics of thermal and hyperthermal molecular beams of NO at gas-liquid interfaces. Specifically, a collimated incident beam of supersonically cooled NO ( 2 Π 1/2 , J = 0.5) is directed toward a series of low vapor pressure liquid surfaces ([bmim][Tf 2 N], squalane, and PFPE) at θ inc = 45(1)°, with the scattered molecules detected with quantum state resolution over a series of final angles (θ s = -60°, -30°, 0°, 30°, 45°, and 60°) via spatially filtered laser induced fluorescence. At low collision energies [E inc = 2.7(9) kcal/mol], the angle-resolved quantum state distributions reveal (i) cos(θ s ) probabilities for the scattered NO and (ii) electronic/rotational temperatures independent of final angle (θ s ), in support of a simple physical picture of angle independent sticking coefficients and all incident NO thermally accommodating on the surface. However, the observed electronic/rotational temperatures for NO scattering reveal cooling below the surface temperature (T elec < T rot < T S ) for all three liquids, indicating a significant dependence of the sticking coefficient on NO internal quantum state. Angle-resolved scattering at high collision energies [E inc = 20(2) kcal/mol] has also been explored, for which the NO scattering populations reveal angle-dependent dynamical branching between thermal desorption and impulsive scattering (IS) pathways that depend strongly on θ s . Characterization of the data in terms of the final angle, rotational state, spin-orbit electronic state, collision energy, and liquid permit new correlations to be revealed and investigated in detail. For example, the IS rotational distributions reveal an enhanced propensity for higher J/spin-orbit excited states scattered into near specular angles and thus hotter rotational/electronic distributions measured in the forward scattering direction. Even more surprisingly, the average NO scattering angle (⟨θ s ⟩) exhibits a remarkably strong correlation with final angular momentum, N, which implies a linear scaling between net forward scattering propensity and torque delivered to the NO projectile by the gas-liquid interface.

  17. Angle-resolved molecular beam scattering of NO at the gas-liquid interface

    NASA Astrophysics Data System (ADS)

    Zutz, Amelia; Nesbitt, David J.

    2017-08-01

    This study presents first results on angle-resolved, inelastic collision dynamics of thermal and hyperthermal molecular beams of NO at gas-liquid interfaces. Specifically, a collimated incident beam of supersonically cooled NO (2 Π 1/2, J = 0.5) is directed toward a series of low vapor pressure liquid surfaces ([bmim][Tf2N], squalane, and PFPE) at θinc = 45(1)°, with the scattered molecules detected with quantum state resolution over a series of final angles (θs = -60°, -30°, 0°, 30°, 45°, and 60°) via spatially filtered laser induced fluorescence. At low collision energies [Einc = 2.7(9) kcal/mol], the angle-resolved quantum state distributions reveal (i) cos(θs) probabilities for the scattered NO and (ii) electronic/rotational temperatures independent of final angle (θs), in support of a simple physical picture of angle independent sticking coefficients and all incident NO thermally accommodating on the surface. However, the observed electronic/rotational temperatures for NO scattering reveal cooling below the surface temperature (Telec < Trot < TS) for all three liquids, indicating a significant dependence of the sticking coefficient on NO internal quantum state. Angle-resolved scattering at high collision energies [Einc = 20(2) kcal/mol] has also been explored, for which the NO scattering populations reveal angle-dependent dynamical branching between thermal desorption and impulsive scattering (IS) pathways that depend strongly on θs. Characterization of the data in terms of the final angle, rotational state, spin-orbit electronic state, collision energy, and liquid permit new correlations to be revealed and investigated in detail. For example, the IS rotational distributions reveal an enhanced propensity for higher J/spin-orbit excited states scattered into near specular angles and thus hotter rotational/electronic distributions measured in the forward scattering direction. Even more surprisingly, the average NO scattering angle (⟨θs⟩) exhibits a remarkably strong correlation with final angular momentum, N, which implies a linear scaling between net forward scattering propensity and torque delivered to the NO projectile by the gas-liquid interface.

  18. Scattering of an electronic wave packet by a one-dimensional electron-phonon-coupled structure

    NASA Astrophysics Data System (ADS)

    Brockt, C.; Jeckelmann, E.

    2017-02-01

    We investigate the scattering of an electron by phonons in a small structure between two one-dimensional tight-binding leads. This model mimics the quantum electron transport through atomic wires or molecular junctions coupled to metallic leads. The electron-phonon-coupled structure is represented by the Holstein model. We observe permanent energy transfer from the electron to the phonon system (dissipation), transient self-trapping of the electron in the electron-phonon-coupled structure (due to polaron formation and multiple reflections at the structure edges), and transmission resonances that depend strongly on the strength of the electron-phonon coupling and the adiabaticity ratio. A recently developed TEBD algorithm, optimized for bosonic degrees of freedom, is used to simulate the quantum dynamics of a wave packet launched against the electron-phonon-coupled structure. Exact results are calculated for a single electron-phonon site using scattering theory and analytical approximations are obtained for limiting cases.

  19. The boomerang effect in electron-hydrogen molecule scattering as determined by time-dependent calculations

    NASA Astrophysics Data System (ADS)

    Ben-Asher, Anael; Moiseyev, Nimrod

    2017-05-01

    The appearance of oscillations in the energy-dependent cross sections of the vibrational excitation ν =0 →ν ≥3 of the hydrogen molecule in its electronic ground state as predicted by Mündel, Berman, and Domcke [Phys. Rev. A 32, 181 (1985)] was confirmed in the electron scattering experiments by Allan [J. Phys. B: At. Mol. Phys. 18, L451 (1985)]. These unusual structures were obtained in spite of the extremely short lifetime of H2- in its ro-vibrational states. Based on the standard (Hermitian) time-independent scattering calculations, Horáček et al. [Phys. Rev. A 73, 022701 (2006)] associated these oscillations with the boomerang effect. Here, we show the boomerang effect as developed in time, based on our time-dependent nuclear wavepacket (WP) calculations. The nuclear WP dynamics of H2- is determined using the non-Hermitian quantum mechanics (NH-QM) which enables the use of the Born-Oppenheimer approximation with complex potential energy surfaces. This NH-QM approach, which enables us the association of the nuclear WP dynamics as obtained from the complex potential energy curve of H2- with the evolution of cross section in time, can enlighten the dynamics in other scattering experiments.

  20. The boomerang effect in electron-hydrogen molecule scattering as determined by time-dependent calculations.

    PubMed

    Ben-Asher, Anael; Moiseyev, Nimrod

    2017-05-28

    The appearance of oscillations in the energy-dependent cross sections of the vibrational excitation ν=0→ν≥3 of the hydrogen molecule in its electronic ground state as predicted by Mündel, Berman, and Domcke [Phys. Rev. A 32, 181 (1985)] was confirmed in the electron scattering experiments by Allan [J. Phys. B: At. Mol. Phys. 18, L451 (1985)]. These unusual structures were obtained in spite of the extremely short lifetime of H 2 - in its ro-vibrational states. Based on the standard (Hermitian) time-independent scattering calculations, Horáček et al. [Phys. Rev. A 73, 022701 (2006)] associated these oscillations with the boomerang effect. Here, we show the boomerang effect as developed in time, based on our time-dependent nuclear wavepacket (WP) calculations. The nuclear WP dynamics of H 2 - is determined using the non-Hermitian quantum mechanics (NH-QM) which enables the use of the Born-Oppenheimer approximation with complex potential energy surfaces. This NH-QM approach, which enables us the association of the nuclear WP dynamics as obtained from the complex potential energy curve of H 2 - with the evolution of cross section in time, can enlighten the dynamics in other scattering experiments.

  1. NONLINEAR AND FIBER OPTICS: Mutual suppression of the electron stimulated Raman scattering and four-wave parametric mixing

    NASA Astrophysics Data System (ADS)

    Malakyan, Yu P.

    1990-04-01

    A new effect is considered: self-induced suppression of electron stimulated Raman scattering involving generation of two new fields from the Stokes radiation as a result of four-wave mixing, interfering destructively with electron stimulated Raman scattering and suppressing it, which in turn suppresses the mixing process. The effect occurs in the steady-state case and not under transient conditions. The results account in a simple manner for the generation of the Stokes radiation in barium vapor as a result of different transitions, depending on the duration of the pump pulse.

  2. Electron Raman scattering in a strained ZnO/MgZnO double quantum well

    NASA Astrophysics Data System (ADS)

    Mojab-abpardeh, M.; Karimi, M. J.

    2018-02-01

    In this work, the electron Raman scattering in a strained ZnO / MgZnO double quantum wells is studied. The energy eigenvalues and the wave functions are obtained using the transfer matrix method. The effects of Mg composition, well width and barrier width on the internal electric field in well and barrier layers are investigated. Then, the influences of these parameters on the differential cross-section of electron Raman scattering are studied. Results indicate that the position, magnitude and the number of the peaks depend on the Mg composition, well width and barrier width.

  3. Electronic quenching of O({sup 1}D) by Xe: Oscillations in the product angular distribution and their dependence on collision energy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garofalo, Lauren A.; Smith, Mica C.; Dagdigian, Paul J., E-mail: pjdagdigian@jhu.edu

    2015-08-07

    The dynamics of the O({sup 1}D) + Xe electronic quenching reaction was investigated in a crossed beam experiment at four collision energies. Marked large-scale oscillations in the differential cross sections were observed for the inelastic scattering products, O({sup 3}P) and Xe. The shape and relative phases of the oscillatory structure depend strongly on collision energy. Comparison of the experimental results with time-independent scattering calculations shows qualitatively that this behavior is caused by Stueckelberg interferences, for which the quantum phases of the multiple reaction pathways accessible during electronic quenching constructively and destructively interfere.

  4. Scatterings and Quantum Effects in (Al ,In )N /GaN Heterostructures for High-Power and High-Frequency Electronics

    NASA Astrophysics Data System (ADS)

    Wang, Leizhi; Yin, Ming; Khan, Asif; Muhtadi, Sakib; Asif, Fatima; Choi, Eun Sang; Datta, Timir

    2018-02-01

    Charge transport in the wide-band-gap (Al ,In )N /GaN heterostructures with high carrier density approximately 2 ×1013 cm-2 is investigated over a large range of temperature (270 mK ≤T ≤280 K ) and magnetic field (0 ≤B ≤18 T ). We observe the first evidence of weak localization in the two-dimensional electron gas in this system. From the Shubnikov-de Haas (SdH) oscillations a relatively light effective mass of 0.23 me is determined. Furthermore, the linear dependence with temperature (T <20 K ) of the inelastic scattering rate (τi-1∝T ) is attributed to the phase breaking by electron-electron scattering. Also in the same temperature range the less-than unit ratio of quantum lifetime to Hall transport time (τq/τt<1 ) is taken to signify the dominance of small-angle scattering. Above 20 K, with increasing temperature scattering changes from acoustic phonon to optical phonon scattering, resulting in a rapid decrease in carrier mobility and increase in sheet resistance. Suppression of such scatterings will lead to higher mobility and a way forward to high-power and high-frequency electronics.

  5. Thermoelectric band engineering: The role of carrier scattering

    NASA Astrophysics Data System (ADS)

    Witkoske, Evan; Wang, Xufeng; Lundstrom, Mark; Askarpour, Vahid; Maassen, Jesse

    2017-11-01

    Complex electronic band structures, with multiple valleys or bands at the same or similar energies, can be beneficial for thermoelectric performance, but the advantages can be offset by inter-valley and inter-band scattering. In this paper, we demonstrate how first-principles band structures coupled with recently developed techniques for rigorous simulation of electron-phonon scattering provide the capabilities to realistically assess the benefits and trade-offs associated with these materials. We illustrate the approach using n-type silicon as a model material and show that intervalley scattering is strong. This example shows that the convergence of valleys and bands can improve thermoelectric performance, but the magnitude of the improvement depends sensitively on the relative strengths of intra- and inter-valley electron scattering. Because anisotropy of the band structure also plays an important role, a measure of the benefit of band anisotropy in the presence of strong intervalley scattering is presented.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Furui, Shun’ya; Fukazawa, Yasushi; Ohno, Masanori

    We construct an X-ray spectral model of reprocessing by a torus in an active galactic nucleus (AGN) with the Monte Carlo simulation framework MONACO. Two torus geometries of smooth and clumpy cases are considered and compared. In order to reproduce a Compton shoulder accurately, MONACO includes not only free electron scattering but also bound electron scattering. Raman and Rayleigh scattering are also treated, and scattering cross sections dependent on chemical states of hydrogen and helium are included. Doppler broadening by turbulence velocity can be implemented. Our model gives results consistent with other available models, such as MYTorus, except for differencesmore » due to different physical parameters and assumptions. We studied the dependence on torus parameters for a Compton shoulder, and found that a intensity ratio of a Compton shoulder to the line core mainly depends on column density, inclination angle, and metal abundance. For instance, an increase of metal abundance makes a Compton shoulder relatively weak. Also, the shape of a Compton shoulder depends on the column density. Furthermore, these dependences become different between smooth and clumpy cases. Then, we discuss the possibility of ASTRO-H/SXS spectroscopy of Compton shoulders in AGN reflection spectra.« less

  7. Fractional conductance oscillations in quantum rings: wave packet picture of transport in a few-electron system.

    PubMed

    Chwiej, T; Szafran, B

    2013-04-17

    We study electron transfer across a two-terminal quantum ring using a time-dependent description of the scattering process. For the considered scattering event the quantum ring is initially charged with one or two electrons, with another electron incident to the ring from the input channel. We study the electron transfer probability (T) as a function of the external magnetic field. We determine the periodicity of T for a varied number of electrons confined within the ring. For that purpose we develop a method to describe the wave packet dynamics for a few electrons participating in the scattering process, taking into full account the electron-electron correlations. We find that electron transfer across the quantum ring initially charged by a single electron acquires a distinct periodicity of half of the magnetic flux quantum (Φ0/2), corresponding to the formation of a transient two-electron state inside the ring. In the case of a three-electron scattering problem with two electrons initially occupying the ring, a period of Φ0/3 for T is formed in the limit of thin channels. The effect of disorder present in the confinement potential of the ring is also discussed.

  8. Dark matter in the Sun: scattering off electrons vs nucleons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Garani, Raghuveer; Palomares-Ruiz, Sergio, E-mail: garani@th.physik.uni-bonn.de, E-mail: sergiopr@ific.uv.es

    The annihilation of dark matter (DM) particles accumulated in the Sun could produce a flux of neutrinos, which is potentially detectable with neutrino detectors/telescopes and the DM elastic scattering cross section can be constrained. Although the process of DM capture in astrophysical objects like the Sun is commonly assumed to be due to interactions only with nucleons, there are scenarios in which tree-level DM couplings to quarks are absent, and even if loop-induced interactions with nucleons are allowed, scatterings off electrons could be the dominant capture mechanism. We consider this possibility and study in detail all the ingredients necessary tomore » compute the neutrino production rates from DM annihilations in the Sun (capture, annihilation and evaporation rates) for velocity-independent and isotropic, velocity-dependent and isotropic and momentum-dependent scattering cross sections for DM interactions with electrons and compare them with the results obtained for the case of interactions with nucleons. Moreover, we improve the usual calculations in a number of ways and provide analytical expressions in three appendices. Interestingly, we find that the evaporation mass in the case of interactions with electrons could be below the GeV range, depending on the high-velocity tail of the DM distribution in the Sun, which would open a new mass window for searching for this type of scenarios.« less

  9. Modulated Electron Emission by Scattering-Interference of Primary Electrons

    NASA Astrophysics Data System (ADS)

    Valeri, Sergio; di Bona, Alessandro

    We review the effects of scattering-interference of the primary, exciting beam on the electron emission from ordered atomic arrays. The yield of elastically and inelastically backscattered electrons, Auger electrons and secondary electrons shows a marked dependence on the incidence angle of primary electrons. Both the similarity and the relative importance of processes experienced by incident and excident electrons are discussed. We also present recent studies of electron focusing and defocusing along atomic chains. The interplay between these two processes determines the in-depth profile of the primary electron intensity anisotropy. Finally, the potential for surface-structural studies and limits for quantitative analysis are discussed, in comparison with the Auger electron diffraction (AED) and photoelectron diffraction (PD) techniques.

  10. Enhanced Spontaneous Emission of Bloch Oscillation Radiation from a Single Energy Band

    DTIC Science & Technology

    2006-06-30

    ignore interband tunneling , spon- taneous photon emission occurs as the Bloch electron inter- acts with the quantum radiation field; the emission occurs... interband coupling 17 and electron intraband scattering are ignored. Therefore, the quantum dynamics is described by the time-dependent Schrödinger...single band “n0” of a periodic crystal with energy n0K; the ef- fects of interband coupling15 and electron intraband scatter- ing are ignored

  11. Key scattering mechanisms limiting the lateral transport in a modulation-doped polar heterojunction

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tien, Nguyen Thanh, E-mail: nttien@ctu.edu.vn; Thao, Pham Thi Bich; Thao, Dinh Nhu

    2016-06-07

    We present a study of the lateral transport of a two-dimensional electron gas (2DEG) in a modulation-doped polar heterojunction (HJ). In contrast to previous studies, we assume that the Coulomb correlation among ionized impurities and among charged dislocations in the HJ is so strong that the 2DEG low-temperature mobility is not limited by impurity and dislocation scattering. The mobility, however, is specified by alloy disorder scattering and combined roughness scattering, which is the total effect induced by both the potential barrier and polarization roughness. The obtained results show that the alloy disorder and combined roughness scattering strongly depend on themore » alloy content and on the near-interface electron distribution. Our theory is capable of explaining the bell-shaped dependence of the lateral mobility on alloy content observed in AlGaN/GaN and on 2DEG density observed in AlN/GaN, which have not previously been explained.« less

  12. Demonstration of a novel technique to measure two-photon exchange effects in elastic e±p scattering

    DOE PAGES

    Moteabbed, Maryam; Niroula, Megh; Raue, Brian A.; ...

    2013-08-30

    The discrepancy between proton electromagnetic form factors extracted using unpolarized and polarized scattering data is believed to be a consequence of two-photon exchange (TPE) effects. However, the calculations of TPE corrections have significant model dependence, and there is limited direct experimental evidence for such corrections. The TPE contributions depend on the sign of the lepton charge in e±p scattering, but the luminosities of secondary positron beams limited past measurement at large scattering angles, where the TPE effects are believe to be most significant. We present the results of a new experimental technique for making direct e±p comparisons, which has themore » potential to make precise measurements over a broad range in Q 2 and scattering angles. We use the Jefferson Laboratory electron beam and the Hall B photon tagger to generate a clean but untagged photon beam. The photon beam impinges on a converter foil to generate a mixed beam of electrons, positrons, and photons. A chicane is used to separate and recombine the electron and positron beams while the photon beam is stopped by a photon blocker. This provides a combined electron and positron beam, with energies from 0.5 to 3.2 GeV, which impinges on a liquid hydrogen target. The large acceptance CLAS detector is used to identify and reconstruct elastic scattering events, determining both the initial lepton energy and the sign of the scattered lepton. The data were collected in two days with a primary electron beam energy of only 3.3 GeV, limiting the data from this run to smaller values of Q 2 and scattering angle. Nonetheless, this measurement yields a data sample for e±p with statistics comparable to those of the best previous measurements. We have shown that we can cleanly identify elastic scattering events and correct for the difference in acceptance for electron and positron scattering. Because we ran with only one polarity for the chicane, we are unable to study the difference between the incoming electron and positron beams. This systematic effect leads to the largest uncertainty in the final ratio of positron to electron scattering: R=1.027±0.005±0.05 for < Q 2 >=0.206 GeV 2 and 0.830 ≤ ε ≤ 0.943. We have demonstrated that the tertiary e ± beam generated using this technique provides the opportunity for dramatically improved comparisons of e±p scattering, covering a significant range in both Q 2 and scattering angle. Combining data with different chicane polarities will allow for detailed studies of the difference between the incoming e + and e - beams.« less

  13. Demonstration of a novel technique to measure two-photon exchange effects in elastic e±p scattering

    NASA Astrophysics Data System (ADS)

    Moteabbed, M.; Niroula, M.; Raue, B. A.; Weinstein, L. B.; Adikaram, D.; Arrington, J.; Brooks, W. K.; Lachniet, J.; Rimal, Dipak; Ungaro, M.; Afanasev, A.; Adhikari, K. P.; Aghasyan, M.; Amaryan, M. J.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Baltzell, N. A.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Bennett, R. P.; Biselli, A. S.; Bono, J.; Boiarinov, S.; Briscoe, W. J.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chandavar, S.; Cole, P. L.; Collins, P.; Contalbrigo, M.; Cortes, O.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Doughty, D.; Dupre, R.; Egiyan, H.; Fassi, L. El; Eugenio, P.; Fedotov, G.; Fegan, S.; Fersch, R.; Fleming, J. A.; Gevorgyan, N.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guler, N.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Heddle, D.; Hicks, K.; Ho, D.; Holtrop, M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jo, H. S.; Joo, K.; Keller, D.; Khandaker, M.; Kim, A.; Klein, F. J.; Koirala, S.; Kubarovsky, A.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Lewis, S.; Lu, H. Y.; MacCormick, M.; MacGregor, I. J. D.; Martinez, D.; Mayer, M.; McKinnon, B.; Mineeva, T.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moriya, K.; Moutarde, H.; Munevar, E.; Munoz Camacho, C.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Pappalardo, L. L.; Paremuzyan, R.; Park, K.; Park, S.; Phelps, E.; Phillips, J. J.; Pisano, S.; Pogorelko, O.; Pozdniakov, S.; Price, J. W.; Procureur, S.; Protopopescu, D.; Puckett, A. J. R.; Ripani, M.; Rosner, G.; Rossi, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seder, E.; Seraydaryan, H.; Sharabian, Y. G.; Smith, E. S.; Smith, G. D.; Sober, D. I.; Sokhan, D.; Stepanyan, S.; Strauch, S.; Tang, W.; Taylor, C. E.; Tian, Ye; Tkachenko, S.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.

    2013-08-01

    Background: The discrepancy between proton electromagnetic form factors extracted using unpolarized and polarized scattering data is believed to be a consequence of two-photon exchange (TPE) effects. However, the calculations of TPE corrections have significant model dependence, and there is limited direct experimental evidence for such corrections.Purpose: The TPE contributions depend on the sign of the lepton charge in e±p scattering, but the luminosities of secondary positron beams limited past measurement at large scattering angles, where the TPE effects are believe to be most significant. We present the results of a new experimental technique for making direct e±p comparisons, which has the potential to make precise measurements over a broad range in Q2 and scattering angles.Methods: We use the Jefferson Laboratory electron beam and the Hall B photon tagger to generate a clean but untagged photon beam. The photon beam impinges on a converter foil to generate a mixed beam of electrons, positrons, and photons. A chicane is used to separate and recombine the electron and positron beams while the photon beam is stopped by a photon blocker. This provides a combined electron and positron beam, with energies from 0.5 to 3.2 GeV, which impinges on a liquid hydrogen target. The large acceptance CLAS detector is used to identify and reconstruct elastic scattering events, determining both the initial lepton energy and the sign of the scattered lepton.Results: The data were collected in two days with a primary electron beam energy of only 3.3 GeV, limiting the data from this run to smaller values of Q2 and scattering angle. Nonetheless, this measurement yields a data sample for e±p with statistics comparable to those of the best previous measurements. We have shown that we can cleanly identify elastic scattering events and correct for the difference in acceptance for electron and positron scattering. Because we ran with only one polarity for the chicane, we are unable to study the difference between the incoming electron and positron beams. This systematic effect leads to the largest uncertainty in the final ratio of positron to electron scattering: R=1.027±0.005±0.05 for =0.206 GeV2 and 0.830⩽ɛ⩽0.943.Conclusions: We have demonstrated that the tertiary e± beam generated using this technique provides the opportunity for dramatically improved comparisons of e±p scattering, covering a significant range in both Q2 and scattering angle. Combining data with different chicane polarities will allow for detailed studies of the difference between the incoming e+ and e- beams.

  14. X-ray radiation from nonlinear Thomson scattering of an intense femtosecond laser on relativistic electrons in a helium plasma.

    PubMed

    Ta Phuoc, K; Rousse, A; Pittman, M; Rousseau, J P; Malka, V; Fritzler, S; Umstadter, D; Hulin, D

    2003-11-07

    We have generated x-ray radiation from the nonlinear Thomson scattering of a 30 fs/1.5 J laser beam on plasma electrons. A collimated x-ray radiation with a broad continuous spectrum peaked at 0.15 keV with a significant tail up to 2 keV has been observed. These characteristics are found to depend strongly on the laser strength parameter a(0). This radiative process is dominant for a(0) greater than unity at which point the relativistic scattering of the laser light originates from MeV energy electrons inside the plasma.

  15. Carrier Injection and Scattering in Atomically Thin Chalcogenides

    NASA Astrophysics Data System (ADS)

    Li, Song-Lin; Tsukagoshi, Kazuhito

    2015-12-01

    Atomically thin two-dimensional chalcogenides such as MoS2 monolayers are structurally ideal channel materials for the ultimate atomic electronics. However, a heavy thickness dependence of electrical performance is shown in these ultrathin materials, and the device performance normally degrades while exhibiting a low carrier mobility as compared with corresponding bulks, constituting a main hurdle for application in electronics. In this brief review, we summarize our recent work on electrode/channel contacts and carrier scattering mechanisms to address the origins of this adverse thickness dependence. Extrinsically, the Schottky barrier height increases at the electrode/channel contact area in thin channels owing to bandgap expansion caused by quantum confinement, which hinders carrier injection and degrades device performance. Intrinsically, thin channels tend to suffer from intensified Coulomb impurity scattering, resulting from the reduced interaction distance between interfacial impurities and channel carriers. Both factors are responsible for the adverse dependence of carrier mobility on channel thickness in two-dimensional semiconductors.

  16. Pitch Angle Scattering of Upgoing Electron Beams in Jupiter's Polar Regions by Whistler Mode Waves

    NASA Astrophysics Data System (ADS)

    Elliott, S. S.; Gurnett, D. A.; Kurth, W. S.; Clark, G.; Mauk, B. H.; Bolton, S. J.; Connerney, J. E. P.; Levin, S. M.

    2018-02-01

    The Juno spacecraft's Jupiter Energetic-particle Detector Instrument has observed field-aligned, unidirectional (upgoing) electron beams throughout most of Jupiter's entire polar cap region. The Waves instrument detected intense broadband whistler mode emissions occurring in the same region. In this paper, we investigate the pitch angle scattering of the upgoing electron beams due to interactions with the whistler mode waves. Profiles of intensity versus pitch angle for electron beams ranging from 2.53 to 7.22 Jovian radii show inconsistencies with the expected adiabatic invariant motion of the electrons. It is believed that the observed whistler mode waves perturb the electron motion and scatter them away from the magnetic field line. The diffusion equation has been solved by using diffusion coefficients which depend on the magnetic intensity of the whistler mode waves.

  17. Plasmon-enhanced electron scattering in nanostructured thin metal films revealed by low-voltage scanning electron microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mikhailovskii, V., E-mail: v.mikhailovskii@spbu.ru; IRC for Nanotechnology, Research Park, St.-Petersburg State University; Petrov, Yu.

    2016-06-17

    The drastic enhancement of backscattered electrons (BSE) yield from nanostructured thin metal film which exceeded well the one from massive metal was observed at accelerating voltages below 400 V. The dependences of BSE signal from nanostructured gold film on accelerating voltage and on retarding grid potential applied to BSE detector were investigated. It was shown that enhanced BSE signal was formed by inelastic scattered electrons coming from the gaps between nanoparticles. A tentative explanation of the mechanism of BSE signal enhancement was suggested.

  18. Incoherent scatter radar observations of the ionosphere

    NASA Technical Reports Server (NTRS)

    Hagfors, Tor

    1989-01-01

    Incoherent scatter radar (ISR) has become the most powerful means of studying the ionosphere from the ground. Many of the ideas and methods underlying the troposphere and stratosphere (ST) radars have been taken over from ISR. Whereas the theory of refractive index fluctuations in the lower atmosphere, depending as it does on turbulence, is poorly understood, the theory of the refractivity fluctuations in the ionosphere, which depend on thermal fluctuations, is known in great detail. The underlying theory is one of the most successful theories in plasma physics, and allows for many detailed investigations of a number of parameters such as electron density, electron temperature, ion temperature, electron mean velocity, and ion mean velocity as well as parameters pertaining to composition, neutral density and others. Here, the author reviews the fundamental processes involved in the scattering from a plasma undergoing thermal or near thermal fluctuations in density. The fundamental scattering properties of the plasma to the physical parameters characterizing them from first principles. He does not discuss the observation process itself, as the observational principles are quite similar whether they are applied to a neutral gas or a fluctuating plasma.

  19. Cloud Effects in Hyperspectral Imagery from First-Principles Scene Simulations

    DTIC Science & Technology

    2009-01-01

    SPIE. One print or electronic copy may be made for personal use only. Systematic or multiple reproduction, or distribution to multiple locations...scattering and absorption, scattering events, surface scattering with material-dependent bidirectional reflectances, multiple surface adjacency...aerosols or clouds, they may be absorbed, or they may reflect off the ground or an object. A given photon may undergo multiple scattering events

  20. Non-Local Diffusion of Energetic Electrons during Solar Flares

    NASA Astrophysics Data System (ADS)

    Bian, N. H.; Emslie, G.; Kontar, E.

    2017-12-01

    The transport of the energy contained in suprathermal electrons in solar flares plays a key role in our understanding of many aspects of flare physics, from the spatial distributions of hard X-ray emission and energy deposition in the ambient atmosphere to global energetics. Historically the transport of these particles has been largely treated through a deterministic approach, in which first-order secular energy loss to electrons in the ambient target is treated as the dominant effect, with second-order diffusive terms (in both energy and angle) generally being either treated as a small correction or even neglected. Here, we critically analyze this approach, and we show that spatial diffusion through pitch-angle scattering necessarily plays a very significant role in the transport of electrons. We further show that a satisfactory treatment of the diffusion process requires consideration of non-local effects, so that the electron flux depends not just on the local gradient of the electron distribution function but on the value of this gradient within an extended region encompassing a significant fraction of a mean free path. Our analysis applies generally to pitch-angle scattering by a variety of mechanisms, from Coulomb collisions to turbulent scattering. We further show that the spatial transport of electrons along the magnetic field of a flaring loop can be modeled as a Continuous Time Random Walk with velocity-dependent probability distribution functions of jump sizes and occurrences, both of which can be expressed in terms of the scattering mean free path.

  1. Quasiparticle scattering spectroscopy (QPS) of Kondo lattice heavy fermions

    NASA Astrophysics Data System (ADS)

    Greene, L. H.; Narasiwodeyar, S. M.; Banerjee, P.; Park, W. K.; Bauer, E. D.; Tobash, P. H.; Baumbach, R. E.; Ronning, F.; Sarrao, J. L.; Thompson, J. D.

    2013-03-01

    Point-contact spectroscopy (PCS) is a powerful technique to study electronic properties via measurements of non-linear current-voltage characteristic across a ballistic junction. It has been frequently adopted to investigate novel and/or unconventional superconductors by detecting the energy-dependent Andreev scattering. PCS of non-superconducting materials has been much rarely reported. From our recent studies on heavy fermions, we have frequently observed strongly bias-dependent and asymmetric conductance behaviors. Based on a Fano resonance model in a Kondo lattice, we attribute them to energy-dependent quasiparticle scattering off hybridized renormalized electronic states, dubbing it QPS. We will present our QPS results on several heavy-fermion systems and discuss QPS as a novel technique to probe the bulk spectroscopic properties of the electronic structure. For instance, it reveals that the hybridization gap in URu2Si2 opens well above the hidden order transition. The work at UIUC is supported by the U.S. DOE under Award No. DE-FG02-07ER46453 and the NSF DMR 12-06766, and the work at LANL is carried out under the auspices of the U.S. DOE, Office of Science.

  2. Electron scattering wings on lines in interacting supernovae

    NASA Astrophysics Data System (ADS)

    Huang, Chenliang; Chevalier, Roger A.

    2018-03-01

    We consider the effect of electron scattering on lines emitted as a result of supernova interaction with a circumstellar medium, assuming that the scattering occurs in ionized gas in the pre-shock circumstellar medium. The single scattering case gives the broad component in the limit of low optical depth, showing a velocity full width half-maximum that is close to the thermal velocities of electrons. The line shape is approximately exponential at low velocities and steepens at higher velocities. At higher optical depths, the line profile remains exponential at low velocities, but wings strengthen with increasing optical depth. In addition to the line width, the ratio of narrow to broad (scattered) line strength is a possible diagnostic of the gas. The results depend on the density profile of the circumstellar gas, especially if the scattering and photon creation occur in different regions. We apply the scattering model to a number of supernovae, including Type IIn and Type Ia-circumstellar medium (CSM) events. The asymmetry to the red found in some cases can be explained by scattering in a fast wind region that is indicated by observations.

  3. Examinations of electron temperature calculation methods in Thomson scattering diagnostics.

    PubMed

    Oh, Seungtae; Lee, Jong Ha; Wi, Hanmin

    2012-10-01

    Electron temperature from Thomson scattering diagnostic is derived through indirect calculation based on theoretical model. χ-square test is commonly used in the calculation, and the reliability of the calculation method highly depends on the noise level of input signals. In the simulations, noise effects of the χ-square test are examined and scale factor test is proposed as an alternative method.

  4. Auger electron diffraction in thin CoO films on Au(1 1 1)

    NASA Astrophysics Data System (ADS)

    Chassé, A.; Niebergall, L.; Heiler, M.; Neddermeyer, H.; Schindler, K.-M.

    The local structure of thin CoO films grown on a single crystal Au(1 1 1) surface has been studied by Auger electron diffraction (AED). Therefore, the angular dependence of the Auger electron intensity of Co-LMM and O-KLL Auger electrons was recorded in the total half-space above the film. Such 2 π-scans immediately reflect the symmetry of the surface and the local structure of the film. The experimental data are compared to multiple-scattering cluster calculations, where both the influence of multiple-scattering effects and effects of Auger transition matrix elements have been investigated. We have found that the AED patterns of a CoO film in forward-scattering conditions do not always provide straightforward information on the local structure of the film, whereas the multiple-scattering approximation applied gives very good agreement between experimental and theoretical results.

  5. Probing Dirac fermion dynamics in topological insulator Bi2Se3 films with a scanning tunneling microscope.

    PubMed

    Song, Can-Li; Wang, Lili; He, Ke; Ji, Shuai-Hua; Chen, Xi; Ma, Xu-Cun; Xue, Qi-Kun

    2015-05-01

    Scanning tunneling microscopy and spectroscopy have been used to investigate the femtosecond dynamics of Dirac fermions in the topological insulator Bi2Se3 ultrathin films. At the two-dimensional limit, bulk electrons become quantized and the quantization can be controlled by the film thickness at a single quintuple layer level. By studying the spatial decay of standing waves (quasiparticle interference patterns) off steps, we measure directly the energy and film thickness dependence of the phase relaxation length lϕ and inelastic scattering lifetime τ of topological surface-state electrons. We find that τ exhibits a remarkable (E - EF)(-2) energy dependence and increases with film thickness. We show that the features revealed are typical for electron-electron scattering between surface and bulk states.

  6. Hot electron inelastic scattering and transmission across graphene surfaces

    NASA Astrophysics Data System (ADS)

    Kong, Byoung Don; Champlain, James G.; Boos, J. Brad

    2017-06-01

    Inelastic scattering and transmission of externally injected hot carriers across graphene layers are considered as a function of graphene carrier density, temperature, and surrounding dielectric media. A finite temperature dynamic dielectric function for graphene for an arbitrary momentum q and frequency ω is found under the random phase approximation and a generalized scattering lifetime formalism is used to calculate the scattering and transmission rates. Unusual trends in scattering are found, including declining rates as graphene carrier density increases and interband transition excitations, which highlights the difference with out-of-plane as compared to in-plane transport. The results also show strong temperature dependence with a drastic increase in scattering at room temperature. The calculated scattering rate at T = 300 K shows a wide variation from 0.2 to 10 fs-1 depending on graphene carrier density, incident carrier momentum, and surrounding dielectrics. The analysis suggests that a transmission rate greater than 0.9 for a carrier with kinetic energy over 1 eV is achievable by carefully controlling the graphene carrier density in conjunction with the use of high-κ dielectric materials. Potential applications to electronic and electro-optical devices are also discussed.

  7. Ab initio studies of ultrafast x-ray scattering of the photodissociation of iodine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Debnarova, Andrea; Techert, Simone; Schmatz, Stefan

    2010-09-28

    We computationally examine various aspects of the reaction dynamics of the photodissociation and recombination of molecular iodine. We use our recently proposed formalism to calculate time-dependent x-ray scattering signal changes from first principles. Different aspects of the dynamics of this prototypical reaction are studied, such as coherent and noncoherent processes, features of structural relaxation that are periodic in time versus nonperiodic dissociative processes, as well as small electron density changes caused by electronic excitation, all with respect to x-ray scattering. We can demonstrate that wide-angle x-ray scattering offers a possibility to study the changes in electron densities in nonperiodic systems,more » which render it a suitable technique for the investigation of chemical reactions from a structural dynamics point of view.« less

  8. Conservation law of angular momentum in helicity-dependent Raman and Rayleigh scattering

    NASA Astrophysics Data System (ADS)

    Tatsumi, Yuki; Kaneko, Tomoaki; Saito, Riichiro

    2018-05-01

    In first-order Raman scattering, helicity of circularly polarized incident light is either conserved or changed depending on the Raman modes. When the helicity of incident light changes in the scattered light, the angular momentum of a photon is transferred to the material. Here, we present the conservation law of pseudoangular momentum in the helicity-dependent Raman scattering for a N -fold (N =1 -4 ,6 ) rotational symmetry of a crystal. Furthermore, the conservation law of electron-phonon interaction is discussed by considering the vibration direction of a phonon that has the same or lower symmetry than the symmetry of the crystal, which is essential to allow the helicity change in Raman scattering in a highly symmetric material, such as graphene. We also discuss the conservation law of pseudoangular momentum in Rayleigh scattering and show that the helicity change is allowed only in the crystal with one- or twofold rotational symmetry.

  9. Thermally Driven Electronic Topological Transition in FeTi

    NASA Astrophysics Data System (ADS)

    Yang, F. C.; Muñoz, J. A.; Hellman, O.; Mauger, L.; Lucas, M. S.; Tracy, S. J.; Stone, M. B.; Abernathy, D. L.; Xiao, Yuming; Fultz, B.

    2016-08-01

    Ab initio molecular dynamics, supported by inelastic neutron scattering and nuclear resonant inelastic x-ray scattering, showed an anomalous thermal softening of the M5- phonon mode in B 2 -ordered FeTi that could not be explained by phonon-phonon interactions or electron-phonon interactions calculated at low temperatures. A computational investigation showed that the Fermi surface undergoes a novel thermally driven electronic topological transition, in which new features of the Fermi surface arise at elevated temperatures. The thermally induced electronic topological transition causes an increased electronic screening for the atom displacements in the M5- phonon mode and an adiabatic electron-phonon interaction with an unusual temperature dependence.

  10. The integration of improved Monte Carlo compton scattering algorithms into the Integrated TIGER Series.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Quirk, Thomas, J., IV

    2004-08-01

    The Integrated TIGER Series (ITS) is a software package that solves coupled electron-photon transport problems. ITS performs analog photon tracking for energies between 1 keV and 1 GeV. Unlike its deterministic counterpart, the Monte Carlo calculations of ITS do not require a memory-intensive meshing of phase space; however, its solutions carry statistical variations. Reducing these variations is heavily dependent on runtime. Monte Carlo simulations must therefore be both physically accurate and computationally efficient. Compton scattering is the dominant photon interaction above 100 keV and below 5-10 MeV, with higher cutoffs occurring in lighter atoms. In its current model of Comptonmore » scattering, ITS corrects the differential Klein-Nishina cross sections (which assumes a stationary, free electron) with the incoherent scattering function, a function dependent on both the momentum transfer and the atomic number of the scattering medium. While this technique accounts for binding effects on the scattering angle, it excludes the Doppler broadening the Compton line undergoes because of the momentum distribution in each bound state. To correct for these effects, Ribbefor's relativistic impulse approximation (IA) will be employed to create scattering cross section differential in both energy and angle for each element. Using the parameterizations suggested by Brusa et al., scattered photon energies and angle can be accurately sampled at a high efficiency with minimal physical data. Two-body kinematics then dictates the electron's scattered direction and energy. Finally, the atomic ionization is relaxed via Auger emission or fluorescence. Future work will extend these improvements in incoherent scattering to compounds and to adjoint calculations.« less

  11. Differential Cross Sections for Ionization of Argon by 1 keV Positron and Electron Impact

    NASA Astrophysics Data System (ADS)

    Gavin, J.; DuBois, R. D.; de Lucio, O. G.

    2014-04-01

    Differential information was generated by establishing coincidences and imposing conditions on data recorded for target ions, scattered projectiles, and ejected electrons, as a function of projectile energy loss and scattering angles; in order to describe the interaction between a positron (electron) 1 keV beam and a simple Ar jet. Single ionization triply differential cross section (TDCS) results exhibit two distinct regions (lobes) for which binary (events arising from 2-body interaction) and recoil (events which can only be produced by many-body interactions) interactions are associated. Results indicate that binary events are significantly larger for positron impact, in accordance with theoretical predictions. A similar feature is found for different energy losses and scattering angles. Intensity of the recoil lobe for both projectiles, positron and electron, is observed to depend on the energy loss and scattering angle. Also, it can be noticed that for positron impact the recoil interactions intensity is larger than that observed for electron impact.

  12. Resonant Inverse Compton Scattering Spectra from Highly Magnetized Neutron Stars

    NASA Astrophysics Data System (ADS)

    Wadiasingh, Zorawar; Baring, Matthew G.; Gonthier, Peter L.; Harding, Alice K.

    2018-02-01

    Hard, nonthermal, persistent pulsed X-ray emission extending between 10 and ∼150 keV has been observed in nearly 10 magnetars. For inner-magnetospheric models of such emission, resonant inverse Compton scattering of soft thermal photons by ultrarelativistic charges is the most efficient production mechanism. We present angle-dependent upscattering spectra and pulsed intensity maps for uncooled, relativistic electrons injected in inner regions of magnetar magnetospheres, calculated using collisional integrals over field loops. Our computations employ a new formulation of the QED Compton scattering cross section in strong magnetic fields that is physically correct for treating important spin-dependent effects in the cyclotron resonance, thereby producing correct photon spectra. The spectral cutoff energies are sensitive to the choices of observer viewing geometry, electron Lorentz factor, and scattering kinematics. We find that electrons with energies ≲15 MeV will emit most of their radiation below 250 keV, consistent with inferred turnovers for magnetar hard X-ray tails. More energetic electrons still emit mostly below 1 MeV, except for viewing perspectives sampling field-line tangents. Pulse profiles may be singly or doubly peaked dependent on viewing geometry, emission locale, and observed energy band. Magnetic pair production and photon splitting will attenuate spectra to hard X-ray energies, suppressing signals in the Fermi-LAT band. The resonant Compton spectra are strongly polarized, suggesting that hard X-ray polarimetry instruments such as X-Calibur, or a future Compton telescope, can prove central to constraining model geometry and physics.

  13. Diffusive transport of energetic electrons in the solar corona: X-ray and radio diagnostics

    NASA Astrophysics Data System (ADS)

    Musset, S.; Kontar, E. P.; Vilmer, N.

    2018-02-01

    Context. Imaging spectroscopy in X-rays with RHESSI provides the possibility to investigate the spatial evolution of X-ray emitting electron distribution and therefore, to study transport effects on energetic electrons during solar flares. Aims: We study the energy dependence of the scattering mean free path of energetic electrons in the solar corona. Methods: We used imaging spectroscopy with RHESSI to study the evolution of energetic electrons distribution in various parts of the magnetic loop during the 2004 May 21 flare. We compared these observations with the radio observations of the gyrosynchrotron radiation of the same flare and with the predictions of a diffusive transport model. Results: X-ray analysis shows a trapping of energetic electrons in the corona and a spectral hardening of the energetic electron distribution between the top of the loop and the footpoints. Coronal trapping of electrons is stronger for radio-emitting electrons than for X-ray-emitting electrons. These observations can be explained by a diffusive transport model. Conclusions: We show that the combination of X-ray and radio diagnostics is a powerful tool to study electron transport in the solar corona in different energy domains. We show that the diffusive transport model can explain our observations, and in the range 25-500 keV, the scattering mean free path of electrons decreases with electron energy. We can estimate for the first time the scattering mean free path dependence on energy in the corona.

  14. Bursty Precipitation Driven by Chorus Waves

    NASA Technical Reports Server (NTRS)

    Khazanov, G. V.; Telnikhin, A. A.; Kronberg, T. K.

    2011-01-01

    The electron precipitation bursts have been shown to be a major sink for the radiation belt relativistic electrons. As underlying mechanism of such bursts, we propose particle scattering into the loss cone due to nonlinear resonance interaction between electrons and chorus. Stochastic heating due to the coupling leads to diffusion in pitch angle, and the rate of diffusion would be sufficient to account for the emptying of the Earth's radiation belt over the time of the main phase of geomagnetic storms. The results obtained in the present paper account for a strong energy dependence in the electron precipitation event and the correlation between the energization and loss processes on macroscopic timescales, which is primarily attributed to the cooperative effects of the coupling. This mechanism of chorus scattering should produce pitch angle distributions that are energy-dependent and butterfly-shaped. The calculated timescales and the total energy input to the atmosphere from precipitating relativistic electrons are in reasonable agreement with experimental data.

  15. Model for Ultrafast Carrier Scattering in Semiconductors

    DTIC Science & Technology

    2012-11-14

    energy transfer between semi-classical carrier drift-diffusion under an electric field and quantum kinetics of interband /intersubband transitions...from an electron during each phonon-emission event. The net rate of phonon emission is determined by the Boltzmann scattering equation which depends ...energy-drift term under a strong dc field was demonstrated to reduce the field- dependent drift velocity and mobility. The Doppler shift in the energy

  16. A revisit to the temperature dependence of electrical resistivity of α - Titanium at low temperatures

    NASA Astrophysics Data System (ADS)

    Sharath Chandra, L. S.; Mondal, R.; Thamizhavel, A.; Dhar, S. K.; Roy, S. B.

    2017-09-01

    The temperature dependence of resistivity ρ(T) of a polycrystalline sample and a single crystal sample (current along the [0001] direction) of α - Titanium (Ti) at low temperatures is revisited to understand the electrical charge transport phenomena in this hexagonal closed pack metal. We show that the ρ(T) in single crystal Ti can be explained by considering the scattering of electrons due to electron-phonon, electron-electron, inter-band s-d and electron-impurity interactions, whereas the ρ(T) of polycrystalline Ti could not be explained by these interactions alone. We observed that the effects of the anisotropy of the hexagonal structure on the electronic band structure and the phonon dispersion need to be taken into account to explain ρ(T) of polycrystalline Ti. Two Debye temperatures corresponding to two different directions for the electron-phonon interactions and inter-band s-d scattering are needed to account the observed ρ(T) in polycrystalline Ti.

  17. Diffusive and inelastic scattering in ballistic-electron-emission spectroscopy and ballistic-electron-emission microscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, E.Y.; Turner, B.R.; Schowalter, L.J.

    1993-07-01

    Ballistic-electron-emission microscopy (BEEM) of Au/Si(001) n type was done to study whether elastic scattering in the Au overlayer is dominant. It was found that there is no dependence of the BEEM current on the relative gradient of the Au surface with respect to the Si interface, and this demonstrates that significant elastic scattering must occur in the Au overlayer. Ballistic-electron-emission spectroscopy (BEES) was also done, and, rather than using the conventional direct-current BEES, alternating-current (ac) BEES was done on Au/Si and also on Au/PtSi/Si(001) n type. The technique of ac BEES was found to give linear threshold for the Schottkymore » barrier, and it also clearly showed the onset of electron-hole pair creation and other inelastic scattering events. The study of device quality PtSi in Au/PtSi/Si(001) yielded an attenuation length of 4 nm for electrons of energy 1 eV above the PtSi Fermi energy. 20 refs., 5 figs.« less

  18. Theory of bright-field scanning transmission electron microscopy for tomography

    NASA Astrophysics Data System (ADS)

    Levine, Zachary H.

    2005-02-01

    Radiation transport theory is applied to electron microscopy of samples composed of one or more materials. The theory, originally due to Goudsmit and Saunderson, assumes only elastic scattering and an amorphous medium dominated by atomic interactions. For samples composed of a single material, the theory yields reasonable parameter-free agreement with experimental data taken from the literature for the multiple scattering of 300-keV electrons through aluminum foils up to 25μm thick. For thin films, the theory gives a validity condition for Beer's law. For thick films, a variant of Molière's theory [V. G. Molière, Z. Naturforschg. 3a, 78 (1948)] of multiple scattering leads to a form for the bright-field signal for foils in the multiple-scattering regime. The signal varies as [tln(e1-2γt/τ)]-1 where t is the path length of the beam, τ is the mean free path for elastic scattering, and γ is Euler's constant. The Goudsmit-Saunderson solution interpolates numerically between these two limits. For samples with multiple materials, elemental sensitivity is developed through the angular dependence of the scattering. From the elastic scattering cross sections of the first 92 elements, a singular-value decomposition of a vector space spanned by the elastic scattering cross sections minus a delta function shows that there is a dominant common mode, with composition-dependent corrections of about 2%. A mathematically correct reconstruction procedure beyond 2% accuracy requires the acquisition of the bright-field signal as a function of the scattering angle. Tomographic reconstructions are carried out for three singular vectors of a sample problem with four elements Cr, Cu, Zr, and Te. The three reconstructions are presented jointly as a color image; all four elements are clearly identifiable throughout the image.

  19. Temperature dependence of electron impact ionization coefficient in bulk silicon

    NASA Astrophysics Data System (ADS)

    Ahmed, Mowfaq Jalil

    2017-09-01

    This work exhibits a modified procedure to compute the electron impact ionization coefficient of silicon for temperatures between 77 and 800K and electric fields ranging from 70 to 400 kV/cm. The ionization coefficients are computed from the electron momentum distribution function through solving the Boltzmann transport equation (BTE). The arrangement is acquired by joining Legendre polynomial extension with BTE. The resulting BTE is solved by differences-differential method using MATLAB®. Six (X) equivalent ellipsoidal and non-parabolic valleys of the conduction band of silicon are taken into account. Concerning the scattering mechanisms, the interval acoustic scattering, non-polar optical scattering and II scattering are taken into consideration. This investigation showed that the ionization coefficients decrease with increasing temperature. The overall results are in good agreement with previous experimental and theoretical reported data predominantly at high electric fields.

  20. Electronic transport properties of intermediately coupled superconductors: PdTe2 and Cu0.04PdTe2

    NASA Astrophysics Data System (ADS)

    Hooda, M. K.; Yadav, C. S.

    2018-01-01

    We have investigated the electrical resistivity (1.8-480 K), Seebeck coefficient (2.5-300 K) and thermal conductivity (2.5-300 K) of PdTe2 and 4% Cu intercalated PdTe2 compounds. The electrical resistivity for the compounds shows a Bloch-Gruneisen-type linear temperature (T) dependence for 100 \\text{K}, and Fermi liquid behavior (ρ (T) \\propto T2) for T<50 \\text{K} . Seebeck coefficient data exhibit a strong competition between Normal (N) and Umklapp (U) scattering processes at low T. The low-T, thermal conductivity (κ) of the compounds is strongly dominated by the electronic contribution, and exhibits a rare linear T-dependence below 10 K. However, high-T, κ (T) shows the usual 1/T -dependence, dominated by the U-scattering process. The electron-phonon coupling parameters, estimated from the low-T, specific-heat data and first-principle electronic structure calculations suggest that PdTe2 and Cu0.04PdTe2 are intermediately coupled superconductors.

  1. First measurement of electron temperature from signal ratios in a double-pass Thomson scattering system.

    PubMed

    Tojo, H; Ejiri, A; Hiratsuka, J; Yamaguchi, T; Takase, Y; Itami, K; Hatae, T

    2012-02-01

    This paper presents an experimental demonstration to determine electron temperature (T(e)) with unknown spectral sensitivity (transmissivity) in a Thomson scattering system. In this method, a double-pass scattering configuration is used and the scattered lights from each pass (with different scattering angles) are measured separately. T(e) can be determined from the ratio of the signal intensities without knowing a real chromatic dependence in the sensitivity. Note that the wavelength range for each spectral channel must be known. This method was applied to the TST-2 Thomson scattering system. As a result, T(e) measured from the ratio (T(e,r)) and T(e) measured from a standard method (T(e,s)) showed a good agreement with <∣T(e,r) - T(e,s)∣∕T(e,s)> = 7.3%.

  2. Scattering mechanisms in shallow undoped Si/SiGe quantum wells

    DOE PAGES

    Laroche, Dominique; Huang, S. -H.; Nielsen, Erik; ...

    2015-10-07

    We report the magneto-transport study and scattering mechanism analysis of a series of increasingly shallow Si/SiGe quantum wells with depth ranging from ~ 100 nm to ~ 10 nm away from the heterostructure surface. The peak mobility increases with depth, suggesting that charge centers near the oxide/semiconductor interface are the dominant scattering source. The power-law exponent of the electron mobility versus density curve, μ ∝ n α, is extracted as a function of the depth of the Si quantum well. At intermediate densities, the power-law dependence is characterized by α ~ 2.3. At the highest achievable densities in the quantummore » wells buried at intermediate depth, an exponent α ~ 5 is observed. Lastly, we propose and show by simulations that this increase in the mobility dependence on the density can be explained by a non-equilibrium model where trapped electrons smooth out the potential landscape seen by the two-dimensional electron gas.« less

  3. Application and development of the Schwinger multichannel scattering theory and the partial differential equation theory of electron-molecule scattering

    NASA Technical Reports Server (NTRS)

    Weatherford, Charles A.

    1993-01-01

    One version of the multichannel theory for electron-target scattering based on the Schwinger variational principle, the SMC method, requires the introduction of a projection parameter. The role of the projection parameter a is investigated and it is shown that the principal-value operator in the SMC equation is Hermitian regardless of the value of a as long as it is real and nonzero. In a basis that is properly orthonormalizable, the matrix representation of this operator is also Hermitian. The use of such basis is consistent with the Schwinger variational principle because the Lippmann-Schwinger equation automatically builds in the correct boundary conditions. Otherwise, an auxiliary condition needs to be introduced, and Takatsuka and McKoy's original value of a is one of the three possible ways to achieve Hermiticity. In all cases but one, a can be uncoupled from the Hermiticity condition and becomes a free parameter. An equation for a based on the variational stability of the scattering amplitude is derived; its solution has an interesting property that the scattering amplitude from a converged SMC calculation is independent of the choice of a even though the SMC operator itself is a-dependent. This property provides a sensitive test of the convergence of the calculation. For a static-exchange calculation, the convergence requirement only depends on the completeness of the one-electron basis, but for a general multichannel case, the a-invariance in the scattering amplitude requires both the one-electron basis and the N plus 1-electron basis to be complete. The role of a in the SMC equation and the convergence property are illustrated using two examples: e-CO elastic scattering in the static-exchange approximation, and a two-state treatment of the e-H2 Chi(sup 1)Sigma(sub g)(+) yields b(sup 3)Sigma(sub u)(+) excitation.

  4. Electrical transport, electrothermal transport, and effective electron mass in single-crystalline In2O3 films

    NASA Astrophysics Data System (ADS)

    Preissler, Natalie; Bierwagen, Oliver; Ramu, Ashok T.; Speck, James S.

    2013-08-01

    A comprehensive study of the room-temperature electrical and electrothermal transport of single-crystalline indium oxide (In2O3) and indium tin oxide (ITO) films over a wide range of electron concentrations is reported. We measured the room-temperature Hall mobility μH and Seebeck coefficient S of unintentionally doped and Sn-doped high-quality, plasma-assisted molecular-beam-epitaxy-grown In2O3 for volume Hall electron concentrations nH from 7×1016 cm-3 (unintentionally doped) to 1×1021 cm-3 (highly Sn-doped, ITO). The resulting empirical S(nH) relation can be directly used in other In2O3 samples to estimate the volume electron concentration from simple Seebeck coefficient measurements. The mobility and Seebeck coefficient were modeled by a numerical solution of the Boltzmann transport equation. Ionized impurity scattering and polar optical phonon scattering were found to be the dominant scattering mechanisms. Acoustic phonon scattering was found to be negligible. Fitting the temperature-dependent mobility above room temperature of an In2O3 film with high mobility allowed us to find the effective Debye temperature (ΘD=700 K) and number of phonon modes (NOPML=1.33) that best describe the polar optical phonon scattering. The modeling also yielded the Hall scattering factor rH as a function of electron concentration, which is not negligible (rH≈1.4) at nondegenerate electron concentrations. Fitting the Hall-scattering-factor corrected concentration-dependent Seebeck coefficient S(n) for nondegenerate samples to the numerical solution of the Boltzmann transport equation and to widely used, simplified equations allowed us to extract an effective electron mass of m*=(0.30±0.03)me (with free electron mass me). The modeled mobility and Seebeck coefficient based on polar optical phonon and ionized impurity scattering describes the experimental results very accurately up to electron concentrations of 1019 cm-3, and qualitatively explains a mobility plateau or local maximum around 1020 cm-3. Ionized impurity scattering with doubly charged donors best describes the mobility in our unintentionally doped films, consistent with oxygen vacancies as unintentional shallow donors, whereas singly charged donors best describe our Sn-doped films. Our modeling yields a (phonon-limited) maximum theoretical drift mobility and Hall mobility of μ=190 cm2/Vs and μH=270 cm2/Vs, respectively. Simplified equations for the Seebeck coefficient describe the measured values in the nondegenerate regime using a Seebeck scattering parameter of r=-0.55 (which is consistent with the determined Debye temperature), and provide an estimate of the Seebeck coefficient to lower electron concentrations. The simplified equations fail to describe the Seebeck coefficient around the Mott transition (nMott=5.5×1018 cm-3) from nondegenerate to degenerate electron concentrations, whereas the numerical modeling accurately describes this region.

  5. The Role of Diffusion in the Transport of Energetic Electrons during Solar Flares

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bian, Nicolas H.; Kontar, Eduard P.; Emslie, A. Gordon, E-mail: nicolas.bian@glasgow.gla.ac.uk, E-mail: emslieg@wku.edu

    2017-02-01

    The transport of the energy contained in suprathermal electrons in solar flares plays a key role in our understanding of many aspects of flare physics, from the spatial distributions of hard X-ray emission and energy deposition in the ambient atmosphere to global energetics. Historically the transport of these particles has been largely treated through a deterministic approach, in which first-order secular energy loss to electrons in the ambient target is treated as the dominant effect, with second-order diffusive terms (in both energy and angle) generally being either treated as a small correction or even neglected. Here, we critically analyze thismore » approach, and we show that spatial diffusion through pitch-angle scattering necessarily plays a very significant role in the transport of electrons. We further show that a satisfactory treatment of the diffusion process requires consideration of non-local effects, so that the electron flux depends not just on the local gradient of the electron distribution function but on the value of this gradient within an extended region encompassing a significant fraction of a mean free path. Our analysis applies generally to pitch-angle scattering by a variety of mechanisms, from Coulomb collisions to turbulent scattering. We further show that the spatial transport of electrons along the magnetic field of a flaring loop can be modeled rather effectively as a Continuous Time Random Walk with velocity-dependent probability distribution functions of jump sizes and occurrences, both of which can be expressed in terms of the scattering mean free path.« less

  6. Inelastic X-ray Scattering Measurements of Ionization in Warm, Dense Matter

    NASA Astrophysics Data System (ADS)

    Davis, Paul F.

    In this work we demonstrate spectrally resolved x-ray scattering from electron-plasma waves in shock-compressed deuterium and proton-heated matter. Because the spectral signature of inelastic x-ray scattering is strongly dependent on the free electron density of the system, it is used to infer ionization in dynamically heated samples. Using 2-6 ns, 500 J laser pulses from LLNL's Janus laser, we shocked liquid deuterium to pressures approaching 50 GPa, reaching compressions of 4 times liquid density. A second laser produced intense 2 keV x-rays. By collecting and spectrally dispersing forward scattered photons at 45°, the onset of ionization was detected at compressions of about 3 times in the form of plasmon oscillations. Backscattered x-rays bolstered this observation by measuring the free electron distribution through Compton scattering. Comparison with simulations shows very close agreement between the pressure dependence of ionization and molecular dissociation in dynamically compressed deuterium. In a second set of experiments, a 10 ps, 200 J Titan laser pulse was split into two beams. One created a stream of MeV protons to heat samples of boron and boron-nitride and the other pumped 4.5 keV K-alpha radiation in a titanium foil to probe the hot target. We observed scattered x-rays 300 ps after heating, noting a strong difference in average ionization between the two target materials at temperatures of 16 eV and very similar mass densities. Comparison with electron structure calculations suggests that this difference is due to a persistence of long-range ion structure in BN resulting in high-temperature band structure. These results underscore the importance of understanding the complex electron structure of materials even at electron-volt temperatures and gigapascal pressures. Our results provide new data to guide the theoretical modeling of warm, dense matter important to understanding giant planets and inertial fusion targets.

  7. Thermally Driven Electronic Topological Transition in FeTi

    DOE PAGES

    Yang, F. C.; Muñoz, J. A.; Hellman, O.; ...

    2016-08-08

    In this paper, ab initio molecular dynamics, supported by inelastic neutron scattering and nuclear resonant inelastic x-ray scattering, showed an anomalous thermal softening of the M 5 - phonon mode in B2-ordered FeTi that could not be explained by phonon-phonon interactions or electron-phonon interactions calculated at low temperatures. A computational investigation showed that the Fermi surface undergoes a novel thermally driven electronic topological transition, in which new features of the Fermi surface arise at elevated temperatures. Finally, the thermally induced electronic topological transition causes an increased electronic screening for the atom displacements in the M 5 - phonon mode andmore » an adiabatic electron-phonon interaction with an unusual temperature dependence.« less

  8. Ultrafast electron-optical phonon scattering and quasiparticle lifetime in CVD-grown graphene.

    PubMed

    Shang, Jingzhi; Yu, Ting; Lin, Jianyi; Gurzadyan, Gagik G

    2011-04-26

    Ultrafast quasiparticle dynamics in graphene grown by chemical vapor deposition (CVD) has been studied by UV pump/white-light probe spectroscopy. Transient differential transmission spectra of monolayer graphene are observed in the visible probe range (400-650 nm). Kinetics of the quasiparticle (i.e., low-energy single-particle excitation with renormalized energy due to electron-electron Coulomb, electron-optical phonon (e-op), and optical phonon-acoustic phonon (op-ap) interactions) was monitored with 50 fs resolution. Extending the probe range to near-infrared, we find the evolution of quasiparticle relaxation channels from monoexponential e-op scattering to double exponential decay due to e-op and op-ap scattering. Moreover, quasiparticle lifetimes of mono- and randomly stacked graphene films are obtained for the probe photon energies continuously from 1.9 to 2.3 eV. Dependence of quasiparticle decay rate on the probe energy is linear for 10-layer stacked graphene films. This is due to the dominant e-op intervalley scattering and the linear density of states in the probed electronic band. A dimensionless coupling constant W is derived, which characterizes the scattering strength of quasiparticles by lattice points in graphene.

  9. Exciton scattering approach for optical spectra calculations in branched conjugated macromolecules

    NASA Astrophysics Data System (ADS)

    Li, Hao; Wu, Chao; Malinin, Sergey V.; Tretiak, Sergei; Chernyak, Vladimir Y.

    2016-12-01

    The exciton scattering (ES) technique is a multiscale approach based on the concept of a particle in a box and developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, electronic excitations in molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph whose edges and nodes stand for the molecular linear segments and vertices, respectively. Exciton propagation on the linear segments is characterized by the exciton dispersion, whereas exciton scattering at the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized "particle in a box" problems on the graph that represents the molecule. Similarly, unique energy-dependent ES dipolar parameters permit calculations of the corresponding oscillator strengths, thus, completing optical spectra modeling. Both the energetic and dipolar parameters can be extracted from quantum-chemical computations in small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within a considered molecular family could be performed with negligible numerical effort. We demonstrate the ES method application to molecular families of branched conjugated phenylacetylenes and ladder poly-para-phenylenes, as well as structures with electron donor and acceptor chemical substituents. Time-dependent density functional theory (TD-DFT) is used as a reference model for electronic structure. The ES calculations accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  10. Anomalous satellite inductive peaks in alternating current response of defective carbon nanotubes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hirai, Daisuke; Watanabe, Satoshi; Yamamoto, Takahiro

    2014-05-07

    AC response of defective metallic carbon nanotubes is investigated from first principles. We found that capacitive peaks appear at electron scattering states. Moreover, we show that satellite inductive peaks are seen adjacent to a main capacitive peak, which is in contrast to the conductance spectra having no satellite features. The appearance of satellite inductive peaks seems to depend on the scattering states. Our analysis with a simple resonant scattering model reveals that the origin of the satellite inductive peaks can be understood by just one parameter, i.e., the lifetime of electrons at a defect state.

  11. Specific features of electron scattering in uniaxially deformed n-Ge single crystals in the presence of radiation defects

    NASA Astrophysics Data System (ADS)

    Luniov, S. V.; Zimych, A. I.; Nazarchuk, P. F.; Maslyuk, V. T.; Megela, I. G.

    2016-12-01

    Temperature dependencies for concentration of electrons and the Hall mobility for unirradiated and irradiated by the flow of electrons ? single crystals ?, with the energy of ?, for different values of uniaxial pressures along the crystallographic directions ?, ? and ? are obtained on the basis of piezo-Hall effect measurements. Non-typical growth of the Hall mobility of electrons for irradiated single crystals ? in comparison with unirradiated with the increasing of value of uniaxial pressures along the crystallographic directions ? (for the entire range of the investigated temperatures) and ? (to temperatures ?) has been revealed. Such an effect of the Hall mobility increase for uniaxially deformed single crystals ? is explained by the reduction of gradients of a resistance as a result of reduction in the amplitude of a large-scale potential with deformation and concentration of charged A-centers in the process of their recharge by the increasing of uniaxial pressure and consequently the probability of scattering on these centers. Theoretical calculations for temperature dependencies of the Hall mobility for uniaxially deformed single crystals ? in terms of the electrons scattering on the ions of shallow donors, acoustic, optical and intervalley phonons, regions of disordering and large-scale potential is good conformed to the corresponding experimental results at temperatures T<220 K for the case of uniaxial pressures along the crystallographic directions ? and ? and for temperatures ? when the uniaxial pressure is directed along the crystallographic directions ?. The mechanism of electron scattering on a charged radiation defects (which correspond to the deep energy levels of A-centers) 'is turned off' for the given temperatures due to the uniaxial pressure. Reduction of the Hall mobility in transition through a maximum of dependence ? with the increasing temperature for cases of the uniaxial deformation of the irradiated single crystals ? along the crystallographic directions ? and ? is explained by the deforming redistribution of electrons between the minima of conduction band of germanium with different mobility.

  12. Tensor Analyzing Powers for Quasi-Elastic Electron Scattering from Deuterium

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Z.-L. Zhou; M. Bouwhuis; M. Ferro-Luzzi

    1999-01-01

    We report on a first measurement of tensor analyzing powers in quasi-elastic electron-deuteron scattering at an average three-momentum transfer of 1.7 fm{sup -1}. Data sensitive to the spin-dependent nucleon density in the deuteron were obtained for missing momenta up to 150 MeV/c with a tensor polarized {sup 2}H target internal to an electron storage ring. The data are well described by a calculation that includes the effects of final-state interaction, meson-exchange and isobar currents, and leading-order relativistic contributions.

  13. Magnetotransport of multiple-band nearly antiferromagnetic metals due to hot-spot scattering

    DOE PAGES

    Koshelev, A. E.

    2016-09-30

    Multiple-band electronic structure and proximity to antiferromagnetic (AF) instability are the key properties of iron-based superconductors. In this paper, we explore the influence of scattering by the AF spin fluctuations on transport of multiple-band metals above the magnetic transition. A salient feature of scattering on the AF fluctuations is that it is strongly enhanced at the Fermi surface locations where the nesting is perfect (“hot spots” or “hot lines”). We review derivation of the collision integral for the Boltzmann equation due to AF-fluctuations scattering. In the paramagnetic state, the enhanced scattering rate near the hot lines leads to anomalous behaviormore » of electronic transport in magnetic field. We explore this behavior by analytically solving the Boltzmann transport equation with approximate transition rates. This approach accounts for return scattering events and is more accurate than the relaxation-time approximation. The magnetic-field dependences are characterized by two very different field scales: the lower scale is set by the hot-spot width and the higher scale is set by the total scattering amplitude. A conventional magnetotransport behavior is limited to magnetic fields below the lower scale. In the wide range in-between these two scales, the longitudinal conductivity has linear dependence on the magnetic field and the Hall conductivity has quadratic dependence. The linear dependence of the diagonal component reflects growth of the Fermi-surface area affected by the hot spots proportional to the magnetic field. Finally, we discuss applicability of this theoretical framework for describing of anomalous magnetotransport properties in different iron pnictides and chalcogenides in the paramagnetic state.« less

  14. Many-particle-effects in the theory of the extended X-ray absorption fine structure

    NASA Astrophysics Data System (ADS)

    Tran Thoai, D. B.; Ekardt, W.

    1981-10-01

    The Lee-Beni-procedure for the calculation of the extended X-ray absorption fine structure (EXAFS) is extended so as to include the effects of the electronic charge density outside the localized muffin-tin potentials. In our scheme EXAFS is caused by back-scattering of an elementary excitation of a homogeneous electron gas by localized energy dependent many-particle muffin-tin potentials. The difference between the two schemes is negligible at large k's, as expected from physical grounds. However, at small and intermediate k-values the difference is quite large. The effect of the outer electrons as compared to the Lee-Beni-model is twofold. First, they renormalize the scattered electron in the usual way. Second, they are missing within the scattering muffin-tins. Hence, we avoid to count some of the electrons twice. Results are presented for Cu as an example.

  15. Electron-excited energy dispersive x-ray spectrometry in the variable pressure scanning electron microscope (EDS/VPSEM): it's not microanalysis anymore!

    NASA Astrophysics Data System (ADS)

    Newbury, Dale E.; Ritchie, Nicholas W. M.

    2015-10-01

    X-ray spectra suffer significantly degraded spatial resolution when measured in the variable-pressure scanning electron microscope (VPSEM, chamber pressure 1 Pa to 2500 Pa) as compared to highvacuum SEM (operating pressure < 10 mPa). Depending on the gas path length, electrons that are scattered hundreds of micrometers outside the focused beam can contribute 90% or more of the measured spectrum. Monte Carlo electron trajectory simulation, available in NIST DTSA-II, models the gas scattering and simulates mixed composition targets, e.g., particle on substrate. The impact of gas scattering at the major (C > 0.1 mass fraction), minor (0.01 <= C <= 0.1), and trace (C < 0.01) constituent levels can be estimated. NIST DTSA-II for Java-platforms is available free at: http://www.cstl.nist.gov/div837/837.02/epq/dtsa2/index.html).

  16. Using resistive readout to probe ultrafast dynamics of a plasmonic sensor

    NASA Astrophysics Data System (ADS)

    Cheney, Alec; Chen, Borui; Cartwright, Alexander; Thomay, Tim

    2018-02-01

    Surface plasmons in a DC current lead to an increase in scattering processes, resulting in a measurable increase in electrical resistance of a plasmonic nano-grating. This enables a purely electronic readout of plasmonically mediated optical absorption. We show that there is a time-dependence in these resistance changes on the order of 100ps that we attribute to electron-phonon and phonon-phonon scattering processes in the metal of the nano-gratings. Since plasmonic responses are strongly structurally dependent, an appropriately designed plasmoelectronic detector could potentially offer an extremely fast response at communication wavelengths in a fully CMOS compatible system.

  17. Proton Form Factor Puzzle and the CEBAF Large Acceptance Spectrometer (CLAS) two-photon exchange experiment

    NASA Astrophysics Data System (ADS)

    Rimal, Dipak

    The electromagnetic form factors are the most fundamental observables that encode information about the internal structure of the nucleon. The electric (GE) and the magnetic ( GM) form factors contain information about the spatial distribution of the charge and magnetization inside the nucleon. A significant discrepancy exists between the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors of the proton. One possible explanation for the discrepancy is the contributions of two-photon exchange (TPE) effects. Theoretical calculations estimating the magnitude of the TPE effect are highly model dependent, and limited experimental evidence for such effects exists. Experimentally, the TPE effect can be measured by comparing the ratio of positron-proton elastic scattering cross section to that of the electron-proton [R = sigma(e +p)/sigma(e+p)]. The ratio R was measured over a wide range of kinematics, utilizing a 5.6 GeV primary electron beam produced by the Continuous Electron Beam Accelerator Facility (CEBAF) at Jefferson Lab. This dissertation explored dependence of R on kinematic variables such as squared four-momentum transfer (Q2) and the virtual photon polarization parameter (epsilon). A mixed electron-positron beam was produced from the primary electron beam in experimental Hall B. The mixed beam was scattered from a liquid hydrogen (LH2) target. Both the scattered lepton and the recoil proton were detected by the CEBAF Large Acceptance Spectrometer (CLAS). The elastic events were then identified by using elastic scattering kinematics. This work extracted the Q2 dependence of R at high epsilon(epsilon > 0.8) and the $epsilon dependence of R at approx 0.85 GeV2. In these kinematics, our data confirm the validity of the hadronic calculations of the TPE effect by Blunden, Melnitchouk, and Tjon. This hadronic TPE effect, with additional corrections contributed by higher excitations of the intermediate state nucleon, largely reconciles the Rosenbluth and the polarization transfer measurements of the electromagnetic form factors.

  18. Simulation of energy-dependent electron diffusion processes in the Earth's outer radiation belt

    DOE PAGES

    Ma, Q.; Li, W.; Thorne, R. M.; ...

    2016-04-28

    The radial and local diffusion processes induced by various plasma waves govern the highly energetic electron dynamics in the Earth's radiation belts, causing distinct characteristics in electron distributions at various energies. In this study, we present our simulation results of the energetic electron evolution during a geomagnetic storm using the University of California, Los Angeles 3-D diffusion code. Following the plasma sheet electron injections, the electrons at different energy bands detected by the Magnetic Electron Ion Spectrometer (MagEIS) and Relativistic Electron Proton Telescope (REPT) instruments on board the Van Allen Probes exhibit a rapid enhancement followed by a slow diffusivemore » movement in differential energy fluxes, and the radial extent to which electrons can penetrate into depends on energy with closer penetration toward the Earth at lower energies than higher energies. We incorporate radial diffusion, local acceleration, and loss processes due to whistler mode wave observations to perform a 3-D diffusion simulation. Here, our simulation results demonstrate that chorus waves cause electron flux increase by more than 1 order of magnitude during the first 18 h, and the subsequent radial extents of the energetic electrons during the storm recovery phase are determined by the coupled radial diffusion and the pitch angle scattering by EMIC waves and plasmaspheric hiss. The radial diffusion caused by ULF waves and local plasma wave scattering are energy dependent, which lead to the observed electron flux variations with energy dependences. Lastly, this study suggests that plasma wave distributions in the inner magnetosphere are crucial for the energy-dependent intrusions of several hundred keV to several MeV electrons.« less

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koshelev, A. E.

    Multiple-band electronic structure and proximity to antiferromagnetic (AF) instability are the key properties of iron-based superconductors. In this paper, we explore the influence of scattering by the AF spin fluctuations on transport of multiple-band metals above the magnetic transition. A salient feature of scattering on the AF fluctuations is that it is strongly enhanced at the Fermi surface locations where the nesting is perfect (“hot spots” or “hot lines”). We review derivation of the collision integral for the Boltzmann equation due to AF-fluctuations scattering. In the paramagnetic state, the enhanced scattering rate near the hot lines leads to anomalous behaviormore » of electronic transport in magnetic field. We explore this behavior by analytically solving the Boltzmann transport equation with approximate transition rates. This approach accounts for return scattering events and is more accurate than the relaxation-time approximation. The magnetic-field dependences are characterized by two very different field scales: the lower scale is set by the hot-spot width and the higher scale is set by the total scattering amplitude. A conventional magnetotransport behavior is limited to magnetic fields below the lower scale. In the wide range in-between these two scales, the longitudinal conductivity has linear dependence on the magnetic field and the Hall conductivity has quadratic dependence. The linear dependence of the diagonal component reflects growth of the Fermi-surface area affected by the hot spots proportional to the magnetic field. Finally, we discuss applicability of this theoretical framework for describing of anomalous magnetotransport properties in different iron pnictides and chalcogenides in the paramagnetic state.« less

  20. Comparative study of inelastic squared form factors of the vibronic states of B 1Σu+ , C 1Πu , and E F 1Σg+ for molecular hydrogen: Inelastic x-ray and electron scattering

    NASA Astrophysics Data System (ADS)

    Xu, Long-Quan; Kang, Xu; Peng, Yi-Geng; Xu, Xin; Liu, Ya-Wei; Wu, Yong; Yang, Ke; Hiraoka, Nozomu; Tsuei, Ku-Ding; Wang, Jian-Guo; Zhu, Lin-Fan

    2018-03-01

    A joint experimental and theoretical investigation of the valence-shell excitations of hydrogen has been performed by the high-resolution inelastic x-ray scattering and electron scattering as well as the multireference single- and double-excitation configuration-interaction method. Momentum-transfer-dependent inelastic squared form factors for the vibronic series belonging to the B 1Σu+ ,C 1Πu , and E F 1Σg+ electronic states of molecular hydrogen have been derived from the inelastic x-ray scattering method at an impact photon energy around 10 keV, and the electron energy-loss spectra measured at an incident electron energy of 1500 eV. It is found that both the present and the previous calculations cannot satisfactorily reproduce the inelastic squared form-factor profiles for the higher vibronic transitions of the B 1Σu+ state of molecular hydrogen, which may be due to the electronic-vibrational coupling for the higher vibronic states. For the C 1Πu state and some vibronic excitations of E F 1Σg+ state, the present experimental results are in good agreement with the present and previous calculations, while the slight differences between the inelastic x-ray scattering and electron energy-loss spectroscopy results in the larger squared momentum-transfer region may be attributed to the increasing role of the higher-order Born terms in the electron-scattering process.

  1. Understanding the mechanisms of radiation belt dropouts observed by Van Allen Probes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiang, Zheng; Tu, Weichao; Li, Xinlin

    To achieve a better understanding of the dominant loss mechanisms for the rapid dropouts of radiation belt electrons, three distinct radiation belt dropout events observed by Van Allen Probes are comprehensively investigated. For each event, observations of the pitch angle distribution of electron fluxes and electromagnetic ion cyclotron (EMIC) waves are analyzed to determine the effects of atmospheric precipitation loss due to pitch angle scattering induced by EMIC waves. Last closed drift shells (LCDS) and magnetopause standoff position are obtained to evaluate the effects of magnetopause shadowing loss. Evolution of electron phase space density (PSD) versus L* profiles and themore » μ and K (first and second adiabatic invariants) dependence of the electron PSD drops are calculated to further analyze the dominant loss mechanisms at different L*. Here, our findings suggest that these radiation belt dropouts can be classified into distinct classes in terms of dominant loss mechanisms: magnetopause shadowing dominant, EMIC wave scattering dominant, and combination of both mechanisms. Different from previous understanding, our results show that magnetopause shadowing can deplete electrons at L* < 4, while EMIC waves can efficiently scatter electrons at L* > 4. Compared to the magnetopause standoff position, it is more reliable to use LCDS to evaluate the impact of magnetopause shadowing. Finally, the evolution of electron PSD versus L* profile and the μ, K dependence of electron PSD drops can provide critical and credible clues regarding the mechanisms responsible for electron losses at different L* over the outer radiation belt.« less

  2. Understanding the Mechanisms of Radiation Belt Dropouts Observed by Van Allen Probes

    NASA Astrophysics Data System (ADS)

    Xiang, Zheng; Tu, Weichao; Li, Xinlin; Ni, Binbin; Morley, S. K.; Baker, D. N.

    2017-10-01

    To achieve a better understanding of the dominant loss mechanisms for the rapid dropouts of radiation belt electrons, three distinct radiation belt dropout events observed by Van Allen Probes are comprehensively investigated. For each event, observations of the pitch angle distribution of electron fluxes and electromagnetic ion cyclotron (EMIC) waves are analyzed to determine the effects of atmospheric precipitation loss due to pitch angle scattering induced by EMIC waves. Last closed drift shells (LCDS) and magnetopause standoff position are obtained to evaluate the effects of magnetopause shadowing loss. Evolution of electron phase space density (PSD) versus L* profiles and the μ and K (first and second adiabatic invariants) dependence of the electron PSD drops are calculated to further analyze the dominant loss mechanisms at different L*. Our findings suggest that these radiation belt dropouts can be classified into distinct classes in terms of dominant loss mechanisms: magnetopause shadowing dominant, EMIC wave scattering dominant, and combination of both mechanisms. Different from previous understanding, our results show that magnetopause shadowing can deplete electrons at L* < 4, while EMIC waves can efficiently scatter electrons at L* > 4. Compared to the magnetopause standoff position, it is more reliable to use LCDS to evaluate the impact of magnetopause shadowing. The evolution of electron PSD versus L* profile and the μ, K dependence of electron PSD drops can provide critical and credible clues regarding the mechanisms responsible for electron losses at different L* over the outer radiation belt.

  3. Understanding the mechanisms of radiation belt dropouts observed by Van Allen Probes

    DOE PAGES

    Xiang, Zheng; Tu, Weichao; Li, Xinlin; ...

    2017-08-30

    To achieve a better understanding of the dominant loss mechanisms for the rapid dropouts of radiation belt electrons, three distinct radiation belt dropout events observed by Van Allen Probes are comprehensively investigated. For each event, observations of the pitch angle distribution of electron fluxes and electromagnetic ion cyclotron (EMIC) waves are analyzed to determine the effects of atmospheric precipitation loss due to pitch angle scattering induced by EMIC waves. Last closed drift shells (LCDS) and magnetopause standoff position are obtained to evaluate the effects of magnetopause shadowing loss. Evolution of electron phase space density (PSD) versus L* profiles and themore » μ and K (first and second adiabatic invariants) dependence of the electron PSD drops are calculated to further analyze the dominant loss mechanisms at different L*. Here, our findings suggest that these radiation belt dropouts can be classified into distinct classes in terms of dominant loss mechanisms: magnetopause shadowing dominant, EMIC wave scattering dominant, and combination of both mechanisms. Different from previous understanding, our results show that magnetopause shadowing can deplete electrons at L* < 4, while EMIC waves can efficiently scatter electrons at L* > 4. Compared to the magnetopause standoff position, it is more reliable to use LCDS to evaluate the impact of magnetopause shadowing. Finally, the evolution of electron PSD versus L* profile and the μ, K dependence of electron PSD drops can provide critical and credible clues regarding the mechanisms responsible for electron losses at different L* over the outer radiation belt.« less

  4. Diffusive transport of several hundred keV electrons in the Earth's slot region

    NASA Astrophysics Data System (ADS)

    Ma, Q.; Li, W.; Thorne, R. M.; Bortnik, J.

    2017-12-01

    We investigate the gradual diffusion of energetic electrons from the inner edge of the outer radiation belt into the slot region. The Van Allen Probes observed slow inward diffusion and decay of 200-600 keV electrons following the intense geomagnetic storm that occurred on 17 March 2013. During the 10-day non-disturbed period following the storm, the peak of electron fluxes gradually moved from L 2.7 to L 2.4, and the flux levels decreased by a factor of 2-4 depending on the electron energy. We simulated the radial intrusion and decay of electrons using a 3-dimentional diffusion code, which reproduced the energy-dependent transport of electrons from 100 keV to 1 MeV in the slot region. At energies of 100-200 keV, the electrons experience fast transport across the slot region due to the dominance of radial diffusion; at energies of 200-600 keV, the electrons gradually diffuse and decay in the slot region due to the comparable radial diffusion rate and pitch angle scattering rate by plasmaspheric hiss; at energies of E > 700 keV, the electrons stopped diffusing near the inner edge of outer radiation belt due to the dominant pitch angle scattering loss. In addition to plasmaspheric hiss, magnetosonic waves and VLF waves can cause the loss of high pitch angle electrons, relaxing the sharp `top-hat' shaped pitch angle distributions created by plasmaspheric hiss. Our simulation indicates the importance of radial diffusion and pitch angle scattering in forming the diffusive intrusion of energetic electrons across the slot region.

  5. Diffusive Transport of Several Hundred keV Electrons in the Earth's Slot Region

    NASA Astrophysics Data System (ADS)

    Ma, Q.; Li, W.; Thorne, R. M.; Bortnik, J.; Reeves, G. D.; Spence, H. E.; Turner, D. L.; Blake, J. B.; Fennell, J. F.; Claudepierre, S. G.; Kletzing, C. A.; Kurth, W. S.; Hospodarsky, G. B.; Baker, D. N.

    2017-10-01

    We investigate the gradual diffusion of energetic electrons from the inner edge of the outer radiation belt into the slot region. The Van Allen Probes observed slow inward diffusion and decay of 200-600 keV electrons following the intense geomagnetic storm that occurred on 17 March 2013. During the 10 day nondisturbed period following the storm, the peak of electron fluxes gradually moved from L 2.7 to L 2.4, and the flux levels decreased by a factor of 2-4 depending on the electron energy. We simulated the radial intrusion and decay of electrons using a three-dimensional diffusion code, which reproduced the energy-dependent transport of electrons from 100 keV to 1 MeV in the slot region. At energies of 100-200 keV, the electrons experience fast transport across the slot region due to the dominance of radial diffusion; at energies of 200-600 keV, the electrons gradually diffuse and decay in the slot region due to the comparable rate of radial diffusion and pitch angle scattering by plasmaspheric hiss; at energies of E > 700 keV, the electrons stopped diffusing near the inner edge of outer radiation belt due to the dominant pitch angle scattering loss. In addition to plasmaspheric hiss, magnetosonic waves and VLF transmitters can cause the loss of high pitch angle electrons, relaxing the sharp "top-hat" shaped pitch angle distributions created by plasmaspheric hiss. Our simulation indicates the importance of balance between radial diffusion and loss through pitch angle scattering in forming the diffusive intrusion of energetic electrons across the slot region.

  6. STUDY OF THE INELASTIC SCATTERING OF ELECTRONS BY THE NUCLEI $sup 6$Li AND $sup 7$Li (in French)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bernheim, M.; Bishop, G.R.

    1963-11-01

    We have measured the form factors for transitions to the following excited states by the inelastic scattering of electrons: 2.189, 3.57, and 4.52 Mev of /sup 6/Li; and 0.478, 4.61, 5.76, and 6.8 Mev of /sup 7/Li. The dependence of the form factors on the momentum transfer indicates the principal components of the wave functions describing these states. (auth)

  7. Acquisition parameters optimization of a transmission electron forward scatter diffraction system in a cold-field emission scanning electron microscope for nanomaterials characterization.

    PubMed

    Brodusch, Nicolas; Demers, Hendrix; Trudeau, Michel; Gauvin, Raynald

    2013-01-01

    Transmission electron forward scatter diffraction (t-EFSD) is a new technique providing crystallographic information with high resolution on thin specimens by using a conventional electron backscatter diffraction (EBSD) system in a scanning electron microscope. In this study, the impact of tilt angle, working distance, and detector distance on the Kikuchi pattern quality were investigated in a cold-field emission scanning electron microscope (CFE-SEM). We demonstrated that t-EFSD is applicable for tilt angles ranging from -20° to -40°. Working distance (WD) should be optimized for each material by choosing the WD for which the EBSD camera screen illumination is the highest, as the number of detected electrons on the screen is directly dependent on the scattering angle. To take advantage of the best performances of the CFE-SEM, the EBSD camera should be close to the sample and oriented towards the bottom to increase forward scattered electron collection efficiency. However, specimen chamber cluttering and beam/mechanical drift are important limitations in the CFE-SEM used in this work. Finally, the importance of t-EFSD in materials science characterization was illustrated through three examples of phase identification and orientation mapping. © Wiley Periodicals, Inc.

  8. Size- and temperature-dependent Hamaker constants for heterogeneous systems of interacting nanoparticles

    NASA Astrophysics Data System (ADS)

    Pinchuk, P.; Pinchuk, A. O.

    2016-09-01

    Hamaker-Lifshitz constants are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the free-electron Drude model for metals. For bulk metals, the Drude model does is size independent. However, the conducting electrons in small metal nanoparticles exhibit surface scattering, which changes the complex dielectric permittivity function. Additionally, the Drude model can be modified to include temperature dependence. That is, an increase in temperature leads to thermal volume expansion and increased phonon population, which affect the scattering rate of the electrons and the plasma frequency. Both of these terms contribute significantly to the Drude model for the dielectric permittivity of the particles. In this work, we show theoretically that scattering of the free conducting electrons inside noble metal nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. In addition, we calculate numerically the Hamaker-Lifshitz constants for a variety of temperatures. The results of the study might be of interest for understanding colloidal stability of metal nanoparticles.

  9. Hard X-ray quiescent emission in magnetars via resonant Compton upscattering

    NASA Astrophysics Data System (ADS)

    Baring, M. G.; Wadiasingh, Z.; Gonthier, P. L.; Harding, A. K.

    2017-12-01

    Non-thermal quiescent X-ray emission extending between 10 keV and around 150 keV has been seen in about 10 magnetars by RXTE, INTEGRAL, Suzaku, NuSTAR and Fermi-GBM. For inner magnetospheric models of such hard X-ray signals, inverse Compton scattering is anticipated to be the most efficient process for generating the continuum radiation, because the scattering cross section is resonant at the cyclotron frequency. We present hard X-ray upscattering spectra for uncooled monoenergetic relativistic electrons injected in inner regions of pulsar magnetospheres. These model spectra are integrated over bundles of closed field lines and obtained for different observing perspectives. The spectral turnover energies are critically dependent on the observer viewing angles and electron Lorentz factor. We find that electrons with energies less than around 15 MeV will emit most of their radiation below 250 keV, consistent with the turnovers inferred in magnetar hard X-ray tails. Electrons of higher energy still emit most of the radiation below around 1 MeV, except for quasi-equatorial emission locales for select pulse phases. Our spectral computations use a new state-of-the-art, spin-dependent formalism for the QED Compton scattering cross section in strong magnetic fields.

  10. Stochastic treatment of electron multiplication without scattering in dielectrics

    NASA Technical Reports Server (NTRS)

    Lin, D. L.; Beers, B. L.

    1981-01-01

    By treating the emission of optical phonons as a Markov process, a simple analytic method is developed for calculating the electronic ionization rate per unit length for dielectrics. The effects of scattering from acoustic and optical phonons are neglected. The treatment obtains universal functions in recursive form, the theory depending on only two dimensionless energy ratios. A comparison of the present work with other numerical approaches indicates that the effect of scattering becomes important only when the electric potential energy drop in a mean free path for optical-phonon emission is less than about 25% of the ionization potential. A comparison with Monte Carlo results is also given for Teflon.

  11. Time-dependent first-principles study of angle-resolved secondary electron emission from atomic sheets

    NASA Astrophysics Data System (ADS)

    Ueda, Yoshihiro; Suzuki, Yasumitsu; Watanabe, Kazuyuki

    2018-02-01

    Angle-resolved secondary electron emission (ARSEE) spectra were analyzed for two-dimensional atomic sheets using a time-dependent first-principles simulation of electron scattering. We demonstrate that the calculated ARSEE spectra capture the unoccupied band structure of the atomic sheets. The excitation dynamics that lead to SEE have also been revealed by the time-dependent Kohn-Sham decomposition scheme. In the present study, the mechanism for the experimentally observed ARSEE from atomic sheets is elucidated with respect to both energetics and the dynamical aspects of SEE.

  12. Energy shift and conduction-to-valence band transition mediated by a time-dependent potential barrier in graphene

    NASA Astrophysics Data System (ADS)

    Chaves, Andrey; da Costa, D. R.; de Sousa, G. O.; Pereira, J. M.; Farias, G. A.

    2015-09-01

    We investigate the scattering of a wave packet describing low-energy electrons in graphene by a time-dependent finite-step potential barrier. Our results demonstrate that, after Klein tunneling through the barrier, the electron acquires an extra energy which depends on the rate of change of the barrier height with time. If this rate is negative, the electron loses energy and ends up as a valence band state after leaving the barrier, which effectively behaves as a positively charged quasiparticle.

  13. Electron collisions with ethylene

    NASA Astrophysics Data System (ADS)

    Panajotovic, R.; Kitajima, M.; Tanaka, H.; Jelisavcic, M.; Lower, J.; Campbell, L.; Brunger, M. J.; Buckman, S. J.

    2003-04-01

    We have measured absolute elastic scattering and vibrational excitation cross sections for electron impact on ethylene. The experimental data have been obtained on two different crossed-beam electron spectrometers and they cover the energy range from 1 to 100 eV and scattering angles between 10° and 130°. Both differential (in angle) and energy-dependent cross sections have been measured. The differential cross sections have also been analysed using a molecular phase shift analysis technique in order to derive the integral elastic and elastic momentum transfer cross sections. Comparison is made with earlier data, where available, and also with a number of recent theoretical calculations.

  14. Multibeam Stimulated Raman Scattering in Inertial Confinement Fusion Conditions.

    PubMed

    Michel, P; Divol, L; Dewald, E L; Milovich, J L; Hohenberger, M; Jones, O S; Hopkins, L Berzak; Berger, R L; Kruer, W L; Moody, J D

    2015-07-31

    Stimulated Raman scattering from multiple laser beams arranged in a cone sharing a common daughter wave is investigated for inertial confinement fusion (ICF) conditions in a inhomogeneous plasma. It is found that the shared electron plasma wave (EPW) process, where the lasers collectively drive the same EPW, can lead to an absolute instability when the electron density reaches a matching condition dependent on the cone angle of the laser beams. This mechanism could explain recent experimental observations of hot electrons at early times in ICF experiments, at densities well below quarter critical when two plasmon decay is not expected to occur.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsytovich, Vadim, E-mail: tsytov@lpi.ru; Max Planck Institute for Extraterrestrial Physics, Garching; Gusein-zade, Namik

    Dust structuring is a natural and universal process in complex plasmas. The scattering of electromagnetic waves by dust structures is governed by the factor of coherency, i.e., the total number of coherent electrons in a single structure. In the present paper, we consider how the factor of coherency changes due to additional pulse electron heating and show that it obeys a hysteresis. After the end of the pulse heating, the scattering intensity differs substantially from that before heating. There are three necessary conditions for scattering hysteresis: first, the radiation wavelength should be larger than the pattern (structure) size; second, themore » total number of coherent electrons confined by the structure should be large; and third, the heating pulse duration should be shorter than the characteristic time of dust structure formation. We present the results of numerical calculations using existing models of self-consistent dust structures with either positively or negatively charged dust grains. It is shown that, depending on the grain charge and the ionization rate, two types of hysteresis are possible: one with a final increase of the scattering and the other with a final decrease of the scattering. It is suggested that the hysteresis of coherent scattering can be used as a tool in laboratory experiments and that it can be a basic mechanism explaining the observed hysteresis in radar scattering by noctilucent clouds during active experiments on electron heating in mesosphere.« less

  16. Temperature dependence of Brillouin light scattering spectra of acoustic phonons in silicon

    NASA Astrophysics Data System (ADS)

    Olsson, Kevin S.; Klimovich, Nikita; An, Kyongmo; Sullivan, Sean; Weathers, Annie; Shi, Li; Li, Xiaoqin

    2015-02-01

    Electrons, optical phonons, and acoustic phonons are often driven out of local equilibrium in electronic devices or during laser-material interaction processes. The need for a better understanding of such non-equilibrium transport processes has motivated the development of Raman spectroscopy as a local temperature sensor of optical phonons and intermediate frequency acoustic phonons, whereas Brillouin light scattering (BLS) has recently been explored as a temperature sensor of low-frequency acoustic phonons. Here, we report the measured BLS spectra of silicon at different temperatures. The origins of the observed temperature dependence of the BLS peak position, linewidth, and intensity are examined in order to evaluate their potential use as temperature sensors for acoustic phonons.

  17. High time resolved electron temperature measurements by using the multi-pass Thomson scattering system in GAMMA 10/PDX.

    PubMed

    Yoshikawa, Masayuki; Yasuhara, Ryo; Ohta, Koichi; Chikatsu, Masayuki; Shima, Yoriko; Kohagura, Junko; Sakamoto, Mizuki; Nakashima, Yousuke; Imai, Tsuyoshi; Ichimura, Makoto; Yamada, Ichihiro; Funaba, Hisamichi; Minami, Takashi

    2016-11-01

    High time resolved electron temperature measurements are useful for fluctuation study. A multi-pass Thomson scattering (MPTS) system is proposed for the improvement of both increasing the TS signal intensity and time resolution. The MPTS system in GAMMA 10/PDX has been constructed for enhancing the Thomson scattered signals for the improvement of measurement accuracy. The MPTS system has a polarization-based configuration with an image relaying system. We optimized the image relaying optics for improving the multi-pass laser confinement and obtaining the stable MPTS signals over ten passing TS signals. The integrated MPTS signals increased about five times larger than that in the single pass system. Finally, time dependent electron temperatures were obtained in MHz sampling.

  18. In situ characterization of nanoparticles using Rayleigh scattering

    DOE PAGES

    Santra, Biswajit; Shneider, Mikhail N.; Car, Roberto

    2017-01-10

    Here, we report a theoretical analysis showing that Rayleigh scattering could be used to monitor the growth of nanoparticles under arc discharge conditions. We compute the Rayleigh scattering cross sections of the nanoparticles by combining light scattering theory for gas-particle mixtures with calculations of the dynamic electronic polarizability of the nanoparticles. We find that the resolution of the Rayleigh scattering probe is adequate to detect nanoparticles as small as C 60 at the expected concentrations of synthesis conditions in the arc periphery. Larger asymmetric nanoparticles would yield brighter signals, making possible to follow the evolution of the growing nanoparticle populationmore » from the evolution of the scattered intensity. Observable spectral features include characteristic resonant behaviour, shape-dependent depolarization ratio, and mass-dependent line shape. Direct observation of nanoparticles in the early stages of growth with unobtrusive laser probes should give insight on the particle formation mechanisms and may lead to better-controlled synthesis protocols.« less

  19. In situ Characterization of Nanoparticles Using Rayleigh Scattering

    PubMed Central

    Santra, Biswajit; Shneider, Mikhail N.; Car, Roberto

    2017-01-01

    We report a theoretical analysis showing that Rayleigh scattering could be used to monitor the growth of nanoparticles under arc discharge conditions. We compute the Rayleigh scattering cross sections of the nanoparticles by combining light scattering theory for gas-particle mixtures with calculations of the dynamic electronic polarizability of the nanoparticles. We find that the resolution of the Rayleigh scattering probe is adequate to detect nanoparticles as small as C60 at the expected concentrations of synthesis conditions in the arc periphery. Larger asymmetric nanoparticles would yield brighter signals, making possible to follow the evolution of the growing nanoparticle population from the evolution of the scattered intensity. Observable spectral features include characteristic resonant behaviour, shape-dependent depolarization ratio, and mass-dependent line shape. Direct observation of nanoparticles in the early stages of growth with unobtrusive laser probes should give insight on the particle formation mechanisms and may lead to better-controlled synthesis protocols. PMID:28071715

  20. In situ characterization of nanoparticles using Rayleigh scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santra, Biswajit; Shneider, Mikhail N.; Car, Roberto

    Here, we report a theoretical analysis showing that Rayleigh scattering could be used to monitor the growth of nanoparticles under arc discharge conditions. We compute the Rayleigh scattering cross sections of the nanoparticles by combining light scattering theory for gas-particle mixtures with calculations of the dynamic electronic polarizability of the nanoparticles. We find that the resolution of the Rayleigh scattering probe is adequate to detect nanoparticles as small as C 60 at the expected concentrations of synthesis conditions in the arc periphery. Larger asymmetric nanoparticles would yield brighter signals, making possible to follow the evolution of the growing nanoparticle populationmore » from the evolution of the scattered intensity. Observable spectral features include characteristic resonant behaviour, shape-dependent depolarization ratio, and mass-dependent line shape. Direct observation of nanoparticles in the early stages of growth with unobtrusive laser probes should give insight on the particle formation mechanisms and may lead to better-controlled synthesis protocols.« less

  1. Coherent band excitations in CePd 3: A comparison of neutron scattering and ab initio theory

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goremychkin, Eugene A.; Park, Hyowon; Osborn, Raymond

    In common with many strongly correlated electron systems, intermediate valence compounds are believed to display a crossover from a high-temperature regime of incoherently fluctuating local moments to a low-temperature regime of coherent hybridized bands. In this work, we show that inelastic neutron scattering measurements of the dynamic magnetic susceptibility of CePd 3 provides a benchmark for ab initio calculations based on dynamical mean field theory. The magnetic response is strongly momentum dependent thanks to the formation of coherent f-electron bands at low temperature, with an amplitude that is strongly enhanced by local particle-hole interactions. Finally, the agreement between experiment andmore » theory shows that we have a robust first-principles understanding of the temperature dependence of f-electron coherence.« less

  2. Materials characterisation by angle-resolved scanning transmission electron microscopy.

    PubMed

    Müller-Caspary, Knut; Oppermann, Oliver; Grieb, Tim; Krause, Florian F; Rosenauer, Andreas; Schowalter, Marco; Mehrtens, Thorsten; Beyer, Andreas; Volz, Kerstin; Potapov, Pavel

    2016-11-16

    Solid-state properties such as strain or chemical composition often leave characteristic fingerprints in the angular dependence of electron scattering. Scanning transmission electron microscopy (STEM) is dedicated to probe scattered intensity with atomic resolution, but it drastically lacks angular resolution. Here we report both a setup to exploit the explicit angular dependence of scattered intensity and applications of angle-resolved STEM to semiconductor nanostructures. Our method is applied to measure nitrogen content and specimen thickness in a GaN x As 1-x layer independently at atomic resolution by evaluating two dedicated angular intervals. We demonstrate contrast formation due to strain and composition in a Si- based metal-oxide semiconductor field effect transistor (MOSFET) with Ge x Si 1-x stressors as a function of the angles used for imaging. To shed light on the validity of current theoretical approaches this data is compared with theory, namely the Rutherford approach and contemporary multislice simulations. Inconsistency is found for the Rutherford model in the whole angular range of 16-255 mrad. Contrary, the multislice simulations are applicable for angles larger than 35 mrad whereas a significant mismatch is observed at lower angles. This limitation of established simulations is discussed particularly on the basis of inelastic scattering.

  3. Temperature Dependence of Electric Transport in Few-layer Graphene under Large Charge Doping Induced by Electrochemical Gating

    PubMed Central

    Gonnelli, R. S.; Paolucci, F.; Piatti, E.; Sharda, Kanudha; Sola, A.; Tortello, M.; Nair, Jijeesh R.; Gerbaldi, C.; Bruna, M.; Borini, S.

    2015-01-01

    The temperature dependence of electric transport properties of single-layer and few-layer graphene at large charge doping is of great interest both for the study of the scattering processes dominating the conductivity at different temperatures and in view of the theoretically predicted possibility to reach the superconducting state in such extreme conditions. Here we present the results obtained in 3-, 4- and 5-layer graphene devices down to 3.5 K, where a large surface charge density up to about 6.8·1014 cm−2 has been reached by employing a novel polymer electrolyte solution for the electrochemical gating. In contrast with recent results obtained in single-layer graphene, the temperature dependence of the sheet resistance between 20 K and 280 K shows a low-temperature dominance of a T2 component – that can be associated with electron-electron scattering – and, at about 100 K, a crossover to the classic electron-phonon regime. Unexpectedly, this crossover does not show any dependence on the induced charge density, i.e. on the large tuning of the Fermi energy. PMID:25906088

  4. Electron acceleration in combined intense laser fields and self-consistent quasistatic fields in plasma

    NASA Astrophysics Data System (ADS)

    Qiao, Bin; He, X. T.; Zhu, Shao-ping; Zheng, C. Y.

    2005-08-01

    The acceleration of plasma electron in intense laser-plasma interaction is investigated analytically and numerically, where the conjunct effect of laser fields and self-consistent spontaneous fields (including quasistatic electric field Esl, azimuthal quasistatic magnetic field Bsθ and the axial one Bsz) is completely considered for the first time. An analytical relativistic electron fluid model using test-particle method has been developed to give an explicit analysis about the effects of each quasistatic fields. The ponderomotive accelerating and scattering effects on electrons are partly offset by Esl, furthermore, Bsθ pinches and Bsz collimates electrons along the laser axis. The dependences of energy gain and scattering angle of electron on its initial radial position, plasma density, and laser intensity are, respectively, studied. The qualities of the relativistic electron beam (REB), such as energy spread, beam divergence, and emitting (scattering) angle, generated by both circularly polarized (CP) and linearly polarized (LP) lasers are studied. Results show CP laser is of clear advantage comparing to LP laser for it can generate a better REB in collimation and stabilization.

  5. Diffusive Transport of Several Hundred keV Electrons in the Earth's Slot Region

    DOE PAGES

    Ma, Q.; Li, W.; Thorne, R. M.; ...

    2017-09-29

    Here, we investigate the gradual diffusion of energetic electrons from the inner edge of the outer radiation belt into the slot region. The Van Allen Probes observed slow inward diffusion and decay of ~200–600 keV electrons following the intense geomagnetic storm that occurred on 17 March 2013. During the 10 day nondisturbed period following the storm, the peak of electron fluxes gradually moved from L ~ 2.7 to L ~ 2.4, and the flux levels decreased by a factor of ~2–4 depending on the electron energy. We simulated the radial intrusion and decay of electrons using a three–dimensional diffusion code,more » which reproduced the energy–dependent transport of electrons from ~100 keV to 1 MeV in the slot region. At energies of 100–200 keV, the electrons experience fast transport across the slot region due to the dominance of radial diffusion; at energies of 200–600 keV, the electrons gradually diffuse and decay in the slot region due to the comparable rate of radial diffusion and pitch angle scattering by plasmaspheric hiss; at energies of E > 700 keV, the electrons stopped diffusing near the inner edge of outer radiation belt due to the dominant pitch angle scattering loss. In addition to plasmaspheric hiss, magnetosonic waves and VLF transmitters can cause the loss of high pitch angle electrons, relaxing the sharp “top–hat” shaped pitch angle distributions created by plasmaspheric hiss. Our simulation indicates the importance of balance between radial diffusion and loss through pitch angle scattering in forming the diffusive intrusion of energetic electrons across the slot region.« less

  6. Stern-Gerlach-like approach to electron orbital angular momentum measurement

    DOE PAGES

    Harvey, Tyler R.; Grillo, Vincenzo; McMorran, Benjamin J.

    2017-02-28

    Many methods now exist to prepare free electrons into orbital-angular-momentum states, and the predicted applications of these electron states as probes of materials and scattering processes are numerous. The development of electron orbital-angular-momentum measurement techniques has lagged behind. We show that coupling between electron orbital angular momentum and a spatially varying magnetic field produces an angular-momentum-dependent focusing effect. We propose a design for an orbital-angular-momentum measurement device built on this principle. As the method of measurement is noninterferometric, the device works equally well for mixed, superposed, and pure final orbital-angular-momentum states. The energy and orbital-angular-momentum distributions of inelastically scattered electronsmore » may be simultaneously measurable with this technique.« less

  7. Stern-Gerlach-like approach to electron orbital angular momentum measurement

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Harvey, Tyler R.; Grillo, Vincenzo; McMorran, Benjamin J.

    Many methods now exist to prepare free electrons into orbital-angular-momentum states, and the predicted applications of these electron states as probes of materials and scattering processes are numerous. The development of electron orbital-angular-momentum measurement techniques has lagged behind. We show that coupling between electron orbital angular momentum and a spatially varying magnetic field produces an angular-momentum-dependent focusing effect. We propose a design for an orbital-angular-momentum measurement device built on this principle. As the method of measurement is noninterferometric, the device works equally well for mixed, superposed, and pure final orbital-angular-momentum states. The energy and orbital-angular-momentum distributions of inelastically scattered electronsmore » may be simultaneously measurable with this technique.« less

  8. Observation of long phase-coherence length in epitaxial La-doped CdO thin films

    NASA Astrophysics Data System (ADS)

    Yun, Yu; Ma, Yang; Tao, Songsheng; Xing, Wenyu; Chen, Yangyang; Su, Tang; Yuan, Wei; Wei, Jian; Lin, Xi; Niu, Qian; Xie, X. C.; Han, Wei

    2017-12-01

    The search for long electron phase-coherence length, which is the length that an electron can keep its quantum wavelike properties, has attracted considerable interest in the last several decades. Here, we report the long phase-coherence length of ˜3.7 μm in La-doped CdO thin films at 2 K. Systematical investigations of the La doping and the temperature dependences of the electron mobility and the electron phase-coherence length reveal contrasting scattering mechanisms for these two physical properties. Furthermore, these results show that the oxygen vacancies could be the dominant scatters in CdO thin films that break the electron phase coherence, which would shed light on further investigation of phase-coherence properties in oxide materials.

  9. Measurement of two-photon exchange effect by comparing elastic e ± p cross sections

    DOE PAGES

    Rimal, D.; Adikaram, D.; Raue, B. A.; ...

    2017-06-01

    Here, the electromagnetic form factors of the proton measured by unpolarized and polarized electron scattering experiments show a significant disagreement that grows with the squared four momentum transfer (more » $$Q^{2}$$). Calculations have shown that the two measurements can be largely reconciled by accounting for the contributions of two-photon exchange (TPE). TPE effects are not typically included in the standard set of radiative corrections since theoretical calculations of the TPE effects are highly model dependent, and, until recently, no direct evidence of significant TPE effects has been observed. We measured the ratio of positron-proton to electron-proton elastic-scattering cross sections in order to determine the TPE contribution to elastic electron-proton scattering and thereby resolve the proton electric form factor discrepancy. We produced a mixed simultaneous electron-positron beam in Jefferson Lab's Hall B by passing the 5.6 GeV primary electron beam through a radiator to produce a bremsstrahlung photon beam and then passing the photon beam through a convertor to produce electron/positron pairs. The mixed electron-positron (lepton) beam with useful energies from approximately 0.85 to 3.5 GeV then struck a 30-cm long liquid hydrogen (LH$$_2$$) target located within the CEBAF Large Acceptance Spectrometer (CLAS). By detecting both the scattered leptons and the recoiling protons we identified and reconstructed elastic scattering events and determined the incident lepton energy. A detailed description of the experiment is presented.« less

  10. A glimpse of gluons through deeply virtual compton scattering on the proton.

    PubMed

    Defurne, M; Jiménez-Argüello, A Martí; Ahmed, Z; Albataineh, H; Allada, K; Aniol, K A; Bellini, V; Benali, M; Boeglin, W; Bertin, P; Brossard, M; Camsonne, A; Canan, M; Chandavar, S; Chen, C; Chen, J-P; de Jager, C W; de Leo, R; Desnault, C; Deur, A; El Fassi, L; Ent, R; Flay, D; Friend, M; Fuchey, E; Frullani, S; Garibaldi, F; Gaskell, D; Giusa, A; Glamazdin, O; Golge, S; Gomez, J; Hansen, O; Higinbotham, D; Holmstrom, T; Horn, T; Huang, J; Huang, M; Hyde, C E; Iqbal, S; Itard, F; Kang, H; Kelleher, A; Keppel, C; Koirala, S; Korover, I; LeRose, J J; Lindgren, R; Long, E; Magne, M; Mammei, J; Margaziotis, D J; Markowitz, P; Mazouz, M; Meddi, F; Meekins, D; Michaels, R; Mihovilovic, M; Camacho, C Muñoz; Nadel-Turonski, P; Nuruzzaman, N; Paremuzyan, R; Puckett, A; Punjabi, V; Qiang, Y; Rakhman, A; Rashad, M N H; Riordan, S; Roche, J; Russo, G; Sabatié, F; Saenboonruang, K; Saha, A; Sawatzky, B; Selvy, L; Shahinyan, A; Sirca, S; Solvignon, P; Sperduto, M L; Subedi, R; Sulkosky, V; Sutera, C; Tobias, W A; Urciuoli, G M; Wang, D; Wojtsekhowski, B; Yao, H; Ye, Z; Zhan, X; Zhang, J; Zhao, B; Zhao, Z; Zheng, X; Zhu, P

    2017-11-10

    The internal structure of nucleons (protons and neutrons) remains one of the greatest outstanding problems in modern nuclear physics. By scattering high-energy electrons off a proton we are able to resolve its fundamental constituents and probe their momenta and positions. Here we investigate the dynamics of quarks and gluons inside nucleons using deeply virtual Compton scattering (DVCS)-a highly virtual photon scatters off the proton, which subsequently radiates a photon. DVCS interferes with the Bethe-Heitler (BH) process, where the photon is emitted by the electron rather than the proton. We report herein the full determination of the BH-DVCS interference by exploiting the distinct energy dependences of the DVCS and BH amplitudes. In the regime where the scattering is expected to occur off a single quark, measurements show an intriguing sensitivity to gluons, the carriers of the strong interaction.

  11. Temperature dependent behavior of thermal conductivity of sub-5 nm Ir film: Defect-electron scattering quantified by residual thermal resistivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cheng, Zhe; Xu, Zaoli; Xu, Shen

    2015-01-14

    By studying the temperature-dependent behavior (300 K down to 43 K) of electron thermal conductivity (κ) in a 3.2 nm-thin Ir film, we quantify the extremely confined defect-electron scatterings and isolate the intrinsic phonon-electron scattering that is shared by the bulk Ir. At low temperatures below 50 K, κ of the film has almost two orders of magnitude reduction from that of bulk Ir. The film has ∂κ/∂T > 0, while the bulk Ir has ∂κ/∂T < 0. We introduce a unified thermal resistivity (Θ = T/κ) to interpret these completely different κ ∼ T relations. It is found that the film and the bulk Ir share a very similar Θ ∼ T trend,more » while they have a different residual part (Θ{sub 0}) at 0 K limit: Θ{sub 0} ∼ 0 for the bulk Ir, and Θ{sub 0} = 5.5 m·K{sup 2}/W for the film. The Ir film and the bulk Ir have very close ∂Θ/∂T (75–290 K): 6.33 × 10{sup −3} m K/W for the film and 7.62 × 10{sup −3} m K/W for the bulk Ir. This strongly confirms the similar phonon-electron scattering in them. Therefore, the residual thermal resistivity provides an unprecedented way to quantitatively evaluating defect-electron scattering (Θ{sub 0}) in heat conduction. Moreover, the interfacial thermal conductance across the grain boundaries is found larger than that of Al/Cu interface, and its value is proportional to temperature, largely due to the electron's specific heat. A unified interfacial thermal conductance is also defined and firmly proves this relation. Additionally, the electron reflection coefficient is found to be large (88%) and almost temperature independent.« less

  12. Piezoelectric substrate effect on electron-acoustic phonon scattering in bilayer graphene

    NASA Astrophysics Data System (ADS)

    Ansari, Mohd Meenhaz; Ashraf, SSZ

    2018-05-01

    We have studied the effect of piezoelectric scattering as a function of electron temperature and distance between the sample and the substrate on electron-acoustic phonon scattering rate in Bilayer Graphene sitting on a piezoelectric substrate. We obtain approximate analytical result by neglecting the chiral nature of carriers and then proceed to obtain unapproximated numerical results for the scattering rate incorporating chirality of charge carriers. We find that on the incorporation of full numerical computation the magnitude as well as the power exponent both is affected with the power exponent changed from T3 to T3.31 in the low temperature range and to T6.98 dependence in the temperature range (>5K). We also find that the distance between the sample and substrate begins to strongly affect the scattering rate at temperatures above 10K. These calculation not only suggest the influencing effect of piezoelectric substrate on the transport properties of Dirac Fermions at very low temperatures but also open a channel to study low dimension structures by probing piezoelectric acoustical phonons.

  13. A Hydrodynamic Theory for Spatially Inhomogeneous Semiconductor Lasers: Microscopic Approach

    NASA Technical Reports Server (NTRS)

    Li, Jianzhong; Ning, C. Z.; Biegel, Bryan A. (Technical Monitor)

    2001-01-01

    Starting from the microscopic semiconductor Bloch equations (SBEs) including the Boltzmann transport terms in the distribution function equations for electrons and holes, we derived a closed set of diffusion equations for carrier densities and temperatures with self-consistent coupling to Maxwell's equation and to an effective optical polarization equation. The coherent many-body effects are included within the screened Hartree-Fock approximation, while scatterings are treated within the second Born approximation including both the in- and out-scatterings. Microscopic expressions for electron-hole (e-h) and carrier-LO (c-LO) phonon scatterings are directly used to derive the momentum and energy relaxation rates. These rates expressed as functions of temperatures and densities lead to microscopic expressions for self- and mutual-diffusion coefficients in the coupled density-temperature diffusion equations. Approximations for reducing the general two-component description of the electron-hole plasma (EHP) to a single-component one are discussed. In particular, we show that a special single-component reduction is possible when e-h scattering dominates over c-LO phonon scattering. The ambipolar diffusion approximation is also discussed and we show that the ambipolar diffusion coefficients are independent of e-h scattering, even though the diffusion coefficients of individual components depend sensitively on the e-h scattering rates. Our discussions lead to new perspectives into the roles played in the single-component reduction by the electron-hole correlation in momentum space induced by scatterings and the electron-hole correlation in real space via internal static electrical field. Finally, the theory is completed by coupling the diffusion equations to the lattice temperature equation and to the effective optical polarization which in turn couples to the laser field.

  14. Exciton Scattering approach for conjugated macromolecules: from electronic spectra to electron-phonon coupling

    NASA Astrophysics Data System (ADS)

    Tretiak, Sergei

    2014-03-01

    The exciton scattering (ES) technique is a multiscale approach developed for efficient calculations of excited-state electronic structure and optical spectra in low-dimensional conjugated macromolecules. Within the ES method, the electronic excitations in the molecular structure are attributed to standing waves representing quantum quasi-particles (excitons), which reside on the graph. The exciton propagation on the linear segments is characterized by the exciton dispersion, whereas the exciton scattering on the branching centers is determined by the energy-dependent scattering matrices. Using these ES energetic parameters, the excitation energies are then found by solving a set of generalized ``particle in a box'' problems on the graph that represents the molecule. All parameters can be extracted from quantum-chemical computations of small molecular fragments and tabulated in the ES library for further applications. Subsequently, spectroscopic modeling for any macrostructure within considered molecular family could be performed with negligible numerical effort. The exciton scattering properties of molecular vertices can be further described by tight-binding or equivalently lattice models. The on-site energies and hopping constants are obtained from the exciton dispersion and scattering matrices. Such tight-binding model approach is particularly useful to describe the exciton-phonon coupling, energetic disorder and incoherent energy transfer in large branched conjugated molecules. Overall the ES applications accurately reproduce the optical spectra compared to the reference quantum chemistry results, and make possible to predict spectra of complex macromolecules, where conventional electronic structure calculations are unfeasible.

  15. Incipient 2D Mott insulators in extreme high electron density, ultra-thin GdTiO3/SrTiO3/GdTiO3 quantum wells

    NASA Astrophysics Data System (ADS)

    Allen, S. James; Ouellette, Daniel G.; Moetakef, Pouya; Cain, Tyler; Chen, Ru; Balents, Leon; Stemmer, Susanne

    2013-03-01

    By reducing the number of SrO planes in a GdTiO3 /SrTiO3/ GdTiO3 quantum well heterostructure, an electron gas with ~ fixed 2D electron density can be driven close to the Mott metal insulator transition - a quantum critical point at ~1 electron per unit cell. A single interface between the Mott insulator GdTiO3 and band insulator SrTiO3 has been shown to introduce ~ 1/2 electron per interface unit cell. Two interfaces produce a quantum well with ~ 7 1014 cm-2 electrons: at the limit of a single SrO layer it may produce a 2D magnetic Mott insulator. We use temperature and frequency dependent (DC - 3eV) conductivity and temperature dependent magneto-transport to understand the relative importance of electron-electron interactions, electron-phonon interactions, and surface roughness scattering as the electron gas is compressed toward the quantum critical point. Terahertz time-domain and FTIR spectroscopies, measure the frequency dependent carrier mass and scattering rate, and the mid-IR polaron absorption as a function of quantum well thickness. At the extreme limit of a single SrO plane, we observe insulating behavior with an optical gap substantially less than that of the surrounding GdTiO3, suggesting a novel 2D Mott insulator. MURI program of the Army Research Office - Grant No. W911-NF-09-1-0398

  16. ecode - Electron Transport Algorithm Testing v. 1.0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Franke, Brian C.; Olson, Aaron J.; Bruss, Donald Eugene

    2016-10-05

    ecode is a Monte Carlo code used for testing algorithms related to electron transport. The code can read basic physics parameters, such as energy-dependent stopping powers and screening parameters. The code permits simple planar geometries of slabs or cubes. Parallelization consists of domain replication, with work distributed at the start of the calculation and statistical results gathered at the end of the calculation. Some basic routines (such as input parsing, random number generation, and statistics processing) are shared with the Integrated Tiger Series codes. A variety of algorithms for uncertainty propagation are incorporated based on the stochastic collocation and stochasticmore » Galerkin methods. These permit uncertainty only in the total and angular scattering cross sections. The code contains algorithms for simulating stochastic mixtures of two materials. The physics is approximate, ranging from mono-energetic and isotropic scattering to screened Rutherford angular scattering and Rutherford energy-loss scattering (simple electron transport models). No production of secondary particles is implemented, and no photon physics is implemented.« less

  17. Improved cross-calibration of Thomson scattering and electron cyclotron emission with ECH on DIII-D.

    PubMed

    Brookman, M W; Austin, M E; McLean, A G; Carlstrom, T N; Hyatt, A W; Lohr, J

    2016-11-01

    Thomson scattering produces n e profiles from measurement of scattered laser beam intensity. Rayleigh scattering provides a first calibration of the relation n e ∝ I TS , which depends on many factors (e.g., laser alignment and power, optics, and measurement systems). On DIII-D, the n e calibration is adjusted against an absolute n e from the density-driven cutoff of the 48 channel 2nd harmonic X-mode electron cyclotron emission system. This method has been used to calibrate Thomson n e from the edge to near the core (r/a > 0.15). Application of core electron cyclotron heating improves the quality of cutoff and depth of its penetration into the core, and also changes underlying MHD activity, minimizing crashes which confound calibration. Less fueling is needed as "ECH pump-out" generates a plasma ready to take up gas. On removal of gyrotron power, cutoff penetrates into the core as channels fall successively and smoothly into cutoff.

  18. Dark-field microscopy studies of single metal nanoparticles: understanding the factors that influence the linewidth of the localized surface plasmon resonance.

    PubMed

    Hu, Min; Novo, Carolina; Funston, Alison; Wang, Haining; Staleva, Hristina; Zou, Shengli; Mulvaney, Paul; Xia, Younan; Hartland, Gregory V

    2008-01-01

    This article provides a review of our recent Rayleigh scattering measurements on single metal nanoparticles. Two different systems will be discussed in detail: gold nanorods with lengths between 30 and 80 nm, and widths between 8 and 30 nm; and hollow gold-silver nanocubes (termed nanoboxes or nanocages depending on their exact morphology) with edge lengths between 100 and 160 nm, and wall thicknesses of the order of 10 nm. The goal of this work is to understand how the linewidth of the localized surface plasmon resonance depends on the size, shape, and environment of the nanoparticles. Specifically, the relative contributions from bulk dephasing, electron-surface scattering, and radiation damping (energy loss via coupling to the radiation field) have been determined by examining particles with different dimensions. This separation is possible because the magnitude of the radiation damping effect is proportional to the particle volume, whereas, the electron-surface scattering contribution is inversely proportional to the dimensions. For the nanorods, radiation damping is the dominant effect for thick rods (widths greater than 20 nm), while electron-surface scattering is dominant for thin rods (widths less than 10 nm). Rods with widths in between these limits have narrow resonances-approaching the value determined by the bulk contribution. For nanoboxes and nanocages, both radiation damping and electron-surface scattering are significant at all sizes. This is because these materials have thin walls, but large edge lengths and, therefore, relatively large volumes. The effect of the environment on the localized surface plasmon resonance has also been studied for nanoboxes. Increasing the dielectric constant of the surroundings causes a red-shift and an increase in the linewidth of the plasmon band. The increase in linewidth is attributed to enhanced radiation damping.

  19. Temperature dependence of Brillouin light scattering spectra of acoustic phonons in silicon

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olsson, Kevin S.; Klimovich, Nikita; An, Kyongmo

    2015-02-02

    Electrons, optical phonons, and acoustic phonons are often driven out of local equilibrium in electronic devices or during laser-material interaction processes. The need for a better understanding of such non-equilibrium transport processes has motivated the development of Raman spectroscopy as a local temperature sensor of optical phonons and intermediate frequency acoustic phonons, whereas Brillouin light scattering (BLS) has recently been explored as a temperature sensor of low-frequency acoustic phonons. Here, we report the measured BLS spectra of silicon at different temperatures. The origins of the observed temperature dependence of the BLS peak position, linewidth, and intensity are examined in ordermore » to evaluate their potential use as temperature sensors for acoustic phonons.« less

  20. Quasiparticle scattering in type-II Weyl semimetal MoTe2

    NASA Astrophysics Data System (ADS)

    Lin, Chun-Liang; Arafune, Ryuichi; Minamitani, Emi; Kawai, Maki; Takagi, Noriaki

    2018-03-01

    The electronic structure of type-II Weyl semimetal molybdenum ditelluride (MoTe2) is studied by using scanning tunneling microscopy and density functional theory calculations. Through measuring energy-dependent quasiparticle interference (QPI) patterns with a cryogenic scanning tunneling microscope, several characteristic features are found in the QPI patterns. Two of them arise from the Weyl semimetal nature; one is the topological Fermi arc surface state and the other can be assigned to be a Weyl point. The remaining structures are derived from the scatterings relevant to the bulk electronic states. The findings lead to further understanding of the topological electronic structure of type-II Weyl semimetal MoTe2.

  1. Quasiparticle scattering in type-II Weyl semimetal MoTe2.

    PubMed

    Lin, Chun-Liang; Arafune, Ryuichi; Minamitani, Emi; Kawai, Maki; Takagi, Noriaki

    2018-02-15

    The electronic structure of type-II Weyl semimetal molybdenum ditelluride (MoTe 2 ) is studied by using scanning tunneling microscopy and density functional theory calculations. Through measuring energy-dependent quasiparticle interference (QPI) patterns with a cryogenic scanning tunneling microscope, several characteristic features are found in the QPI patterns. Two of them arise from the Weyl semimetal nature; one is the topological Fermi arc surface state and the other can be assigned to be a Weyl point. The remaining structures are derived from the scatterings relevant to the bulk electronic states. The findings lead to further understanding of the topological electronic structure of type-II Weyl semimetal MoTe 2 .

  2. Mapping momentum-dependent electron-phonon coupling and nonequilibrium phonon dynamics with ultrafast electron diffuse scattering

    NASA Astrophysics Data System (ADS)

    Stern, Mark J.; René de Cotret, Laurent P.; Otto, Martin R.; Chatelain, Robert P.; Boisvert, Jean-Philippe; Sutton, Mark; Siwick, Bradley J.

    2018-04-01

    Despite their fundamental role in determining material properties, detailed momentum-dependent information on the strength of electron-phonon and phonon-phonon coupling (EPC and PPC, respectively) across the entire Brillouin zone has remained elusive. Here we demonstrate that ultrafast electron diffuse scattering (UEDS) directly provides such information. By exploiting symmetry-based selection rules and time resolution, scattering from different phonon branches can be distinguished even without energy resolution. Using graphite as a model system, we show that UEDS patterns map the relative EPC and PPC strength through their profound sensitivity to photoinduced changes in phonon populations. We measure strong EPC to the K -point TO phonon of A1' symmetry (K -A1' ) and along the entire TO branch between Γ -K , not only to the Γ -E2 g phonon. We also determine that the subsequent phonon relaxation of these strongly coupled optical phonons involve three stages: decay via several identifiable channels to TA and LA phonons (1 -2 ps), intraband thermalization of the non-equilibrium TA/LA phonon populations (30 -40 ps) and interband relaxation of the TA/LA modes (115 ps). Combining UEDS with ultrafast angle-resolved photoelectron spectroscopy will yield a complete picture of the dynamics within and between electron and phonon subsystems, helping to unravel complex phases in which the intertwined nature of these systems has a strong influence on emergent properties.

  3. Validations of calibration-free measurements of electron temperature using double-pass Thomson scattering diagnostics from theoretical and experimental aspects.

    PubMed

    Tojo, H; Yamada, I; Yasuhara, R; Ejiri, A; Hiratsuka, J; Togashi, H; Yatsuka, E; Hatae, T; Funaba, H; Hayashi, H; Takase, Y; Itami, K

    2016-09-01

    This paper evaluates the accuracy of electron temperature measurements and relative transmissivities of double-pass Thomson scattering diagnostics. The electron temperature (T e ) is obtained from the ratio of signals from a double-pass scattering system, then relative transmissivities are calculated from the measured T e and intensity of the signals. How accurate the values are depends on the electron temperature (T e ) and scattering angle (θ), and therefore the accuracy of the values was evaluated experimentally using the Large Helical Device (LHD) and the Tokyo spherical tokamak-2 (TST-2). Analyzing the data from the TST-2 indicates that a high T e and a large scattering angle (θ) yield accurate values. Indeed, the errors for scattering angle θ = 135° are approximately half of those for θ = 115°. The method of determining the T e in a wide T e range spanning over two orders of magnitude (0.01-1.5 keV) was validated using the experimental results of the LHD and TST-2. A simple method to provide relative transmissivities, which include inputs from collection optics, vacuum window, optical fibers, and polychromators, is also presented. The relative errors were less than approximately 10%. Numerical simulations also indicate that the T e measurements are valid under harsh radiation conditions. This method to obtain T e can be considered for the design of Thomson scattering systems where there is high-performance plasma that generates harsh radiation environments.

  4. Implementation of a method for calculating temperature-dependent resistivities in the KKR formalism

    NASA Astrophysics Data System (ADS)

    Mahr, Carsten E.; Czerner, Michael; Heiliger, Christian

    2017-10-01

    We present a method to calculate the electron-phonon induced resistivity of metals in scattering-time approximation based on the nonequilibrium Green's function formalism. The general theory as well as its implementation in a density-functional theory based Korringa-Kohn-Rostoker code are described and subsequently verified by studying copper as a test system. We model the thermal expansion by fitting a Debye-Grüneisen curve to experimental data. Both the electronic and vibrational structures are discussed for different temperatures, and employing a Wannier interpolation of these quantities we evaluate the scattering time by integrating the electron linewidth on a triangulation of the Fermi surface. Based thereupon, the temperature-dependent resistivity is calculated and found to be in good agreement with experiment. We show that the effect of thermal expansion has to be considered in the whole calculation regime. Further, for low temperatures, an accurate sampling of the Fermi surface becomes important.

  5. Dependence of Whistler-mode Wave Induced Electron Precipitation on k-vector Direction.

    NASA Astrophysics Data System (ADS)

    Kulkarni, P.; Inan, U. S.; Bell, T. F.; Bortnik, J.

    2007-12-01

    Whistler-mode waves that are either spontaneously generated in-situ (i.e., chorus), or externally injected (lightning, VLF transmitters) are known to be responsible for the loss of radiation belt electrons. An important determinant in the quantification of this loss is the dependence of the cyclotron resonant pitch angle scattering on the initial wave normal angles of the driving waves. Inan et al. (U.S. Inan et al., Controlled precipitation of radiation belt electrons, Journal of Geophysical Research-Space Physics, 108 (A5), 1186, doi: 10.1029/2002JA009580, 2003.) suggested that the lifetime of > 1 MeV electrons in the inner radiation belts might be moderated by in situ injection of VLF whistler mode waves at frequencies of a few kHz. The formulation of Wang and Bell (T.N.C. Wang and T.F. Bell, Radiation resisitance of a short dipole immersed in a cold magnetoionic medium, Radio Science, 4(2), 167-177, February 1969) for an electric dipole antenna located in the inner magnetosphere established that most of the radiated power is concentrated in waves whose wave normal angles lie near the local resonance cone. Such waves, compared to those injected at less oblique initial wave normal angles, undergo several more magnetospheric reflections, persist in the magnetospheric cavity for longer periods of time, and resonate with electrons of higher energies. Accordingly, such waves may be highly effective in contributing to the loss of electrons from the inner belt and slot regions [Inan et al., 2006]. Nevertheless, it has been noted (Inan et al. [2006], Inan and Bell [1991] and Albert [1999]) that > 1 MeV electrons may not be effectively scattered by waves propagating with very high wave normal angles, due to the generally reduced gyroresonant diffusion coefficients for wave normals near the resonance cone. We use the Stanford 2D VLF raytracing program to determine the energetic electron pitch angle scattering and the precipitated flux signatures that would be detected for a range of initial wave normal angles. We conclude that whistler-mode waves with highly oblique wave normal angles may be more effective than previously believed at precipitating > 1 MeV electrons, despite the dependence of the scattering coefficients on wave normal direction.

  6. Collisional damping rates for electron plasma waves reassessed

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Banks, J. W.; Brunner, S.; Berger, R. L.

    Collisional damping of electron plasma waves, the primary damping for high phase velocity waves, is proportional to the electron-ion collision rate, ν ei,th. Here in this work, it is shown that the damping rate normalized to ν ei,th depends on the charge state, Z, on the magnitude of ν ei,th and the wave number k in contrast with the commonly used damping rate in plasma wave research. Only for weak collision rates in low-Z plasmas for which the electron self-collision rate is comparable to the electron-ion collision rate is the damping rate given by the commonly accepted value. The resultmore » presented here corrects the result presented in textbooks at least as early as 1973. Lastly, the complete linear theory requires the inclusion of both electron-ion pitch-angle and electron-electron scattering, which itself contains contributions to both pitch-angle scattering and thermalization.« less

  7. Collisional damping rates for electron plasma waves reassessed

    DOE PAGES

    Banks, J. W.; Brunner, S.; Berger, R. L.; ...

    2017-10-13

    Collisional damping of electron plasma waves, the primary damping for high phase velocity waves, is proportional to the electron-ion collision rate, ν ei,th. Here in this work, it is shown that the damping rate normalized to ν ei,th depends on the charge state, Z, on the magnitude of ν ei,th and the wave number k in contrast with the commonly used damping rate in plasma wave research. Only for weak collision rates in low-Z plasmas for which the electron self-collision rate is comparable to the electron-ion collision rate is the damping rate given by the commonly accepted value. The resultmore » presented here corrects the result presented in textbooks at least as early as 1973. Lastly, the complete linear theory requires the inclusion of both electron-ion pitch-angle and electron-electron scattering, which itself contains contributions to both pitch-angle scattering and thermalization.« less

  8. Experimental Study of Electron and Phonon Dynamics in Nanoscale Materials by Ultrafast Laser Time-Domain Spectroscopy

    NASA Astrophysics Data System (ADS)

    Shen, Xiaohan

    With the rapid advances in the development of nanotechnology, nowadays, the sizes of elementary unit, i.e. transistor, of micro- and nanoelectronic devices are well deep into nanoscale. For the pursuit of cheaper and faster nanoscale electronic devices, the size of transistors keeps scaling down. As the miniaturization of the nanoelectronic devices, the electrical resistivity increases dramatically, resulting rapid growth in the heat generation. The heat generation and limited thermal dissipation in nanoscale materials have become a critical problem in the development of the next generation nanoelectronic devices. Copper (Cu) is widely used conducting material in nanoelectronic devices, and the electron-phonon scattering is the dominant contributor to the resistivity in Cu nanowires at room temperature. Meanwhile, phonons are the main carriers of heat in insulators, intrinsic and lightly doped semiconductors. The thermal transport is an ensemble of phonon transport, which strongly depends on the phonon frequency. In addition, the phonon transport in nanoscale materials can behave fundamentally different than in bulk materials, because of the spatial confinement. However, the size effect on electron-phonon scattering and frequency dependent phonon transport in nanoscale materials remain largely unexplored, due to the lack of suitable experimental techniques. This thesis is mainly focusing on the study of carrier dynamics and acoustic phonon transport in nanoscale materials. The weak photothermal interaction in Cu makes thermoreflectance measurement difficult, we rather measured the reflectivity change of Cu induced by absorption variation. We have developed a method to separately measure the processes of electron-electron scattering and electron-phonon scattering in epitaxial Cu films by monitoring the transient reflectivity signal using the resonant probe with particular wavelengths. The enhancement on electron-phonon scattering in epitaxial Cu films with thickness less than 100 nm was observed. The longitudinal acoustic phonon transport in silicon (Si) nanorod with confined diameter and length was investigated. The guided phonon modes in Si nanorod with different frequencies and wave vectors were observed. The mean-free-path of the guided phonons in Si nanorod was found to be larger than the effective phonon mean-free-path in Si film, because of the limited phonon scattering channels in Si nanorod. The phonon density of states and dispersion relation strongly depend on the size and boundary conditions of nanorod. Our work demonstrates the possibility of modifying the phonon transport properties in nanoscale materials by designing the size and boundary conditions, hence the control of thermal conductivity. In addition, the periodicity effect of nanostructures on acoustic phonon transport was investigated in silicon dioxide (SiO2) nanorod arrays. The lattice modes and mechanical eigenmodes were observed, and the pitch effect on lattice modes was discussed. A narrowband acoustic phonon spectroscopic technique with tunable frequency and spectral width throughout GHz frequency range has been developed to investigate the frequency-dependent acoustic phonon transport in nanoscale materials. The quadratic frequency dependence of acoustic attenuation of SiO2 and indium tin oxide (ITO) thin films was observed, and the acoustic attenuation of ITO was found to be larger than SiO2. Moreover, the acoustic control on mechanical resonance of nanoscale materials using the narrowband acoustic phonon source was demonstrated in tungsten thin film.

  9. Investigating Whistler Mode Wave Diffusion Coefficients at Mars

    NASA Astrophysics Data System (ADS)

    Shane, A. D.; Liemohn, M. W.; Xu, S.; Florie, C.

    2017-12-01

    Observations of electron pitch angle distributions have suggested collisions are not the only pitch angle scattering process occurring in the Martian ionosphere. This unknown scattering process is causing high energy electrons (>100 eV) to become isotropized. Whistler mode waves are one pitch angle scattering mechanism known to preferentially scatter high energy electrons in certain plasma regimes. The distribution of whistler mode wave diffusion coefficients are dependent on the background magnetic field strength and thermal electron density, as well as the frequency and wave normal angle of the wave. We have solved for the whistler mode wave diffusion coefficients using the quasi-linear diffusion equations and have integrated them into a superthermal electron transport (STET) model. Preliminary runs have produced results that qualitatively match the observed electron pitch angle distributions at Mars. We performed parametric sweeps over magnetic field, thermal electron density, wave frequency, and wave normal angle to understand the relationship between the plasma parameters and the diffusion coefficient distributions, but also to investigate what regimes whistler mode waves scatter only high energy electrons. Increasing the magnetic field strength and lowering the thermal electron density shifts the distribution of diffusion coefficients toward higher energies and lower pitch angles. We have created an algorithm to identify Mars Atmosphere Volatile and EvolutioN (MAVEN) observations of high energy isotropic pitch angle distributions in the Martian ionosphere. We are able to map these distributions at Mars, and compare the conditions under which these are observed at Mars with the results of our parametric sweeps. Lastly, we will also look at each term in the kinetic diffusion equation to determine if the energy and mixed diffusion coefficients are important enough to incorporate into STET as well.

  10. Impact of finite temperatures on the transport properties of Gd from first principles

    NASA Astrophysics Data System (ADS)

    Chadova, K.; Mankovsky, S.; Minár, J.; Ebert, H.

    2017-03-01

    Finite-temperature effects have a pronounced impact on the transport properties of solids. In magnetic systems, besides the scattering of conduction electrons by impurities and phonons, an additional scattering source coming from the magnetic degrees of freedom must be taken into account. A first-principle scheme which treats all these scattering effects on equal footing was recently suggested within the framework of the multiple scattering formalism. Employing the alloy analogy model treated by means of the CPA, thermal lattice vibrations and spin fluctuations are effectively taken into account. In the present work the temperature dependence of the longitudinal resistivity and the anomalous Hall effect in the strongly correlated metal Gd is considered. The comparison with experiments demonstrates that the proposed numerical scheme does provide an adequate description of the electronic transport at finite temperatures.

  11. Raman scattering in the Mott insulators LaTiO3 and YTiO3: evidence for orbital excitations.

    PubMed

    Ulrich, C; Gössling, A; Grüninger, M; Guennou, M; Roth, H; Cwik, M; Lorenz, T; Khaliullin, G; Keimer, B

    2006-10-13

    Raman scattering is used to observe pronounced electronic excitations around 230 meV--well above the two-phonon range--in the Mott insulators LaTiO3 and YTiO3. Based on the temperature, polarization, and photon energy dependence, the modes are identified as orbital excitations. The observed profiles bear a striking resemblance to magnetic Raman modes in the insulating parent compounds of the superconducting cuprates, indicating an unanticipated universality of the electronic excitations in transition metal oxides.

  12. Sensing the temperature influence on plasmonic field of metal nanoparticles by photoluminescence of fullerene C{sub 60} in layered C{sub 60}/Au system

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yeshchenko, Oleg A., E-mail: yes@univ.kiev.ua; Bondarchuk, Illya S.; Kozachenko, Viktor V.

    2015-04-21

    Influence of temperature on the plasmonic field in the temperature range of 78–278 K was studied employing surface plasmon enhanced photoluminescence from the fullerene C{sub 60} thin film deposited on 2D array of Au nanoparticles. It was experimentally found that temperature dependence of plasmonic enhancement factor of C{sub 60} luminescence decreases monotonically with the temperature increase. Influence of temperature on plasmonic enhancement factor was found to be considerably stronger when the frequency of surface plasmon absorption band of Au nanoparticles and the frequency of fullerene luminescence band are in resonance. Electron-phonon scattering and thermal expansion of Au nanoparticles were considered asmore » two competing physical mechanisms of the temperature dependence of plasmonic field magnitude. The calculations revealed significant prevalence of the electron-phonon scattering. The temperature induced increase in the scattering rate leads to higher plasmon damping that causes the decrease in the magnitude of plasmonic field.« less

  13. Temperature-driven topological transition in 1T'-MoTe2

    NASA Astrophysics Data System (ADS)

    Berger, Ayelet Notis; Andrade, Erick; Kerelsky, Alexander; Edelberg, Drew; Li, Jian; Wang, Zhijun; Zhang, Lunyong; Kim, Jaewook; Zaki, Nader; Avila, Jose; Chen, Chaoyu; Asensio, Maria C.; Cheong, Sang-Wook; Bernevig, Bogdan A.; Pasupathy, Abhay N.

    2018-01-01

    The topology of Weyl semimetals requires the existence of unique surface states. Surface states have been visualized in spectroscopy measurements, but their connection to the topological character of the material remains largely unexplored. 1T'-MoTe2, presents a unique opportunity to study this connection. This material undergoes a phase transition at 240 K that changes the structure from orthorhombic (putative Weyl semimetal) to monoclinic (trivial metal), while largely maintaining its bulk electronic structure. Here, we show from temperature-dependent quasiparticle interference measurements that this structural transition also acts as a topological switch for surface states in 1T'-MoTe2. At low temperature, we observe strong quasiparticle scattering, consistent with theoretical predictions and photoemission measurements for the surface states in this material. In contrast, measurements performed at room temperature show the complete absence of the scattering wavevectors associated with the trivial surface states. These distinct quasiparticle scattering behaviors show that 1T'-MoTe2 is ideal for separating topological and trivial electronic phenomena via temperature-dependent measurements.

  14. Average-atom treatment of relaxation time in x-ray Thomson scattering from warm dense matter.

    PubMed

    Johnson, W R; Nilsen, J

    2016-03-01

    The influence of finite relaxation times on Thomson scattering from warm dense plasmas is examined within the framework of the average-atom approximation. Presently most calculations use the collision-free Lindhard dielectric function to evaluate the free-electron contribution to the Thomson cross section. In this work, we use the Mermin dielectric function, which includes relaxation time explicitly. The relaxation time is evaluated by treating the average atom as an impurity in a uniform electron gas and depends critically on the transport cross section. The calculated relaxation rates agree well with values inferred from the Ziman formula for the static conductivity and also with rates inferred from a fit to the frequency-dependent conductivity. Transport cross sections determined by the phase-shift analysis in the average-atom potential are compared with those evaluated in the commonly used Born approximation. The Born approximation converges to the exact cross sections at high energies; however, differences that occur at low energies lead to corresponding differences in relaxation rates. The relative importance of including relaxation time when modeling x-ray Thomson scattering spectra is examined by comparing calculations of the free-electron dynamic structure function for Thomson scattering using Lindhard and Mermin dielectric functions. Applications are given to warm dense Be plasmas, with temperatures ranging from 2 to 32 eV and densities ranging from 2 to 64 g/cc.

  15. Average-atom treatment of relaxation time in x-ray Thomson scattering from warm dense matter

    DOE PAGES

    Johnson, W. R.; Nilsen, J.

    2016-03-14

    Here, the influence of finite relaxation times on Thomson scattering from warm dense plasmas is examined within the framework of the average-atom approximation. Presently most calculations use the collision-free Lindhard dielectric function to evaluate the free-electron contribution to the Thomson cross section. In this work, we use the Mermin dielectric function, which includes relaxation time explicitly. The relaxation time is evaluated by treating the average atom as an impurity in a uniform electron gas and depends critically on the transport cross section. The calculated relaxation rates agree well with values inferred from the Ziman formula for the static conductivity andmore » also with rates inferred from a fit to the frequency-dependent conductivity. Transport cross sections determined by the phase-shift analysis in the average-atom potential are compared with those evaluated in the commonly used Born approximation. The Born approximation converges to the exact cross sections at high energies; however, differences that occur at low energies lead to corresponding differences in relaxation rates. The relative importance of including relaxation time when modeling x-ray Thomson scattering spectra is examined by comparing calculations of the free-electron dynamic structure function for Thomson scattering using Lindhard and Mermin dielectric functions. Applications are given to warm dense Be plasmas, with temperatures ranging from 2 to 32 eV and densities ranging from 2 to 64 g/cc.« less

  16. Energy-weighted dynamical scattering simulations of electron diffraction modalities in the scanning electron microscope.

    PubMed

    Pascal, Elena; Singh, Saransh; Callahan, Patrick G; Hourahine, Ben; Trager-Cowan, Carol; Graef, Marc De

    2018-04-01

    Transmission Kikuchi diffraction (TKD) has been gaining momentum as a high resolution alternative to electron back-scattered diffraction (EBSD), adding to the existing electron diffraction modalities in the scanning electron microscope (SEM). The image simulation of any of these measurement techniques requires an energy dependent diffraction model for which, in turn, knowledge of electron energies and diffraction distances distributions is required. We identify the sample-detector geometry and the effect of inelastic events on the diffracting electron beam as the important factors to be considered when predicting these distributions. However, tractable models taking into account inelastic scattering explicitly are lacking. In this study, we expand the Monte Carlo (MC) energy-weighting dynamical simulations models used for EBSD [1] and ECP [2] to the TKD case. We show that the foil thickness in TKD can be used as a means of energy filtering and compare band sharpness in the different modalities. The current model is shown to correctly predict TKD patterns and, through the dictionary indexing approach, to produce higher quality indexed TKD maps than conventional Hough transform approach, especially close to grain boundaries. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

  17. Influence of the angular scattering of electrons on the runaway threshold in air

    NASA Astrophysics Data System (ADS)

    Chanrion, O.; Bonaventura, Z.; Bourdon, A.; Neubert, T.

    2016-04-01

    The runaway electron mechanism is of great importance for the understanding of the generation of x- and gamma rays in atmospheric discharges. In 1991, terrestrial gamma-ray flashes (TGFs) were discovered by the Compton Gamma-Ray Observatory. Those emissions are bremsstrahlung from high energy electrons that run away in electric fields associated with thunderstorms. In this paper, we discuss the runaway threshold definition with a particular interest in the influence of the angular scattering for electron energy close to the threshold. In order to understand the mechanism of runaway, we compare the outcome of different Fokker-Planck and Monte Carlo models with increasing complexity in the description of the scattering. The results show that the inclusion of the stochastic nature of collisions smooths the probability to run away around the threshold. Furthermore, we observe that a significant number of electrons diffuse out of the runaway regime when we take into account the diffusion in angle due to the scattering. Those results suggest using a runaway threshold energy based on the Fokker-Planck model assuming the angular equilibrium that is 1.6 to 1.8 times higher than the one proposed by [1, 2], depending on the magnitude of the ambient electric field. The threshold also is found to be 5 to 26 times higher than the one assuming forward scattering. We give a fitted formula for the threshold field valid over a large range of electric fields. Furthermore, we have shown that the assumption of forward scattering is not valid below 1 MeV where the runaway threshold usually is defined. These results are important for the thermal runaway and the runaway electron avalanche discharge mechanisms suggested to participate in the TGF generation.

  18. Electron mobility in the inversion layers of fully depleted SOI films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zaitseva, E. G., E-mail: ZaytsevaElza@yandex.ru; Naumova, O. V.; Fomin, B. I.

    The dependences of the electron mobility μ{sub eff} in the inversion layers of fully depleted double–gate silicon-on-insulator (SOI) metal–oxide–semiconductor (MOS) transistors on the density N{sub e} of induced charge carriers and temperature T are investigated at different states of the SOI film (inversion–accumulation) from the side of one of the gates. It is shown that at a high density of induced charge carriers of N{sub e} > 6 × 10{sup 12} cm{sup –2} the μeff(T) dependences allow the components of mobility μ{sub eff} that are related to scattering at surface phonons and from the film/insulator surface roughness to be distinguished.more » The μ{sub eff}(N{sub e}) dependences can be approximated by the power functions μ{sub eff}(N{sub e}) ∝ N{sub e}{sup −n}. The exponents n in the dependences and the dominant mechanisms of scattering of electrons induced near the interface between the SOI film and buried oxide are determined for different N{sub e} ranges and film states from the surface side.« less

  19. Interstellar scattering of the Vela pulsar

    NASA Technical Reports Server (NTRS)

    Backer, D. C.

    1974-01-01

    The frequency dependence of the parameters of interstellar scattering between 837 and 8085 MHz for the Vela pulsar are consistent with thin-screen models of strong scattering. The magnitudes of the parameters indicate an anomalous turbulence along the path when they are compared with results for other pulsars with comparable column densities of free electrons in the line of sight. This anomaly is due presumably to the Gum Nebula. The decorrelation frequency, appropriately defined, is related to the pulse broadening time by 2 pi as predicted theoretically.

  20. PEPSI — a Monte Carlo generator for polarized leptoproduction

    NASA Astrophysics Data System (ADS)

    Mankiewicz, L.; Schäfer, A.; Veltri, M.

    1992-09-01

    We describe PEPSI (Polarized Electron Proton Scattering Interactions), a Monte Carlo program for polarized deep inelastic leptoproduction mediated by electromagnetic interaction, and explain how to use it. The code is a modification of the LEPTO 4.3 Lund Monte Carlo for unpolarized scattering. The hard virtual gamma-parton scattering is generated according to the polarization-dependent QCD cross-section of the first order in α S. PEPSI requires the standard polarization-independent JETSET routines to simulate the fragmentation into final hadrons.

  1. Spin decoherence of InAs surface electrons by transition metal ions

    NASA Astrophysics Data System (ADS)

    Zhang, Yao; Soghomonian, V.; Heremans, J. J.

    2018-04-01

    Spin interactions between a two-dimensional electron system at the InAs surface and transition metal ions, Fe3 +, Co2 +, and Ni2 +, deposited on the InAs surface, are probed by antilocalization measurements. The spin-dependent quantum interference phenomena underlying the quantum transport phenomenon of antilocalization render the technique sensitive to the spin states of the transition metal ions on the surface. The experiments yield data on the magnitude and temperature dependence of the electrons' inelastic scattering rates, spin-orbit scattering rates, and magnetic spin-flip rates as influenced by Fe3 +, Co2 +, and Ni2 +. A high magnetic spin-flip rate is shown to mask the effects of spin-orbit interaction, while the spin-flip rate is shown to scale with the effective magnetic moment of the surface species. The spin-flip rates and their dependence on temperature yield information about the spin states of the transition metal ions at the surface, and in the case of Co2 + suggest either a spin transition or formation of a spin-glass system.

  2. Bend-imitating models of abruptly bent electron waveguides

    NASA Astrophysics Data System (ADS)

    Vakhnenko, Oleksiy O.

    2011-07-01

    The fundamentals of bend-imitating approach regarding the one-electron quantum mechanics in abruptly bent ideal electron waveguides are given. In general, the theory allows to model each particular circularlike bend of a continuous quantum wire as some effective multichannel scatterer being pointlike in longitudinal direction. Its scattering ability is determined by the bending angle, mean bending radius, lateral coordinate (or coordinates) in wire cross section, time (or electronic energy), and possibly by the applied magnetic field. In an equivalent formulation, the theory gives rise to rather simple matching rules for the electron wave function and its longitudinal derivative affecting only the straight parts of a wire and thereby permitting to bypass a detailed quantum mechanical consideration of elbow domains. The proposed technique is applicable for the analytical investigation of spectral and transport electronic properties related to the ideal abruptly bent 3D wirelike structures of fixed cross section and is adaptable to the 2D wirelike structures as well as to the wirelike structures subjected to the magnetic field perpendicular to the plane of wire bending. In the framework of bend-imitating approach, the investigation of electron scattering in a singly bent 2D quantum wire and a doubly bent 2D quantum wire with S-like bend has been made and the explicit dependences of transmission and reflection coefficients on geometrical parameters of respective structure as well as on electron energy have been obtained. The total suppression of mixing between the scattering channels of S-like bent quantum wire is predicted.

  3. Electron radiography

    DOEpatents

    Merrill, Frank E.; Morris, Christopher

    2005-05-17

    A system capable of performing radiography using a beam of electrons. Diffuser means receive a beam of electrons and diffuse the electrons before they enter first matching quadrupoles where the diffused electrons are focused prior to the diffused electrons entering an object. First imaging quadrupoles receive the focused diffused electrons after the focused diffused electrons have been scattered by the object for focusing the scattered electrons. Collimator means receive the scattered electrons and remove scattered electrons that have scattered to large angles. Second imaging quadrupoles receive the collimated scattered electrons and refocus the collimated scattered electrons and map the focused collimated scattered electrons to transverse locations on an image plane representative of the electrons' positions in the object.

  4. Determination of the charge radii of several light nuclei from precision, high-energy electron elastic scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kabir, Al Amin

    2015-12-01

    Analysis of high-energy electron scattering has been used to determine the charge radii of nuclei for several decades. Recent analysis of the Lamb shift in muonic hydrogen found an r.m.s. radius significantly different than the electron scattering result. To understand this puzzle we have analyzed the "LEDEX" data for the (e, e'p) reaction. This experiment includes measurements on several light nuclei, hydrogen, deuterium, lithium, boron, and carbon. To test our ability to measure absolute cross sections, as well as our ability to extract the charge radius, we tested our technique against the extremely well-measured carbon case and found excellent agreementmore » using the Fourier-Bessel parametrization. We then extended the procedure to boron and lithium, which show nice agreement with the latest theoretical calculations. For hydrogen, we see clearly the limits of this technique and therefore, the charge radius is determined from the traditional extrapolation to q 2 = 0. We will show that there is a model dependence in extracting the charge radius of hydrogen and its unambiguous determination is very difficult with available electron-scattering measurements.« less

  5. Experimental evidence for importance of Hund's exchange interaction for incoherence of charge carriers in iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Fink, J.; Rienks, E. D. L.; Thirupathaiah, S.; Nayak, J.; van Roekeghem, A.; Biermann, S.; Wolf, T.; Adelmann, P.; Jeevan, H. S.; Gegenwart, P.; Wurmehl, S.; Felser, C.; Büchner, B.

    2017-04-01

    Angle-resolved photoemission spectroscopy is used to study the scattering rates of charge carriers from the hole pockets near Γ in the iron-based high-Tc hole-doped superconductors KxBa1 -xFe2As2 , x =0.4 , and KxEu1 -xFe2As2 , x =0.55 , and the electron-doped compound Ba (Fe1-xCox) 2As2 , x =0.075 . The scattering rate for any given band is found to depend linearly on the energy, indicating a non-Fermi-liquid regime. The scattering rates in the hole-doped compound are considerably higher than those in the electron-doped compounds. In the hole-doped systems the scattering rate of the charge carriers of the inner hole pocket is about three times higher than the binding energy, indicating that the spectral weight is heavily incoherent. The strength of the scattering rates and the difference between electron- and hole-doped compounds signals the importance of Hund's exchange coupling for correlation effects in these iron-based high-Tc superconductors. The experimental results are in qualitative agreement with theoretical calculations in the framework of combined density functional dynamical mean-field theory.

  6. Signals of strong electronic correlation in ion scattering processes

    NASA Astrophysics Data System (ADS)

    Bonetto, F.; Gonzalez, C.; Goldberg, E. C.

    2016-05-01

    Previous measurements of neutral atom fractions for S r+ scattered by gold polycrystalline surfaces show a singular dependence with the target temperature. There is still not a theoretical model that can properly describe the magnitude and the temperature dependence of the neutralization probabilities found. Here, we applied a first-principles quantum-mechanical theoretical formalism to describe the time-dependent scattering process. Three different electronic correlation approaches consistent with the system analyzed are used: (i) the spinless approach, where two charge channels are considered (S r0 and S r+ ) and the spin degeneration is neglected; (ii) the infinite-U approach, with the same charge channels (S r0 and S r+ ) but considering the spin degeneration; and (iii) the finite-U approach, where the first ionization and second ionization energy levels are considered very, but finitely, separated. Neutral fraction magnitudes and temperature dependence are better described by the finite-U approach, indicating that e -correlation plays a significant role in charge-transfer processes. However, none of them is able to explain the nonmonotonous temperature dependence experimentally obtained. Here, we suggest that small changes in the surface work function introduced by the target heating, and possibly not detected by experimental standard methods, could be responsible for that singular behavior. Additionally, we apply the same theoretical model using the infinite-U approximation for the Mg-Au system, obtaining an excellent description of the experimental neutral fractions measured.

  7. The effect of a hot, spherical scattering cloud on quasi-periodic oscillation behavior

    NASA Astrophysics Data System (ADS)

    Bussard, R. W.; Weisskopf, M. C.; Elsner, R. F.; Shibazaki, N.

    1988-04-01

    A Monte Carlo technique is used to investigate the effects of a hot electron scattering cloud surrounding a time-dependent X-ray source. Results are presented for the time-averaged emergent energy spectra and the mean residence time in the cloud as a function of energy. Moreover, after Fourier transforming the scattering Green's function, it is shown how the cloud affects both the observed power spectrum of a time-dependent source and the cross spectrum (Fourier transform of a cross correlation between energy bands). It is found that the power spectra intrinsic to the source are related to those observed by a relatively simple frequency-dependent multiplicative factor (a transmission function). The cloud can severely attenuate high frequencies in the power spectra, depending on optical depth, and, at lower frequencies, the transmission function has roughly a Lorentzian shape. It is also found that if the intrinsic energy spectrum is constant in time, the phase of the cross spectrum is determined entirely by scattering. Finally, the implications of the results for studies of the X-ray quasi-periodic oscillators are discussed.

  8. Carrier density independent scattering rate in SrTiO₃-based electron liquids

    DOE PAGES

    Mikheev, Evgeny; Raghavan, Santosh; Zhang, Jack Y.; ...

    2016-02-10

    We examine the carrier density dependence of the scattering rate in two- and three-dimensional electron liquids in SrTiO 3 in the regime where it scales with T n (T is the temperature and n ≤ 2) in the cases when it is varied by electrostatic control and chemical doping, respectively. It is shown that the scattering rate is independent of the carrier density. This is contrary to the expectations from Landau Fermi liquid theory, where the scattering rate scales inversely with the Fermi energy (E F). We discuss that the behavior is very similar to systems traditionally identified as non-Fermimore » liquids (n < 2). This includes the cuprates and other transition metal oxide perovskites, where strikingly similar density independent scattering rates have been observed. Ultimately, the results indicate that the applicability of Fermi liquid theory should be questioned for a much broader range of correlated materials and point to the need for a unified theory.« less

  9. Carrier density independent scattering rate in SrTiO3-based electron liquids

    PubMed Central

    Mikheev, Evgeny; Raghavan, Santosh; Zhang, Jack Y.; Marshall, Patrick B.; Kajdos, Adam P.; Balents, Leon; Stemmer, Susanne

    2016-01-01

    We examine the carrier density dependence of the scattering rate in two- and three-dimensional electron liquids in SrTiO3 in the regime where it scales with Tn (T is the temperature and n ≤ 2) in the cases when it is varied by electrostatic control and chemical doping, respectively. It is shown that the scattering rate is independent of the carrier density. This is contrary to the expectations from Landau Fermi liquid theory, where the scattering rate scales inversely with the Fermi energy (EF). We discuss that the behavior is very similar to systems traditionally identified as non-Fermi liquids (n < 2). This includes the cuprates and other transition metal oxide perovskites, where strikingly similar density-independent scattering rates have been observed. The results indicate that the applicability of Fermi liquid theory should be questioned for a much broader range of correlated materials and point to the need for a unified theory. PMID:26861764

  10. Validations of calibration-free measurements of electron temperature using double-pass Thomson scattering diagnostics from theoretical and experimental aspects

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tojo, H., E-mail: tojo.hiroshi@qst.go.jp; Hiratsuka, J.; Yatsuka, E.

    2016-09-15

    This paper evaluates the accuracy of electron temperature measurements and relative transmissivities of double-pass Thomson scattering diagnostics. The electron temperature (T{sub e}) is obtained from the ratio of signals from a double-pass scattering system, then relative transmissivities are calculated from the measured T{sub e} and intensity of the signals. How accurate the values are depends on the electron temperature (T{sub e}) and scattering angle (θ), and therefore the accuracy of the values was evaluated experimentally using the Large Helical Device (LHD) and the Tokyo spherical tokamak-2 (TST-2). Analyzing the data from the TST-2 indicates that a high T{sub e} andmore » a large scattering angle (θ) yield accurate values. Indeed, the errors for scattering angle θ = 135° are approximately half of those for θ = 115°. The method of determining the T{sub e} in a wide T{sub e} range spanning over two orders of magnitude (0.01–1.5 keV) was validated using the experimental results of the LHD and TST-2. A simple method to provide relative transmissivities, which include inputs from collection optics, vacuum window, optical fibers, and polychromators, is also presented. The relative errors were less than approximately 10%. Numerical simulations also indicate that the T{sub e} measurements are valid under harsh radiation conditions. This method to obtain T{sub e} can be considered for the design of Thomson scattering systems where there is high-performance plasma that generates harsh radiation environments.« less

  11. Probing mesoscopic crystals with electrons: One-step simultaneous inelastic and elastic scattering theory

    NASA Astrophysics Data System (ADS)

    Nazarov, Vladimir U.; Silkin, Vyacheslav M.; Krasovskii, Eugene E.

    2017-12-01

    Inelastic scattering of the medium-energy (˜10 -100 eV) electrons underlies the method of the high-resolution electron energy-loss spectroscopy (HREELS), which has been successfully used for decades to characterize pure and adsorbate-covered surfaces of solids. With the emergence of graphene and other quasi-two-dimensional (Q2D) crystals, HREELS could be expected to become the major experimental tool to study this class of materials. We, however, identify a critical flaw in the theoretical picture of the HREELS of Q2D crystals in the context of the inelastic scattering only ("energy-loss functions" formalism), in contrast to its justifiable use for bulk solids and surfaces. The shortcoming is the neglect of the elastic scattering, which we show is inseparable from the inelastic one, and which, affecting the spectra dramatically, must be taken into account for the meaningful interpretation of the experiment. With this motivation, using the time-dependent density functional theory for excitations, we build a theory of the simultaneous inelastic and elastic electron scattering at Q2D crystals. We apply this theory to HREELS of graphene, revealing an effect of the strongly coupled excitation of the π +σ plasmon and elastic diffraction resonances. Our results open a path to the theoretically interpretable study of the excitation processes in crystalline mesoscopic materials by means of HREELS, with its supreme resolution on the meV energy scale, which is far beyond the capacity of the now overwhelmingly used EELS in transmission electron microscopy.

  12. Coulomb scattering rates of excited states in monolayer electron-doped germanene

    NASA Astrophysics Data System (ADS)

    Shih, Po-Hsin; Chiu, Chih-Wei; Wu, Jhao-Ying; Do, Thi-Nga; Lin, Ming-Fa

    2018-05-01

    Excited conduction electrons, conduction holes, and valence holes in monolayer electron-doped germanene exhibit unusual Coulomb decay rates. The deexcitation processes are studied using the screened exchange energy. They might utilize the intraband single-particle excitations (SPEs), the interband SPEs, and the plasmon modes, depending on the quasiparticle states and the Fermi energies. The low-lying valence holes can decay through the undamped acoustic plasmon, so that they present very fast Coulomb deexcitations, nonmonotonous energy dependence, and anisotropic behavior. However, the low-energy conduction electrons and holes are similar to those in a two-dimensional electron gas. The higher-energy conduction states and the deeper-energy valence ones behave similarly in the available deexcitation channels and have a similar dependence of decay rate on the wave vector k .

  13. Improved cross-calibration of Thomson scattering and electron cyclotron emission with ECH on DIII-D

    DOE PAGES

    Brookman, M. W.; Austin, M. E.; McLean, A. G.; ...

    2016-08-08

    Thomson scattering (TS) produces n e profiles from measurement of scattered laser beam intensity. In the case of Rayleigh scattering, it provides a first calibration of the relation n e / ITS, which depends on many factors (e.g. laser alignment and power, optics, and measurement systems). On DIII-D, the n e calibration is adjusted for each laser and optic path against an absolute n e measurement from a density-driven cutoff on the 48 channel 2nd harmonic X-mode electron cyclotron emission (ECE) system. This method has been used to calibrate Thompson densities from the edge to near the core (r/a >more » 0.15). Application of core electron cyclotron heating improves the quality of cutoff and depth of its penetration into the core. ECH also changes underlying MHD activity. Furthermore, on the removal of ECH power, cutoff penetrates in from the edge to the core and channels fall successively and smoothly into cutoff. This improves the quality of the TS n e calibration while minimizing wall loading.« less

  14. Low-energy d-d excitations in MnO studied by resonant x-ray fluorescence spectroscopy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Butorin, S.M.; Guo, J.; Magnuson, M.

    1997-04-01

    Resonant soft X-ray emission spectroscopy has been demonstrated to possess interesting abilities for studies of electronic structure in various systems, such as symmetry probing, alignment and polarization dependence, sensitivity to channel interference, etc. In the present abstract the authors focus on the feasibility of resonant soft X-ray emission to probe low energy excitations by means of resonant electronic X-ray Raman scattering. Resonant X-ray emission can be regarded as an inelastic scattering process where a system in the ground state is transferred to a low excited state via a virtual core excitation. The energy closeness to a core excitation of themore » exciting radiation enhances the (generally) low probability for inelastic scattering at these wavelengths. Therefore soft X-ray emission spectroscopy (in resonant electronic Raman mode) can be used to study low energy d-d excitations in transition metal systems. The involvement of the intermediate core state allows one to use the selection rules of X-ray emission, and the appearance of the elastically scattered line in the spectra provides the reference to the ground state.« less

  15. Improved cross-calibration of Thomson scattering and electron cyclotron emission with ECH on DIII-D

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brookman, M. W., E-mail: brookmanmw@fusion.gat.com; Austin, M. E.; McLean, A. G.

    2016-11-15

    Thomson scattering produces n{sub e} profiles from measurement of scattered laser beam intensity. Rayleigh scattering provides a first calibration of the relation n{sub e} ∝ I{sub TS}, which depends on many factors (e.g., laser alignment and power, optics, and measurement systems). On DIII-D, the n{sub e} calibration is adjusted against an absolute n{sub e} from the density-driven cutoff of the 48 channel 2nd harmonic X-mode electron cyclotron emission system. This method has been used to calibrate Thomson n{sub e} from the edge to near the core (r/a > 0.15). Application of core electron cyclotron heating improves the quality of cutoffmore » and depth of its penetration into the core, and also changes underlying MHD activity, minimizing crashes which confound calibration. Less fueling is needed as “ECH pump-out” generates a plasma ready to take up gas. On removal of gyrotron power, cutoff penetrates into the core as channels fall successively and smoothly into cutoff.« less

  16. UHF Radar observations at HAARP with HF pump frequencies near electron gyro-harmonics and associated ionospheric effects

    NASA Astrophysics Data System (ADS)

    Watkins, Brenton; Fallen, Christopher; Secan, James

    Results for HF modification experiments at the HAARP facility in Alaska are presented for experiments with the HF pump frequency near third and fourth electron gyro-harmonics. A UHF diagnostic radar with range resolution of 600 m was used to determine time-dependent altitudes of scattering from plasma turbulence during heating experiments. Experiments were conducted with multiple HF frequencies stepped by 20 kHz above and below the gyro-harmonic values. During times of HF heating the HAARP facility has sufficient power to enhance large-scale ionospheric densities in the lower ionosphere (about 150-200 km altitude) and also in the topside ionosphere (above about 350 km). In the lower ionosphere, time-dependent decreases of the altitude of radar scatter result from electron density enhancements. The effects are substantially different even for relatively small frequency steps of 20 kHz. In all cases the time-varying altitude decrease of radar scatter stops about 5-10 km below the gyro-harmonic altitude that is frequency dependent; we infer that electron density enhancements stop at this altitude where the radar signals stop decreasing with altitude. Experiments with corresponding total electron content (TEC) data show that for HF interaction altitudes above about 170 km there is substantial topside electron density increases due to upward electron thermal conduction. For lower altitudes of HF interaction the majority of the thermal energy is transferred to the neutral gas and no significant topside density increases are observed. By selecting an appropriate HF frequency a little greater than the gyro-harmonic value we have demonstrated that the ionospheric response to HF heating is a self-oscillating mode where the HF interaction altitude moves up and down with a period of several minutes. If the interaction region is above about 170 km this also produces a continuously enhanced topside electron density and upward plasma flux. Experiments using an FM scan with the HF frequency increasing near the gyro-harmonic value were conducted. The FM scan rate was sufficiently slow that the electron density was approximately in an equilibrium state. For these experiments the altitude of the HF interaction follows a near straight line downward parallel to the altitude-dependent gyro-harmonic level.

  17. A method to investigate the electron scattering characteristics of ultrathin metallic films by in situ electrical resistance measurements.

    PubMed

    Trindade, I G; Fermento, R; Leitão, D; Sousa, J B

    2009-07-01

    In this article, a method to measure the electrical resistivity/conductivity of metallic thin films during layer growth on specific underlayers is described. The in situ monitoring of an underlayer electrical resistance, its change upon the incoming of new material atoms/molecules, and the growth of a new layer are presented. The method is easy to implement and allows obtaining in situ experimental curves of electrical resistivity dependence upon film thickness with a subatomic resolution, providing insight in film growth microstructure characteristics, specular/diffuse electron scattering surfaces, and optimum film thicknesses.

  18. Evidence for novel age-dependent network structures as a putative primo vascular network in the dura mater of the rat brain

    PubMed Central

    Lee, Ho-Sung; Kang, Dai-In; Yoon, Seung Zhoo; Ryu, Yeon Hee; Lee, Inhyung; Kim, Hoon-Gi; Lee, Byung-Cheon; Lee, Ki Bog

    2015-01-01

    With chromium-hematoxylin staining, we found evidence for the existence of novel age-dependent network structures in the dura mater of rat brains. Under stereomicroscopy, we noticed that chromium-hematoxylin-stained threadlike structures, which were barely observable in 1-week-old rats, were networked in specific areas of the brain, for example, the lateral lobes and the cerebella, in 4-week-old rats. In 7-week-old rats, those structures were found to have become larger and better networked. With phase contrast microscopy, we found that in 1-week-old rats, chromium-hematoxylin-stained granules were scattered in the same areas of the brain in which the network structures would later be observed in the 4- and 7-week-old rats. Such age-dependent network structures were examined by using optical and transmission electron microscopy, and the following results were obtained. The scattered granules fused into networks with increasing age. Cross-sections of the age-dependent network structures demonstrated heavily-stained basophilic substructures. Transmission electron microscopy revealed the basophilic substructures to be clusters with high electron densities consisting of nanosized particles. We report these data as evidence for the existence of age-dependent network structures in the dura mater, we discuss their putative functions of age-dependent network structures beyond the general concept of the dura mater as a supporting matrix. PMID:26330833

  19. A Static and Dynamic Investigation of Quantum Nonlinear Transport in Highly Dense and Mobile 2D Electron Systems

    NASA Astrophysics Data System (ADS)

    Dietrich, Scott

    Heterostructures made of semiconductor materials may be one of most versatile environments for the study of the physics of electron transport in two dimensions. These systems are highly customizable and demonstrate a wide range of interesting physical phenomena. In response to both microwave radiation and DC excitations, strongly nonlinear transport that gives rise to non-equilibrium electron states has been reported and investigated. We have studied GaAs quantum wells with a high density of high mobility two-dimensional electrons placed in a quantizing magnetic field. This study presents the observation of several nonlinear transport mechanisms produced by the quantum nature of these materials. The quantum scattering rate, 1tau/q, is an important parameter in these systems, defining the width of the quantized energy levels. Traditional methods of extracting 1tau/q involve studying the amplitude of Shubnikov-de Haas oscillations. We analyze the quantum positive magnetoresistance due to the cyclotron motion of electrons in a magnetic field. This method gives 1tau/q and has the additional benefit of providing access to the strength of electron-electron interactions, which is not possible by conventional techniques. The temperature dependence of the quantum scattering rate is found to be proportional to the square of the temperature and is in very good agreement with theory that considers electron-electron interactions in 2D systems. In quantum wells with a small scattering rate - which corresponds to well-defined Landau levels - quantum oscillations of nonlinear resistance that are independent of magnetic field strength have been observed. These oscillations are periodic in applied bias current and are connected to quantum oscillations of resistance at zero bias: either Shubnikov-de Haas oscillations for single subband systems or magnetointersubband oscillations for two subband systems. The bias-induced oscillations can be explained by a spatial variation of electron density across the sample. The theoretical model predicts the period of these oscillations to depend on the total electron density, which has been confirmed by controlling the density through a voltage top-gate on the sample. The peculiar nonlinear mechanism of quantal heating has garned much attention recently. This bulk phenomenon is a quantum manifestation of Joule heating where an applied bias current causes selective flattening in the electron distribution function but conserves overall broadening. This produces a highly non-equilibrium distribution of electrons that drastically effects the transport properties of the system. Recent studies have proposed contributions from edge states and/or skipping orbitals. We have shown that these contributions are minimal by studying the transition to the zero differential conductance state and comparing results between Hall and Corbino geometries. This demonstrated quantal heating as the dominant nonlinear mechanism in these systems. To study the dynamics of quantal heating, we applied microwave radiation simultaneously from two sources at frequencies ƒ1 and ƒ2 and measured the response of the system at the difference frequency, ƒ=|ƒ 1-ƒ2|. This provides direct access to the rate of inelastic scattering processes, 1tau/in, that tend to bring the electron distribution back to thermal equilibrium. While conventional measurements of the temperature dependence indicate that 1tau/in is proportional to temperature, recent DC investigations and our new dynamic measurements show either T2 or T3 dependence in different magnetic fields. Our microwave experiment is the first direct access to the inelastic relaxation rate and confirms the non-linear temperature dependence.

  20. Diffusive charge transport in graphene

    NASA Astrophysics Data System (ADS)

    Chen, Jianhao

    The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.

  1. Ratios of N15/C12 and He4/C12 inclusive electroproduction cross sections in the nucleon resonance region

    NASA Astrophysics Data System (ADS)

    Bosted, P. E.; Fersch, R.; Adams, G.; Amarian, M.; Anefalos, S.; Anghinolfi, M.; Asryan, G.; Avakian, H.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Batourine, V.; Battaglieri, M.; Beard, K.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bradford, R.; Branford, D.; Brooks, W. K.; Bültmann, S.; Burkert, V. D.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Cazes, A.; Chen, S.; Cole, P. L.; Collins, P.; Coltharp, P.; Cords, D.; Corvisiero, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; de Masi, R.; de Vita, R.; de Sanctis, E.; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Djalali, C.; Dodge, G. E.; Donnelly, J.; Doughty, D.; Dragovitsch, P.; Dugger, M.; Dharmawardane, K. V.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; Elouadrhiri, L.; Eugenio, P.; Fatemi, R.; Fedotov, G.; Feuerbach, R. J.; Forest, T. A.; Fradi, A.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, R. S.; Hardie, J.; Heddle, D.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Kalantarians, N.; Keith, C.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klusman, M.; Kossov, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuhn, S. E.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Lima, A. C. S.; Livingston, K.; Lu, H.; Lukashin, K.; MacCormick, M.; Markov, N.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morand, L.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Nasseripour, R.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Philips, S. A.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Shvedunov, N. V.; Skabelin, A. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strauch, S.; Suleiman, R.; Taiuti, M.; Taylor, S.; Tedeschi, D. J.; Thoma, U.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Ungaro, M.; Vineyard, M. F.; Vlassov, A. V.; Weinstein, L. B.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.; Zhao, B.; Zhao, Z.

    2008-07-01

    The (W,Q2) dependence of the ratio of inclusive electron scattering cross sections for N15/C12 was determined in the kinematic ranges 0.8

  2. Spin-orbit scattering visualized in quasiparticle interference

    NASA Astrophysics Data System (ADS)

    Kohsaka, Y.; Machida, T.; Iwaya, K.; Kanou, M.; Hanaguri, T.; Sasagawa, T.

    2017-03-01

    In the presence of spin-orbit coupling, electron scattering off impurities depends on both spin and orbital angular momentum of electrons—spin-orbit scattering. Although some transport properties are subject to spin-orbit scattering, experimental techniques directly accessible to this effect are limited. Here we show that a signature of spin-orbit scattering manifests itself in quasiparticle interference (QPI) imaged by spectroscopic-imaging scanning tunneling microscopy. The experimental data of a polar semiconductor BiTeI are well reproduced by numerical simulations with the T -matrix formalism that include not only scalar scattering normally adopted but also spin-orbit scattering stronger than scalar scattering. To accelerate the simulations, we extend the standard efficient method of QPI calculation for momentum-independent scattering to be applicable even for spin-orbit scattering. We further identify a selection rule that makes spin-orbit scattering visible in the QPI pattern. These results demonstrate that spin-orbit scattering can exert predominant influence on QPI patterns and thus suggest that QPI measurement is available to detect spin-orbit scattering.

  3. Linac head scatter factor for asymmetric radiation field

    NASA Astrophysics Data System (ADS)

    Soubra, Mazen Ahmed

    1997-11-01

    The head scatter factor, Sh is an important dosimetric quantity used in radiation therapy dose calculation. It is empirically determined and its field size dependence reflects changes in photon scatter from components in the linac treatment head. In this work a detailed study of the physical factors influencing the determination of Sh was performed with particular attention given to asymmetric field geometries. Ionization measurements for 6 and 18 MV photon beams were made to examine the factors which determine Sh. These include: phantom size and material, collimator backscatter, non-lateral electronic equilibrium (LEE) conditions, electron contamination, collimator-exchange, photon energy, flattening filter and off-axis distance (OAD). Results indicated that LEE is not required for Sh measurements if electron contamination is minimized. Brass caps or polystyrene miniphantoms can both be used in Sh measurements provided the phantom thickness is large enough to stop contaminant electrons. Backscatter radiation effects into the monitor chamber were found to be negligible for the Siemens linac. It was found that the presence and shape of the flattening filter had a significant effect on the empirically determined value of Sh was also shown to be a function of OAD, particularly for small fields. For fields larger than 12×12 cm2/ Sh was independent of OAD. A flattening filter mass model was introduced to explain qualitatively the above results. A detailed Monte Carlo simulation of the Siemens KD2 linac head in 6 MV mode was performed to investigate the sources of head scatter which contribute to the measured Sh. The simulated head components include the flattening filter, the electron beam stopper, the primary collimator, the photon monitor chamber and the secondary collimators. The simulations showed that the scatter from the head of the Siemens linac is a complex function of the head components. On the central axis the flattening filter played the dominant role in the contributing to scatter. However this role was significantly reduced off- axis and other head components, such as the electron beam stopper and the primary collimator, became more important. The role of the mirror and ion chamber was relatively minor. Scatter from the secondary collimators was shown to be a function of the filed size and the position of the collimators in the treatment head. They were also found to play a dual role, both as a scatter source and as an attenuator for scatter produced upstream in the linac head. A closed form model, based on the work of Yu and Slobada, was developed to estimate head scatter factors for on- and off-axis asymmetric fields. The model requires three parameters to fit the measured data. The first, a constant c, has a physical significance and is independent of energy and off-axis distance. The second, g, shows a small variation with the energy and OAD while the third parameter, the primary-to-scatter ratio, is strongly dependent on energy and off-axis distance. Comparison of Sh, predicted by the model, to measurement for a large range of symmetric and asymmetric fields showed excellent agreement. A maximum of 0.7% discrepancy was observed at 12 cm OAD.

  4. The Effect of Precipitating Electrons and Ions on Ionospheric Conductance and Inner Magnetospheric Electric Fields 142106

    NASA Astrophysics Data System (ADS)

    Chen, M.; Lemon, C.; Hecht, J. H.; Evans, J. S.; Boyd, A. J.

    2016-12-01

    We investigate how scattering of electrons by waves and of ions by field-line curvature in the inner magnetosphere affect precipitating energy flux distributions and how the precipitating particles modify the ionospheric conductivity and electric potentials during magnetic storms. We examine how particle precipitation in the evening sector affects the development of the Sub-Auroral Polarization Stream (SAPS) electric field that is observed at sub-auroral latitudes in that sector as well as the electric field in the morning sector. Our approach is to use the magnetically and electrically self-consistent Rice Convection Model - Equilibrium (RCM-E) of the inner magnetosphere to simulate the stormtime precipitating particle distributions and the electric field. We use parameterized rates of whistler-generated electron pitch-angle scattering from Orlova and Shprits [JGR, 2014] that depend on equatorial radial distance, magnetic activity (Kp), and magnetic local time (MLT) outside the simulated plasmasphere. Inside the plasmasphere, parameterized scattering rates due to hiss [Orlova et al., GRL, 2014] are employed. Our description for the rate of ion scattering is more simplistic. We assume that the ions are scattered at a fraction of strong pitch-angle scattering where the fraction is scaled by epsilon, the ratio of the gyroradius to the field-line radius of curvature, when epsilon is greater than 0.1. We compare simulated trapped and precipitating electron/ion flux distributions with measurements from Van Allen Probes/MagEIS, POES and DMSP, respectively, to validate the particle loss models. DMSP observations of electric fields are compared with the simulation results. We discuss the effect of precipitating electrons and ions on the SAPS and the inner magnetospheric electric field through the data-model comparisons.

  5. Evidence for the absence of electron-electron Coulomb interaction quantum correction to the anomalous Hall effect in Co2FeSi Heusler-alloy thin films

    NASA Astrophysics Data System (ADS)

    Hazra, Binoy Krishna; Kaul, S. N.; Srinath, S.; Raja, M. Manivel; Rawat, R.; Lakhani, Archana

    2017-11-01

    Electrical (longitudinal) resistivity ρx x, at H =0 and H =80 kOe, anomalous Hall resistivity ρxy A H, and magnetization M , have been measured at different temperatures in the range 5-300 K on the Co2FeSi (CFS) Heusler-alloy thin films, grown on Si(111) substrate, with thickness ranging from 12 to 100 nm. At fixed fields H =0 and H =80 kOe, ρx x(T ) goes through a minimum at T =Tmin (which depends on the film thickness) in all the CFS thin films. In sharp contrast, both the anomalous Hall coefficient RA and ρxy A H monotonously increase with temperature without exhibiting a minimum. Elaborate analyses of ρx x, RA, and ρxy A H establishes the following. (i) The enhanced electron-electron Coulomb interaction (EEI) quantum correction (QC) is solely responsible for the upturn in "zero-field" and "in-field" ρx x(T ) at T

  6. Sensitivity of a fibre scattered-light interferometer to external phase perturbations in an optical fibre

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alekseev, A E; Potapov, V T; Gorshkov, B G

    2015-10-31

    Sensitivity of a fibre scattered-light interferometer to external phase perturbations is studied for the first time. An expression is derived for an average power of a useful signal at the interferometer output under external harmonic perturbations in a signal fibre of the interferometer. It is shown that the maximum sensitivity of the scattered-light interferometer depends on the dispersion of the interferogram intensity. An average signal-to-noise ratio is determined theoretically and experimentally at the output of the interferometer at different amplitudes of external perturbations. Using the measured dependences of the signal-to-noise ratio, the threshold sensitivity of the fibre scattered-light interferometer tomore » external phase perturbations is found. The results obtained can be used to optimise characteristics of optical time-domain reflectometers and to design individual phase-sensitive fibre-optic sensors. (laser applications and other topics in quantum electronics)« less

  7. Compton Scattering Cross Sections in Strong Magnetic Fields: Advances for Neutron Star Applications

    NASA Astrophysics Data System (ADS)

    Eiles, Matthew; Gonthier, P. L.; Baring, M. G.; Wadiasingh, Z.

    2013-04-01

    Various telescopes including RXTE, INTEGRAL and Suzaku have detected non-thermal X-ray emission in the 10 - 200 keV band from strongly magnetic neutron stars. Inverse Compton scattering, a quantum-electrodynamical process, is believed to be a leading candidate for the production of this intense X-ray radiation. Magnetospheric conditions are such that electrons may well possess ultra-relativistic energies, which lead to attractive simplifications of the cross section. We have recently addressed such a case by developing compact analytic expressions using correct spin-dependent widths and Sokolov & Ternov (ST) basis states, focusing specifically on ground state-to-ground state scattering. However, inverse Compton scattering can cool electrons down to mildly-relativistic energies, necessitating the development of a more general case where the incoming photons acquire nonzero incident angles relative to the field in the rest frame of the electron, and the intermediate state can be excited to arbitrary Landau levels. In this paper, we develop results pertaining to this general case using ST formalism, and treating the plethora of harmonic resonances associated with various cyclotron transitions between Landau states. Four possible scattering modes (parallel-parallel, perpendicular-perpendicular, parallel-perpendicular, and perpendicular-parallel) encapsulate the polarization dependence of the cross section. We present preliminary analytic and numerical investigations of the magnitude of the extra Landau state contributions to obtain the full cross section, and compare these new analytic developments with the spin-averaged cross sections, which we develop in parallel. Results will find application to various neutron star problems, including computation of Eddington luminosities in the magnetospheres of magnetars. We express our gratitude for the generous support of the Michigan Space Grant Consortium, of the National Science Foundation (REU and RUI), and the NASA Astrophysics Theory and Fundamental Program.

  8. Phase transformation in multiferroic Bi5Ti3FeO15 ceramics by temperature-dependent ellipsometric and Raman spectra: An interband electronic transition evidence

    NASA Astrophysics Data System (ADS)

    Jiang, P. P.; Duan, Z. H.; Xu, L. P.; Zhang, X. L.; Li, Y. W.; Hu, Z. G.; Chu, J. H.

    2014-02-01

    Thermal evolution and an intermediate phase between ferroelectric orthorhombic and paraelectric tetragonal phase of multiferroic Bi5Ti3FeO15 ceramic have been investigated by temperature-dependent spectroscopic ellipsometry and Raman scattering. Dielectric functions and interband transitions extracted from the standard critical-point model show two dramatic anomalies in the temperature range of 200-873 K. It was found that the anomalous temperature dependence of electronic transition energies and Raman mode frequencies around 800 K can be ascribed to intermediate phase transformation. Moreover, the disappearance of electronic transition around 3 eV at 590 K is associated with the conductive property.

  9. Effect of Oblique Electromagnetic Ion Cyclotron Waves on Relativistic Electron Scattering: CRRES Based Calculation

    NASA Technical Reports Server (NTRS)

    Gamayunov, K. V.; Khazanov, G. V.

    2007-01-01

    We consider the effect of oblique EMIC waves on relativistic electron scattering in the outer radiation belt using simultaneous observations of plasma and wave parameters from CRRES. The main findings can be s ummarized as follows: 1. In 1comparison with field-aligned waves, int ermediate and highly oblique distributions decrease the range of pitc h-angles subject to diffusion, and reduce the local scattering rate b y an order of magnitude at pitch-angles where the principle absolute value of n = 1 resonances operate. Oblique waves allow the absolute va lue of n > 1 resonances to operate, extending the range of local pitc h-angle diffusion down to the loss cone, and increasing the diffusion at lower pitch angles by orders of magnitude; 2. The local diffusion coefficients derived from CRRES data are qualitatively similar to the local results obtained for prescribed plasma/wave parameters. Conseq uently, it is likely that the bounce-averaged diffusion coefficients, if estimated from concurrent data, will exhibit the dependencies similar to those we found for model calculations; 3. In comparison with f ield-aligned waves, intermediate and highly oblique waves decrease th e bounce-averaged scattering rate near the edge of the equatorial lo ss cone by orders of magnitude if the electron energy does not excee d a threshold (approximately equal to 2 - 5 MeV) depending on specified plasma and/or wave parameters; 4. For greater electron energies_ ob lique waves operating the absolute value of n > 1 resonances are more effective and provide the same bounce_averaged diffusion rate near the loss cone as fiel_aligned waves do.

  10. Retrieval of target structure information from laser-induced photoelectrons by few-cycle bicircular laser fields

    NASA Astrophysics Data System (ADS)

    Hoang, Van-Hung; Le, Van-Hoang; Lin, C. D.; Le, Anh-Thu

    2017-03-01

    By analyzing theoretical results from a numerical solution of the time-dependent Schrödinger equation for atoms in few-cycle bicircular laser pulses, we show that high-energy photoelectron momentum spectra can be used to extract accurate elastic scattering differential cross sections of the target ion with free electrons. We find that the retrieval range for a scattering angle with bicircular pulses is wider than with linearly polarized pulses, although the retrieval method has to be modified to account for different returning directions of the electron in the continuum. This result can be used to extend the range of applicability of ultrafast imaging techniques such as laser-induced electron diffraction and for the accurate characterization of laser pulses.

  11. Spin-dependent sum rules connecting real and virtual Compton scattering verified

    NASA Astrophysics Data System (ADS)

    Lensky, Vadim; Pascalutsa, Vladimir; Vanderhaeghen, Marc; Kao, Chung Wen

    2017-04-01

    We present a detailed derivation of the two sum rules relating the spin polarizabilities measured in real, virtual, and doubly virtual Compton scattering. For example, the polarizability δL T , accessed in inclusive electron scattering, is related to the spin polarizability γE 1 E 1 and the slope of generalized polarizabilities P(M 1 ,M 1 )1-P(L 1 ,L 1 )1 , measured in, respectively, the real and the virtual Compton scattering. We verify these sum rules in different variants of chiral perturbation theory, discuss their empirical verification for the proton, and prospect their use in studies of the nucleon spin structure.

  12. First-Principles Estimation of Electronic Temperature from X-Ray Thomson Scattering Spectrum of Isochorically Heated Warm Dense Matter

    NASA Astrophysics Data System (ADS)

    Mo, Chongjie; Fu, Zhenguo; Kang, Wei; Zhang, Ping; He, X. T.

    2018-05-01

    Through the perturbation formula of time-dependent density functional theory broadly employed in the calculation of solids, we provide a first-principles calculation of x-ray Thomson scattering spectrum of isochorically heated aluminum foil, as considered in the experiments of Sperling et al. [Phys. Rev. Lett. 115, 115001 (2015), 10.1103/PhysRevLett.115.115001], where ions were constrained near their lattice positions. From the calculated spectra, we find that the electronic temperature cannot exceed 2 eV, much smaller than the previous estimation of 6 eV via the detailed balance relation. Our results may well be an indication of unique electronic properties of warm dense matter, which can be further illustrated by future experiments. The lower electronic temperature predicted partially relieves the concern on the heating of x-ray free electron laser to the sample when used in structure measurement.

  13. Resonant nuclear scattering of synchrotron radiation: Detector development and specular scattering from a thin layer of {sup 57}Fe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baron, A.Q.R.

    1995-04-01

    This thesis explores resonant nudear scattering of synchrotron radiation. An introductory chapter describes some useful concepts, such as speedup and coherent enhancement, in the context of some basic physical principles. Methods of producing highly monochromatic synchrotron beams usmg either electronic or nuclear scattering are also discussed. The body of the thesis concentrates on detector development and specular scattering from iynthetic layered materials. A detector employing n-dcrochannel plate electron multipliers is shown to have good ({approximately}50%) effidency for detecting 14.4 key x-rays incident at small ({approximately}0.5 degree) grazing angles onto Au or CsI photocathodes. However, being complicated to use, it wasmore » replaced with a large area (>=lan2) avalanche photodiode (APD) detector. The APD`s are simpler to use and have comparable (30--70%) efficiencies at 14.4 key, subnanosecond time resolution, large dynan-dc range (usable at rates up to {approximately}10{sup 8} photons/second) and low (<{approximately}0.01 cts/sec) background rates. Maxwell`s equations are used to derive the specular x-ray reflectivity of layered materials with resonant transitions and complex polarization dependencies. The effects of interfadal roughness are treated with some care, and the distorted wave Born approximation (DWBA) used to describe electronic scattering is generalized to the nuclear case. The implications of the theory are discussed in the context of grazing incidence measurements with emphasis on the kinematic and dynamical aspects of the scattering.« less

  14. Effect of Precipitating Electrons on Stormtime Inner Magnetospheric Electric Fields during the 17 March 2013 Storm

    NASA Astrophysics Data System (ADS)

    Chen, M.; Lemon, C. L.; Sazykin, S. Y.; Wolf, R.; Hecht, J. H.; Walterscheid, R. L.; Boyd, A. J.; Turner, D. L.

    2015-12-01

    We investigate how scattering of electrons by waves in the plasma sheet and plasmasphere affects precipitating energy flux distributions and how the precipitating electrons modify the ionospheric conductivity and electric potentials during the large 17 March 2013 magnetic storm. Of particular interest is how electron precipitation in the evening sector affects the development of the Sub-auroral Polarization Stream (SAPS) electric field that is observed at sub-auroral latitudes in that sector. Our approach is to use the magnetically and electrically self-consistent Rice Convection Model - Equilibrium (RCM-E) of the inner magnetosphere to simulate the stormtime precipitating electron distributions and the electric field. We use parameterized rates of whistler-generated electron pitch-angle scattering from Orlova and Shprits [JGR, 2014] that depend on equatorial radial distance, magnetic activity (Kp), and magnetic local time (MLT) outside the simulated plasmasphere. Inside the plasmasphere, parameterized scattering rates due to hiss [Orlova et al., GRL, 2014] are used. We compare simulated trapped and precipitating electron flux distributions with measurements from Van Allen Probes/MagEIS, POES/TED and MEPED, respectively, to validate the electron loss model. Ground-based (SuperDARN) and in-situ (Van Allen Probes/EFW) observations of electric fields are compared with the simulation results. We discuss the effect of precipitating electrons on the SAPS and inner magnetospheric electric field through the data-model comparisons.

  15. First-principles modeling of resonant Raman scattering for the understanding of phonons and electrons in nanomaterials

    NASA Astrophysics Data System (ADS)

    Liang, Liangbo; Meunier, Vincent; Yan, Jia-An; Sumpter, Bobby

    Raman spectroscopy is a popular tool that can probe both phonons and electrons of the materials. First-principles modeling is important in aiding the understanding of experimental data. Raman modeling is typically based on the classical Placzek approximation and limited to the non-resonant condition, and thus the laser energy dependence of Raman intensities could not be captured. Here we showed that resonant Raman scattering could be captured by upgrading the classical approach, i.e., by calculating the dynamic dielectric tensor at the laser energy instead of the commonly used static value at zero energy. Our method was successfully applied to recently synthesized atomically precise graphene nanoribbons, and revealed the photon-energy-dependent Raman intensity of the radial breathing like mode (RBLM), which explained experimental observations that RBLM can be only observed in certain laser energies. Additionally, we also explored anisotropic 2D material, ReS2, and found that the angle-resolved Raman polarization dependence of its Raman modes is sensitive to the laser energy, as confirmed by recent experiments. The intricate electron-phonon coupling could lead to no simple rule for using Raman polarization dependence to determine the crystalline orientation. LL is supported by Eugene P. Wigner Fellowship at Oak Ridge National Laboratory and CNMS (a DOE Office of Science User Facility).

  16. Effects of Carrier Confinement and Intervalley Scattering on Photoexcited Electron Plasma in Silicon.

    PubMed

    Sieradzki, A; Kuznicki, Z T

    2013-01-01

    The ultrafast reflectivity of silicon, excited and probed with femtosecond laser pulses, is studied for different wavelengths and energy densities. The confinement of carriers in a thin surface layer delimited by a nanoscale Si-layered system buried in a Si heavily-doped wafer reduces the critical density of carriers necessary to create the electron plasma by a factor of ten. We performed two types of reflectivity measurements, using either a single beam or two beams. The plasma strongly depends on the photon energy density because of the intervalley scattering of the electrons revealed by two different mechanisms assisted by the electron-phonon interaction. One mechanism leads to a negative differential reflectivity that can be attributed to an induced absorption in X valleys. The other mechanism occurs, when the carrier population is thermalizing and gives rise to a positive differential reflectivity corresponding to Pauli-blocked intervalley gamma to X scattering. These results are important for improving the efficiency of Si light-to-electricity converters, in which there is a possibility of multiplying carriers by nanostructurization of Si.

  17. Experimental characterization of an ultra-fast Thomson scattering x-ray source with three-dimensional time and frequency-domain analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuba, J; Slaughter, D R; Fittinghoff, D N

    We present a detailed comparison of the measured characteristics of Thomson backscattered x-rays produced at the PLEIADES (Picosecond Laser-Electron Interaction for the Dynamic Evaluation of Structures) facility at Lawrence Livermore National Laboratory to predicted results from a newly developed, fully three-dimensional time and frequency-domain code. Based on the relativistic differential cross section, this code has the capability to calculate time and space dependent spectra of the x-ray photons produced from linear Thomson scattering for both bandwidth-limited and chirped incident laser pulses. Spectral broadening of the scattered x-ray pulse resulting from the incident laser bandwidth, perpendicular wave vector components in themore » laser focus, and the transverse and longitudinal phase space of the electron beam are included. Electron beam energy, energy spread, and transverse phase space measurements of the electron beam at the interaction point are presented, and the corresponding predicted x-ray characteristics are determined. In addition, time-integrated measurements of the x-rays produced from the interaction are presented, and shown to agree well with the simulations.« less

  18. Temperature Dependence of Brillouin Light Scattering Spectra of Acoustic Phonons in Silicon

    NASA Astrophysics Data System (ADS)

    Somerville, Kevin; Klimovich, Nikita; An, Kyongmo; Sullivan, Sean; Weathers, Annie; Shi, Li; Li, Xiaoqin

    2015-03-01

    Thermal management represents an outstanding challenge in many areas of technology. Electrons, optical phonons, and acoustic phonons are often driven out of local equilibrium in electronic devices or during laser-material interaction processes. Interest in non-equilibrium transport processes has motivated the development of Raman spectroscopy as a local temperature sensor of optical phonons and intermediate frequency acoustic phonons, whereas Brillouin light scattering (BLS) has recently been explored as a temperature sensor of low-frequency acoustic phonons. Here, we report temperature dependent BLS spectra of silicon, with Raman spectra taken simultaneously for comparison. The origins of the observed temperature dependence of the BLS peak position, linewidth, and intensity are examined in order to evaluate their potential use as temperature sensors for acoustic phonons. We determine that the integrated BLS intensity can be used measure the temperature of specific acoustic phonon modes. This work is supported by National Science Foundation (NSF) Thermal Transport Processes Program under Grant CBET-1336968.

  19. Spin-resolved inelastic electron scattering by spin waves in noncollinear magnets

    NASA Astrophysics Data System (ADS)

    dos Santos, Flaviano José; dos Santos Dias, Manuel; Guimarães, Filipe Souza Mendes; Bouaziz, Juba; Lounis, Samir

    2018-01-01

    Topological noncollinear magnetic phases of matter are at the heart of many proposals for future information nanotechnology, with novel device concepts based on ultrathin films and nanowires. Their operation requires understanding and control of the underlying dynamics, including excitations such as spin waves. So far, no experimental technique has attempted to probe large wave-vector spin waves in noncollinear low-dimensional systems. In this paper, we explain how inelastic electron scattering, being suitable for investigations of surfaces and thin films, can detect the collective spin-excitation spectra of noncollinear magnets. To reveal the particularities of spin waves in such noncollinear samples, we propose the usage of spin-polarized electron-energy-loss spectroscopy augmented with a spin analyzer. With the spin analyzer detecting the polarization of the scattered electrons, four spin-dependent scattering channels are defined, which allow us to filter and select specific spin-wave modes. We take as examples a topological nontrivial skyrmion lattice, a spin-spiral phase, and the conventional ferromagnet. Then we demonstrate that, counterintuitively and in contrast to the ferromagnetic case, even non-spin-flip processes can generate spin waves in noncollinear substrates. The measured dispersion and lifetime of the excitation modes permit us to fingerprint the magnetic nature of the substrate.

  20. Quasi-particle Interference of Heavy Fermions in Resonant X-ray Scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gyenis, Andras; da Silva Neto, Eduardo H.; Sutarto, Ronny

    Resonant x-ray scattering (RXS) has recently become an increasingly important tool for the study of ordering phenomena in correlated electron systems. Yet, the interpretation of RXS experiments remains theoretically challenging because of the complexity of the RXS cross section. Central to this debate is the recent proposal that impurity-induced Friedel oscillations, akin to quasi-particle interference signals observed with a scanning tunneling microscope (STM), can lead to scattering peaks in RXS experiments. The possibility that quasi-particle properties can be probed in RXS measurements opens up a new avenue to study the bulk band structure of materials with the orbital and elementmore » selectivity provided by RXS. We test these ideas by combining RXS and STM measurements of the heavy fermion compound CeMIn5 (M = Co, Rh). Temperature- and doping-dependent RXS measurements at the Ce-M4 edge show a broad scattering enhancement that correlates with the appearance of heavy f-electron bands in these compounds. The scattering enhancement is consistent with the measured quasi-particle interference signal in the STM measurements, indicating that the quasi-particle interference can be probed through the momentum distribution of RXS signals. Overall, our experiments demonstrate new opportunities for studies of correlated electronic systems using the RXS technique.« less

  1. Quasi-particle interference of heavy fermions in resonant x-ray scattering

    PubMed Central

    Gyenis, András; da Silva Neto, Eduardo H.; Sutarto, Ronny; Schierle, Enrico; He, Feizhou; Weschke, Eugen; Kavai, Mariam; Baumbach, Ryan E.; Thompson, Joe D.; Bauer, Eric D.; Fisk, Zachary; Damascelli, Andrea; Yazdani, Ali; Aynajian, Pegor

    2016-01-01

    Resonant x-ray scattering (RXS) has recently become an increasingly important tool for the study of ordering phenomena in correlated electron systems. Yet, the interpretation of RXS experiments remains theoretically challenging because of the complexity of the RXS cross section. Central to this debate is the recent proposal that impurity-induced Friedel oscillations, akin to quasi-particle interference signals observed with a scanning tunneling microscope (STM), can lead to scattering peaks in RXS experiments. The possibility that quasi-particle properties can be probed in RXS measurements opens up a new avenue to study the bulk band structure of materials with the orbital and element selectivity provided by RXS. We test these ideas by combining RXS and STM measurements of the heavy fermion compound CeMIn5 (M = Co, Rh). Temperature- and doping-dependent RXS measurements at the Ce-M4 edge show a broad scattering enhancement that correlates with the appearance of heavy f-electron bands in these compounds. The scattering enhancement is consistent with the measured quasi-particle interference signal in the STM measurements, indicating that the quasi-particle interference can be probed through the momentum distribution of RXS signals. Overall, our experiments demonstrate new opportunities for studies of correlated electronic systems using the RXS technique. PMID:27757422

  2. Quasi-particle Interference of Heavy Fermions in Resonant X-ray Scattering

    DOE PAGES

    Gyenis, Andras; da Silva Neto, Eduardo H.; Sutarto, Ronny; ...

    2016-10-14

    Resonant x-ray scattering (RXS) has recently become an increasingly important tool for the study of ordering phenomena in correlated electron systems. Yet, the interpretation of RXS experiments remains theoretically challenging because of the complexity of the RXS cross section. Central to this debate is the recent proposal that impurity-induced Friedel oscillations, akin to quasi-particle interference signals observed with a scanning tunneling microscope (STM), can lead to scattering peaks in RXS experiments. The possibility that quasi-particle properties can be probed in RXS measurements opens up a new avenue to study the bulk band structure of materials with the orbital and elementmore » selectivity provided by RXS. We test these ideas by combining RXS and STM measurements of the heavy fermion compound CeMIn5 (M = Co, Rh). Temperature- and doping-dependent RXS measurements at the Ce-M4 edge show a broad scattering enhancement that correlates with the appearance of heavy f-electron bands in these compounds. The scattering enhancement is consistent with the measured quasi-particle interference signal in the STM measurements, indicating that the quasi-particle interference can be probed through the momentum distribution of RXS signals. Overall, our experiments demonstrate new opportunities for studies of correlated electronic systems using the RXS technique.« less

  3. Quasi-particle interference of heavy fermions in resonant x-ray scattering.

    PubMed

    Gyenis, András; da Silva Neto, Eduardo H; Sutarto, Ronny; Schierle, Enrico; He, Feizhou; Weschke, Eugen; Kavai, Mariam; Baumbach, Ryan E; Thompson, Joe D; Bauer, Eric D; Fisk, Zachary; Damascelli, Andrea; Yazdani, Ali; Aynajian, Pegor

    2016-10-01

    Resonant x-ray scattering (RXS) has recently become an increasingly important tool for the study of ordering phenomena in correlated electron systems. Yet, the interpretation of RXS experiments remains theoretically challenging because of the complexity of the RXS cross section. Central to this debate is the recent proposal that impurity-induced Friedel oscillations, akin to quasi-particle interference signals observed with a scanning tunneling microscope (STM), can lead to scattering peaks in RXS experiments. The possibility that quasi-particle properties can be probed in RXS measurements opens up a new avenue to study the bulk band structure of materials with the orbital and element selectivity provided by RXS. We test these ideas by combining RXS and STM measurements of the heavy fermion compound Ce M In 5 ( M = Co, Rh). Temperature- and doping-dependent RXS measurements at the Ce- M 4 edge show a broad scattering enhancement that correlates with the appearance of heavy f -electron bands in these compounds. The scattering enhancement is consistent with the measured quasi-particle interference signal in the STM measurements, indicating that the quasi-particle interference can be probed through the momentum distribution of RXS signals. Overall, our experiments demonstrate new opportunities for studies of correlated electronic systems using the RXS technique.

  4. Electron scattering in graphene with adsorbed NaCl nanoparticles

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Drabińska, Aneta, E-mail: Aneta.Drabinska@fuw.edu.pl; Kaźmierczak, Piotr; Bożek, Rafał

    2015-01-07

    In this work, the results of contactless magnetoconductance and Raman spectroscopy measurements performed for a graphene sample after its immersion in NaCl solution were presented. The properties of the immersed sample were compared with those of a non-immersed reference sample. Atomic force microscopy and electron spin resonance experiments confirmed the deposition of NaCl nanoparticles on the graphene surface. A weak localization signal observed using contactless magnetoconductance showed the reduction of the coherence length after NaCl treatment of graphene. Temperature dependence of the coherence length indicated a change from ballistic to diffusive regime in electron transport after NaCl treatment. The mainmore » inelastic scattering process was of the electron-electron type but the major reason for the reduction of the coherence length at low temperatures was additional, temperature independent, inelastic scattering. We associate it with spin flip scattering, caused by NaCl nanoparticles present on the graphene surface. Raman spectroscopy showed an increase in the D and D′ bands intensities for graphene after its immersion in NaCl solution. An analysis of the D, D′, and G bands intensities proved that this additional scattering is related to the decoration of vacancies and grain boundaries with NaCl nanoparticles, as well as generation of new on-site defects as a result of the decoration of the graphene surface with NaCl nanoparticles. The observed energy shifts of 2D and G bands indicated that NaCl deposition on the graphene surface did not change carrier concentration, but reduced compressive biaxial strain in the graphene layer.« less

  5. Three-dimensional imaging of individual point defects using selective detection angles in annular dark field scanning transmission electron microscopy.

    PubMed

    Johnson, Jared M; Im, Soohyun; Windl, Wolfgang; Hwang, Jinwoo

    2017-01-01

    We propose a new scanning transmission electron microscopy (STEM) technique that can realize the three-dimensional (3D) characterization of vacancies, lighter and heavier dopants with high precision. Using multislice STEM imaging and diffraction simulations of β-Ga 2 O 3 and SrTiO 3 , we show that selecting a small range of low scattering angles can make the contrast of the defect-containing atomic columns substantially more depth-dependent. The origin of the depth-dependence is the de-channeling of electrons due to the existence of a point defect in the atomic column, which creates extra "ripples" at low scattering angles. The highest contrast of the point defect can be achieved when the de-channeling signal is captured using the 20-40mrad detection angle range. The effect of sample thickness, crystal orientation, local strain, probe convergence angle, and experimental uncertainty to the depth-dependent contrast of the point defect will also be discussed. The proposed technique therefore opens new possibilities for highly precise 3D structural characterization of individual point defects in functional materials. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Single-Inclusive Jet Production In Electron-Nucleon Collisions Through Next-To-Next-To-Leading Order In Perturbative QCD

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Abelof, Gabriel; Boughezal, Radja; Liu, Xiaohui

    2016-10-17

    We compute the Oσ 2σ 2 s perturbative corrections to inclusive jet production in electron-nucleon collisions. This process is of particular interest to the physics program of a future Electron Ion Collider (EIC). We include all relevant partonic processes, including deep-inelastic scattering contributions, photon-initiated corrections, and parton-parton scattering terms that first appear at this order. Upon integration over the final-state hadronic phase space we validate our results for the deep-inelastic corrections against the known next-to-next-to-leading order (NNLO) structure functions. Our calculation uses the N-jettiness subtraction scheme for performing higher-order computations, and allows for a completely differential description of the deep-inelasticmore » scattering process. We describe the application of this method to inclusive jet production in detail, and present phenomenological results for the proposed EIC. The NNLO corrections have a non-trivial dependence on the jet kinematics and arise from an intricate interplay between all contributing partonic channels.« less

  7. Compton interaction of free electrons with intense low frequency radiation

    NASA Technical Reports Server (NTRS)

    Illarionov, A. F.; Kompaneyets, D. A.

    1978-01-01

    Electron behavior in an intense low frequency radiation field, with induced Compton scattering as the primary mechanism of interaction, is investigated. Evolution of the electron energy spectrum is studied, and the equilibrium spectrum of relativistic electrons in a radiation field with high brightness temperature is found. The induced radiation pressure and heating rate of an electron gas are calculated. The direction of the induced pressure depends on the radiation spectrum. The form of spectrum, under the induced force can accelerate electrons to superrelativistic energies is found.

  8. Compton Scattering Cross Sections in Strong Magnetic Fields: Advances for Neutron Star Applications

    NASA Astrophysics Data System (ADS)

    Ickes, Jesse; Gonthier, Peter L.; Eiles, Matthew; Baring, Matthew G.; Wadiasingh, Zorawar

    2014-08-01

    Various telescopes including RXTE, INTEGRAL, Suzaku and Fermi have detected steady non-thermal X-ray emission in the 10 ~ 200 keV band from strongly magnetic neutron stars known as magnetars. Magnetic inverse Compton scattering is believed to be a leading candidate for the production of this intense X-ray radiation. Generated by electrons possessing ultra-relativistic energies, this leads to attractive simplifications of the magnetic Compton cross section. We have recently addressed such a case by developing compact analytic expressions using correct spin-dependent widths acquired through the implementation of Sokolov & Ternov (ST) basis states, focusing specifically on ground state-to-ground state scattering. Such scattering in magnetar magnetospheres can cool electrons down to mildly-relativistic energies. Moreover, soft gamma-ray flaring in magnetars may well involve strong Comptonization in expanding clouds of mildly-relativistic pairs. These situations necessitate the development of more general magnetic scattering cross sections, where the incoming photons acquire substantial incident angles relative to the field in the rest frame of the electron, and the intermediate state can be excited to arbitrary Landau levels. Here, we highlight results from such a generalization using ST formalism. The cross sections treat the plethora of harmonic resonances associated with various cyclotron transitions between Landau states. Polarization dependence of the cross section for the four scattering modes is illustrated and compared with the non-relativistic Thompson cross section with classical widths. Results will find application to various neutron star problems, including computation of Eddington luminosities and polarization mode-switching rates in transient magnetar fireballs.We express our gratitude for the generous support of Michigan Space Grant Consortium, the National Science Foundation (grants AST-0607651, AST-1009725, AST-1009731 and PHY/DMR-1004811), and the NASA Astrophysics Theory Program through grants NNX06AI32G, NNX09AQ71G and NNX10AC59A.

  9. Effect of EMIC Wave Normal Angle Distribution on Relativistic Electron Scattering

    NASA Technical Reports Server (NTRS)

    Gamayunov, K. V.; Khazanov, G. V.

    2006-01-01

    The flux level of outer-zone relativistic electrons (above 1 MeV) is extremely variable during geomagnetic storms, and controlled by a competition between acceleration and loss. Precipitation of these electrons due to resonant pitch-angle scattering by electromagnetic ion cyclotron (EMIC) waves is considered one of the major loss mechanisms. This mechanism was suggested in early theoretical studies more than three decades ago. However, direct experimental evidence of the wave role in relativistic electrons precipitation is difficult to obtain because of lack of concurrent measurements of precipitating electrons at low altitudes and the waves in a magnetically conjugate equatorial region. Recently, the data from balloon-borne X-ray instruments provided indirect but strong evidence on an efficiency of the EMIC wave induced loss for the outer-zone relativistic electrons. These observations stimulated theoretical studies that, particularly, demonstrated that EMIC wave induced pitch-angle diffusion of MeV electrons can operate in the strong diffusion limit and this mechanism can compete with relativistic electron depletion caused by the Dst effect during the initial and main phases of storm. Although an effectiveness of relativistic electron scattering by EMIC waves depends strongly on the wave spectral properties, the most favorable assumptions regarding wave characteristics has been made in all previous theoretical studies. Particularly, only quasi field-aligned EMIC waves have been considered as a driver for relativistic electron loss. At the same time, there is growing experimental and theoretical evidence that these waves can be highly oblique; EMIC wave energy can occupy not only the region of generation, i.e. the region of small wave normal angles, but also the entire wave normal angle region, and even only the region near 90 degrees. The latter can dramatically change he effectiveness of relativistic electron scattering by EMIC waves. In the present study, we calculate the pitch-angle diffusion coefficients using the typical wave normal distributions obtained from our self-consistent ring current-EMIC wave model, and try to quantify the effect of EMIC wave normal angle characteristics on relativistic electron scattering.

  10. Effect of Multiple Scattering on the Compton Recoil Current Generated in an EMP, Revisited

    DOE PAGES

    Farmer, William A.; Friedman, Alex

    2015-06-18

    Multiple scattering has historically been treated in EMP modeling through the obliquity factor. The validity of this approach is examined here. A simplified model problem, which correctly captures cyclotron motion, Doppler shifting due to the electron motion, and multiple scattering is first considered. The simplified problem is solved three ways: the obliquity factor, Monte-Carlo, and Fokker-Planck finite-difference. Because of the Doppler effect, skewness occurs in the distribution. It is demonstrated that the obliquity factor does not correctly capture this skewness, but the Monte-Carlo and Fokker-Planck finite-difference approaches do. Here, the obliquity factor and Fokker-Planck finite-difference approaches are then compared inmore » a fuller treatment, which includes the initial Klein-Nishina distribution of the electrons, and the momentum dependence of both drag and scattering. It is found that, in general, the obliquity factor is adequate for most situations. However, as the gamma energy increases and the Klein-Nishina becomes more peaked in the forward direction, skewness in the distribution causes greater disagreement between the obliquity factor and a more accurate model of multiple scattering.« less

  11. X-ray Thomson scattering measurements of temperature and density from multi-shocked CH capsules

    DOE PAGES

    Fletcher, L. B.; Glenzer, S. H.; Kritcher, A.; ...

    2013-05-24

    Proof-of-principle measurements of the electron densities, temperatures, and ionization states of spherically compressed multi-shocked CH (polystyrene) capsules have been achieved using spectrally resolved x-ray Thomson scattering. A total energy of 13.5 kJ incident on target is used to compress a 70 μm thick CH shell above solid-mass density using three coalescing shocks. Separately, a laser-produced zinc He-α x-ray source at 9 keV delayed 200 ps-800 ps after maximum compression is used to probe the plasma in the non-collective scattering regime. The data show that x-ray Thomson scattering enables a complete description of the time-dependent hydrodynamic evolution of shock-compressed CH capsules,more » with a maximum measured density of ρ > 6 g cm –3. Additionally, the results demonstrate that accurate measurements of x-ray scattering from bound-free transitions in the CH plasma demonstrate strong evidence that continuum lowering is the primary ionization mechanism of carbon L-shell electrons.« less

  12. Light collection optimization for composite photoanode in dye-sensitized solar cells: Towards higher efficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guo, X. Z.; Shen, W. Z., E-mail: wzshen@sjtu.edu.cn; Laboratory of Condensed Matter Spectroscopy and Opto-Electronic Physics, and Key Laboratory of Artificial Structures and Quantum Control

    2015-06-14

    Composite photoanode comprising nanoparticles and one-dimensional (1D) nanostructure is a promising alternative to conventional photoanode for dye-sensitized solar cells (DSCs). Besides fast electron transport channels, the 1D nanostructure also plays as light scattering centers. Here, we theoretically investigate the light scattering properties of capsule-shaped 1D nanostructure and their influence on the light collection of DSCs. It is found that the far-field light scattering of a single capsule depends on its volume, shape, and orientation: capsules with bigger equivalent spherical diameter, smaller aspect ratio, and horizontal orientation demonstrate stronger light scattering especially at large scattering angle. Using Monte Carlo approach, wemore » simulated and optimized the light harvesting efficiency of the cell. Two multilayer composite photoanodes containing orderly or randomly oriented capsules are proposed. DSCs composed of these two photoanodes are promising for higher efficiencies because of their efficient light collection and superior electron collection. These results will provide practical guidance to the design and optimization of the photoanodes for DSCs.« less

  13. The dynamics of energy and charge transfer in low and hyperthermal energy ion-solid interactions

    NASA Astrophysics Data System (ADS)

    Ray, Matthew Preston

    The energy and charge transfer dynamics for low and hyperthermal energy (10 eV to 2 keV) alkali and noble gas ions impacting noble metals as a function of incident energy, species and scattering geometry has been studied. The experiments were performed in an ultra-high vacuum scattering chamber attached to a low and hyperthermal energy beamline. The energy transfer was measured for K+ scattered from a Ag(001) surface along the [110] crystalline direction at a fixed laboratory angle of 90°. It was found that as the incident energy is reduced from 100 to 10 eV, the normalized scattered energy increased. Previous measurements have shown a decrease in the normalized energy as the incident ion energy is reduced due to an attractive image force. Trajectory analysis of the data using a classical scattering simulation revealed that instead of undergoing sequential binary collisions as in previous studies, the ion scatters from two surface atoms simultaneously leading to an increased normalized energy. Additionally, charge transfer measurements have been performed for Na + scattering from Ag(001) along the [110] crystalline direction at a fixed laboratory angle of 70°. It was found that over the range of energies used (10 eV to 2 keV), the neutralization probability of the scattered ions varied from ˜30% to ˜70% depending on the incident velocity, consistent with resonant charge transfer. A fully quantum mechanical model that treats electrons independently accurately reproduces the observed data. Measurements of electron-hole pair excitations were used to explore the pathways which a solid uses to dissipate the energy imparted by the incident ion beam. Ultrathin film (10 nm) metal-oxide-semiconductor (Au/SiO2/n-Si) devices were used to detect the electron-hole pairs for cases when the ion deposited all of its translational energy into the solid. The incident ions were incident at an angle normal to the surface of the device to maximize energy deposition and consequently electron-hole pair production. The rectifying metal-oxide-semiconductor device separates the electrons from the holes, allowing a current associated with electron-hole pair production to be measured. In these experiments a number of ion species (He+, Li+ , Ar+, K+) were made incident on multiple devices and the incident energy ranged from 100 eV to 2 keV. It was found that electron-hole pair production increased with incident ion velocity consistent with a kinetic electron excitation model where the electrons in the metal are partially confined to the surface.

  14. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Brian B.; Kirkegaard, Marie C.; Miskowiec, Andrew J.

    Uranyl fluoride (UO 2F 2) is a hygroscopic powder with two main structural phases: an anhydrous crystal and a partially hydrated crystal of the same R¯3m symmetry. The formally closed-shell electron structure of anhydrous UO 2F 2 is amenable to density functional theory calculations. We use density functional perturbation theory (DFPT) to calculate the vibrational frequencies of the anhydrous crystal structure and employ complementary inelastic neutron scattering and temperature-dependent Raman scattering to validate those frequencies. As a model closed-shell actinide, we investigated the effect of LDA, GGA, and non-local vdW functionals as well as the spherically-averaged Hubbard +U correction onmore » vibrational frequencies, electronic structure, and geometry of anhydrous UO 2F 2. A particular choice of U eff = 5.5 eV yields the correct U Oyl bond distance and vibrational frequencies for the characteristic Eg and A1g modes that are within the resolution of experiment. Inelastic neutron scattering and Raman scattering suggest a degree of water coupling to the lattice vibrations in the more experimentally accessible partially hydrated UO 2F 2 system, with the symmetric O-U-O stretching vibration shifted approximately 47 cm -1 lower in energy compared to the anhydrous structure. Evidence of water interaction with the uranyl ion is present from a two-peak decomposition of the uranyl stretching vibration in the Raman spectra and anion hydrogen stretching vibrations in the inelastic neutron scattering spectra. A first-order dehydration phase transition temperature is definitively identified to be 125 °C using temperature-dependent Raman scattering.« less

  15. Vibrational Properties of Anhydrous and Partially Hydrated Uranyl Fluoride

    DOE PAGES

    Anderson, Brian B.; Kirkegaard, Marie C.; Miskowiec, Andrew J.; ...

    2017-01-01

    Uranyl fluoride (UO 2F 2) is a hygroscopic powder with two main structural phases: an anhydrous crystal and a partially hydrated crystal of the same R¯3m symmetry. The formally closed-shell electron structure of anhydrous UO 2F 2 is amenable to density functional theory calculations. We use density functional perturbation theory (DFPT) to calculate the vibrational frequencies of the anhydrous crystal structure and employ complementary inelastic neutron scattering and temperature-dependent Raman scattering to validate those frequencies. As a model closed-shell actinide, we investigated the effect of LDA, GGA, and non-local vdW functionals as well as the spherically-averaged Hubbard +U correction onmore » vibrational frequencies, electronic structure, and geometry of anhydrous UO 2F 2. A particular choice of U eff = 5.5 eV yields the correct U Oyl bond distance and vibrational frequencies for the characteristic Eg and A1g modes that are within the resolution of experiment. Inelastic neutron scattering and Raman scattering suggest a degree of water coupling to the lattice vibrations in the more experimentally accessible partially hydrated UO 2F 2 system, with the symmetric O-U-O stretching vibration shifted approximately 47 cm -1 lower in energy compared to the anhydrous structure. Evidence of water interaction with the uranyl ion is present from a two-peak decomposition of the uranyl stretching vibration in the Raman spectra and anion hydrogen stretching vibrations in the inelastic neutron scattering spectra. A first-order dehydration phase transition temperature is definitively identified to be 125 °C using temperature-dependent Raman scattering.« less

  16. Mass-specific scattering coefficient for natural minerogenic particle populations: particle size distribution effect and closure analyses.

    PubMed

    Peng, Feng; Effler, Steve W

    2012-05-01

    The relationship between the particulate scattering coefficient (b(p)) and the concentration of suspended particulate matter (SPM), as represented by the mass-specific scattering coefficient of particulates (b(p)*=b(p)/SPM), depends on particle size distribution (PSD). This dependence is quantified for minerogenic particle populations in this paper through calculations of b(p)* for common minerals as idealized populations (monodispersed spheres); contemporaneous measurements of b(p), SPM, and light-scattering attributes of mineral particles with scanning electron microscopy interfaced with automated image and x-ray analyses (SAX), for a connected stream-reservoir system where minerogenic particles dominate b(p); and estimates of b(p) and its size dependency (through SAX results-driven Mie theory calculations), particle volume concentration, and b(p)*. Modest changes in minerogenic PSDs are shown to result in substantial variations in b(p)*. Good closure of the SAX-based estimates of b(p) and particle volume concentration with bulk measurements is demonstrated. Converging relationships between b(p)* and particle size, developed from three approaches, were well described by power law expressions.

  17. Clusters in intense x-ray pulses

    NASA Astrophysics Data System (ADS)

    Bostedt, Christoph

    2012-06-01

    Free-electron lasers can deliver extremely intense, coherent x-ray flashes with femtosecond pulse length, opening the door for imaging single nanoscale objects in a single shot. All matter irradiated by these intense x-ray pulses, however, will be transformed into a highly-excited non-equilibrium plasma within femtoseconds. During the x-ray pulse complex electron dynamics and the onset of atomic disorder will be induced, leading to a time-varying sample. We have performed first experiments about x-ray laser pulse -- cluster interaction with a combined spectroscopy and imaging approach at both, the FLASH free electron laser in Hamburg (Germany) and the LCLS x-ray free-electron laser in Stanford (California). Atomic clusters are ideal for investigating the light - matter interaction because their size can be tuned from the molecular to the bulk regime, thus allowing to distinguish between intra and inter atomic processes. Imaging experiments with xenon clusters show power-density dependent changes in the scattering patterns. Modeling the scattering data indicates that the optical constants of the clusters change during the femtosecond pulse due to the transient creation of high charge states. The results show that ultra fast scattering is a promising approach to study transient states of matter on a femtosecond time scale. Coincident recording of time-of-flight spectra and scattering patterns allows the deconvolution of focal volume and particle size distribution effects. Single-shot single-particle experiments with keV x-rays reveal that for the highest power densities an highly excited and hot cluster plasma is formed for which recombination is suppressed. Time resolved infrared pump -- x-ray probe experiments have started. Here, the clusters are pumped into a nanoplasma state and their time evolution is probed with femtosecond x-ray scattering. The data show strong variations in the scattering patterns stemming from electronic reconfigurations in the cluster plasma. The results will be compared to theoretical predictions and discussed in light of current developments at free-electron laser sources.

  18. On possibility of time reversal symmetry violation in neutrino elastic scattering on polarized electron target

    NASA Astrophysics Data System (ADS)

    Sobków, W.; Błaut, A.

    2018-03-01

    In this paper we indicate a possibility of utilizing the elastic scattering of Dirac low-energy (˜ 1 MeV) electron neutrinos (ν _es) on a polarized electron target (PET) in testing the time reversal symmetry violation (TRSV). We consider a scenario in which the incoming ν _e beam is a superposition of left chiral (LC) and right chiral (RC) states. LC ν _e interact mainly by the standard V-A and small admixture of non-standard scalar S_L, pseudoscalar P_L, tensor T_L interactions, while RC ones are only detected by the exotic V + A and S_R, P_R, T_R interactions. As a result of the superposition of the two chiralities the transverse components of ν e spin polarization (T-even and T-odd) may appear. We compute the differential cross section as a function of the recoil electron azimuthal angle and scattered electron energy, and show how the interference terms between standard V-A and exotic S_R, P_R, T_R couplings depend on the various angular correlations among the transversal ν _e spin polarization, the polarization of the electron target, the incoming neutrino momentum and the outgoing electron momentum in the limit of relativistic ν _e. We illustrate how the maximal value of recoil electrons azimuthal asymmetry and the asymmetry axis location of outgoing electrons depend on the azimuthal angle of the transversal component of the ν _e spin polarization, both for the time reversal symmetry conservation (TRSC) and TRSV. Next, we display that the electron energy spectrum and polar angle distribution of the recoil electrons are also sensitive to the interference terms between V-A and S_R, P_R, T_R couplings, proportional to the T-even and T-odd angular correlations among the transversal ν _e polarization, the electron polarization of the target, and the incoming ν _e momentum, respectively. We also discuss the possibility of testing the TRSV by observing the azimuthal asymmetry of outgoing electrons, using the PET without the impact of the transversal ν polarization related to the production process. In this scenario the predicted effects depend only on the interferences between S_R and T_R couplings. Our model-independent analysis is carried out for the flavor ν _e. To make such tests feasible, the intense (polarized) artificial ν _e source, PET and the appropriate detector measuring the directionality of the outgoing electrons and/or the recoil electrons energy with a high resolution have to be identified.

  19. Dyakonov-Perel Effect on Spin Dephasing in n-Type GaAs

    NASA Technical Reports Server (NTRS)

    Ning, C. Z.; Wu, M. W.

    2003-01-01

    A paper presents a study of the contribution of the Dyakonov-Perel (DP) effect to spin dephasing in electron-donor-doped bulk GaAs in the presence of an applied steady, moderate magnetic field perpendicular to the growth axis of the GaAs crystal. (The DP effect is an electron-wave-vector-dependent spin-state splitting of the conduction band, caused by a spin/orbit interaction in a crystal without an inversion center.) The applicable Bloch equations of kinetics were constructed to include terms accounting for longitudinal optical and acoustic phonon scattering as well as impurity scattering. The contributions of the aforementioned scattering mechanisms to spin-dephasing time in the presence of DP effect were examined by solving the equations numerically. Spin-dephasing time was obtained from the temporal evolution of the incoherently summed spin coherence. Effects of temperature, impurity level, magnetic field, and electron density on spin-dephasing time were investigated. Spin-dephasing time was found to increase with increasing magnetic field. Contrary to predictions of previous simplified treatments of the DP effect, spin-dephasing time was found to increase with temperature in the presence of impurity scattering. These results were found to agree qualitatively with results of recent experiments.

  20. Detective quantum efficiency of photon-counting x-ray detectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanguay, Jesse, E-mail: jessetan@mail.ubc.ca; Yun, Seungman; Kim, Ho Kyung

    Purpose: Single-photon-counting (SPC) x-ray imaging has the potential to improve image quality and enable novel energy-dependent imaging methods. Similar to conventional detectors, optimizing image SPC quality will require systems that produce the highest possible detective quantum efficiency (DQE). This paper builds on the cascaded-systems analysis (CSA) framework to develop a comprehensive description of the DQE of SPC detectors that implement adaptive binning. Methods: The DQE of SPC systems can be described using the CSA approach by propagating the probability density function (PDF) of the number of image-forming quanta through simple quantum processes. New relationships are developed to describe PDF transfermore » through serial and parallel cascades to accommodate scatter reabsorption. Results are applied to hypothetical silicon and selenium-based flat-panel SPC detectors including the effects of reabsorption of characteristic/scatter photons from photoelectric and Compton interactions, stochastic conversion of x-ray energy to secondary quanta, depth-dependent charge collection, and electronic noise. Results are compared with a Monte Carlo study. Results: Depth-dependent collection efficiency can result in substantial broadening of photopeaks that in turn may result in reduced DQE at lower x-ray energies (20–45 keV). Double-counting interaction events caused by reabsorption of characteristic/scatter photons may result in falsely inflated image signal-to-noise ratio and potential overestimation of the DQE. Conclusions: The CSA approach is extended to describe signal and noise propagation through photoelectric and Compton interactions in SPC detectors, including the effects of escape and reabsorption of emission/scatter photons. High-performance SPC systems can be achieved but only for certain combinations of secondary conversion gain, depth-dependent collection efficiency, electronic noise, and reabsorption characteristics.« less

  1. Detective quantum efficiency of photon-counting x-ray detectors.

    PubMed

    Tanguay, Jesse; Yun, Seungman; Kim, Ho Kyung; Cunningham, Ian A

    2015-01-01

    Single-photon-counting (SPC) x-ray imaging has the potential to improve image quality and enable novel energy-dependent imaging methods. Similar to conventional detectors, optimizing image SPC quality will require systems that produce the highest possible detective quantum efficiency (DQE). This paper builds on the cascaded-systems analysis (CSA) framework to develop a comprehensive description of the DQE of SPC detectors that implement adaptive binning. The DQE of SPC systems can be described using the CSA approach by propagating the probability density function (PDF) of the number of image-forming quanta through simple quantum processes. New relationships are developed to describe PDF transfer through serial and parallel cascades to accommodate scatter reabsorption. Results are applied to hypothetical silicon and selenium-based flat-panel SPC detectors including the effects of reabsorption of characteristic/scatter photons from photoelectric and Compton interactions, stochastic conversion of x-ray energy to secondary quanta, depth-dependent charge collection, and electronic noise. Results are compared with a Monte Carlo study. Depth-dependent collection efficiency can result in substantial broadening of photopeaks that in turn may result in reduced DQE at lower x-ray energies (20-45 keV). Double-counting interaction events caused by reabsorption of characteristic/scatter photons may result in falsely inflated image signal-to-noise ratio and potential overestimation of the DQE. The CSA approach is extended to describe signal and noise propagation through photoelectric and Compton interactions in SPC detectors, including the effects of escape and reabsorption of emission/scatter photons. High-performance SPC systems can be achieved but only for certain combinations of secondary conversion gain, depth-dependent collection efficiency, electronic noise, and reabsorption characteristics.

  2. Resonant Compton Scattering in Highly-Magnetized Pulsars

    NASA Astrophysics Data System (ADS)

    Wadiasingh, Zorawar

    Soft gamma repeaters and anomalous X-ray pulsars are subset of slow-rotating neutron stars, known as magnetars, that have extremely high inferred surface magnetic fields, of the order 100-1000 TeraGauss. Hard, non-thermal and pulsed persistent X-ray emission extending between 10 keV and 230 keV has been seen in a number of magnetars by RXTE, INTEGRAL, and Suzaku. In this thesis, the author considers inner magnetospheric models of such persistent hard X-ray emission where resonant Compton upscattering of soft thermal photons is anticipated to be the most efficient radiative process. This high efficiency is due to the relative proximity of the surface thermal photons, and also because the scattering becomes resonant at the cyclotron frequency. At the cyclotron resonance, the effective cross section exceeds the classical Thomson one by over two orders of magnitude, thereby enhancing the efficiency of continuum production and cooling of relativistic electrons. In this thesis, a new Sokolov and Ternov formulation of the QED Compton scattering cross section for strong magnetic fields is employed in electron cooling and emission spectra calculations. This formalism is formally correct for treating spin-dependent effects and decay rates that are important at the cyclotron resonance. The author presents electron cooling rates at arbitrary interaction points in a magnetosphere using the QED cross sections. The QED effects reduce the rates below high-field extrapolations of older magnetic Thomson results. The author also computes angle-dependent upscattering model spectra, formed using collisional integrals, for uncooled monoenergetic relativistic electrons injected in inner regions of pulsar magnetospheres. These spectra are integrated over closed field lines and obtained for different observing perspectives. The spectral cut-off energies are critically dependent on the observer viewing angles and electron Lorentz factor. It is found that electrons with energies less than around 15 MeV will emit most of their radiation below 250 keV, consistent with the observed turnovers in magnetar hard X-ray tails. Moreover, electrons of higher energy still emit most of the radiation below 1 MeV, except for very select viewing perspectives that sample tangents to field lines. This small parameter space makes it difficult to observe signals extending into the Fermi-LAT band. Polarization dependence in spectra is illustrated, offering potential constraints for models of magnetar emission in anticipation of a future hard X-ray polarimetry missions.

  3. Electron-impact excitation of He: Dependence of electron-photon coherence parameters on the principal quantum number

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hammond, P.; Khakoo, M.A.; McConkey, J.W.

    1987-12-01

    Measurements are presented representing a complete set of electron-photon polarization correlation parameters for the excitation of n /sup 1/P states of He at an incident energy of 80 eV and an electron scattering angle of 20/sup 0/. The data support the predictions of a recent theoretical paper that these parameters should exhibit little variation with n. However, disagreement in absolute values between experiment and theory indicates the need for additional theoretical input into the problem.

  4. Ponderomotive phase plate for transmission electron microscopes

    DOEpatents

    Reed, Bryan W [Livermore, CA

    2012-07-10

    A ponderomotive phase plate system and method for controllably producing highly tunable phase contrast transfer functions in a transmission electron microscope (TEM) for high resolution and biological phase contrast imaging. The system and method includes a laser source and a beam transport system to produce a focused laser crossover as a phase plate, so that a ponderomotive potential of the focused laser crossover produces a scattering-angle-dependent phase shift in the electrons of the post-sample electron beam corresponding to a desired phase contrast transfer function.

  5. Polarization of the Sunyaev-Zel'dovich effect: relativistic imprint of thermal and non-thermal plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Emritte, Mohammad Shehzad; Colafrancesco, Sergio; Marchegiani, Paolo, E-mail: Sergio.Colafrancesco@wits.ac.za, E-mail: emrittes@yahoo.com, E-mail: Paolo.Marchegiani@wits.ac.za

    2016-07-01

    Inverse Compton (IC) scattering of the anisotropic CMB fluctuations off cosmic electron plasmas generates a polarization of the associated Sunyaev-Zel'dovich (SZ) effect. The polarized SZ effect has important applications in cosmology and in astrophysics of galaxy clusters. However, this signal has been studied so far mostly in the non-relativistic regime which is valid only in the very low electron temperature limit for a thermal electron population and, as such, has limited astrophysical applications. Partial attempts to extend this calculation to the IC scattering of a thermal electron plasma in the relativistic regime have been done but these cannot be appliedmore » to a more general or mildly relativistic electron distribution. In this paper we derive a general form of the SZ effect polarization that is valid in the full relativistic approach for both thermal and non-thermal electron plasmas, as well as for a generic combination of various electron population which can be co-spatially distributed in the environments of galaxy clusters or radiogalaxy lobes. We derive the spectral shape of the Stokes parameters induced by the IC scattering of every CMB multipole for both thermal and non-thermal electron populations, focussing in particular on the CMB quadrupole and octupole that provide the largest detectable signals in cosmic structures (like galaxy clusters). We found that the CMB quadrupole induced Stoke parameter Q is always positive with a maximum amplitude at a frequency ≈ 216 GHz which increases non-linearly with increasing cluster temperature. On the contrary, the CMB octupole induced Q spectrum shows a cross-over frequency which depends on the cluster electron temperature in a linear way, while it shows a non-linear dependence on the minimum momentum p {sub 1} of a non-thermal power-law spectrum as well as a linear dependence on the power-law spectral index of the non-thermal electron population. We discuss some of the possibilities to disentangle the quadrupole-induced Q spectrum from the octupole-induced one which will allow to measure these important cosmological quantities through the SZ effect polarization at different cluster locations in the universe. We finally apply our model to the Bullet cluster and derive the visibility windows of the total, quandrupole-induced and octupole-induced Stoke parameter Q in the frequency ranges accessible to SKA, ALMA, MILLIMETRON and CORE++ experiments.« less

  6. Quasiparticle interference in ZrSiS: Strongly band-selective scattering depending on impurity lattice site

    NASA Astrophysics Data System (ADS)

    Butler, Christopher J.; Wu, Yu-Mi; Hsing, Cheng-Rong; Tseng, Yi; Sankar, Raman; Wei, Ching-Ming; Chou, Fang-Cheng; Lin, Minn-Tsong

    2017-11-01

    Scanning tunneling microscopy visualizations of quasiparticle interference (QPI) enable powerful insights into the k -space properties of superconducting, topological, Rashba, and other exotic electronic phases, but their reliance on impurities acting as scattering centers is rarely scrutinized. Here, we investigate QPI at the vacuum-cleaved (001) surface of the Dirac semimetal ZrSiS. We find that interference patterns around impurities located on the Zr and S lattice sites appear very different, and can be ascribed to selective scattering of different subsets of the predominantly Zr 4 d -derived band structure, namely, the m =0 and ±1 components. We show that the selectivity of scattering channels requires an explanation beyond the different bands' orbital characteristics and their respective charge density distributions over Zr and S lattice sites. Importantly, this result shows that the usual assumption of generic scattering centers allowing observations of quasiparticle interference to shed light indiscriminately and isotropically upon the q space of scattering events does not hold, and that the scope and interpretation of QPI observations can therefore be be strongly contingent on the material defect chemistry. This finding promises to spur new investigations into the quasiparticle scattering process itself, to inform future interpretations of quasiparticle interference observations, and ultimately to aid the understanding and engineering of quantum electronic transport properties.

  7. Resonant inelastic x-ray scattering study of charge excitations in superconducting and nonsuperconducting PrFeAsO₁₋ y

    DOE PAGES

    Jarrige, I.; Nomura, T.; Ishii, K.; ...

    2012-09-05

    We report the first observation by momentum-resolved resonant inelastic x-ray scattering of charge excitations in an iron-based superconductor and its parent compound, PrFeAsO₀.₇ and PrFeAsO, respectively, with two main results. First, using calculations based on a 16-band dp model, we show that the energy of the lowest-lying excitations, identified as dd interband transitions of dominant xz,yz orbital character, exhibits a dramatic dependence on electron correlation. This enables us to estimate the Coulomb repulsion U and Hund's coupling J, and to highlight the role played by J in these peculiar orbital-dependent electron correlation effects. Second, we show that short-range antiferromagnetic correlations,more » which are a prerequisite to the occurrence of these excitations at the Γ point, are still present in the superconducting state.« less

  8. Collision dynamics of H+ + N2 at low energies based on time-dependent density-functional theory

    NASA Astrophysics Data System (ADS)

    Yu, W.; Zhang, Y.; Zhang, F. S.; Hutton, R.; Zou, Y.; Gao, C.-Z.; Wei, B.

    2018-02-01

    Using time-dependent density-functional theory at the level of local density approximation augmented by a self-interaction correction and coupled non-adiabatically to molecular dynamics, we study, from a theoretical perspective, scattering dynamics of the proton in collisions with the N2 molecule at 30 eV. Nine different collision configurations are employed to analyze the proton energy loss spectra, electron depletion, scattering angles and self-interaction effects. Our results agree qualitatively with the experimental data and previous theoretical calculations. The discrepancies are ascribed to the limitation of the theoretical models in use. We find that self-interaction effects can significantly influence the electron capture and the excited diatomic vibrational motion, which is in consistent with other calculations. In addition, it is found that the molecular structure can be readily retrieved from the proton energy loss spectra due to a significant momentum transfer in head-on collisions.

  9. Outrunning damage: Electrons vs X-rays-timescales and mechanisms.

    PubMed

    Spence, John C H

    2017-07-01

    Toward the end of his career, Zewail developed strong interest in fast electron spectroscopy and imaging, a field to which he made important contributions toward his aim of making molecular movies free of radiation damage. We therefore compare here the atomistic mechanisms leading to destruction of protein samples in diffract-and-destroy experiments for the cases of high-energy electron beam irradiation and X-ray laser pulses. The damage processes and their time-scales are compared and relevant elastic, inelastic, and photoelectron cross sections are given. Inelastic mean-free paths for ejected electrons at very low energies in insulators are compared with the bioparticle size. The dose rate and structural damage rate for electrons are found to be much lower, allowing longer pulses, reduced beam current, and Coulomb interactions for the formation of smaller probes. High-angle electron scattering from the nucleus, which has no parallel in the X-ray case, tracks the slowly moving nuclei during the explosion, just as the gain of the XFEL (X-ray free-electron laser) has no parallel in the electron case. Despite reduced damage and much larger elastic scattering cross sections in the electron case, leading to not dissimilar elastic scattering rates (when account is taken of the greatly increased incident XFEL fluence), progress for single-particle electron diffraction is seen to depend on the effort to reduce emittance growth due to Coulomb interactions, and so allow formation of intense sub-micron beams no larger than a virus.

  10. Outrunning damage: Electrons vs X-rays—timescales and mechanisms

    PubMed Central

    Spence, John C. H.

    2017-01-01

    Toward the end of his career, Zewail developed strong interest in fast electron spectroscopy and imaging, a field to which he made important contributions toward his aim of making molecular movies free of radiation damage. We therefore compare here the atomistic mechanisms leading to destruction of protein samples in diffract-and-destroy experiments for the cases of high-energy electron beam irradiation and X-ray laser pulses. The damage processes and their time-scales are compared and relevant elastic, inelastic, and photoelectron cross sections are given. Inelastic mean-free paths for ejected electrons at very low energies in insulators are compared with the bioparticle size. The dose rate and structural damage rate for electrons are found to be much lower, allowing longer pulses, reduced beam current, and Coulomb interactions for the formation of smaller probes. High-angle electron scattering from the nucleus, which has no parallel in the X-ray case, tracks the slowly moving nuclei during the explosion, just as the gain of the XFEL (X-ray free-electron laser) has no parallel in the electron case. Despite reduced damage and much larger elastic scattering cross sections in the electron case, leading to not dissimilar elastic scattering rates (when account is taken of the greatly increased incident XFEL fluence), progress for single-particle electron diffraction is seen to depend on the effort to reduce emittance growth due to Coulomb interactions, and so allow formation of intense sub-micron beams no larger than a virus. PMID:28653018

  11. Microwave zero-resistance states in a bilayer electron system.

    PubMed

    Wiedmann, S; Gusev, G M; Raichev, O E; Bakarov, A K; Portal, J C

    2010-07-09

    Magnetotransport measurements on a high-mobility electron bilayer system formed in a wide GaAs quantum well reveal vanishing dissipative resistance under continuous microwave irradiation. Profound zero-resistance states (ZRS) appear even in the presence of additional intersubband scattering of electrons. We study the dependence of photoresistance on frequency, microwave power, and temperature. Experimental results are compared with a theory demonstrating that the conditions for absolute negative resistivity correlate with the appearance of ZRS.

  12. Quasiparticle Scattering in Type-II Weyl semimetal MoTe2.

    PubMed

    Lin, Chun-Liang; Arafune, Ryuichi; Minamitani, Emi; Kawai, Maki; Takagi, Noriaki

    2018-01-30

    The electronic structure of type-II Weyl semimetal molybdenum ditelluride (MoTe<sub>2</sub>) is studied by using scanning tunneling microscopy and density functional theory calculations. Through measuring energy-dependent quasiparticle interference (QPI) patterns with a cryogenic scanning tunneling microscope, several characteristic features are found in the QPI patterns. Two of them arise from the Weyl semimetal nature; one is the topological Fermi arc surface state and the other can be assigned to be a Weyl point. The remaining structures are derived from the scatterings relevant to the bulk electronic states. The findings lead to thorough understanding of the topological electronic structure of type-II Weyl semimetal MoTe<sub>2</sub>. © 2018 IOP Publishing Ltd.

  13. Electronic transport properties of inner and outer shells in near ohmic-contacted double-walled carbon nanotube transistors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yuchun; Zhou, Liyan; Zhao, Shangqian

    2014-06-14

    We investigate electronic transport properties of field-effect transistors based on double-walled carbon nanotubes, of which inner shells are metallic and outer shells are semiconducting. When both shells are turned on, electron-phonon scattering is found to be the dominant phenomenon. On the other hand, when outer semiconducting shells are turned off, a zero-bias anomaly emerges in the dependence of differential conductance on the bias voltage, which is characterized according to the Tomonaga-Luttinger liquid model describing tunneling into one-dimensional materials. We attribute these behaviors to different contact conditions for outer and inner shells of the double-walled carbon nanotubes. A simple model combiningmore » Luttinger liquid model for inner metallic shells and electron-phonon scattering in outer semiconducting shells is given here to explain our transport data at different temperatures.« less

  14. Copper plasmonics and catalysis: role of electron-phonon interactions in dephasing localized surface plasmons

    NASA Astrophysics Data System (ADS)

    Sun, Qi-C.; Ding, Yuchen; Goodman, Samuel M.; H. Funke, Hans; Nagpal, Prashant

    2014-10-01

    Copper metal can provide an important alternative for the development of efficient, low-cost and low-loss plasmonic nanoparticles, and selective nanocatalysts. However, poor chemical stability and lack of insight into photophysics and plasmon decay mechanisms has impeded study. Here, we use smooth conformal ALD coating on copper nanoparticles to prevent surface oxidation, and study dephasing time for localized surface plasmons on different sized copper nanoparticles. Using dephasing time as a figure of merit, we elucidate the role of electron-electron, electron-phonon, impurity, surface and grain boundary scattering on the decay of localized surface plasmon waves. Using our quantitative analysis and different temperature dependent measurements, we show that electron-phonon interactions dominate over other scattering mechanisms in dephasing plasmon waves. While interband transitions in copper metal contributes substantially to plasmon losses, tuning surface plasmon modes to infrared frequencies leads to a five-fold enhancement in the quality factor. These findings demonstrate that conformal ALD coatings can improve the chemical stability for copper nanoparticles, even at high temperatures (>300 °C) in ambient atmosphere, and nanoscaled copper is a good alternative material for many potential applications in nanophotonics, plasmonics, catalysis and nanoscale electronics.Copper metal can provide an important alternative for the development of efficient, low-cost and low-loss plasmonic nanoparticles, and selective nanocatalysts. However, poor chemical stability and lack of insight into photophysics and plasmon decay mechanisms has impeded study. Here, we use smooth conformal ALD coating on copper nanoparticles to prevent surface oxidation, and study dephasing time for localized surface plasmons on different sized copper nanoparticles. Using dephasing time as a figure of merit, we elucidate the role of electron-electron, electron-phonon, impurity, surface and grain boundary scattering on the decay of localized surface plasmon waves. Using our quantitative analysis and different temperature dependent measurements, we show that electron-phonon interactions dominate over other scattering mechanisms in dephasing plasmon waves. While interband transitions in copper metal contributes substantially to plasmon losses, tuning surface plasmon modes to infrared frequencies leads to a five-fold enhancement in the quality factor. These findings demonstrate that conformal ALD coatings can improve the chemical stability for copper nanoparticles, even at high temperatures (>300 °C) in ambient atmosphere, and nanoscaled copper is a good alternative material for many potential applications in nanophotonics, plasmonics, catalysis and nanoscale electronics. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr04719b

  15. Electron scattering by molecules. II - Experimental methods and data

    NASA Technical Reports Server (NTRS)

    Trajmar, S.; Chutjian, A.; Register, D. F.

    1983-01-01

    Experimental techniques for measuring electron-molecule collision cross sections are briefly summarized. A survey of the available experimental cross section data is presented. The emphasis here is on elastic scattering, rotational, vibrational and electronic excitations, total electron scattering, and momentum transfer in the few eV to few hundred eV impact energy range. Reference is made to works concerned with high energy electron scattering, innershell and multi-electron excitations, conicidence methods and electron scattering in laser fields.

  16. Quantum State-Resolved Collision Dynamics of Nitric Oxide at Ionic Liquid and Molten Metal Surfaces

    NASA Astrophysics Data System (ADS)

    Zutz, Amelia Marie

    Detailed molecular scale interactions at the gas-liquid interface are explored with quantum state-to-state resolved scattering of a jet-cooled beam of NO(2pi1/2; N = 0) from ionic liquid and molten metal surfaces. The scattered distributions are probed via laser-induced fluorescence methods, which yield rotational and spin-orbit state populations that elucidate the dynamics of energy transfer at the gas-liquid interface. These collision dynamics are explored as a function of incident collision energy, surface temperature, scattering angle, and liquid identity, all of which are found to substantially affect the degree of rotational, electronic and vibrational excitation of NO via collisions at the liquid surface. Rotational distributions observed reveal two distinct scattering pathways, (i) molecules that trap, thermalize and eventually desorb from the surface (trapping-desorption, TD), and (ii) those that undergo prompt recoil (impulsive scattering, IS) prior to complete equilibration with the liquid surface. Thermally desorbing NO molecules are found to have rotational temperatures close to, but slightly cooler than the surface temperature, indicative of rotational dependent sticking probabilities on liquid surfaces. Nitric oxide is a radical with multiple low-lying electronic states that serves as an ideal candidate for exploring nonadiabatic state-changing collision dynamics at the gas-liquid interface, which induce significant excitation from ground (2pi1/2) to excited (2pi 3/2) spin-orbit states. Molecular beam scattering of supersonically cooled NO from hot molten metals (Ga and Au, Ts = 300 - 1400 K) is also explored, which provide preliminary evidence for vibrational excitation of NO mediated by thermally populated electron-hole pairs in the hot, conducting liquid metals. The results highlight the presence of electronically nonadiabatic effects and build toward a more complete characterization of energy transfer dynamics at gas-liquid interfaces.

  17. Temperature-dependent spectral linewidths of terahertz Bloch oscillations in biased semiconductor superlattices

    NASA Astrophysics Data System (ADS)

    Unuma, Takeya; Matsuda, Aleph

    2018-04-01

    We investigate temperature-dependent spectral linewidths of Bloch oscillations in biased semiconductor superlattices experimentally and theoretically. The spectral linewidth in a GaAs-based superlattice determined by terahertz emission spectroscopy becomes larger gradually as temperature increases from 80 to 320 K. This behavior can be quantitatively reproduced by a microscopic theory of the spectral linewidth that has been extended to treat the phonon scattering and interface roughness scattering of electrons on a Wannier-Stark ladder. A detailed comparison between the terahertz measurements and theoretical simulations reveals that the LO phonon absorption process governs the increase in the spectral linewidth with increasing temperature.

  18. Electronic transport properties of single-crystal bismuth nanowire arrays

    NASA Astrophysics Data System (ADS)

    Zhang, Zhibo; Sun, Xiangzhong; Dresselhaus, M. S.; Ying, Jackie Y.; Heremans, J.

    2000-02-01

    We present here a detailed study of the electrical transport properties of single-crystal bismuth nanowire arrays embedded in a dielectric matrix. Measurements of the resistance of Bi nanowire arrays with different wire diameters (60-110 nm) have been carried out over a wide range of temperatures (2.0-300 K) and magnetic fields (0-5.4 T). The transport properties of a heavily Te-doped Bi nanowire array have also been studied. At low temperatures, we show that the wire boundary scattering is the dominant scattering process for carriers in the undoped single-crystal Bi nanowires, while boundary scattering is less important for a heavily Te-doped sample, consistent with general theoretical considerations. The temperature dependences of the zero-field resistivity and of the longitudinal magneto-coefficient of the Bi nanowires were also studied and were found to be sensitive to the wire diameter. The quantum confinement of carriers is believed to play an important role in determining the overall temperature dependence of the zero-field resistivity. Theoretical considerations of the quantum confinement effects on the electronic band structure and on the transport properties of Bi nanowires are discussed. Despite the evidence for localization effects and diffusive electron interactions at low temperatures (T<=4.0 K), localization effects are not the dominant mechanisms affecting the resistivity or the magnetoresistance in the temperature range of this study.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Johnson, W. R.; Nilsen, J.

    Here, the influence of finite relaxation times on Thomson scattering from warm dense plasmas is examined within the framework of the average-atom approximation. Presently most calculations use the collision-free Lindhard dielectric function to evaluate the free-electron contribution to the Thomson cross section. In this work, we use the Mermin dielectric function, which includes relaxation time explicitly. The relaxation time is evaluated by treating the average atom as an impurity in a uniform electron gas and depends critically on the transport cross section. The calculated relaxation rates agree well with values inferred from the Ziman formula for the static conductivity andmore » also with rates inferred from a fit to the frequency-dependent conductivity. Transport cross sections determined by the phase-shift analysis in the average-atom potential are compared with those evaluated in the commonly used Born approximation. The Born approximation converges to the exact cross sections at high energies; however, differences that occur at low energies lead to corresponding differences in relaxation rates. The relative importance of including relaxation time when modeling x-ray Thomson scattering spectra is examined by comparing calculations of the free-electron dynamic structure function for Thomson scattering using Lindhard and Mermin dielectric functions. Applications are given to warm dense Be plasmas, with temperatures ranging from 2 to 32 eV and densities ranging from 2 to 64 g/cc.« less

  20. Resonant inelastic x-ray scattering and photoemission measurement of O2: Direct evidence for dependence of Rydberg-valence mixing on vibrational states in O 1s → Rydberg states

    NASA Astrophysics Data System (ADS)

    Gejo, T.; Oura, M.; Tokushima, T.; Horikawa, Y.; Arai, H.; Shin, S.; Kimberg, V.; Kosugi, N.

    2017-07-01

    High-resolution resonant inelastic x-ray scattering (RIXS) and low-energy photoemission spectra of oxygen molecules have been measured for investigating the electronic structure of Rydberg states in the O 1s → σ* energy region. The electronic characteristics of each Rydberg state have been successfully observed, and new assignments are made for several states. The RIXS spectra clearly show that vibrational excitation is very sensitive to the electronic characteristics because of Rydberg-valence mixing and vibronic coupling in O2. This observation constitutes direct experimental evidence that the Rydberg-valence mixing characteristic depends on the vibrational excitation near the avoided crossing of potential surfaces. We also measured the photoemission spectra of metastable oxygen atoms (O*) from O2 excited to 1s → Rydberg states. The broadening of the 4p Rydberg states of O* has been found with isotropic behavior, implying that excited oxygen molecules undergo dissociation with a lifetime of the order of 10 fs in 1s → Rydberg states.

  1. Energy and Momentum Relaxation Times of 2D Electrons Due to Near Surface Deformation Potential Scattering

    NASA Astrophysics Data System (ADS)

    Pipa, Viktor; Vasko, Fedor; Mitin, Vladimir

    1997-03-01

    The low temperature energy and momentum relaxation rates of 2D electron gas placed near the free or clamped surface of a semi-infinit sample are calculated. To describe the electron-acoustic phonon interaction with allowance of the surface effect the method of elasticity theory Green functions was used. This method allows to take into account the reflection of acoustic waves from the surface and related mutual conversion of LA and TA waves. It is shown that the strength of the deformation potential scattering at low temperatures substantially depends on the mechanical conditions at the surface: relaxation rates are suppressed for the free surface while for the rigid one the rates are enhanced. The dependence of the conductivity on the distance between the 2D layer and the surface is discussed. The effect is most pronounced in the range of temperatures 2 sl pF < T < (2 hbar s_l)/d, where pF is the Fermi momentum, sl is the velocity of LA waves, d is the width of the quantum well.

  2. The effect of density fluctuations on electron cyclotron beam broadening and implications for ITER

    NASA Astrophysics Data System (ADS)

    Snicker, A.; Poli, E.; Maj, O.; Guidi, L.; Köhn, A.; Weber, H.; Conway, G.; Henderson, M.; Saibene, G.

    2018-01-01

    We present state-of-the-art computations of propagation and absorption of electron cyclotron waves, retaining the effects of scattering due to electron density fluctuations. In ITER, injected microwaves are foreseen to suppress neoclassical tearing modes (NTMs) by driving current at the q=2 and q=3/2 resonant surfaces. Scattering of the beam can spoil the good localization of the absorption and thus impair NTM control capabilities. A novel tool, the WKBeam code, has been employed here in order to investigate this issue. The code is a Monte Carlo solver for the wave kinetic equation and retains diffraction, full axisymmetric tokamak geometry, determination of the absorption profile and an integral form of the scattering operator which describes the effects of turbulent density fluctuations within the limits of the Born scattering approximation. The approach has been benchmarked against the paraxial WKB code TORBEAM and the full-wave code IPF-FDMC. In particular, the Born approximation is found to be valid for ITER parameters. In this paper, we show that the radiative transport of EC beams due to wave scattering in ITER is diffusive unlike in present experiments, thus causing up to a factor of 2-4 broadening in the absorption profile. However, the broadening depends strongly on the turbulence model assumed for the density fluctuations, which still has large uncertainties.

  3. Radiation of the high-order plasmonic modes of large gold nanospheres excited by surface plasmon polaritons.

    PubMed

    Chen, Jing-Dong; Xiang, Jin; Jiang, Shuai; Dai, Qiao-Feng; Tie, Shao-Long; Lan, Sheng

    2018-05-17

    Large metallic nanoparticles with sizes comparable to the wavelength of light are expected to support high-order plasmon modes exhibiting resonances in the visible to near infrared spectral range. However, the radiation behavior of high-order plasmon modes, including scattering spectra and radiation patterns, remains unexplored. Here, we report on the first observation and characterization of the high-order plasmon modes excited in large gold nanospheres by using the surface plasmon polaritons generated on the surface of a thin gold film. The polarization-dependent scattering spectra were measured by inserting a polarization analyzer in the collection channel and the physical origins of the scattering peaks observed in the scattering spectra were clearly identified. More interestingly, the radiation of electric quadrupoles and octupoles was resolved in both frequency and spatial domains. In addition, the angular dependences of the radiation intensity for all plasmon modes were extracted by fitting the polarization-dependent scattering spectra with multiple Lorentz line shapes. A significant enhancement of the electric field was found in the gap plasmon modes and it was employed to generate hot-electron intraband luminescence. Our findings pave the way for exploiting the high-order plasmon modes of large metallic nanoparticles in the manipulation of light radiation and light-matter interaction.

  4. Spin-orbit coupling and surface magnetism coexisting in spin-dependent low-energy He+-ion surface scattering

    NASA Astrophysics Data System (ADS)

    Suzuki, T. T.; Sakai, O.

    2017-04-01

    Surface magnetism is analyzed by spin-dependent He+-ion neutralization (the Auger neutralization) in the vicinity of a surface using an electron spin-polarized low-energy He+-ion beam [spin-polarized ion scattering spectroscopy (SP-ISS)]. Recently, spin-orbit coupling (SOC) has been found to act as another mechanism of spin-dependent low-energy He+-ion scattering. Thus, it is crucial for surface magnetism analyses by SP-ISS to separate those two mechanisms. In the present study, we investigated the spin-induced asymmetry in scattering of low-energy He+ ions on ultrathin Au and Sn films as well as the oxygen adsorbate on a magnetized-Fe(100) surface where these two mechanisms may coexist. We found that the Fe surface magnetism immediately disappeared with the growth of those overlayers. On the other hand, we observed no induced spin polarization in the Au and Sn thin films even in the very initial stage of the growth. We also observed that the spin asymmetry of the O adsorbate was induced by the magnetism of the underlying Fe substrate. The present study demonstrates that the two mechanisms of the spin-asymmetric He+-ion scattering (the ion neutralization and SOC) can be separated by an azimuthal-angle-resolved SP-ISS measurement.

  5. Wave-packet continuum-discretization approach to ion-atom collisions including rearrangement: Application to differential ionization in proton-hydrogen scattering

    NASA Astrophysics Data System (ADS)

    Abdurakhmanov, I. B.; Bailey, J. J.; Kadyrov, A. S.; Bray, I.

    2018-03-01

    In this work, we develop a wave-packet continuum-discretization approach to ion-atom collisions that includes rearrangement processes. The total scattering wave function is expanded using a two-center basis built from wave-packet pseudostates. The exact three-body Schrödinger equation is converted into coupled-channel differential equations for time-dependent expansion coefficients. In the asymptotic region these time-dependent coefficients represent transition amplitudes for all processes including elastic scattering, excitation, ionization, and electron capture. The wave-packet continuum-discretization approach is ideal for differential ionization studies as it allows one to generate pseudostates with arbitrary energies and distribution. The approach is used to calculate the double differential cross section for ionization in proton collisions with atomic hydrogen. Overall good agreement with experiment is obtained for all considered cases.

  6. Are quantum spin Hall edge modes more resilient to disorder, sample geometry and inelastic scattering than quantum Hall edge modes?

    PubMed

    Mani, Arjun; Benjamin, Colin

    2016-04-13

    On the surface of 2D topological insulators, 1D quantum spin Hall (QSH) edge modes occur with Dirac-like dispersion. Unlike quantum Hall (QH) edge modes, which occur at high magnetic fields in 2D electron gases, the occurrence of QSH edge modes is due to spin-orbit scattering in the bulk of the material. These QSH edge modes are spin-dependent, and chiral-opposite spins move in opposing directions. Electronic spin has a larger decoherence and relaxation time than charge. In view of this, it is expected that QSH edge modes will be more robust to disorder and inelastic scattering than QH edge modes, which are charge-dependent and spin-unpolarized. However, we notice no such advantage accrues in QSH edge modes when subjected to the same degree of contact disorder and/or inelastic scattering in similar setups as QH edge modes. In fact we observe that QSH edge modes are more susceptible to inelastic scattering and contact disorder than QH edge modes. Furthermore, while a single disordered contact has no effect on QH edge modes, it leads to a finite charge Hall current in the case of QSH edge modes, and thus a vanishing of the pure QSH effect. For more than a single disordered contact while QH states continue to remain immune to disorder, QSH edge modes become more susceptible--the Hall resistance for the QSH effect changes sign with increasing disorder. In the case of many disordered contacts with inelastic scattering included, while quantization of Hall edge modes holds, for QSH edge modes a finite charge Hall current still flows. For QSH edge modes in the inelastic scattering regime we distinguish between two cases: with spin-flip and without spin-flip scattering. Finally, while asymmetry in sample geometry can have a deleterious effect in the QSH case, it has no impact in the QH case.

  7. Measuring Transmission Efficiencies Of Mass Spectrometers

    NASA Technical Reports Server (NTRS)

    Srivastava, Santosh K.

    1989-01-01

    Coincidence counts yield absolute efficiencies. System measures mass-dependent transmission efficiencies of mass spectrometers, using coincidence-counting techniques reminiscent of those used for many years in calibration of detectors for subatomic particles. Coincidences between detected ions and electrons producing them counted during operation of mass spectrometer. Under certain assumptions regarding inelastic scattering of electrons, electron/ion-coincidence count is direct measure of transmission efficiency of spectrometer. When fully developed, system compact, portable, and used routinely to calibrate mass spectrometers.

  8. Phonon-driven electron scattering and magnetothermoelectric effect in two-dimensional tin selenide

    NASA Astrophysics Data System (ADS)

    Yang, Kaike; Ren, Ji-Chang; Qiu, Hongfei; Wang, Jian-Sheng

    2018-02-01

    The bulk tin selenide (SnSe) is the best thermoelectric material currently with the highest figure-of-merit due to strong phonon-phonon interactions. We investigate the effect of electron-phonon coupling (EPC) on the transport properties of a two-dimensional (2D) SnSe sheet. We demonstrate that EPC plays a key role in the scattering rate when the constant relaxation time approximation is deficient. The EPC strength is especially large in contrast to that of pristine graphene. The scattering rate depends sensitively on the system temperatures and the carrier densities when the Fermi energy approaches the band edge. We also investigate the magnetothermoelectric effect of the 2D SnSe. It is found that at low temperatures there is enormous magnetoelectrical resistivity and magnetothermal resistivity above 200%, suggesting possible potential applications in device design. Our results agree qualitatively well with the experimental data.

  9. Electron Dynamics in the Core-Excited CS2 Molecule Revealed through Resonant Inelastic X-Ray Scattering Spectroscopy

    NASA Astrophysics Data System (ADS)

    Marchenko, T.; Carniato, S.; Journel, L.; Guillemin, R.; Kawerk, E.; Žitnik, M.; Kavčič, M.; Bučar, K.; Bohinc, R.; Petric, M.; Vaz da Cruz, V.; Gel'mukhanov, F.; Simon, M.

    2015-07-01

    We present an experimental and theoretical study of resonant inelastic x-ray scattering (RIXS) in the carbon disulphide CS2 molecule near the sulfur K-absorption edge. We observe a strong evolution of the RIXS spectral profile with the excitation energy tuned below the lowest unoccupied molecular orbital (LUMO) absorption resonance. The reason for this is twofold. Reducing the photon energy in the vicinity of the LUMO absorption resonance leads to a relative suppression of the LUMO contribution with respect to the emission signal from the higher unoccupied molecular orbitals, which results in the modulation of the total RIXS profile. At even larger negative photon-energy detuning from the resonance, the excitation-energy dependence of the RIXS profile is dominated by the onset of electron dynamics triggered by a coherent excitation of multiple electronic states. Furthermore, our study demonstrates that in the hard x-ray regime, localization of the S 1s core hole occurs in CS2 during the RIXS process because of the orientational dephasing of interference between the waves scattering on the two sulfur atoms. Core-hole localization leads to violation of the symmetry selection rules for the electron transitions observed in the spectra.

  10. Alignment error envelopes for single particle analysis.

    PubMed

    Jensen, G J

    2001-01-01

    To determine the structure of a biological particle to high resolution by electron microscopy, image averaging is required to combine information from different views and to increase the signal-to-noise ratio. Starting from the number of noiseless views necessary to resolve features of a given size, four general factors are considered that increase the number of images actually needed: (1) the physics of electron scattering introduces shot noise, (2) thermal motion and particle inhomogeneity cause the scattered electrons to describe a mixture of structures, (3) the microscope system fails to usefully record all the information carried by the scattered electrons, and (4) image misalignment leads to information loss through incoherent averaging. The compound effect of factors 2-4 is approximated by the product of envelope functions. The problem of incoherent image averaging is developed in detail through derivation of five envelope functions that account for small errors in 11 "alignment" parameters describing particle location, orientation, defocus, magnification, and beam tilt. The analysis provides target error tolerances for single particle analysis to near-atomic (3.5 A) resolution, and this prospect is shown to depend critically on image quality, defocus determination, and microscope alignment. Copyright 2001 Academic Press.

  11. Impurity and phonon scattering in silicon nanowires

    NASA Astrophysics Data System (ADS)

    Zhang, W.; Persson, M. P.; Mera, H.; Delerue, C.; Niquet, Y. M.; Allan, G.; Wang, E.

    2011-03-01

    We model the scattering of electrons by phonons and dopant impurities in ultimate [110]-oriented gate-all-around silicon nanowires with an atomistic valence force field and tight-binding approach. All electron-phonons interactions are included. We show that impurity scattering can reduce with decreasing nanowire diameter due to the enhanced screening by the gate. Donors and acceptors however perform very differently : acceptors behave as tunnel barriers for the electrons, while donors behave as quantum wells which introduce Fano resonances in the conductance. As a consequence the acceptors are much more limiting the mobility than the donors. The resistances of single acceptors are also very dependent on their radial position in the nanowire, which might be a significant source of variability in ultimate silicon nanowire devices. Concerning phonons, we show that, as a result of strong confinement, i) electrons couple to a wide and complex distribution of phonons modes, and ii) the mobility has a non-monotonic variation with wire diameter and is strongly reduced with respect to bulk. French National Research Agency ANR project QUANTAMONDE Contract No. ANR-07-NANO-023-02 and by the Délégation Générale pour l'Armement, French Ministry of Defense under Grant No. 2008.34.0031.

  12. Reproducing the observed energy-dependent structure of Earth's electron radiation belts during storm recovery with an event-specific diffusion model

    DOE PAGES

    Ripoll, J. -F.; Reeves, Geoffrey D.; Cunningham, Gregory Scott; ...

    2016-06-11

    Here, we present dynamic simulations of energy-dependent losses in the radiation belt “slot region” and the formation of the two-belt structure for the quiet days after the 1 March storm. The simulations combine radial diffusion with a realistic scattering model, based data-driven spatially and temporally resolved whistler-mode hiss wave observations from the Van Allen Probes satellites. The simulations reproduce Van Allen Probes observations for all energies and L shells (2–6) including (a) the strong energy dependence to the radiation belt dynamics (b) an energy-dependent outer boundary to the inner zone that extends to higher L shells at lower energies andmore » (c) an “S-shaped” energy-dependent inner boundary to the outer zone that results from the competition between diffusive radial transport and losses. We find that the characteristic energy-dependent structure of the radiation belts and slot region is dynamic and can be formed gradually in ~15 days, although the “S shape” can also be reproduced by assuming equilibrium conditions. The highest-energy electrons (E > 300 keV) of the inner region of the outer belt (L ~ 4–5) also constantly decay, demonstrating that hiss wave scattering affects the outer belt during times of extended plasmasphere. Through these simulations, we explain the full structure in energy and L shell of the belts and the slot formation by hiss scattering during storm recovery. We show the power and complexity of looking dynamically at the effects over all energies and L shells and the need for using data-driven and event-specific conditions.« less

  13. Competitive Self-Assembly Manifests Supramolecular Darwinism in Soft-Oxometalates

    NASA Astrophysics Data System (ADS)

    Das, Santu; Kumar, Saurabh; Mallick, Apabrita; Roy, Soumyajit

    2015-09-01

    Topological transformation manifested in inorganic materials shows manifold possibilities. In our present work, we show a clear topological transformation in a soft-oxometalate (SOM) system which was formed from its polyoxometalate (POM) precursor [PMo12@Mo72Fe30]. This topological transformation was observed due to time dependent competitive self-assembly of two different length scale soft-oxometalate moieties formed from this two-component host-guest reaction. We characterized different morphologies by scanning electron microscopy, electron dispersive scattering spectroscopy, dynamic light scattering, horizontal attenuated total reflection-infrared spectroscopy and Raman spectroscopy. The predominant structure is selected by its size in a sort of supramolecular Darwinian competition in this process and is described here.

  14. Resonances in positron scattering on a supercritical nucleus and spontaneous production of e+e- pairs

    NASA Astrophysics Data System (ADS)

    Godunov, S. I.; Machet, B.; Vysotsky, M. I.

    2017-11-01

    We re-examine the physics of supercritical nuclei, specially focusing on the scattering phase δ _{κ} and its dependence on the energy ɛ of the diving electronic level, for which we give both exact and approximate formulas. The Coulomb potential Zα /r is rounded to the constant Zα /R for r < R. We confirm the resonant behavior of δ _{κ} that we investigate in detail. In addition to solving the Dirac equation for an electron, we solve it for a positron, in the field of the same nucleus. This clarifies the interpretation of the resonances. Our results are compared with claims made in previous works.

  15. Clusters of Point Defects Near Dislocations as a Tool to Control CdZnTe Electrical Parameters by Ultrasound

    NASA Astrophysics Data System (ADS)

    Olikh, Ya. M.; Tymochko, M. D.; Olikh, O. Ya.; Shenderovsky, V. A.

    2018-05-01

    We studied the temperature dependence (77-300 K) of the electron concentration and mobility using the Hall method under ultrasound (the acoustic Hall method) to determine the mechanisms by which ultrasound influences the electrical activity of near-dislocation clusters in n-type low-ohmic Cd1-x Zn x Te single crystals (N Cl ≈ 1024 m-3; x = 0; 0.04) with different dislocation density (0.4-5.1) × 1010 m-2. Changes in electrophysical parameters were found to occur as a function of temperature and ultrasound intensity. To evaluate the relative contribution of different charge carrier scattering mechanisms (lattice scattering, ionized impurity scattering, neutral impurity scattering, and dislocation scattering) and their change under ultrasound, a differential evolution method was used. This method made it possible to analyze experimental mobility μ H(T) by its nonlinear approximation with characteristic temperature dependence for each mechanism. An increase in neutral impurity scattering and a decrease in ionized impurity and dislocation scattering components were observed under ultrasound. The character and the amount of these acoustically induced changes correlate with particular sample dislocation characteristics. It was concluded that the observed effects are related to the acoustically induced transformation of the point-defect structure, mainly in the near dislocation crystal regions.

  16. Electron-molecule scattering in a strong laser field: Two-center interference effects

    NASA Astrophysics Data System (ADS)

    Dakić, J.; Habibović, D.; Čerkić, A.; Busuladžić, M.; Milošević, D. B.

    2017-10-01

    Laser-assisted scattering of electrons on diatomic molecules is considered using the S -matrix theory within the second Born approximation. The first term of the expansion in powers of the scattering potential corresponds to the direct or single laser-assisted scattering of electrons on molecular targets, while the second term of this expansion corresponds to the laser-assisted rescattering or double scattering. The rescattered electrons may have considerably higher energies in the final state than those that scattered only once. For multicenter polyatomic molecules scattering and rescattering may happen at any center and in any order. All these cases contribute to the scattering amplitude and the interference of different contributions leads to an increase or a decrease of the differential cross section in particular electron energy regions. For diatomic molecules there are two such contributions for single scattering and four contributions for double scattering. Analyzing the spectra of the scattered electrons, we find two interesting effects. For certain molecular orientations, the plateaus in the electron energy spectrum, characteristic of laser-assisted electron-atom scattering, are replaced by a sequence of gradually declining maxima, caused by the two-center interference effects. The second effect is the appearance of symmetric U -shaped structures in the angle-resolved energy spectra, which are described very well by the analytical formulas we provide.

  17. Compton scattering artifacts in electron excited X-ray spectra measured with a silicon drift detector.

    PubMed

    Ritchie, Nicholas W M; Newbury, Dale E; Lindstrom, Abigail P

    2011-12-01

    Artifacts are the nemesis of trace element analysis in electron-excited energy dispersive X-ray spectrometry. Peaks that result from nonideal behavior in the detector or sample can fool even an experienced microanalyst into believing that they have trace amounts of an element that is not present. Many artifacts, such as the Si escape peak, absorption edges, and coincidence peaks, can be traced to the detector. Others, such as secondary fluorescence peaks and scatter peaks, can be traced to the sample. We have identified a new sample-dependent artifact that we attribute to Compton scattering of energetic X-rays generated in a small feature and subsequently scattered from a low atomic number matrix. It seems likely that this artifact has not previously been reported because it only occurs under specific conditions and represents a relatively small signal. However, with the advent of silicon drift detectors and their utility for trace element analysis, we anticipate that more people will observe it and possibly misidentify it. Though small, the artifact is not inconsequential. Under some conditions, it is possible to mistakenly identify the Compton scatter artifact as approximately 1% of an element that is not present.

  18. Parameter dependences of the separatrix density in nitrogen seeded ASDEX Upgrade H-mode discharges

    NASA Astrophysics Data System (ADS)

    Kallenbach, A.; Sun, H. J.; Eich, T.; Carralero, D.; Hobirk, J.; Scarabosio, A.; Siccinio, M.; ASDEX Upgrade Team; EUROfusion MST1 Team

    2018-04-01

    The upstream separatrix electron density is an important interface parameter for core performance and divertor power exhaust. It has been measured in ASDEX Upgrade H-mode discharges by means of Thomson scattering using a self-consistent estimate of the upstream electron temperature under the assumption of Spitzer-Härm electron conduction. Its dependence on various plasma parameters has been tested for different plasma conditions in H-mode. The leading parameter determining n e,sep was found to be the neutral divertor pressure, which can be considered as an engineering parameter since it is determined mainly by the gas puff rate and the pumping speed. The experimentally found parameter dependence of n e,sep, which is dominated by the divertor neutral pressure, could be approximately reconciled by 2-point modelling.

  19. Electron Scattering and Doping Mechanisms in Solid-Phase-Crystallized In2O3:H Prepared by Atomic Layer Deposition.

    PubMed

    Macco, Bart; Knoops, Harm C M; Kessels, Wilhelmus M M

    2015-08-05

    Hydrogen-doped indium oxide (In2O3:H) has recently emerged as an enabling transparent conductive oxide for solar cells, in particular for silicon heterojunction solar cells because its high electron mobility (>100 cm(2)/(V s)) allows for a simultaneously high electrical conductivity and optical transparency. Here, we report on high-quality In2O3:H prepared by a low-temperature atomic layer deposition (ALD) process and present insights into the doping mechanism and the electron scattering processes that limit the carrier mobility in such films. The process consists of ALD of amorphous In2O3:H at 100 °C and subsequent solid-phase crystallization at 150-200 °C to obtain large-grained polycrystalline In2O3:H films. The changes in optoelectronic properties upon crystallization have been monitored both electrically by Hall measurements and optically by analysis of the Drude response. After crystallization, an excellent carrier mobility of 128 ± 4 cm(2)/(V s) can be obtained at a carrier density of 1.8 × 10(20) cm(-3), irrespective of the annealing temperature. Temperature-dependent Hall measurements have revealed that electron scattering is dominated by unavoidable phonon and ionized impurity scattering from singly charged H-donors. Extrinsic defect scattering related to material quality such as grain boundary and neutral impurity scattering was found to be negligible in crystallized films indicating that the carrier mobility is maximized. Furthermore, by comparison of the absolute H-concentration and the carrier density in crystallized films, it is deduced that <4% of the incorporated H is an active dopant in crystallized films. Therefore, it can be concluded that inactive H atoms do not (significantly) contribute to defect scattering, which potentially explains why In2O3:H films are capable of achieving a much higher carrier mobility than conventional In2O3:Sn (ITO).

  20. Optical-model potential for electron and positron elastic scattering by atoms

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Salvat, Francesc

    2003-07-01

    An optical-model potential for systematic calculations of elastic scattering of electrons and positrons by atoms and positive ions is proposed. The electrostatic interaction is determined from the Dirac-Hartree-Fock self-consistent atomic electron density. In the case of electron projectiles, the exchange interaction is described by means of the local-approximation of Furness and McCarthy. The correlation-polarization potential is obtained by combining the correlation potential derived from the local density approximation with a long-range polarization interaction, which is represented by means of a Buckingham potential with an empirical energy-dependent cutoff parameter. The absorption potential is obtained from the local-density approximation, using the Born-Ochkurmore » approximation and the Lindhard dielectric function to describe the binary collisions with a free-electron gas. The strength of the absorption potential is adjusted by means of an empirical parameter, which has been determined by fitting available absolute elastic differential cross-section data for noble gases and mercury. The Dirac partial-wave analysis with this optical-model potential provides a realistic description of elastic scattering of electrons and positrons with energies in the range from {approx}100 eV up to {approx}5 keV. At higher energies, correlation-polarization and absorption corrections are small and the usual static-exchange approximation is sufficiently accurate for most practical purposes.« less

  1. Novel Electron-Phonon Relaxation Pathway in Graphite Revealed by Time-Resolved Raman Scattering and Angle-Resolved Photoemission Spectroscopy.

    PubMed

    Yang, Jhih-An; Parham, Stephen; Dessau, Daniel; Reznik, Dmitry

    2017-01-19

    Time dynamics of photoexcited electron-hole pairs is important for a number of technologies, in particular solar cells. We combined ultrafast pump-probe Raman scattering and photoemission to directly follow electron-hole excitations as well as the G-phonon in graphite after an excitation by an intense laser pulse. This phonon is known to couple relatively strongly to electrons. Cross-correlating effective electronic and phonon temperatures places new constraints on model-based fits. The accepted two-temperature model predicts that G-phonon population should start to increase as soon as excited electron-hole pairs are created and that the rate of increase should not depend strongly on the pump fluence. Instead we found that the increase of the G-phonon population occurs with a delay of ~65 fs. This time-delay is also evidenced by the absence of the so-called self-pumping for G phonons. It decreases with increased pump fluence. We show that these observations imply a new relaxation pathway: Instead of hot carriers transferring energy to G-phonons directly, the energy is first transferred to optical phonons near the zone boundary K-points, which then decay into G-phonons via phonon-phonon scattering. Our work demonstrates that phonon-phonon interactions must be included in any calculations of hot carrier relaxation in optical absorbers even when only short timescales are considered.

  2. Change in resonance parameters of a linear molecule as it bends: Evidence in electron-impact vibrational transitions of hot COS and CO2 molecules*

    NASA Astrophysics Data System (ADS)

    Hoshino, Masamitsu; Ishijima, Yohei; Kato, Hidetoshi; Mogi, Daisuke; Takahashi, Yoshinao; Fukae, Katsuya; Limão-Vieira, Paulo; Tanaka, Hiroshi; Shimamura, Isao

    2016-04-01

    Inelastic and superelastic electron-impact vibrational excitation functions of hot carbonyl sulphide COS (and hot CO2) are measured for electron energies from 0.5 to 3.0 eV (1.5 to 6.0 eV) and at a scattering angle of 90°. Based on the vibrational populations and the principle of detailed balance, these excitation functions are decomposed into contributions from state-to-state vibrational transitions involving up to the second bending overtone (030) in the electronically ground state. Both the 2Π resonance for COS around 1.2 eV and the 2Πu resonance for CO2 around 3.8 eV are shifted to lower energies as the initial vibrational state is excited in the bending mode. The width of the resonance hump for COS changes only little as the molecule bends, whereas that of the overall boomerang resonance for CO2 becomes narrower. The angular distribution of the electrons resonantly scattered by hot COS and hot CO2 is also measured. The different shapes depending on the vibrational transitions and gas temperatures are discussed in terms of the symmetry of the vibrational wave functions. Contribution to the Topical Issue "Advances in Positron and Electron Scattering", edited by Paulo Limao-Vieira, Gustavo Garcia, E. Krishnakumar, James Sullivan, Hajime Tanuma and Zoran Petrovic.

  3. Measurement of collective dynamical mass of Dirac fermions in graphene.

    PubMed

    Yoon, Hosang; Forsythe, Carlos; Wang, Lei; Tombros, Nikolaos; Watanabe, Kenji; Taniguchi, Takashi; Hone, James; Kim, Philip; Ham, Donhee

    2014-08-01

    Individual electrons in graphene behave as massless quasiparticles. Unexpectedly, it is inferred from plasmonic investigations that electrons in graphene must exhibit a non-zero mass when collectively excited. The inertial acceleration of the electron collective mass is essential to explain the behaviour of plasmons in this material, and may be directly measured by accelerating it with a time-varying voltage and quantifying the phase delay of the resulting current. This voltage-current phase relation would manifest as a kinetic inductance, representing the reluctance of the collective mass to accelerate. However, at optical (infrared) frequencies, phase measurements of current are generally difficult, and, at microwave frequencies, the inertial phase delay has been buried under electron scattering. Therefore, to date, the collective mass in graphene has defied unequivocal measurement. Here, we directly and precisely measure the kinetic inductance, and therefore the collective mass, by combining device engineering that reduces electron scattering and sensitive microwave phase measurements. Specifically, the encapsulation of graphene between hexagonal boron nitride layers, one-dimensional edge contacts and a proximate top gate configured as microwave ground together enable the inertial phase delay to be resolved from the electron scattering. Beside its fundamental importance, the kinetic inductance is found to be orders of magnitude larger than the magnetic inductance, which may be utilized to miniaturize radiofrequency integrated circuits. Moreover, its bias dependency heralds a solid-state voltage-controlled inductor to complement the prevalent voltage-controlled capacitor.

  4. Detecting non-maxwellian electron velocity distributions at JET by high resolution Thomson scattering.

    PubMed

    Beausang, K V; Prunty, S L; Scannell, R; Beurskens, M N; Walsh, M J; de la Luna, E

    2011-03-01

    The present work is motivated by a long standing discrepancy between the electron temperature measurements of Thomson scattering (TS) and electron cyclotron emission (ECE) diagnostics for plasmas with strong auxiliary heating observed at both JET and TFTR above 6–7 keV, where in some cases the ECE electron temperature measurements can be 15%–20% higher than the TS measurements. Recent analysis based on ECE results at JET has shown evidence of distortions to the Maxwellian electron velocity distribution and a correlation with the TS and ECE discrepancies has been suggested. In this paper, a technique to determine the presence of non-Maxwellian behavior using TS diagnostics is outlined. The difficulties and limitations of modern TS system designs to determine the electron velocity distribution are also discussed. It is demonstrated that small deviations such as those suggested by previous ECE analysis could be potentially detected, depending on the spectral layout of the TS polychromators. The spectral layout of the JET high resolution Thomson scattering system is such that it could be used to determine these deviations between 1 and 6 keV, and the results presented here indicate that no evidence of non-Maxwellian behavior is observed in this range. In this paper, a modification to the current polychromator design is proposed, allowing non-Maxwellian distortions to be detected up to at least 10 keV.

  5. Charge transport in organic molecular semiconductors from first principles: The bandlike hole mobility in a naphthalene crystal

    NASA Astrophysics Data System (ADS)

    Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco

    2018-03-01

    Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.

  6. The Frequency Evolution of Interstellar Pulse Broadening from Radio Pulsars

    NASA Astrophysics Data System (ADS)

    Löhmer, O.; Mitra, D.; Gupta, Y.; Kramer, M.; Ahuja, A.

    2004-10-01

    Using radio pulsars as probes of the interstellar medium (ISM) we study the frequency evolution of interstellar scattering. The frequency dependence of scatter broadening times, τsc, for most of the pulsars with low and intermediate dispersion measures (DM ≲ 400 pc cm-3) is consistent with the Kolmogorov spectrum of electron density fluctuations in a turbulent medium. In contrast, the measured τsc's for highly dispersed pulsars in the central region of the Galaxy are larger than expected and show a spectrum which is flatter than the Kolmogorov law. We analyse the first measurements of spectral indices of scatter broadening over the full known DM range and discuss possible explanations for the anomalous scattering behaviour along peculiar lines of sight (LOS).

  7. Electron-deuteron deep-inelastic scattering with spectator nucleon tagging and final-state interactions at intermediate x

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strikman, Mark; Weiss, Christian

    We consider electron-deuteron deep-inelastic scattering (DIS) with detection of a proton in the nuclear fragmentation region ("spectator tagging") as a method for extracting the free neutron structure functions and studying their nuclear modifications. Such measurements could be performed at a future Electron-Ion Collider (EIC) with suitable forward detectors. The measured proton recoil momentum (≲ 100 MeV in the deuteron rest frame) specifies the deuteron configuration during the high-energy process and permits a controlled theoretical treatment of nuclear effects. Nuclear and nucleonic structure are separated using methods of light-front quantum mechanics. The impulse approximation (IA) to the tagged DIS cross sectionmore » contains the free neutron pole, which can be reached by on-shell extrapolation in the recoil momentum. Final-state interactions (FSI) distort the recoil momentum distribution away from the pole. In the intermediate-x region 0.1 < x < 0.5 FSI arise predominantly from interactions of the spectator proton with slow hadrons produced in the DIS process on the neutron (rest frame momenta ≲1 GeV, target fragmentation region). We construct a schematic model describing this effect, using final-state hadron distributions measured in nucleon DIS experiments and low-energy hadron scattering amplitudes. We investigate the magnitude of FSI, their dependence on the recoil momentum (angular dependence, forward/backward regions), their analytic properties, and their effect on the on-shell extrapolation. We comment on the prospects for neutron structure extraction in tagged DIS with EIC. Finally, we discuss possible extensions of the FSI model to other kinematic regions (large/small x). In tagged DIS at x << 0.1 FSI resulting from diffractive scattering on the nucleons become important and require separate treatment.« less

  8. Electron-deuteron deep-inelastic scattering with spectator nucleon tagging and final-state interactions at intermediate x

    NASA Astrophysics Data System (ADS)

    Strikman, M.; Weiss, C.

    2018-03-01

    We consider electron-deuteron deep-inelastic scattering (DIS) with detection of a proton in the nuclear fragmentation region ("spectator tagging") as a method for extracting the free neutron structure functions and studying their nuclear modifications. Such measurements could be performed at a future electron-ion collider (EIC) with suitable forward detectors. The measured proton recoil momentum (≲100 MeV in the deuteron rest frame) specifies the deuteron configuration during the high-energy process and permits a controlled theoretical treatment of nuclear effects. Nuclear and nucleonic structure are separated using methods of light-front quantum mechanics. The impulse approximation to the tagged DIS cross section contains the free neutron pole, which can be reached by on-shell extrapolation in the recoil momentum. Final-state interactions (FSIs) distort the recoil momentum distribution away from the pole. In the intermediate-x region 0.1

  9. Electron-deuteron deep-inelastic scattering with spectator nucleon tagging and final-state interactions at intermediate x

    DOE PAGES

    Strikman, Mark; Weiss, Christian

    2018-03-27

    We consider electron-deuteron deep-inelastic scattering (DIS) with detection of a proton in the nuclear fragmentation region ("spectator tagging") as a method for extracting the free neutron structure functions and studying their nuclear modifications. Such measurements could be performed at a future Electron-Ion Collider (EIC) with suitable forward detectors. The measured proton recoil momentum (≲ 100 MeV in the deuteron rest frame) specifies the deuteron configuration during the high-energy process and permits a controlled theoretical treatment of nuclear effects. Nuclear and nucleonic structure are separated using methods of light-front quantum mechanics. The impulse approximation (IA) to the tagged DIS cross sectionmore » contains the free neutron pole, which can be reached by on-shell extrapolation in the recoil momentum. Final-state interactions (FSI) distort the recoil momentum distribution away from the pole. In the intermediate-x region 0.1 < x < 0.5 FSI arise predominantly from interactions of the spectator proton with slow hadrons produced in the DIS process on the neutron (rest frame momenta ≲1 GeV, target fragmentation region). We construct a schematic model describing this effect, using final-state hadron distributions measured in nucleon DIS experiments and low-energy hadron scattering amplitudes. We investigate the magnitude of FSI, their dependence on the recoil momentum (angular dependence, forward/backward regions), their analytic properties, and their effect on the on-shell extrapolation. We comment on the prospects for neutron structure extraction in tagged DIS with EIC. Finally, we discuss possible extensions of the FSI model to other kinematic regions (large/small x). In tagged DIS at x << 0.1 FSI resulting from diffractive scattering on the nucleons become important and require separate treatment.« less

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vidal, Luciano N., E-mail: lnvidal@utfpr.edu.br; Cappelli, Chiara, E-mail: chiara.cappelli@unipi.it; Egidi, Franco

    A theoretical investigation on the origin dependence of the vibronic polarizabilities, isotropic and anisotropic rotational invariants, and scattering cross sections in Resonance Raman Optical Activity (RROA) spectroscopy is presented. Expressions showing the origin dependence of these polarizabilities were written in the resonance regime using the Franck-Condon (FC) and Herzberg-Teller (HT) approximations for the electronic transition moments. Differently from the far-from-resonance scattering regime, where the origin dependent terms cancel out when the rotational invariants are calculated, RROA spectrum can exhibit some origin dependence even for eigenfunctions of the electronic Hamiltonian. At the FC level, the RROA spectrum is completely origin invariantmore » if the polarizabilities are calculated using a single excited state or for a set of degenerate states. Otherwise, some origin effects can be observed in the spectrum. At the HT level, RROA spectrum is origin dependent even when the polarizabilities are evaluated from a single excited state but the origin effect is expected to be small in this case. Numerical calculations performed for (S)-methyloxirane, (2R,3R)-dimethyloxirane, and (R)-4-F-2-azetidinone at both FC and HT levels using the velocity representation of the electric dipole and quadrupole transition moments confirm the predictions of the theory and show the extent of origin effects and the effectiveness of suggested ways to remove them.« less

  11. Polarization-Dependent Ti 2p-Resonant X-ray Raman Scattering from Ti2O3

    NASA Astrophysics Data System (ADS)

    Tezuka, Yasuhisa; Nakajima, Nobuo; Adachi, Jun-ichi; Morimoto, Osamu; Sato, Hitoshi; Uozumi, Takayuki

    2017-12-01

    Detailed resonant X-ray emission spectra (XES) and these polarization dependences of Ti2O3 were obtained by excitation at the Ti 2p absorption edge. About 100 XES spectra were observed in different polarization configurations. X-ray Raman scattering spectra showed two types of crystal field (dd) excitations as well as charge-transfer (CT) excitations. Bulk states of the powder sample were obtained by the XES measurement, which is the photon-in/photon-out method. Partial photon yields (PPYs) of some elementary excitations were extracted from the XES spectra. The CT excitations were hidden in total electron yield spectra, but these were revealed by PPY measurements. Symmetry information of these excitations was acquired on the basis of polarization dependences.

  12. Electron mobility on the surface of liquid Helium: influence of surface level atoms and depopulation of lowest subbands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grigoriev, P. D., E-mail: grigorev@itp.ac.ru; Dyugaev, A. M.; Lebedeva, E. V.

    2008-02-15

    The temperature dependence of electron mobility is examined. We calculate the contribution to the electron scattering rate from the surface level atoms (SLAs), proposed in [10]. This contribution is substantial at low temperatures T < 0.5, when the He vapor concentration is exponentially small. We also study the effect of depopulation of the lowest energy subband, which leads to an increase in the electron mobility at high temperature. The results explain certain long-standing discrepancies between the existing theory and experiment on electron mobility on the surface of liquid helium.

  13. The effect of dynamical Bloch oscillations on optical-field-induced current in a wide-gap dielectric

    NASA Astrophysics Data System (ADS)

    Földi, P.; Benedict, M. G.; Yakovlev, V. S.

    2013-06-01

    We consider the motion of charge carriers in a bulk wide-gap dielectric interacting with a few-cycle laser pulse. A semiclassical model based on Bloch equations is applied to describe the emerging time-dependent macroscopic currents for laser intensities close to the damage threshold. At such laser intensities, electrons can reach edges of the first Brillouin zone even for electron-phonon scattering rates as high as those known for SiO2. We find that, whenever this happens, Bragg-like reflections of electron waves, also known as Bloch oscillations, affect the dependence of the charge displaced by the laser pulse on its carrier-envelope phase.

  14. Dynamic light scattering study on vesicles of Netaine-Cholesterol system

    NASA Astrophysics Data System (ADS)

    Alenaizi, R.; Radiman, S.; Mohamed, F.; Rahman, I. Abdul

    2014-09-01

    The morphology of vesicles system with defined particle size and shape is one of interest in our technical applications. Here we have used dynamic light scattering technique and transmission electron microscopy for structural characterization of N-dimethylglycine Betaine with 5-cholesten-3β-ol vesicles in aqueous solutions. An isotropic one phase region is found in the very diluted regions depending on Betaine/Cholesterol ratio. The isotropic region was stable for more than 3 months at room temperature, with monodispersed unilamellar vesicles ˜ 300nm.

  15. The DD Cold Fusion-Transmutation Connection

    NASA Astrophysics Data System (ADS)

    Chubb, Talbot A.

    2005-12-01

    LENR theory must explain dd fusion, alpha-addition transmutations, radiationless nuclear reactions, and three-body nuclear particle reactions. Reaction without radiation requires many-body D Bloch+ periodicity in both location and internal structure dependencies. Electron scattering leads to mixed quantum states. The radiationless dd fusion reaction is 2-D Bloch+ -> {}4 He Bloch2+. Overlap between {}4 He Bloch2+ and surface Cs leads to alpha absorption. In the Iwamura et al. studies active deuterium is created by scattering at diffusion barriers.

  16. Anisotropic scattering rate in Fe-substituted Bi 2Sr 2Ca(Cu 1-xFex) 2O 8+δ

    DOE PAGES

    Naamneh, M.; Lubashevsky, Y.; Lahoud, E.; ...

    2015-05-27

    We measured the electronic structure of Fe substituted Bi2212 using Angle Resolved Photoemission Spectroscopy (ARPES). We find that the substitution does not change the momentum dependence of the superconducting gap but induces a very anisotropic enhancement of the scattering rate. A comparison of the effect of Fe substitution to that of Zn substitution suggests that the Fe reduces T c so effectively because it supresses very strongly the coherence weight around the anti-nodes.

  17. A glimpse of gluons through deeply virtual compton scattering on the proton

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Defurne, Maxime; Jimenez-Arguello, A. Marti; Ahmed, Z.

    The proton is composed of quarks and gluons, bound by the most elusive mechanism of strong interaction called confinement. In this work, the dynamics of quarks and gluons are investigated using deeply virtual Compton scattering (DVCS): produced by a multi-GeV electron, a highly virtual photon scatters off the proton which subsequently radiates a high energy photon. Similarly to holography, measuring not only the magnitude but also the phase of the DVCS amplitude allows to perform 3D images of the internal structure of the proton. The phase is made accessible through the quantum-mechanical interference of DVCS with the Bethe-Heitler (BH) process,more » in which the final photon is emitted by the electron rather than the proton. Here, we report herein the first full determination of the BH-DVCS interference by exploiting the distinct energy dependences of the DVCS and BH amplitudes. In the high energy regime where the scattering process is expected to occur off a single quark in the proton, these accurate measurements show an intriguing sensitivity to gluons, the carriers of the strong interaction.« less

  18. Polarization observables and T-noninvariance in the weak charged current induced electron proton scattering

    NASA Astrophysics Data System (ADS)

    Fatima, A.; Sajjad Athar, M.; Singh, S. K.

    2018-06-01

    In this work, we have studied the total scattering cross section (σ, differential scattering cross section ( dσ/d Q2) as well as the longitudinal ( P_L(Ee,Q2)), perpendicular ( PP(Ee,Q2)), and transverse ( PT(Ee,Q2)) components of the polarization of the final hadron ( n, Λ and Σ0) produced in the electron proton scattering induced by the weak charged current. We have not assumed T-invariance which allows the transverse component of the hadron polarization perpendicular to the production plane to be non-zero. The numerical results are presented for all the above observables and their dependence on the axial vector form factor and the weak electric form factor are discussed. The present study enables the determination of the axial vector nucleon-hyperon transition form factors at high Q2 in the strangeness sector which can provide a test of the symmetries of the weak hadronic currents like T-invariance and SU(3) symmetry while assuming the hypothesis of conserved vector current and partial conservation of axial vector current.

  19. A glimpse of gluons through deeply virtual compton scattering on the proton

    DOE PAGES

    Defurne, Maxime; Jimenez-Arguello, A. Marti; Ahmed, Z.; ...

    2017-11-10

    The proton is composed of quarks and gluons, bound by the most elusive mechanism of strong interaction called confinement. In this work, the dynamics of quarks and gluons are investigated using deeply virtual Compton scattering (DVCS): produced by a multi-GeV electron, a highly virtual photon scatters off the proton which subsequently radiates a high energy photon. Similarly to holography, measuring not only the magnitude but also the phase of the DVCS amplitude allows to perform 3D images of the internal structure of the proton. The phase is made accessible through the quantum-mechanical interference of DVCS with the Bethe-Heitler (BH) process,more » in which the final photon is emitted by the electron rather than the proton. Here, we report herein the first full determination of the BH-DVCS interference by exploiting the distinct energy dependences of the DVCS and BH amplitudes. In the high energy regime where the scattering process is expected to occur off a single quark in the proton, these accurate measurements show an intriguing sensitivity to gluons, the carriers of the strong interaction.« less

  20. Electron-phonon interactions in semiconductor nanostructures

    NASA Astrophysics Data System (ADS)

    Yu, Segi

    In this dissertation, electron-phonon interactions are studied theoretically in semiconductor nanoscale heterostructures. Interactions of electrons with interface optical phonons dominate over other electron-phonon interactions in narrow width heterostructures. Hence, a transfer matrix method is used to establish a formalism for determining the dispersion relations and electrostatic potentials of the interface phonons for multiple-interface heterostructure within the macroscopic dielectric continuum model. This method facilitates systematic calculations for complex structures where the conventional method is difficult to implement. Several specific cases are treated to illustrate advantages of the formalism. Electrophonon resonance (EPR) is studied in cylindrical quantum wires using the confined/interface optical phonons representation and bulk phonon representation. It has been found that interface phonon contribution to EPR is small compared with confined phonon. Different selection rules for bulk phonons and confined phonons result in different EPR behaviors as the radius of cylindrical wire changes. Experiment is suggested to test which phonon representation is appropriate for EPR. The effects of phonon confinement on elect ron-acoustic-phonon scattering is studied in cylindrical and rectangular quantum wires. In the macroscopic elastic continuum model, the confined-phonon dispersion relations are obtained for several crystallographic directions with free-surface and clamped-surface boundary conditions in cylindrical wires. The scattering rates due to the deformation potential are obtained for these confined phonons and are compared with those of bulk-like phonons. The results show that the inclusion of acoustic phonon confinement may be crucial for calculating accurate low-energy electron scattering rates. Furthermore, it has been found that there is a scaling rule governing the directional dependence of the scattering rates. The Hamiltonian describing the deformation-potential of confined acoustic phonons is derived by quantizing the appropriate, experimentally verified approximate compressional acoustic-phonon modes in a free-standing rectangular quantum wire. The scattering rate is obtained for GaAs quantum wires with a range of cross-sectional dimensions. The results demonstrate that a proper treatment of confined acoustic phonons may be essential to correctly model electron scattering rates at low energies in nanoscale structures.

  1. Electron-phonon coupling and superconductivity in the (4/3)-monolayer of Pb on Si(111): Role of spin-orbit interaction

    NASA Astrophysics Data System (ADS)

    Sklyadneva, I. Yu.; Heid, R.; Bohnen, K.-P.; Echenique, P. M.; Chulkov, E. V.

    2018-05-01

    The effect of spin-orbit coupling on the electron-phonon interaction in a (4/3)-monolayer of Pb on Si(111) is investigated within the density-functional theory and linear-response approach in the mixed-basis pseudopotential representation. We show that the spin-orbit interaction produces a large weakening of the electron-phonon coupling strength, which appears to be strongly overestimated in the scalar relativistic calculations. The effect of spin-orbit interaction is largely determined by the induced modification of Pb electronic bands and a stiffening of the low-energy part of phonon spectrum, which favor a weakening of the electron-phonon coupling strength. The state-dependent strength of the electron-phonon interaction in occupied Pb electronic bands varies depending on binding energy rather than electronic momentum. It is markedly larger than the value averaged over electron momentum because substrate electronic bands make a small contribution to the phonon-mediated scattering and agrees well with the experimental data.

  2. Perpendicular dynamics of runaway electrons in tokamak plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fernandez-Gomez, I.; Martin-Solis, J. R.; Sanchez, R.

    2012-10-15

    In this paper, it will be shown that the runaway phenomenon in tokamak plasmas cannot be reduced to a one-dimensional problem, based on the competence between electric field acceleration and collisional friction losses in the parallel direction. A Langevin approach, including collisional diffusion in velocity space, will be used to analyze the two-dimensional runaway electron dynamics. An investigation of the runaway probability in velocity space will yield a criterion for runaway, which will be shown to be consistent with the results provided by the more simple test particle description of the runaway dynamics [Fuchs et al., Phys. Fluids 29, 2931more » (1986)]. Electron perpendicular collisional scattering will be found to play an important role, relaxing the conditions for runaway. Moreover, electron pitch angle scattering perpendicularly broadens the runaway distribution function, increasing the electron population in the runaway plateau region in comparison with what it should be expected from electron acceleration in the parallel direction only. The perpendicular broadening of the runaway distribution function, its dependence on the plasma parameters, and the resulting enhancement of the runaway production rate will be discussed.« less

  3. The Contribution of Compressional Magnetic Pumping to the Energization of the Earth's Outer Electron Radiation Belt During High-Speed Stream-Driven Storms

    NASA Astrophysics Data System (ADS)

    Borovsky, Joseph E.; Horne, Richard B.; Meredith, Nigel P.

    2017-12-01

    Compressional magnetic pumping is an interaction between cyclic magnetic compressions and pitch angle scattering with the scattering acting as a catalyst to allow the cyclic compressions to energize particles. Compressional magnetic pumping of the outer electron radiation belt at geosynchronous orbit in the dayside magnetosphere is analyzed by means of computer simulations, wherein solar wind compressions of the dayside magnetosphere energize electrons with electron pitch angle scattering by chorus waves and by electromagnetic ion cyclotron (EMIC) waves. The magnetic pumping is found to produce a weak bulk heating of the electron radiation belt, and it also produces an energetic tail on the electron energy distribution. The amount of energization depends on the robustness of the solar wind compressions and on the amplitude of the chorus and/or EMIC waves. Chorus-catalyzed pumping is better at energizing medium-energy (50-200 keV) electrons than it is at energizing higher-energy electrons; at high energies (500 keV-2 MeV) EMIC-catalyzed pumping is a stronger energizer. The magnetic pumping simulation results are compared with energy diffusion calculations for chorus waves in the dayside magnetosphere; in general, compressional magnetic pumping is found to be weaker at accelerating electrons than is chorus-driven energy diffusion. In circumstances when solar wind compressions are robust and when EMIC waves are present in the dayside magnetosphere without the presence of chorus, EMIC-catalyzed magnetic pumping could be the dominant energization mechanism in the dayside magnetosphere, but at such times loss cone losses will be strong.

  4. Spin relaxation in n-type GaAs quantum wells from a fully microscopic approach

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, J.; Wu, M. W.; Department of Physics, University of Science and Technology of China, Hefei, Anhui 230026

    2007-01-15

    We perform a full microscopic investigation on the spin relaxation in n-type (001) GaAs quantum wells with an Al{sub 0.4}Ga{sub 0.6}As barrier due to the D'yakonov-Perel' mechanism from nearly 20 K to room temperature by constructing and numerically solving the kinetic spin Bloch equations. We consider all the relevant scattering such as the electron-acoustic-phonon, the electron-longitudinal-optical-phonon, the electron-nonmagnetic-impurity, and the electron-electron Coulomb scattering to the spin relaxation. The spin relaxation times calculated from our theory with a fitting spin splitting parameter are in good agreement with the experimental data by Ohno et al. [Physica E (Amsterdam) 6, 817 (2000)] overmore » the whole temperature regime (from 20 to 300 K). The value of the fitted spin splitting parameter agrees with many experiments and theoretical calculations. We further show the temperature dependence of the spin relaxation time under various conditions such as electron density, impurity density, and well width. We predict a peak solely due to the Coulomb scattering in the spin relaxation time at low temperature (<50 K) in samples with low electron density (e.g., density less than 1x10{sup 11} cm{sup -2}) but high mobility. This peak disappears in samples with high electron density (e.g., 2x10{sup 11} cm{sup -2}) and/or low mobility. The hot-electron spin kinetics at low temperature is also addressed with many features quite different from the high-temperature case predicted.« less

  5. REPLY: Reply to 'Comment on "Electron-phonon scattering in Sn-doped In2O3 FET nanowires probed by temperature-dependent measurements"'

    NASA Astrophysics Data System (ADS)

    Berengue, Olivia M.; Chiquito, Adenilson J.; Pozzi, Livia P.; Lanfredi, Alexandre J. C.; Leite, Edson R.

    2009-11-01

    In this reply we discuss the use of two and four-probe methods in the resistivity measurements of ITO nanowires. We pointed out that the results obtained by using two or four probe methods are indistinguishable in our case. Additionally we present the correct values for resistivity and consequently for the density of electrons.

  6. Remote interfacial dipole scattering and electron mobility degradation in Ge field-effect transistors with GeO x /Al2O3 gate dielectrics

    NASA Astrophysics Data System (ADS)

    Wang, Xiaolei; Xiang, Jinjuan; Wang, Shengkai; Wang, Wenwu; Zhao, Chao; Ye, Tianchun; Xiong, Yuhua; Zhang, Jing

    2016-06-01

    Remote Coulomb scattering (RCS) on electron mobility degradation is investigated experimentally in Ge-based metal-oxide-semiconductor field-effect-transistors (MOSFETs) with GeO x /Al2O3 gate stacks. It is found that the mobility increases with greater GeO x thickness (7.8-20.8 Å). The physical origin of this mobility dependence on GeO x thickness is explored. The following factors are excluded: Coulomb scattering due to interfacial traps at GeO x /Ge, phonon scattering, and surface roughness scattering. Therefore, the RCS from charges in gate stacks is studied. The charge distributions in GeO x /Al2O3 gate stacks are evaluated experimentally. The bulk charges in Al2O3 and GeO x are found to be negligible. The density of the interfacial charge is  +3.2  ×  1012 cm-2 at the GeO x /Ge interface and  -2.3  ×  1012 cm-2 at the Al2O3/GeO x interface. The electric dipole at the Al2O3/GeO x interface is found to be  +0.15 V, which corresponds to an areal charge density of 1.9  ×  1013 cm-2. The origin of this mobility dependence on GeO x thickness is attributed to the RCS due to the electric dipole at the Al2O3/GeO x interface. This remote dipole scattering is found to play a significant role in mobility degradation. The discovery of this new scattering mechanism indicates that the engineering of the Al2O3/GeO x interface is key for mobility enhancement and device performance improvement. These results are helpful for understanding and engineering Ge mobility enhancement.

  7. Handling Density Conversion in TPS.

    PubMed

    Isobe, Tomonori; Mori, Yutaro; Takei, Hideyuki; Sato, Eisuke; Tadano, Kiichi; Kobayashi, Daisuke; Tomita, Tetsuya; Sakae, Takeji

    2016-01-01

    Conversion from CT value to density is essential to a radiation treatment planning system. Generally CT value is converted to the electron density in photon therapy. In the energy range of therapeutic photon, interactions between photons and materials are dominated with Compton scattering which the cross-section depends on the electron density. The dose distribution is obtained by calculating TERMA and kernel using electron density where TERMA is the energy transferred from primary photons and kernel is a volume considering spread electrons. Recently, a new method was introduced which uses the physical density. This method is expected to be faster and more accurate than that using the electron density. As for particle therapy, dose can be calculated with CT-to-stopping power conversion since the stopping power depends on the electron density. CT-to-stopping power conversion table is also called as CT-to-water-equivalent range and is an essential concept for the particle therapy.

  8. Dissipative time-dependent quantum transport theory: Quantum interference and phonon induced decoherence dynamics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Yu, E-mail: zhy@yangtze.hku.hk; Chen, GuanHua, E-mail: ghc@everest.hku.hk; Yam, ChiYung

    2015-04-28

    A time-dependent inelastic electron transport theory for strong electron-phonon interaction is established via the equations of motion method combined with the small polaron transformation. In this work, the dissipation via electron-phonon coupling is taken into account in the strong coupling regime, which validates the small polaron transformation. The corresponding equations of motion are developed, which are used to study the quantum interference effect and phonon-induced decoherence dynamics in molecular junctions. Numerical studies show clearly quantum interference effect of the transport electrons through two quasi-degenerate states with different couplings to the leads. We also found that the quantum interference can bemore » suppressed by the electron-phonon interaction where the phase coherence is destroyed by phonon scattering. This indicates the importance of electron-phonon interaction in systems with prominent quantum interference effect.« less

  9. Polarized micro Raman spectroscopy of bilayer graphene

    NASA Astrophysics Data System (ADS)

    Moon, Hyerim; Yoon, Duhee; Son, Young-Woo; Cheong, Hyeonsik

    2009-03-01

    The frequency of Raman 2D band of the graphite depends on the excitation laser energy. This phenomenon is explained with double resonance Raman process. In polarized micro-Raman spectroscopy of single layer graphene, Raman G band (˜1586 cm-1) is isotropic, and 2D band (˜2686 cm-1) strongly depends on relative polarizations of the incident and scattered photons. This strong polarization dependence originates from inhomogeneous optical absorption and emission mediated by resonant electron-phonon interaction. In bi-layer graphene, Raman 2D band can be decomposed into four Lorenztian peaks which can be interpreted in terms of the four transition paths in the double resonance Raman process. We investigated the polarization dependence of each Lorenztian peak in the Raman 2D band of bi-layer graphene for different excitation laser energies. Strong polarization dependence of the Raman 2D band, similar to the case of single layer graphene, is observed. The excitation energy dependence of the polarized Raman scattering is analyzed in terms of the band structure of bi-layer graphene.

  10. Reggi-Leduc and Maggi-Reggi-Leduc effects in conducting films with an anisotropic dispersion law

    NASA Astrophysics Data System (ADS)

    Askerov, B. M.; Guseinov, G. I.; Kuliev, B. I.; Figarova, S. R.

    1989-06-01

    The influence of the spectrum and bulk scattering anisotropies on the Reggi-Leduc and Maggi-Reggi-Leduc effects is investigated in semiconducting films of the electronic silicon type under classical dimensional effect conditions. It is shown that in contrast to a massive specimen these effects depend not only on a single parameter, the ratio between the anisotropy coefficients of the effective mass and the relaxation time but also on each of them separately, which permit their direct determination. It is also established that the Reggi-Leduc coefficient depends differently on the film thickness, depending on the relationship between the electron and phonon parts of the crystal heat conductivity.

  11. Phonon anharmonicity and negative thermal expansion in SnSe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bansal, Dipanshu; Hong, Jiawang; Li, Chen W.

    In this paper, the anharmonic phonon properties of SnSe in the Pnma phase were investigated with a combination of experiments and first-principles simulations. Using inelastic neutron scattering (INS) and nuclear resonant inelastic X-ray scattering (NRIXS), we have measured the phonon dispersions and density of states (DOS) and their temperature dependence, which revealed a strong, inhomogeneous shift and broadening of the spectrum on warming. First-principles simulations were performed to rationalize these measurements, and to explain the previously reported anisotropic thermal expansion, in particular the negative thermal expansion within the Sn-Se bilayers. Including the anisotropic strain dependence of the phonon free energy,more » in addition to the electronic ground state energy, is essential to reproduce the negative thermal expansion. From the phonon DOS obtained with INS and additional calorimetry measurements, we quantify the harmonic, dilational, and anharmonic components of the phonon entropy, heat capacity, and free energy. Finally, the origin of the anharmonic phonon thermodynamics is linked to the electronic structure.« less

  12. Phonon anharmonicity and negative thermal expansion in SnSe

    DOE PAGES

    Bansal, Dipanshu; Hong, Jiawang; Li, Chen W.; ...

    2016-08-09

    In this paper, the anharmonic phonon properties of SnSe in the Pnma phase were investigated with a combination of experiments and first-principles simulations. Using inelastic neutron scattering (INS) and nuclear resonant inelastic X-ray scattering (NRIXS), we have measured the phonon dispersions and density of states (DOS) and their temperature dependence, which revealed a strong, inhomogeneous shift and broadening of the spectrum on warming. First-principles simulations were performed to rationalize these measurements, and to explain the previously reported anisotropic thermal expansion, in particular the negative thermal expansion within the Sn-Se bilayers. Including the anisotropic strain dependence of the phonon free energy,more » in addition to the electronic ground state energy, is essential to reproduce the negative thermal expansion. From the phonon DOS obtained with INS and additional calorimetry measurements, we quantify the harmonic, dilational, and anharmonic components of the phonon entropy, heat capacity, and free energy. Finally, the origin of the anharmonic phonon thermodynamics is linked to the electronic structure.« less

  13. Three energy scales in the superconducting state of hole-doped cuprates detected by electronic Raman scattering

    DOE PAGES

    Benhabib, S.; Gu, G. D.; Gallais, Y.; ...

    2015-10-06

    We explore by electronic Raman scattering the superconducting state of the Bi 2Sr 2CaCu 2O 8+δ (Bi-2212) crystal by performing a fine-tuned doping study. We find three distinct energy scales in A 1g, B 1g, and B 2g symmetries which show three distinct doping dependencies. Above p=0.22, the three energies merge; below p=0.12, the A 1g scale is no longer detectable, while the B 1g and B 2g scales become constant in energy. In between, the A 1g and B 1g scales increase monotonically with underdoping, while the B 2g one exhibits a maximum at p=0.16. The three superconducting energymore » scales appear to be a universal feature of hole-doped cuprates. Furthermore, we propose that the nontrivial doping dependencies of the three scales originate from the Fermi-surface changes and reveal competing orders inside the superconducting dome.« less

  14. Data-driven sensitivity inference for Thomson scattering electron density measurement systems.

    PubMed

    Fujii, Keisuke; Yamada, Ichihiro; Hasuo, Masahiro

    2017-01-01

    We developed a method to infer the calibration parameters of multichannel measurement systems, such as channel variations of sensitivity and noise amplitude, from experimental data. We regard such uncertainties of the calibration parameters as dependent noise. The statistical properties of the dependent noise and that of the latent functions were modeled and implemented in the Gaussian process kernel. Based on their statistical difference, both parameters were inferred from the data. We applied this method to the electron density measurement system by Thomson scattering for the Large Helical Device plasma, which is equipped with 141 spatial channels. Based on the 210 sets of experimental data, we evaluated the correction factor of the sensitivity and noise amplitude for each channel. The correction factor varies by ≈10%, and the random noise amplitude is ≈2%, i.e., the measurement accuracy increases by a factor of 5 after this sensitivity correction. The certainty improvement in the spatial derivative inference was demonstrated.

  15. High Electron Mobility and Insights into Temperature-Dependent Scattering Mechanisms in InAsSb Nanowires.

    PubMed

    Boland, Jessica L; Amaduzzi, Francesca; Sterzl, Sabrina; Potts, Heidi; Herz, Laura M; Fontcuberta I Morral, Anna; Johnston, Michael B

    2018-06-13

    InAsSb nanowires are promising elements for thermoelectric devices, infrared photodetectors, high-speed transistors, as well as thermophotovoltaic cells. By changing the Sb alloy fraction the mid-infrared bandgap energy and thermal conductivity may be tuned for specific device applications. Using both terahertz and Raman noncontact probes, we show that Sb alloying increases the electron mobility in the nanowires by over a factor of 3 from InAs to InAs 0.65 Sb 0.35 . We also extract the temperature-dependent electron mobility via both terahertz and Raman spectroscopy, and we report the highest electron mobilities for InAs 0.65 Sb 0.35 nanowires to date, exceeding 16,000 cm 2 V -1 s -1 at 10 K.

  16. Elastic electron-deuteron scattering within a relativistic potential model

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Khokhlov, N. A., E-mail: nikolakhokhlov@yandex.ru; Vakulyuk, A. A.

    Elastic electron-deuteron scattering was considered in the point form of relativistic quantum mechanics. Observables of this process and the dependence of the deuteron form factors on the 4-momentum transfer Q up to 8 fm{sup −1} were calculated. The nucleon-nucleon potentials used in the calculations included the Nijmegen potentials NijmI and NijmII, the Bonn potential CD-Bonn, and the Moscow potential involving forbidden states. A parametrization of the nucleon form factors that complies with present-day experimental results was used as input data. The results of the calculations that employ all of the above potential types describe experimental data at least up tomore » Q ≈ 5 fm{sup −}1.« less

  17. Ionic scattering factors of atoms that compose biological molecules

    PubMed Central

    Matsuoka, Rei; Yamashita, Yoshiki; Yamane, Tsutomu; Kidera, Akinori; Maki-Yonekura, Saori

    2018-01-01

    Ionic scattering factors of atoms that compose biological molecules have been computed by the multi-configuration Dirac–Fock method. These ions are chemically unstable and their scattering factors had not been reported except for O−. Yet these factors are required for the estimation of partial charges in protein molecules and nucleic acids. The electron scattering factors of these ions are particularly important as the electron scattering curves vary considerably between neutral and charged atoms in the spatial-resolution range explored in structural biology. The calculated X-ray and electron scattering factors have then been parameterized for the major scattering curve models used in X-ray and electron protein crystallography and single-particle cryo-EM. The X-ray and electron scattering factors and the fitting parameters are presented for future reference. PMID:29755750

  18. On the wind geometry of the Wolf-Rayet star EZ Canis Majoris

    NASA Technical Reports Server (NTRS)

    Schulte-Ladbeck, R. E.; Nordsieck, K. H.; Taylor, M.; Nook, M. A.; Bjorkman, K. S.; Magalhaes, A. M.; Anderson, C. M.

    1991-01-01

    Recent models of Wolf-Rayet star winds have been tailored to EZ CMa, and make predictions of the envelope structure and location of line-emitting regions. It is discussed how the wind structure of EZ CMa can be probed observationally through electron distribution integrals as measured by spectropolarimetry, and then present, analyze, and interpret a time-dependent spectropolarimetric data set of EZ CMa. The observations further the view of an electron-scattering wind that is axisymmetric, rotating, and expanding, with a variable mass-loss rate being responsible for the quasi-periodic polarimetric variability. It is demonstrated that the emission lines of EZ CMa are partially polarized, indicating that line photons are electron-scattered in the wind. The polarization in N V lambda 4945 and N IV lambda 4058 is observed to be larger than that of He II lambda 4686 and He I lambda 5876, as expected from ionization stratification.

  19. Kondo scattering in δ-doped LaTiO3/SrTiO3 interfaces: Renormalization by spin-orbit interactions

    NASA Astrophysics Data System (ADS)

    Das, Shubhankar; Rastogi, A.; Wu, Lijun; Zheng, Jin-Cheng; Hossain, Z.; Zhu, Yimei; Budhani, R. C.

    2014-08-01

    We present a study of δ doping at the LaTiO3/SrTiO3 interface with isostructural antiferromagnetic perovskite LaCrO3 that dramatically alters the properties of the two-dimensional electron gas at the interface. The effects include a reduction in sheet-carrier density, prominence of the low-temperature resistivity minimum, enhancement of weak antilocalization below 10 K, and observation of a strong anisotropic magnetoresistance (MR). The positive and negative MR for out-of-plane and in-plane fields, respectively, and the field and temperature dependencies of MR suggest Kondo scattering by localized Ti3+ moments renormalized by spin-orbit interaction at T < 10 K, with the increased δ-layer thickness. Electron-energy-loss spectroscopy and density functional calculations provide convincing evidence of blocking of electron transfer from LTO to STO by the δ layer.

  20. Resistivity scaling and electron relaxation times in metallic nanowires

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moors, Kristof, E-mail: kristof@itf.fys.kuleuven.be; Imec, Kapeldreef 75, B-3001 Leuven; Sorée, Bart

    2014-08-14

    We study the resistivity scaling in nanometer-sized metallic wires due to surface roughness and grain-boundaries, currently the main cause of electron scattering in nanoscaled interconnects. The resistivity has been obtained with the Boltzmann transport equation, adopting the relaxation time approximation of the distribution function and the effective mass approximation for the conducting electrons. The relaxation times are calculated exactly, using Fermi's golden rule, resulting in a correct relaxation time for every sub-band state contributing to the transport. In general, the relaxation time strongly depends on the sub-band state, something that remained unclear with the methods of previous work. The resistivitymore » scaling is obtained for different roughness and grain-boundary properties, showing large differences in scaling behavior and relaxation times. Our model clearly indicates that the resistivity is dominated by grain-boundary scattering, easily surpassing the surface roughness contribution by a factor of 10.« less

  1. Nematicity in stripe ordered cuprates probed via resonant x-ray scattering

    DOE PAGES

    Achkar, A. J.; Zwiebler, M.; McMahon, Christopher; ...

    2016-02-05

    We found that in underdoped cuprate superconductors, a rich competition occurs between superconductivity and charge density wave (CDW) order. Whether rotational symmetry-breaking (nematicity) occurs intrinsically and generically or as a consequence of other orders is under debate. Here, we employ resonant x-ray scattering in stripe-ordered superconductors (La,M) 2CuO 4 to probe the relationship between electronic nematicity of the Cu 3d orbitals, structure of the (La,M) 2O 2 layers, and CDW order. We find distinct temperature dependences for the structure of the (La,M) 2O 2 layers and the electronic nematicity of the CuO 2 planes, with only the latter being enhancedmore » by the onset of CDW order. Our results identify electronic nematicity as an order parameter that is distinct from a purely structural order parameter in underdoped striped cuprates.« less

  2. Nanoscale electron transport at the surface of a topological insulator.

    PubMed

    Bauer, Sebastian; Bobisch, Christian A

    2016-04-21

    The use of three-dimensional topological insulators for disruptive technologies critically depends on the dissipationless transport of electrons at the surface, because of the suppression of backscattering at defects. However, in real devices, defects are unavoidable and scattering at angles other than 180° is allowed for such materials. Until now, this has been studied indirectly by bulk measurements and by the analysis of the local density of states in close vicinity to defect sites. Here, we directly measure the nanoscale voltage drop caused by the scattering at step edges, which occurs if a lateral current flows along a three-dimensional topological insulator. The experiments were performed using scanning tunnelling potentiometry for thin Bi2Se3 films. So far, the observed voltage drops are small because of large contributions of the bulk to the electronic transport. However, for the use of ideal topological insulating thin films in devices, these contributions would play a significant role.

  3. Nanoscale electron transport at the surface of a topological insulator

    NASA Astrophysics Data System (ADS)

    Bauer, Sebastian; Bobisch, Christian A.

    2016-04-01

    The use of three-dimensional topological insulators for disruptive technologies critically depends on the dissipationless transport of electrons at the surface, because of the suppression of backscattering at defects. However, in real devices, defects are unavoidable and scattering at angles other than 180° is allowed for such materials. Until now, this has been studied indirectly by bulk measurements and by the analysis of the local density of states in close vicinity to defect sites. Here, we directly measure the nanoscale voltage drop caused by the scattering at step edges, which occurs if a lateral current flows along a three-dimensional topological insulator. The experiments were performed using scanning tunnelling potentiometry for thin Bi2Se3 films. So far, the observed voltage drops are small because of large contributions of the bulk to the electronic transport. However, for the use of ideal topological insulating thin films in devices, these contributions would play a significant role.

  4. Mode Specific Electronic Friction in Dissociative Chemisorption on Metal Surfaces: H2 on Ag(111)

    NASA Astrophysics Data System (ADS)

    Maurer, Reinhard J.; Jiang, Bin; Guo, Hua; Tully, John C.

    2017-06-01

    Electronic friction and the ensuing nonadiabatic energy loss play an important role in chemical reaction dynamics at metal surfaces. Using molecular dynamics with electronic friction evaluated on the fly from density functional theory, we find strong mode dependence and a dominance of nonadiabatic energy loss along the bond stretch coordinate for scattering and dissociative chemisorption of H2 on the Ag(111) surface. Exemplary trajectories with varying initial conditions indicate that this mode specificity translates into modulated energy loss during a dissociative chemisorption event. Despite minor nonadiabatic energy loss of about 5%, the directionality of friction forces induces dynamical steering that affects individual reaction outcomes, specifically for low-incidence energies and vibrationally excited molecules. Mode-specific friction induces enhanced loss of rovibrational rather than translational energy and will be most visible in its effect on final energy distributions in molecular scattering experiments.

  5. Nematicity in stripe ordered cuprates probed via resonant x-ray scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Achkar, A. J.; Zwiebler, M.; McMahon, Christopher

    We found that in underdoped cuprate superconductors, a rich competition occurs between superconductivity and charge density wave (CDW) order. Whether rotational symmetry-breaking (nematicity) occurs intrinsically and generically or as a consequence of other orders is under debate. Here, we employ resonant x-ray scattering in stripe-ordered superconductors (La,M) 2CuO 4 to probe the relationship between electronic nematicity of the Cu 3d orbitals, structure of the (La,M) 2O 2 layers, and CDW order. We find distinct temperature dependences for the structure of the (La,M) 2O 2 layers and the electronic nematicity of the CuO 2 planes, with only the latter being enhancedmore » by the onset of CDW order. Our results identify electronic nematicity as an order parameter that is distinct from a purely structural order parameter in underdoped striped cuprates.« less

  6. Parametric dependence of ion temperature and electron density in the SUMMA hot-ion plasma using laser light scattering and emission spectroscopy

    NASA Technical Reports Server (NTRS)

    Snyder, A.; Patch, R. W.; Lauver, M. R.

    1980-01-01

    Hot-ion plasma experiments were conducted in the NASA Lewis SUMMA facility. A steady-state modified Penning discharge was formed by applying a radially inward dc electric field of several kilovolts near the magnetic mirror maxima. Results are reported for a hydrogen plasma covering a wide range in midplane magnetic flux densities from 0.5 to 3.37 T. Input power greater than 45 kW was obtained with water-cooled cathodes. Steady-state plasmas with ion kinetic temperatures from 18 to 830 eV were produced and measured spectroscopically. These ion temperatures were correlated with current, voltage, and magnetic flux density as the independent variables. Electron density measurements were made using an unusually sensitive Thomson scattering apparatus. The measured electron densities range from 2.1 x 10 to the 11th to 6.8 x 10 to the 12th per cu cm.

  7. Effect of EMIC Wave Normal Angle Distribution on Relativistic Electron Scattering Based on the Newly Developed Self-consistent RC/EMIC Waves Model by Khazanov et al. [2006

    NASA Technical Reports Server (NTRS)

    Khazanov, G. V.; Gallagher, D. L.; Gamayunov, K.

    2007-01-01

    It is well known that the effects of EMIC waves on RC ion and RB electron dynamics strongly depend on such particle/wave characteristics as the phase-space distribution function, frequency, wave-normal angle, wave energy, and the form of wave spectral energy density. Therefore, realistic characteristics of EMIC waves should be properly determined by modeling the RC-EMIC waves evolution self-consistently. Such a selfconsistent model progressively has been developing by Khaznnov et al. [2002-2006]. It solves a system of two coupled kinetic equations: one equation describes the RC ion dynamics and another equation describes the energy density evolution of EMIC waves. Using this model, we present the effectiveness of relativistic electron scattering and compare our results with previous work in this area of research.

  8. Effect of spin fluctuations on the electronic structure in iron-based superconductors

    NASA Astrophysics Data System (ADS)

    Heimes, Andreas; Grein, Roland; Eschrig, Matthias

    2012-08-01

    Magnetic inelastic neutron scattering studies of iron-based superconductors reveal a strongly temperature-dependent spin-fluctuation spectrum in the normal conducting state, which develops a prominent low-energy resonance feature when entering the superconducting state. Angle-resolved photoemission spectroscopy (ARPES) and scanning tunneling spectroscopy (STS) allow us to study the fingerprints of fluctuation modes via their interactions with electronic quasiparticles. We calculate such fingerprints in 122 iron pnictides using an experimentally motivated spin-fluctuation spectrum and make a number of predictions that can be tested in ARPES and STS experiments. This includes discussions of the quasiparticle scattering rate and the superconducting order parameter. In quantitative agreement with experiment we reproduce the quasiparticle dispersions obtained from momentum distribution curves as well as energy distribution curves. We discuss the relevance of the coupling between spin fluctuations and electronic excitations for the superconducting mechanism.

  9. Electron- and positron-impact atomic scattering calculations using propagating exterior complex scaling

    NASA Astrophysics Data System (ADS)

    Bartlett, P. L.; Stelbovics, A. T.; Rescigno, T. N.; McCurdy, C. W.

    2007-11-01

    Calculations are reported for four-body electron-helium collisions and positron-hydrogen collisions, in the S-wave model, using the time-independent propagating exterior complex scaling (PECS) method. The PECS S-wave calculations for three-body processes in electron-helium collisions compare favourably with previous convergent close-coupling (CCC) and time-dependent exterior complex scaling (ECS) calculations, and exhibit smooth cross section profiles. The PECS four-body double-excitation cross sections are significantly different from CCC calculations and highlight the need for an accurate representation of the resonant helium final-state wave functions when undertaking these calculations. Results are also presented for positron-hydrogen collisions in an S-wave model using an electron-positron potential of V12 = - (8 + (r1 - r2)2)-1/2. This model is representative of the full problem, and the results demonstrate that ECS-based methods can accurately calculate scattering, ionization and positronium formation cross sections in this three-body rearrangement collision.

  10. The effect of charged quantum dots on the mobility of a two-dimensional electron gas: How important is the Coulomb scattering?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kurzmann, A., E-mail: annika.kurzmann@uni-due.de; Beckel, A.; Lorke, A.

    2015-02-07

    We have investigated the influence of a layer of charged self-assembled quantum dots (QDs) on the mobility of a nearby two-dimensional electron gas (2DEG). Time-resolved transconductance spectroscopy was used to separate the two contributions of the change in mobility, which are: (i) The electrons in the QDs act as Coulomb scatterers for the electrons in the 2DEG. (ii) The screening ability and, hence, the mobility of the 2DEG decreases when the charge carrier density is reduced by the charged QDs, i.e., the mobility itself depends on the charge carrier concentration. Surprisingly, we find a negligible influence of the Coulomb scatteringmore » on the mobility for a 2DEG, separated by a 30 nm tunneling barrier to the layer of QDs. This means that the mobility change is completely caused by depletion, i.e., reduction of the charge carrier density in the 2DEG, which indirectly influences the mobility.« less

  11. Scattering of surface electrons by isolated steps versus periodic step arrays

    NASA Astrophysics Data System (ADS)

    Ortega, J. E.; Lobo-Checa, J.; Peschel, G.; Schirone, S.; Abd El-Fattah, Z. M.; Matena, M.; Schiller, F.; Borghetti, P.; Gambardella, P.; Mugarza, A.

    2013-03-01

    We investigate the scattering of electrons belonging to Shockley states of (111)-oriented noble metal surfaces using angle-resolved photoemission (ARPES) and scanning tunneling microscopy (STM). Both ARPES and STM indicate that monatomic steps on a noble metal surface may act either as strongly repulsive or highly transmissive barriers for surface electrons, depending on the coherence of the step lattice, and irrespectively of the average step spacing. By measuring curved crystal surfaces with terrace length ranging from 30 to 180 Å, we show that vicinal surfaces of Au and Ag with periodic step arrays exhibit a remarkable wave function coherence beyond 100 Å step spacings, well beyond the Fermi wavelength limit and independently of the projection of the bulk band gap on the vicinal plane. In contrast, the analysis of transmission resonances investigated by STM shows that a pair of isolated parallel steps defining a 58 Å wide terrace confines and decouples the surface state of the small terrace from that of the (111) surface. We conclude that the formation of laterally confined quantum well states in vicinal surfaces as opposed to propagating superlattice states depends on the loss of coherence driven by imperfection in the superlattice order.

  12. Size-dependent Hamaker constants for silver and gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Pinchuk, Pavlo; Jiang, Ke

    2015-08-01

    Hamaker-Lifshitz constants are material specific constants that are used to calculate van der Waals interaction forces between small particles in solution. Typically, these constants are size-independent and material specific. According to the Lifshitz theory, the Hamaker-Lifshitz constants can be calculated by taking integrals that include the dielectric permittivity, as a function of frequency, of the interacting particles and the medium around particles. The dielectric permittivity of interacting metal nanoparticles can be calculated using the Drude model, which is based on the assumption of motion of free conducting electrons. For bulk metals, the Drude model does not predict any sizedependence of the dielectric permittivity. However, the conducting electrons in small noble metal nanoparticles (R ~ 10nm) exhibit surface scattering, which changes the complex permittivity function. In this work, we show theoretically that scattering of the free conducting electrons inside silver and gold nanoparticles with the size of 1 - 50 nm leads to size-dependent dielectric permittivity and Hamaker-Lifshitz constants. We calculate numerically the Hamaker-Lifshitz constants for silver and gold nanoparticles with different diameters. The results of the study might be of interests for understanding colloidal stability of metal nanoparticles.

  13. Polarization observables using positron beams

    NASA Astrophysics Data System (ADS)

    Schmidt, Axel

    2018-05-01

    The discrepancy between polarized and unpolarized measurements of the proton's electromagnetic form factors is striking, and suggests that two-photon exchange (TPE) may be playing a larger role in elastic electron-proton scattering than is estimated in standard radiative corrections formulae. While TPE is difficult to calculate in a model-independent way, it can be determined experimentally from asymmetries between electron-proton and positron-proton scattering. The possibility of a polarized positron beam at Jefferson Lab would open the door to measurements of TPE using polarization observables. In these proceedings, I examine the feasibility of measuring three such observables with positron scattering. Polarization-transfer, specifically the ɛ-dependence for fixed Q2, is an excellent test of TPE, and the ability to compare electrons and positrons would lead to a drastic reduction of systematics. However, such a measurement would be severely statistically limited. Normal single-spin asymmetries (SSAs) probe the imaginary part of the TPE amplitude and can be improved by simultaneous measurements with electron and positron beams. Beam-normal SSAs are too small to be measured with the proposed polarized positron beam, but target-normal SSAs could be feasibly measured with unpolarized positrons in the spectrometer halls. This technique should be included in the physics case for developing a positron source for Jefferson Lab.

  14. Measurement of two-photon exchange effect by comparing elastic e ± p cross sections

    DOE PAGES

    Rimal, D.; Adikaram, D.; Raue, B. A.; ...

    2017-06-01

    Background: The electromagnetic form factors of the proton measured by unpolarized and polarized electron scattering experiments showa significant disagreement that grows with the squared four-momentum transfer (Q(2)). Calculations have shown that the two measurements can be largely reconciled by accounting for the contributions of two-photon exchange (TPE). TPE effects are not typically included in the standard set of radiative corrections since theoretical calculations of the TPE effects are highly model dependent, and, until recently, no direct evidence of significant TPE effects has been observed. Purpose: We measured the ratio of positron-proton to electron-proton elastic-scattering cross sections in order to determinemore » the TPE contribution to elastic electron-proton scattering and thereby resolve the proton electric form factor discrepancy. Methods: We produced a mixed simultaneous electron-positron beam in Jefferson Lab's Hall B by passing the 5.6-GeV primary electron beam through a radiator to produce a bremsstrahlung photon beam and then passing the photon beam through a convertor to produce electron-positron pairs. The mixed electron-positron (lepton) beam with useful energies from approximately 0.85 to 3.5 GeV then struck a 30-cm-long liquid hydrogen (LH2) target located within the CEBAF Large Acceptance Spectrometer (CLAS). By detecting both the scattered leptons and the recoiling protons, we identified and reconstructed elastic scattering events and determined the incident lepton energy. A detailed description of the experiment is presented. Results: We present previously unpublished results for the quantity R-2 gamma, the TPE correction to the elastic-scattering cross section, at Q(2) approximate to 0.85 and 1.45 GeV2 over a large range of virtual photon polarization epsilon. Conclusions: Our results, along with recently published results from VEPP-3, demonstrate a nonzero contribution from TPE effects and are in excellent agreement with the calculations that include TPE effects and largely reconcile the form-factor discrepancy up to Q(2) approximate to 2 GeV2. These data are consistent with an increase in R-2 gamma. with decreasing e at Q(2) approximate to 0.85 and 1.45 GeV2. There are indications of a slight increase in R-2 gamma with Q(2).« less

  15. Measurement of two-photon exchange effect by comparing elastic e±p cross sections

    NASA Astrophysics Data System (ADS)

    Rimal, D.; Adikaram, D.; Raue, B. A.; Weinstein, L. B.; Arrington, J.; Brooks, W. K.; Ungaro, M.; Adhikari, K. P.; Afanasev, A. V.; Akbar, Z.; Pereira, S. Anefalos; Badui, R. A.; Ball, J.; Baltzell, N. A.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Bültmann, S.; Burkert, V. D.; Carman, D. S.; Celentano, A.; Chetry, T.; Ciullo, G.; Clark, L.; Colaneri, L.; Cole, P. L.; Compton, N.; Contalbrigo, M.; Cortes, O.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; Deur, A.; Djalali, C.; Dupre, R.; Egiyan, H.; Alaoui, A. El; Fassi, L. El; Eugenio, P.; Fanchini, E.; Fedotov, G.; Fersch, R.; Filippi, A.; Fleming, J. A.; Forest, T. A.; Fradi, A.; Gevorgyan, N.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Gleason, C.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guo, L.; Hafidi, K.; Hanretty, C.; Harrison, N.; Hattawy, M.; Heddle, D.; Hicks, K.; Holtrop, M.; Hughes, S. M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jiang, H.; Joosten, S.; Keller, D.; Khachatryan, G.; Khandaker, M.; Kim, W.; Klein, A.; Klein, F. J.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Lanza, L.; Lenisa, P.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; McKinnon, B.; Mestayer, M. D.; Mirazita, M.; Mokeev, V.; Movsisyan, A.; Munevar, E.; Camacho, C. Munoz; Nadel-Turonski, P.; Ni, A.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Paremuzyan, R.; Park, K.; Pasyuk, E.; Phelps, W.; Pisano, S.; Pogorelko, O.; Price, J. W.; Prok, Y.; Protopopescu, D.; Puckett, A. J. R.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Salgado, C.; Schumacher, R. A.; Seder, E.; Sharabian, Y. G.; Skorodumina, Iu.; Smith, G. D.; Sokhan, D.; Sparveris, N.; Stankovic, Ivana; Stepanyan, S.; Strauch, S.; Sytnik, V.; Taiuti, M.; Torayev, B.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration

    2017-06-01

    Background: The electromagnetic form factors of the proton measured by unpolarized and polarized electron scattering experiments show a significant disagreement that grows with the squared four-momentum transfer (Q2). Calculations have shown that the two measurements can be largely reconciled by accounting for the contributions of two-photon exchange (TPE). TPE effects are not typically included in the standard set of radiative corrections since theoretical calculations of the TPE effects are highly model dependent, and, until recently, no direct evidence of significant TPE effects has been observed. Purpose: We measured the ratio of positron-proton to electron-proton elastic-scattering cross sections in order to determine the TPE contribution to elastic electron-proton scattering and thereby resolve the proton electric form factor discrepancy. Methods: We produced a mixed simultaneous electron-positron beam in Jefferson Lab's Hall B by passing the 5.6-GeV primary electron beam through a radiator to produce a bremsstrahlung photon beam and then passing the photon beam through a convertor to produce electron-positron pairs. The mixed electron-positron (lepton) beam with useful energies from approximately 0.85 to 3.5 GeV then struck a 30-cm-long liquid hydrogen (LH2) target located within the CEBAF Large Acceptance Spectrometer (CLAS). By detecting both the scattered leptons and the recoiling protons, we identified and reconstructed elastic scattering events and determined the incident lepton energy. A detailed description of the experiment is presented. Results: We present previously unpublished results for the quantity R2 γ, the TPE correction to the elastic-scattering cross section, at Q2≈0.85 and 1.45 GeV2 over a large range of virtual photon polarization ɛ . Conclusions: Our results, along with recently published results from VEPP-3, demonstrate a nonzero contribution from TPE effects and are in excellent agreement with the calculations that include TPE effects and largely reconcile the form-factor discrepancy up to Q2≈2 GeV2 . These data are consistent with an increase in R2 γ with decreasing ɛ at Q2≈0.85 and 1.45 GeV2. There are indications of a slight increase in R2 γ with Q2.

  16. Kinetics of Electrons from Plasma Discharge in a Latent Track Region Induced by Swift Heavy ION Irradiation

    NASA Astrophysics Data System (ADS)

    Minárik, Stanislav

    2015-08-01

    While passing swift heavy ion through a material structure, it produces a region of radiation affected material which is known as a "latent track". Scattering motions of electrons interacting with a swift heavy ion are dominant in the latent track region. These phenomena include the electron impurity and phonon scattering processes modified by the interaction with the ion projectile as well as the Coulomb scattering between two electrons. In this paper, we provide detailed derivation of a 3D Boltzmann scattering equation for the description of the relative scattering motion of such electrons. Phase-space distribution function for this non-equilibrioum system of scattering electrons can be found by the solution of mentioned equation.

  17. Scanned gate microscopy of inter-edge channel scattering in the quantum Hall regime

    NASA Astrophysics Data System (ADS)

    Woodside, Michael T.; Vale, Chris; McEuen, Paul L.; Kadow, C.; Maranowski, K. D.; Gossard, A. C.

    2000-03-01

    Novel scanned probe techniques have recently been used to study in detail the microscopic properties of 2D electron gases in the quantum Hall regime [1]. We report local measurements of the scattering between edge states in a quantum Hall conductor with non-equilibrium edge state populations. Using an atomic force microscope (AFM) tip as a local gate to perturb the edge states, we find that the scattering is dominated by individual, microscopic scattering sites, which we directly image and characterise. The dependence of the scattering on the AFM tip voltage reveals that it involves tunneling both through quasi-bound impurity states and through disorder-induced weak links between the edge states. [1] S. H. Tessmer et al., Nature 392, 51 (1998); K. L. McCormick et al., Phys. Rev. B 59, 4654 (1999); A. Yacoby et al., Solid State Comm. 111, 1 (1999).

  18. Identification of dominant scattering mechanism in epitaxial graphene on SiC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lin, Jingjing; Guo, Liwei, E-mail: lwguo@iphy.ac.cn, E-mail: chenx29@aphy.iphy.ac.cn; Jia, Yuping

    2014-05-05

    A scheme of identification of scattering mechanisms in epitaxial graphene (EG) on SiC substrate is developed and applied to three EG samples grown on SiC (0001), (112{sup ¯}0), and (101{sup ¯}0) substrates. Hall measurements combined with defect detection technique enable us to evaluate the individual contributions to the carrier scatterings by defects and by substrates. It is found that the dominant scatterings can be due to either substrate or defects, dependent on the substrate orientations. The EG on SiC (112{sup ¯}0) exhibits a better control over the two major scattering mechanisms and achieves the highest mobility even with a highmore » carrier concentration, promising for high performance graphene-based electronic devices. The method developed here will shed light on major aspects in governing carrier transport in EG to harness it effectively.« less

  19. Pitch Angle Scattering of Energetic Electrons by Plasmaspheric Hiss Emissions

    NASA Astrophysics Data System (ADS)

    Tobita, M.; Omura, Y.; Summers, D.

    2017-12-01

    We study scattering of energetic electrons in pitch angles and kinetic energies through their resonance with plasmaspheric hiss emissions consisting of many coherent discrete whistler-mode wave packets with rising and falling frequencies [1,2,3]. Using test particle simulations, we evaluate the efficiency of scattering, which depends on the inhomogeneity ratio S of whistler mode wave-particle interaction [4]. The value of S is determined by the wave amplitude, frequency sweep rate, and the gradient of the background magnetic field. We first modulate those parameters and observe variations of pitch angles and kinetic energies of electrons with a single wave under various S values so as to obtain basic understanding. We then include many waves into the system to simulate plasmaspheric hiss emissions. As the wave packets propagate away from the magnetic equator, the nonlinear trapping potential at the resonance velocity is deformed, making a channel of gyrophase for untrapped electrons to cross the resonance velocity, and causing modulations in their pitch angles and kinetic energies. We find efficient scattering of pitch angles and kinetic energies because of coherent nonlinear wave-particle interaction, resulting in electron precipitations into the polar atmosphere. We compare the results with the bounce averaged pitch angle diffusion coefficient based on quasi-linear theory, and show that the nonlinear wave model with many coherent packets can cause scattering of resonant electrons much faster than the quasi-linear diffusion process. [1] Summers, D., Omura, Y., Nakamura, S., and C. A. Kletzing (2014), Fine structure of plasmaspheric hiss, J. Geophys. Res., 119, 9134-9149. [2] Omura, Y., Y. Miyashita, M. Yoshikawa, D. Summers, M. Hikishima, Y. Ebihara, and Y. Kubota (2015), Formation process of relativistic electron flux through interaction with chorus emissions in the Earth's inner magnetosphere, J. Geophys. Res. Space Physics, 120, 9545-9562. [3] Nakamura, S., Y. Omura, D. Summers, and C. A. Kletzing (2016), Observational evidence of the nonlinear wave growth theory of plasmaspheric hiss, Geophys. Res. Lett., 43, 10,040-10,049. [4] Omura, Y., Katoh, Y., and Summers, D., Theory and simulation of the generation of whistler-mode chorus (2008), J. Geophys. Res., 113, A04223.

  20. Guiding the Design of Radiation Imagers with Experimentally Benchmarked Geant4 Simulations for Electron-Tracking Compton Imaging

    NASA Astrophysics Data System (ADS)

    Coffer, Amy Beth

    Radiation imagers are import tools in the modern world for a wide range of applications. They span the use-cases of fundamental sciences, astrophysics, medical imaging, all the way to national security, nuclear safeguards, and non-proliferation verification. The type of radiation imagers studied in this thesis were gamma-ray imagers that detect emissions from radioactive materials. Gamma-ray imagers goal is to localize and map the distribution of radiation within their specific field-of-view despite the fact of complicating background radiation that can be terrestrial, astronomical, and temporal. Compton imaging systems are one type of gamma-ray imager that can map the radiation around the system without the use of collimation. Lack of collimation enables the imaging system to be able to detect radiation from all-directions, while at the same time, enables increased detection efficiency by not absorbing incident radiation in non-sensing materials. Each Compton-scatter events within an imaging system generated a possible cone-surface in space that the radiation could have originated from. Compton imaging is limited in its reconstructed image signal-to-background due to these source Compton-cones overlapping with background radiation Compton-cones. These overlapping cones limit Compton imaging's detection-sensitivity in image space. Electron-tracking Compton imaging (ETCI) can improve the detection-sensitivity by measuring the Compton-scattered electron's initial trajectory. With an estimate of the scattered electron's trajectory, one can reduce the Compton-back-projected cone to a cone-arc, thus enabling faster radiation source detection and localization. However, the ability to measure the Compton-scattered electron-trajectories adds another layer of complexity to an already complex methodology. For a real-world imaging applications, improvements are needed in electron-track detection efficiency and in electron-track reconstruction. One way of measuring Compton-scattered electron-trajectories is with high-resolution Charged-Coupled Devices (CCDs). The proof-of-principle CCD-based ETCI experiment demonstrated the CCDs' ability to measure the Compton-scattered electron-tracks as a 2-dimensional image. Electron-track-imaging algorithms using the electron-track-image are able to determine the 3-dimensional electron-track trajectory within +/- 20 degrees. The work presented here is the physics simulations developed along side the experimental proof-of-principle experiment. The development of accurate physics modeling for multiple-layer CCDs based ETCI systems allow for the accurate prediction of future ETCI system performance. The simulations also enable quick development insights for system design, and they guide the development of electron-track reconstruction methods. The physics simulation efforts for this project looked closely at the accuracy of the Geant4 Monte Carlo methods for medium energy electron transport. In older version of Geant4 there were some discrepancies between the electron-tracking experimental measurements and the simulation results. It was determined that when comparing the electron dynamics of electrons at very high resolutions, Geant4 simulations must be fine tuned with careful choices for physics production cuts and electron physics stepping sizes. One result of this work is a CCDs Monte Carlo model that has been benchmarked to experimental findings and fully characterized for both photon and electron transport. The CCDs physics model now match to within 1 percent error of experimental results for scattered-electron energies below 500 keV. Following the improvements of the CCDs simulations, the performance of a realistic two-layer CCD-stack system was characterized. The realistic CCD-stack system looked at the effect of thin passive-layers on the CCDs' front face and back-contact. The photon interaction efficiency was calculated for the two-layer CCD-stack, and we found that there is a 90 percent probability of scattered-electrons from a 662 keV source to stay within a single active layer. This demonstrates the improved detection efficiency, which is one of the strengths of the CCDs' implementation as a ETCI system. The CCD-stack simulations also established that electron-tracks scattering from one CCDs layer to another could be reconstructed. The passive-regions on the CCD-stack mean that these inter-layer scattered-electron-tracks will always loose both angular information and energy information. Looking at the angular changes of these electrons scattering between the CCDs layers showed us there is not a strong energy dependence on the angular changes due to the passive-regions of the CCDs. The angular changes of the electron track are, for the most part, a function of the thickness of the thin back-layer of the CCDs. Lastly, an approach using CCD-stack simulations was developed to reconstruct the energy transport across dead-layers and its feasibility was demonstrated. Adding back this lost energy will limit the loss of energy resolution of the scatter-interactions. Energy resolution losses would negatively impacted the achievable image resolution from image reconstruction algorithms. Returning some of the energy back to the reconstructed electron-track will help retain the expected performance of the electron-track trajectory determination algorithm.

  1. SU-E-T-489: Quantum versus Classical Trajectory Monte Carlo Simulations of Low Energy Electron Transport.

    PubMed

    Thomson, R; Kawrakow, I

    2012-06-01

    Widely-used classical trajectory Monte Carlo simulations of low energy electron transport neglect the quantum nature of electrons; however, at sub-1 keV energies quantum effects have the potential to become significant. This work compares quantum and classical simulations within a simplified model of electron transport in water. Electron transport is modeled in water droplets using quantum mechanical (QM) and classical trajectory Monte Carlo (MC) methods. Water droplets are modeled as collections of point scatterers representing water molecules from which electrons may be isotropically scattered. The role of inelastic scattering is investigated by introducing absorption. QM calculations involve numerically solving a system of coupled equations for the electron wavefield incident on each scatterer. A minimum distance between scatterers is introduced to approximate structured water. The average QM water droplet incoherent cross section is compared with the MC cross section; a relative error (RE) on the MC results is computed. RE varies with electron energy, average and minimum distances between scatterers, and scattering amplitude. The mean free path is generally the relevant length scale for estimating RE. The introduction of a minimum distance between scatterers increases RE substantially (factors of 5 to 10), suggesting that the structure of water must be modeled for accurate simulations. Inelastic scattering does not improve agreement between QM and MC simulations: for the same magnitude of elastic scattering, the introduction of inelastic scattering increases RE. Droplet cross sections are sensitive to droplet size and shape; considerable variations in RE are observed with changing droplet size and shape. At sub-1 keV energies, quantum effects may become non-negligible for electron transport in condensed media. Electron transport is strongly affected by the structure of the medium. Inelastic scatter does not improve agreement between QM and MC simulations of low energy electron transport in condensed media. © 2012 American Association of Physicists in Medicine.

  2. Resonant Scattering of Radiation Belt Electrons by Off-Equatorial Magnetosonic Waves

    NASA Astrophysics Data System (ADS)

    Ni, Binbin; Zou, Zhengyang; Fu, Song; Cao, Xing; Gu, Xudong; Xiang, Zheng

    2018-02-01

    Fast magnetosonic (MS) waves are commonly regarded as electromagnetic waves that are characteristically confined within ±3° of the geomagnetic equator. We report two typical off-equatorial MS events observed by Van Allen Probes, that is, the 8 May 2014 event that occurred at the geomagnetic latitudes of 7.5°-9.2° both inside and outside the plasmasphere with the wave amplitude up to 590 pT and the 9 January 2014 event that occurred at the latitudes of—(15.7°-17.5°) outside the plasmasphere with a smaller amplitude about 81 pT. Detailed test particle simulations quantify the electron resonant scattering rates by the off-equatorial MS waves to find that they can cause the pitch angle scattering and momentum diffusion of radiation belt electrons with equatorial pitch angles < 75° or < 58° (depending on the wave latitudinal coverage) on timescales of a day. Subsequent two-dimensional Fokker-Planck diffusion simulations indicate that the strong off-equatorial MS waves are capable of efficiently transporting high pitch angle electrons to lower pitch angles to facilitate the formation of radiation belt electron butterfly distributions for a broad energy range from 100 keV to >1 MeV within an hour. Our study clearly demonstrates that the presence of off-equatorial MS waves, in addition to equatorial MS waves, can contribute importantly to the dynamical variations of radiation belt electron fluxes and their pitch angle distribution.

  3. Resonant Compton Upscattering Models of Magnetar Hard X-ray Emission and Polarization

    NASA Astrophysics Data System (ADS)

    Baring, Matthew G.; Wadiasingh, Zorawar; Gonthier, Peter L.; Kust Harding, Alice

    2017-08-01

    Non-thermal quiescent X-ray emission extending between 10 keV and around 150 keV has been seen in about 10 magnetars by RXTE, INTEGRAL, Suzaku and Fermi-GBM. For inner magnetospheric models of such hard X-ray signals, resonant Compton upscattering is anticipated to be the most efficient process for generating the continuum radiation. This is because the scattering becomes resonant at the cyclotron frequency, and the effective cross section exceeds the classical Thomson value by over two orders of magnitude. We present angle-dependent hard X-ray upscattering model spectra for uncooled monoenergetic relativistic electrons injected in inner regions of pulsar magnetospheres. These spectra are integrated over closed field lines and obtained for different observing perspectives. The spectral cut-off energies are critically dependent on the observer viewing angles and electron Lorentz factor. We find that electrons with energies less than around 15 MeV will emit most of their radiation below 250 keV, consistent with the observed turnovers in magnetar hard X-ray tails. Moreover, electrons of higher energy still emit most of the radiation below around 1 MeV, except for quasi-equatorial emission locales for select pulses phases. In such cases, attenuation mechanisms such as pair creation will be prolific, thereby making it difficult to observe signals extending into the Fermi-LAT band. Our spectral computations use new state-of-the-art, spin-dependent formalism for the QED Compton scattering cross section in strong magnetic fields. The emission exhibits strong polarization above around 30 keV that is anticipated to be dependent on pulse phase, thereby defining science agendas for future hard X-ray polarimeters.

  4. Resistivity scaling due to electron surface scattering in thin metal layers

    NASA Astrophysics Data System (ADS)

    Zhou, Tianji; Gall, Daniel

    2018-04-01

    The effect of electron surface scattering on the thickness-dependent electrical resistivity ρ of thin metal layers is investigated using nonequilibrium Green's function density functional transport simulations. Cu(001) thin films with thickness d =1 -2 nm are used as a model system, employing a random one-monolayer-high surface roughness and frozen phonons to cause surface and bulk scattering, respectively. The zero-temperature resistivity increases from 9.7 ±1.0 μ Ω cm at d =1.99 nm to 18.7 ±2.6 μ Ω cm at d =0.9 0 nm, contradicting the asymptotic T =0 prediction from the classical Fuchs-Sondheimer model. At T =9 00 K, ρ =5.8 ±0.1 μ Ω cm for bulk Cu and ρ =13.4 ±1.1 and 22.5 ±2.4 μ Ω cm for layers with d =1.99 and 0.90 nm, respectively, indicating an approximately additive phonon contribution which, however, is smaller than for bulk Cu or atomically smooth layers. The overall data indicate that the resistivity contribution from surface scattering is temperature-independent and proportional to 1 /d , suggesting that it can be described using a surface-scattering mean-free path λs for 2D transport which is channel-independent and proportional to d . Data fitting indicates λs=4 ×d for the particular simulated Cu(001) surfaces with a one-monolayer-high surface roughness. The 1 /d dependence deviates considerably from previous 1 /d2 predictions from quantum models, indicating that the small-roughness approximation in these models is not applicable to very thin (<2 nm) layers, where the surface roughness is a considerable fraction of d .

  5. Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.

    PubMed

    Banerjee, Swastika; Pati, Swapan K

    2016-06-28

    Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.

  6. Quantized magnetoresistance in atomic-size contacts.

    PubMed

    Sokolov, Andrei; Zhang, Chunjuan; Tsymbal, Evgeny Y; Redepenning, Jody; Doudin, Bernard

    2007-03-01

    When the dimensions of a metallic conductor are reduced so that they become comparable to the de Broglie wavelengths of the conduction electrons, the absence of scattering results in ballistic electron transport and the conductance becomes quantized. In ferromagnetic metals, the spin angular momentum of the electrons results in spin-dependent conductance quantization and various unusual magnetoresistive phenomena. Theorists have predicted a related phenomenon known as ballistic anisotropic magnetoresistance (BAMR). Here we report the first experimental evidence for BAMR by observing a stepwise variation in the ballistic conductance of cobalt nanocontacts as the direction of an applied magnetic field is varied. Our results show that BAMR can be positive and negative, and exhibits symmetric and asymmetric angular dependences, consistent with theoretical predictions.

  7. Evidence for momentum-dependent heavy-fermionic electronic structures: Soft x-ray ARPES for the superconductor CeNi2Ge2 in the normal state

    NASA Astrophysics Data System (ADS)

    Nakatani, Y.; Aratani, H.; Fujiwara, H.; Mori, T.; Tsuruta, A.; Tachibana, S.; Yamaguchi, T.; Kiss, T.; Yamasaki, A.; Yasui, A.; Yamagami, H.; Miyawaki, J.; Ebihara, T.; Saitoh, Y.; Sekiyama, A.

    2018-03-01

    We present clear experimental evidence for the momentum-dependent heavy fermionic electronic structures of the 4 f -based strongly correlated system CeNi2Ge2 by soft x-ray angle-resolved photoemission spectroscopy. A comparison between the experimental three-dimensional quasiparticle dispersion of LaNi2Ge2 and CeNi2Ge2 has revealed that heavy fermionic electronic structures are seen in the region surrounding a specific momentum. Furthermore, the wave vectors between the observed "heavy spots" are consistent with a result of neutron scattering reflecting magnetic correlations, which could be a trigger for the superconductivity in CeNi2Ge2 .

  8. Nonlinear optical response in narrow graphene nanoribbons

    NASA Astrophysics Data System (ADS)

    Karimi, Farhad; Knezevic, Irena

    We present an iterative method to calculate the nonlinear optical response of armchair graphene nanoribbons (aGNRs) and zigzag graphene nanoribbons (zGNRs) while including the effects of dissipation. In contrast to methods that calculate the nonlinear response in the ballistic (dissipation-free) regime, here we obtain the nonlinear response of an electronic system to an external electromagnetic field while interacting with a dissipative environment (to second order). We use a self-consistent-field approach within a Markovian master-equation formalism (SCF-MMEF) coupled with full-wave electromagnetic equations, and we solve the master equation iteratively to obtain the higher-order response functions. We employ the SCF-MMEF to calculate the nonlinear conductance and susceptibility, as well as to calculate the dependence of the plasmon dispersion and plasmon propagation length on the intensity of the electromagnetic field in GNRs. The electron scattering mechanisms included in this work are scattering with intrinsic phonons, ionized impurities, surface optical phonons, and line-edge roughness. Unlike in wide GNRs, where ionized-impurity scattering dominates dissipation, in ultra-narrow nanoribbons on polar substrates optical-phonon scattering and ionized-impurity scattering are equally prominent. Support by the U.S. Department of Energy, Office of Basic Energy Sciences, Division of Materials Sciences and Engineering under Award DE-SC0008712.

  9. Thorough small-angle X-ray scattering analysis of the instability of liquid micro-jets in air.

    PubMed

    Marmiroli, Benedetta; Cacho-Nerin, Fernando; Sartori, Barbara; Pérez, Javier; Amenitsch, Heinz

    2014-01-01

    Liquid jets are of interest, both for their industrial relevance and for scientific applications (more important, in particular for X-rays, after the advent of free-electron lasers that require liquid jets as sample carrier). Instability mechanisms have been described theoretically and by numerical simulation, but confirmed by few experimental techniques. In fact, these are mainly based on cameras, which is limited by the imaging resolution, and on light scattering, which is hindered by absorption, reflection, Mie scattering and multiple scattering due to complex air/liquid interfaces during jet break-up. In this communication it is demonstrated that synchrotron small-angle X-ray scattering (SAXS) can give quantitative information on liquid jet dynamics at the nanoscale, by detecting time-dependent morphology and break-up length. Jets ejected from circular tubes of different diameters (100-450 µm) and speeds (0.7-21 m s(-1)) have been explored to cover the Rayleigh and first wind-induced regimes. Various solvents (water, ethanol, 2-propanol) and their mixtures have been examined. The determination of the liquid jet behaviour becomes essential, as it provides background data in subsequent studies of chemical and biological reactions using SAXS or X-ray diffraction based on synchrotron radiation and free-electron lasers.

  10. Size and Temperature Dependence of Electron Transfer between CdSe Quantum Dots and a TiO 2 Nanobelt

    DOE PAGES

    Tafen, De Nyago; Prezhdo, Oleg V.

    2015-02-24

    Understanding charge transfer reactions between quantum dots (QD) and metal oxides is fundamental for improving photocatalytic, photovoltaic and electronic devices. The complexity of these processes makes it difficult to find an optimum QD size with rapid charge injection and low recombination. We combine time-domain density functional theory with nonadiabatic molecular dynamics to investigate the size and temperature dependence of the experimentally studied electron transfer and charge recombination at CdSe QD-TiO 2 nanobelt (NB) interfaces. The electron injection rate shows strong dependence on the QD size, increasing for small QDs. The rate exhibits Arrhenius temperature dependence, with the activation energy ofmore » the order of millielectronvolts. The charge recombination process occurs due to coupling of the electronic subsystem to vibrational modes of the TiO 2 NB. Inelastic electron-phonon scattering happens on a picosecond time scale, with strong dependence on the QD size. Our simulations demonstrate that the electron-hole recombination rate decreases significantly as the QD size increases, in excellent agreement with experiments. The temperature dependence of the charge recombination rates can be successfully modeled within the framework of the Marcus theory through optimization of the electronic coupling and the reorganization energy. Our simulations indicate that by varying the QD size, one can modulate the photoinduced charge separation and charge recombination, fundamental aspects of the design principles for high efficiency devices.« less

  11. Multilevel acceleration of scattering-source iterations with application to electron transport

    DOE PAGES

    Drumm, Clif; Fan, Wesley

    2017-08-18

    Acceleration/preconditioning strategies available in the SCEPTRE radiation transport code are described. A flexible transport synthetic acceleration (TSA) algorithm that uses a low-order discrete-ordinates (S N) or spherical-harmonics (P N) solve to accelerate convergence of a high-order S N source-iteration (SI) solve is described. Convergence of the low-order solves can be further accelerated by applying off-the-shelf incomplete-factorization or algebraic-multigrid methods. Also available is an algorithm that uses a generalized minimum residual (GMRES) iterative method rather than SI for convergence, using a parallel sweep-based solver to build up a Krylov subspace. TSA has been applied as a preconditioner to accelerate the convergencemore » of the GMRES iterations. The methods are applied to several problems involving electron transport and problems with artificial cross sections with large scattering ratios. These methods were compared and evaluated by considering material discontinuities and scattering anisotropy. Observed accelerations obtained are highly problem dependent, but speedup factors around 10 have been observed in typical applications.« less

  12. Effect of void shape in Czochralski-Si wafers on the intensity of laser-scattering

    NASA Astrophysics Data System (ADS)

    Takahashi, J.; Kawakami, K.; Nakai, K.

    2001-06-01

    The shape effect of anisotropic-shaped microvoid defects in Czochralski-grown silicon wafers on the intensity of laser scattering has been investigated. The size and shape of the defects were examined by means of transmission electron microscopy. Octahedral voids in conventional (nitrogen-undoped) wafers showed an almost isotropic scattering property under the incident condition of a p-polarization beam. On the other hand, parallelepiped-plate-shaped voids in nitrogen-doped wafers showed an anisotropic scattering property on both p- and s-polarized components of scattered light, depending strongly on the incident laser direction. The measured results were explained not by scattering calculation using Born approximation but by calculation based on Rayleigh scattering. It was found that the s component is explained by an inclination of a dipole moment induced on a defect from the scattering plane. Furthermore, using numerical electromagnetic analysis it was shown that the asymmetric behavior of the s component on the parallelepiped-plate voids is ascribed to the parallelepiped shape effect. These results suggest that correction of the scattering intensity is necessary to evaluate the size and volume of anisotropic-shaped defects from the scattered intensity.

  13. Interplay Between Electron-Electron, Electron-Impurity and Electron-Boundary Scattering in a Two Dimensional Electron Gas (2DEG)

    NASA Astrophysics Data System (ADS)

    Abraham, Mathew C.; Ram, Rajeev J.; Gossard, A. C.

    2003-03-01

    A small group of experiments have been conducted over the past decade that explore the fact that even though electron-electron (e-e) scattering in a 2DEG is momentum conserving, its interplay with electron-impurity (e-i)and electron-boundary (e-b) scattering can change the resistance of bulk and mesoscopic devices respectively. The interplay between e-e and e-i scattering in a bulk sample has been shown to cause a fall in the resistivity as a function of electron temperature in the regime where the scattering length l_ee > l_ei and a rise when l_ee < l_ei. In contrast, the interplay between e-e and e-b scattering has been demonstrated to raise the resistivity of a mesoscopic sized wire as a function of electron temperature in the regime l_ee > lb and a fall when l_ee < l_b. We attempt to present a comprehensive picture of these two apparently competing effects by studying devices that are affected by both phenomena simultaneously.

  14. Breakdown of the independent electron picture in mesoscopic samples at low temperatures: The hunt for the Unicorn

    NASA Astrophysics Data System (ADS)

    Webb, R. A.

    1998-03-01

    A variety of experiments are discussed where, at low temperatures, it appears that the non-interacting picture of electrons in a Fermi liquid description of a mesoscopic sample is breaking down. Specifically, experiments on the temperature dependence of the phase-coherence time, energy relaxation rate, spin-flip scattering time, persistent currents in normal metals and transmission through a barrier in the fractional quantum Hall regime all display low-temperature properties which can not be accounted for in the independent electron picture.

  15. Measurement of Deeply Virtual Compton Scattering with a Polarized-Proton Target

    NASA Astrophysics Data System (ADS)

    Chen, S.; Avakian, H.; Burkert, V. D.; Eugenio, P.; Adams, G.; Amarian, M.; Ambrozewicz, P.; Anghinolfi, M.; Asryan, G.; Bagdasaryan, H.; Baillie, N.; Ball, J. P.; Baltzell, N. A.; Barrow, S.; Batourine, V.; Battaglieri, M.; Beard, K.; Bedlinskiy, I.; Bektasoglu, M.; Bellis, M.; Benmouna, N.; Berman, B. L.; Biselli, A. S.; Bonner, B. E.; Bouchigny, S.; Boiarinov, S.; Bosted, P.; Bradford, R.; Branford, D.; Briscoe, W. J.; Brooks, W. K.; Bültmann, S.; Butuceanu, C.; Calarco, J. R.; Careccia, S. L.; Carman, D. S.; Carnahan, B.; Cazes, A.; Cole, P. L.; Collins, P.; Coltharp, P.; Cords, D.; Corvisiero, P.; Crabb, D.; Crannell, H.; Crede, V.; Cummings, J. P.; Masi, R. De; Devita, R.; Sanctis, E. De; Degtyarenko, P. V.; Denizli, H.; Dennis, L.; Deur, A.; Dharmawardane, K. V.; Dhuga, K. S.; Djalali, C.; Dodge, G. E.; Donnelly, J.; Doughty, D.; Dugger, M.; Dytman, S.; Dzyubak, O. P.; Egiyan, H.; Egiyan, K. S.; Fassi, L. El; Elouadrhiri, L.; Fatemi, R.; Fedotov, G.; Feldman, G.; Feuerbach, R. J.; Forest, T. A.; Funsten, H.; Garçon, M.; Gavalian, G.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Goetz, J. T.; Golovatch, E.; Gonenc, A.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guillo, M.; Guler, N.; Guo, L.; Gyurjyan, V.; Hadjidakis, C.; Hafidi, K.; Hakobyan, H.; Hakobyan, R. S.; Hardie, J.; Heddle, D.; Hersman, F. W.; Hicks, K.; Hleiqawi, I.; Holtrop, M.; Huertas, M.; Hyde-Wright, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Ito, M. M.; Jenkins, D.; Jo, H. S.; Joo, K.; Juengst, H. G.; Keith, C.; Kellie, J. D.; Khandaker, M.; Kim, K. Y.; Kim, K.; Kim, W.; Klein, A.; Klein, F. J.; Klusman, M.; Kossov, M.; Kramer, L. H.; Kubarovsky, V.; Kuhn, J.; Kuhn, S. E.; Kuleshov, S. V.; Lachniet, J.; Laget, J. M.; Langheinrich, J.; Lawrence, D.; Li, Ji; Lima, A. C. S.; Livingston, K.; Lu, H.; Lukashin, K.; MacCormick, M.; Markov, N.; McAleer, S.; McKinnon, B.; McNabb, J. W. C.; Mecking, B. A.; Mestayer, M. D.; Meyer, C. A.; Mibe, T.; Mikhailov, K.; Minehart, R.; Mirazita, M.; Miskimen, R.; Mokeev, V.; Morand, L.; Morrow, S. A.; Moteabbed, M.; Mueller, J.; Mutchler, G. S.; Nadel-Turonski, P.; Napolitano, J.; Nasseripour, R.; Natasha, N.; Niccolai, S.; Niculescu, G.; Niculescu, I.; Niczyporuk, B. B.; Niroula, M. R.; Niyazov, R. A.; Nozar, M.; O'Rielly, G. V.; Osipenko, M.; Ostrovidov, A. I.; Park, K.; Pasyuk, E.; Paterson, C.; Philips, S. A.; Pierce, J.; Pivnyuk, N.; Pocanic, D.; Pogorelko, O.; Polli, E.; Popa, I.; Pozdniakov, S.; Preedom, B. M.; Price, J. W.; Prok, Y.; Protopopescu, D.; Qin, L. M.; Raue, B. A.; Riccardi, G.; Ricco, G.; Ripani, M.; Ritchie, B. G.; Ronchetti, F.; Rosner, G.; Rossi, P.; Rowntree, D.; Rubin, P. D.; Sabatié, F.; Salgado, C.; Santoro, J. P.; Sapunenko, V.; Schumacher, R. A.; Serov, V. S.; Sharabian, Y. G.; Shaw, J.; Shvedunov, N. V.; Skabelin, A. V.; Smith, E. S.; Smith, L. C.; Sober, D. I.; Stavinsky, A.; Stepanyan, S. S.; Stepanyan, S.; Stokes, B. E.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Suleiman, R.; Taiuti, M.; Tedeschi, D. J.; Thoma, U.; Tkabladze, A.; Tkachenko, S.; Todor, L.; Tur, C.; Ungaro, M.; Vanderhaeghen, M.; Vineyard, M. F.; Vlassov, A. V.; Watts, D. P.; Weinstein, L. B.; Weygand, D. P.; Williams, M.; Wolin, E.; Wood, M. H.; Yegneswaran, A.; Yun, J.; Zana, L.; Zhang, J.; Zhao, B.; Zhao, Z.

    2006-08-01

    The longitudinal target-spin asymmetry AUL for the exclusive electroproduction of high-energy photons was measured for the first time in ep→→e'pγ. The data have been accumulated at JLab with the CLAS spectrometer using 5.7 GeV electrons and a longitudinally polarized NH3 target. A significant azimuthal angular dependence was observed, resulting from the interference of the deeply virtual Compton scattering and Bethe-Heitler processes. The amplitude of the sin⁡ϕ moment is 0.252±0.042stat±0.020sys. Theoretical calculations are in good agreement with the magnitude and the kinematic dependence of the target-spin asymmetry, which is sensitive to the generalized parton distributions H˜ and H.

  16. Laser light scattering review

    NASA Technical Reports Server (NTRS)

    Schaetzel, Klaus

    1989-01-01

    Since the development of laser light sources and fast digital electronics for signal processing, the classical discipline of light scattering on liquid systems experienced a strong revival plus an enormous expansion, mainly due to new dynamic light scattering techniques. While a large number of liquid systems can be investigated, ranging from pure liquids to multicomponent microemulsions, this review is largely restricted to applications on Brownian particles, typically in the submicron range. Static light scattering, the careful recording of the angular dependence of scattered light, is a valuable tool for the analysis of particle size and shape, or of their spatial ordering due to mutual interactions. Dynamic techniques, most notably photon correlation spectroscopy, give direct access to particle motion. This may be Brownian motion, which allows the determination of particle size, or some collective motion, e.g., electrophoresis, which yields particle mobility data. Suitable optical systems as well as the necessary data processing schemes are presented in some detail. Special attention is devoted to topics of current interest, like correlation over very large lag time ranges or multiple scattering.

  17. Electronic thermal conductivity and the Wiedemann-Franz law for unconventional superconductors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Graf, M.J.; Yip, S.; Sauls, J.A.

    1996-06-01

    We use the quasiclassical theory of superconductivity to calculate the electronic contribution to the thermal conductivity. The theory is formulated for low temperatures when heat transport is limited by electron scattering from random defects and for superconductors with nodes in the order parameter. We show that certain eigenvalues of the thermal conductivity tensor are universal at low temperature, {ital k}{sub {ital BT}}{lt}{gamma}, where {gamma} is the bandwidth of impurity bound states in the superconducting phase. The components of the electrical and thermal conductivity also obey a Wiedemann-Franz law with the Lorenz ratio {ital L}({ital T})={kappa}/{sigma}{ital T} given by the Sommerfeldmore » value of {ital L}{sub {ital S}}=({pi}{sup 2}/3)({ital k}{sub {ital B}}/{ital e}){sup 2} for {ital k}{sub {ital BT}}{lt}{gamma}. For intermediate temperatures the Lorenz ratio deviates significantly from {ital L}{sub {ital S}}, and is strongly dependent on the scattering cross section, and qualitatively different for resonant vs nonresonant scattering. We include comparisons with other theoretical calculations and the thermal conductivity data for the high-{ital T}{sub {ital c}} cuprate and heavy fermion superconductors. {copyright} {ital 1996 The American Physical Society.}« less

  18. Intensity dependence of non-linear kinetic behaviour of stimulated Raman scattering in fusion relevant plasmas

    NASA Astrophysics Data System (ADS)

    Mašek, Martin; Rohlena, Karel

    2015-05-01

    Influence of kinetic effects on 3-wave interaction was examined within the frame of stimulated Raman backward scattering (SRBS) in a rarefied laser corona. The plasma is supposed to be weakly collisional with a negligible density gradient. The model is centred on the physical situation of shock ignition at a large scale direct drive compression experiments. The modelling uses a 1D geometry in a Maxwell-Vlasov model. The method used is a truncated Fourier-Hermite expansion numerically stabilized by a model collisional term with a realistic value of the collision frequency. In parallel, besides the linear theory of SRBS, a coupled mode 3-wave equation system (laser driving wave, Raman back-scattered wave and the daughter forward scattered plasma wave) is solved to demonstrate the correspondence between the full kinetic model and 3-wave interaction with no electron kinetics involved to identify the differences between both the solutions arising due to the electron kinetic effects. We concentrated mainly on the Raman reflectivity, which is one of the important parameters controlling the efficiency of the shock ignition scheme. It was found that the onset of the kinetic effects has a distinct intensity threshold, above which the Raman reflectivity may go down due to the electron kinetics. In addition, we were trying to identify the most important features of the electron phase space behaviour, such as particle trapping in potential minima of the generated plasma wave and its consequences for the 3-wave interaction. The role of the trapped electrons seems to be crucial for a deformation of the plasma wave dispersion curve, as indicated in some earlier work.

  19. Local Quark-Hadron Duality in Electron Scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wally Melnitchouk

    2007-09-10

    We present some recent developments in the study of quark-hadron duality in structure functions in the resonance region. To understand the workings of local duality we introduce the concept of truncated moments, which are used to describe the Q^2 dependence of specific resonance regions within a QCD framework.

  20. Role of electron-phonon coupling in finite-temperature dielectric functions of Au, Ag, and Cu

    NASA Astrophysics Data System (ADS)

    Xu, Meng; Yang, Jia-Yue; Zhang, Shangyu; Liu, Linhua

    2017-09-01

    Realistic representation of finite temperature dielectric functions of noble metals is crucial in describing the optical properties of advancing applications in plasmonics and optical metamaterials. However, the atomistic origins of the temperature dependence of noble metals' dielectric functions still lack full explanation. In this paper, we implement electronic structure calculations as well as ellipsometry experiments to study the finite temperature dielectric functions of noble metals Au, Ag, and Cu. Theoretically, the intraband dielectric function is described by the Drude model, of which the important quantity electron lifetime is obtained by considering the electron-phonon, electron-electron, and electron-surface scattering mechanism. The electron-phonon coupling is key to determining the temperature dependence of electron lifetime and intraband dielectric function. For the interband dielectric function, it arises from the electronic interband transition. Due to the limitation of incorporating electron-phonon coupling into the interband transition scheme, the temperature dependence of the interband dielectric function is mainly determined by the thermal expansion effect. Experimentally, variable angle spectroscopic ellipsometry measures the dielectric functions of Au and Ag over the temperature range of 300-700 K and spectral range of 2-20 µm. Those experimental measurements are consistent with theoretical results and thus verify the theoretical models for the finite temperature dielectric function.

  1. Atomic-scale Visualization of Electronic Nematicity and Cooper Pairing in Iron-based Superconductors

    NASA Astrophysics Data System (ADS)

    Allan, Milan P.

    2013-03-01

    The mechanism of high-temperature superconductivity in the relatively novel iron-based high-Tc superconductors is unresolved, both in terms of how the phases evolve with doping, and in terms of the actual Cooper pairing process. To explore these issues, we used spectroscopic-imaging scanning tunneling microscopy to study the electronic structure of CaFe2As2 in the antiferromagnetic-orthorhombic `parent' state from which the superconductivity emerges. We discovered and visualized the now widely studied electronic `nematicity' of this phase, whose suppression is associated with the emergence of superconductivity (Science 327, 181, 2010). As subsequent transport experiments discovered a related anisotropic conductance which increases with dopant concentration, the interplay between the electronic structure surrounding each dopant atom, quasiparticle scattering therefrom, and the transport nematicity has become a pivotal focus of research. We find that substituting Co for Fe atoms in underdoped Ca(Fe1-xCox)2As2 generates a dense population of identical and strongly anisotropic impurity states that are distributed randomly but aligned with the antiferromagnetic a-axis. We also demonstrate, by imaging their surrounding interference patterns, that these impurity states scatter quasiparticles and thus influence transport in a highly anisotropic manner (M.P. Allan et al., 2013). Next, we studied the momentum dependence of the energy gaps of iron-based superconductivity, now focusing on LiFeAs. If strong electron-electron interactions mediate the Cooper pairing, then momentum-space anisotropic superconducting energy gaps Δi (k) were predicted by multiple techniques to appear on the different electronic bands i. We introduced intraband Bogoliubov quasiparticle scattering interference (QPI) techniques for the determination of anisotropic energy gaps to test these hypotheses and discovered the anisotropy, magnitude, and relative orientations of the energy gaps on multiple bands (Science 336, 563 (2012)). Finally, the electron-electron interactions generating Cooper pairing are often conjectured to involve bosonic spin fluctuations generated by interband scattering of electrons. We explore the STM signatures of both the interband scattering and the electron-boson coupling self-energy in LiFeAs, and detect the signatures of the electron-boson coupling (M.P. Allan et al., in preparation). In collaboration with A.W. Rost, T.-M. Chuang, F. Massee, M.S. Golden, Y. Xie, M.H. Fisher, E.-A. Kim, K. Lee, Ni Ni, S.L. Bud'ko, P.C. Canfield, Q. Wang, D.S. Dessau, K. Kihou, C.H. Lee, A. Iyo, H. Eisaki, D.J. Scalapino, A.P. Mackenzie and J.C. Davis

  2. Genuine binding energy of the hydrated electron

    PubMed Central

    Luckhaus, David; Yamamoto, Yo-ichi; Suzuki, Toshinori; Signorell, Ruth

    2017-01-01

    The unknown influence of inelastic and elastic scattering of slow electrons in water has made it difficult to clarify the role of the solvated electron in radiation chemistry and biology. We combine accurate scattering simulations with experimental photoemission spectroscopy of the hydrated electron in a liquid water microjet, with the aim of resolving ambiguities regarding the influence of electron scattering on binding energy spectra, photoelectron angular distributions, and probing depths. The scattering parameters used in the simulations are retrieved from independent photoemission experiments of water droplets. For the ground-state hydrated electron, we report genuine values devoid of scattering contributions for the vertical binding energy and the anisotropy parameter of 3.7 ± 0.1 eV and 0.6 ± 0.2, respectively. Our probing depths suggest that even vacuum ultraviolet probing is not particularly surface-selective. Our work demonstrates the importance of quantitative scattering simulations for a detailed analysis of key properties of the hydrated electron. PMID:28508051

  3. The role of polarization coulomb field scattering in the electron mobility of AlGaN/AlN/GaN heterostructure field-effect transistors

    NASA Astrophysics Data System (ADS)

    Liu, Yan; Lin, Zhaojun; Zhao, Jingtao; Yang, Ming; Shi, Wenjing; Lv, Yuanjie; Feng, Zhihong

    2016-04-01

    The electron mobility for the prepared AlGaN/AlN/GaN heterostructure field-effect transistor (HFET) with the ratio of the gate length to the drain-to-source distance being less than 1/2 has been studied by comparing the measured electron mobility with the theoretical value. The measured electron mobility is derived from the measured capacitance-voltage (C-V) and current-voltage (I-V) characteristics, and the theoretical mobility is determined by using Matthiessen's law, involving six kinds of important scattering mechanisms. For the prepared device at room temperature, longitudinal optical phonon scattering (LO scattering) was found to have a remarkable effect on the value of the electron mobility, and polarization Coulomb field scattering (PCF scattering ) was found to be important to the changing trend of the electron mobility versus the two-dimensional electron gas (2DEG) density.

  4. Resonant inelastic x-ray scattering probes the electron-phonon coupling in the spin liquid κ -(BEDT-TTF)2Cu2(CN) 3

    NASA Astrophysics Data System (ADS)

    Ilakovac, V.; Carniato, S.; Foury-Leylekian, P.; Tomić, S.; Pouget, J.-P.; Lazić, P.; Joly, Y.; Miyagawa, K.; Kanoda, K.; Nicolaou, A.

    2017-11-01

    Resonant inelastic x-ray scattering at the N K edge reveals clearly resolved harmonics of the anion plane vibrations in the κ -(BEDT-TTF) 2Cu2 (CN) 3 spin-liquid insulator. Tuning the incoming light energy at the K edge of two distinct N sites permits us to excite different sets of phonon modes. The cyanide (CN) stretching mode is selected at the edge of the ordered N sites which are more strongly connected to the bis(ethylenedithio)tetrathiafulvalene (BEDT-TTF) molecules, while positionally disordered N sites show multimode excitation. Combining measurements with calculations on an anion plane cluster permits us to estimate the site-dependent electron-phonon coupling of the modes related to nitrogen excitation.

  5. Creation of X-Ray Transparency of Matter by Stimulated Elastic Forward Scattering.

    PubMed

    Stöhr, J; Scherz, A

    2015-09-04

    X-ray absorption by matter has long been described by the famous Beer-Lambert law. Here, we show how this fundamental law needs to be modified for high-intensity coherent x-ray pulses, now available at x-ray free electron lasers, due to the onset of stimulated elastic forward scattering. We present an analytical expression for the modified polarization-dependent Beer-Lambert law for the case of resonant core-to-valence electronic transitions and incident transform limited x-ray pulses. Upon transmission through a solid, the resonant absorption and dichroic contrasts are found to vanish with increasing x-ray intensity, with the stimulation threshold lowered by orders of magnitude through a resonant superradiantlike effect. Our results have broad implications for the study of matter with x-ray lasers.

  6. Creation of X-Ray Transparency of Matter by Stimulated Elastic Forward Scattering

    NASA Astrophysics Data System (ADS)

    Stöhr, J.; Scherz, A.

    2015-09-01

    X-ray absorption by matter has long been described by the famous Beer-Lambert law. Here, we show how this fundamental law needs to be modified for high-intensity coherent x-ray pulses, now available at x-ray free electron lasers, due to the onset of stimulated elastic forward scattering. We present an analytical expression for the modified polarization-dependent Beer-Lambert law for the case of resonant core-to-valence electronic transitions and incident transform limited x-ray pulses. Upon transmission through a solid, the resonant absorption and dichroic contrasts are found to vanish with increasing x-ray intensity, with the stimulation threshold lowered by orders of magnitude through a resonant superradiantlike effect. Our results have broad implications for the study of matter with x-ray lasers.

  7. Bias-induced modulation of ultrafast carrier dynamics in metallic single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Maekawa, Keisuke; Yanagi, Kazuhiro; Minami, Yasuo; Kitajima, Masahiro; Katayama, Ikufumi; Takeda, Jun

    2018-02-01

    The gate bias dependence of excited-state relaxation dynamics in metallic single-walled carbon nanotubes (MCNTs) was investigated using pump-probe transient absorption spectroscopy coupled with electrochemical doping through an ionic liquid. The transient transmittance decayed exponentially with the pump-probe delay time, whose value could be tuned via the Fermi-level modulation of Dirac electrons under a bias voltage. The obtained relaxation time was the shortest when the Fermi level was at the Dirac point of the MCNTs, and exhibited a U-shaped dependence on the bias voltage. Because optical dipole transitions between the Dirac bands are forbidden in MCNTs, the observed dynamics were attributed to carrier relaxation from the E11 band to the Dirac band. Using a model that considers the suppression of electron-electron scattering (impact ionization) due to Pauli blocking, we could qualitatively explain the obtained bias dependence of the relaxation time.

  8. Quantum interference on electron scattering in graphene by carbon impurities in underlying h -BN

    NASA Astrophysics Data System (ADS)

    Kaneko, Tomoaki; Koshino, Mikito; Saito, Riichiro

    2017-03-01

    Electronic structures and transport properties of graphene on h -BN with carbon impurities are investigated by first-principles calculation and the tight-binding model. We show that the coupling between the impurity level and the graphene's Dirac cone sensitively depends on the impurity position, and in particular, it nearly vanishes when the impurity is located right below the center of the six membered ring of graphene. The Bloch phase factor at the Brillouin zone edge plays a decisive role in the cancellation of the hopping integrals. The impurity position dependence on the electronic structures of graphene on h -BN is investigated by the first-principles calculation, and its qualitative feature is well explained by a tight-binding model with graphene and a single impurity site. We also propose a simple one-dimensional chain-impurity model to analytically describe the role of the quantum interference in the position-dependent coupling.

  9. Dual-angle, self-calibrating Thomson scattering measurements in RFX-MOD

    NASA Astrophysics Data System (ADS)

    Giudicotti, L.; Pasqualotto, R.; Fassina, A.

    2014-11-01

    In the multipoint Thomson scattering (TS) system of the RFX-MOD experiment the signals from a few spatial positions can be observed simultaneously under two different scattering angles. In addition the detection system uses optical multiplexing by signal delays in fiber optic cables of different length so that the two sets of TS signals can be observed by the same polychromator. Owing to the dependence of the TS spectrum on the scattering angle, it was then possible to implement self-calibrating TS measurements in which the electron temperature Te, the electron density ne and the relative calibration coefficients of spectral channels sensitivity Ci were simultaneously determined by a suitable analysis of the two sets of TS data collected at the two angles. The analysis has shown that, in spite of the small difference in the spectra obtained at the two angles, reliable values of the relative calibration coefficients can be determined by the analysis of good S/N dual-angle spectra recorded in a few tens of plasma shots. This analysis suggests that in RFX-MOD the calibration of the entire set of TS polychromators by means of the similar, dual-laser (Nd:YAG/Nd:YLF) TS technique, should be feasible.

  10. A liquid diffraction analysis of sarcoplasmic reticulum. I. Compositional variation.

    PubMed Central

    Brady, G W; Fein, D B; Harder, M E; Spehr, R; Meissner, G

    1981-01-01

    Intensities of x-ray scattering from a series of fragmented rabbit muscle sarcoplasmic reticulum (SR) samples have been measured over the range x = 0.05 to s = 0.25. By varying the relative concentrations of lipid and protein (chiefly the Mg++-dependent, Ca++- stimulated ATPase) in the membranes of this series, and by employing methods of analysis appropriate to the scattering from binary liquid mixtures, we have identified the separable contributions of protein and lipid, and the protein-lipid interaction contributions to the total scattering profiles. The shape of the protein term is consistent with scattering from a cylindrical ATPase particle 142 A in length and 35 A in diameter. These data imply that the dominant ATPase species is monomeric. The protein-lipid interaction term has been analyzed by a novel treatment based on a determination of the pair correlation function between the electrons of the protein molecule with the electrons of the lipid bilayer in terms of the asymmetry of the transbilayer disposition of the protein. Applied to our results, the analysis indicates a fully asymmetric disposition of ATPase, in which one end of the molecule is contiguous with either the lumenal or cytoplasmic surface of the bilayer. PMID:6111360

  11. Quantitative Cryo-Scanning Transmission Electron Microscopy of Biological Materials.

    PubMed

    Elbaum, Michael

    2018-05-11

    Electron tomography provides a detailed view into the 3D structure of biological cells and tissues. Physical fixation by vitrification of the aqueous medium provides the most faithful preservation of biological specimens in the native, fully hydrated state. Cryo-microscopy is challenging, however, because of the sensitivity to electron irradiation and due to the weak electron scattering of organic material. Tomography is even more challenging because of the dependence on multiple exposures of the same area. Tomographic imaging is typically performed in wide-field transmission electron microscopy (TEM) mode with phase contrast generated by defocus. Scanning transmission electron microscopy (STEM) is an alternative mode based on detection of scattering from a focused probe beam, without imaging optics following the specimen. While careful configuration of the illumination and detectors is required to generate useful contrast, STEM circumvents the major restrictions of phase contrast TEM to very thin specimens and provides a signal that is more simply interpreted in terms of local composition and density. STEM has gained popularity in recent years for materials science. The extension of STEM to cryomicroscopy and tomography of cells and macromolecules is summarized herein. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. An experimental and theoretical investigation into the electronically excited states of para-benzoquinone

    NASA Astrophysics Data System (ADS)

    Jones, D. B.; Limão-Vieira, P.; Mendes, M.; Jones, N. C.; Hoffmann, S. V.; da Costa, R. F.; Varella, M. T. do N.; Bettega, M. H. F.; Blanco, F.; García, G.; Ingólfsson, O.; Lima, M. A. P.; Brunger, M. J.

    2017-05-01

    We report on a combination of experimental and theoretical investigations into the structure of electronically excited para-benzoquinone (pBQ). Here synchrotron photoabsorption measurements are reported over the 4.0-10.8 eV range. The higher resolution obtained reveals previously unresolved pBQ spectral features. Time-dependent density functional theory calculations are used to interpret the spectrum and resolve discrepancies relating to the interpretation of the Rydberg progressions. Electron-impact energy loss experiments are also reported. These are combined with elastic electron scattering cross section calculations performed within the framework of the independent atom model-screening corrected additivity rule plus interference (IAM-SCAR + I) method to derive differential cross sections for electronic excitation of key spectral bands. A generalized oscillator strength analysis is also performed, with the obtained results demonstrating that a cohesive and reliable quantum chemical structure and cross section framework has been established. Within this context, we also discuss some issues associated with the development of a minimal orbital basis for the single configuration interaction strategy to be used for our high-level low-energy electron scattering calculations that will be carried out as a subsequent step in this joint experimental and theoretical investigation.

  13. Electron-impact excitation of the low-lying electronic states of HCN

    NASA Technical Reports Server (NTRS)

    Chutjian, A.; Tanaka, H.; Srivastava, S. K.; Wicke, B. G.

    1977-01-01

    The first study of the low-energy electron-impact excitation of low-lying electronic transitions in the HCN molecule is reported. Measurements were made at incident electron energies of 11.6 and 21.6 eV in the energy-loss range of 3-10 eV, and at scattering angles of 20-130 deg. Inelastic scattering spectra were placed on the absolute cross-section scale by determining first the ratio of inelastic-to-elastic scattering cross sections, and then separately measuring the absolute elastic scattering cross section. Several new electronic transitions are observed which are intrinsically overlapped in the molecule itself. Assignments of these electronic transitions are suggested. These assignments are based on present spectroscopic and cross-sections measurements, high-energy electron scattering spectra, optical absorption spectra, and ab initio molecular orbital calculations.

  14. Renormalization of Fermi Velocity in a Composite Two Dimensional Electron Gas

    NASA Astrophysics Data System (ADS)

    Weger, M.; Burlachkov, L.

    We calculate the self-energy Σ(k, ω) of an electron gas with a Coulomb interaction in a composite 2D system, consisting of metallic layers of thickness d ≳ a0, where a0 = ħ2ɛ1/me2 is the Bohr radius, separated by layers with a dielectric constant ɛ2 and a lattice constant c perpendicular to the planes. The behavior of the electron gas is determined by the dimensionless parameters kFa0 and kFc ɛ2/ɛ1. We find that when ɛ2/ɛ1 is large (≈5 or more), the velocity v(k) becomes strongly k-dependent near kF, and v(kF) is enhanced by a factor of 5-10. This behavior is similar to the one found by Lindhard in 1954 for an unscreened electron gas; however here we take screening into account. The peak in v(k) is very sharp (δk/kF is a few percent) and becomes sharper as ɛ2/ɛ1 increases. This velocity renormalization has dramatic effects on the transport properties; the conductivity at low T increases like the square of the velocity renormalization and the resistivity due to elastic scattering becomes temperature dependent, increasing approximately linearly with T. For scattering by phonons, ρ ∝ T2. Preliminary measurements suggest an increase in vk in YBCO very close to kF.

  15. Laser beam-profile impression and target thickness impact on laser-accelerated protons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schollmeier, M.; Harres, K.; Nuernberg, F.

    Experimental results on the influence of the laser focal spot shape onto the beam profile of laser-accelerated protons from gold foils are reported. The targets' microgrooved rear side, together with a stack of radiochromic films, allowed us to deduce the energy-dependent proton source-shape and size, respectively. The experiments show, that shape and size of the proton source depend only weakly on target thickness as well as shape of the laser focus, although they strongly influence the proton's intensity distribution. It was shown that the laser creates an electron beam that closely follows the laser beam topology, which is maintained duringmore » the propagation through the target. Protons are then accelerated from the rear side with an electron created electric field of a similar shape. Simulations with the Sheath-Accelerated Beam Ray-tracing for IoN Analysis code SABRINA, which calculates the proton distribution in the detector for a given laser-beam profile, show that the electron distribution during the transport through a thick target (50 {mu}m Au) is only modified due to multiple small angle scattering. Thin targets (10 {mu}m) show large source sizes of over 100 {mu}m diameter for 5 MeV protons, which cannot be explained by multiple scattering only and are most likely the result of refluxing electrons.« less

  16. Dynamics of valley pseudospin in single-layer WSe2. Inter-valley scattering mediated by electron-phonon interaction

    NASA Astrophysics Data System (ADS)

    Molina-Sanchez, Alejandro; Sangalli, Davide; Wirtz, Ludger; Marini, Andrea

    In a time-dependent Kerr experiment a circularly polarized laser field is used to selectively populate the K+/- electronic valleys of single-layer WSe2. This carrier population corresponds to a finite pseudospin polarization that dictates the valleytronic properties of WSe2, but whose decay mechanism still remains largely debated. Time-dependent Kerr experiments provide an accurate way to visualize the pseudospin dynamics by measuring the rotation of a linearly polarized probe pulse applied after a circularly polarized and short pump pulse. We present here a clear, accurate and parameter-free description of the valley pseudospin dynamics in single-layer WSe2. By using an ab-initio approach we solve unambiguously the long standing debate about the dominant mechanism that drives the valley depolarization. Our results are in excellent agreement with recent time-dependent Kerr experiments. The decay dynamics and peculiar temperature dependence is explained in terms of electron phonon mediated processes that induce spin-flip inter-valley transitions.

  17. Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited).

    PubMed

    Follett, R K; Delettrez, J A; Edgell, D H; Henchen, R J; Katz, J; Myatt, J F; Froula, D H

    2016-11-01

    Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10 21 cm -3 , which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra to show the improvements in plasma characterization.

  18. Electron Transport in SrTio3 Accumulation Layers and Semiconductor Nanocrystal Films

    NASA Astrophysics Data System (ADS)

    Fu, Han

    In this thesis, we study two subjects: SrTiO3 (STO) accumulation layers and films made of semiconductor nanocrystals (NCs), which are important for technological applications. We start from the low temperature conductivity of electron accumulation layers induced by the very strong electric field at the surface of STO sample. Due to the strongly nonlinear lattice dielectric response, the three-dimensional density of electrons n(z) in such a layer decays with the distance from the surface z very slowly as n(z) ≃ 1/z12/7 . We show that when the mobility is limited by the surface scattering the contribution of such a tail to the conductivity diverges at large z because of growing time electrons need to reach the surface. We explore truncation of this divergence by the finite sample width, by the bulk scattering rate, by the back gate voltage, or by the crossover to the bulk linear dielectric response with the dielectric constant kappa. As a result we arrive at the anomalously large mobility, which depends not only on the rate of the surface scattering, but also on the physics of truncation. Similar anomalous behavior is found for the Hall factor, the magnetoresistance, and the thermopower. For the second part, we extend to the cases of spherical and cylindrical geometries, and more complicated planar structures. For the planar case, we study overlapping accumulation layers in GdTiO3/STO/GdTiO 3 quantum wells and electron gases created by spill-out from NSTO (heavily n-type doped STO) layers into STO. Generalization of our approach to a spherical donor cluster creating a big Thomas-Fermi atom with electrons in STO brings us to the problem of supercharged nuclei. It is known that for an atom with nuclear charge Ze, where Z > 170, electrons collapse onto the nucleus resulting in a net charge Zn < Z. Here, instead of relativistic physics, the collapse is caused by the nonlinear dielectric response. Electrons collapse into the charged spherical donor cluster with radius R when its total charge number Z exceeds the critical value Zc ≃ R/a, where a is the lattice constant. The net charge eZ n grows with Z until Z exceeds Z*≃ (R/a)9/7. After this point, the charge number of the compact core Zn remains ≃ Z*, with the rest Z electrons forming a sparse Thomas-Fermi atom with it. We also study the case of long cylindrical clusters. In the third part, we look at the details of the surface scattering by roughness of accumulation layers. To connect with previous works on surface roughness scattering, we focus on conventional semiconductors with the linear dielectric response where accumulation layers with very large concentrations of electrons and many subbands filled became recently available due to ionic liquid and other new methods of gating. The low temperature mobility in such layers is limited by the surface roughness scattering. However theories of roughness scattering so far dealt only with the small-density single subband two-dimensional (2D) electron gas. Here we develop a theory of roughness scattering limited mobility for the multisubband large concentration case. We show that with growing 2D electron concentration N the surface dimensionless conductivity sigma/(2e2/h) first decreases as ≃ N-6/5 and then saturates as ˜ (LambdaaB/Delta 2) >> 1, where Lambda and Delta are the characteristic length and height of the surface roughness, aB is the effective Bohr radius. This means that in spite of the shrinkage of the 2D electron gas width and the related increase of the scattering rate, the 2D electron gas remains a good metal. Thus, there is no re-entrant metal-insulator transition at high concentrations conjectured by Das Sarma and Hwang [PRB 89, 121413 (2014)]. The expression of surface relaxation time can be generalized to the STO case where the dielectric response is nonlinear. We find that there is no reentrant metal-insulator transition, either, in STO accumulation layers at experimentally available large N.. Finally, we switch to the study of NC films. We focus on the variable-range hopping of electrons in semiconductor NC films below the critical doping concentration nc at which films become metallic. The hopping conductivity is then described by the Efros-Shklovskii law which depends on the localization length of electrons. We study how the localization length grows with the doping concentration n in the film of touching NCs. For that we calculate the electron transfer matrix element t(n) between neighboring NCs for two models when NCs touch by small facets or just one point. We study two sources of disorder: variations of NC diameters and random Coulomb potentials originating from random numbers of donors in NCs. We use the ratio of t(n) to the disorder-induced NC level dispersion to find the localization length of electrons due to the multi-step elastic co-tunneling process. We find three different phases at n < nc depending on the strength of disorder, the material, sizes of NCs and their facets: 1) "insulator" where the localization length of electrons increases monotonically with n and 2) "oscillating insulator" when the localization length (and the conductivity) oscillates with n from the insulator base and 3) "blinking metal" where the localization length periodically diverges. The first two phases were seen experimentally and we discuss how one can see the more exotic third one. In all three the localization length diverges at n = nc. This allows us to find nc..

  19. Positronium collisions with atoms and molecules

    NASA Astrophysics Data System (ADS)

    Fabrikant, I. I.; Gribakin, G. F.; Wilde, R. S.

    2017-11-01

    We review recent theoretical efforts to explain observed similarities between electron-atom and positronium(Ps)-atom scattering which also extends to molecular targets. In the range of the projectile velocities above the threshold for Ps ionization (break-up) this similarity can be explained in terms of quasi-free electron scattering and impulse approximation. However, for lower Ps velocities more sophisticated methods should be developed. Our calculations of Ps scattering by heavy noble-gas atoms agree well with experiments at Ps velocities above the Ps ionization threshold. However, in contrast to electron scattering cross sections, at lower velocities they exhibit maxima whereas the experimental cross sections tend to decrease toward lower velocities indicating the same similarity with electron scattering cross section observed above the threshold. Our preliminary results for Ps-N2 scattering confirm experimental observation of a resonance similar to the ∏ g resonance in electron-N2 scattering.

  20. A Hydrodynamic Theory for Spatially Inhomogeneous Semiconductor Lasers. 2; Numerical Results

    NASA Technical Reports Server (NTRS)

    Li, Jianzhong; Ning, C. Z.; Biegel, Bryan A. (Technical Monitor)

    2001-01-01

    We present numerical results of the diffusion coefficients (DCs) in the coupled diffusion model derived in the preceding paper for a semiconductor quantum well. These include self and mutual DCs in the general two-component case, as well as density- and temperature-related DCs under the single-component approximation. The results are analyzed from the viewpoint of free Fermi gas theory with many-body effects incorporated. We discuss in detail the dependence of these DCs on densities and temperatures in order to identify different roles played by the free carrier contributions including carrier statistics and carrier-LO phonon scattering, and many-body corrections including bandgap renormalization and electron-hole (e-h) scattering. In the general two-component case, it is found that the self- and mutual- diffusion coefficients are determined mainly by the free carrier contributions, but with significant many-body corrections near the critical density. Carrier-LO phonon scattering is dominant at low density, but e-h scattering becomes important in determining their density dependence above the critical electron density. In the single-component case, it is found that many-body effects suppress the density coefficients but enhance the temperature coefficients. The modification is of the order of 10% and reaches a maximum of over 20% for the density coefficients. Overall, temperature elevation enhances the diffusive capability or DCs of carriers linearly, and such an enhancement grows with density. Finally, the complete dataset of various DCs as functions of carrier densities and temperatures provides necessary ingredients for future applications of the model to various spatially inhomogeneous optoelectronic devices.

  1. Electron-exchange and quantum screening effects on the Thomson scattering process in quantum Fermi plasmas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Gyeong Won; Jung, Young-Dae; Department of Physics, Applied Physics, and Astronomy, Rensselaer Polytechnic Institute, 110 Eighth Street, Troy, New York 12180-3590

    2013-06-15

    The influence of the electron-exchange and quantum screening on the Thomson scattering process is investigated in degenerate quantum Fermi plasmas. The Thomson scattering cross section in quantum plasmas is obtained by the plasma dielectric function and fluctuation-dissipation theorem as a function of the electron-exchange parameter, Fermi energy, plasmon energy, and wave number. It is shown that the electron-exchange effect enhances the Thomson scattering cross section in quantum plasmas. It is also shown that the differential Thomson scattering cross section has a minimum at the scattering angle Θ=π/2. It is also found that the Thomson scattering cross section increases with anmore » increase of the Fermi energy. In addition, the Thomson scattering cross section is found to be decreased with increasing plasmon energy.« less

  2. Electron density inversed by plasma lines induced by suprathermal electron in the ionospheric modification experiment

    NASA Astrophysics Data System (ADS)

    Wang, Xiang; Zhou, Chen

    2018-05-01

    Incoherent scatter radar (ISR) is the most powerful ground-based measurement facility to study the ionosphere. The plasma lines are not routinely detected by the incoherent scatter radar due to the low intensity, which falls below the measured spectral noise level of the incoherent scatter radar. The plasma lines are occasionally enhanced by suprathermal electrons through the Landau damping process and detectable to the incoherent scatter radar. In this study, by using the European Incoherent Scatter Association (EISCAT) UHF incoherent scatter radar, the experiment observation presents that the enhanced plasma lines were observed. These plasma lines were considered as manifest of the suprathermal electrons generated by the high-frequency heating wave during the ionospheric modification. The electron density profile is also obtained from the enhanced plasma lines. This study can be a promising technique for obtaining the accurate electron density during ionospheric modification experiment.

  3. Monte Carlo calculation of large and small-angle electron scattering in air

    NASA Astrophysics Data System (ADS)

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; Farmer, W. A.; Friedman, A.; Grote, D. P.; Larson, D. J.

    2017-11-01

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. The algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  4. Excitation laser energy dependence of surface-enhanced fluorescence showing plasmon-induced ultrafast electronic dynamics in dye molecules

    NASA Astrophysics Data System (ADS)

    Itoh, Tamitake; Yamamoto, Yuko S.; Tamaru, Hiroharu; Biju, Vasudevanpillai; Murase, Norio; Ozaki, Yukihiro

    2013-06-01

    We find unique properties accompanying surface-enhanced fluorescence (SEF) from dye molecules adsorbed on Ag nanoparticle aggregates, which generate surface-enhanced Raman scattering. The properties are observed in excitation laser energy dependence of SEF after excluding plasmonic spectral modulation in SEF. The unique properties are large blue shifts of fluorescence spectra, deviation of ratios between anti-Stokes SEF intensity and Stokes from those of normal fluorescence, super-broadening of Stokes spectra, and returning to original fluorescence by lower energy excitation. We elucidate that these properties are induced by electromagnetic enhancement of radiative decay rates exceeding the vibrational relaxation rates within an electronic excited state, which suggests that molecular electronic dynamics in strong plasmonic fields can be largely deviated from that in free space.

  5. Mahan excitons in degenerate wurtzite InN: Photoluminescence spectroscopy and reflectivity measurements

    NASA Astrophysics Data System (ADS)

    Feneberg, Martin; Däubler, Jürgen; Thonke, Klaus; Sauer, Rolf; Schley, Pascal; Goldhahn, Rüdiger

    2008-06-01

    Unintentionally degenerately doped n -type hexagonal wurtzite InN samples were studied by using Fourier-transform photoluminescence spectroscopy and reflectivity measurements. We found in luminescence overlapping band acceptor (e,A0) transitions related to two different acceptors with a strong enhancement of their intensities close to the Fermi energy of the electrons recombining with the localized holes. Our explanation is in terms of a Fermi-edge singularity of the electrons due to strongly increased electron-hole scattering. Electron-hole pairs with such resonantly enhanced oscillator strengths have been referred to as Mahan excitons. Temperature-dependent reflectivity measurements confirm this interpretation.

  6. Thickness and microstructure effects in the optical and electrical properties of silver thin films

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ding, Guowen, E-mail: gding@intermolecular.com; Clavero, César; Schweigert, Daniel

    The optical and electrical response of metal thin films approaching thicknesses in the range of the electron mean free path is highly affected by electronic scattering with the interfaces and defects. Here, we present a theoretical and experimental study on how thickness and microstructure affect the properties of Ag thin films. We are able to successfully model the electrical resistivity and IR optical response using a thickness dependent electronic scattering time. Remarkably, the product of electronic scattering time and resistivity remains constant regardless of the thickness (τx ρ = C), with a value of 59 ± 2 μΩ cm ⋅more » fs for Ag films in the investigated range from 3 to 74 nm. Our findings enable us to develop a theoretically framework that allows calculating the optical response of metal thin films in the IR by using their measured thickness and resistivity. An excellent agreement is found between experimental measurements and predicted values. This study also shows the theoretical lower limit for emissivity in Ag thin films according to their microstructure and thickness. Application of the model presented here will allow rapid characterization of the IR optical response of metal thin films, with important application in a broad spectrum of fundamental and industrial applications, including optical coatings, low-emissivity windows and semiconductor industry.« less

  7. Dark matter search results from the PICO-2L C$$_3$$F$$_8$$ bubble chamber

    DOE PAGES

    Amole, C.

    2015-06-11

    New data are reported from the operation of a 2 liter C 3F 8 bubble chamber in the SNOLAB underground laboratory, with a total exposure of 211.5 kg days at four different energy thresholds below 10 keV. These data show that C 3F 8 provides excellent electron-recoil and alpha rejection capabilities at very low thresholds. The chamber exhibits an electron-recoil sensitivity of < 3.5 × 10 –10 and an alpha rejection factor of > 98.2%. These data also include the first observation of a dependence of acoustic signal on alpha energy. Twelve single nuclear recoil event candidates were observed duringmore » the run. The candidate events exhibit timing characteristics that are not consistent with the hypothesis of a uniform time distribution, and no evidence for a dark matter signal is claimed. Lastly, these data provide the most sensitive direct detection constraints on WIMP-proton spin-dependent scattering to date, with significant sensitivity at low WIMP masses for spin-independent WIMP-nucleon scattering.« less

  8. Spectrum bandwidth narrowing of Thomson scattering X-rays with energy chirped electron beams from laser wakefield acceleration

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Tong; Chen, Min, E-mail: minchen@sjtu.edu.cn; Li, Fei-Yu

    2014-01-06

    We study incoherent Thomson scattering between an ultrashort laser pulse and an electron beam accelerated from a laser wakefield. The energy chirp effects of the accelerated electron beam on the final radiation spectrum bandwidth are investigated. It is found that the scattered X-ray radiation has the minimum spectrum width and highest intensity as electrons are accelerated up to around the dephasing point. Furthermore, it is proposed that the electron acceleration process inside the wakefield can be studied by use of 90° Thomson scattering. The dephasing position and beam energy chirp can be deduced from the intensity and bandwidth of themore » scattered radiation.« less

  9. Plasma characterization using ultraviolet Thomson scattering from ion-acoustic and electron plasma waves (invited)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Follett, R. K., E-mail: rfollett@lle.rochester.edu; Delettrez, J. A.; Edgell, D. H.

    2016-11-15

    Collective Thomson scattering is a technique for measuring the plasma conditions in laser-plasma experiments. Simultaneous measurements of ion-acoustic and electron plasma-wave spectra were obtained using a 263.25-nm Thomson-scattering probe beam. A fully reflective collection system was used to record light scattered from electron plasma waves at electron densities greater than 10{sup 21} cm{sup −3}, which produced scattering peaks near 200 nm. An accurate analysis of the experimental Thomson-scattering spectra required accounting for plasma gradients, instrument sensitivity, optical effects, and background radiation. Practical techniques for including these effects when fitting Thomson-scattering spectra are presented and applied to the measured spectra tomore » show the improvements in plasma characterization.« less

  10. Relativistic electron scattering by magnetosonic waves: Effects of discrete wave emission and high wave amplitudes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artemyev, A. V., E-mail: ante0226@gmail.com; Mourenas, D.; Krasnoselskikh, V. V.

    2015-06-15

    In this paper, we study relativistic electron scattering by fast magnetosonic waves. We compare results of test particle simulations and the quasi-linear theory for different spectra of waves to investigate how a fine structure of the wave emission can influence electron resonant scattering. We show that for a realistically wide distribution of wave normal angles θ (i.e., when the dispersion δθ≥0.5{sup °}), relativistic electron scattering is similar for a wide wave spectrum and for a spectrum consisting in well-separated ion cyclotron harmonics. Comparisons of test particle simulations with quasi-linear theory show that for δθ>0.5{sup °}, the quasi-linear approximation describes resonantmore » scattering correctly for a large enough plasma frequency. For a very narrow θ distribution (when δθ∼0.05{sup °}), however, the effect of a fine structure in the wave spectrum becomes important. In this case, quasi-linear theory clearly fails in describing accurately electron scattering by fast magnetosonic waves. We also study the effect of high wave amplitudes on relativistic electron scattering. For typical conditions in the earth's radiation belts, the quasi-linear approximation cannot accurately describe electron scattering for waves with averaged amplitudes >300 pT. We discuss various applications of the obtained results for modeling electron dynamics in the radiation belts and in the Earth's magnetotail.« less

  11. Novel plasmonic polarimeter for biomedical imaging applications

    NASA Astrophysics Data System (ADS)

    Cheney, Alec; Chen, Borui; Cartwright, Alexander; Thomay, Tim

    2018-02-01

    Using polarized light in medical imaging is a valuable tool for diagnostic purposes since light traveling through scattering tissues such as skin, blood, or cartilage may be subject to changes in polarization. We present a new detection scheme and sensor that allows for directly measuring the polarization of light electronically using a plasmonic sensor. The sensor we fabricated consists of a plasmonic nano-grating that is embedded in a Wheatstone circuit. Using resistive losses induced by optically excited plasmons has shown promise as a CMOScompatible plasmonic light detector. Since the plasmonic response is sensitive to polarization with respect to the grating orientation, measuring the resistance change under incident light supplies a direct electronic measure of the polarization of light without polarization optics. Increased electron scattering introduced by plasmons in an applied current results in a measurable decrease in electrical conductance of a grating, allowing a purely electronic readout of a plasmonic excitation. Accordingly, because of its plasmonic nature, such a detector is dependent on both the wavelength and polarization of incident light with a response time limited by the surface plasmon lifetime.

  12. Spin-to-charge conversion for hot photoexcited electrons in germanium

    NASA Astrophysics Data System (ADS)

    Zucchetti, C.; Bottegoni, F.; Isella, G.; Finazzi, M.; Rortais, F.; Vergnaud, C.; Widiez, J.; Jamet, M.; Ciccacci, F.

    2018-03-01

    We investigate the spin-to-charge conversion in highly doped germanium as a function of the kinetic energy of the carriers. Spin-polarized electrons are optically generated in the Ge conduction band, and their kinetic energy is varied by changing the photon energy in the 0.7-2.2 eV range. The spin detection scheme relies on spin-dependent scattering inside Ge, which yields an inverse spin-Hall electromotive force. The detected signal shows a sign inversion for h ν ≈1 eV which can be related to an interplay between the spin relaxation of high-energy electrons photoexcited from the heavy-hole and light-hole bands and that of low-energy electrons promoted from the split-off band. The inferred spin-Hall angle increases by about 3 orders of magnitude within the analyzed photon energy range. Since, for increasing photon energies, the phonon contribution to spin scattering exceeds that of impurities, our result indicates that the spin-to-charge conversion mediated by phonons is much more efficient than the one mediated by impurities.

  13. Simplifying Electron Beam Channeling in Scanning Transmission Electron Microscopy (STEM).

    PubMed

    Wu, Ryan J; Mittal, Anudha; Odlyzko, Michael L; Mkhoyan, K Andre

    2017-08-01

    Sub-angstrom scanning transmission electron microscopy (STEM) allows quantitative column-by-column analysis of crystalline specimens via annular dark-field images. The intensity of electrons scattered from a particular location in an atomic column depends on the intensity of the electron probe at that location. Electron beam channeling causes oscillations in the STEM probe intensity during specimen propagation, which leads to differences in the beam intensity incident at different depths. Understanding the parameters that control this complex behavior is critical for interpreting experimental STEM results. In this work, theoretical analysis of the STEM probe intensity reveals that intensity oscillations during specimen propagation are regulated by changes in the beam's angular distribution. Three distinct regimes of channeling behavior are observed: the high-atomic-number (Z) regime, in which atomic scattering leads to significant angular redistribution of the beam; the low-Z regime, in which the probe's initial angular distribution controls intensity oscillations; and the intermediate-Z regime, in which the behavior is mixed. These contrasting regimes are shown to exist for a wide range of probe parameters. These results provide a new understanding of the occurrence and consequences of channeling phenomena and conditions under which their influence is strengthened or weakened by characteristics of the electron probe and sample.

  14. Electronic confining effects in Sierpiński triangle fractals

    NASA Astrophysics Data System (ADS)

    Wang, Hao; Zhang, Xue; Jiang, Zhuoling; Wang, Yongfeng; Hou, Shimin

    2018-03-01

    Electron confinement in fractal Sierpiński triangles (STs) on Ag(111) is investigated using scanning tunneling spectroscopy and theoretically simulated by employing an improved two-dimensional (2D) multiple scattering theory in which the energy-dependent phase shifts are explicitly calculated from the electrostatic potentials of the molecular building block of STs. Well-defined bound surface states are observed in three kinds of triangular cavities with their sides changing at a scale factor of 2. The decrease in length of the cavities results in an upshift of the resonances that deviates from an expected inverse quadratic dependence on the cavity length due to the less efficient confinement of smaller triangular cavities. Differential conductance maps at some specific biases present a series of alternative bright and dark rounded triangles preserving the symmetry of the boundary. Our improved 2D multiple scattering model reproduces the characteristics of the standing wave patterns and all features in the differential conductance spectra measured in experiments, illustrating that the elastic loss boundary scattering dominates the resonance broadening in these ST quantum corrals. Moreover, the self-similar structure of STs, that a larger central cavity is surrounded by three smaller ones with a half side length, gives rise to interactions of surface states confined in neighboring cavities, which are helpful for the suppression of the linewidth in differential conductance spectra.

  15. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaurov, Alexander A., E-mail: kaurov@uchicago.edu

    We explore a time-dependent energy dissipation of the energetic electrons in the inhomogeneous intergalactic medium (IGM) during the epoch of cosmic reionization. In addition to the atomic processes, we take into account the inverse Compton (IC) scattering of the electrons on the cosmic microwave background photons, which is the dominant channel of energy loss for electrons with energies above a few MeV. We show that: (1) the effect on the IGM has both local (atomic processes) and non-local (IC radiation) components; (2) the energy distribution between hydrogen and helium ionizations depends on the initial energy of an electron; (3) themore » local baryon overdensity significantly affects the fractions of energy distributed in each channel; and (4) the relativistic effect of the atomic cross-section becomes important during the epoch of cosmic reionization. We release our code as open source for further modification by the community.« less

  16. Energy dependence of the spatial distribution of inelastically scattered electrons in backscatter electron diffraction

    NASA Astrophysics Data System (ADS)

    Ram, Farangis; De Graef, Marc

    2018-04-01

    In an electron backscatter diffraction pattern (EBSP), the angular distribution of backscattered electrons (BSEs) depends on their energy. Monte Carlo modeling of their depth and energy distributions suggests that the highest energy BSEs are more likely to hit the bottom of the detector than the top. In this paper, we examine experimental EBSPs to validate the modeled angular BSE distribution. To that end, the Kikuchi bandlet method is employed to measure the width of Kikuchi bands in both modeled and measured EBSPs. The results show that in an EBSP obtained with a 15 keV primary probe, the width of a Kikuchi band varies by about 0 .4∘ from the bottom of the EBSD detector to its top. The same is true for a simulated pattern that is composed of BSEs with 5 keV to 15 keV energies, which validates the Monte Carlo simulations.

  17. Dependence of the absorption and optical surface plasmon scattering of MoS₂ nanoparticles on aspect ratio, size, and media.

    PubMed

    Yadgarov, Lena; Choi, Charina L; Sedova, Anastasiya; Cohen, Ayala; Rosentsveig, Rita; Bar-Elli, Omri; Oron, Dan; Dai, Hongjie; Tenne, Reshef

    2014-04-22

    The optical and electronic properties of suspensions of inorganic fullerene-like nanoparticles of MoS2 are studied through light absorption and zeta-potential measurements and compared to those of the corresponding microscopic platelets. The total extinction measurements show that, in addition to excitonic peaks and the indirect band gap transition, a new peak is observed at 700-800 nm. This spectral peak has not been reported previously for MoS2. Comparison of the total extinction and decoupled absorption spectrum indicates that this peak largely originates from scattering. Furthermore, the dependence of this peak on nanoparticle size, shape, and surface charge, as well as solvent refractive index, suggests that this transition arises from a plasmon resonance.

  18. Analysis of photon emission induced by light and heavy ions in time-of-flight medium energy ion scattering

    NASA Astrophysics Data System (ADS)

    Lohmann, S.; Sortica, M. A.; Paneta, V.; Primetzhofer, D.

    2018-02-01

    We present a systematic analysis of the photon emission observed due to impact of pulsed keV ion beams in time-of-flight medium energy ion scattering (ToF-MEIS) experiments. Hereby, hydrogen, helium and neon ions served as projectiles and thin gold and titanium nitride films on different substrates were employed as target materials. The present experimental evidence indicates that a significant fraction of the photons has energies of around 10 eV, i.e. on the order of typical valence and conduction band transitions in solids. Furthermore, the scaling properties of the photon emission with respect to several experimental parameters were studied. A dependence of the photon yield on the projectile velocity was observed in all experiments. The photon yield exhibits a dependence on the film thickness and the scattering angle, which can be explained by photon production along the path of the incident ion through the material. Additionally, a strong dependence on the projectile type was found with the photon emission being higher for heavier projectiles. This difference is larger than the respective difference in electronic stopping cross section. The photon yield shows a strong material dependence, and according to a comparison of SiO2 and Si seems to be subject to matrix effects.

  19. Monte Carlo calculation of large and small-angle electron scattering in air

    DOE PAGES

    Cohen, B. I.; Higginson, D. P.; Eng, C. D.; ...

    2017-08-12

    A Monte Carlo method for angle scattering of electrons in air that accommodates the small-angle multiple scattering and larger-angle single scattering limits is introduced. In this work, the algorithm is designed for use in a particle-in-cell simulation of electron transport and electromagnetic wave effects in air. The method is illustrated in example calculations.

  20. Elucidating the Wavelength Dependence of Phonon Scattering in Nanoparticle-Matrix Composites using Phonon Spectroscopy

    DTIC Science & Technology

    2016-07-11

    composites with x - ray diffraction (XRD), transmission electron microscopy (TEM), scanning electron microscopy (SEM), Rutherford backscattering spectroscopy...RBS), particle-induced x - ray emission (PIXE), and energy dispersive x - ray spectroscopy (EDX). This work complements earlier works on CdSe...sample shows only In2Se3 and CdIn2Se4 XRD peaks (Figure 1.4e), it is stoichiometrically   Figure 1.4. X - ray diffraction patterns of (a) γ-In2Se3

  1. The gamma-ray emitting region of the jet in Cyg X-3

    NASA Astrophysics Data System (ADS)

    Zdziarski, Andrzej A.; Sikora, Marek; Dubus, Guillaume; Yuan, Feng; Cerutti, Benoit; Ogorzałek, Anna

    2012-04-01

    We study models of the γ-ray emission of Cyg X-3 observed by Fermi. We calculate the average X-ray spectrum during the γ-ray active periods. Then, we calculate spectra from Compton scattering of a photon beam into a given direction by isotropic relativistic electrons with a power-law distribution, both based on the Klein-Nishina cross-section and in the Thomson limit. Applying the results to scattering of stellar blackbody radiation in the inner jet of Cyg X-3, we find that a low-energy break in the electron distribution at a Lorentz factor of ˜300-103 is required by the shape of the observed X-ray/γ-ray spectrum in order to avoid overproducing the observed X-ray flux. The electrons giving rise to the observed γ-rays are efficiently cooled by Compton scattering, and the power-law index of the acceleration process is ≃2.5-3. The bulk Lorentz factor of the jet and the kinetic power before the dissipation region depend on the fraction of the dissipation power supplied to the electrons; if it is ≃1/2, the Lorentz factor is ˜2.5, and the kinetic power is ˜1038 erg s-1, which represents a firm lower limit on the jet power, and is comparable to the bolometric luminosity of Cyg X-3. Most of the power supplied to the electrons is radiated. The broad-band spectrum constrains the synchrotron and self-Compton emission from the γ-ray emitting electrons, which requires the magnetic field to be relatively weak, with the magnetic energy density ≲ a few times 10-3 of that in the electrons. The actual value of the magnetic field strength can be inferred from a future simultaneous measurement of the infrared and γ-ray fluxes.

  2. Dissociative recombination of HCl+

    NASA Astrophysics Data System (ADS)

    Larson, Åsa; Fonseca dos Santos, Samantha; E. Orel, Ann

    2017-08-01

    The dissociative recombination of HCl+, including both the direct and indirect mechanisms, is studied. For the direct process, the relevant electronic states are calculated ab initio by combining electron scattering calculations to obtain resonance positions and autoionization widths with multi-reference configuration interaction calculations of the ion and Rydberg states. The cross section for the direct dissociation along electronic resonant states is computed by solution of the time-dependent Schrödinger equation. For the indirect process, an upper bound value for the cross section is obtained using a vibrational frame transformation of the elements of the scattering matrix at energies just above the ionization threshold. Vibrational excitations of the ionic core from the ground vibrational state, v = 0 , to the first three excited vibrational states, v = 1 , v = 2 , and v = 3 , are considered. Autoionization is neglected and the effect of the spin-orbit splitting of the ionic potential energy upon the indirect dissociative recombination cross section is considered. The calculated cross sections are compared to measurements.

  3. Sum rules and other properties involving resonance projection operators. [for optical potential description of electron scattering from atoms and ions

    NASA Technical Reports Server (NTRS)

    Berk, A.; Temkin, A.

    1985-01-01

    A sum rule is derived for the auxiliary eigenvalues of an equation whose eigenspectrum pertains to projection operators which describe electron scattering from multielectron atoms and ions. The sum rule's right-hand side depends on an integral involving the target system eigenfunctions. The sum rule is checked for several approximations of the two-electron target. It is shown that target functions which have a unit eigenvalue in their auxiliary eigenspectrum do not give rise to well-defined projection operators except through a limiting process. For Hylleraas target approximations, the auxiliary equations are shown to contain an infinite spectrum. However, using a Rayleigh-Ritz variational principle, it is shown that a comparatively simple aproximation can exhaust the sum rule to better than five significant figures. The auxiliary Hylleraas equation is greatly simplified by conversion to a square root equation containing the same eigenfunction spectrum and from which the required eigenvalues are trivially recovered by squaring.

  4. Thermoelectric properties of PbTe with indium and bismuth secondary phase

    NASA Astrophysics Data System (ADS)

    Bali, A.; Chetty, R.; Mallik, R. C.

    2016-06-01

    Lead telluride (PbTe) with indium (In) and bismuth (Bi) as micrometer sized secondary phases dispersed throughout the bulk has been prepared by matrix encapsulation method. In and Bi are not found to substitute in PbTe as shown by Rietveld and room temperature Raman studies but are present as secondary phases. Increased values of temperature dependent electrical resistivity and Seebeck coefficient show the effect of interfaces on electronic transport. As expected, thermal conductivity is found to reduce on addition of secondary phases due to a reduced electronic contribution, further confirming that electron scattering at interfaces is more important than phonon scattering in such systems for thermoelectric properties. However, due to the reduction in the power factor of the In and Bi added samples from that of the parent PbTe, the overall thermoelectric figure of merit ( zT) does not increase beyond that of PbTe, for which the highest value of 0.7 is obtained at 778 K.

  5. Dissociative recombination of HCl.

    PubMed

    Larson, Åsa; Fonseca Dos Santos, Samantha; E Orel, Ann

    2017-08-28

    The dissociative recombination of HCl + , including both the direct and indirect mechanisms, is studied. For the direct process, the relevant electronic states are calculated ab initio by combining electron scattering calculations to obtain resonance positions and autoionization widths with multi-reference configuration interaction calculations of the ion and Rydberg states. The cross section for the direct dissociation along electronic resonant states is computed by solution of the time-dependent Schrödinger equation. For the indirect process, an upper bound value for the cross section is obtained using a vibrational frame transformation of the elements of the scattering matrix at energies just above the ionization threshold. Vibrational excitations of the ionic core from the ground vibrational state, v = 0, to the first three excited vibrational states, v = 1, v = 2, and  v = 3, are considered. Autoionization is neglected and the effect of the spin-orbit splitting of the ionic potential energy upon the indirect dissociative recombination cross section is considered. The calculated cross sections are compared to measurements.

  6. Electron scattering on molecules: search for semi-empirical indications

    NASA Astrophysics Data System (ADS)

    Fedus, Kamil; Karwasz, Grzegorz P.

    2017-06-01

    Reliable cross-sections for electron-molecule collisions are urgently needed for numerical modeling of various processes important from technological point of view. Unfortunately, a significant progress in theory and experiment over the last decade is not usually accompanied by the convergence of cross-sections measured at different laboratories and calculated with different methods. Moreover the most advanced contemporary theories involve such large basis sets and complicated equations that they are not easily applied to each specific molecule for which data are needed. For these reasons the search for semi-empirical indications in angular and energy dependencies of scattering cross-section becomes important. In this paper we make a brief review of the applicability of the Born-dipole approximation for elastic, rotational, vibrational and ionization processes that can occur during electron-molecule collisions. We take into account the most recent experimental findings as the reference points. Contribution to the Topical Issue "Atomic and Molecular Data and Their Applications", edited by Gordon W.F. Drake, Jung-Sik Yoon, Daiji Kato, and Grzegorz Karwasz.

  7. Importance of projectile-target interactions in the triple differential cross sections for Low energy (e,2e) ionization of aligned H2

    NASA Astrophysics Data System (ADS)

    Ali, Esam; Madison, Don; Ren, X.; Dorn, A.; Ning, Chuangang

    2014-10-01

    Experimental and theoretical Triple Differential Cross Sections (TDCS) are presented for electron impact ionization-excitation of the 2 sσg state of H2 in the perpendicular plane. The excited 2 sσg state immediately dissociates and the alignment of the molecule is determined by detecting one of the fragments. Results are presented for three different alignments in the xy-plane (scattering plane is xz)-alignment along y-axis, x-axis, and 45° between the x- and y-axes for incident electron energies of 4, 10, and 25 eV and different scattered electron angles of 20° and 30° in the perpendicular plane. Theoretical M4DW (molecular 4-body distorted wave) results are compared to experimental data, and overall we found reasonably good agreement between experiment and theory. The Results show that (e,2e) cross sections for excitation-ionization depend strongly on the orientation of the H2 molecule.

  8. Dark trions and biexcitons in WS2 and WSe2 made bright by e-e scattering

    NASA Astrophysics Data System (ADS)

    Danovich, Mark; Zólyomi, Viktor; Fal'Ko, Vladimir I.

    2017-04-01

    The direct band gap character and large spin-orbit splitting of the valence band edges (at the K and K’ valleys) in monolayer transition metal dichalcogenides have put these two-dimensional materials under the spot-light of intense experimental and theoretical studies. In particular, for Tungsten dichalcogenides it has been found that the sign of spin splitting of conduction band edges makes ground state excitons radiatively inactive (dark) due to spin and momentum mismatch between the constituent electron and hole. One might similarly assume that the ground states of charged excitons and biexcitons in these monolayers are also dark. Here, we show that the intervalley (K ⇆ K‧) electron-electron scattering mixes bright and dark states of these complexes, and estimate the radiative lifetimes in the ground states of these “semi-dark” trions and biexcitons to be ~10 ps, and analyse how these complexes appear in the temperature-dependent photoluminescence spectra of WS2 and WSe2 monolayers.

  9. On the Q-dependence of the lowest-order QED corrections and other properties of the ground 11S-states in the two-electron ions

    NASA Astrophysics Data System (ADS)

    Frolov, Alexei M.

    2015-10-01

    Formulas and expectation values which are need to determine the lowest-order QED corrections (∼α3) and corresponding recoil (or finite mass) corrections in the two-electron helium-like ions are presented. Other important properties of the two-electron ions are also determined to high accuracy, including the expectation values of the quasi-singular Vinti operator and < reN-2> and < ree-2> expectation values. Elastic scattering of fast electrons by the two-electron ions in the Born approximation is considered. Interpolation formulas are derived for the bound state properties of the two-electron ions as the function of the nuclear electric charge Q.

  10. Comparative electron temperature measurements of Thomson scattering and electron cyclotron emission diagnostics in TCABR plasmas.

    PubMed

    Alonso, M P; Figueiredo, A C A; Borges, F O; Elizondo, J I; Galvão, R M O; Severo, J H F; Usuriaga, O C; Berni, L A; Machida, M

    2010-10-01

    We present the first simultaneous measurements of the Thomson scattering and electron cyclotron emission radiometer diagnostics performed at TCABR tokamak with Alfvén wave heating. The Thomson scattering diagnostic is an upgraded version of the one previously installed at the ISTTOK tokamak, while the electron cyclotron emission radiometer employs a heterodyne sweeping radiometer. For purely Ohmic discharges, the electron temperature measurements from both diagnostics are in good agreement. Additional Alfvén wave heating does not affect the capability of the Thomson scattering diagnostic to measure the instantaneous electron temperature, whereas measurements from the electron cyclotron emission radiometer become underestimates of the actual temperature values.

  11. Relativistic Gurzhi effect in channels of Dirac materials

    NASA Astrophysics Data System (ADS)

    Kashuba, Oleksiy; Trauzettel, Björn; Molenkamp, Laurens W.

    2018-05-01

    Charge transport in channel-shaped 2D Dirac systems is studied employing the Boltzmann equation. The dependence of the resistivity on temperature and chemical potential is investigated. An accurate understanding of the influence of electron-electron interaction and material disorder allows us to identify a parameter regime, where the system reveals hydrodynamic transport behavior. We point out the conditions for three Dirac fermion specific features: heat flow hydrodynamics, pseudodiffusive transport, and the electron-hole scattering dominated regime. It is demonstrated that for clean samples the relativistic Gurzhi effect, a definite indicator of hydrodynamic transport, can be observed.

  12. Salt-induced aggregation and fusion of dioctadecyldimethylammonium chloride and sodium dihexadecylphosphate vesicles.

    PubMed Central

    Carmona-Ribeiro, A M; Chaimovich, H

    1986-01-01

    Small dioctadecyldimethylammonium chloride (DODAC) vesicles prepared by sonication fuse upon addition of NaCl as detected by several methods (electron microscopy, trapped volume determinations, temperature-dependent phase transition curves, and osmometer behavior. In contrast, small sodium dihexadecyl phosphate (DHP) vesicles mainly aggregate upon NaCl addition as shown by electron microscopy and the lack of osmometer behavior. Scatter-derived absorbance changes of small and large DODAC or DHP vesicles as a function of time after salt addition were obtained for a range of NaCl or amphiphile concentration. These changes were interpreted in accordance with a phenomenological model based upon fundamental light-scattering laws and simple geometrical considerations. Short-range hydration repulsion between DODAC (or DHP) vesicles is possibly the main energy barrier for the fusion process. Images FIGURE 2 FIGURE 9 PMID:3779002

  13. Electron scattering effects at physisorbed hydrogen molecules on break-junction electrodes and nanowires formation in hydrogen environment

    NASA Astrophysics Data System (ADS)

    van der Maas, M.; Vasnyov, S.; Hendriksen, B. L. M.; Shklyarevskii, O. I.; Speller, S.

    2012-06-01

    Physisorption of hydrogen molecules on the surface of gold and other coinage metals has been studied using distance tunneling spectroscopy. We have observed that the distance dependence of the tunnel current (resistance) displays a strong N-shaped deviation from exponential behavior. Such deviations are difficult to explain within the Tersoff-Hamann approximation. We suggest the scattering of tunneling electrons by H2 molecules as an origin for the observed effect. We have found that this phenomenon is also common for strongly adsorbed organic molecules with a single anchoring group. Pulling Au, Cu and Pt nanowires at 22 K in hydrogen environment shows that the break-junction electrodes are still connected through hydrogen-metal monoatomic chains down to very low conductance values of 10-4-10-6 G0.

  14. Spin Filtering in Storage Rings

    NASA Astrophysics Data System (ADS)

    Nikolaev, N. N.; Pavlov, F. F.

    The spin filtering in storage rings is based on a multiple passage of a stored beam through a polarized internal gas target. Apart from the polarization by the spin-dependent transmission, a unique geometrical feature of interaction with the target in such a filtering process, pointed out by H.O. Meyer,1 is a scattering of stored particles within the beam. A rotation of the spin in the scattering process affects the polarization buildup. We derive here a quantum-mechanical evolution equation for the spin-density matrix of a stored beam which incorporates the scattering within the beam. We show how the interplay of the transmission and scattering within the beam changes from polarized electrons to polarized protons in the atomic target. After discussions of the FILTEX results on the filtering of stored protons,2 we comment on the strategy of spin filtering of antiprotons for the PAX experiment at GSI FAIR.3.

  15. Raman scattering excitation spectroscopy of monolayer WS2.

    PubMed

    Molas, Maciej R; Nogajewski, Karol; Potemski, Marek; Babiński, Adam

    2017-07-11

    Resonant Raman scattering is investigated in monolayer WS 2 at low temperature with the aid of an unconventional technique, i.e., Raman scattering excitation (RSE) spectroscopy. The RSE spectrum is made up by sweeping the excitation energy, when the detection energy is fixed in resonance with excitonic transitions related to either neutral or charged excitons. We demonstrate that the shape of the RSE spectrum strongly depends on the selected detection energy. The resonance of outgoing light with the neutral exciton leads to an extremely rich RSE spectrum, which displays several Raman scattering features not reported so far, while no clear effect on the associated background photoluminescence is observed. Instead, when the outgoing photons resonate with the negatively charged exciton, a strong enhancement of the related emission occurs. Presented results show that the RSE spectroscopy can be a useful technique to study electron-phonon interactions in thin layers of transition metal dichalcogenides.

  16. Size effect on thermoelectric properties of Bi2Te3 nanoparticles

    NASA Astrophysics Data System (ADS)

    Choudhary, K. K.; Sharma, Uttam; Lodhi, Pavitra Devi; Kaurav, Netram

    2018-05-01

    Bi2Te3 nanoparticles exhibit size dependent thermoelectric properties which gives an opportunity to tune the size for optimization of the thermoelectric figure of merit (ZT). We have quantitatively analyzed the thermoelectric properties of Bi2Te3 using phonon scattering mechanism by incorporating the scattering of phonons with defects, grain boundaries, electrons and Umklapp phonon scatterings. The maximum value of ZT = 0.92 is obtained at T = 400 K for 30 nm Bi2Te3 nanoparticles in comparison to ZT = 0.45 for 150 nm nanoparticles at the same temperature. With decrease in size of nanoparticles interface volume ratio increases which increase the phonon scatterings with grain boundaries and point defects, results in decrease in thermal conductivity due to reduction in mean free path of phonons. As a result of decrease in thermal conductivity (κ), Seeback coefficient (S) and ZT increases.

  17. Setting up a Rayleigh Scattering Based Flow Measuring System in a Large Nozzle Testing Facility

    NASA Technical Reports Server (NTRS)

    Panda, Jayanta; Gomez, Carlos R.

    2002-01-01

    A molecular Rayleigh scattering based air density measurement system has been built in a large nozzle testing facility at NASA Glenn Research Center. The technique depends on the light scattering by gas molecules present in air; no artificial seeding is required. Light from a single mode, continuous wave laser was transmitted to the nozzle facility by optical fiber, and light scattered by gas molecules, at various points along the laser beam, is collected and measured by photon-counting electronics. By placing the laser beam and collection optics on synchronized traversing units, the point measurement technique is made effective for surveying density variation over a cross-section of the nozzle plume. Various difficulties associated with dust particles, stray light, high noise level and vibration are discussed. Finally, a limited amount of data from an underexpanded jet are presented and compared with expected variations to validate the technique.

  18. STM on Gate-Tunable Graphene

    NASA Astrophysics Data System (ADS)

    Zhang, Yuanbo

    2009-03-01

    We have successfully performed atomically-resolved scanning tunneling microscopy and spectroscopy (STS) on mechanically exfoliated graphene samples having tunable back-gates. We have discovered that the tunneling spectra of graphene flakes display an unexpected gap-like feature that is pinned to the Fermi level for different gate voltages, and which coexists with another depression in density-of-states that moves with gate voltage. Extensive tests and careful analysis show that the gap-feature is due to phonon-assisted inelastic tunneling, and the depression directly marks the location of the graphene Dirac point. Using tunneling spectroscopy as a new tool, we further probe the local energetic variations of the graphene charge neutral point (Dirac point) to map out spatial electron density inhomogeneities in graphene. Such measurements are two orders of magnitude higher in resolution than previous experiments, and they can be directly correlated with nanometer scale topographic features. Based on our observation of energy-dependent periodic electronic interference patterns, our measurements also reveal the nature of impurity scattering of Dirac fermions in graphene. These results are significant for understanding the sources of electron density inhomogeneity and electron scattering in graphene, and the microscopic causes of graphene electron mobility.

  19. Size-dependent surface-enhanced Raman scattering of sodium benzoate on Silver nanoparticles

    NASA Astrophysics Data System (ADS)

    Badr, Y.; Mahmoud, M. A.

    2005-07-01

    The absorption spectrum of silver nanoparticles (Ag NPs) with different size and the transmission electron microscopy (TEM) was recorded. Surface-enhanced Raman scattering (SERS) spectra of Sodium Benzoate (SB) adsorbed on Ag NPs with different particle size were studied. The carboxylic group bands were enhanced as the particle size decreases due to the chemisorption of SB on the Ag NPs through it in which the carboxyl group was perpendicular to the surface and the benzene ring parallel to the surface; the SB bands were enhanced as the coverage density of Ag NPs increased.

  20. Two-potential approach for electron-molecular collisions at intermediate and high energies - Application to e-N2 scatterings

    NASA Technical Reports Server (NTRS)

    Choi, B. H.; Poe, R. T.; Sun, J. C.; Shan, Y.

    1979-01-01

    A general theoretical approach is proposed for the calculation of elastic, vibrational, and rotational transitions for electron-molecule scattering at intermediate and high-electron-impact energies. In this formulation, contributions to the scattering process come from the incoherent sum of two dominant potentials: a short-range shielded nuclear Coulomb potential from individual atomic centers, and a permanent/induced long-range potential. Application to e-N2 scattering from 50-500 eV incident electron energies has yielded good agreement with absolutely calibrated experiments. Comparisons with other theoretical approaches are made. The physical picture as well as the general features of electron-molecule scattering process are discussed within the framework of the two-potential approach.

  1. Inelastic scattering matrix elements for the nonadiabatic collision B(2P1/2)+H2(1Sigmag+,j)<-->B(2P3/2)+H2(1Sigmag+,j').

    PubMed

    Weeks, David E; Niday, Thomas A; Yang, Sang H

    2006-10-28

    Inelastic scattering matrix elements for the nonadiabatic collision B(2P1/2)+H2(1Sigmag+,j)<-->B(2P3/2)+H2(1Sigmag+,j') are calculated using the time dependent channel packet method (CPM). The calculation employs 1 2A', 2 2A', and 1 2A" adiabatic electronic potential energy surfaces determined by numerical computation at the multireference configuration-interaction level [M. H. Alexander, J. Chem. Phys. 99, 6041 (1993)]. The 1 2A' and 2 2A', adiabatic electronic potential energy surfaces are transformed to yield diabatic electronic potential energy surfaces that, when combined with the total B+H2 rotational kinetic energy, yield a set of effective potential energy surfaces [M. H. Alexander et al., J. Chem. Phys. 103, 7956 (1995)]. Within the framework of the CPM, the number of effective potential energy surfaces used for the scattering matrix calculation is then determined by the size of the angular momentum basis used as a representation. Twenty basis vectors are employed for these calculations, and the corresponding effective potential energy surfaces are identified in the asymptotic limit by the H2 rotor quantum numbers j=0, 2, 4, 6 and B electronic states 2Pja, ja=1/2, 3/2. Scattering matrix elements are obtained from the Fourier transform of the correlation function between channel packets evolving in time on these effective potential energy surfaces. For these calculations the H2 bond length is constrained to a constant value of req=1.402 a.u. and state to state scattering matrix elements corresponding to a total angular momentum of J=1/2 are discussed for j=0<-->j'=0,2,4 and 2P1/2<-->2P1/2, 2P3/2 over a range of total energy between 0.0 and 0.01 a.u.

  2. Precision calculation of the lowest 1S resonance in e-H scattering. [electron-hydrogen scattering

    NASA Technical Reports Server (NTRS)

    Ho, Y. K.; Bhatia, A. K.; Temkin, A.

    1977-01-01

    The position and width of the lowest resonance in electron-hydrogen scattering have been calculated using a Hylleraas correlation function with up to 95 terms in the optical potential formalism. The results should be useful as calibration points for experimental electron scattering purposes. A formula relating the conventional (Breit-Wigner) width with the Feschbach formalism is derived.

  3. Investigation of superelastic electron scattering by laser-excited Ba - Experimental procedures and results

    NASA Technical Reports Server (NTRS)

    Register, D. F.; Trajmar, S.; Fineman, M. A.; Poe, R. T.; Csanak, G.; Jensen, S. W.

    1983-01-01

    Differential (in angle) electron scattering experiments on laser-excited Ba-138 1P were carried out at 30- and 100-eV impact energies. The laser light was linearly polarized and located in the scattering plane. The superelastic scattering signal was measured as a function of polarization direction of the laser light with respect to the scattering plane. It was found at low electron scattering angles that the superelastic scattering signal was asymmetric to reflection of the polarization vector with respect to the scattering plane. This is in contradiction with theoretical predictions. An attempt was made to pinpoint the reason for this observation, and a detailed investigation of the influence of experimental conditions on the superelastic scattering was undertaken. No explanation for the asymmetry has as yet been found.

  4. Fano resonance in the nonadiabatically pumped shot noise of a time-dependent quantum well in a two-dimensional electron gas and graphene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhu, Rui, E-mail: rzhu@scut.edu.cn; Dai, Jiao-Hua; Guo, Yong

    Interference between different quantum paths can generate Fano resonance. One of the examples is transport through a quasibound state driven by a time-dependent scattering potential. Previously it is found that Fano resonance occurs as a result of energy matching in one-dimensional systems. In this work, we demonstrate that when transverse motion is present, Fano resonance occurs precisely at the wavevector matching situation. Using the Floquet scattering theory, we considered the transport properties of a nonadiabatic time-dependent well both in a two-dimensional electron gas and monolayer graphene structure. Dispersion of the quasibound state of a static quantum well is obtained withmore » transverse motion present. We found that Fano resonance occurs when the wavevector in the transport direction of one of the Floquet sidebands is exactly identical to that of the quasibound state in the well at equilibrium and follows the dispersion pattern of the latter. To observe the Fano resonance phenomenon in the transmission spectrum, we also considered the pumped shot noise properties when time and spatial symmetry secures vanishing current in the considered configuration. Prominent Fano resonance is found in the differential pumped shot noise with respect to the reservoir Fermi energy.« less

  5. Precision determination of electron scattering angle by differential nuclear recoil energy method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liyanage, N.; Saenboonruang, K.

    2015-12-01

    The accurate determination of the scattered electron angle is crucial to electron scattering experiments, both with open-geometry large-acceptance spectrometers and ones with dipole-type magnetic spectrometers for electron detection. In particular, for small central-angle experiments using dipole-type magnetic spectrometers, in which surveys are used to measure the spectrometer angle with respect to the primary electron beam, the importance of the scattering angle determination is emphasized. However, given the complexities of large experiments and spectrometers, the accuracy of such surveys is limited and insufficient to meet demands of some experiments. In this article, we present a new technique for determination of themore » electron scattering angle based on an accurate measurement of the primary beam energy and the principle of differential nuclear recoil. This technique was used to determine the scattering angle for several experiments carried out at the Experimental Hall A, Jefferson Lab. Results have shown that the new technique greatly improved the accuracy of the angle determination compared to surveys.« less

  6. Precision Determination of Electron Scattering Angle by Differential Nuclear Recoil Energy Method

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liyanage, Nilanga; Saenboonruang, Kiadtisak

    2015-09-01

    The accurate determination of the scattered electron angle is crucial to electron scattering experiments, both with open-geometry large-acceptance spectrometers and ones with dipole-type magnetic spectrometers for electron detection. In particular, for small central-angle experiments using dipole-type magnetic spectrometers, in which surveys are used to measure the spectrometer angle with respect to the primary electron beam, the importance of the scattering angle determination is emphasized. However, given the complexities of large experiments and spectrometers, the accuracy of such surveys is limited and insufficient to meet demands of some experiments. In this article, we present a new technique for determination of themore » electron scattering angle based on an accurate measurement of the primary beam energy and the principle of differential nuclear recoil. This technique was used to determine the scattering angle for several experiments carried out at the Experimental Hall A, Jefferson Lab. Results have shown that the new technique greatly improved the accuracy of the angle determination compared to surveys.« less

  7. Complete solution of electronic excitation and ionization in electron-hydrogen molecule scattering

    DOE PAGES

    Zammit, Mark C.; Savage, Jeremy S.; Fursa, Dmitry V.; ...

    2016-06-08

    The convergent close-coupling method has been used to solve the electron-hydrogen molecule scattering problem in the fixed-nuclei approximation. Excellent agreement with experiment is found for the grand total, elastic, electronic-excitation, and total ionization cross sections from the very low to the very high energies. This shows that for the electronic degrees of freedom the method provides a complete treatment of electron scattering on molecules as it does for atoms.

  8. State-to-state time-of-flight measurements of NO scattering from Au(111): direct observation of translation-to-vibration coupling in electronically nonadiabatic energy transfer.

    PubMed

    Golibrzuch, Kai; Shirhatti, Pranav R; Altschäffel, Jan; Rahinov, Igor; Auerbach, Daniel J; Wodtke, Alec M; Bartels, Christof

    2013-09-12

    Translational motion is believed to be a spectator degree of freedom in electronically nonadiabatic vibrational energy transfer between molecules and metal surfaces, but the experimental evidence available to support this view is limited. In this work, we have experimentally determined the translational inelasticity in collisions of NO molecules with a single-crystal Au(111) surface-a system with strong electronic nonadiabaticity. State-to-state molecular beam surface scattering was combined with an IR-UV double resonance scheme to obtain high-resolution time-of-flight data. The measurements include vibrationally elastic collisions (v = 3→3, 2→2) as well as collisions where one or two quanta of molecular vibration are excited (2→3, 2→4) or de-excited (2→1, 3→2, 3→1). In addition, we have carried out comprehensive measurements of the effects of rotational excitation on the translational energy of the scattered molecules. We find that under all conditions of this work, the NO molecules lose a large fraction (∼0.45) of their incidence translational energy to the surface. Those molecules that undergo vibrational excitation (relaxation) during the collision recoil slightly slower (faster) than vibrationally elastically scattered molecules. The amount of translational energy change depends on the surface temperature. The translation-to-rotation coupling, which is well-known for v = 0→0 collisions, is found to be significantly weaker for vibrationally inelastic than elastic channels. Our results clearly show that the spectator view of the translational motion in electronically nonadiabatic vibrational energy transfer between NO and Au(111) is only approximately correct.

  9. Relationship between field-aligned currents and inverted-V parallel potential drops observed at midaltitudes

    NASA Astrophysics Data System (ADS)

    Sakanoi, T.; Fukunishi, H.; Mukai, T.

    1995-10-01

    The inverted-V field-aligned acceleration region existing in the altitude range of several thousand kilometers plays an essential role for the magnetosphere-ionosphere coupling system. The adiabatic plasma theory predicts a linear relationship between field-aligned current density (J∥) and parallel potential drop (Φ∥), that is, J∥=KΦ∥, where K is the field-aligned conductance. We examined this relationship using the charged particle and magnetic field data obtained from the Akebono (Exos D) satellite. The potential drop above the satellite was derived from the peak energy of downward electrons, while the potential drop below the satellite was derived from two different methods: the peak energy of upward ions and the energy-dependent widening of electron loss cone. On the other hand, field-aligned current densities in the inverted-V region were estimated from the Akebono magnetometer data. Using these potential drops and field-aligned current densities, we estimated the linear field-aligned conductance KJΦ. Further, we obtained the corrected field-aligned conductance KCJΦ by applying the full Knight's formula to the current-voltage relationship. We also independently estimated the field-aligned conductance KTN from the number density and the thermal temperature of magnetospheric source electrons which were obtained by fitting accelerated Maxwellian functions for precipitating electrons. The results are summarized as follows: (1) The latitudinal dependence of parallel potential drops is characterized by a narrow V-shaped structure with a width of 0.4°-1.0°. (2) Although the inverted-V potential region exactly corresponds to the upward field aligned current region, the latitudinal dependence of upward current intensity is an inverted-U shape rather than an inverted-V shape. Thus it is suggested that the field-aligned conductance KCJΦ changes with a V-shaped latitudinal dependence. In many cases, KCJΦ values at the edge of the inverted-V region are about 5-10 times larger than those at the center. (3) By comparing KCJΦ with KTN, KCJΦ is found to be about 2-20 times larger than KTN. These results suggest that low-energy electrons such as trapped electrons, secondary and back-scattered electrons, and ionospheric electrons significantly contribute to upward field-aligned currents in the inverted-V region. It is therefore inferred that non adiabatic pitch angle scattering processes play an important role in the inverted-V region. .

  10. A Modified Monte Carlo Method for Carrier Transport in Germanium, Free of Isotropic Rates

    NASA Astrophysics Data System (ADS)

    Sundqvist, Kyle

    2010-03-01

    We present a new method for carrier transport simulation, relevant for high-purity germanium < 100 > at a temperature of 40 mK. In this system, the scattering of electrons and holes is dominated by spontaneous phonon emission. Free carriers are always out of equilibrium with the lattice. We must also properly account for directional effects due to band structure, but there are many cautions in the literature about treating germanium in particular. These objections arise because the germanium electron system is anisotropic to an extreme degree, while standard Monte Carlo algorithms maintain a reliance on isotropic, integrated rates. We re-examine Fermi's Golden Rule to produce a Monte Carlo method free of isotropic rates. Traditional Monte Carlo codes implement particle scattering based on an isotropically averaged rate, followed by a separate selection of the particle's final state via a momentum-dependent probability. In our method, the kernel of Fermi's Golden Rule produces analytical, bivariate rates which allow for the simultaneous choice of scatter and final state selection. Energy and momentum are automatically conserved. We compare our results to experimental data.

  11. Substitution of Ni for Fe in superconducting Fe 0.98 Te 0.5 Se 0.5 depresses the normal-state conductivity but not the magnetic spectral weight

    DOE PAGES

    Wang, Jinghui; Zhong, Ruidan; Li, Shichao; ...

    2015-01-05

    We have performed systematic resistivity and inelastic neutron scattering measurements on Fe₀.₉₈₋ zNi zTe₀.₅Se₀.₅ samples to study the impact of Ni substitution on the transport properties and the low-energy (≤ 12 meV) magnetic excitations. It is found that, with increasing Ni doping, both the conductivity and superconductivity are gradually suppressed; in contrast, the low-energy magnetic spectral weight changes little. Comparing with the impact of Co and Cu substitution, we find that the effects on conductivity and superconductivity for the same degree of substitution grow systematically as the atomic number of the substituent deviates from that of Fe. The impact ofmore » the substituents as scattering centers appears to be greater than any contribution to carrier concentration. The fact that low-energy magnetic spectral weight is not reduced by increased electron scattering indicates that the existence of antiferromagnetic correlations does not depend on electronic states close to the Fermi energy.« less

  12. Molecular t-matrices for Low-Energy Electron Diffraction (TMOL v1.1)

    NASA Astrophysics Data System (ADS)

    Blanco-Rey, Maria; de Andres, Pedro; Held, Georg; King, David A.

    2004-08-01

    We describe a FORTRAN-90 program that computes scattering t-matrices for a molecule. These can be used in a Low-Energy Electron Diffraction program to solve the molecular structural problem very efficiently. The intramolecular multiple scattering is computed within a Dyson-like approach, using free space Green propagators in a basis of spherical waves. The advantage of this approach is related to exploiting the chemical identity of the molecule, and to the simplicity to translate and rotate these t-matrices without performing a new multiple-scattering calculation for each configuration. FORTRAN-90 routines for rotating the resulting t-matrices using Wigner matrices are also provided. Program summaryTitle of program: TMOL Catalogue number: ADUF Program summary URL:http://cpc.cs.qub.ac.uk/summaries/ADUF Program obtainable from: CPC Program Library, Queen's University of Belfast, N. Ireland. Computers: Alpha ev6-21264 (700 MHz) and Pentium-IV. Operating systems: Digital UNIX V5.0 and Linux (Red Hat 8.0). Programming language: FORTRAN-90/95 (Compaq True64 compiler, and Intel Fortran Compiler 7.0 for Linux). High-speed storage required for the test run: minimum 64 Mbytes, it can grow to more depending on the system considered. Disk storage required: None. No. of bits in a word: 64 and 32. No. of lines in distributed program, including test data etc.: 5404 No. of bytes in distributed program, including test data etc.: 59 856 Distribution format: tar.gz Nature of problem: We describe the FORTRAN-90 program TMOL (v1.1) for the computation of non-diagonal scattering t-matrices for molecules or any other poly-atomic sub-unit of surface structures. These matrices can be used in an standard Low-Energy Electron Diffraction program, such as LEED90 or CLEED. Method of solution: A general non-diagonal t-matrix is assumed for the atoms or more general scatterers forming the molecule. The molecular t-matrix is solved adding the possible intramolecular multiple scattering events using Green's propagator formalism. The resulting t-matrix is referred to the mass centre of the molecule and can be easily translated with these propagators and rotated applying Wigner matrices. Typical running time: Calculating the t-matrix for a single energy takes a few seconds. Time depends on the maximum angular momentum quantum number, lmax, and the number of scatterers in the molecule, N. Running time scales as lmax6 and N3. References: [1] S. Andersson, J.B. Pendry, J. Phys. C: Solid St. Phys. 13 (1980) 3547. [2] A. Gonis, W.H. Butler, Multiple Scattering in Solids, Springer-Verlag, Berlin/New York, 2000.

  13. Interaction of electrons with light metal hydrides in the transmission electron microscope.

    PubMed

    Wang, Yongming; Wakasugi, Takenobu; Isobe, Shigehito; Hashimoto, Naoyuki; Ohnuki, Somei

    2014-12-01

    Transmission electron microscope (TEM) observation of light metal hydrides is complicated by the instability of these materials under electron irradiation. In this study, the electron kinetic energy dependences of the interactions of incident electrons with lithium, sodium and magnesium hydrides, as well as the constituting element effect on the interactions, were theoretically discussed, and electron irradiation damage to these hydrides was examined using in situ TEM. The results indicate that high incident electron kinetic energy helps alleviate the irradiation damage resulting from inelastic or elastic scattering of the incident electrons in the TEM. Therefore, observations and characterizations of these materials would benefit from increased, instead decreased, TEM operating voltage. © The Author 2014. Published by Oxford University Press on behalf of The Japanese Society of Microscopy. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. The influence of structure depth on image blurring of micrometres-thick specimens in MeV transmission electron imaging.

    PubMed

    Wang, Fang; Sun, Ying; Cao, Meng; Nishi, Ryuji

    2016-04-01

    This study investigates the influence of structure depth on image blurring of micrometres-thick films by experiment and simulation with a conventional transmission electron microscope (TEM). First, ultra-high-voltage electron microscope (ultra-HVEM) images of nanometer gold particles embedded in thick epoxy-resin films were acquired in the experiment and compared with simulated images. Then, variations of image blurring of gold particles at different depths were evaluated by calculating the particle diameter. The results showed that with a decrease in depth, image blurring increased. This depth-related property was more apparent for thicker specimens. Fortunately, larger particle depth involves less image blurring, even for a 10-μm-thick epoxy-resin film. The quality dependence on depth of a 3D reconstruction of particle structures in thick specimens was revealed by electron tomography. The evolution of image blurring with structure depth is determined mainly by multiple elastic scattering effects. Thick specimens of heavier materials produced more blurring due to a larger lateral spread of electrons after scattering from the structure. Nevertheless, increasing electron energy to 2MeV can reduce blurring and produce an acceptable image quality for thick specimens in the TEM. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Dual-angle, self-calibrating Thomson scattering measurements in RFX-MOD

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giudicotti, L., E-mail: leonardo.giudicotti@unipd.it; Department of Industrial Engineering, Padova University, Via Gradenigo 6/a, 35131 Padova; Pasqualotto, R.

    2014-11-15

    In the multipoint Thomson scattering (TS) system of the RFX-MOD experiment the signals from a few spatial positions can be observed simultaneously under two different scattering angles. In addition the detection system uses optical multiplexing by signal delays in fiber optic cables of different length so that the two sets of TS signals can be observed by the same polychromator. Owing to the dependence of the TS spectrum on the scattering angle, it was then possible to implement self-calibrating TS measurements in which the electron temperature T{sub e}, the electron density n{sub e} and the relative calibration coefficients of spectralmore » channels sensitivity C{sub i} were simultaneously determined by a suitable analysis of the two sets of TS data collected at the two angles. The analysis has shown that, in spite of the small difference in the spectra obtained at the two angles, reliable values of the relative calibration coefficients can be determined by the analysis of good S/N dual‑angle spectra recorded in a few tens of plasma shots. This analysis suggests that in RFX-MOD the calibration of the entire set of TS polychromators by means of the similar, dual-laser (Nd:YAG/Nd:YLF) TS technique, should be feasible.« less

  16. Theory of Raman scattering in coupled electron-phonon systems

    NASA Astrophysics Data System (ADS)

    Itai, K.

    1992-01-01

    The Raman spectrum is calculated for a coupled conduction-electron-phonon system in the zero-momentum-transfer limit. The Raman scattering is due to electron-hole excitations and phonons as well. The phonons of those branches that contribute to the electron self-energy and the correction of the electron-phonon vertex are assumed to have flat energy dispersion (the Einstein phonons). The effect of electron-impurity scattering is also incorporated. Both the electron-phonon interaction and the electron-impurity interaction cause the fluctuation of the electron distribution between different parts of the Fermi surface, which results in overdamped zero-sound modes of various symmetries. The scattering cross section is obtained by solving the Bethe-Salpeter equation. The spectrum shows a lower threshold at the smallest Einstein phonon energy when only the electron-phonon interaction is taken into consideration. When impurities are also taken into consideration, the threshold disappears.

  17. Correlated Electrons in Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Odintsov, Arkadi A.; Yoshioka, Hideo

    Single-wall carbon nanotubes are almost ideal systems for the investigation of exotic many-body effects due to non-Fermi liquid behavior of interacting electrons in one dimension. Recent theoretical and experimental results are reviewed with a focus on electron correlations. Starting from a microscopic lattice model we derive an effective phase Hamiltonian for conducting single-wall nanotubes with arbitrary chirality. The parameters of the Hamiltonian show very weak dependence on the chiral angle, which makes the low-energy physics of conducting nanotubes universal. The temperature-dependent resistivity and frequency-dependent optical conductivity of nanotubes with impurities are evaluated within the Luttinger-like model. Localization effects are studied. In particular, we found that intra-valley and inter-valley electron scattering can not coexist at low energies. Low-energy properties of clean nanotubes are studied beyond the Luttinger liquid approximation. The strongest Mott-like electron instability occurs at half filling. In the Mott insulating phase electrons at different atomic sublattices form characteristic bound states. The energy gaps occur in all modes of elementary excitations and estimate at 0.01-0.1 eV. We finally discuss observability of the Mott insulating phase in transport experiments. The accent is made on the charge transfer from external electrodes which results in a deviation of the electron density from half-filling.

  18. Voltage dependency of transmission probability of aperiodic DNA molecule

    NASA Astrophysics Data System (ADS)

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  19. Intervalley double resonance processes in MoS2

    NASA Astrophysics Data System (ADS)

    Wang, Yuanxi; Carvalho, Bruno; Malard, Leandro; Fantini, Cristiano; Crespi, Vincent; Pimenta, Marcos

    Intervalley scattering plays a significant role in electronic energy dissipation in semiconductors. We investigate the intervalley scattering of monolayer and few-layer MoS2, by combining density functional theory calculations and resonant Raman spectroscopy probed by up to 20 laser excitation energies. We observe that two Raman peaks within 420-460 cm-1 are dispersive over a small range of laser energy, a clear signature of second-order processes involving intervalley scattering. Both modes involve LA and TA phonons at or near the K point. A third Raman peak at 466 cm-1 shows a strong intensity dependence on the layer number and is assigned 2LA(M). Our results invalidate previous Raman peak assignment proposals and open up a better understanding of double resonance processes in transition metal dichalcogenides.

  20. Density functional theory study on Herzberg-Teller contribution in Raman scattering from 4-aminothiophenol-metal complex and metal-4-aminothiophenol-metal junction

    NASA Astrophysics Data System (ADS)

    Liu, Shasha; Zhao, Xiuming; Li, Yuanzuo; Zhao, Xiaohong; Chen, Maodu

    2009-06-01

    Density functional theory (DFT) and time-dependent DFT calculations have been performed to investigate the Raman scattering spectra of metal-molecule complex and metal-molecule-metal junction architectures interconnected with 4-aminothiophenol (PATP) molecule. The simulated profiles of normal Raman scattering (NRS) spectra for the two complexes (Ag2-PATP and PATP-Au2) and the two junctions (Ag2-PATP-Au2 and Au2-PATP-Ag2) are similar to each other, but exhibit obviously different Raman intensities. Due to the lager static polarizabilities of the two junctions, which directly influence the ground state chemical enhancement in NRS spectra, the calculated normal Raman intensities of them are stronger than those of two complexes by the factor of 102. We calculate preresonance Raman scattering (RRS) spectra with incident light at 1064 nm, which is much lower than the S1 electronic transition energy of complexes and junctions. Ag2-PATP-Au2 and Au2-PATP-Ag2 junctions yield higher Raman intensities than those of Ag2-PATP and PATP-Au2 complexes, especially for b2 modes. This effect is mainly attributed to charge transfer (CT) between the metal gap and the PAPT molecule which results in the occurrence of CT resonance enhancement. The calculated pre-RRS spectra strongly depend on the electronic transition state produced by new structures. With excitation at 514.5 nm, the calculated pre-RRS spectra of two complexes and two junctions are stronger than those of with excitation at 1064 nm. A charge difference densities methodology has been used to visually describe chemical enhancement mechanism of RRS spectrum. This methodology aims at visualizing intermolecular CT which provides direct evidence of the Herzberg-Teller mechanism.

  1. Time-Resolved IR-Absorption Spectroscopy of Hot-Electron Dynamics in Satellite and Upper Conduction Bands in GaP

    NASA Technical Reports Server (NTRS)

    Cavicchia, M. A.; Alfano, R. R.

    1995-01-01

    The relaxation dynamics of hot electrons in the X6 and X7 satellite and upper conduction bands in GaP was directly measured by femtosecond UV-pump-IR-probe absorption spectroscopy. From a fit to the induced IR-absorption spectra the dominant scattering mechanism giving rise to the absorption at early delay times was determined to be intervalley scattering of electrons out of the X7 upper conduction-band valley. For long delay times the dominant scattering mechanism is electron-hole scattering. Electron transport dynamics of the upper conduction band of GaP has been time resolved.

  2. Electron scattering by highly polar molecules. III - CsCl

    NASA Technical Reports Server (NTRS)

    Vuskovic, L.; Srivastava, S. K.

    1981-01-01

    Utilizing a crossed electron-beam-molecular-beam scattering geometry, relative values of differential electron scattering cross sections for cesium chloride at 5 and 20 eV electron impact energies and at scattering angles between 10 and 120 deg have been measured. These relative cross sections have been normalized to the cross section at 15 deg scattering angle calculated by the hybrid S-matrix technique. In the angular range between 0 and 10 deg and between 120 and 180 deg extrapolations have been made to obtain integral and momentum transfer cross sections. An energy-loss spectrum is also presented which gives various spectral features lying between the 4 and 10 eV regions in CsCl.

  3. Analysis of scattering lengths in Co/Cu/Co and Co/Cu/Co/Cu spin-valves using a Ru barrier

    NASA Astrophysics Data System (ADS)

    Strijkers, G. J.; Willekens, M. M. H.; Swagten, H. J. M.; de Jonge, W. J. M.

    1996-10-01

    We use uncoupled Co/Cu/Co and Co/Cu/Co/Cu spin-valve structures with a Ru barrier shifted through the top Co and Cu layer, respectively, to measure the longest of the electron mean free paths in Co and Cu as originally suggested by Parkin. From semiclassical transport calculations and careful analysis of the magnetoresistance data we conclude that the exponential behavior of ΔG is uniquely related to the longest of the Co and Cu mean free paths under the condition of effective spin-dependent filtering at the interfaces or in the bulk of the Co. In this regime we have compared λlong in Co and Cu with bulk conductivities (~λshort+λlong), yielding no strong evidence for bulk spin-dependent scattering in Co.

  4. Two-color vibrational, femtosecond, fully resonant electronically enhanced CARS (FREE-CARS) of gas-phase nitric oxide.

    PubMed

    Stauffer, Hans U; Roy, Sukesh; Schmidt, Jacob B; Wrzesinski, Paul J; Gord, James R

    2016-09-28

    A resonantly enhanced, two-color, femtosecond time-resolved coherent anti-Stokes Raman scattering (CARS) approach is demonstrated and used to explore the nature of the frequency- and time-dependent signals produced by gas-phase nitric oxide (NO). Through careful selection of the input pulse wavelengths, this fully resonant electronically enhanced CARS (FREE-CARS) scheme allows rovibronic-state-resolved observation of time-dependent rovibrational wavepackets propagating on the vibrationally excited ground-state potential energy surface of this diatomic species. Despite the use of broadband, ultrafast time-resolved input pulses, high spectral resolution of gas-phase rovibronic transitions is observed in the FREE-CARS signal, dictated by the electronic dephasing timescales of these states. Analysis and computational simulation of the time-dependent spectra observed as a function of pump-Stokes and Stokes-probe delays provide insight into the rotationally resolved wavepacket motion observed on the excited-state and vibrationally excited ground-state potential energy surfaces of NO, respectively.

  5. Time Dependent Solution for the He I Line Ratio Electron Temperature and Density Diagnostic in TEXTOR and DIII-D

    NASA Astrophysics Data System (ADS)

    Munoz Burgos, J. M.; Schmitz, O.; Unterberg, E. A.; Loch, S. D.; Balance, C. P.

    2010-11-01

    We developed a time dependent solution for the He I line ratio diagnostic. Stationary solution is applied for L-mode at TEXTOR. The radial range is typically limited to a region near the separatrix due to metastable effects, and the atomic data used. We overcome this problem by applying a time dependent solution and thus avoid unphysical results. We use a new R-Matrix with Pseudostates and Convergence Cross-Coupling electron impact excitation and ionization atomic data set into the Collisional Radiative Model (CRM). We include contributions from higher Rydberg states into the CRM by means of the projection matrix. By applying this solution (to the region near the wall) and the stationary solution (near the separatrix), we triple the radial range of the current diagnostic. We explore the possibility of extending this approach to H-mode plasmas in DIII-D by estimating line emission profiles from electron temperature and density Thomson scattering data.

  6. Currents and Associated Electron Scattering and Bouncing Near the Diffusion Region at Earth's Magnetopause

    NASA Technical Reports Server (NTRS)

    Lavraud, B.; Zhang, Y. C.; Vernisse, Y.; Gershman, D. J.; Dorelli, J.; Cassak, P. A.; Dargent, J.; Pollock, C.; Giles, B.; Aunai, N.; hide

    2016-01-01

    Based on high-resolution measurements from NASA's Magnetospheric Multlscale mission, we present the dynamics of electrons associated with current systems observed near the diffusion region of magnetic reconnection at Earth's magnetopause. Using pitch angle distributions (PAD) and magnetic curvature analysis, we demonstrate the occurrence of electron scattering in the curved magnetic field of the diffusion region down to energies of 20eV. We show that scattering occurs closer to the current sheet as the electron energy decreases. The scattering of Inflowing electrons, associated with field-aligned electrostatic potentials and Hall currents, produces a new population of scattered electrons with broader PAD which bounce back and forth in the exhaust. Except at the center of the diffusion region the two populations are collocated and appear to behave adiabatically: the inflowing electron PAD focuses inward (toward lower magnetic field), while the bouncing population PAD gradually peaks at 90 degrees away from the center (where it mirrors owing to higher magnetic field and probable field-aligned potentials).

  7. Experimental electron energy-loss spectra and cross sections for the 4/2/S - 4/2/P transition in Zn II

    NASA Technical Reports Server (NTRS)

    Chutjian, A.; Newell, W. R.

    1982-01-01

    Electron energy-loss spectra and differential cross sections are reported for inelastic scattering from Zn II. Measurements were carried out in a crossed electron beam-ion beam apparatus, at incident electron energies of 30, 40, 50, 60, 75, 85, and 100 eV, and at a scattering angle of 14 deg. The present results are the first reported measurements of inelastic electron scattering from an ion.

  8. Note on measuring electronic stopping of slow ions

    NASA Astrophysics Data System (ADS)

    Sigmund, P.; Schinner, A.

    2017-11-01

    Extracting stopping cross sections from energy-loss measurements requires careful consideration of the experimental geometry. Standard procedures for separating nuclear from electronic stopping treat electronic energy loss as a friction force, ignoring its dependence on impact parameter. In the present study we find that incorporating this dependence has a major effect on measured stopping cross sections, in particular for light ions at low beam energies. Calculations have been made for transmission geometry, nuclear interactions being quantified by Bohr-Williams theory of multiple scattering on the basis of a Thomas-Fermi-Molière potential, whereas electronic interactions are characterized by Firsov theory or PASS code. Differences between the full and the restricted stopping cross section depend on target thickness and opening angle of the detector and need to be taken into account in comparisons with theory as well as in applications of stopping data. It follows that the reciprocity principle can be violated when checked on restricted instead of full electronic stopping cross sections. Finally, we assert that a seeming gas-solid difference in stopping of low-energy ions is actually a metal-insulator difference. In comparisons with experimental results we mostly consider proton data, where nuclear stopping is only a minor perturbation.

  9. A concept for Z-dependent microbunching measurements with coherent X-ray transition radiation in a sase FEL

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lumpkin, A.H.; Fawley, W.M.; Rule, D.W.

    We present an adaptation of the measurements performed in the visible-to-VUV regime of the z-dependent microbunching in a self-amplified spontaneous emission (SASE) free-electron laser (FEL). In these experiments a thin metal foil was used to block the more intense SASE radiation and to generate coherent optical transition radiation (COTR) as one source in a two-foil interferometer. However, for the proposed x-ray SASE FELs, the intense SASE emission is either too strongly transmitted at 1.5 Angstrom or the needed foil thickness for blocking scatters the electron beam too much. Since x-ray transition radiation (XTR) is emitted in an annulus with openingmore » angle 1/g = 36 mrad for 14.09-GeV electrons, we propose using a thin foil or foil stack to generate the XTR and coherent XTR (CXTR) and an annular crystal to wavelength sort the radiation. The combined selectivity in angle and wavelength will favor the CXTR over SASE by about eight orders of magnitude. Time-dependent GINGER simulations support the z-dependent gain evaluation plan.« less

  10. High energy Coulomb-scattered electrons for relativistic particle beams and diagnostics

    DOE PAGES

    Thieberger, P.; Altinbas, Z.; Carlson, C.; ...

    2016-03-29

    A new system used for monitoring energetic Coulomb-scattered electrons as the main diagnostic for accurately aligning the electron and ion beams in the new Relativistic Heavy Ion Collider (RHIC) electron lenses is described in detail. The theory of electron scattering from relativistic ions is developed and applied to the design and implementation of the system used to achieve and maintain the alignment. Commissioning with gold and 3He beams is then described as well as the successful utilization of the new system during the 2015 RHIC polarized proton run. Systematic errors of the new method are then estimated. Lastly, some possiblemore » future applications of Coulomb-scattered electrons for beam diagnostics are briefly discussed.« less

  11. Influence of temperature and charge effects on thermophoresis of polystyrene beads⋆.

    PubMed

    Syshchyk, Olga; Afanasenkau, Dzmitry; Wang, Zilin; Kriegs, Hartmut; Buitenhuis, Johan; Wiegand, Simone

    2016-12-01

    We study the thermodiffusion behavior of spherical polystyrene beads with a diameter of 25 nm by infrared thermal diffusion Forced Rayleigh Scattering (IR-TDFRS). Similar beads were used to investigate the radial dependence of the Soret coefficient by different authors. While Duhr and Braun (Proc. Natl. Acad. Sci. U.S.A. 104, 9346 (2007)) observed a quadratic radial dependence Braibanti et al. (Phys. Rev. Lett. 100, 108303 (2008)) found a linear radial dependence of the Soret coefficient. We demonstrated that special care needs to be taken to obtain reliable thermophoretic data, because the measurements are very sensitive to surface properties. The colloidal particles were characterized by transmission electron microscopy and dynamic light scattering (DLS) experiments were performed. We carried out systematic thermophoretic measurements as a function of temperature, buffer and surfactant concentration. The temperature dependence was analyzed using an empirical formula. To describe the Debye length dependence we used a theoretical model by Dhont. The resulting surface charge density is in agreement with previous literature results. Finally, we analyze the dependence of the Soret coefficient on the concentration of the anionic surfactant sodium dodecyl sulfate (SDS), applying an empirical thermodynamic approach accounting for chemical contributions.

  12. Exclusive ϱ0 production in deep inelastic electron-proton scattering at HERA

    NASA Astrophysics Data System (ADS)

    Derrick, M.; Krakauer, D.; Magill, S.; Mikunas, D.; Musgrave, B.; Repond, J.; Stanek, R.; Talaga, R. L.; Zhang, H.; Ayad, R.; Bari, G.; Basile, M.; Bellagamba, L.; Boscherini, D.; Bruni, A.; Bruni, G.; Bruni, P.; Cara Romeo, G.; Castellini, G.; Chiarini, M.; Cifarelli, L.; Cindolo, F.; Contin, A.; Corradi, M.; Gialas, I.; Giusti, P.; Iacobucci, G.; Laurenti, G.; Levi, G.; Margotti, A.; Massam, T.; Nania, R.; Nemoz, C.; Palmonari, F.; Polini, A.; Sartorelli, G.; Timellini, R.; Zamora Garcia, Y.; Zichichi, A.; Bargende, A.; Crittenden, J.; Desch, K.; Diekmann, B.; Doeker, T.; Eckert, M.; Feld, L.; Frey, A.; Geerts, M.; Grothe, M.; Hartmann, H.; Heinloth, K.; Hilger, E.; Jakob, H.-P.; Katz, U. F.; Mari, S. M.; Mengel, S.; Mollen, J.; Paul, E.; Pfeiffer, M.; Rembser, Ch.; Schramm, D.; Stamm, J.; Wedemeyer, R.; Campbell-Robson, S.; Cassidy, A.; Dyce, N.; Foster, B.; George, S.; Gilmore, R.; Heath, G. P.; Heath, H. F.; Llewellyn, T. J.; Morgado, C. J. S.; Norman, D. J. P.; O'Mara, J. A.; Tapper, R. J.; Wilson, S. S.; Yoshida, R.; Rau, R. R.; Arneodo, M.; Capua, M.; Garfagnini, A.; Iannotti, L.; Schioppa, M.; Susinno, G.; Bernstein, A.; Caldwell, A.; Cartiglia, N.; Parsons, J. A.; Ritz, S.; Sciulli, F.; Straub, P. B.; Wai, L.; Yang, S.; Zhu, Q.; Borzemski, P.; Chwastowski, J.; Eskreys, A.; Piotrzkowski, K.; Zachara, M.; Zawiejski, L.; Adamczyk, L.; Bednarek, B.; Jeleń, K.; Kisielewska, D.; Kowalski, T.; Rulikowska-Zarȩbska, E.; Suszycki, L.; Zajaç, J.; Kotański, A.; Przybycień, M.; Bauerdick, L. A. T.; Behrens, U.; Beier, H.; Bienlein, J. K.; Coldewey, C.; Deppe, O.; Desler, K.; Drews, G.; Flasiński, M.; Gilkinson, D. J.; Glasman, C.; Göttlicher, P.; Große-Knetter, J.; Gutjahr, B.; Haas, T.; Hain, W.; Hasell, D.; Heßling, H.; Iga, Y.; Johnson, K.; Joos, P.; Kasemann, M.; Klanner, R.; Koch, W.; Köpke, L.; Kötz, U.; Kowalski, H.; Labs, J.; Ladage, A.; Löhr, B.; Löwe, M.; Lüke, D.; Mainusch, J.; Mańczak, O.; Monteiro, T.; Ng, J. S. T.; Nickel, S.; Notz, D.; Ohrenberg, K.; Roco, M.; Rohde, M.; Roldán, J.; Schneekloth, U.; Schulz, W.; Selonke, F.; Stiliaris, E.; Surrow, B.; Voß, T.; Westphal, D.; Wolf, G.; Youngman, C.; Zeuner, W.; Zhou, J. F.; Grabosch, H. J.; Kharchilava, A.; Leich, A.; Mattingly, M. C. K.; Meyer, A.; Schlenstedt, S.; Wulff, N.; Barbagli, G.; Pelfer, P.; Anzivino, G.; Maccarrone, G.; De Pasquale, S.; Votano, L.; Bamberger, A.; Eisenhardt, S.; Freidhof, A.; Söldner-Rembold, S.; Schroeder, J.; Trefzger, T.; Brook, N. H.; Bussey, P. J.; Doyle, A. T.; Fleck, J. I.; Saxon, D. H.; Utley, M. L.; Wilson, A. S.; Dannemann, A.; Holm, U.; Horstmann, D.; Neumann, T.; Sinkus, R.; Wick, K.; Badura, E.; Burow, B. D.; Hagge, L.; Lohrmann, E.; Milewski, J.; Nakahata, M.; Pavel, N.; Poelz, G.; Schott, W.; Zetsche, F.; Bacon, T. C.; Bruemmer, N.; Butterworth, I.; Gallo, E.; Harris, V. L.; Hung, B. Y. H.; Long, K. R.; Miller, D. B.; Morawitz, P. P. O.; Prinias, A.; Sedgbeer, J. K.; Whitfield, A. F.; Mallik, U.; McCliment, E.; Wang, M. Z.; Wang, S. M.; Wu, J. T.; Cloth, P.; Filges, D.; An, S. H.; Hong, S. M.; Nam, S. W.; Park, S. K.; Suh, M. H.; Yon, S. H.; Imlay, R.; Kartik, S.; Kim, H.-J.; McNeil, R. R.; Metcalf, W.; Nadendla, V. K.; Barreiro, F.; Cases, G.; Fernandez, J. P.; Graciani, R.; Hernández, J. M.; Hervás, L.; Labarga, L.; Martinez, M.; del Peso, J.; Puga, J.; Terron, J.; de Trocóniz, J. F.; Smith, G. R.; Corriveau, F.; Hanna, D. S.; Hartmann, J.; Hung, L. W.; Lim, J. N.; Matthews, C. G.; Patel, P. M.; Sinclair, L. E.; Stairs, D. G.; St. Laurent, M.; Ullmann, R.; Zacek, G.; Bashkirov, V.; Dolgoshein, B. A.; Stifutkin, A.; Bashindzhagyan, G. L.; Ermolov, P. F.; Gladilin, L. K.; Golubkov, Yu. A.; Kobrin, V. D.; Korzhavina, I. A.; Kurzhavina, V. A.; Kuzmin, V. A.; Lukina, O. Yu.; Proskuryakov, A. S.; Savin, A. A.; Shcheglova, L. M.; Solomin, A. N.; Zotov, N. P.; Botje, M.; Chlebana, F.; Dake, A.; Engelen, J.; de Kamps, M.; Kooijman, P.; Kruse, A.; Tiecke, H.; Verkerke, W.; Veeswijk, M.; Wiggers, L.; de Wolf, E.; van Woudenberg, R.; Acosta, D.; Bylsma, B.; Durkin, L. S.; Honscheid, K.; Li, C.; Ling, T. Y.; McLean, K. W.; Murray, W. N.; Park, I. H.; Romanowski, T. A.; Seidlein, R.; Bailey, D. S.; Byrne, A.; Cashmore, R. J.; Cooper-Sarkar, A. M.; Devenish, R. C. E.; Harnew, N.; Lancaster, M.; Lindemann, L.; McFall, J. D.; Nath, C.; Noyes, V. A.; Quadt, A.; Tickner, J. R.; Uijterwaal, H.; Walczak, R.; Waters, D. S.; Wilson, F. F.; Yip, T.; Abbiendi, G.; Bertolin, A.; Brugnera, R.; Carlin, R.; Dal Corso, F.; De Giorgi, M.; Dosselli, U.; Limentani, S.; Morandin, M.; Posocco, M.; Stanco, L.; Stroili, R.; Voci, C.; Bulmahn, J.; Butterworth, J. M.; Feild, R. G.; Oh, B. Y.; Whitmore, J. J.; D'Agostini, G.; Marini, G.; Nigro, A.; Tassi, E.; Hart, J. C.; McCubbin, N. A.; Prytz, K.; Shah, T. P.; Short, T. L.; Barberis, E.; Dubbs, T.; Heusch, C.; Van Hook, M.; Lockman, W.; Rahn, J. T.; Sadrozinski, H. F.-W.; Seiden, A.; Williams, D. C.; Biltzinger, J.; Seifert, R. J.; Schwarzer, O.; Walenta, A. H.; Zech, G.; Abramowicz, H.; Briskin, G.; Dagan, S.; Levy, A.; Hasegawa, T.; Hazumi, M.; Ishii, T.; Kuze, M.; Mine, S.; Nagasawa, Y.; Nakao, M.; Suzuki, I.; Tokushuku, K.; Yamada, S.; Yamazaki, Y.; Chiba, M.; Hamatsu, R.; Hirose, T.; Homma, K.; Kitamura, S.; Nakamitsu, Y.; Yamauchi, K.; Cirio, R.; Costa, M.; Ferrero, M. I.; Lamberti, L.; Maselli, S.; Peroni, C.; Sacchi, R.; Solano, A.; Staiano, A.; Dardo, M.; Bailey, D. C.; Bandyopadhyay, D.; Benard, F.; Brkic, M.; Gingrich, D. M.; Hartner, G. F.; Joo, K. K.; Levman, G. M.; Martin, J. F.; Orr, R. S.; Polenz, S.; Sampson, C. R.; Teuscher, R. J.; Catterall, C. D.; Jones, T. W.; Kaziewicz, P. B.; Lane, J. B.; Saunders, R. L.; Shulman, J.; Blankenship, K.; Lu, B.; Mo, L. W.; Bogusz, W.; Charchuła, K.; Ciborowski, J.; Gajewski, J.; Grzelak, G.; Kasprzak, M.; Krzyżanowski, M.; Muchorowski, K.; Nowak, R. J.; Pawlak, J. M.; Tymieniecka, T.; Wróblewski, A. K.; Zakrzewski, J. A.; Żarnecki, A. F.; Adamus, M.; Eisenberg, Y.; Karshon, U.; Revel, D.; Zer-Zion, D.; Ali, I.; Badgett, W. F.; Behrens, B.; Dasu, S.; Fordham, C.; Foudas, C.; Goussiou, A.; Loveless, R. J.; Reeder, D. D.; Silverstein, S.; Smith, W. H.; Vaiciulis, A.; Wodarczyk, M.; Tsurugai, T.; Bhadra, S.; Cardy, M. L.; Fagerstroem, C.-P.; Frisken, W. R.; Furutani, K. M.; Khakzad, M.; Schmidke, W. B.; ZEUS Collaboration

    1995-02-01

    The exclusive production of ϱ0 mesons in deep inelastic electron-proton scattering has been studied using the ZEUS detector. Cross sections have been measured in the range 7 < Q2 < 25 GeV 2 for λ ∗p centre of mass (c.m.) energies 40 to 130 GeV. The λ ∗p → ϱ 0p cross section exhibits a Q-(4.2±0.8 -0.5+1.4) dependence and both longitudinally and transversely polarised ϱ0's are observed. The λ ∗p → ϱ 0p cross section rises strongly with increasing c.m. energy, when compared with NMC data at lower energy, which cannot be explained by production through soft pomeron exchange. The data are compared with perturbative QCD calculations where the rise in the cross section reflects the increase in the gluon density at low x.

  13. Erratum: Creation of X-Ray Transparency of Matter by Stimulated Elastic Forward Scattering [Phys. Rev. Lett. 115 , 107402 (2015)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stöhr, J.; Scherz, A.

    X-ray absorption by matter has long been described by the famous Beer-Lambert law. Here we show how this fundamental law needs to be modified for high-intensity coherent x-ray pulses, now available at x-ray free electron lasers, due to the onset of stimulated elastic forward scattering. We present an analytical expression for the modified polarization-dependent Beer-Lambert law for the case of resonant core-to-valence electronic transitions and incident transform limited x-ray pulses. Upon transmission through a solid, the absorption and dichroic contrasts are found to vanish with increasing x-ray intensity, with the stimulation threshold lowered by orders of magnitude through a super-radiativemore » coherent effect. Our results have broad implications for the study of matter with x-ray lasers.« less

  14. X-ray Emission Line Anisotropy Effects on the Isoelectronic Temperature Measurement Method

    NASA Astrophysics Data System (ADS)

    Liedahl, Duane; Barrios, Maria; Brown, Greg; Foord, Mark; Gray, William; Hansen, Stephanie; Heeter, Robert; Jarrott, Leonard; Mauche, Christopher; Moody, John; Schneider, Marilyn; Widmann, Klaus

    2016-10-01

    Measurements of the ratio of analogous emission lines from isoelectronic ions of two elements form the basis of the isoelectronic method of inferring electron temperatures in laser-produced plasmas, with the expectation that atomic modeling errors cancel to first order. Helium-like ions are a common choice in many experiments. Obtaining sufficiently bright signals often requires sample sizes with non-trivial line optical depths. For lines with small destruction probabilities per scatter, such as the 1s2p-1s2 He-like resonance line, repeated scattering can cause a marked angular dependence in the escaping radiation. Isoelectronic lines from near-Z equimolar dopants have similar optical depths and similar angular variations, which leads to a near angular-invariance for their line ratios. Using Monte Carlo simulations, we show that possible ambiguities associated with anisotropy in deriving electron temperatures from X-ray line ratios are minimized by exploiting this isoelectronic invariance.

  15. Contemporary Use of Anomalous Diffraction in Biomolecular Structure Analysis.

    PubMed

    Liu, Qun; Hendrickson, Wayne A

    2017-01-01

    The normal elastic X-ray scattering that depends only on electron density can be modulated by an "anomalous" component due to resonance between X-rays and electronic orbitals. Anomalous scattering thereby precisely identifies atomic species, since orbitals distinguish atomic elements, which enables the multi- and single-wavelength anomalous diffraction (MAD and SAD) methods. SAD now predominates in de novo structure determination of biological macromolecules, and we focus here on the prevailing SAD method. We describe the anomalous phasing theory and the periodic table of phasing elements that are available for SAD experiments, differentiating between those readily accessible for at-resonance experiments and those that can be effective away from an edge. We describe procedures for present-day SAD phasing experiments and we discuss optimization of anomalous signals for challenging applications. We also describe methods for using anomalous signals as molecular markers for tracing and element identification. Emerging developments and perspectives are discussed in brief.

  16. Physical mechanism causing rapid changes in ultrarelativistic electron pitch angle distributions right after a shock arrival: Evaluation of an electron dropout event

    NASA Astrophysics Data System (ADS)

    Zhang, X.-J.; Li, W.; Thorne, R. M.; Angelopoulos, V.; Ma, Q.; Li, J.; Bortnik, J.; Nishimura, Y.; Chen, L.; Baker, D. N.; Reeves, G. D.; Spence, H. E.; Kletzing, C. A.; Kurth, W. S.; Hospodarsky, G. B.; Blake, J. B.; Fennell, J. F.

    2016-09-01

    Three mechanisms have been proposed to explain relativistic electron flux depletions (dropouts) in the Earth's outer radiation belt during storm times: adiabatic expansion of electron drift shells due to a decrease in magnetic field strength, magnetopause shadowing and subsequent outward radial diffusion, and precipitation into the atmosphere (driven by EMIC wave scattering). Which mechanism predominates in causing electron dropouts commonly observed in the outer radiation belt is still debatable. In the present study, we evaluate the physical mechanism that may be primarily responsible for causing the sudden change in relativistic electron pitch angle distributions during a dropout event observed by Van Allen Probes during the main phase of the 27 February 2014 storm. During this event, the phase space density of ultrarelativistic (>1 MeV) electrons was depleted by more than 1 order of magnitude over the entire radial extent of the outer radiation belt (3 < L* < 5) in less than 6 h after the passage of an interplanetary shock. We model the electron pitch angle distribution under a compressed magnetic field topology based on actual solar wind conditions. Although these ultrarelativistic electrons exhibit highly anisotropic (peaked in 90°), energy-dependent pitch angle distributions, which appear to be associated with the typical EMIC wave scattering, comparison of the modeled electron distribution to electron measurements indicates that drift shell splitting is responsible for this rapid change in electron pitch angle distributions. This further indicates that magnetopause loss is the predominant cause of the electron dropout right after the shock arrival.

  17. Ultrafast momentum imaging of pseudospin-flip excitations in graphene

    NASA Astrophysics Data System (ADS)

    Aeschlimann, S.; Krause, R.; Chávez-Cervantes, M.; Bromberger, H.; Jago, R.; Malić, E.; Al-Temimy, A.; Coletti, C.; Cavalleri, A.; Gierz, I.

    2017-07-01

    The pseudospin of Dirac electrons in graphene manifests itself in a peculiar momentum anisotropy for photoexcited electron-hole pairs. These interband excitations are in fact forbidden along the direction of the light polarization and are maximum perpendicular to it. Here, we use time- and angle-resolved photoemission spectroscopy to investigate the resulting unconventional hot carrier dynamics, sampling carrier distributions as a function of energy, and in-plane momentum. We first show that the rapidly-established quasithermal electron distribution initially exhibits an azimuth-dependent temperature, consistent with relaxation through collinear electron-electron scattering. Azimuthal thermalization is found to occur only at longer time delays, at a rate that depends on the substrate and the static doping level. Further, we observe pronounced differences in the electron and hole dynamics in n -doped samples. By simulating the Coulomb- and phonon-mediated carrier dynamics we are able to disentangle the influence of excitation fluence, screening, and doping, and develop a microscopic picture of the carrier dynamics in photoexcited graphene. Our results clarify new aspects of hot carrier dynamics that are unique to Dirac materials, with relevance for photocontrol experiments and optoelectronic device applications.

  18. Understanding charge transfer of Li+ and Na+ ions scattered from metal surfaces with high work function

    NASA Astrophysics Data System (ADS)

    Chen, Lin; Wu, Wen-Bin; Liu, Pin-Yang; Xiao, Yun-Qing; Li, Guo-Peng; Liu, Yi-Ran; Jiang, Hao-Yu; Guo, Yan-Ling; Chen, Xi-Meng

    2016-08-01

    For Li+ and Na+ ions scattered from high work function metal surfaces, efficient neutralization is observed, and it cannot be explained by the conventional free electron model. In order to explain these experimental data, we investigate the velocity-dependent neutral fraction with the modified Brako-Newns (BN) model. The calculated results are in agreement with the experimental data. We find that the parallel velocity effect plays an important role in neutralizing the Li+ and Na+ ions for large angle scattering. The nonmonotonic velocity behavior of neutral fraction is strongly related to the distance-dependent coupling strength between the atomic level and metal states. Project supported by the National Natural Science Foundation of China (Grant Nos. 11405078 and 11474140), the Fundamental Research Funds for the Central Universities, China (Grant Nos. lzujbky-2014-169 and lzujbky-2015-244), the Project sponsored by the Scientific Research Foundation for the Returned Overseas Chinese Scholars, the State Education Ministry, and the National Students’ Innovation and Entrepreneurship Training Program (Grant Nos. 201410730069 and 201510730078).

  19. LETTER TO THE EDITOR: Differential electron scattering from the (010) excited vibrational mode of N2O

    NASA Astrophysics Data System (ADS)

    Akther, P.; Johnstone, W. M.; El-Zein, A. A. A.; Campbell, L.; Teubner, P. J. O.; Brunger, M. J.; Newell, W. R.

    2002-11-01

    In this letter we report differential superelastic, elastic and inelastic electron scattering measurements from nitrous oxide (N2O) in its (010)* excited vibrational quantum. The incident electron energy was 2.5 eV and the scattered electron angular range was 10°- 40°. Unlike our previous results (1999 J. Phys. B: At. Mol. Opt. Phys. 32 5779) with the isoelectronic molecule carbon dioxide (CO2), where the elastic differential cross sections (DCSs) for scattering from the (010)* mode were 2.3 times larger than those for elastic scattering from the ground (000) state, in N2O the corresponding (010)* elastic cross sections are usually only a fraction of those for the ground state. To the best of our knowledge, the present data are the first DCSs which have been reported in the literature for electron scattering from an excited vibrational level of the N2O molecule.

  20. Thomson scattering from a three-component plasma.

    PubMed

    Johnson, W R; Nilsen, J

    2014-02-01

    A model for a three-component plasma consisting of two distinct ionic species and electrons is developed and applied to study x-ray Thomson scattering. Ions of a specific type are assumed to be identical and are treated in the average-atom approximation. Given the plasma temperature and density, the model predicts mass densities, effective ionic charges, and cell volumes for each ionic type, together with the plasma chemical potential and free-electron density. Additionally, the average-atom treatment of individual ions provides a quantum-mechanical description of bound and continuum electrons. The model is used to obtain parameters needed to determine the dynamic structure factors for x-ray Thomson scattering from a three-component plasma. The contribution from inelastic scattering by free electrons is evaluated in the random-phase approximation. The contribution from inelastic scattering by bound electrons is evaluated using the bound-state and scattering wave functions obtained from the average-atom calculations. Finally, the partial static structure factors for elastic scattering by ions are evaluated using a two-component version of the Ornstein-Zernike equations with hypernetted chain closure, in which electron-ion interactions are accounted for using screened ion-ion interaction potentials. The model is used to predict the x-ray Thomson scattering spectrum from a CH plasma and the resulting spectrum is compared with experimental results obtained by Feltcher et al. [Phys. Plasmas 20, 056316 (2013)].

  1. The interaction of low-energy electrons with fructose molecules

    NASA Astrophysics Data System (ADS)

    Chernyshova, I. V.; Kontrosh, E. E.; Markush, P. P.; Shpenik, O. B.

    2017-11-01

    Using a hypocycloidal electronic spectrometer, the interactions of low energy electrons (0-8.50 eV) with fructose molecules, namely, electron scattering and dissociative attachment, are studied. The results of these studies showed that the fragmentation of fructose molecules occurs effectively even at an electron energy close to zero. In the total electron-scattering cross section by molecules, resonance features (at energies 3.10 and 5.00 eV) were first observed near the formation thresholds of light ion fragments OH- and H-. The correlation of the features observed in the cross sections of electron scattering and dissociative attachment is analyzed.

  2. High carrier mobility in ultrapure diamond measured by time-resolved cyclotron resonance

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Akimoto, Ikuko, E-mail: akimoto@sys.wakayama-u.ac.jp; Handa, Yushi; Fukai, Katsuyuki

    2014-07-21

    We have performed time-resolved cyclotron resonance measurements in ultrapure diamond crystals for the temperature range of T=7.3–40 K and obtained the temperature-dependent momentum relaxation times based on the cyclotron resonance widths for optically generated electrons and holes. The relaxation time follows a T{sup −3/2} law down to 12 K, which is expected for acoustic-phonon scattering without impurity effect because of the high purity of our samples. The deviation from the law at lower temperatures is explained by the impurity scattering and the breakdown of the high-temperature approximation for the phonon scattering. We extract the carrier drift mobility by using the directly measuredmore » effective masses and the relaxation times. The mobility at 10 K for 600 ns delay time after optical injection is found to be μ{sub e}=1.5×10{sup 6} cm{sup 2}/V s for the electrons, and μ{sub lh}=2.3×10{sup 6} cm{sup 2}/V s and  μ{sub hh}=2.4×10{sup 5} cm{sup 2}/V s for the light and heavy holes, respectively. These high values are achieved by our high-sensitivity detection for low-density carriers (at <10{sup 11} cm{sup −3}) free from the carrier-carrier scattering as well as by the suppression of the impurity scattering in the high-purity samples.« less

  3. Magnetic order at a single-crystal surface in the diffuse-scattering theory

    NASA Astrophysics Data System (ADS)

    Zasada, I.

    2003-06-01

    A theoretical description of incoherent spin-dependent multiple scattering of electrons at a magnetically disordered single-crystal surface is reported. A formalism in which the spin operators specify the magnetic state of a surface atom is used for the description of magnetic order at the surface. The theory is based upon the concepts used in multiple scattering spin-dependent diffuse LEED theory (DSPLEED) theory. In the present considerations, this theory is extended to the case of magnetic materials by using the time-independent Dirac equation with an effective magnetic field. Thus, an expression for incoherent spin-dependent intensity for magnetic material is obtained. It depends on the Fourier transform on the surface lattice of the spin-pair correlation function and, as a consequence, on the magnetic properties of the surface. The equations for the description of magnetization and various correlation functions in the frame of effective field theory are derived and the results of the numerical calculations are presented for the particular case of Ni(1 0 0) surface. The spin-orbit induced and exchange asymmetries are calculated. It is found that the magnetic DSPLEED is sensitive to the properties of the surface characterized by the spin-pair correlation functions. Thus, it is demonstrated that the magnetic DSPLEED can be an effective method in the investigation of critical behaviour of magnetic surfaces.

  4. Low-energy electron scattering from atomic hydrogen. II. Elastic and inelastic scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    James, K.E. Jr.; Childers, J.G.; Khakoo, M.A.

    2004-02-01

    We present measurements of differential cross sections for elastic electron scattering from atomic hydrogen at 20 eV and 40 eV incident electron energies and ratios of differential cross sections for electron-impact excitation of atomic hydrogen to the n=2, 3, and 4 levels at incident electron energies of 14.6 eV, 15.6 eV, 17.6 eV, 20 eV, 25 eV, and 40 eV with scattering angles ranging from 10 deg. to 130 deg. We compare our results to available experimental measurements and recent convergent close-coupling calculations. Our results resolve significant discrepancies that existed between theory and past experiments.

  5. An analytic formula for the relativistic incoherent Thomson backscattering spectrum for a drifting bi-Maxwellian plasma

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Naito, O.

    2015-08-15

    An analytic formula has been derived for the relativistic incoherent Thomson backscattering spectrum for a drifting anisotropic plasma when the scattering vector is parallel to the drifting direction. The shape of the scattering spectrum is insensitive to the electron temperature perpendicular to the scattering vector, but its amplitude may be modulated. As a result, while the measured temperature correctly represents the electron distribution parallel to the scattering vector, the electron density may be underestimated when the perpendicular temperature is higher than the parallel temperature. Since the scattering spectrum in shorter wavelengths is greatly enhanced by the existence of drift, themore » diagnostics might be used to measure local electron current density in fusion plasmas.« less

  6. Remote sensing of high-latitude ionization profiles by ground-based and spaceborne instrumentation

    NASA Technical Reports Server (NTRS)

    Vondrak, R. R.

    1981-01-01

    Ionospheric specification and modeling are now largely based on data provided by active remote sensing with radiowave techniques (ionosondes, incoherent-scatter radars, and satellite beacons). More recently, passive remote sensing techniques have been developed that can be used to monitor quantitatively the spatial distribution of high-latitude E-region ionization. These passive methods depend on the measurement, or inference, of the energy distribution of precipitating kilovolt electrons, the principal source of the nighttime E-region at high latitudes. To validate these techniques, coordinated measurements of the auroral ionosphere have been made with the Chatanika incoherent-scatter radar and a variety of ground-based and spaceborne sensors

  7. Use of a solar panel as a directionally sensitive large-area radiation monitor for direct and scattered x-rays and gamma-rays.

    PubMed

    Abdul-Majid, S

    1987-01-01

    The characteristics of a 25.4 X 91 cm solar cell panel used as an x-ray and gamma-ray radiation monitor are presented. Applications for monitoring the primary x-ray beam are described at different values of operating currents and voltages as well as for directional dependence of scattered radiation. Other applications in gamma-ray radiography are also given. The detector showed linear response to both x-ray and gamma-ray exposures. The equipment is rigid, easy to use, relatively inexpensive and requires no power supply or any complex electronic equipment.

  8. Spin and charge currents and current rectification in Luttinger liquids

    NASA Astrophysics Data System (ADS)

    Braunecker, B.; Feldman, D. E.; Marston, J. B.

    2006-03-01

    Asymmetries in spin and charge transport properties are of great interest for spintronic and electronic applications. We show that externally-driven spin and charge currents in a Luttinger liquid model of a one-dimensional quantum wire are strongly modified by the presence of a localized magnetic or nonmagnetic scatterer. A diode effect appears at low voltages when this scatterer is spatially asymmetric, and a non-monotonous dependence of the current on the voltage is possible. D.E. Feldman, S. Scheidl, and V. M. Vinokur, Phys. Rev. Lett. 94, 186809 (2005); B. Braunecker, D. E. Feldman, and J. B. Marston, Phys. Rev. B 72, 125311 (2005)

  9. On the temperature-dependent exchange splitting in the quasiparticle bandstructure of Ni

    NASA Astrophysics Data System (ADS)

    Borgiel, W.; Nolting, W.; Donath, M.

    1989-11-01

    A theoretical model for the bandferromagnet Ni is proposed, which takes into account the intraatomic electron interactions within the d band complex. After introducing effective spin operators the model-Hamiltonian consists of a one-particle part, an intraband interaction of Hubbard-type, and an interband exchange, formally describing electron magnon scattering (s-f model). The one particle energies are taken from a realistic bandstructure calculation for paramagnetic Ni. We use a many body procedure for a detailed inspection of the quasiparticle bandstructure in KX and XW directions, present the corresponding spectral densities, and compare the temperature dependent exchange splittings near the X and W point with recent results from spin resolved photoemission (PE) - and inverse photoemission (IPE) - experiments.

  10. Angle and frequency dependence of self-energy from spin fluctuation mediated d-wave pairing for high temperature superconductors.

    PubMed

    Hong, Seung Hwan; Choi, Han-Yong

    2013-09-11

    We investigated the characteristics of spin fluctuation mediated superconductivity employing the Eliashberg formalism. The effective interaction between electrons was modeled in terms of the spin susceptibility measured by inelastic neutron scattering experiments on single crystal La(2-x)Sr(x)CuO4 superconductors. The diagonal self-energy and off-diagonal self-energy were calculated by solving the coupled Eliashberg equation self-consistently for the chosen spin susceptibility and tight-binding dispersion of electrons. The full momentum and frequency dependence of the self-energy is presented for optimally doped, overdoped, and underdoped LSCO cuprates in a superconductive state. These results may be compared with the experimentally deduced self-energy from ARPES experiments.

  11. The LOCV asymmetric nuclear matter two-body density distributions versus those of FHNC

    NASA Astrophysics Data System (ADS)

    Tafrihi, Azar

    2018-05-01

    The theoretical computations of the electron-nucleus scattering can be improved, by employing the asymmetric nuclear matter (ASM) two-body density distributions (TBDD) . But, due to the sophistications of the calculations, the TBDD with arbitrary isospin asymmetry have not yet been computed in the Fermi Hypernetted Chain (FHNC) or the Monte Carlo (MC) approaches. So, in the present work, we intend to find the ASM TBDD, in the states with isospin T, spin S and spin projection Sz, in the Lowest Order Constrained Variational (LOCV) method. It is demonstrated that, at small relative distances, independent of the proton to neutron ratio β, the state-dependent TBDD have a universal shape. Expectedly, it is observed that, at low (high) β values, the nucleons prefer to make a pair in the T = 1(0) states. In addition, the strength of the tensor-dependent correlations is investigated, using the ratio of the TBDD in the TSSz = 010 state with θ = π / 2 and that of θ = 0. The mentioned ratios peak at r ∼ 0 . 9 fm, considering different β values. It is hoped that, the present results could help a better reproduction of the experimental data of the electron-nucleus scattering.

  12. Final state interactions and the extraction of neutron single spin asymmetries from semi-inclusive deep-inelastic scattering by a transversely polarized 3He target

    NASA Astrophysics Data System (ADS)

    Del Dotto, A.; Kaptari, L. P.; Pace, E.; Salmè, G.; Scopetta, S.

    2017-12-01

    The semi-inclusive deep-inelastic electron scattering off transversely polarized 3He, i.e., the process e +3He ⃗→e'+h +X , with h being a detected fast hadron, is studied beyond the plane-wave impulse approximation. To this end, a distorted spin-dependent spectral function of a nucleon inside an A =3 nucleus is actually evaluated through a generalized eikonal approximation, in order to take into account the final state interactions between the hadronizing system and the (A -1 ) nucleon spectator one. Our realistic description of both nuclear target and final state is a substantial step forward for achieving a reliable extraction of the Sivers and Collins single spin asymmetries of the free neutron. To illustrate how and to what extent the model dependence due to the treatment of the nuclear effects is under control, we apply our approach to the extraction procedure of the neutron single spin asymmetries from those measured for 3He for values of the kinematical variables relevant both for forthcoming experiments at Jefferson Laboratory and, with an exploratory purpose, for the future Electron Ion Collider.

  13. Influence of quantizing magnetic field and Rashba effect on indium arsenide metal-oxide-semiconductor structure accumulation capacitance

    NASA Astrophysics Data System (ADS)

    Kovchavtsev, A. P.; Aksenov, M. S.; Tsarenko, A. V.; Nastovjak, A. E.; Pogosov, A. G.; Pokhabov, D. A.; Tereshchenko, O. E.; Valisheva, N. A.

    2018-05-01

    The accumulation capacitance oscillations behavior in the n-InAs metal-oxide-semiconductor structures with different densities of the built-in charge (Dbc) and the interface traps (Dit) at temperature 4.2 K in the magnetic field (B) 2-10 T, directed perpendicular to the semiconductor-dielectric interface, is studied. A decrease in the oscillation frequency and an increase in the capacitance oscillation amplitude are observed with the increase in B. At the same time, for a certain surface accumulation band bending, the influence of the Rashba effect, which is expressed in the oscillations decay and breakdown, is traced. The experimental capacitance-voltage curves are in a good agreement with the numeric simulation results of the self-consistent solution of Schrödinger and Poisson equations in the magnetic field, taking into account the quantization, nonparabolicity of dispersion law, and Fermi-Dirac electron statistics, with the allowance for the Rashba effect. The Landau quantum level broadening in a two-dimensional electron gas (Lorentzian-shaped density of states), due to the electron scattering mechanism, linearly depends on the magnetic field. The correlation between the interface electronic properties and the characteristic scattering times was established.

  14. Time-Dependent Density Functional Theory for Extreme Environments

    NASA Astrophysics Data System (ADS)

    Baczewski, Andrew; Magyar, Rudolph; Shulenburger, Luke

    2013-10-01

    In recent years, DFT-MD has been shown to be a powerful tool for calculating the equation of state and constitutive properties of warm dense matter (WDM). These studies are validated through a number of experiments, including recently developed X-Ray Thomson Scattering (XRTS) techniques. Here, electronic temperatures and densities of WDM are accessible through x-ray scattering data, which is related to the system's dynamic structure factor (DSF)-a quantity that is accessible through DFT-MD calculations. Previous studies predict the DSF within the Born-Oppenheimer approximation, with the electronic state computed using Mermin DFT. A capability for including more general coupled electron-ion dynamics is desirable, to study both the effect on XRTS observables and the broader problem of electron-ion energy transfer in extreme WDM conditions. Progress towards such a capability will be presented, in the form of an Ehrenfest MD framework using TDDFT. Computational challenges and open theoretical questions will be discussed. Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Security Administration under contract DE-AC04-94AL85000.

  15. CDW fluctuations and the pseudogap in the single-particle conductivity of quasi-1D Peierls CDW systems: II.

    PubMed

    Kupčić, I; Rukelj, Z; Barišić, S

    2014-05-14

    The current-dipole Kubo formula for the dynamical conductivity of interacting multiband electronic systems derived in Kupčić et al (2013 J. Phys.: Condens. Matter 25 145602) is illustrated on the Peierls model for quasi-one-dimensional systems with the charge-density-wave (CDW) instability. Using the microscopic representation of the Peierls model, it is shown in which way the scattering of conduction electrons by CDW fluctuations affects the dynamical conductivity at temperatures above and well below the CDW transition temperature. The generalized Drude formula for the intraband conductivity is derived in the ordered CDW state well below the transition temperature. The natural extension of this formula to the case where the intraband memory function is dependent on frequency and wave vectors is also presented. It is shown that the main adventage of such a memory-function conductivity model is that it can be easily extended to study the dynamical conductivity and the electronic Raman scattering in more complicated multiband electronic systems in a way consistent with the law of conservation of energy. The incoherent interband conductivity in the CDW pseudogap state is briefly discussed as well.

  16. Testing helicity-dependent γγ → γγ scattering in the region of MeV

    NASA Astrophysics Data System (ADS)

    Homma, K.; Matsuura, K.; Nakajima, K.

    2016-01-01

    Light-by-light scatterings contain rich information on photon coupling to virtual and real particle states. In the context of quantum electrodynamics (QED), photons can couple to a virtual e^+e^- pair. Photons may also couple to known resonance states in the context of quantum chromodyanmics and electroweak dynamics in higher energy domains and possibly couple to unknown resonance states beyond the standard model. The perturbative QED calculations manifestly predict a maximized cross section at the MeV scale; however, no example of exact real-photon-real-photon scattering has yet been observed. Hence, we propose direct measurement with the maximized cross section at the center-of-mass system energy of 1-2 MeV to establish a firm footing at the MeV scale. Given current state of the art high power lasers, helicity-dependent elastic scattering may be observed at a reasonable rate, if a photon-photon collider exploiting γ -rays generated by the inverse nonlinear Compton process with electrons delivered from laser-plasma accelerators (LPA) are properly designed. We show that such verification is feasible in a table-top scale collider, which may be an unprecedented breakthrough in particle accelerators for basic physics research in contrast to energy frontier colliders.

  17. Thermal and thermoelectric transport measurements of an individual boron arsenide microstructure

    NASA Astrophysics Data System (ADS)

    Kim, Jaehyun; Evans, Daniel A.; Sellan, Daniel P.; Williams, Owen M.; Ou, Eric; Cowley, Alan H.; Shi, Li

    2016-05-01

    Recent first principles calculations have predicted that boron arsenide (BAs) can possess an unexpectedly high thermal conductivity that depends sensitively on the crystal size and defect concentration. However, few experimental results have been obtained to verify these predictions. In the present work, we report four-probe thermal and thermoelectric transport measurements of an individual BAs microstructure that was synthesized via a vapor transport method. The measured thermal conductivity was found to decrease slightly with temperature in the range between 250 K and 350 K. The temperature dependence suggests that the extrinsic phonon scattering processes play an important role in addition to intrinsic phonon-phonon scattering. The room temperature value of (186 ± 46) W m-1 K-1 is higher than that of bulk silicon but still a factor of four lower than the calculated result for a defect-free, non-degenerate BAs rod with a similar diameter of 1.15 μm. The measured p-type Seebeck coefficient and thermoelectric power factor are comparable to those of bismuth telluride, which is a commonly used thermoelectric material. The foregoing results also suggest that it is necessary to not only reduce defect and boundary scatterings but also to better understand and control the electron scattering of phonons in order to achieve the predicted ultrahigh intrinsic lattice thermal conductivity of BAs.

  18. A United Effort for Crystal Growth, Neutron Scattering, and X-ray Scattering Studies of Novel Correlated Electron Materials

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Young S.

    2015-02-12

    The research accomplishments during the award involved experimental studies of correlated electron systems and quantum magnetism. The techniques of crystal growth, neutron scattering, x-ray scattering, and thermodynamic & transport measurements were employed, and graduate students and postdoctoral research associates were trained in these techniques.

  19. Electron scattering in large water clusters from photoelectron imaging with high harmonic radiation.

    PubMed

    Gartmann, Thomas E; Hartweg, Sebastian; Ban, Loren; Chasovskikh, Egor; Yoder, Bruce L; Signorell, Ruth

    2018-06-06

    Low-energy electron scattering in water clusters (H2O)n with average cluster sizes of n < 700 is investigated by angle-resolved photoelectron spectroscopy using high harmonic radiation at photon energies of 14.0, 20.3, and 26.5 eV for ionization from the three outermost valence orbitals. The measurements probe the evolution of the photoelectron anisotropy parameter β as a function of cluster size. A remarkably steep decrease of β with increasing cluster size is observed, which for the largest clusters reaches liquid bulk values. Detailed electron scattering calculations reveal that neither gas nor condensed phase scattering can explain the cluster data. Qualitative agreement between experiment and simulations is obtained with scattering calculations that treat cluster scattering as an intermediate case between gas and condensed phase scattering.

  20. Excitation of phonons in medium-energy electron diffraction

    NASA Astrophysics Data System (ADS)

    Alvarez, M. A. Vicente; Ascolani, H.; Zampieri, G.

    1996-03-01

    The ``elastic'' backscattering of electrons from crystalline surfaces presents two regimes: a low-energy regime, in which the characteristic low-energy electron diffraction (LEED) pattern is observed, and a medium-energy regime, in which the diffraction pattern is similar to those observed in x-ray photoemission diffraction (XPD) and Auger electron diffraction (AED) experiments. We present a model for the electron scattering which, including the vibrational degrees of freedom of the crystal, contains both regimes and explains the passage from one regime to the other. Our model is based on a separation of the electron and atomic motions (adiabatic approximation) and on a cluster-type formulation of the multiple scattering of the electron. The inelastic scattering events (excitation and/or absorption of phonons) are treated as coherent processes and no break of the phase relation between the incident and the exit paths of the electron is assumed. The LEED and the medium-energy electron diffraction regimes appear naturally in this model as the limit cases of completely elastic scattering and of inelastic scattering with excitation and/or absorption of multiple phonons. Intensity patterns calculated with this model are in very good agreement with recent experiments of electron scattering on Cu(001) at low and medium energies. We show that there is a correspondence between the type of intensity pattern and the mean number of phonons excited and/or absorbed during the scattering: a LEED-like pattern is observed when this mean number is less than 2, LEED-like and XPD/AED-like features coexist when this number is 3-4, and a XPD/AED-like pattern is observed when this number is greater than 5-6.

  1. Electron and positron interaction with pyrimidine: A theoretical investigation

    NASA Astrophysics Data System (ADS)

    Sinha, Nidhi; Antony, Bobby

    2018-03-01

    Pyrimidine (C4H4N2) is considered as the building block of nucleobases, viz., cytosine, thymine and uracil. They provide a blueprint for probing the scattering of radiation by DNA and RNA bases. In this article, we report the elastic and total scattering cross-sections for electron and positron scattering from the pyrimidine molecule, employing a spherical complex optical potential (SCOP) formalism for an extensive energy range of 10 eV to 5 keV. In the case of positron scattering, the original SCOP formalism is modified to adequately solve the positron-target dynamics. Moreover, a reasonable agreement is observed between the present results and other available datasets, for both electron and positron scattering. The cross-sections for electron and positron impact scattering by pyrimidine are necessary input data for codes that seek to simulate radiation damage, and hence are useful to model biomolecular systems.

  2. Electron scattering from gas phase cis-diamminedichloroplatinum(II): Quantum analysis of resonance dynamics

    NASA Astrophysics Data System (ADS)

    Carey, Ralph; Lucchese, Robert R.; Gianturco, F. A.

    2013-05-01

    We present scattering calculations of electron collisions with the platinum-containing compound cis-diamminedichloroplatinum (CDDP), commonly known as cisplatin, between 0.5 eV and 6 eV, and the corresponding isolated Pt atom from 0.1 eV to 10 eV. We find evidence of resonances in e--CDDP scattering, using an ab initio description of the target. We computed scattering matrix elements from equations incorporating exchange and polarization effects through the use of the static-exchange plus density functional correlation potential. Additionally, we made use of a purely local adiabatic model potential that allows Siegert eigenstates to be calculated, thereby allowing inspection of the possible resonant scattering wave functions. The total cross section for electron scattering from (5d10) 1S Pt displays a large magnitude, monotonic decay from the initial collision energies, with no apparent resonance scattering features in any scattering symmetry. By contrast, the e--CDDP scattering cross section shows a small feature near 3.8 eV, which results from a narrow, well localized resonance of b2 symmetry. These findings are then related to the possible electron-mediated mechanism of the action of CDDP on DNA replication as suggested by recent experiments.

  3. Visualization of carrier dynamics in p(n)-type GaAs by scanning ultrafast electron microscopy

    PubMed Central

    Cho, Jongweon; Hwang, Taek Yong; Zewail, Ahmed H.

    2014-01-01

    Four-dimensional scanning ultrafast electron microscopy is used to investigate doping- and carrier-concentration-dependent ultrafast carrier dynamics of the in situ cleaved single-crystalline GaAs(110) substrates. We observed marked changes in the measured time-resolved secondary electrons depending on the induced alterations in the electronic structure. The enhancement of secondary electrons at positive times, when the electron pulse follows the optical pulse, is primarily due to an energy gain involving the photoexcited charge carriers that are transiently populated in the conduction band and further promoted by the electron pulse, consistent with a band structure that is dependent on chemical doping and carrier concentration. When electrons undergo sufficient energy loss on their journey to the surface, dark contrast becomes dominant in the image. At negative times, however, when the electron pulse precedes the optical pulse (electron impact), the dynamical behavior of carriers manifests itself in a dark contrast which indicates the suppression of secondary electrons upon the arrival of the optical pulse. In this case, the loss of energy of material’s electrons is by collisions with the excited carriers. These results for carrier dynamics in GaAs(110) suggest strong carrier–carrier scatterings which are mirrored in the energy of material’s secondary electrons during their migration to the surface. The approach presented here provides a fundamental understanding of materials probed by four-dimensional scanning ultrafast electron microscopy, and offers possibilities for use of this imaging technique in the study of ultrafast charge carrier dynamics in heterogeneously patterned micro- and nanostructured material surfaces and interfaces. PMID:24469803

  4. Visualization of carrier dynamics in p(n)-type GaAs by scanning ultrafast electron microscopy.

    PubMed

    Cho, Jongweon; Hwang, Taek Yong; Zewail, Ahmed H

    2014-02-11

    Four-dimensional scanning ultrafast electron microscopy is used to investigate doping- and carrier-concentration-dependent ultrafast carrier dynamics of the in situ cleaved single-crystalline GaAs(110) substrates. We observed marked changes in the measured time-resolved secondary electrons depending on the induced alterations in the electronic structure. The enhancement of secondary electrons at positive times, when the electron pulse follows the optical pulse, is primarily due to an energy gain involving the photoexcited charge carriers that are transiently populated in the conduction band and further promoted by the electron pulse, consistent with a band structure that is dependent on chemical doping and carrier concentration. When electrons undergo sufficient energy loss on their journey to the surface, dark contrast becomes dominant in the image. At negative times, however, when the electron pulse precedes the optical pulse (electron impact), the dynamical behavior of carriers manifests itself in a dark contrast which indicates the suppression of secondary electrons upon the arrival of the optical pulse. In this case, the loss of energy of material's electrons is by collisions with the excited carriers. These results for carrier dynamics in GaAs(110) suggest strong carrier-carrier scatterings which are mirrored in the energy of material's secondary electrons during their migration to the surface. The approach presented here provides a fundamental understanding of materials probed by four-dimensional scanning ultrafast electron microscopy, and offers possibilities for use of this imaging technique in the study of ultrafast charge carrier dynamics in heterogeneously patterned micro- and nanostructured material surfaces and interfaces.

  5. Free-Free Transitions in the Presence of Laser Fields at Very Low Incident Electron Energy

    NASA Technical Reports Server (NTRS)

    Bhatia, A. K.; Sinha, Chandana

    2010-01-01

    We study the free-free transition in electron-hydrogenic systems in ground state in presence of an external laser field at very loud incident energies. The laser field is treated classically while the collision dynamics is treated quantum mechanically. The laser field is chosen to be monochromatic, linearly polarized and homogeneous. The incident electron is considered to be dressed by the laser in a nonperturbative manner by choosing a Volkov wave function for it. The scattering weave function for the electron is solved numerically by taking into account the effect of the electron exchange, short-range as well as of the long-range interactions to get the S and P wave phase shifts while for the higher angular momentum phase shifts the exchange approximation has only been considered. We calculate the laser assisted differential cross sections (LADCS) for the aforesaid free-free transition process for single photon absorption/emission. The laser intensity is chosen to be much less than the atomic field intensity. A strong suppression is noted in the LADCS as compared to the field free (FF) cross sections. Unlike the FF ones, the LADCS exhibit some oscillations having a distinct maximum at a low value of the scattering angle depending on the laser parameters as well as on the incident energies.

  6. Free-Free Transitions in the Presence of Laser Fields at Very Low Incident Electron Energy

    NASA Technical Reports Server (NTRS)

    Bhatia, Anand K.; Sinha, Chandana

    2009-01-01

    We study the free-free transition in electron-hydrogenic systems in ground state in presence of an external laser field at very low incident energies. The laser field is treated classically while the collision dynamics is treated quantum mechanically. The laser field is chosen to be monochromatic, linearly polarized and homogeneous. The incident electron is considered to be dressed by the laser in a nonperturbative manner by choosing a Volkov wave function for it The scattering wave function for the electron is solved numerically by taking into account the effect of the electron exchange, short-range as well as of the long-range interactions to get the S and P wave phase shifts while for the higher angular momentum phase shifts, the exchange approximation has only been considered. We calculate the laser-assisted differential cross sections (LADCS) for the aforesaid free-free transition process for single photon absorption/emission. The laser intensity is chosen to be much less than the atomic field intensity. A strong suppression is noted in the LADCS as compared to the field free (FF) cross sections. Unlike the FF ones, the LADCS exhibit some oscillations having a distinct maximum at a low value of the scattering angle depending on the laser parameters as well as on the incident energies.

  7. Energy dissipation in Ni-containing concentrated solid solutions.

    NASA Astrophysics Data System (ADS)

    Samolyuk, German; Mu, Sai; Jin, Ke; Bei, Hongbin; Stocks, G. Malcolm

    Due to high disorder the diffusion processes are noticeably suppressed concentrated solid solution, so called high entropy alloys. It makes these alloys promising candidate for energy application under extreme conditions. Understanding of the energy dissipation in these alloys during the irradiation or interaction with laser bean is extremely important. In the metals and alloys the main channel of energy dissipation is provided by the electronic subsystem. The first principles approach was used to investigate the electronic structure properties of the alloys. The obtained results were used to calculate the electronic part of thermal resistivity caused by scattering of electrons on atomic disorder, magnetic and phonon excitations The contribution of last two excitations to the temperature dependence of thermal resistivity is discussed. The importance of magnetism in 3d transition metals based alloy was demonstrated. In particular, it was shown that antiferromagnetic ordering of chromium or manganese leads to significant increase of electron scattering in alloy containing these elements. It results in significant reduction of conductivity in chromium or manganese containing alloys. The comparison with the existing experimental data is discussed. This work was supported as part of the Energy Dissipation to Defect Evolution (EDDE), an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Basic Energy Sciences.

  8. Scanning electron microscope measurement of width and shape of 10nm patterned lines using a JMONSEL-modeled library.

    PubMed

    Villarrubia, J S; Vladár, A E; Ming, B; Kline, R J; Sunday, D F; Chawla, J S; List, S

    2015-07-01

    The width and shape of 10nm to 12 nm wide lithographically patterned SiO2 lines were measured in the scanning electron microscope by fitting the measured intensity vs. position to a physics-based model in which the lines' widths and shapes are parameters. The approximately 32 nm pitch sample was patterned at Intel using a state-of-the-art pitch quartering process. Their narrow widths and asymmetrical shapes are representative of near-future generation transistor gates. These pose a challenge: the narrowness because electrons landing near one edge may scatter out of the other, so that the intensity profile at each edge becomes width-dependent, and the asymmetry because the shape requires more parameters to describe and measure. Modeling was performed by JMONSEL (Java Monte Carlo Simulation of Secondary Electrons), which produces a predicted yield vs. position for a given sample shape and composition. The simulator produces a library of predicted profiles for varying sample geometry. Shape parameter values are adjusted until interpolation of the library with those values best matches the measured image. Profiles thereby determined agreed with those determined by transmission electron microscopy and critical dimension small-angle x-ray scattering to better than 1 nm. Published by Elsevier B.V.

  9. Electron- and positron-molecule scattering: development of the molecular convergent close-coupling method

    NASA Astrophysics Data System (ADS)

    Zammit, Mark C.; Fursa, Dmitry V.; Savage, Jeremy S.; Bray, Igor

    2017-06-01

    Starting from first principles, this tutorial describes the development of the adiabatic-nuclei convergent close-coupling (CCC) method and its application to electron and (single-centre) positron scattering from diatomic molecules. We give full details of the single-centre expansion CCC method, namely the formulation of the molecular target structure; solving the momentum-space coupled-channel Lippmann-Schwinger equation; deriving adiabatic-nuclei cross sections and calculating V-matrix elements. Selected results are presented for electron and positron scattering from molecular hydrogen H2 and electron scattering from the vibrationally excited molecular hydrogen ion {{{H}}}2+ and its isotopologues (D2 +, {{{T}}}2+, HD+, HT+ and TD+). Convergence in both the close-coupling (target state) and projectile partial-wave expansions of fixed-nuclei electron- and positron-molecule scattering calculations is demonstrated over a broad energy-range and discussed in detail. In general, the CCC results are in good agreement with experiments.

  10. A detailed study of the proton structure functions in deep inelastic muon-proton scattering

    NASA Astrophysics Data System (ADS)

    Aubert, J. J.; Bassompierre, G.; Becks, K. H.; Best, C.; Böhm, E.; de Bouard, X.; Brasse, F. W.; Broll, C.; Brown, S.; Carr, J.; Clifft, R. W.; Cobb, J. H.; Coignet, G.; Combley, F.; D'Agostini, G.; Dau, W. D.; Davies, J. K.; Déclais, Y.; Dobinson, R. W.; Dosselli, U.; Drees, J.; Edwards, A. W.; Edwards, M.; Favier, J.; Ferrero, M. I.; Flauger, W.; Gabathuler, E.; Gamet, R.; Gayler, J.; Gerhardt, V.; Gössling, C.; Haas, J.; Hamacher, K.; Hayman, P.; Henckes, M.; Korbel, V.; Landgraf, U.; Leenen, M.; Maire, M.; Mohr, W.; Montgomery, H. E.; Moser, K.; Mount, R. P.; Nassalski, J.; Norton, P. R.; McNicholas, J.; Osborne, A. M.; Payre, P.; Peroni, C.; Pessard, H.; Pietrzyk, U.; Rith, K.; Schneegans, M.; Sloan, T.; Stier, H. E.; Stockhausen, W.; Thénard, J. M.; Thompson, J. C.; Urban, L.; Wahlen, H.; Whalley, M.; Williams, W. S. C.; Williamson, J.; Wimpenny, S. J.; European Muon Collaboration

    1985-09-01

    The x and Q2 dependence of the single photon exchange cross section d 2σ/d Q2d x and the proton structure functions F2( x, Q2) and R( x, Q2) have been measured in deep inelastic muon proton scattering in the region 0.02 < x < 0.8 and 3 < Q2 < 190 GeV 2. By comparing data at different incident muon energies R was found to have little kinematic dependence and an average value of -0.010 ± 0.037 (stat.) ± 0.102 (stat.). The observed deviations from scaling gave the value of Λ overlineMS, the QCD mass scale parameter, to be 105 -45+55 (stat.) -45+85 (syst.) MeV. The fraction of the momentum of the nucleon carried by gluons was found to be ˜56% at Q2˜22.5 GeV 2. It is shown that to obtain a description of the data for F2( x, Q2) together with that measured in deep inelastic electron-proton scattering at lower Q2 it is necessary to include additional higher twist contributions. The value of Λ overlineMS remains unchanged with the inclusion of these contributions which were found to have an x-dependence of the form x3/(1 - x).

  11. First principles calculation of lattice thermal conductivity of metals considering phonon-phonon and phonon-electron scattering

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Yan; Lu, Zexi; Ruan, Xiulin, E-mail: ruan@purdue.edu

    2016-06-14

    The effect of phonon-electron (p-e) scattering on lattice thermal conductivity is investigated for Cu, Ag, Au, Al, Pt, and Ni. We evaluate both phonon-phonon (p-p) and p-e scattering rates from first principles and calculate the lattice thermal conductivity (κ{sub L}). It is found that p-e scattering plays an important role in determining the κ{sub L} of Pt and Ni at room temperature, while it has negligible effect on the κ{sub L} of Cu, Ag, Au, and Al. Specifically, the room temperature κ{sub L}s of Cu, Ag, Au, and Al predicted from density-functional theory calculations with the local density approximation aremore » 16.9, 5.2, 2.6, and 5.8 W/m K, respectively, when only p-p scattering is considered, while it is almost unchanged when p-e scattering is also taken into account. However, the κ{sub L} of Pt and Ni is reduced from 7.1 and 33.2 W/m K to 5.8 and 23.2 W/m K by p-e scattering. Even though Al has quite high electron-phonon coupling constant, a quantity that characterizes the rate of heat transfer from hot electrons to cold phonons in the two-temperature model, p-e scattering is not effective in reducing κ{sub L} owing to the relatively low p-e scattering rates in Al. The difference in the strength of p-e scattering in different metals can be qualitatively understood by checking the amount of electron density of states that is overlapped with the Fermi window. Moreover, κ{sub L} is found to be comparable to the electronic thermal conductivity in Ni.« less

  12. Binary collision model for neon Auger spectra from neon ion bombardment of the aluminum surface

    NASA Technical Reports Server (NTRS)

    Pepper, S. V.

    1986-01-01

    A model is developed to account for the angle-resolved Auger spectra from neon ion bombardment of the aluminum surface recently obtained by Pepper and Aron. The neon is assumed to be excited in a single asymmetric neon-aluminum-collision and scattered back into the vacuum where it emits an Auger electron. The velocity of the Auger electron acquires a Doppler shift by virtue of the emission from a moving source. The dependence of the Auger peak shape and energy on the incident ion energy, angle of incidence and on the angle of Auger electron emission with respect to the surface is presented. Satisfactory agreement with the angle resolved experimental observations is obtained. The dependence of the angle-integrated Auger yield on the incident ion energy and angle of incidence is also obtained and shown to be in satisfactory agreement with available experimental evidence.

  13. Higher-order ionospheric error at Arecibo, Millstone, and Jicamarca

    NASA Astrophysics Data System (ADS)

    Matteo, N. A.; Morton, Y. T.

    2010-12-01

    The ionosphere is a dominant source of Global Positioning System receiver range measurement error. Although dual-frequency receivers can eliminate the first-order ionospheric error, most second- and third-order errors remain in the range measurements. Higher-order ionospheric error is a function of both electron density distribution and the magnetic field vector along the GPS signal propagation path. This paper expands previous efforts by combining incoherent scatter radar (ISR) electron density measurements, the International Reference Ionosphere model, exponential decay extensions of electron densities, the International Geomagnetic Reference Field, and total electron content maps to compute higher-order error at ISRs in Arecibo, Puerto Rico; Jicamarca, Peru; and Millstone Hill, Massachusetts. Diurnal patterns, dependency on signal direction, seasonal variation, and geomagnetic activity dependency are analyzed. Higher-order error is largest at Arecibo with code phase maxima circa 7 cm for low-elevation southern signals. The maximum variation of the error over all angles of arrival is circa 8 cm.

  14. Electronic and magnetic properties of manganite thin films with different compositions and its correlation with transport properties: An X-ray resonant magnetic scattering study

    DOE PAGES

    Singh, Surendra; Freeland, J. W.; Fitzsimmons, M. R.; ...

    2014-12-08

    Here, we present x-ray resonant magnetic dichroism and x-ray resonant magnetic scattering measurements of the temperature dependence of magnetism in Pr-doped La-Ca-Mn-O films grown on (110) NdGaO3 substrates. We observed thermal hysteresis of the ferromagnetism in one film that also showed large thermal hysteresis of ~18K in transport measurements. While in a second film of a different nominal chemistry, which showed very small thermal hysteresis ~3K in transport measurements, no thermal hysteresis of the ferromagnetism was observed. As a result, these macroscopic properties are correlated with evolution of surface magnetization across metal insulator transition for these films as observed bymore » soft x-ray resonant magnetic scattering measurements.« less

  15. The effect of pathological processes on absorption and scattering spectra of samples of bile and pancreatic juice

    NASA Astrophysics Data System (ADS)

    Giraev, K. M.; Ashurbekov, N. A.; Magomedov, M. A.; Murtazaeva, A. A.; Medzhidov, R. T.

    2015-07-01

    Spectra of optical transmission coefficients and optical reflectance for bile and pancreatic juice samples were measured experimentally for different forms of pathologies of the pancreas within the range of 250-2500 nm. The absorption and scattering spectra, as well as the spectrum of the anisotropy factor of scattering, were determined based on the results obtained using the reverse Monte Carlo method. The surface morphology for the corresponding samples of the biological media was studied employing electron microscopy. The dynamics of the optical properties of the biological media was determined depending on the stage of the pathology. It has been demonstrated that the results of the study presented are in a good agreement with pathophysiological data and could supplement and broaden the results of conventional methods for diagnostics of the pancreas.

  16. Phonon anomalies in FeS

    DOE PAGES

    Baum, A.; Milosavljevic, A.; Lazarevic, N.; ...

    2018-02-12

    Here, we present results from light scattering experiments on tetragonal FeS with the focus placed on lattice dynamics. We identify the Raman active A 1g and B 1g phonon modes, a second order scattering process involving two acoustic phonons, and contributions from potentially defect-induced scattering. The temperature dependence between 300 and 20 K of all observed phonon energies is governed by the lattice contraction. Below 20 K the phonon energies increase by 0.5–1 cm -1 , thus indicating putative short range magnetic order. Additionally, along with the experiments we performed lattice-dynamical simulations and a symmetry analysis for the phonons andmore » potential overtones and find good agreement with the experiments. In particular, we argue that the two-phonon excitation observed in a gap between the optical branches becomes observable due to significant electron-phonon interaction.« less

  17. Conceptual design of a divertor Thomson scattering diagnostic for NSTX-U

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McLean, A. G., E-mail: mclean@fusion.gat.com; Soukhanovskii, V. A.; Allen, S. L.

    2014-11-15

    A conceptual design for a divertor Thomson scattering (DTS) diagnostic has been developed for the NSTX-U device to operate in parallel with the existing multipoint Thomson scattering system. Higher projected peak heat flux in NSTX-U will necessitate application of advanced magnetics geometries and divertor detachment. Interpretation and modeling of these divertor scenarios will depend heavily on local measurement of electron temperature, T{sub e}, and density, n{sub e}, which DTS provides in a passive manner. The DTS design for NSTX-U adopts major elements from the successful DIII-D DTS system including 7-channel polychromators measuring T{sub e} to 0.5 eV. If implemented onmore » NSTX-U, the divertor TS system would provide an invaluable diagnostic for the boundary program to characterize the edge plasma.« less

  18. Phonon anomalies in FeS

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Baum, A.; Milosavljevic, A.; Lazarevic, N.

    Here, we present results from light scattering experiments on tetragonal FeS with the focus placed on lattice dynamics. We identify the Raman active A 1g and B 1g phonon modes, a second order scattering process involving two acoustic phonons, and contributions from potentially defect-induced scattering. The temperature dependence between 300 and 20 K of all observed phonon energies is governed by the lattice contraction. Below 20 K the phonon energies increase by 0.5–1 cm -1 , thus indicating putative short range magnetic order. Additionally, along with the experiments we performed lattice-dynamical simulations and a symmetry analysis for the phonons andmore » potential overtones and find good agreement with the experiments. In particular, we argue that the two-phonon excitation observed in a gap between the optical branches becomes observable due to significant electron-phonon interaction.« less

  19. Dependence of weak interaction rates on the nuclear composition during stellar core collapse

    NASA Astrophysics Data System (ADS)

    Furusawa, Shun; Nagakura, Hiroki; Sumiyoshi, Kohsuke; Kato, Chinami; Yamada, Shoichi

    2017-02-01

    We investigate the influences of the nuclear composition on the weak interaction rates of heavy nuclei during the core collapse of massive stars. The nuclear abundances in nuclear statistical equilibrium (NSE) are calculated by some equation of state (EOS) models including in-medium effects on nuclear masses. We systematically examine the sensitivities of electron capture and neutrino-nucleus scattering on heavy nuclei to the nuclear shell effects and the single-nucleus approximation. We find that the washout of the shell effect at high temperatures brings significant change to weak rates by smoothing the nuclear abundance distribution: the electron capture rate decreases by ˜20 % in the early phase and increases by ˜40 % in the late phase at most, while the cross section for neutrino-nucleus scattering is reduced by ˜15 % . This is because the open-shell nuclei become abundant instead of those with closed neutron shells as the shell effects disappear. We also find that the single-nucleus description based on the average values leads to underestimations of weak rates. Electron captures and neutrino coherent scattering on heavy nuclei are reduced by ˜80 % in the early phase and by ˜5 % in the late phase, respectively. These results indicate that NSE like EOS accounting for shell washout is indispensable for the reliable estimation of weak interaction rates in simulations of core-collapse supernovae.

  20. Effects of Fe3O4 Magnetic Nanoparticles on the Thermoelectric Properties of Heavy-Fermion YbAl3 Materials

    NASA Astrophysics Data System (ADS)

    He, Danqi; Mu, Xin; Zhou, Hongyu; Li, Cuncheng; Ma, Shifang; Ji, Pengxia; Hou, Weikang; Wei, Ping; Zhu, Wanting; Nie, Xiaolei; Zhao, Wenyu

    2018-06-01

    The magnetic nanocomposite thermoelectric materials xFe3O4/YbAl3 ( x = 0%, 0.3%, 0.6%, 1.0%, and 1.5%) have been prepared by the combination of ultrasonic dispersion and spark plasma sintering process. The nanocomposites retain good chemical stability in the presence of the second-phase Fe3O4. The second-phase Fe3O4 magnetic nanoparticles are distributed on the interfaces and boundaries of the matrix. The x dependences of thermoelectric properties indicate that Fe3O4 magnetic nanoparticles can significantly decrease the thermal conductivity and electrical conductivity. The magnetic nanoparticles embedded in YbAl3 matrix are not only the phonon scattering centers of nanostructures, but also the electron scattering centers due to the Kondo-like effect between the magnetic moment of Fe3O4 nanoparticles and the spin of electrons. The ZT values of the composites are first increased in the x range 0%-1.0% and then decreased when x > 1.0%. The highest ZT value reaches 0.3 at 300 K for the nanocomposite with x = 1.0%. Our work demonstrates that the Fe3O4 magnetic nanoparticles can greatly increase the thermoelectric performance of heavy-fermion YbAl3 thermoelectric materials through simultaneously scattering electrons and phonons.

Top